U.S. patent application number 10/153275 was filed with the patent office on 2003-02-13 for oligonucleotides specific for the marorab operon.
This patent application is currently assigned to Hybridon, Inc.. Invention is credited to Hofe, Eric Von, Levy, Stuart B..
Application Number | 20030032612 10/153275 |
Document ID | / |
Family ID | 21901200 |
Filed Date | 2003-02-13 |
United States Patent
Application |
20030032612 |
Kind Code |
A1 |
Levy, Stuart B. ; et
al. |
February 13, 2003 |
Oligonucleotides specific for the marORAB operon
Abstract
Disclosed are synthetic oligonucleotides complementary to a
transcript of the marORAB operon which inhibit expression of a gene
in the operon. Also disclosed are methods of reducing bacterial
resistance to antibiotics, and pharmaceutical formulations
containing marORAB-specific oligonucleotides of the invention.
Inventors: |
Levy, Stuart B.; (Boston,
MA) ; Hofe, Eric Von; (Wellesley, MA) |
Correspondence
Address: |
LAHIVE & COCKFIELD
28 STATE STREET
BOSTON
MA
02109
US
|
Assignee: |
Hybridon, Inc.
|
Family ID: |
21901200 |
Appl. No.: |
10/153275 |
Filed: |
May 21, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10153275 |
May 21, 2002 |
|
|
|
09596390 |
Jun 16, 2000 |
|
|
|
09596390 |
Jun 16, 2000 |
|
|
|
09027130 |
Feb 20, 1998 |
|
|
|
6136602 |
|
|
|
|
60038663 |
Feb 21, 1997 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/455; 536/23.2 |
Current CPC
Class: |
C12N 15/113 20130101;
Y02A 50/30 20180101; A61P 31/04 20180101; Y02A 50/475 20180101;
C12N 2310/315 20130101; C12N 2310/111 20130101; A61K 38/00
20130101; Y02A 50/481 20180101 |
Class at
Publication: |
514/44 ; 435/455;
536/23.2 |
International
Class: |
A61K 048/00; C07H
021/04; C12N 015/87 |
Claims
What is claimed is:
1. A synthetic oligonucleotide complementary to a transcript of the
marORAB operon which inhibits expression of the operon.
2. The oligonucleotide of claim 1 wherein the gene whose expression
is inhibited is selected from the group consisting of marO, marO/R,
marR, marR/A, and marA.
3. The oligonucleotide of claim 1 wherein the oligonucleotide
contains at least one internucleotide linkage selected from the
group consisting of alkylphosphonates, phosphorothioates,
phosphorodithioates, alkylphosphonothioates, phosphoramidates,
phosphate esters, carbamates, acetamidate, carboxymethyl esters,
carbonates, and phosphate triesters.
4. The oligonucleotide of claim 3 wherein the synthetic
oligonucleotide contains at least one phosphorothioate
internucleotide linkage.
5. The oligonucleotide of claim 1 comprising at least one
deoxyribonucleotide.
6. The oligonucleotide of claim 1 comprising at least one
ribonucleotide.
7. The oligonucleotide of claim 5 comprising at least one
ribonucleotide.
8. The oligonucleotide of claim 1 wherein the oligonucleotide is
from about 15 to 21 nucleotides in length.
9. The oligonucleotide of claim 1 having a nucleotide sequence
selected from the group consisting of SEQ ID NO: 1, NO:2, NO: 3,
NO:4, NO: 5, and NO: 6.
10. A method of inhibiting expression of the marORAB operon
comprising the step of contacting a transcript of the marORAB
operon nucleic acid with a synthetic oligonucleotide complementary
to the transcript.
11. The method of claim 10 wherein the oligonucleotide is
complementary to a transcript of a gene selected from the group
consisting of marO, marO/R, marR, marR/A, and marA.
12. The method of claim 11 wherein the oligonucleotide comprises a
nucleotide sequence selected from the group consisting of SEQ ID
NO: 1, NO: 2, NO: 3, NO: 4, NO: 5, and NO: 6.
13. A method of reducing bacterial resistance to an antibiotic
comprising exposing a bacteria in a subject with an infection to a
synthetic oligonucleotide complementary to a transcript of the
marORAB operon such that bacterial resistance to an antibiotic is
reduced.
14. The method of claim 13 wherein said oligonucleotide is
administered to the subject in a pharmaceutical carrier.
15. The method of claim 14, comprising administering in addition at
least one antibiotic to the subject.
16. The method of claim 15, wherein the antibiotic is selected from
the group consisting of a penicillin, a cephalosporin, an
aminoglycoside, a sulfonamide, a macrolide, a tetracycline, a
lincoside, a quinolone, a chloramphenicol, a vancomycin, a
rifampin, an isoniazid, or a trimethoprim.
17. The method of claim 13, wherein the oligonucleotide is
complementary to a transcript of a locus selected from the group
consisting of marO, marO/R, marR, marR/A, and marA.
18. The method of claim 13, wherein the oligonucleotide comprises a
nucleotide sequence selected from the group consisting of SEQ ID
NO: 1, NO: 2, NO: 3, NO: 4, NO: 5, and NO: 6.
19. The method of claim 18, wherein the bacteria are exposed to at
least two synthetic oligonucleotides having a nucleotide sequence
selected from the group consisting of SEQ ID NO: 1, NO: 2, NO: 3,
NO: 4, NO: 5, and NO: 6.
20. The method of claim 13, wherein the infection in the subject is
a species of Escherichia, Salmonella, Shigella, Klebsiella,
Citrobacter, Hafnia, or Enterobacter.
21. A method of treatment for a bacterial infection in a subject by
administering to the subject a therapeutic amount of a synthetic
oligonucleotide complementary to a transcript of the marORAB
operon.
22. The method of claim 21, wherein the bacterial infection
comprises infection with at least one bacterium having multiple
drug resistance.
23. The method of claim 21 wherein the subject is additionally
administered an antibiotic.
24. The method of claim 23, wherein the antibiotic is selected from
the group consisting of a penicillin, a cephalosporin, an
aminoglycoside, a sulfonamide, a macrolide, a tetracycline, a
lincoside, a quinolone, a chloramphenicol, a vancomycin, a
rifampin, an isoniazid, or a trimethoprim.
25. The method of claim 21, wherein the infection comprises an
Escherichia, a Salmonella, a Shigella, a Klebsiella, a Citrobacter,
a Hafnia, or an Enterobacter.
26. The method of claim 21 wherein the oligonucleotide is
complementary to a transcript of a gene selected from the group
consisting of marO, marO/R, marR, marR/A, and marA.
27. The method of claim 26 wherein the oligonucleotide comprises a
nucleotide sequence selected from the group consisting of SEQ ID
NO: 1, NO: 2, NO: 3, NO: 4, NO: 5, and NO: 6.
28. A pharmaceutically acceptable composition comprising a
synthetic oligonucleotide complementary to a transcript of marORAB
operon which inhibits the expression of a locus in the operon; and
a physiologically acceptable carrier.
29. The pharmaceutically acceptable composition of claim 28 wherein
the oligonucleotide is complementary to a transcript of a gene
selected from the group consisting of marO, marO/R, marR, marR/A,
and marA.
30. The pharmaceutically acceptable composition of claim 28 wherein
the oligonucleotide has a nucleotide sequence consisting
essentially of SEQ ID NO: 1, NO: 2, NO: 3, NO: 4, NO: 5, and NO: 6.
Description
RELATED APPLICATION
[0001] This application claims priority to the U.S. Provisional
Application Serial No. 60/038,663, entitled "OLIGONUCLEOTIDES
SPECIFC FOR THE marORAB OPERON AND METHODS OF THEIR USE", filed
Feb. 21, 1997, the contents of which are expressly incorporated by
reference.
BACKGROUND OF THE INVENTION
[0002] This invention relates to the control of prokaryotic
multidrug susceptibility. More specifically, this invention relates
to the use of oligonucleotides for the treatment of diseases,
disorders, and conditions associated with drug resistance in
bacteria.
[0003] Bacterial antibiotic and antimicrobial resistance has been
recognized since the advent of antimicrobial agents. In the past,
the appearance of resistant microorganisms has been addressed by
the continued availability of effective alternative drugs. As
reported by Neu (Science(1992) 257:1064-1073), the situation has
recently changed dramatically, leading to increasing morbidity and
mortality. The growing number of pathogens resistant to multiple,
structurally unrelated drugs, and the fact that no new class of
antimicrobials is likely to be introduced before the end of the
decade, have been blamed for the present crisis of clinical and
epidemiologic significance (see, e.g. Neu, supra). Thus, as
discussed extensively in the medical and scientific literature,
there is a growing need to formulate effective therapeutic
approaches to counter the emergence of novel bacterial strains
resistant to antibiotics.
[0004] Resistance to an antimicrobial agent may be an inherent
property of the infecting organism, or may result from mutation or
from transfer of an extrachromosomal genetic determinant, such as
plasmids and transposons, followed by selection of resistant
organisms. In recent years there has been increased interest in the
role of chromosomal sequences involved in conferring antibiotic
resistance. A novel chromosomal stress response locus, the multiple
antibiotic resistance (mar) locus has been shown to control the
expression of chromosomal genes involved in intrinsic multidrug
susceptibility/resistance to multiple, structurally different
antibiotics and other noxious agents in Escherichia coli and in
other members of the Enterobacteriaceae family (Cohen et al. (1988)
J. Bacteriol. 170:5416-5422; Cohen et al. (1993) J. Infec. Dis.
168:484-488).
[0005] The mar locus has been reported to include two
transcriptional units, marC and marRAB. Each unit is divergently
transcribed from a central regulatory region, marO (Cohen et al.
(1993) J. Bacteriol. 175:1484-1492; and Goldman, J. et al. (1996)
Antimicrobiol. Agents Chemo. 40:1266-1269). Both operons, marORAB
and marC are necessary for the full expression of the Mar
phenotype. Transcription of the marORAB operon is inducible two to
three fold by tetracycline, chloramphenicol, salicylate, and other
structurally unrelated compounds (Cohen et al., supra). Activated
cells become resistant not only to multiple unrelated antibiotics
but also to oxidative stress agents and organic solvents (Cohen et
al., supra; George, et al. (1983) J. Bacteriol. 155:531-540; George
et al. (1996) FEMS Micro. Let. 139:1-10).
[0006] In the presence of selective agents (e.g., tetracycline,
chloramphenicol, nalidixic acid, rifampin, penicillin, and
cephalosporin) Mar mutants arise spontaneously at a frequency of
10.sup.-7 (George, et al., J. Bacteriol. supra). Such mutants have
been reported to favor the accumulation of secondary mutations
leading to the expression of higher levels of resistance to novel
or improved antimicrobial agents. For example, Mar mutants have
recently been found among fluoroquinolone-resistant clinical
isolates of E. coli (Maneewannakul et al.(1996) Antimicrob. Agents
Chemo. 38:542-546).
[0007] Characterization of several Mar mutant resistant strains has
revealed constitutive transcription of mRNA from the marORAB operon
as a result of various mutations within that operon (Cohen et al.,
supra). Consistent with these findings, the disruption of the mar
locus has correlated with the complete loss of resistance. The
resistance phenotype has been completely reversed to susceptibility
by insertion of Tn5, a transposon element, into the marA gene of
the E. coli chromosome. (George et al. (1983) J. Bacteriol.
155:541-548).
[0008] A promising new approach to antimicrobial therapy lies in
the use of short synthetic strands of nucleic acids, called
antisense oligonucleotides, to control gene expression. Inhibition
of gene expression by antisense oligonucleotides relies at least in
part, on the ability of the oligonucleotide to bind a complementary
messenger RNA sequence, thereby preventing its translation (see
generally, Agrawal (1992) Trends in Biotech. 10:152; Wagner et
al.(1994) Nature 372:333-335; and Stein et al. (1993) Science
261:1004-1012). Synthetic oligonucleotides administered exogenously
compose an alternate class of therapeutic agents and have been used
successfully in both prokaryotic and eucaryotic systems.
[0009] Antisense oligonucleotides have been developed as
antiparasitic agents, although none have been demonstrated to
reverse the drug resistant phenotype of a drug resistant parasite
strain. PCT publication No. WO 93/13740 discloses the use of
antisense oligonucleotides directed to nucleic acids encoding the
dihydrofolate reductase-thymidilate synthase gene of P. falciparum
to inhibit propagation of drug-resistant malarial parasites.
Rapaport et al. (Proc. Natl. Acad. Sci. (USA) (1992) 89:8577-8580)
teaches inhibition of the growth of chloroquine-resistant and
chloroquine-sensitive P. falciparum in vitro using oligonucleotides
directed to the dihydrofolate reductase-thymidylate synthase gene.
PCT publication No. WO 94/12643 discloses antisense
oligonucleotides directed to nucleic acids encoding a carbamoyl
phosphate synthetase of P. falciparum. Tao et al. (Antisense Res.
Dev. (1995) 5:123-129) teaches inhibition of propagation of a
schistosome parasite by antisense oligonucleotides. Early
experiments by Jayaraman showed that an antisense oligonucleotide
complementary to the Shine-Delagarno ribosomal docking sequence of
E. coli 16S rRNA, inhibited translation of bacterial mRNA in
cell-free extracts derived from E. coli (Jayaraman (1996) Proc.
Natl. Acad. Sci (USA) 93:709-713). Furthermore, experiments were
conducted by Gasparro et al. using a photoactivatable antisense DNA
construct to suppress ampicillin resistance in E. coli (Gasparro et
al. Antisense Res. Dev. (1991) 1:117-140). More recently,
experiments utilizing antisense oligodeoxyribonucleotide
phosphorothioates have shown the successful inhibition of the
growth of a wild-type and drug resistant strain of Mycobacterium
smegmatis (Rapaport et al. (1996) Proc. Natl. Acad. Sci. (USA)
93:709-713).
[0010] Bacteria have been known to mutate extensively, resulting in
a large number of strains which have become resistant to most drugs
presently available. In addition, new resistant bacterial strains
are likely to develop as the time progresses. Thus, there is a
continued need for development of additional therapeutic agents and
effective methods to treat these bacterial infections. Inactivation
or suppression of the multiple antibiotic resistance operon would
ideally make some prokaryotes more susceptible to a larger number
of antimicrobial agents and environmental stresses, thus providing
novel means to counter increased bacterial resistance.
SUMMARY OF THE INVENTION
[0011] The invention disclosed herein satisfies this need. The
present inventors have discovered that antisense oligonucleotides
that are complementary to sequences found in the marORAB operon can
inhibit or suppress the expression of one or more genes within that
operon, thereby making bacteria more susceptible to a larger number
of antimicrobial agents and environmental stresses.
[0012] This discovery has been exploited to develop the present
invention which includes antisense oligonucleotides directed to
mRNA derived from the marORAB operon sequences which specifically
inhibit or suppress the expression of one or more genes within that
operon, and which are therefore useful both as therapeutic agents
and as tools to elucidate the role and biological significance of
the marORAB operon sequences.
[0013] In one aspect, the invention provides a synthetic
oligonucleotide complementary to a transcript of the marORAB operon
which inhibits the expression of a gene in the operon.
[0014] As used herein, the term "operon" is a unit of bacterial
gene expression and regulation. Typically an operon includes
nucleic acid and control elements in the nucleic acid which may be
recognized by regulators of gene products. In the case of marORAB
operon, the nucleic acid includes a regulatory region, designated
marO, containing a promoter and an AUG start codon for rightward
transcription of the loci designated marR, marA and marB.
[0015] For purposes of the invention, the term "transcript" is used
to refer to ribonucleic acid transcribed from DNA, some of which is
capable of serving as a substrate for the translation of one or
more peptide products.
[0016] As used herein, the term "locus" refers to a position on a
chromosome at which nucleic acid encoding a particular gene or
genes reside. The nucleic acid comprises a start codon and at least
one codon encoding an amino acid residue. Typically, a locus is
transcribed to produce at least one mRNA transcript which in turn
may be translated into a peptide.
[0017] As used herein, the term "synthetic oligonucleotide" refers
to chemically synthesized polymers of nucleotides covalently
attached by internucleotide linkages. The term "internucleotide
linkage" is used to refer to the covalent bonding between
nucleotides which are thus attached via at least one 5' to 3'
internucleotide linkage.
[0018] In some embodiments of the invention the oligonucleotide
contains at least one internucleotide linkage selected from the
group consisting of alkylphosphonates, phosphorothioates,
phosphorodithioates, alkylphosphonothioates, phosphoramidates,
phosphate esters, carbamates, acetamidate, carboxymethyl esters,
carbonates, and phosphate triesters. In some other embodiments, the
oligonucleotide contains, in addition to an internucleotide linkage
selected from the linkages recited, at least one phosphothioate
internucleotide linkage.
[0019] In some embodiments, the oligonucleotides contain at least
one deoxyribonucleotide, at least a ribonucleotide, or both
deoxyribonucleotide(s) and ribonucleotide(s).
[0020] In some embodiments, the synthetic oligonucleotide is from
about 15 to about 50 5 nucleotides in length. In preferred
embodiments, these oligonucleotides contain from about 15 to about
21 nucleotides.
[0021] In some particular embodiments of the invention, marORAB
oligonucleotides have a nucleotide sequence selected from the group
consisting of SEQ ID NO:1, NO:2, NO:3, NO:4, NO:5, and NO:6.
[0022] Another aspect of the invention provides a method of
inhibiting the expression of the marORAB operon comprising the step
of contacting a transcript of marORAB operon with a synthetic
oligonucleotide complementary to the transcript. In some
embodiments of the invention, the oligonucleotide is complementary
to a locus selected from the group consisting of marO, marO/R,
marR, marR/A, and marA. In yet other embodiments of the invention,
the oligonucleotide comprises a nucleotide sequence selected from
the group consisting of SEQ ID NO:1, NO:2, NO:3, NO:4, NO:5, and
NO:6.
[0023] An additional aspect of the invention provides a method of
reducing bacterial resistance to an antibiotic by exposing a
resistant bacterium to synthetic oligonucleotide complementary to a
transcript of the marORAB operon. The bacterium further may be
treated with an antibiotic.
[0024] The term "antibiotic" is art recognized and includes a
composition which decreases the viability or which inhibits the
growth or reproduction of microorganisms.
[0025] As used in this disclosure, an antibiotic is further
intended to include an antimicrobial or bactericidal agent.
[0026] In an additional embodiment of the invention the
oligonucleotide is complementary to a transcript of a locus
selected from the group consisting of marO, marO/R, marR, marR/A,
and marA. In yet another embodiment of the invention, the
oligonucleotide comprises a nucleotide sequence selected from the
group consisting of SEQ ID NO:1, NO:2, NO:3, NO:4, NO:5, and
NO:6.
[0027] In an additional embodiment, bacteria are contacted with at
least two synthetic oligonucleotides selected from the group
consisting of SEQ ID NO:1, NO:2, NO:3, NO:4, NO:5, and NO:6.
[0028] Another aspect of the invention pertains to a method of
treating a bacterial infection in a subject by administering to the
subject a therapeutic amount of a synthetic oligonucleotide
complementary to a transcript of the marORAB operon which is
effective in reducing bacterial resistance to antibacterial
agent.
[0029] In one embodiment of the invention, the oligonucleotide is
complementary to a transcript of a gene or locus selected from the
group consisting of marO, marO/R, marR, marR/A, and marA. In an
additional embodiment of the invention the oligonucleotide includes
a nucleotide sequence selected from the group consisting of SEQ ID
NO: 1, NO:2, NO:3, NO:4, NO:5, and NO:6.
[0030] An additional aspect of the invention is a pharmaceutically
acceptable composition comprising a synthetic oligonucleotide
complementary to a transcript of marORAB operon nucleic acid which
inhibits the expression of one or more genes in the operon, and a
physiologically acceptable carrier.
[0031] As used herein, the term "pharmaceutically acceptable" means
a non-toxic material that does not interfere with the effectiveness
of the biological activity of the active ingredient(s). The term
"physiologically acceptable" refers to a non-toxic material that is
compatible with a biological system such as a cell, cell culture,
tissue, or organism.
[0032] In one embodiment of the invention, the oligonucleotide is
complementary to a locus selected from the group consisting of
marO, marO/R, marR, marR/A, and marA.
[0033] In yet another embodiment, the oligonucleotide consists
essentially of SEQ ID NO:1, NO:2, NO:3, NO:4, NO:5, and NO:6.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] The foregoing and other objects of the present invention,
the various features thereof, as well as the invention itself may
be more fully understood from the following description, when read
together with the accompanying drawings in which:
[0035] FIG. 1 is a schematic representation or the marORAB operon,
including the approximate location of sequences targeted by
representative oligonucleotides of the invention; and
[0036] FIG. 2 is a graphic representation of the ability of
representative antisense oligonucleotides of the invention to
inhibit the expression of a marA::lacZ fusion in E. coli. The
representative oligonucleotides are identified on the x axis, and
the corresponding spectrophotometeric O.D. unit levels of
.beta.-galactosidase activities observed as a percent of the
control in the absence of oligonucleotides are represented on the y
axis.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0037] The present invention provides antisense oligonucleotides
specific for marORAB operon nucleic acid which are useful in
treating diseases and disorders associated with drug resistance in
prokaryotes. Antisense oligonucleotides of the invention are also
useful for determining the role of marORAB sequences in
pathogenicity, and more specifically, in processes where drug
resistance is involved.
[0038] MarORAB sequences have been reported in E. coli (George et
al.(1983) J. Bacteriol. supra) in Salmonella, Shigella, Klebsiella,
Citrobacter, Hafnia, and Enterobacter bacterial species (Cohen et
al. (1993) J. Infect. Dis. 168:484-488). In addition,
DNA-relatedness studies suggest that enteric bacteria in which the
marORAB regulatory operon was found to be conserved may be only a
fraction of those in which marORAB-like sequences may be present.
(Cohen et al. ibid.).
[0039] The marORAB locus at 34 min (1,636 kbp) on the E. coli
chromosome map has been cloned and sequenced, and its regulation
has been studied. (Cohen et al. ibid.; and Hachler et al. (1991)J.
Bacteriol. 173:5532-5538). As shown in FIG. 1, the operon includes
a regulatory region, designated marO, containing a
promoter-operator region for the rightward transcription of the
marR, marA and the marB genes as well as the AUG start codon. The
proteins encoded by these genes are MarR, a repressor protein
(Cohen et al. ibid.), MarA, a positive regulator protein whose
overexpression leads to multidrug resistance, and MarB, a small
protein which is required for the full resistance phenotype but
whose function is yet unknown (George J. Bacteriol. supra; Yan et
al. Abstr. 1992 Gen. Meet. Am. Soc. Microbiol. A-26, p.5).
[0040] The oligonucleotides of the invention are directed to any
portion of the marORAB operon nucleic acid sequence that
effectively acts as a target for inhibiting the expression of the
genes within the marORAB operon.
[0041] FIG. 1 shows some non-limiting regions of the operon to
which oligonucleotide of the invention may be directed. The
nucleotide sequences of some representative, non-limiting
oligonucleotides specific for the marORAB operon are listed below
in TABLE 1.
[0042] One of skill in the art, knowing the nucleotide sequence of
the marORAB operon (Cohen et al. (1993) J. Bacteriol. supra) could
prepare other oligonucleotides directed to these regions that
inhibit the expression of one or more genes in the operon. For
example, other sequences targeted specifically to marORAB nucleic
acid can be selected based on their ability to be cleaved by RNase
H.
[0043] Preferred antisense oligonucleotides useful in the practice
of the invention and suitable for use in therapeutic compositions
of the invention are particularly active in inhibiting the
expression of one or more genes in the marORAB operon. As used
herein, the term oligonucleotide includes polymers of two or more
ribonucleotides, deoxyribonucleotides, 2' substituted
ribonucleotides or deoxyribonucleotides or any combinations of
monomers thereof, such monomers being connected together via 5' to
3' linkages which may include any of the linkages that are known in
the antisense oligonucleotide art.
[0044] The term oligonucleotide also encompasses such polymers
having chemically modified bases or sugars and/or having additional
substituents including without limitation, lipophilic groups,
intercalating agents, diamines adamantane and others. For example,
oligonucleotides used in accordance with the invention may comprise
other than phosphodiester internucleotide linkages between the 5'
end of one nucleotide and the 3' end of another nucleotide in which
the 5' nucleotide phosphate has been replaced with any number of
chemical groups, such as a phosphorothioate. The phosphorothioate
linkages may be mixed Rp and Sp enantiomers, or they may be
stereoregular or substantially stereoregular in either Rp or Sp
form (see Iyer et al. (1995) Tetrahedron Asymmetry
6:1051-1054).
1TABLE 1 TARGETED SEQ OLIGO SITE SEQUENCE (5' to 3') ID NO: 92 marA
GCGTCTGGACATCGTCAT 1 93 marA ATCGTCATAGCTCTT 2 1281 marOR
CTTTTCACATTAGTTGCCC 3 1282 marR GCGCTTGTCATTCGGGTTC 4 1283 marO
GTAATTAGTTGCAGAGGATA 5 1284 marO TAGTTGCAGGAGATAATATTG 6
[0045] Oligonucleotides with phosphorothioate linkages can be
prepared using methods well known in the field such as
phosphoramidite (see, e.g., Agrawal et al. (1988) Proc. Natl. Acad.
Sci. (USA) 85:7079-7083) or by H-phosphonate (see, e.g., Froehler
(1986) Tetrahedron Lett. 27:5575-5578) chemistry. The synthetic
methods described in Bergot et al. (J. Chromatog. (1992) 559:35-42)
can also be used. Examples of other chemical groups include
alkylphosphonates, phosphorodithioates, alkyl phosphonothioates,
phosphoramidates, carbamates, acetamidate, carboxymethyl esters,
carbonates, and phosphate triesters or any combinations thereof.
For example, U.S. Pat. No. 5,149,797 describes traditional chimeric
oligonucleotides having a phosphorothioate core region interposed
between methylphosphonate or phosphoramidate flanking regions. PCT
Application No. PCT US96/13371, filed on Aug. 31, 1996, discloses
"inverted" chimeric oligonucleotides comprising one or more
nonionic oligonucleotide region (e.g. alkylphosphonate and/or
phosphoramidate and/or phosphotriester intemucleoside linkage)
flanked by one or more region of oligonucleotide phosphorothioate.
Various oligonucleotides with modified intemucleotide linkages can
be prepared according to known methods (see, e.g., Goodchild (1990)
Bioconjugate Chem. 2:165-187; Agrawal et al., (1988) Proc. Natl.
Acad. Sci. (USA) 85:7079-7083; Uhlmann et al. (1990) Chem. Rev.
90:534-583; and Agrawal et al. (1992) Trends Biotechnol.
10:152-158.
[0046] Examples of modifications to sugars include modifications to
the 2' position of the ribose moiety which include but are not
limited to 2'-O-substituted with an -O-lower alkyl group containing
1-6 saturated or unsaturated carbon atoms, or with an -O-aryl, or
allyl group having 2-6 carbon atoms wherein such -0-alkyl, aryl or
allyl group may be unsubstituted or may be substituted, (e.g., with
halo, hydroxy, trifluoromethyl cyano, nitro acyl acyloxy, alkoxy,
carboxy, carbalkoxyl, or amino groups), or with an amino, or halo
group. None of these substitutions are intended to exclude the
native 2'-hydroxyl group in the case of ribose or 2'-H- in the case
of deoxyribose. PCT Publication No. WO 94/02498 discloses
traditional hybrid oligonucleotides having regions of
2'-O-substituted ribonucleotides flanking a DNA core region. PCT
Application No. PCT US96/13371, filed on Aug. 31, 1996, discloses
an "inverted" hybrid oligonucleotide which includes an
oligonucleotide comprising a 2'-O-substituted (or 2'OH,
unsubstituted) RNA region which is in between two
oligodeoxyribonucleotide regions, a structure that "inverted
relative to the "traditional" hybrid oligonucleotides.
[0047] Other modifications include those which are internal or are
at the end(s) of the oligonucleotide molecule and include additions
to the molecule at the internucleoside phosphate linkages, such as
cholesteryl or diamine compounds with varying numbers of carbon
residues between the two amino groups, and terminal ribose,
deoxyribose and phosphate modifications which cleave, or crosslink
to the opposite chains or to associated enzymes or other proteins
which bind to the bacterial genome. Examples of such modified
oligonucleotides include oligonucleotides with a modified base
and/or sugar such as arabinose instead of ribose, or a 3',
5'-substituted oligonucleotide having a sugar which, at one or both
its 3' and 5' positions is attached to a chemical group other than
a hydroxyl or phosphate group (at its 3' or 5' position). Other
modified oligonucleotides are capped with a nuclease
resistance-conferring bulky substituent at their 3' and/or 5'
end(s), or have a substitution in one or both nonbridging oxygens
per nucleotide. Such modifications can be at some or all of the
internucleoside linkages, as well as at either or both ends of the
oligonucleotide and/or in the interior of the molecule (reviewed in
Agrawal et al.(1992) Trends Biotechnol. 10:152-158).
[0048] Preferably, oligonucleotides used in accordance with the
invention will have from about 7 to about 50 nucleotides, more
preferably from about 12 to 35 nucleotides, e.g. 12 to about 30,
and most preferably from about 15 to about 21 nucleotides. Such
oligonucleotides are preferably complementary to at least a portion
of the targeted mRNA transcript of the marORAB operon such that the
oligonucleotide is capable of hybridizing or otherwise associating
with at least a portion of such mRNA transcript under physiological
conditions. Hybridization is ordinarily the result of base-specific
hydrogen bonding between complementary strands of mRNA transcript
preferably to form Watson-Crick or Hoogsteen base pairs, although
other modes of hydrogen bonding, as well as base stacking can also
lead to hybridization.
[0049] Without being limited to any theory or mechanism, it is
generally believed that the activity of oligonucleotides used in
accordance with this invention depends is on the binding of the
oligonucleotide to the target nucleic acid (e.g. to at least a
portion of an mRNA transcript thereof), thus disrupting the
function of the target, either by hybridization arrest or by
destruction of target RNA by RNase H (the ability to activate RNase
H when hybridized to RNA). Such hybridization under physiological
conditions is measured as a practical matter by observing
interference with the function of the nucleic acid sequence.
[0050] Thus, a preferred oligonucleotide used in accordance with
the invention is capable of forming a stable duplex (or triplex in
the Hoogsteen pairing mechanism) with the target nucleic acid,
activate RNase H thereby causing effective destruction of the
target RNA molecule transcript, and in addition is capable of
resisting nucleolytic degradation (e.g. endonuclease and
exonuclease activity) in vivo. A number of the modifications to
oligonucleotides described above and others which are known in the
art specifically and successfully address each of these preferred
characteristics.
[0051] The synthetic antisense oligonucleotides of the invention in
the form of a therapeutic formulation are useful in treating
diseases, and disorders, and conditions associated with drug
resistance in prokaryotes. Such formulations include a
physiologically and/or pharmaceutically acceptable carrier. The
characteristics of the carrier will depend on the route of
administration. Such a composition may contain, in addition to the
synthetic oligonucleotide and carrier, diluents, fillers, salts,
buffers, stabilizers, solubilizers, and other materials well known
in the art. The pharmaceutical composition of the invention may
also contain other active factors and/or agents which enhance
inhibition of the expression of marORAB operon sequences or which
will reduce drug resistance in prokaryotes. For example,
combinations of synthetic oligonucleotides, each of which is
directed to transcripts from different regions of the marORAB
operon, may be used in the pharmaceutical compositions of the
invention. The pharmaceutical composition of the invention may
further contain penicillins, cephalosporins, aminoglycosides,
sulfonamides, macrolides, tetracyclines, lincosides, quinolones,
chloramphenicol, vencomycin, metronidazole, rifampin, isoniazid,
fm-butylethambutol, spectinomycin, trimethoprim, sulfamethoxazole,
and others.
[0052] Such additional factors and/or agents may be included in the
pharmaceutical composition to produce a synergistic effect with the
synthetic oligonucleotide of the invention, or to minimize
side-effects caused by the synthetic oligonucleotide of the
invention.
[0053] The pharmaceutical composition of the invention may be in
the form of a liposome in which the synthetic oligonucleotides of
the invention is combined, in addition to other pharmaceutically
acceptable carriers, with amphipathic agents such as lipids which
exist in aggregated form as micelles, insoluble monolayers, liquid
crystals, or lamellar layers which are in aqueous solution.
Suitable lipids for liposomal formulation include, without
limitation, monoglycerides, diglycerides, sulfatides, lysolecithin,
phospholipids, saponin, bile acids, and the like. One particularly
useful lipid carrier is lipofectin. Preparation of such liposomal
formulations is within the level of skill in the art, as disclosed,
for example, in U.S. Pat. No. 4,235,871; U.S. Pat. No. 4,501,728;
U.S. Pat. No. 4,837,028; and U.S. Pat. No. 4,737,323. The
pharmaceutical composition of the invention may further include
compounds such as cyclodextrins and the like which enhance delivery
of oligonucleotides into cells, as described by Habus et al.
(Bioconjug. Chem. (1995) 6:327-331), or slow release polymers.
[0054] As used herein, the term "therapeutically effective amount"
means the total amount of each active component of the
pharmaceutical composition or method that is sufficient to show a
meaningful patient benefit, i.e., healing of conditions associated
with bacterial drug resistance. When applied to an individual
active ingredient, administered alone, the term refers to that
ingredient alone. When applied to a combination, the term refers to
combined amounts of the active ingredients that result in the
therapeutic effect, whether administered in combination, serially
or simultaneously.
[0055] In practicing the method of treatment or use of the present
invention, a therapeutically effective amount of one or more of the
synthetic oligonucleotides of the invention is administered to a
subject afflicted with a disease, disorder or condition associated
with bacterial drug resistance. The synthetic oligonucleotide of
the invention may be administered in accordance with the method of
the invention either alone of in combination with other known
therapies. When co-administered with one or more other therapies,
the synthetic oligonucleotide of the invention may be administered
either simultaneously with the other treatment(s), or sequentially.
If administered sequentially, the attending physician will decide
on the appropriate sequence of administering the synthetic
oligonucleotide of the invention in combination with the other
therapy.
[0056] Administration of the synthetic oligonucleotide of the
invention used in the pharmaceutical composition or to practice the
method of the present invention can be carried out in a variety of
conventional ways, such as, for example, oral ingestion,
inhalation, or cutaneous, subcutaneous, intramuscular, or
intravenous injection.
[0057] When a therapeutically effective amount of synthetic
oligonucleotide of the invention is administered orally, the
synthetic oligonucleotide will be in the form of a tablet, capsule,
powder, solution or elixir. When administered in tablet form, the
pharmaceutical composition of the invention may additionally
contain a solid carrier such as a gelatin or an adjuvant. The
tablet, capsule, and powder contain from about 5 to 95% synthetic
oligonucleotide and preferably from about 25 to 90% synthetic
oligonucleotide. When administered in liquid form, a liquid carrier
such as water, petroleum, oils of animal or plant origin such as
peanut oil, mineral oil, soybean oil, sesame oil, or synthetic oils
may be added. The liquid form of the pharmaceutical composition may
further contain physiological saline solution, dextrose or other
saccharide solution, or glycols such as ethylene glycol, propylene
glycol or polyethylene glycol. When administered in liquid form,
the pharmaceutical composition contains from about 0.5 to 90% by
weight of the synthetic oligonucleotide and preferably from about 1
to 50% synthetic oligonucleotide.
[0058] When a therapeutically effective amount of synthetic
oligonucleotide of the invention is administered by intravenous,
subcutaneous, intramuscular, intraocular, or intraperitoneal
injection, the synthetic oligonucleotide will be in the form of a
pyrogen-free, parenterally acceptable aqueous solution. The
preparation of such parenterally acceptable solutions, having due
regard to pH, isotonicity, stability, and the like, is within the
skill in the art. A preferred pharmaceutical composition for
intravenous, subcutaneous, intramuscular, intraperitoneal, or
intraocular injection should contain, in addition to the synthetic
oligonucleotide, an isotonic vehicle such as Sodium Chloride
Injection, Ringer's Injection, Dextrose Injection, Dextrose and
Sodium Chloride Injection, Lactated Ringer's Injection, or other
vehicle as known in the art. The pharmaceutical composition of the
present invention may also contain stabilizers, preservatives,
buffers, antioxidants, or other additives known to those of skill
in the art.
[0059] The amount of synthetic oligonucleotide in the
pharmaceutical composition of the present invention will depend
upon the nature and severity of the condition being treated, and on
the nature of prior treatments which the patent has undergone.
Ultimately, the attending physician will decide the amount of
synthetic oligonucleotide with which to treat each individual
patient. Initially, the attending physician will administer low
doses of the synthetic oligonucleotide and observe the patient's
response. Larger doses of synthetic oligonucleotide may be
administered until the optimal therapeutic effect is obtained for
the patient, and at that point the dosage is not increased further.
It is contemplated that the dosages of the pharmaceutical
compositions administered in the method of the present invention
should contain about 0.1 to 5.0 mg/kg body weight per day, and
preferably 0.1 to 2.0 mg/kg body weight per day. When administered
systemically, the therapeutic composition is preferably
administered at a sufficient dosage to attain a blood level of
oligonucleotide from about 0.01 .mu.M to about 10 .mu.M.
[0060] The duration of intravenous therapy using the pharmaceutical
composition of the present invention will vary, depending on the
severity of the disease being treated and the condition and
potential idiosyncratic response of each individual patient.
Ultimately the attending physician will decide on the appropriate
duration of intravenous therapy using the pharmaceutical
composition of the present invention. Some diseases lend themselves
to acute treatment while others require longer term therapy.
[0061] Antisense oligonucleotides of the invention specific for the
marORAB operon sequences are useful in determining the role of
these sequences in pathogenicity, and more specifically in
processes in which drug resistance is involved. For example, the
efficacy of antisense technology in inhibiting bacterial drug
resistance was measured in comparison to that of the wild type
repressor marR. To measure the inhibitory effect of wild type MarR,
DNA vectors containing marR sequences were introduced and expressed
in two different fusion cell lines containing lac Z sequences under
the control of the marORAB operon. The cell lines used are wild
type AG 100 (George et al. (1983), supra) and the Mar mutant AG
102. Wild type repressor MarR reduced lacZ expression from the 2
different fusions by 9-47 fold depending on the bacterial strain
assayed.
[0062] Subsequently, to test the feasibility of using antisense
technology to inhibit the expression of sequences under the control
of the marORAB operon, a DNA vector containing both the marR and
the marA genes cloned in the antisense direction (pKMN23), was
tested for its ability to inhibit the production of
.beta.-galactosidase activity from marA-lacZ translational fusions.
More specifically, pKMN23 was tested in KMN14 (marO*RA-lacZ) and in
KMN18 (marORA-lacZ) cells. Both KMN14 and KMN 18 are translational
fusion cell lines containing marA sequences in the same
translational fusion as LacZ. KMN14 is a mutant containing a mar-R2
mutation in the marR region. The results are shown in TABLE 2.
2TABLE 2 GENE TRANSIENTLY .beta.-GAL FOLD STRAIN EXPRESSED ACTIVITY
REDUCTION KMN14 5130 -- (marO*RA-lacZ) marR 550 9.3 mutant marR
4278 1.2 anti-marA 950 5.4 KMN18 -- 2741 -- (marORA-lacZ) marR 59
46.5 mutant marR 1659 1.7 anti-marA 56 48.9
[0063] As shown above, plasmids containing antisense marA sequences
effectively reduced LacZ expression from the fusions by 5-49 fold,
thus achieving an inhibitory effect comparable to that observed
when adding wild type repressor MarR.
[0064] To establish further the inhibitory efficacy of antisense
marA sequences, KMN23 (the same DNA vector described above,
containing both the marR and the marA genes cloned in the antisense
direction) was also expressed in the presence of various
antibiotics (tetracycline (Tet), chloramphenicol (Cml), ampicillin
(Amp) and rifampicin (Rif). The effect of KMN23 was assessed by
measuring cell growth inhibition by the gradient plate method as
described in Example 9. The results are shown in TABLE 3.
3 TABLE 3 MIC/(.mu.g/ml) PLASMID Tet Cml Amp Rif AG 102 mar mutant
12.5 34.2 17.7 8.8 AG 102 with 3.7 3.3 5.5 1.1 marR.sup.+ plasmid
AG 102 with antisense- 8.3 16.4 15 2.6 marA plasmid pKMN23
[0065] As shown above, the antisense construct reduced resistance
to various unrelated antibiotics, hence proving that antisense
sequences directed to sequences associated with the marORAB operon
provide an ideal tool to inhibit bacterial drug resistance.
[0066] To optimize the inhibitory effect of the antisense
oligonucleotides, KMN 18 cells (a marORA-lacZ fusion E. coli cell
line described above) were incubated with increasing concentrations
of antisense oligonucleotides (10-20 .mu.M). Transcription of marA
sequences was induced by the addition of sodium salicylate. Samples
were assayed for .beta.-galactosidase activity at 60
minute-intervals. As shown in FIG. 2 all oligonucleotides added at
20 .mu.M concentrations reduced marA-lacZ activity. Control
oligonucleotide 101C (SEQ ID NO:7) showed no reduction in marA-lacZ
activity. In addition, antisense oligonucleotides 92 (SEQ ID NO: 1)
and 1284 (SEQ ID NO:6) reduced marA-lacZ activity from a cell line
constitutively expressing a marORA-lacZ fusion protein (KMN14)
(data not shown).
[0067] In order to ascertain the effects of increasing the
oligonucleotides of the invention on the bactericidal activity of
norfloxacin, competent cells of ML308-225-C2 (an isolated Mar
mutant E. coli strain) were treated with increasing concentrations
of representative antisense oligonucleotide 92 (SEQ ID NO:1), or
oligonucleotide 1284 (SEQ ID NO:6), or control oligonucleotide 1403
(SEQ ID NO:8), (scrambled sequence of oligonucleotide 1284). TABLE
4 summarizes the results pertaining to antisense oligonucleotide
1284 in duplicate experiments.
4 TABLE 4 NORFLOXACIN OLIGO 1284 (.mu.g/ml) (.mu.M) % OF CONTROL
CELLS 0 0 100 100 0.5 0 71 57 0.5 20 43 54 0.5 40 42 58 0.5 100 27
46 0.5 200 25 38
[0068] As shown, the killing effect of norfloxacin against ML308-C2
was enhanced significantly by the addition of antisense
oligonucleotide 1284 (SEQ ID NO:6).
[0069] In order to establish the effects of increasing
oligonucleotide concentrations on the antibacterial activity of
antibiotics, Mar mutant cells were treated with oligonucleotide
1284 (SEQ ID NO:6) at a final concentration of 20, 40, 100 and 200
mM in the presence of 0.5 mg/ml of norfloxacin for 1 hour. Cell
growth in the presence of the various concentrations of
oligonucleotide 1284 (SEQ ID NO:6) was compared to that observed in
untreated cells. The results are shown in TABLE 5.
5TABLE 5 NORFLOXACIN [OLIGO 1284] % OF CONTROL mg/ml mM (untreated
cells) -- -- 100 0.5 -- 65 0.5 20 48 0.5 40 50 0.5 100 36 0.5 200
31
[0070] As shown above for oligonucleotide 1284 (SEQ ID NO.6), the
antisense oligonucleotides of this invention enhance the
antibactericidal effect of antibiotics such as norfloxacin.
[0071] To ascertain that the inhibitory effect observed was a
specific antisense effect causing the repression of the RNA message
from the marORAB operon, the effect of oligonucleotide 1284 (SEQ ID
NO:6) on bacterial growth was measured following one or two hours
oligonucleotide treatment. Bacterial growth was compared to that
observed following treatment with the scrambled negative control
oligonucleotide 1403 (SEQ ID NO:8). Concentrations of 40 and 100
.mu.M of antisense oligonucleotides 1284 and scrambled
oligonucleotide 1403 were shown to cause no change in cell
viability in the absence of antibiotic. These results demonstrate
that the killing effect of oligonucleotide 1284 shown above in
TABLE 4 is not the result of the presence of the oligonucleotide
alone, but rather, is the result of the combined action of the
antibactericidal agent and the marORAB oligonucleotide of the
invention.
[0072] The following examples illustrate the preferred modes of
making and practicing the present invention, but are not meant to
limit the scope of the invention since alternative methods may be
utilized to obtain similar results.
EXAMPLE 1
Preparation of Oligonucleotides
[0073] Synthesis of the following phosphothioate oligonucleotides:
92 (SEQ ID NO: 1), 93 (SEQ ID NO:2), 1281 (SEQ ID NO:3), 1282 (SEQ
ID NO:4), 1283 (SEQ ID NO:5), 1284 (SEQ ID NO:6), 101C (SEQ ID
NO:7), 1403 (SEQ ID NO:8), RK1, (SEQ ID NO:9), A2, (SEQ ID NO:10),
LZ, (SEQ ID NO:11), ORAB2, (SEQ ID NO:12), and RK3, (SEQ ID NO:13)
was performed on a synthesizer (Pharmacia Gene Assembler Series
Synthesizer, Pharmacia LKB Biotechnology, Uppsala, Sweden) using
standard b-cyanoethylphosphoramidit- e procedure (see, Sonveaux
"Protecting Groups in Oligonucleotides Synthesis" in Agrawal (1994)
Methods in Molecular Biology 26:1-72; see also Uhlmann et al.
(1990) Chem. Rev. 90:543-583). Agrawal) and amidites (Cruachem,
Glasgow, Scotland) and supports (Millipore, Bedford, MA). The
random 20-mer phosphodiester contained an equimolar mixture of A,
C, G, and T at each position. DNAs were deprotected by treatment of
the support with I ml of acqueous NaOH at 55.degree. C. for 16
hours. Subsequently the ammonia was removed from the support, the
support was washed with 200 ml of water, and the two fractions were
pooled and lyophilized. Following assembly and deprotection, the
oligonucleotides were ethanol precipitated twice, dried, and
suspended in phosphate-buffered saline (PBS) at the desired
concentration.
[0074] The purity of these oligonucleotides was tested by capillary
gel electrophoreses and ion exchange HPLC. Endotoxin levels in the
oligonucleotide preparation was determined using the Luminous
Amebocyte Assay (Bang (1953) Biol. Bull. (Woods Hole, Mass.)
105:361-362).
EXAMPLE 2
[0075] Preparation of Constructs
[0076] A. Selection of a Mar Mutant of ML308-225
[0077] Antibiotic resistant mutants of ML308-225 (Rahman et al.
(1991) Antisense Res. Dev. 1:319-327) were grown and maintained at
30.degree. C. in LB broth. These mutants were selected by spreading
washed overnight cultures onto a LB agar plate containing
chloramphenicol (5 .mu.g/ml, Sigma, St. Louis, Mo.) and incubated
at 30.degree. C for 48-72 hours. Single colonies appearing after 48
hours were picked for further study. Resistant colonies were
observed for multiple antibiotic resistance using antibiotic
gradient plates.
[0078] One mutant showing increased minimal inhibitory
concentrations (hereinafter referred to as MIC) to tetracycline,
chloramphenicol, ampicillin, nalidixic acid, and norfloxacin was
selected and designated ML308-C2. Sequencing confirmed a C.RTM. T
substitution in amino acid 117 of marR, which results in a
truncated MarR protein. When wild type marR (pMAL-marR) was cloned
into ML308-C2, the MIC's decreased to that of levels expressed by
the wild-type ML308-225 strain (unpublished data). Northern
analysis using a marA DNA probe confirmed that ML308-C2 over
expresses marA and was a Mar mutant (unpublished data). These
results, in conjunction with the sequence data, support the
conclusion that a marR mutation is responsible for the Mar
phenotype in the ML308-C2 strain.
[0079] B. Construction of pDW10 and pDW11
[0080] Plasmid DNA was prepared using the Promega Wizard.TM. Prep
Kit (Madison, Wis.). Restriction endonucleases and T4 DNA ligase
(New England Biolabs, Beverly, Mass.) were used under conditions
suggested by the supplier. PCR amplification was carried out using
the Perkin Elmer Cetus DNA thermal cycler 480. Taq Polymerase and
reagents (Perkin Elmer Cetus, Norwalk, Conn.) were used as directed
to amplify the target sequence. Based on the known DNA sequence of
the mar loci (GenBank accession #M96235), PCR primers were created
which flanked the coding sequence and allowed amplification of marA
and the marORAB operon region, which were then cloned behind the T7
promoter of pBLUESCRIPT KS (Stratagene, La Jolla, Calif.). The marA
PCR primers were designed to amplify the marA coding sequence from
1893-2282 bp, resulting in a 389 bp product. A marORAB PCR product
(1281 bp) was created as well using primers designed to amplify the
DNA sequence of marORAB from 1311-2592 bp from the published
sequence. Restriction endonuclease sites for EcoR1 and Pst1 were
incorporated into the ends of PCR primers to ensure that insertion
of fragments were in the correct orientation when cloned into
pBLUESCRIPT. pBLUESCRIPT-marA was termed pDW10 and
pBLUESCRIPT-marORAB was named pDW11. To ensure that the proper DNA
fragments were cloned, the DNA sequence of the cloned PCR products
was determined by the method of Sanger et al. (Proc. Natl. Acad.
Sci. USA (1977) 74:5463-5467) using the Sequenase.TM. sequencing
kit (U.S. Biochemical, Cleveland, Ohio).
EXAMPLE 3
Transcription of Target RNA
[0081] Ten .mu.g each of the plasmids pDW10 (marA) and pDW11
(marORAB) were linearized with HindIII (New England Biolabs,
Beverly, Mass.) or EcoRI (New England Biolabs, Beverly, Mass.) in a
50 pi reaction containing a 1X dilution of the appropriate buffer
supplied and 100 U of restriction enzyme. Cleavage was allowed to
proceed at 37.degree. C for 2 hrs. After this time the reaction was
extracted twice with buffered phenol/CHC13 (1:1), twice with
CHCl.sub.3/isoamyl alcohol (24:1), and precipitated with 3 volumes
of precipitation mix (66 mM sodium acetate in ethanol). The DNA was
collected by centrifugation in a microfuge for 20 min, washed with
70% ethanol, and dried briefly under vacuum. The resultant pellet
was resuspended in 20 .mu.l of water and stored frozen until
needed.
[0082] RNA bearing a hydroxyl group was transcribed from the
linearized plasmids in a 20 .mu.l reaction containing 1X supplied
buffer, 1 mM each of rATP, rCTP, rUTP, 0.9 mM guanosine, 0.1 mM
GTP, 2 U/ml RNasin (Promega, Madison, Wis.), 2 .mu.g linearized
plasmid, and 2.5 .mu.l of 50,000 U/ml T7 RNA polymerase (New
England Biolabs, Beverly, Mass.), added in the order indicated.
This reaction was incubated at 37.degree. C for I hr and 1 unit of
RQ1 DNase (Promega, Madison, Wis.) was added. DNA was allowed to
digest at 37.degree. C for 15 min and then the RNA was purified
using a ProbeQuant G-50 spin column (Pharmacia Biotech, Piscataway,
N.J.) and the manufacturer's protocol. This produced about 50 .mu.l
of solution containing the marORAB transcript. At this point, the
integrity of an aliquot of the transcript was checked by
electrophoresis on a 1% agarose TBE gel and ethidium bromide
staining.
EXAMPLE 4
Radiolabelling of Target RNA
[0083] The transcripts were radiolabelled with .sup.32p in a 20
.mu.l reaction containing 10 .mu.l of transcript (1/5th of
transcription), 2 .mu.l of supplied T4 polynucleotide kinase
buffer, 5 .mu.l of g-.sup.32P-ATP (10 mCi/ml, Amersham, Cleveland,
OH), 1 .mu.l of 40 U/ml RNasin, and 2 .mu.l of 10 U/.mu.l T4
polynucleotide kinase (New England Biolabs, Beverly, Mass.). After
1 hr of incubation at 37.degree. C, the transcript was purified
using a spin column as described above, yielding the radiolabelled
transcript in a volume of approximately 50 .mu.l. Integrity of the
transcript was checked by denaturing polyacrylamide electrophoresis
and autoradiography.
EXAMPLE 5
RNase H Mapping of Accessible Sites in Target RNA
[0084] Mapping of sites accessible to oligonucleotide binding using
RNase H as a probe for RNA/DNA duplex was done in a 10 .mu.l
reaction containing 5 pi of radiolabelled transcript, 1 .mu.l of
10X RNase H buffer (400 mM Tris-HCl, pH 7.4, 40 mM MgCl.sub.2, 10
mM dithiothreitol), 0.5 ml of 40 U/.mu.l RNasin, 1 .mu.l of 500 mM
random 20-mer (heated and snap cooled), and 1.5 .mu.l of water.
This mixture was incubated at room temperature for 90 min and 1
.mu.l of 1 U/ml RNase H (Boehringer Mannheim, Indianapolis, Ind.)
was added. This constitutes the complete reaction. Control
reactions lacking either random 20-mer, RNase H, or both were done
in parallel. After 10 min at room temperature, the reaction was
quenched by the addition of 10 .mu.l of formamide loading dye.
Samples were denatured by heating to 95.degree. C. for 5 min and 7
pi were analyzed by electrophoresis on a 4% polyacrylamide
denaturing gel. Accessible sites were identified as abundant
radiolabelled fragments unique to the complete reaction lane.
Lengths of RNA fragments produced were calculated by comparison to
a radiolabelled DNA restriction ladder. This ladder had been
previously calibrated against RNAs of known lengths.
[0085] Sites accessible to oligonucleotide binding were found in
both the 5' untranslated region (bases 1401-1450) and the coding
region (bases 1708-1727) of MarR as well as near the translational
start (bases 1890-1950) and in the coding region (bases 2040-2075)
of MarA (numbering as in Gasparro et al. (1991) Antisense Res. Dev.
1:117-140).
EXAMPLE 6
Construction of Chromosomal
marA-lacZ and marORA-lacZ Fusions
[0086] A translational fusion plasmid (pMLB1034) and a
transcriptional fusion plasmid (pMBL1109) were used for
constructing marA-lacZ fusions. A 818 bp Dra1 fragment, containing
marOR and 144 bp of marA, were cloned into the Sma1 site of the
fusion plasmids. The resulting plasmids, pKMN14 and pKMN18 have the
marA fusion in the same translation frame with lacZ. Plasmids
pKMN19 and pKMN21 have marA inserted in a position upstream of a
promoterless lacZ gene, thereby creating a transcriptional fusion.
The marOR(A) fragment of pKMN14 and pKMN19 were derived from the
pHHM191 plasmid which has a missense mutation at the 45th amino
acid of marR, while pKMN18 and pKMN21 contained marOR(A) from the
wild type pHHM183 plasmid. A 560 bp fragment bearing the XmnI site
in marR to the Dra1 site in marA was also inserted into the fusion
plasmids leading to pKMN16, a marA-lacZ translational fusion
plasmid and pKMN21, a marA-lacZ transcriptional fusion plasmid.
[0087] The marOR*A-lacZ, marORA-lacZ, and mar(R)A-lacZ
translational fusions in plasmids pKMN14, pKMN18, and pKMN 16
respectively were transduced via a site specific recombination
mechanism into the chromosome of ASS111, which contains a 1.24 kb
marORAB deletion and is lacZ.sup.-, phoA.sup.-, and recA. First,
the fusion plasmids were transformed individually into ASS110, a
recA.sup.+ strain (Seone, A. et al. (1996) J. Bacteriol.
177:530-535). The transformants were infected with .lambda.RZ5 to
allow the formation of .lambda.RZ5(marA-lacZ) recombinants. The
recombinant lysate was used to transduce the plasmid less ASS110
strain and ampicillin resistant (50 .mu.g/ml) lysogens were
selected. Lysates from these purified lysogens were then used to
infect ASS111.
[0088] The presence of the marA-lacZ fusion in the chromosomal DNA
of ampicillin resistant lysogenies was confirmed by PCR for the
marR-lacZ fragment and the marA-lacz fragment. Primer RK1
(5'-GTGAAAAGTACCAGCGATCTG- -3'; SEQ ID NO:9), which can hybridize
to the 5' terminal end of marA was used for the marR-lacZ fragment
amplification and primer A2 (5'-GGTGAATTCATGACGATGTCCAGACGC-3'; SEQ
ID NO:10), which can hybridize to the 5'terminal end of marA, was
used for marA-lacZ fragment amplification. Primer LZ
(5'-ATGTGCTGCAAGGCGAT-3'; SEQ ID NO:11), which can anneal to the
internal portion of lacZ, was used as the lacz primer in both
constructions.
EXAMPLE 7
Cloning of marR and Anti sense marA
Under lac and T7 Promoters
[0089] Primer ORAB2 (5'-GGACTGCAGGCTAGCCTTGCATCGCAT-3'; SEQ ID
NO:12) hybridizes with nucleotides 1311 to 1328 in marO (Gen Bank
sequence #M96235) and create a PstI site. Primer RK3
(5'-TCTTGAATTCTTACGGCAGGACTTT- CTTAAG-3'; SEQ ID NO:13) hybridizes
with nucleotides 1858 to 1879 at the 3' terminal end of marR and
create an EcoR1 site. These primers were used for amplification of
the marOR gene from the wild type AG100 E. coli strain and the Mar
mutant AG102 strain. The resulting 570 bp Pst1-EcoR1 PCR fragments
were cloned into the Pst1-EcoR1 site of the pSPOK plasmid, a
kanamycin resistant derivative of pSPORT1 (Gibco/BRL, Washington,
D.C.), (Manneewannakul et al. (1994) supra). The marOR/pSPOK
plasmid can be induced for the expression of the marR gene from
either the lac or T7 promoter by IPTG or T7 RNA polymerase,
respectively.
[0090] A 473 bp fragment from the SacII site in marR to the Dra1
site in marA was inserted into the SnaB1 site of pSPOK. The
resulting construct, pKMN23, in which the marA gene was directed in
the opposite orientation of the lac promoter in pSPOK, was selected
for the antisense marA construct. MarA was fused to lacZ in both
transcriptional and translational fusions using cloning vectors
pMLB1034 or pMLB1109). The fusions were introduced into a
previously described mar deleted strain. Additionally, a 473 bp
segment consisting of 330 bases of marR and 143 bases of marA was
cloned in the antisense direction behind the lac promoter/T7
polymerase system (creating pKMN23).
EXAMPLE 8
DNA Transformation and Oligonucleotide Treatment of E coli
[0091] DNA transformation into bacterial strains was performed
using the CaCl.sub.2 procedure as previously described by Cohen et
al. J. Bacteriol. (1993) supra) or via electroporation. Competent
cells (10.sup.5) were transferred to tubes containing marORAB or
control oligonucleotides in various concentrations. Oligonucleotide
uptake was induced by a 1 minute heat shock (42.degree. C.) or
through electroporation and the samples were incubated at
30.degree. C. for 1 or 2 hours. Depending on the experiment,
strains incubated with the oligonucleotides were used in
.beta.-galactosidase assays, or colony formation and/or time kill
experiments.
EXAMPLE 9
Gradient Plate Assay
[0092] Bacterial susceptibility to tetracycline hydrochloride,
chloramphenicol, ampicillin, kanamycin, rifampin, nalidixic acid
and norfloxacin was assayed by the gradient plate method.
(Microbiology: Including Immunology and Molecular Genetics (3rd
ed.)(Davis et al. eds.(1980)J. P. Lippincott Co., Philadelphia,
Pa.).
EXAMPLE 10
.beta.-galactosidase Assays
[0093] Strains KMN14 and KMN18, with or without antisense
oligonucleotides, were grown at 30.degree. C. to mid-logarithmic
phase. Fifty microliters of competent cells were treated with the
appropriate oligonucleotide, heat shocked for 1 minute, and
incubated at room temperature for 30 minutes to allow for annealing
of the oligonucleotide with the mRNA. LB broth was then added to 1
ml, and the cell/oligonucleotide mixture was then incubated at
30.degree. C for 30 minutes. After 30 minutes incubation, KMN18
(wild type) was induced with 5 mM sodium salicylate, whereas KMN14
was not (constitutively expressed mar mRNA). Samples of
cell/oligonucleotide mixtures were then removed at 1 hour intervals
and assayed for .beta.-galactosidase the method of Miller
(Immunochemistry (1972) 9:217-228).
EXAMPLE 11
Inhibition of .beta.-galactosidase Activity in KMN18
[0094] The marA transcript was inducible with 5 mM sodium
salicylate after 30 minutes incubation in E. coli KMN18 strain (a
marORA-lacZ fusion cell line). KMN18 was incubated with increasing
concentrations (4-20 .mu.M) of antisense oligonucleotides. The
cells were then induced with 5 mM salicylate. The samples were
removed after 30 and 60 minute intervals and assayed for
.beta.-galactosidase activity. After 30 and 60 minute incubations
with salicylate, oligonucleotides 92 and 1284 at 20 .mu.M
concentrations caused reduced marA-lacZ activity (FIG. 2). Control
Oligonucleotide 101 showed no reduction in marA-lacZ activity. At
20 .mu.M, the same and an additional oligonucleotide, 1403, a
scrambled 1284, were tested. In four separate experiments
oligonucleotides 92 and 1284 showed significant activity. These
studies showed that antisense oligonucleotides 92 and 1284 showed a
dose response effect on LacZ expression.
EXAMPLE 12
Augmentation of Bactericidal Activity of Norfloxacin Using
marORAB-specific
Oligonucleotides
[0095] Competent cells of ML308-225-C2 (Mar mutant)(50 .mu.l ,
10.sup.7 cells) were incubated with increasing concentrations of
antisense oligonucleotides 1403, 92, or 1284 for 30 minutes on ice.
The cell/oligonucleotide mixture was either heat shocked at
42.degree. C for one minute or electroporated (to allow for
uptake). The cell suspension was placed on ice for two minutes and
then placed at room temperature for 30 minutes to allow for
association of the antisense oligonucleotide with the mRNA. LB
broth (450 .mu.l) was added to the mixture which was incubated for
1 and 2 hours at 30.degree. C. After 30 minutes of incubation at
30.degree. C, 1X the MIC of norfloxacin (0.5 .mu.g/ml) was added to
the cell suspension. At 1 hour post exposure to norfloxacin, 100
.mu.l aliquots of cell/oligonucleotide mixtures were collected,
diluted into PBS and the various dilutions were plated on LB agar
plates. Following overnight incubation at 30.degree. C., the number
of colonies was counted on al plates. For all experiments, the
samples were plated in duplicate or triplicate and all colonies on
a plate were counted.
[0096] Antisense oligonucleotide 1284 (SEQ ID NO:6) enhanced the
killing effect of norfloxacin against ML308-C2 as shown above in
TABLE 4. In two separate experiments, there was a greater effect
with 100-200 .mu.M vs. 20-40 .mu.M oligonucleotide. Oligonucleotide
1284 was then compared to its scrambled control 1403 (SEQ ID NO:8)
to determine if its activity was a specific antisense effect
directed at repressing the marRAB RNA message Concentrations of 40
and 100 .mu.M were chosen based on the results of TABLE 4. As shown
in TABLE 5 the presence of control Oligonucleotide 1403 alone
caused no change in cell viability. At 1 hour post exposure to 1X
MIC of norfloxacin, 1284 exhibited a 23% drop in viability as
compared to 6% with 1403. This effect seemed to diminish at 2
hours. The results showed a specific effect of oligonucleotide 1284
in enhancing the killing effects of norfloxacin against a mar
mutant which had been resistant to the bactericidal effect of
norfloxacin.
[0097] Equivalents
[0098] Those skilled in the art will recognize, or be able to
ascertain, using no more than routine experimentation, numerous
equivalents to the specific substances and procedures described
herein. Such equivalents are considered to be within the scope of
this invention, and are covered by the following claims.
Sequence CWU 1
1
* * * * *