U.S. patent application number 10/077023 was filed with the patent office on 2003-02-13 for b7-related nucleic acids and polypeptides useful for immunomodulation.
Invention is credited to Mikesell, Glen E., Shen, Henry.
Application Number | 20030031675 10/077023 |
Document ID | / |
Family ID | 26758785 |
Filed Date | 2003-02-13 |
United States Patent
Application |
20030031675 |
Kind Code |
A1 |
Mikesell, Glen E. ; et
al. |
February 13, 2003 |
B7-related nucleic acids and polypeptides useful for
immunomodulation
Abstract
The present invention provides nucleic acids encoding B7-related
factors that modulate the activation of immune or inflammatory
response cells, such as T-cells. Also provided are expression
vectors and fusion constructs comprising nucleic acids encoding
B7-related polypeptides, including BSL1, BSL2, and BSL3. The
present invention further provides isolated B7-related
polypeptides, isolated fusion proteins comprising B7-related
polypeptides, and antibodies that are specifically reactive with
B7-related polypeptides, or portions thereof. In addition, the
present invention provides assays utilizing B7-related nucleic
acids, polypeptides, or peptides. The present invention further
provides compositions of B7-related nucleic acids, polypeptides,
fusion proteins, or antibodies that are useful for the
immunomodulation of a human or animal subject.
Inventors: |
Mikesell, Glen E.;
(Hamilton, NJ) ; Shen, Henry; (Princeton,
NJ) |
Correspondence
Address: |
STEPHEN B. DAVIS
BRISTOL-MYERS SQUIBB COMPANY
PATENT DEPARTMENT
P O BOX 4000
PRINCETON
NJ
08543-4000
US
|
Family ID: |
26758785 |
Appl. No.: |
10/077023 |
Filed: |
February 15, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10077023 |
Feb 15, 2002 |
|
|
|
09875338 |
Jun 6, 2001 |
|
|
|
60272107 |
Feb 28, 2001 |
|
|
|
60209811 |
Jun 6, 2000 |
|
|
|
Current U.S.
Class: |
424/178.1 ;
435/252.3; 435/254.2; 435/320.1; 435/325; 435/410; 435/69.7;
530/350; 530/388.1; 536/23.2 |
Current CPC
Class: |
C07K 14/70532 20130101;
C07K 16/2827 20130101; C07K 2319/40 20130101; C07K 2317/56
20130101; C07K 2319/02 20130101; C07K 2319/03 20130101; C07K
2319/10 20130101; G01N 33/5005 20130101; C07K 19/00 20130101; A61K
2039/505 20130101; C07K 2319/00 20130101; C07K 2317/76 20130101;
C07K 2319/30 20130101; Y02A 50/30 20180101; A61K 38/1774 20130101;
A61K 38/00 20130101; C07K 2317/73 20130101; A61K 39/39533
20130101 |
Class at
Publication: |
424/178.1 ;
435/69.7; 435/325; 435/320.1; 435/252.3; 435/254.2; 435/410;
536/23.2; 530/350; 530/388.1 |
International
Class: |
A61K 039/395; C07H
021/04; C12P 021/04; C12N 001/21; C12N 005/04; C12N 005/06 |
Claims
What is claimed is:
1. An isolated nucleic acid fusion molecule consisting of a
nucleotide sequence encoding an amino acid sequence selected from
the group consisting of SEQ ID NO:133 and SEQ ID NO:135.
2. A vector comprising the isolated nucleic acid fusion molecule
according to claim 1.
3. A host cell comprising the vector according to claim 2, wherein
the host cell is selected from the group consisting of bacterial,
yeast, insect, mammalian, and plant cells.
4. An isolated fusion polypeptide consisting of an amino acid
sequence selected from the group consisting of SEQ ID NO:133 and
SEQ ID NO:135.
5. An antibody that binds to the isolated fusion polypeptide
according to claim 4.
6. The antibody according to claim 5 which is monoclonal.
7. A hybridoma cell which produces the monoclonal antibody
according to claim 6.
8. A method of decreasing T-cell proliferation in a subject
comprising: administering to the subject a pharmaceutical
composition comprising an isolated fusion polypeptide consisting of
amino acid sequence SEQ ID NO:9, and a physiologically acceptable
carrier, diluent, or excipient, in an amount effective to decrease
T-cell proliferation.
9. The method according to claim 8, wherein the subject is affected
with a condition selected from the group consisting of tissue
rejection, bone marrow rejection, organ transplant rejection, graft
versus host disease, psoriasis, chronic obstructive pulmonary
disease, asthma, atherosclerosis, rheumatoid arthritis, multiple
sclerosis, Lupus erythematosus, Hashimoto's thyroiditis, primary
mixedema, Graves' disease, pernicious anemia, autoimmune atrophic
gastritis, insulin dependent diabetes mellitus, good pasture's
syndrome, myasthenia gravis, pemphigus, Crohn's disease,
sympathetic opthalmia, autoimmune uveitis, autoimmune hemolytic
anemis, idiopathic thrombocytopenia, primary biliary cirrhosis,
ulcerative colitis, Sjogren's syndrome, polymyositis, and mixed
connective tissue disease.
10. The method according to claim 8, wherein the pharmaceutical
composition is co-administered with a pharmaceutical composition
comprising a monoclonal antibody that binds to a polypeptide
consisting of the amino acid sequence SEQ ID NO:7, and a
physiologically acceptable carrier, diluent, or excipient.
11. A method of decreasing T-cell proliferation in a subject
comprising: administering to the subject a pharmaceutical
composition comprising a monoclonal antibody that binds to a
polypeptide consisting of the amino acid sequence SEQ ID NO:7, and
a physiologically acceptable carrier, diluent, or excipient, in an
amount effective to decrease T-cell proliferation.
12. The method according to claim 11, wherein the subject is
affected with a condition selected from the group consisting of
tissue rejection, bone marrow rejection, organ transplant
rejection, graft versus host disease, psoriasis, chronic
obstructive pulmonary disease, asthma, and atherosclerosis,
rheumatoid arthritis, multiple sclerosis, Lupus erythematosus,
Hashimoto's thyroiditis, primary mixedema, Graves' disease,
pernicious anemia, autoimmune atrophic gastritis, insulin dependent
diabetes mellitus, good pasture's syndrome, myasthenia gravis,
pemphigus, Crohn's disease, sympathetic opthalmia, autoimmune
uveitis, autoimmune hemolytic anemis, idiopathic thrombocytopenia,
primary biliary cirrhosis, ulcerative colitis, Sjogren's syndrome,
polymyositis, and mixed connective tissue disease.
13. The method according to claim 11, wherein the pharmaceutical
composition is co-administered with a pharmaceutical composition
comprising an isolated fusion polypeptide consisting of amino acid
sequence SEQ ID NO:9, and a physiologically acceptable carrier,
diluent, or excipient.
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 09/875,338, filed Jun. 6, 2001, which is a
continuation-in-part of U.S. Application Serial No. 60/272,107,
filed Feb. 28, 2001, and U.S. Application Serial No. 60/209,811,
filed Jun. 6, 2000, which are all hereby incorporated by reference
in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to isolated nucleic acids
encoding B7-related polypeptides, including BSL1, BSL2, and BSL3,
which modulate cells that are important for immune and inflammatory
responses, such as T-cells. Also related are expression vectors and
fusion constructs comprising nucleic acids encoding B7-related
polypeptides. The present invention further relates to isolated
B7-related polypeptides, isolated fusion proteins comprising
B7-related polypeptides, and antibodies that are specifically
reactive with B7-related polypeptides, or portions thereof. In
addition, the present invention relates to methods of isolating and
identifying the corresponding counter-receptor(s) of the B7-related
polypeptides, utilizing B7-related polypeptides, or fusion
proteins. Also related are methods of immunomodulation of a subject
by the administration of compositions of the B7-related
polypeptides, fusion proteins, cognate antibodies, or portions or
derivatives thereof. The present invention further relates to
methods of immunomodulation of animal or human subjects by the
administration of compositions of genetically engineered vectors or
host cells comprising the B7-related polypeptide expression
cassettes as disclosed herein.
BACKGROUND OF THE INVENTION
[0003] The primary response of T-cells, involving T-cell
activation, expansion, and differentiation is essential for the
initiation of an immune response to a foreign antigen. The
activation of T-cells by antigen presenting cells (APCs) requires
at least two separate signals (K. E. Hellstrom et al. (1996) Cancer
Chemother. Pharmacol. 38:S40-1; N. K. Damle et al. (1992) J.
Immunol. 148:1985-92; J. M. Green et al. (1994) Eur. J. Immunol.
24:265-72; E. C. Guinan et al. (1994) Blood 84:3261-82; J. W. Hodge
et al. (1995) Cancer Res. 55:3598-603). The first signal causes
T-cell entry into the cell cycle, and is mediated by foreign
antigens presented by the major histocompatibility complex (MHC).
The second signal, termed costimulation, causes cytokine production
and T-cell proliferation, but is neither antigen-specific, nor MHC
restricted (R. H. Schwartz (1990) Science 248:1349-1356).
[0004] Costimulation is believed to be mediated by one or more
distinct cells surface molecules expressed by APCs (M. K. Jenkins
et al. (1988) J. Immunol. 140:3324-3330; P. S. Linsley et al.
(1991) J. Exp. Med. 173:721-730; C. D. Gimmi, et al. (1991) Proc.
Natl. Acad. Sci. USA 88:6575-6579; J. W. Young et al. (1992) J.
Clin. Invest. 90:229-237; L. Koulova et al. (1991) J. Exp. Med.
173:759-762; H. Reiser et al. (1992) Proc. Natl. Acad. Sci. USA
89:271-275; G. A. van-Seventer et al. (1990) J. Immunol.
144:4579-4586; J. M. LaSalle et al. (1991) J. Immunol. 147:774-80;
M. I. Dustin et al. (1989) J. Exp. Med. 169:503; R. J. Armitage et
al. (1992) Nature 357:80-82; Y. Liu et al. (1992) J. Exp. Med.
175:437-445). Considerable evidence suggests that B7, an APC
cell-surface protein, is one such costimulatory molecule (P. S.
Linsley et al. (1991) J. Exp. Med. 173:721-730; C. D. Gimmi et al.
(1991) Proc. Natl. Acad. Sci. USA 88:6575-6579; L. Koulova et al.
(1991) J. Exp. Med. 173:759-762; H. Reiser et al. (1992) Proc.
Natl. Acad. Sci. USA 89, 271-275; P. S. Linsley et al. (1990) Proc.
Natl. Acad. Sci. USA 87:5031-5035; G. J. Freeman et al. (1991) J.
Exp. Med. 174:625-631).
[0005] B7 has been shown to bind to two counter-receptors (ligands)
expressed on T-cells, termed CD28 and CTLA-4. B7 binding to CD28
induces T-cells to proliferate and secrete IL-2 (P. S. Linsley et
al. (1991) J. Exp. Med. 173, 721-730; C. D. Gimmi et al. (1991)
Proc. Natl. Acad. Sci. USA 88:6575-6579; C. B. Thompson et al.
(1989) Proc. Natl. Acad. Sci. USA 86:1333-1337; C. H. June et al.
(1990) Immunol. Today 11:211-6; F. A. Harding et al. (1992) Nature
356:607-609), allowing full T-cell activation. Conversely, B7
binding to CTLA-4 mediates T-cell down-regulation. The importance
of the B7:CD28/CTLA-4 costimulatory pathway has been demonstrated
in vitro and in several in vivo model systems. Blockade of this
pathway results in the development of antigen specific tolerance in
murine and humans systems (F. A. Harding et al. (1992) Nature
356:607-609; D. J. Lenschow et al. (1992) Science 257:789-792; L.
A. Turka et al. (1992) Proc. Natl. Acad. Sci. USA 89:11102-11105;
C. D. Gimmi et al. (1993) Proc. Natl. Acad. Sci. USA 90:6586-6590).
Conversely, the ectopic expression of B7 in B7-negative murine
tumor cells induces T-cell mediated specific immunity accompanied
by tumor rejection and long lasting protection to tumor challenge
(L. Chen et al. (1992) Cell 71:1093-1102; S. E. Townsend et al.
(1993) Science 259:368-370; S. Baskar et al. (1993) Proc. Natl.
Acad. Sci. USA 90:5687-5690). Therefore, manipulation of the
B7:CD28/CTLA-4 pathway offers great potential to stimulate or
suppress immune responses in humans.
[0006] In addition to the previously characterized B7 molecule
(referred to hereafter as B7-1) B7-1-like molecules have been
identified (see, e.g., M. Azuma et al. (1993) Nature 366:76-79; C.
Chen et al. (1994) J. Immunol. 152:4929-36; R. H. Reeves et al.
(1997) Mamm. Genome 8:581-582; K. Ishikawa et al. (1998) DNA Res.
5:169-176; U.S. Pat. No. 5,942,607 issued Aug. 24, 1999 to Freeman
et al.). In particular, PD-L1 and PD-L2 have been identified as
inhibitors of T-cell activation (G. J. Freeman et al. (2000) J.
Exp. Med. 192:1027-1034; Y. Latchman et al., (2001) Nature
Immunology 2:261-268), whereas B7-H1, B7-H3, and B7-DC have been
described as co-stimulators of T-cell proliferation (H. Dong et al.
(1999) Nature Medicine 5:1365-1369; A. I. Chapoval (2001) Nature
Immunology 2:269-274; Tseng et al. (2001) J. Exp. Med.
193(7):839-45).
[0007] Thus, there is a growing family of factors related to B7-1,
which modulate T-cell activation (reviewed by J. Henry et al.
(1999) Immunol. Today 20:285-288). The identification, isolation,
and characterization of B7-related factors are therefore important
goals for the further understanding of T-cell activation and
function in both normal and disease states in animals, particularly
humans. Accordingly, the present invention discloses the discovery
and characterization of three B7-related factors, termed BSL1,
BSL2, and BSL3. Also disclosed are various assays and treatments
utilizing the BSL1, BSL2, and BSL3 factors.
SUMMARY OF THE INVENTION
[0008] It is an object of the present invention to provide isolated
nucleic acids encoding B7-related polypeptides that modulate
inflammatory and immune responses, including T-cell activation
(i.e., lymphokine production and/or T-cell proliferation).
B7-related polypeptides within the scope of the invention include
counter-receptors on the surface of APCs capable of binding
CD28/CTLA-4 and/or CD28-/CTLA-4-related ligand(s). Specifically,
B7-related polypeptides include the BSL1, BSL2, and BSL3
polypeptides, and soluble fragments or derivatives thereof. More
specifically, a B7-related nucleic acid is: i) a nucleic acid
molecule comprising at least a fragment of a nucleotide sequence
encoding a BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11,
or 13), or BSL3 (e.g., SEQ ID NO:15) polypeptide; ii) a nucleic
acid molecule comprising a nucleotide sequence encoding a
polypeptide that shares moderate to substantial sequence homology
with a BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or
13), or BSL3 (e.g., SEQ ID NO:15) polypeptide; iii) a nucleic acid
molecule capable of hybridizing to the BSL1 (e.g., SEQ ID NO:1 or
3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or 131), or BSL3 (e.g., SEQ ID
NO:14) nucleotide sequences, or fragments thereof, under
appropriate conditions (e.g., moderate or high stringency
hybridization conditions); iv) a nucleic acid molecule which
differs from the nucleotide sequence of BSL1 (e.g., SEQ ID NO:1 or
3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or 131), or BSL3 (e.g., SEQ ID
NO:14) due to degeneracy in the genetic code, or recombinant or
synthetic modifications; or v) a nucleic acid molecule that shares
at least substantial homology with the nucleic acid sequence set
forth in SEQ ID NO:1, 3, 6, 10, 12, 14, or 131.
[0009] In addition, nucleic acid probes or primers comprising
B7-related sequences are encompassed by the present invention. Such
probes and primers are useful, for example, for assaying a
biological sample for the presence of APCs expressing the BSL1,
BSL2, and BSL3 factors.
[0010] It is another object of the present invention to provide
vectors (e.g., expression vectors) and fusion constructs comprising
nucleic acids encoding B7-related polypeptides. Expression vectors
direct the synthesis of the corresponding polypeptides or peptides
in a variety of hosts, particularly eukaryotic cells, such as
mammalian and insect cell culture, and prokaryotic cells, such as
Escherichia coli. Expression vectors within the scope of the
invention comprise a nucleic acid sequence encoding at least one
B7-related polypeptide as described herein, and a promoter
operatively linked to the nucleic acid sequence. In one embodiment,
the expression vector comprises a DNA sequence encoding the
extracellular domain of BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ
ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15) fused to a DNA
sequence encoding the Fc region human immunoglobulin G1 (IgG1).
Such expression vectors can be used to transform or transfect host
cells to thereby produce polypeptides or peptides, including fusion
proteins or peptides encoded by nucleic acid molecules as described
herein.
[0011] It is yet another object of the present invention to provide
isolated B7-related polypeptides, including the BSL1, BSL2, and
BSL3 polypeptides, or portions or derivatives thereof. Preferred
B7-related polypeptides comprise the amino acid sequences of the
BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or
BSL3 (e.g., SEQ ID NO:15) polypeptides, or portions thereof. Such
polypeptides comprise at least a portion of the mature forms of the
BSL1, BSL2, and BSL3 polypeptides, and preferably comprise soluble
forms of these polypeptides. Also encompassed by the present
invention are polypeptides that share moderate to substantial
homology with the amino acid sequence set forth in SEQ ID NO:2, 7,
11, 13, or 15, which are naturally occurring isoforms of the BSL1,
BSL2, or BSL3 polypeptides, or modified recombinant
polypeptides.
[0012] It is still another object of the present invention to
provide isolated fusion proteins comprising the B7-related
polypeptides, or portions or derivatives thereof, as disclosed
herein. In one aspect, the fusion protein comprises an
extracellular domain portion of a B7-related polypeptide fused to
another polypeptide that alters the solubility, purification,
binding affinity, and/or valency of the B7-related polypeptide.
Preferably, a DNA molecule encoding an extracellular domain portion
of the BSL1, BSL2, or BSL3 polypeptides can be joined to DNA
encoding the Fc region of human IgG1 to form DNA fusion products
that encode the BSL1-Ig (e.g., SEQ ID NO:5), BSL2-Ig (e.g., SEQ ID
NO:9, 133, or 135), or BSL3-Ig (e.g., SEQ ID NO:17) fusion
proteins.
[0013] It is a further object of the present invention to provide
methods of isolating and identifying the corresponding
counter-receptor(s) of the B7-related polypeptides, utilizing the
isolated B7-related polypeptides, fusion proteins, or cognate
antibodies disclosed herein. In one embodiment, isolated BSL1,
BSL2, or BSL3 polypeptides, or portions thereof, can be incubated
with protein extracts obtained from immune or inflammatory response
cells, such as T-cells, to form a BSL/receptor complex, and then
incubated with anti-BSL antibodies to isolate the BSL/receptor
complex. Alternatively, a fusion protein comprising the BSL1, BSL2,
or BSL3 polypeptide can be incubated with protein extracts obtained
from immune or inflammatory response cells, such as T-cells, and
then incubated with antibodies that specifically react with the
fusion protein. Receptors that bind to the B7-related polypeptides
would be expected to have significant immunomodulatory
activity.
[0014] It is another object of the present invention to provide
diagnostic methods and kits utilizing the B7-related factors of the
present invention, including nucleic acids, polypeptides,
antibodies, or functional fragments thereof. Such factors can be
used, for example, in diagnostic methods and kits for measuring
expression levels of B7-related factors, and to screen for various
B7-related diseases. In addition, the B7-related nucleic acids
described herein can be used to identify chromosomal abnormalities
affecting BSL1, BSL2, or BSL3, and to identify allelic variants or
mutations of BSL1, BSL2, or BSL3 in an individual or
population.
[0015] It is yet another object of the present invention to provide
isolated antibodies, including monoclonal and polyclonal
antibodies, that are specifically reactive with the B7-related
polypeptides, fusion proteins, or portions or derivatives thereof,
as disclosed herein. Preferably, monoclonal antibodies are prepared
to be specifically reactive with the BSL1 (e.g., SEQ ID NO:2), BSL2
(e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15)
polypeptides, or portions or derivatives thereof.
[0016] It is another object of the present invention to provide
methods of immunomodulation of a human or animal subject by the
administration of compositions of the B7-related polypeptides,
fusion proteins, or portions or derivatives thereof, as disclosed
herein. Such compositions would be expected to up-regulate or
down-regulate the activities of immune or inflammatory response
cells (e.g., T-cells). For example, B7-related polypeptides in a
composition may interact with CD28 and thereby up-regulate immune
cell activity. Alternatively, B7-related polypeptides in a
composition may interact with CTLA-4 and thereby down-regulate
immune cell activity. In one embodiment, compositions of BSL1-Ig,
BSL2-Ig, and BSL3-Ig, fusion proteins are administered, e.g. via
injection, to a subject to provide systemic immunosupression or
immunostimulation. In a specific embodiment, BSL2-Ig (e.g., SEQ ID
NO:9) fusion proteins can be used to inhibit T-cell proliferation,
and thereby treat conditions associated with aberrant or increased
T-cell proliferation. The protein or fusion protein compositions of
the invention can be administered alone, or in combination with one
or more immunomodulatory molecules. For example, BSL2-Ig fusion
proteins (e.g., SEQ ID NO:9) can be administered in combination
with antibodies against a BSL2 polypeptide (e.g., SEQ ID NO:7) to
inhibit T-cell proliferation.
[0017] It is still another object of the present invention to
provide methods of immunomodulation of a human or animal subject by
the administration of compositions of antibodies that are
specifically reactive with the B7-related polypeptides, fusion
proteins, or portions or derivatives thereof, as disclosed herein.
Such compositions can be expected to block the co-stimulatory
activities of the B7-related polypeptides, and to down-regulate
immune or inflammatory response cells (e.g., T-cells), accordingly.
In one embodiment, compositions of monoclonal antibodies that are
specifically reactive with the BSL1 (e.g., SEQ ID NO:2), BSL2
(e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15)
polypeptides, or fragments thereof, are administered, e.g., via
injection, to a subject to provide immunosupression or induced
tolerance. In a specific embodiment, monoclonal antibodies against
a BSL2 polypeptide (e.g., SEQ ID NO:7) can be used to inhibit
T-cell proliferation, and thereby treat conditions associated with
aberrant or increased T-cell proliferation. Antibody compositions
can be administered alone, or in combination with one or more
immunomodulatory molecules. For example, antibodies against a BSL2
polypeptide (e.g., SEQ ID NO:7) can be administered in combination
with a BSL2-Ig fusion protein (e.g., SEQ ID NO:9) to inhibit T-cell
proliferation. The methods of inducing tolerance described herein
can be used prophylactically for preventing immune responses such
as transplantation rejection (solid organ and bone marrow) and
graft versus host disease, especially in autologous bone marrow
transplantation. Such methods can also be useful therapeutically,
in the treatment of autoimmune diseases, transplantation rejection,
and established graft versus host disease in a subject.
[0018] It is a further object of the present invention to provide
methods of the immunomodulation of a human or animal subject by the
administration of compositions of genetically engineered vectors or
cells comprising the B7-related polypeptide expression cassettes as
disclosed herein. In a preferred embodiment, the cells are antigen
presenting cells, such as a macrophages, which are transfected or
transduced to allow expression of one or more of the B7-related
polypeptides, including the BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g.,
SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15) polypeptides,
fusion proteins, or fragments or derivatives thereof, and then
introduced e.g., via transplantation, into the recipient.
Consistent with the present invention, the genes encoding the BSL1,
BSL2, or BSL3 polypeptides or fusion proteins can be transfected or
transduced alone, or in combination with genes encoding other
immunomodulatory molecules.
[0019] Additional objects and advantages afforded by the present
invention will be apparent from the detailed description and
exemplification herein below.
BRIEF DESCRIPTION OF THE FIGURES
[0020] The appended drawings of the figures are presented to
further describe the invention and to assist in its understanding
through clarification of its various aspects. In the figures of the
present invention, the nucleotide and amino acid sequences are
represented by their one-letter abbreviations.
[0021] FIGS. 1A-1C illustrate the nucleotide and predicted amino
acid sequence of BSL1.
[0022] FIG. 1A shows the nucleotide sequence of BSL1 (SEQ ID NO:1)
determined from the full-length clone isolated from a cDNA library
prepared from human microvascular endothelial cells treated with
TNF-alpha; nucleotides 1-92 contain the 5'-untranslated region;
nucleotides 93-95 contain the translation initiation signal (ATG);
nucleotides 93-962 contain the protein coding region; nucleotides
963-965 contain the translation termination signal (TAA);
nucleotides 963-1576 contain the 3'-untranslated region; and
nucleotides 1577-1605 contain the poly(A).sup.+ RNA tail.
[0023] FIG. 1B shows the predicted amino acid sequence of BSL1 (SEQ
ID NO:2); amino acids 1-240 contain the predicted extracellular
domain (ECD).
[0024] FIG. 1C shows the nucleotide sequence of BSL1 (SEQ ID NO:3)
determined from the full-length clone isolated from a cDNA library
prepared from GM-CSF/IL-4 differentiated human monocyte cells;
nucleotides 1-92 contain the 5'-untranslated region; nucleotides
93-95 contain the translation initiation signal (ATG); nucleotides
93-962 contain the protein coding sequence; nucleotides 963-965
contain the translation stop signal (TAA); and nucleotides 963-3621
contain the 3'-untranslated region (unique sequence is shown in
bold).
[0025] FIGS. 2A-2B illustrate the nucleotide and predicted amino
acid sequence of the BSL1-Ig fusion construct.
[0026] FIG. 2A shows the nucleotide sequence of the BSL1-Ig fusion
construct (SEQ ID NO:4); nucleotides 1-72 encode the predicted CD5
signal sequence; nucleotides 73-78 contain the Spel restriction
site; nucleotides 78-729 encode the predicted BSL1 ECD; nucleotides
730-1440 encode the Fc portion of human IgG1; and nucleotides
1441-1443 contain the translation stop signal (TGA).
[0027] FIG. 2B shows the BSL1-Ig predicted amino acid sequence (SEQ
ID NO:5).
[0028] FIGS. 3A-3H illustrate the nucleotide and predicted amino
sequences of the BSL2 clones.
[0029] FIG. 3A shows the nucleotide sequence of the BSL2-4616811
clone (SEQ ID NO:6); nucleotides 1-12 include vector sequence;
nucleotides 121-123 contain the translation initiation signal
(ATG); between nucleotides 204-205 is the predicted signal peptide
cleavage site; nucleotides 1516-1587 encode the predicted
transmembrane domain; nucleotides 1723-1725 contain the translation
termination signal (TGA). It is noted that BSL2-4616811 is also
called BSL2vcvc for the purposes of this invention.
[0030] FIG. 3B shows the predicted amino acid sequence of the
BSL2-4616811 clone (SEQ ID NO:7); amino acids 1-465 contain the
predicted ECD. The sequence of the mature BSL2-4616811 polypeptide
begins at amino acid 29.
[0031] FIG. 3C shows the nucleotide sequence of the BSL2-L165-21
clone (SEQ ID NO:10); nucleotides 1-3 contain the translation
initiation signal (ATG); between nucleotides 84-85 is the predicted
signal peptide cleavage site; nucleotides 742-813 encode the
predicted transmembrane domain; nucleotides 949-951 contain the
translation termination signal (TGA). It is noted that BSL2-L165-21
is also called BSL2v2c2 for the purposes of this invention.
[0032] FIG. 3D shows the predicted amino acid sequence of the
BSL2-L165-21 clone (SEQ ID NO:11); amino acids 1-247 contain the
predicted ECD.
[0033] FIG. 3E shows the nucleotide sequence of the BSL2-L165-35b
clone (SEQ ID NO:12); nucleotides 1-3 contain the translation
initiation signal (ATG); between nucleotides 84-85 is the predicted
signal peptide cleavage site; nucleotides 742-813 encode the
predicted transmembrane domain; nucleotides 949-951 contain the
translation termination signal (TGA). The sequence encoding the
mature BSL2-L165-35b polypeptide begins at nucleotide 85. It is
noted that BSL2-L165-35b is also called BSL2v1c2 for the purposes
of this invention.
[0034] FIG. 3F shows the predicted amino acid sequence of the
BSL2-L165-35b clone (SEQ ID NO:13); amino acids 1-247 contain the
predicted ECD. The sequence encoding the mature BSL2-L165-35b
polypeptide begins at amino acid 29.
[0035] FIG. 3G shows the coding sequence of BSL2-4616811 (BSL2vcvc;
SEQ ID NO:131). The sequence encoding the mature form of the
BSL2-4616811 polypeptide begins at nucleotide 85; nucleotides 1-3
contain the translation initiation signal (ATG); and nucleotides
1396-1467 encode the predicted transmembrane domain.
[0036] FIG. 3H shows the exons and alternative splicing diagram for
the BSL2 clones, including BSL2-4616811 (BSL2vcvc), BSL2-L165-21
(BSL2v2c2), and BSL2-L165-35b (BSL2v1c2). In the diagram, the exons
are not drawn to scale, and the first 66 nucleotides of the
BSL2-4616811 clone are not mapped to the genomic sequence.
[0037] FIGS. 4A-4F illustrate the nucleotide and predicted amino
sequences of the BSL2-4616811-Ig (BSL2vcvc-Ig), BSL2-L165-35b-Ig
(BSL2v1c2-Ig), and BSL2-L165-21-Ig (BSL2v2c2-Ig) fusion
constructs.
[0038] FIG. 4A shows the nucleotide sequence of the BSL2-4616811-Ig
clone (SEQ ID NO:8); nucleotides 1-3 contain the translation
initiation signal (ATG); nucleotides 1-1394 encode the BSL2-4616811
ECD; nucleotide 1395 is a silent mutation introduced to facilitate
construction of the fusion protein; nucleotides 1396-2094 encode
the Fc portion of human IgG1; nucleotides 2095-2097 contain the
translation termination signal (TGA).
[0039] FIG. 4B shows the predicted amino acid sequence of the
BSL2-4616811-Ig fusion protein (SEQ ID NO:9); amino acids 1-465 of
contain the BSL2-4616811 ECD; amino acids 85-465 contain the mature
BSL2-4616811 ECD; amino acids 466-698 contain the Fc domain of
human IgG.
[0040] FIG. 4C shows the nucleotide sequence of the
BSL2-L165-35b-Ig clone (SEQ ID NO:132); nucleotides 1-3 contain the
translation initiation signal (ATG); nucleotides 1-84 encode the
predicted signal peptide sequence; nucleotides 85-738 encode the
mature ECD; nucleotides 739-744 contain a restriction site
introduced by PCR to facilitate construction of the fusion; and
nucleotides 745-1440 encode the human Ig portion of the fusion
construct.
[0041] FIG. 4D shows the predicted amino acid sequence of the
BSL2-L165-35b-Ig fusion protein (SEQ ID NO:133); amino acids 1-28
contain the predicted signal peptide sequence; amino acids 29-226
contain the mature ECD; amino acids 227-228 correspond to the
restriction site introduced by PCR; amino acids 229-480 contain the
human Ig portion of the fusion.
[0042] FIG. 4E shows the nucleotide sequence of the BSL2-L165-21-Ig
clone (SEQ ID NO:134); nucleotides 1-3 contain the translation
initiation signal (ATG); nucleotides 1-84 encode the predicted
signal peptide sequence; nucleotides 85-738 encode the predicted
mature ECD; nucleotides 739-744 contain an EcoRI site introduced by
PCR to facilitate construction of the fusion; nucleotides 745-1440
encode the human Ig portion of the fusion construct.
[0043] FIG. 4F shows the predicted amino acid sequence of the
BSL2-L165-21-Ig fusion protein (SEQ ID NO:135); amino acid 1 is the
initiating methionine; amino acids 1-28 contain the predicted
signal peptide sequence; amino acids 29-246 contain the predicted
mature ECD; amino acids 247-248 correspond to the EcoRI restriction
site introduced by PCR; amino acids 249-480 contain the human Ig
portion of the fusion protein.
[0044] FIGS. 5A-5B illustrate the nucleotide and predicted amino
acid sequence of BSL3.
[0045] FIG. 5A shows the nucleotide sequence of BSL3 (SEQ ID
NO:14): nucleotides 1-326 contain 5' untranslated region;
nucleotides 327-329 contain the translation initiation signal
(ATG); nucleotides 981-1055 encode a predicted transmembrane
domain; nucleotides 1146-1148 contain the translation termination
signal (TGA)
[0046] FIG. 5B shows the BSL3 predicted amino acid sequence (amino
acids 1-273; SEQ ID NO:15); amino acids 1-219 contain the predicted
ECD.
[0047] FIGS. 6A-6B illustrate the nucleotide and predicted amino
acid sequence of the of the BSL3-Ig fusion construct.
[0048] FIG. 6A shows the nucleotide sequence of BSL3-Ig (L232-6;
SEQ ID NO:16): nucleotides 1-3 contain the translation initiation
signal (ATG); nucleotides 1-651 encode the native BSL3 ECD;
nucleotides 652-654 encode an artificial sequence introduced during
construction; nucleotides 655-1356 encode the Fc domain of human
IgG.
[0049] FIG. 6B shows the predicted amino acid sequence of BSL3-Ig
(L232-6; SEQ ID NO:17); amino acids 1-217 contain the BSL3 ECD;
amino acid 218 represents an artificial residue introduced during
construction; amino acids 219-451 contain the Fc domain of human
IgG.
[0050] FIGS. 7A-7H illustrate the reagents and results of
expression analysis performed for BSL1, BSL2, and BSL3.
[0051] FIG. 7A shows the nucleotide sequence of the BSL1 probe (SEQ
ID NO:18) used for Northern blot analysis.
[0052] FIG. 7B shows the nucleotide sequence of the BSL2 probe (SEQ
ID NO:19).
[0053] FIG. 7C shows the nucleotide sequence of the BSL3 probe (SEQ
ID NO:20).
[0054] FIG. 7D shows the levels of BSL1, BSL3, and BSL3 mRNA
observed in various cell types as determined by Northern blot
analysis; "PBT" indicates peripheral blood T-cells; "CD3/CD28"
indicates stimulation with anti-CD3 and anti-CD28 antibodies; "PMA"
indicates stimulation with phorbol 12 myristate 13 acetate; "LPS"
indicates stimulation with lipopolysaccharide; "PBM" indicates
peripheral blood monocytes; "PHA" indicates stimulation with
phytohemaglutinin; "GM-CSF/IL-4" indicates stimulation with GM-CSF
and IL-4; "HMVEC" indicates human microvascular endothelial cells;
"TNF-alpha" indicates stimulation with TNF-alpha; and "H292
(Starved) indicates serum starved H292 cells.
[0055] FIG. 7E shows BSL3 expression levels in various tissue types
as determined by Northern analysis of commercially available blots
using radiolabeled BSL3/KpnI+XbaI probe.
[0056] FIG. 7F shows BSL3 expression levels in various tissue types
as determined by hybridization analysis of commercially available
microarrays using radiolabeled BSL3/KpnI+XbaI probe.
[0057] FIG. 7G shows BSL1 expression levels in various tissue types
as determined by quantitative PCR.
[0058] FIG. 7H shows BSL3 expression levels in various tissue types
as determined by quantitative PCR.
[0059] FIGS. 8A-8E illustrate the results of PCR analysis performed
to determine the relative levels of the BSL2-4616811 (BSL2vcvc) or
BSL2-L165-35b (BSL2v1c2) transcripts in various cell types, with or
without stimulation. The top arrow points to the bands representing
the BSL2-4616811 transcript; the bottom arrow points to the bands
representing the BSL2-L165-35b transcript.
[0060] FIG. 8A shows the results for RAJI, RAMOS, PM-LCL, and
PL-LCL cell types, with or without PMA and ionomycin
stimulation.
[0061] FIG. 8B shows the results for CE-LCL cells, HL60, Thp1, and
HUVEC cell types, with or without stimulation.
[0062] FIG. 8C shows the results for peripheral blood T-cells with
or without PMA and ionomycin stimulation. The results from cells
isolated from two separate donors are shown (donor 079 and donor
124).
[0063] FIG. 8D shows the results for CEM and HUT78 cells, with or
without PMA and ionomycin stimulation.
[0064] FIG. 8E shows the results of a PCR reaction using
BSL2-4616811 plasmid as template. Lane 1: Lambda BstEII DNA ladder;
lane 2: PCR product. The results demonstrate that the forward
primer preferentially binds the specific binding site in the first
variable fold rather than for the homologous site in the second
variable fold of BSL2-4616811.
[0065] FIGS. 9A-9F illustrate the results of fluorescence activated
cell sorting (FACS) performed using anti-BSL1, anti-BSL2, and
anti-BSL3 monoclonal antibodies (MAbs).
[0066] FIG. 9A shows FACS analysis of A549 epithelial lung cells
using anti-BSL1 MAb. Column 1: no MAb; column 2: isotype control;
column 3: BSL1 hybridoma supernatant 32.
[0067] FIG. 9B shows FACS analysis of A549 epithelial lung cells
using anti-BSL2-4616811 MAb. Column 1: no MAb; column 2: isotype
control; column 3: anti-BSL2 MAb 1F7G2; column 4: anti-BSL2 MAb
2B10D7; column 5: anti-BSL2 MAb 3E6D3; column 6: anti-BSL2 MAb
4C2C6; column 7: anti-BSL2 MAb 5D7E2.
[0068] FIG. 9C shows FACS analysis of various cell types using
anti-BSL3 MAb.
[0069] FIG. 9D shows FACS analysis of human umbilical vein
endothelial cells (HUVEC) with or without TNF-alpha stimulation
using anti-BSL3 MAb.
[0070] FIGS. 9E-9F show FACS analysis of peripheral blood monocytes
(PBMC) with or without GM-CSF/IL4 or PHA stimulation using
anti-BSL3 MAb.
[0071] FIG. 9E shows results from cells isolated from donor
126;
[0072] FIG. 9F shows results from cells isolated from donor
145.
[0073] FIGS. 10A-10D illustrate co-stimulation of peripheral blood
T-cells using BSL3-Ig fusion proteins in the presence of anti-CD3
monoclonal antibody. The L6-Ig fusion protein is used as a negative
control.
[0074] FIG. 10A shows results from cells isolated from donor
78.
[0075] FIG. 10B show results from cells isolated from donor
124.
[0076] FIGS. 10C-10D show the results from cells stimulated with
anti-CD3 MAb and BSL3-Ig fusion protein and blockaded with
anti-BSL3 MAb. Column 1: anti-BSL3-1A4A1 MAb; column 2:
anti-BSL3-2B6H7 MAb; and column 3: isotype control antibody.
[0077] FIG. 10C shows results from cells isolated from donor
010;
[0078] FIG. 10D shows results from cells isolated from donor
127.
[0079] FIGS. 11A-11J illustrate suppression of peripheral blood
T-cell proliferation using BSL2-4616811-Ig (BSL2vcvc-Ig) and/or
anti-BSL2 MAb.
[0080] FIG. 11A shows results obtained using decreasing
concentrations of anti-CD3 MAb, and constant concentrations of
BSL2-4616811-Ig (BSL2vcvc-Ig) or ChiL6 fusion proteins.
[0081] FIG. 11B shows results obtained using a constant
concentration of anti-CD3 MAb, and decreasing concentrations of
BSL2-4616811-Ig (BSL2vcvc-Ig) or ChiL6 fusion proteins.
[0082] FIG. 11C shows results obtained using a decreasing
concentration of anti-CD28 MAb, a constant concentration of
anti-CD3 MAb, and a constant concentration of BSL24616811-Ig
(BSL2vcvc-Ig) or ChiL6 fusion proteins.
[0083] FIG. 11D shows results obtained using a constant
concentration of anti-CD3 MAb, a decreasing concentration of
BSL2-4616811-Ig (BSL2vcvc-Ig), BSL2-L165-35b-Ig (BSL2v1c2-Ig), or
ChiL6 fusion proteins. In the graph, "BSL2vcIg" represents
BSL2-L165-35b-Ig (BSL2v1c2-Ig).
[0084] FIG. 11E shows results obtained using a constant
concentration of anti-CD3 MAb, a constant concentration of
BSL2-4616811-Ig (BSL2vcvc-Ig) fusion protein, and decreasing
concentrations of anti-BSL2-1 MAb, anti-BSL2-5 MAb, or non-specific
3.sub.--15 MAb.
[0085] FIG. 11F shows results obtained using a constant
concentration of anti-CD3 MAb, a constant concentration of
BSL2-4616811-Ig (BSL2vcvc-Ig) fusion protein, and decreasing
concentrations of anti-BSL2-1 MAb, anti-BSL2-2 MAb, anti-BSL2-3
MAb, anti-BSL2-4 MAb, BSL2-5 MAb, or non-specific 3.sub.--15
MAb.
[0086] FIG. 11G shows results obtained using a constant
concentration of anti-CD3 MAb, a constant concentration of ChiL6
fusion protein, and decreasing concentrations of anti-BSL2-1 MAb or
non-specific 3.sub.--15 MAb, or no MAb.
[0087] FIG. 11H shows results obtained using a constant
concentration of anti-CD3 MAb, a constant concentration of
BSL2-L165-35b-Ig (BSL2v1c2-Ig) fusion protein, and decreasing
concentrations of anti-BSL2-1 MAb or non-specific 3.sub.--15 MAb,
or no MAb.
[0088] FIG. 11I shows results obtained using a constant
concentration of anti-CD3 MAb, followed by a constant concentration
of BSL2-4616811-Ig (BSL2vcvc-Ig) fusion protein, later followed by
decreasing concentrations of plate-bound anti-BSL2-1 MAb or
non-specific 3.sub.--15 MAb, or no MAb. In this experiment, MAb was
bound to the plate after addition of BSL2-4616811-Ig
(BSL2vcvc-Ig).
[0089] FIG. 11J shows results obtained using a constant
concentration of anti-CD3 MAb, followed by decreasing
concentrations of plate-bound anti-BSL2-1 MAb, non-specific
3.sub.--15 MAb, or no MAb, later followed by a constant
concentration of BSL2-4616811-Ig (BSL2vcvc-Ig) fusion protein. In
this experiment, MAb was bound to the plate before addition of
BSL2-4616811-Ig (BSL2vcvc-Ig).
[0090] FIGS. 12A-12B illustrate results obtained from mixed
lymphocyte reactions.
[0091] FIG. 12A shows reactions from cells incubated with
decreasing concentrations of BSL2-4616811-Ig (BSL2vcvc-Ig),
CTLA-4-Ig, or ChiL6 fusion proteins. In the graph,
"(124.times.051)" indicates that T-cells from donor 124 were used
as responders and monocytes from donor 051 were used as stimulators
for the reactions.
[0092] FIG. 12B shows reactions from cells incubated with
BSL2-4616811-Ig (BSL2vcvc-Ig), BSL2-L165-35b-Ig (BSL2v1c2-Ig), or
ChiL6 fusion proteins. In the graph, "BSL2vcIg" represents
BSL2-L165-35b-Ig (BSL2v1c2-Ig) fusion protein; and "(82.times.148)"
indicates that T-cells from donor 82 were used as responders and
monocytes from donor 148 were used as stimulators for the
reactions.
[0093] FIG. 13 shows the results of a binding comparison of
anti-BSL2 MAb to BSL2-4616811-Ig (BSL2vcvc-Ig) and BSL2v1c2-Ig. In
the graph, "vcvc" represents BSL2-4616811-Ig (BSL2vcvc-Ig) fusion
protein; "vc" represents BSL2-L165-35b-Ig (BSL2v1c2-Ig) fusion
protein.
DETAILED DESCRIPTION OF THE INVENTION
[0094] Identification of B7-Related Factors
[0095] In accordance with the methods of the present invention,
three B7-related factors, designated BSL1, BSL2, and BSL3, have
been identified and characterized. In addition, three distinct BSL2
splice variants have been identified, including BSL2-4616811
(BSL2vcvc), BSL2-L165-21 (BSL2v2c2), and BSL2-L165-35b (BSLv1c2).
These B7-related factors may provide a molecular basis for the
activation of immune or inflammatory response cells, such as
T-cells, at different times and in different illnesses and disease
states. In addition, the disclosed B7-related factors can be
utilized in the prevention or treatment certain diseases by
modulating the activity of immune or inflammatory response cells,
such as T-cells, using the methods described in detail herein.
These methods can be used as prophylaxis or treatments for cancers
or immune-related disorders as detailed below.
[0096] Notably, experiments described herein demonstrate that
BSL2-4616811-Ig (BSL2vcvc-Ig) fusion protein acts synergistically
with anti-BSL2 MAbs to inhibit T-cell proliferation. Accordingly,
compositions comprising BSL2-4616811-Ig (BSL2vcvc-Ig) fusion
protein may be used alone or in conjunction with compositions
comprising anti-BSL2 MAbs for treatments of various disorders,
including acute and chronic transplant rejection, rheumatoid
arthritis, multiple sclerosis, psoriasis, or other diseases
described in detail herein. In addition, such compositions can be
used individually or in combination for therapeutic applications
such as xenotransplantation.
[0097] Identification of B7-Related Genes from cDNA Libraries:
[0098] To identify B7-related factors, cDNA libraries can be
constructed and analyzed using several well-established techniques.
Messenger RNA can be obtained from cells expressing B7-1 and/or
B7-related factors. For example, mRNA can be obtained from
differentiated human peripheral blood mononuclear cells.
Alternatively, mRNA can be obtained from various subsets of
neoplastic B cells, including tumor cells isolated from patients
with non-Hodgkin's lymphoma (L. Chaperot et al. (1999) Exp.
Hematol. 27:479-88). Such cells are known to express B7-1 and,
thus, may express B7-related factors, and can also serve as a
source of the mRNA for construction of the cDNA library.
[0099] Total cellular mRNA can be isolated by a variety of
techniques, e.g., guanidinium-thiocyanate extraction (J. M.
Chirgwin et al. (1979) Biochemistry 18:5294-5299; Chomczynski et
al. (1987) Anal. Biochem. 162:156-9). Following isolation,
poly(A).sup.+ RNA can be purified using oligo(dT) cellulose. The
purified poly(A).sup.+ RNA can then be used as a template for cDNA
synthesis utilizing reverse transcriptase polymerase chain reaction
(RT-PCR; see C. R. Newton et al. (1997) PCR 2.sup.nd Ed, Scientific
Publishers, Oxford, England). Following reverse transcription, the
cDNA can be converted to double stranded DNA using conventional
techniques (see H. Okayama et al. (1982)Mol. Cell. Biol. 2:161; U.
Gubler et al. (1983) Gene 25:263).
[0100] Cloning of the double stranded cDNAs can be accomplished
using techniques that are well known in the art (see J. Sambrook et
al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring
Harbor Press, Plainview, N.Y.; F. M. Ausubel et al. (1989) Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
N.Y.). The use of synthetic adaptors prior to cloning is
particularly preferred, since it obviates the need for cleavage of
the cDNA with one or more restriction enzymes (see, for example, E.
C. Bottger (1989) Biotechniques 7:925-6, 928-90). Using this
method, non-self complementary, kinased adaptors can be added to
the DNA prior to ligation with the vector. Virtually any adaptor
can be employed.
[0101] A cDNA library sequence can be expressed when placed in the
sense orientation in a vector that supplies an appropriate
promoter. Vectors may also include an origin of replication and
various enhancer sequences, splice acceptor/donor sequences, and
polyadenylation sequences. Vectors may further include a marker
that allows for selection of cells containing the vector construct.
Markers may be an inducible or non-inducible gene and will
generally allow for positive selection under induction, or without
induction, respectively. Examples of marker genes include neomycin,
dihydrofolate reductase, glutamine synthetase, and the like.
Notably, prepared cDNA libraries can be obtained from various
commercial sources (e.g., Incyte Genomics, Inc., St. Louis, Mo.;
Stratagene, La Jolla, Calif.)
[0102] The cDNA library can be used to clone B7-related factors
utilizing expression cloning techniques (see B. Seed et al. (1987)
Proc. Natl. Acad. Sci. USA 84:3365-3369; A. Aruffo et al. (1987)
Proc. Natl. Acad. Sci. USA 84:8573-8577). In one embodiment,
plasmid DNA is introduced into a cell line by known methods of
transfection (e.g., DEAE-Dextran) and allowed to replicate and
express the cDNA inserts. B7-1 antigen is depleted from the
transfected cells using an anti-B7-1 monoclonal antibody (e.g., 133
and B.1.1) and anti-murine IgG and IgM coated immunomagnetic beads.
Transfectants expressing B7-related factors are positively selected
by incubation with CTLA-4-Ig and CD28-Ig followed by panning with
anti-human Ig immunoglobulin. After panning, episomal DNA is
recovered from the panned cells and transfected into a competent
bacterial host, preferably Escherichia coli (E. coli). Plasmid DNA
is subsequently reintroduced into the cell line and the cycle of
expression and panning repeated at least two times. Following the
final panning cycle, plasmid DNA is prepared from individual
colonies, transfected into the cell line and analyzed for
expression of the B7-related polypeptides by indirect
immunofluorescence with CTLA-4-Ig and CD28-Ig. After cloning,
plasmids are prepared from the clones strongly reactive with the
CTLA-4-Ig, and then sequenced using conventional sequencing
techniques (reviewed in G. W. Slater et al. (1998) Electrophoresis
19:1525-41).
[0103] Identification of B7-Related Genes in Protein Sequence
Databases:
[0104] Alternatively, B7-related factors can be identified by
screening available sequence databases. The polypeptide sequence
encoded by a previously identified B7 factor (e.g., B7-1, B7-2, or
B7-H1) or a B7-related factor disclosed herein (e.g., BSL1, BSL2,
or BSL3), can be compared with the polypeptide sequences present in
various protein databases. Publicly available protein sequence
databases, e.g., GenBank, GenPept, SWISS-PROT, Protein Data Bank
(PDB), Protein Information Resource (PIR), Human UniGene (National
Center for Biotechnology Information), can be used to determine if
additional B7-related factors are present in mammalian, preferably
human, species. Alternatively, privately owned protein sequence
databases, e.g., the Incyte Genomics sequence database (Incyte
Genomics), can be used to identify B7-related factors. Databases
with relatively few redundant sequences, e.g., PIR or SWISS-PROT
databases, can be used to improve the statistical significance of a
sequence match. However, databases which are more comprehensive and
up-to-date, e.g., GenBank, GenPept, and Incyte Genomics sequence
databases (Incyte Genomics), are preferred.
[0105] Any method known in the art can be used to align and compare
the previously identified B7 factor sequence with the sequences
present in the protein sequence databases. Preferably, the BLAST
program is used (S. F. Altschul et al. (1990) J. Mol. Biol.
215:403-410; S. Karlin et al. (1990) Proc. Natl. Acad. Sci. USA
87:2264-68; S. Karlin et al. (1993) Proc. Natl. Acad. Sci. USA
90:5873-7). BLAST identifies local alignments between the sequence
of the previously identified protein and the protein sequences in
the database, and predicts the probability of the local alignment
occurring by chance. Although the original BLAST programs utilized
ungapped local alignments, more recently developed BLAST programs
such as WU-BLAST2/BLAST v2.0 (S. F. Altschul et al. (1996) Methods
Enzymol. 266, 460-480) have been modified to incorporate gapped
local alignments similar to SSEARCH (T. F. Smith et al. (1981) J.
Mol. Biol. 147:195-197) and FASTA programs (W. R. Pearson (1990)
Methods Enzymol. 183:63-98). In addition,
position-specific-iterated BLAST (PSI-BLAST) programs have been
developed to identify weak but biologically relevant sequence
similarities (S. F. Altschul et al. (1997) Nucleic Acids Res.
25:3389-3402). Furthermore, pattern-hit-initiated BLAST (PHI-BLAST)
programs have been designed to identify specific patterns or
sequence motifs shared by distantly-related proteins (Z. Zhang et
al. (1998) Nucleic Acids Res. 26:3986-3990). Specialized BLAST
programs are also available for performing searches of human,
microbial, and malaria genome sequences, as well as searches for
vector, immunoglobulin, and predicted human consensus sequences
(National Center for Biotechnology Information (NCBI), Bethesda,
Md.).
[0106] Both FASTA and BLAST programs identify very short exact
sequence matches between the query sequence and the databases
sequences, analyze the best short sequence matches ("hits") to
determine if longer stretches of sequence similarity are present,
and then optimize the best hits by dynamic programming (S. F.
Altschul et al. (1990) J. Mol. Biol. 215:403-410; W. R. Pearson,
supra). In contrast, the SSEARCH program compares the query
sequence to all the sequences in the database via pair-wise
sequence comparisons (T. F. Smith et al., supra). Thus, the SSEARCH
program is considered more sensitive than the BLAST and FASTA
programs, but it is also significantly slower. The BLAST and FASTA
programs utilize several approximations to increase their searching
speed, and utilize statistical parameters (see below) to increase
sensitivity and selectivity to approximate the performance of the
SSEARCH program. A particular sequence alignment program can be
chosen based on the requirements of a sequence search, or
individual preferences. In some cases, it may be necessary to use
more than one search alignment program to confirm search alignment
results or resolve ambiguous search results.
[0107] Typically, BLAST analysis employs (i) a scoring matrix (such
as, e.g., BLOSSUM 62 or PAM 120) to assign a weighted homology
value to each residue and (ii) a filtering program(s) (such as SEG
or XNU) that recognizes and eliminates highly repeated sequences
from the calculation. An appropriate homology cutoff is then
determined by performing BLAST comparisons (using a particular
scoring matrix and filtering program) between sequences that are
known to be related. It will be understood that other appropriate
scoring matrices and filtering programs may be used when the cutoff
is calibrated as described herein. That is, the particular cutoff
point may vary when different standard parameters are used, but it
will correspond to the P(N) scores exhibited when highly related
sequences are compared using those particular parameters.
[0108] B7-Related Nucleic Acids
[0109] One aspect of the present invention pertains to isolated
nucleic acids having a nucleotide sequence such as BSL1 (e.g., SEQ
ID NO:1 or 3), BSL2 (e.g., SEQ ID NO:6, 10,12, or 131), or BSL3
(e.g., SEQ ID NO:14), or fragments thereof. The nucleic acid
molecules of the invention can be DNA or RNA. A preferred nucleic
acid is a DNA encoding the human BSL1 (e.g., SEQ ID NO:2), BSL2
(e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15), or
fragments or functional equivalents thereof. Such nucleic acids can
comprise at least 15, 20, 25, 50, 60, 100, 200, 240, 255, 270, 300,
305, 310, 410, 500, 619, 630, 700, or 1000 contiguous
nucleotides.
[0110] The term "isolated" as used throughout this application
refers to a B7-related nucleic acid, polypeptide, peptide, protein
fusion, or antibody, that is substantially free of cellular
material or culture medium. An isolated or substantially purified
molecule contains less than about 50%, preferably less than about
25%, and most preferably less than about 10%, of the cellular
components with which it was associated.
[0111] The term "functional equivalent" is intended to include
nucleotide sequences encoding functionally equivalent B7-related
factors. A functional equivalent of a B7-related protein includes
fragments or variants that perform at least one characteristic
function of the B7-related protein (e.g., ligand-binding,
antigenic, intra-, or intercellular activity). For example, DNA
sequence polymorphisms within the nucleotide sequence of a
B7-related factor, especially those within the third base of a
codon, may result in "silent" mutations, which do not affect the
encoded amino acid sequence of the protein due to the degeneracy of
the genetic code.
[0112] In one embodiment, the present invention encompasses a
polynucleotide comprising the start codon and the remaining coding
sequence of BSL2-4616811 (BSL2vcvc). Specifically, the invention
encompasses a polynucleotide comprising nucleotides 1 through 1602
of SEQ ID NO:131. The invention also encompasses a polynucleotide
comprising nucleotides 121 through 1722 of SEQ ID NO:6, and the
corresponding polypeptide comprising amino acids 1 through 534 of
SEQ ID NO:7. Also encompassed are vectors comprising these
polynucleotides, and host cells comprising these vectors.
[0113] In another embodiment, the present invention embraces a
polynucleotide lacking the initiating start codon, but including
the remaining coding sequence of BSL2-4616811 (BSL2vcvc).
Specifically, the invention embraces a polynucleotide comprising
nucleotides 4 through 1602 of SEQ ID NO:131. In addition, the
invention embraces a polynucleotide comprising nucleotides 124
through 1722 of SEQ ID NO:6, and the polypeptide corresponding to
amino acids 2 through 534 of SEQ ID NO:7. Also embraced are vectors
comprising these polynucleotides, and host cells comprising these
vectors.
[0114] The present invention also encompasses a polynucleotide
comprising the start codon and the remaining coding sequence of
BSL2-L165-35b (BSL2v1 c2). Specifically, the invention encompasses
a polynucleotide comprising nucleotides 1 through 948 of SEQ ID
NO:12. The invention further encompasses a corresponding
polypeptide comprising amino acids 1 through 316 of SEQ ID NO:13.
Also encompassed are vectors comprising these polynucleotides, and
host cells comprising these vectors.
[0115] The present invention also embraces a polynucleotide lacking
the initiating start codon, but including the remaining coding
sequence of BSL2-L165-35b (BSL2v1c2). Specifically, the invention
embraces a polynucleotide comprising nucleotides 4 through 948 of
SEQ ID NO:12. In addition, the invention embraces a polypeptide
corresponding to amino acids 2 through 316 of SEQ ID NO:13. Also
embraced are vectors comprising these polynucleotides, and host
cells comprising these vectors.
[0116] The invention further encompasses a polynucleotide
comprising the start codon and the remaining coding sequence of
BSL2-L165-21 (BSL2v2c2). Specifically, the invention encompasses a
polynucleotide comprising nucleotides 1 through 948 of SEQ ID
NO:10. The invention further encompasses a corresponding
polypeptide comprising amino acids 1 through 316 of SEQ ID NO:11.
Also encompassed are vectors comprising these polynucleotides, and
host cells comprising these vectors.
[0117] The present invention further embraces a polynucleotide
lacking the initiating start codon, but including the remaining
coding sequence of BSL2-L165-21 (BSL2v2c2). Specifically, the
invention embraces a polynucleotide comprising nucleotides 4
through 948 of SEQ ID NO:10. In addition, the invention embraces a
polypeptide corresponding to amino acids 2 through 316 of SEQ ID
NO:11. Also embraced are vectors comprising these polynucleotides,
and host cells comprising these vectors.
[0118] Preferred embodiments include an isolated nucleic acid
sharing at least 60, 70, 80, 85, 90, 95, 97, 98, 99, 99.5, or 100%
sequence identity with a polynucleotide sequence of BSL1 (e.g., SEQ
ID NO:1 or 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or 131), or BSL3
(e.g., SEQ ID NO:15). This polynucleotide sequence may be identical
to the nucleotide sequence of BSL1 (e.g., SEQ ID NO:1 and 3), BSL2
(e.g., SEQ ID NO:6, 10, 12, or 131), or BSL3 (e.g., SEQ ID NO:14),
or may include up to a certain integer number of nucleotide
alterations as compared to the reference sequence.
[0119] "Identity," as known in the art, is a relationship between
two or more polypeptide sequences or two or more polynucleotide
sequences, as determined by comparing the sequences. In the art,
"identity" also means the degree of sequence relatedness between
polypeptide or polynucleotide sequences, as the case may be, as
determined by the match between strings of such sequences.
"Identity" and "similarity" can be readily calculated by known
methods, including but not limited to those described in
(Computational Molecular Biology, Lesk, A. M., ed., Oxford
University Press, New York, 1988; Biocomputing. Informatics and
Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993;
Computer Analysis of Sequence Data, Part I, Griffin, A. M., and
Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence
Analysis in Molecular Biology, von Heinje, G., Academic Press,
1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J.,
eds., M Stockton Press, New York, 1991; and Carillo, H., and
Lipman, D. (1988) SIAM J. Applied Math., 48:1073.
[0120] For nucleic acids, sequence identity can be determined by
comparing a query sequences to sequences in publicly available
sequence databases (NCBI) using the BLASTN2 algorithm (S. F.
Altschul et al. (1997) Nucl. Acids Res., 25:3389-3402). The
parameters for a typical search are: E=0.05, v=50, B=50, wherein E
is the expected probability score cutoff, V is the number of
database entries returned in the reporting of the results, and B is
the number of sequence alignments returned in the reporting of the
results (S. F. Altschul et al. (1990) J. Mol. Biol.,
215:403-410).
[0121] In another approach, nucleotide sequence identity can be
calculated using the following equation: % identity=(number of
identical nucleotides)/(alignment length in nucleotides) * 100. For
this calculation, alignment length includes internal gaps but not
terminal gaps. Alternatively, nucleotide sequence identity can be
determined experimentally using the specific hybridization
conditions described below.
[0122] In accordance with the present invention, nucleic acid
alterations are selected from the group consisting of at least one
nucleotide deletion, substitution, including transition and
transversion, insertion, or modification (e.g., via RNA or DNA
analogs, dephosphorylation, methylation, or labeling). Alterations
may occur at the 5' or 3' terminal positions of the reference
nucleotide sequence or anywhere between those terminal positions,
interspersed either individually among the nucleotides in the
reference sequence or in one or more contiguous groups within the
reference sequence. Alterations of a nucleic acid sequence of BSL1
(e.g., SEQ ID NO:1 and 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or
131), or BSL3 (e.g., SEQ ID NO:14) may create nonsense, missense,
or frameshift mutations in the coding sequence, and thereby alter
the polypeptide encoded by the nucleic acid.
[0123] Also encompassed by the present invention are splice
variants derived from the BSL1 (e.g., SEQ ID NO:1 and 3), BSL2
(e.g., SEQ ID NO:6, 10, 12, or 131), or BSL3 (e.g., SEQ ID NO:14)
nucleic acid sequences. As used herein, the term "splice variant"
refers to variant B7-related nucleic acids and polypeptides
produced by differential processing of the primary transcript(s) of
genomic DNA. An alternate splice variant may comprise, for example,
any one of the sequences of BSL2 (e.g., SEQ ID NO:6, 10, 12, or
131) disclosed herein. Alternate splice variants can also comprise
other combinations of introns/exons of BSL1, BSL2, or BSL3, which
can be determined by those of skill in the art. Alternate splice
variants can be determined experimentally, for example, by
isolating and analyzing cellular RNAs (e.g., Southern blotting or
PCR), or by screening cDNA libraries using the B7-related nucleic
acid probes or primers described herein. In another approach,
alternate splice variants can be predicted using various methods,
computer programs, or computer systems available to practitioners
in the field.
[0124] General methods for splice site prediction can be found in
Nakata (1985) Nucleic Acids Res. 13:5327-5340. In addition, splice
sites can be predicted using, for example, the GRAIL.TM. (E. C.
Uberbacher and R. J. Mural (1991) Proc. Natl. Acad. Sci. USA,
88:11261-11265; E. C. Uberbacher (1995) Trends Biotech.,
13:497-500; GenView (L. Milanesi et al. (1993) Proceedings of the
Second International Conference on Bioinformatics, Supercomputing,
and Complex Genome Analysis, H. A. Lim et al. (eds), World
Scientific Publishing, Singapore, pp. 573-588; SpliceView; and HSPL
(V. V. Solovyev et al. (1994) Nucleic Acids Res. 22:5156-5163; V.
V. Solovyev et al. (1994) "The Prediction of Human Exons by
Oligonucleotide Composition and Discriminant Analysis of Spliceable
Open Reading Frames," R. Altman et al. (eds), The Second
International conference on Intelligent systems for Molecular
Biology, AAAI Press, Menlo Park, Calif., pp. 354-362; V. V.
Solovyev et al. (1993) "Identification Of Human Gene Functional
Regions Based On Oligonucleotide Composition," L. Hunter et al.
(eds), In Proceedings of First International conference on
Intelligent System for Molecular Biology, Bethesda, pp. 371-379)
computer systems.
[0125] Additionally, computer programs such as GeneParser (E. E.
Snyder and G. D. Stormo (1995) J. Mol. Biol. 248: 1-18; E. E.
Snyder and G. D. Stormo (1993) Nucl. Acids Res. 21(3): 607-613;
MZEF (M. Q. Zhang (1997) Proc. Nat. Acad. Sci. USA, 94:565-568;
MORGAN (S. Salzberg et al. (1998) J. Comp. Biol. 5:667-680; S.
Salzberg et al., eds. (1998) Computational Methods in Molecular
Biology, Elsevier Science, New York, N.Y., pp. 187-203); VEIL (J.
Henderson et al. (1997) J. Comp. Biol. 4:127-141); GeneScan (S.
Tiwari et al. (1997) CABIOS (Biolnformatics) 13: 263-270);
GeneBuilder (L. Milanesi et al. (1999) Bioinformatics 15:612-621);
Eukaryotic GeneMark (J. Besemer et al. (1999) Nucl. Acids Res.
27:3911-3920); and FEXH (V. V. Solovyev et al. (1994) Nucl. Acids
Res. 22:5156-5163) can be used. In addition, splice sites (i.e.,
former or potential splice sites) in cDNA sequences can be
predicted using, for example, the RNASPL (V. V. Solovyev et al.
(1994) Nucl. Acids Res. 22:5156-5163); or INTRON (A. Globek et al.
(1991) INTRON version 1.1 manual, Laboratory of Biochemical
Genetics, NIMH, Washington, D.C.) programs.
[0126] The present invention also encompasses naturally-occurring
polymorphisms of BSL1 (e.g., SEQ ID NO:1 and 3), BSL2 (e.g., SEQ ID
NO:6, 10,12, or 131), or BSL3 (e.g., SEQ ID NO:14). As will be
understood by those in the art, the genomes of all organisms
undergo spontaneous mutation in the course of their continuing
evolution generating variant forms of gene sequences (Gusella
(1986) Ann. Rev. Biochem. 55:831-854). Restriction fragment length
polymorphisms (RFLPs) include variations in DNA sequences that
alter the length of a restriction fragment in the sequence
(Botstein et al. (1980) Am. J. Hum. Genet. 32, 314-331. RFLPs have
been widely used in human and animal genetic analyses (see WO
90/13668; WO 90/11369; Donis-Keller (1987) Cell 51:319-337; Lander
et al. (1989) Genetics 121: 85-99). Short tandem repeats (STRs)
include tandem di-, tri- and tetranucleotide repeated motifs, also
termed variable number tandem repeat (VNTR) polymorphisms. VNTRs
have been used in identity and paternity analysis (U.S. Pat. No.
5,075,217; Armour et al. (1992) FEBS Lett. 307:113-115; Horn et
al., WO 91/14003; Jeffreys, EP 370,719), and in a large number of
genetic mapping studies.
[0127] Single nucleotide polymorphisms (SNPs) are far more frequent
than RFLPS, STRs, and VNTRs. SNPs may occur in protein coding
(e.g., exon), or non-coding (e.g., intron, 5'UTR, 3'UTR) sequences.
SNPs in protein coding regions may comprise silent mutations that
do not alter the amino acid sequence of a protein. Alternatively,
SNPs in protein coding regions may produce conservative or
non-conservative amino acid changes, described in detail below. In
some cases, SNPs may give rise to the expression of a defective or
other variant protein and, potentially, a genetic disease. SNPs
within protein-coding sequences can give rise to genetic diseases,
for example, in the .beta.-globin (sickle cell anemia) and CFTR
(cystic fibrosis) genes. In non-coding sequences, SNPs may also
result in defective protein expression (e.g., as a result of
defective splicing). Other single nucleotide polymorphisms have no
phenotypic effects.
[0128] Single nucleotide polymorphisms can be used in the same
manner as RFLPs and VNTRs, but offer several advantages. Single
nucleotide polymorphisms tend to occur with greater frequency and
are typically spaced more uniformly throughout the genome than
other polymorphisms. Also, different SNPs are often easier to
distinguish than other types of polymorphisms (e.g., by use of
assays employing allele-specific hybridization probes or primers).
In one embodiment of the present invention, a BSL1 (e.g., SEQ ID
NO:1 and 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or 131), or BSL3
(e.g., SEQ ID NO:14) nucleic acid contains at least one SNP.
Various combinations of these SNPs are also encompassed by the
invention. In a preferred aspect, a B7-related SNP is associated
with a immune system disorder, such as the disorders described in
detail herein.
[0129] Further encompassed by the present invention are nucleic
acid molecules that share moderate homology with the BSL1 (e.g.,
SEQ ID NO:1 and 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or 131), or
BSL3 (e.g., SEQ ID NO:14) nucleic acid sequences, and hybridize to
the BSL1, BSL2, or BSL3 nucleic acid molecules under moderate
stringency hybridization conditions. More preferred are nucleic
acid molecules that share substantial homology with the BSL1, BSL2,
or BSL3 nucleic acid sequences and hybridize to the BSL1, BSL2, or
BSL3 nucleic acid molecules under high stringency hybridization
conditions. As used herein, the phrase "moderate homology" refers
to sequences which share at least 60% sequence identity with a
reference sequence (e.g., BSL1, BSL2 or BSL3), whereas the phrase
"substantial homology" refers to sequences that share at least 90%
sequence identity with a reference sequence. It is recognized,
however, that polypeptides and the nucleic acids encoding such
polypeptides containing less than the above-described level of
homology arising as splice variants or that are modified by
conservative amino acid substitutions (or substitution of
degenerate codons) are contemplated to be within the scope of the
present invention.
[0130] The phrase "hybridization conditions" is used herein to
refer to conditions under which a double-stranded nucleic acid
hybrid is formed from two single nucleic acid strands, and remains
stable. As known to those of skill in the art, the stability of the
hybrid sequence is reflected in the melting temperature (T.sub.m)
of the hybrid (see F. M. Ausubel et al., Eds, (1995) Current
Protocols in Molecular Biology, John Wiley and Sons, Inc., New
York, N.Y.). The T.sub.m decreases approximately 0.5.degree. C. to
1.5.degree. C. with every 1% decrease in sequence homology. In
general, the stability of a hybrid sequence is a function of the
length and guanine/cytosine content of the hybrid, the sodium ion
concentration, and the incubation temperature. Typically, the
hybridization reaction is initially performed under conditions of
low stringency, followed by washes of varying, but higher,
stringency. Reference to hybridization stringency relates to such
washing conditions.
[0131] In accordance with the present invention, "high stringency"
conditions can be provided, for example, by hybridization in 50%
formamide, 5.times. Denhardt's solution, 5.times. SSPE, and 0.2%
SDS at 42.degree. C., followed by washing in 0.1.times. SSPE and
0.1% SDS at 65.degree. C. By comparison, "moderate stringency" can
be provided, for example, by hybridization in 50% formamide,
5.times. Denhardt's solution, 5.times. SSPE, and 0.2% SDS at
42.degree. C., followed by washing in 0.2.times. SSPE and 0.2% SDS
at 65.degree. C. In addition, "low stringency" conditions can be
provided, for example, by hybridization in 10% formamide, 5.times.
Denhardt's solution, 6.times. SSPE, and 0.2% SDS at 42.degree. C.,
followed by washing in 1.times. SSPE and 0.2% SDS at 50.degree. C.
It is understood that these conditions may be varied using a
variety of buffers and temperatures well known to those skilled in
the art.
[0132] In a preferred embodiment of the present invention, the
nucleic acid is a DNA molecule encoding at least a portion of the
B7-related factor. A nucleic acid molecule encoding a novel
B7-related factor can be obtained from mRNA present in activated B
lymphocytes. It may also be possible to obtain nucleic acid
molecules encoding B7-related factors from B cell genomic DNA.
Thus, a nucleic acid encoding a B7-related factor can be cloned
from either a cDNA or a genomic library in accordance with the
protocols described in detail herein. Nucleic acids encoding novel
B7-related factors can also be cloned from genomic DNA or cDNA
using established polymerase chain reaction (PCR) techniques (see
K. Mullis et al. (1986) Cold Spring Harbor Symp. Quant. Biol.
51:260; K. H. Roux (1995) PCR Methods Appl. 4:S185) in accordance
with the nucleic acid sequence information provided herein. The
nucleic acid molecules of the invention, or fragments thereof, can
also be chemically synthesized using standard techniques. Various
methods of chemically synthesizing polydeoxynucleotides are known,
including solid-phase synthesis which, like peptide synthesis, has
been fully automated in commercially available DNA synthesizers
(see, for example, U.S. Pat. No. 4,598,049 to Itakura et al.; U.S.
Pat. No. 4,458,066 to Caruthers et al.; U.S. Pat. Nos. 4,401,796
and 4,373,071 to Itakura).
[0133] It will be appreciated by one skilled in the art that
variations in one or more nucleotides (up to about 3-4% of the
nucleotides) of the nucleic acid molecules encoding novel
B7-related factors may exist among individuals within a population
due to natural allelic variation. Any and all such nucleotide
variations and resulting amino acid polymorphisms are within the
scope of the invention. Furthermore, there may be one or more
isoforms or related, cross-reacting family members of the
B7-related factors described herein. Such isoforms or family
members are defined as polypeptides that are related in function
and amino acid sequence to a B7-related factor (e.g., BSL1, BSL2,
or BSL3), but encoded by genes at different loci. In addition, it
is possible to modify the DNA sequence of B7-related factors using
genetic techniques to produce proteins or peptides with altered
amino acid sequences.
[0134] DNA sequence mutations can be introduced into a nucleic acid
encoding a B7-related factor by any one of a number of methods,
including those for producing simple deletions or insertions,
systematic deletions, insertions or substitutions of clusters of
bases or substitutions of single bases, to generate desired
variants. Mutations of the B7-related nucleic acid molecule to
generate amino acid substitutions or deletions are preferably
obtained by site-directed mutagenesis. Site directed mutagenesis
systems are well known in the art, and can be obtained from
commercial sources (see, for example, Amersham Pharmacia Biotech,
Inc., Piscataway, N.J.). Guidance in determining which amino acid
residues may be substituted, inserted, or deleted without
abolishing biological or immunological activity may be found using
computer programs well known in the art, for example, DNASTAR
software (DNASTAR, Inc., Madison, Wis.). Mutant forms of the BSL1
(e.g., SEQ ID NO:1 and 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or
131), or BSL3 (e.g., SEQ ID NO:14) nucleic acid molecules are
considered within the scope of the present invention, where the
expressed polypeptide or peptide is capable modulating the activity
and/or proliferation of immune or inflammatory cells (e.g.,
T-cells).
[0135] A fragment of the nucleic acid molecule encoding a novel
B7-related factor is defined as a nucleotide sequence having fewer
nucleotides than the nucleotide sequence encoding the entire amino
acid sequence of the B7-related factor. Nucleic acid fragments
which encode polypeptides which retain the ability to bind to their
natural ligand(s) on immune or inflammatory response cells, such as
T-cells, and either amplify or block immune responses (as evidenced
by, for example, lymphokine production and/or T-cell proliferation
by T-cells that have received a primary activation signal) are
considered within the scope of the invention. For example, nucleic
acid fragments that encode polypeptides or peptides of a B7-related
factor that retain the ability of the polypeptides or peptides to
bind CD28/CTLA-4 and/or CD28-/CTLA-4-related ligand(s) and deliver
a modulatory (e.g., co-stimulatory or inhibitory) signal to T-cells
are within the scope of the invention. Generally, the nucleic acid
molecule encoding a fragment of a B7-related factor will be
selected from the coding sequence for the mature protein. However,
in some instances it may be desirable to select all or part of a
fragment or fragments from the coding region that includes the
leader sequence.
[0136] In one embodiment of the present invention, a nucleic acid
molecule corresponding to a fragment of a BSL1 (e.g., SEQ ID NO:1
or 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or 131), or BSL3 (e.g., SEQ
ID NO:14) nucleic acid sequence can be used as a probe for assaying
a biological sample for the expression of one or more B7-related
factors, or as a primer for DNA sequencing or PCR amplification.
Preferably, such fragments are at least 8 contiguous nucleotides in
length, more preferably at least 12 contiguous nucleotides in
length, even more preferably at least 15 contiguous nucleotides in
length, and even more preferably at least 20 contiguous nucleotides
in length. Nucleic acid molecules within the scope of the invention
may also contain linker sequences, modified restriction
endonuclease sites, and other sequences useful for molecular
cloning, expression, or purification of recombinant protein or
fragments thereof. Nucleic acid molecules in accordance with the
present invention may also be conjugated with radioisotopes, or
chemiluminescent, fluorescent, or other labeling compounds (e.g.,
digoxigenin). In addition, the nucleic acid molecules of the
present invention may be modified by nucleic acid modifying
enzymes, for example, kinases or phosphatases. These and other
modifications of nucleic acid molecules are well known in the
art.
[0137] In addition, a nucleic acid molecule that encodes a
B7-related factor, or a biologically active fragment thereof, can
be ligated to a heterologous sequence to encode a fusion protein
(also called a chimeric protein). For example, it may be useful to
construct a nucleic acid encoding a fusion protein comprising a
B7-related factor and the Fc domain of human IgG1 as described
herein. In a preferred embodiment, the immunoglobulin sequences
used in construction of the BSL1, BSL2, or BSL3 immunofusion
proteins of the present innovation are obtained from an IgG1
immunoglobulin heavy chain domain. The resulting BSL1-Ig (e.g., SEQ
ID NO:4), BSL2-Ig, (e.g., SEQ ID NO:8, SEQ ID NO:132, or SEQ
NO:134), and BSL3-Ig (e.g., SEQ ID NO:17) fusion constructs can
then be expressed in host cells, and used to prepare pharmaceutical
compositions useful for immunomodulation (see below). Fusion
proteins comprising B7-related polypeptides can also be used for
the isolation and purification of B7-related polypeptides or
antibodies (see below). In addition, fusion proteins can be used to
identify cellular ligands or binding partners for BSL1, BSL2, or
BSL3 (see below).
[0138] In one aspect, polynucleotides encoding 1) a natural or
heterologous signal sequence (ss); 2) a B7-related polypeptide
(e.g., BSL1, BSL2, or BSL3) that lacks a signal sequence; and 3) an
Fc domain can be cloned serially to produce a fusion protein that
can be depicted as ss-BSL1-Ig, ss-BSL2-Ig, ss-BSL3-Ig. Alternately,
polynucleotides encoding 1) a natural or heterologous signal
sequence (ss); 2) an Fc domain; and 3) a B7-related polypeptide
(e.g., BSL1, BSL2, or BSL3) that lacks a signal sequence can be
cloned serially to produce a fusion protein that can be depicted as
ss-Ig-BSL1, ss-Ig-BSL2, ss-Ig-BSL3. Thus, B7-related polypeptide
for this invention may be fused to the C-terminus or N-terminus of
the Fc domain. In addition, the polynucleotide sequence may encode
a proteolytic cleavage site positioned between the B7-related
polypeptide and the Fc domain, which can be used to separate the
B7-related polypeptide from the Fc domain. Notably, a major
advantage of using IgG1 for protein fusions is that IgG1
immunofusions can be purified efficiently on immoblized protein A.
However, other structural and functional properties may be
considered when choosing the Ig fusion partner for a particular
immunofusion construction.
[0139] B7-Related Nucleic Acid Expression Vectors
[0140] Another aspect of the present invention pertains to
expression vectors comprising a nucleic acid encoding at least one
B7-related factor, as described herein, operably linked to at least
one regulatory sequence. "Operably linked" is intended to mean that
the nucleotide acid sequence is linked to a regulatory sequence in
a manner that allows expression of the nucleotide sequence.
Regulatory sequences are known in the art and are selected to
direct expression of the desired protein in an appropriate host
cell. Accordingly, the term regulatory sequence includes promoters,
enhancers and other expression control elements (see D. V. Goeddel
(1990) Methods Enzymol. 185:3-7). It should be understood that the
design of the expression vector may depend on such factors as the
choice of the host cell to be transfected and/or the type of
polypeptide desired to be expressed.
[0141] Appropriate host cells for use with the present invention
include bacteria, fungi, yeast, plant, insect, and animal cells,
especially mammalian and human cells. Preferred replication and
inheritance systems include M13, ColE1, SV40, baculovirus, lambda,
adenovirus, CEN ARS, 2 .mu.m ARS and the like. Several regulatory
elements (e.g., promoters) have been isolated and shown to be
effective in the transcription and translation of heterologous
proteins in the various hosts. Such regulatory regions, methods of
isolation, manner of manipulation, etc. are known in the art.
Non-limiting examples of bacterial promoters include the
.beta.-lactamase (penicillinase) promoter; lactose promoter;
tryptophan (trp) promoter; araBAD (arabinose) operon promoter;
lambda-derived P.sub.1 promoter and N gene ribosome binding site;
and the hybrid tac promoter derived from sequences of the trp and
lac UV5 promoters. Non-limiting examples of yeast promoters include
the 3-phosphoglycerate kinase promoter, glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) promoter, galactokinase (GAL1) promoter,
galactoepimerase promoter, and alcohol dehydrogenase (ADH1)
promoter. Suitable promoters for mammalian cells include, without
limitation, viral promoters, such as those from Simian Virus 40
(SV40), Rous sarcoma virus (RSV), adenovirus (ADV), and bovine
papilloma virus (BPV).
[0142] Eukaryotic cells may also require terminator sequences,
polyadenylation sequences, and enhancer sequences that modulate
gene expression. Sequences that cause amplification of the gene may
also be desirable. These sequences are Well known in the art.
Furthermore, sequences that facilitate secretion of the recombinant
product from cells, including, but not limited to, bacteria, yeast,
and animal cells, such as secretory signal sequences and/or
preprotein or proprotein sequences, may also be included. Such
sequences are well described in the art.
[0143] Suitable expression vectors include, but are not limited to,
pUC, pBluescript (Stratagene), pET (Novagen, Inc., Madison, Wis.),
and pREP (Invitrogen) plasmids. Vectors can contain one or more
replication and inheritance systems for cloning or expression, one
or more markers for selection in the host, e.g. antibiotic
resistance, and one or more expression cassettes. The inserted
coding sequences can be synthesized by standard methods, isolated
from natural sources, or prepared as hybrids. Ligation of the
coding sequences to transcriptional regulatory elements (e.g.,
promoters, enhancers, and/or insulators) and/or to other amino acid
encoding sequences can be carried out using established
methods.
[0144] In one embodiment, the expression vector comprises a nucleic
acid encoding at least a portion of the BSL1, BSL2, or BSL3
polypeptide. In another embodiment, the expression vector comprises
a DNA sequence encoding the B7-related factor and a DNA sequence
encoding another B7-related factor or a heterologous polypeptide or
peptide. Such expression vectors can be used to transfect host
cells to thereby produce polypeptides or peptides, including fusion
proteins or peptides encoded by nucleic acid molecules as described
below.
[0145] Isolation of B7-Related Polypeptides
[0146] Yet another aspect of the present invention pertains to
methods of isolating B7-related polypeptides and related peptides.
As used herein, the terms "protein" and "polypeptide" are
synonymous. Peptides are defined as fragments or portions of
proteins or polypeptides, preferably fragments or portions having
the same or equivalent function or activity as the complete
protein. Both naturally occurring and recombinant forms of the
B7-related polypeptides or peptides may be used in assays and
treatments according to the present invention. Methods for directly
isolating and purifying polypeptides or peptides from natural
sources such as cellular or extracellular lysates are well known in
the art (see E. L. V. Harris and S. Angal, Eds. (1989) Protein
Purification Methods: A Practical Approach, IRL Press, Oxford,
England). Such methods include, without limitation, preparative
disc-gel electrophoresis, isoelectric focusing, high-performance
liquid chromatography (HPLC), reversed-phase HPLC, gel filtration,
ion exchange and partition chromatography, and countercurrent
distribution, and combinations thereof. Naturally occurring
polypeptides can be purified from many possible sources, for
example, plasma, body cells and tissues, or body fluids.
[0147] To produce recombinant B7-related polypeptides or peptides,
DNA sequences encoding the B7-related polypeptides or peptides are
cloned into a suitable vector for expression in intact host cells
or in cell-free translation systems (see J. Sambrook et al.,
supra). Prokaryotic and eukaryotic vectors and host cells may be
employed. The particular choice of a vector, host cell, or
translation system is not critical to the practice of the
invention. DNA sequences can be optimized, if desired, for more
efficient expression in a given host organism. For example, codons
can be altered to conform to the preferred codon usage in a given
host cell or cell-free translation system using techniques
routinely practiced in the art.
[0148] For some purposes, it may be preferable to produce peptides
or polypeptides in a recombinant system wherein the peptides or
polypeptides carry additional sequence tags to facilitate
purification. Such markers include epitope tags and protein tags.
Non-limiting examples of epitope tags include c-myc, haemagglutinin
(HA), polyhistidine (6.times.-HIS; SEQ ID NO:93), GLU-GLU, and
DYKDDDDK (FLAG.RTM.; SEQ ID NO:94) epitope tags. Epitope tags can
be added to peptides by a number of established methods. DNA
sequences of epitope tags can be inserted as oligonucleotides or
through primers used in PCR amplification into or adjacent to a
coding sequence of interest. As an alternative, a coding sequence
of interest can be cloned into specific vectors that create fusions
with epitope tags; for example, pRSET vectors (Invitrogen Corp.,
San Diego, Calif.). Non-limiting examples of protein tags include
glutathione-S-transferase (GST), green fluorescent protein (GFP),
and maltose binding protein (MBP). Protein tags are attached to
peptides or polypeptides by several well-known methods. In one
approach, the coding sequence of a polypeptide or peptide can be
cloned into a vector that creates a fusion between the polypeptide
or peptide and a protein tag of interest. Suitable vectors include,
without limitation, the exemplary plasmids, pGEX (Amersham
Pharmacia Biotech, Inc., Piscataway, N.J.), pEGFP (CLONTECH
Laboratories, Inc., Palo Alto, Calif.), and PMAL.TM. (New England
BioLabs, Inc., Beverly, Mass.). Following expression, the epitope
or protein tagged polypeptide or peptide can be purified from a
crude lysate of the translation system or host cell by
chromatography on an appropriate solid-phase matrix. In some cases,
it may be preferable to remove the epitope or protein tag (i.e.,
via protease cleavage) following purification.
[0149] Suitable cell-free expression systems for use in accordance
with the present invention include rabbit reticulocyte lysate,
wheat germ extract, canine pancreatic microsomal membranes, E. coli
S30 extract, and coupled transcription/translation systems (Promega
Corp., Madison, Wis.). These systems allow the expression of
recombinant polypeptides or peptides upon the addition of cloning
vectors, DNA fragments, or RNA sequences containing coding regions
and appropriate promoter elements.
[0150] Host cells for recombinant cloning vectors include
bacterial, archebacterial, fungal, plant, insect and animal cells,
especially mammalian cells. Of particular interest are E. coli, B.
subtilis, S. aureus, S. cerevisiae, S. pombe, N. crassa, SF9, C129,
293, NIH 3T3, CHO, COS, and HeLa cells. Such cells can be
transformed, transfected, or transduced, as appropriate, by any
suitable method including electroporation, CaCl.sub.2--, LiCl--,
LiAc/PEG-, spheroplasting-, Ca-Phosphate, DEAE-dextran,
liposome-mediated DNA uptake, injection, microinjection,
microprojectile bombardment, or other established methods.
[0151] In order to identify host cells that contain the expression
vector, a gene that contains a selectable marker is generally
introduced into the host cells along with the gene of interest.
Preferred selectable markers include those that confer resistance
to drugs, such as G418, hygromycin, methotrexate, or ampicillin.
Selectable markers can be introduced on the same plasmid as the
gene of interest. Host cells containing the gene of interest are
identified by drug selection, as cells that carry the
drug-resistance marker survive in growth media containing the
corresponding drug.
[0152] The surviving cells can be screened for production of
recombinant B7-related polypeptides, or peptides or fusions
thereof. In one embodiment, the recombinant polypeptides are
secreted to the cell surface, and can be identified by cell surface
staining with ligands to the B cell antigens (e.g., CD28-Ig). In
another embodiment, the recombinant polypeptides are retained in
the cytoplasm of the host cells, and can be identified in cell
extracts using anti-B7-related polypeptide antibodies. In yet
another embodiment, soluble recombinant polypeptides are secreted
into the growth media, and can be identified by screening the
growth media with anti-B7-related polypeptide antibodies. A
soluble, secreted recombinant B7-polypeptide includes the
extracellular domain of the polypeptide, or any fragment thereof,
that does not include the cytoplasmic and/or transmembrane regions.
The cell-surface and cytoplasmic recombinant B7-related
polypeptides can be isolated following cell lysis and extraction of
cellular proteins, while the secreted recombinant B7-related
polypeptides can be isolated from the cell growth media by standard
techniques (see I. M. Rosenberg, Ed. (1996) Protein Analysis and
Purification: Benchtop Techniques, Birkhauser, Boston, Cambridge,
Mass.).
[0153] Antibody-based methods can used to purify natural or
recombinantly produced B7-related polypeptides or peptides.
Antibodies that recognize these polypeptides, or peptides derived
therefrom, can be produced and isolated using methods known and
practiced in the art (see below). B7-related polypeptides or
peptides can then be purified from a crude lysate by chromatography
on antibody-conjugated solid-phase matrices (see E. Harlow and D.
Lane (1999) Using Antibodies: A Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.). Other purification
methods known and used in the art may also be employed.
[0154] It is noted that transfected host cells that express
B7-related factors (e.g., BSL1, BSL2, and/or BSL3) or portions
thereof on the surface of the cell are within the scope of this
invention. For example, a tumor cell such as a sarcoma, melanoma,
leukemia, lymphoma, carcinoma, or neuroblastoma can be transfected
with an expression vector directing the expression of at least one
B7-related factor on the surface of the tumor cell. Such
transfected tumor cells can be used to treat tumor immunity as
described in detail herein.
[0155] B7-Related Polypeptides
[0156] A further aspect of the present invention pertains to
isolated B7-related polypeptides. The present invention encompasses
the BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13),
or BSL3 (e.g., SEQ ID NO:15) polypeptides, and fragments and
functional equivalents thereof. Such polypeptides can comprise at
least 5, 12, 20, 30, 50, 90, 100, 170, 200, 210, 300, or 500
contiguous amino acid residues. Preferred are polypeptides that
share moderate homology with BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g.,
SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15) polypeptides.
More preferred are polypeptides that share substantial homology
with BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13),
or BSL3 (e.g., SEQ ID NO:15).
[0157] The term "functional equivalent" is intended to include
proteins which differ in amino acid sequence from a given
B7-related polypeptide, such as sequence of BSL1 (e.g., SEQ ID
NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID
NO:15) polypeptide, but where such differences result in a modified
protein which performs at least one characteristic function of the
B7-related polypeptide (e.g., ligand-binding, antigenic, intra- or
intercellular activity). For example, a functional equivalent of a
BSL1, BSL2, or BSL3 polypeptide may have a modification such as a
substitution, addition or deletion of an amino acid residue which
is not directly involved in the function of this polypeptide (i.e.,
the ability of these polypeptides to co-stimulate T-cell
proliferation). In addition, non-naturally occurring analogs of
B7-related polypeptides capable of binding CD28/CTLA-4 and/or
CD28-/CTLA-4-related ligand(s) are considered functional
equivalents. Various modifications of the B7-related polypeptides
to produce functional equivalents of these polypeptides are
described in detail herein.
[0158] As described herein below, the BSL4-4616811 (BSL2vcvc)
polypeptide was determined to comprise a signal sequence from amino
acid 1 to amino acid 28 of SEQ ID NO:7 (FIG. 3B), according to the
SPScan computer algorithm (Genetics Computer Group suite of
programs). The site of signal sequence cleavage was confirmed by
N-terminal sequencing of the BSL4-4616811 polypeptide. Based on
this data, the mature BSL4-4616811 (BSL2vcvc) polypeptide sequence
includes amino acid 29 to amino acid 534 of SEQ ID NO:7 (FIG. 3B).
As used herein a "mature sequence" is a polypeptide sequence that
does not contain the signal sequence.
[0159] Accordingly, one embodiment of the present invention
encompasses a polypeptide that lacks the signal sequence, but
includes the remaining sequence of BSL2-4616811 (BSL2vcvc)
polypeptide (i.e., the mature sequence of BSL2-4616811).
Specifically, the invention encompasses a polypeptide comprising
amino acids 29 through 534 of SEQ ID NO:7. The invention also
encompasses a polynucleotide comprising nucleotides 85 through 1602
of SEQ ID NO:131, as well as a polypeptide comprising nucleotides
205 through 1722 of SEQ ID NO:6. Also encompassed are recombinant
vectors comprising these polynucleotides, and host cells comprising
these vectors.
[0160] Another embodiment of the present invention encompasses a
polypeptide that lacks the signal sequence, but includes the
remaining sequence of BSL2-L165-35b (BSL2v1c2) polypeptide, i.e.,
the mature sequence of BSL2-L165-35b. Specifically, the invention
encompasses a polypeptide comprising amino acids 29 through 316 of
SEQ ID NO:13. The invention also encompasses a polynucleotide
comprising nucleotides 85 through 948 of SEQ ID NO:12. Also
encompassed are recombinant vectors comprising these
polynucleotides, and host cells comprising these vectors.
[0161] Yet another embodiment of the present invention encompasses
a polypeptide that lacks the signal sequence, but includes the
remaining sequence of BSL2-L165-21 (BSL2v2c2) polypeptide, i.e.,
the mature sequence of BSL2-L165-21. Specifically, the invention
encompasses a polypeptide comprising amino acids 29 through 316 of
SEQ ID NO:11. The invention also encompasses a polynucleotide
comprising nucleotides 85 through 948 of SEQ ID NO:10. Also
encompassed are recombinant vectors comprising these
polynucleotides, and host cells comprising these vectors.
[0162] It is also possible that under certain conditions the BSL2
signal sequence cleavage site may vary. The invention therefore
encompasses polypeptides that add or subtract 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 more contiguous
amino acids from the N-terminus of the polypeptides described in
the three proceeding paragraphs. Polynucleotides encoding these
polypeptides are also encompassed by the invention, as well as
vectors and host cells comprising these polynucleotides.
[0163] It is possible to modify the structure of a B7-related
polypeptide for such purposes as increasing solubility, enhancing
therapeutic or prophylactic efficacy (reactivity), or stability
(e.g., shelf life ex vivo and resistance to proteolytic degradation
in vivo). Such modified proteins are considered functional
equivalents of the B7-related polypeptides as defined herein.
Preferably, the B7-related polypeptides are modified so that they
retain the ability to modulate (e.g., co-stimulate or inhibit)
T-cell proliferation. Those residues shown to be essential to
interact with the CD28/CTLA-4 or CD28-/CTLA-4-related ligands on
T-cells can be modified by replacing the essential amino acid with
another, preferably similar amino acid residue (a conservative
substitution) whose presence is shown to enhance, diminish, but not
eliminate, or not effect receptor interaction. In addition, those
amino acid residues that are not essential for receptor interaction
can be modified by being replaced by another amino acid whose
incorporation may enhance, diminish, or not effect reactivity. For
example, a B7-related polypeptide can be modified by substitution
of cysteine residues with other amino acids, such as alanine,
serine, threonine, leucine, or glutamic acid, to prevent
dimerization via disulfide linkages. In addition, the amino acid
side chains of a B7-related polypeptide of the invention can be
chemically modified. Also, a B7-related polypeptide can be modified
by cyclization of the amino acid sequence.
[0164] In order to enhance stability and/or reactivity, the
B7-related polypeptides can be altered to incorporate one or more
polymorphisms in the amino acid sequence. Additionally, D-amino
acids, non-natural amino acids, or non-amino acid analogs can be
substituted or added to produce a modified polypeptide.
Furthermore, the B7-related polypeptides disclosed herein can be
modified using polyethylene glycol (PEG) according to known methods
(Wie et al., supra) to produce a protein conjugated with PEG. In
addition, PEG can be added during chemical synthesis of the
protein. Other possible modifications include reduction/alkylation
(Tarr (1986) Methods of Protein Microcharacterization, J. E.
Silver, Ed., Humana Press, Clifton, N.J., pp. 155-194); acylation
(Tarr, supra); chemical coupling to an appropriate carrier (Mishell
and Shiigi, Eds. (1980) Selected Methods in Cellular Immunology, W
H Freeman, San Francisco, Calif.; U.S. Pat. No. 4,939,239; or mild
formalin treatment (Marsh (1971) Int. Arch. of Allergy and Appl.
Immunol. 41:199-215) of the B7-related polypeptide.
[0165] Modified polypeptides can have conservative changes, wherein
a substituted amino acid has similar structural or chemical
properties, e.g., replacement of leucine with isoleucine. More
infrequently, a modified polypeptide can have non-conservative
changes, e.g., substitution of a glycine with a tryptophan.
Guidance in determining which amino acid residues can be
substituted, inserted, or deleted without abolishing biological or
immunological activity can be found using computer programs well
known in the art, for example, DNASTAR software (DNASTAR, Inc.,
Madison, Wis.)
[0166] As non-limiting examples, conservative substitutions in the
B7-related amino acid sequence can be made in accordance with the
following table.
1 Original Conservative Residue Substitution(s) Ala Ser Arg Lys Asn
Gln, His Asp Glu Cys Ser Gln Asn Glu Asp Gly Pro His Asn, Gln Ile
Leu, Val Leu Ile, Val Lys Arg, Gln, Glu Met Leu, Ile Phe Met, Leu,
Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp, Phe Val Ile, Leu
[0167] Substantial changes in function or immunogenicity can be
made by selecting substitutions that are less conservative than
those shown in the table, above. For example, non-conservative
substitutions can be made which more significantly affect the
structure of the polypeptide in the area of the alteration, for
example, the alpha-helical, or beta-sheet structure; the charge or
hydrophobicity of the molecule at the target site; or the bulk of
the side chain. The substitutions which generally are expected to
produce the greatest changes in the polypeptide's properties are
those where 1) a hydrophilic residue, e.g., seryl or threonyl, is
substituted for (or by) a hydrophobic residue, e.g., leucyl,
isoleucyl, phenylalanyl, valyl, or alanyl; 2) a cysteine or proline
is substituted for (or by) any other residue; 3) a residue having
an electropositive side chain, e.g., lysyl, arginyl, or histidyl,
is substituted for (or by) an electronegative residue, e.g.,
glutamyl or aspartyl; or 4) a residue having a bulky side chain,
e.g., phenylalanine, is substituted for (or by) a residue that does
not have a side chain, e.g., glycine.
[0168] Preferred polypeptide embodiments further include an
isolated polypeptide comprising an amino acid sequence sharing at
least 60, 70, 80, 85, 90, 95, 97, 98, 99, 99.5 or 100% identity
with an amino acid sequence of BSL1 (e.g., SEQ ID NO:2), BSL2
(e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15). This
polypeptide sequence may be identical to the sequence of BSL1
(e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3
(e.g., SEQ ID NO:15), or may include up to a certain integer number
of amino acid alterations as compared to the reference sequence
Percent sequence identity can be calculated using computer programs
or direct sequence comparison. Preferred computer program methods
to determine identity between two sequences include, but are not
limited to, the GCG program package, FASTA, BLASTP, and TBLASTN
(see, e.g., D. W. Mount, 2001, Bioinformatics: Sequence and Genome
Analysis, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.). The BLASTP and TBLASTN programs are publicly available from
NCBI and other sources. The well-known Smith Waterman algorithm may
also be used to determine identity.
[0169] Exemplary parameters for amino acid sequence comparison
include the following: 1) algorithm from Needleman and Wunsch
(1970) J. Mol. Biol. 48:443-453; 2) BLOSSUM62 comparison matrix
from Hentikoff and Hentikoff (1992) Proc. Natl. Acad. Sci. USA
89:10915-10919; 3) gap penalty=12; and 4) gap length penalty=4. A
program useful with these parameters is publicly available as the
"gap" program (Genetics Computer Group, Madison, Wis.). The
aforementioned parameters are the default parameters for
polypeptide comparisons (with no penalty for end gaps).
[0170] Alternatively, polypeptide sequence identity can be
calculated using the following equation: % identity=(the number of
identical residues) /(alignment length in amino acid residues) *
100. For this calculation, alignment length includes internal gaps
but does not include terminal gaps.
[0171] In accordance with the present invention, polypeptide
sequences may be identical to the sequence of BSL1 (e.g., SEQ ID
NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID
NO:15), or may include up to a certain integer number of amino acid
alterations. Polypeptide alterations are selected from the group
consisting of at least one amino acid deletion, substitution,
including conservative and non-conservative substitution, or
insertion. Alterations may occur at the amino-or carboxy-terminal
positions of the reference polypeptide sequence or anywhere between
those terminal positions, interspersed either individually among
the amino acids in the reference sequence or in one or more
contiguous groups within the reference sequence. In specific
embodiments, polypeptide variants may be encoded by BSL1, BSL2, or
BSL3 nucleic acids comprising single nucleotide polymorphisms
and/or alternate splice variants. Polypeptides may also be modified
by, for example, phosphorylation, sulfation, or acylation. They may
also be modified with a label capable of providing a detectable
signal, either directly or indirectly, including, but not limited
to, radioisotopes and fluorescent compounds.
[0172] In addition, the B7-related polypeptides of the invention
can be fused to heterologous peptide or polypeptide sequences to
create fusion proteins such as BSL1-Ig (e.g., SEQ ID NO:5);
BSL2-4616811-Ig (e.g., SEQ ID NO:9), BSL2-L165-35b-Ig (e.g., SEQ ID
NO:133), BSL2-L165-21-Ig (e.g., SEQ ID NO:135), and BSL3-Ig (e.g.,
SEQ ID NO: 17) as described in detail herein. In accordance with
the experiments of the invention, the BSL2 sequence of
BSL2-4616811-Ig (BSL2vcvc-Ig) polypeptide was determined to
comprise a signal sequence from about amino acid 1 to about amino
acid 28 of SEQ ID NO:9 (FIG. 4B). The signal sequence cleavage site
was determined using the SPScan computer algorithm (Genetics
Computer Group suite of programs), and was confirmed by N-terminal
sequencing. Based on this data, the mature BSL2-4616811-Ig
(BSL2vcvc-Ig) polypeptide sequence extends from amino acids 29
through 698 of SEQ ID NO:9 (FIG. 4B).
[0173] Accordingly, one embodiment of the present invention
encompasses a BSL2-4616811-Ig (BSL2vcvc-Ig) polypeptide that
includes amino acids 1 through 698 of SEQ ID NO:9. The invention
also encompasses a BSL2-4616811-Ig (BSL2vcvc-Ig) polypeptide that
lacks the initiating methionine, but includes amino acids 2 through
698 of SEQ ID NO:9. The invention further encompasses a polypeptide
that lacks the signal sequence, but includes the remaining sequence
of BSL2-4616811-Ig (BSL2vcvc-Ig) polypeptide, i.e., the mature
sequence of BSL2-4616811-Ig. Specifically, the invention
encompasses a polypeptide comprising amino acids 29 through 698 of
SEQ ID NO:9. The invention also encompasses BSL2-4616811-Ig
(BSL2vcvc-Ig) polynucleotides comprising nucleotides 1 through
2094, nucleotides 4 through 2094, or nucleotides 85 through 2094 of
SEQ ID NO:8. Also encompassed are recombinant vectors comprising
these polynucleotides, and host cells comprising these vectors.
[0174] Another embodiment of the present invention encompasses a
BSL2-L165-35b-Ig (BSL2v1c2-Ig) polypeptide that includes amino
acids 1 through 480 of SEQ ID NO:133. The invention also
encompasses a BSL2-L165-35b-Ig (BSL2v1c2-Ig) polypeptide that lacks
the initiating methionine, but includes amino acids 2 through 480
of SEQ ID NO:133. The invention further encompasses a polypeptide
that lacks the signal sequence, but includes the remaining sequence
of BSL2-L165-35b-Ig (BSL2v1c2-Ig) polypeptide, i.e., the mature
sequence of BSL2-L165-35b-Ig. Specifically, the invention
encompasses a polypeptide comprising amino acids 29 through 480 of
SEQ ID NO:133. The invention also encompasses BSL2-L165-35b-Ig
(BSL2v1c2-Ig) polynucleotides comprising nucleotides 1 through
1440, nucleotides 4 through 1440, or nucleotides 85 through 1440 of
SEQ ID NO:132. Also encompassed are recombinant vectors comprising
these polynucleotides, and host cells comprising these vectors.
[0175] Yet another embodiment of the present invention encompasses
a BSL2-L165-21-Ig (BSL2v2c2-Ig) polypeptide that includes amino
acids 1 through 480 of SEQ ID NO:135. The invention also
encompasses a BSL2-L165-21-Ig (BSL2v2c2-Ig) polypeptide that lacks
the initiating methionine, but includes amino acids 2 through 480
of SEQ ID NO:135. The invention further encompasses a polypeptide
that lacks the signal sequence, but includes the remaining sequence
of BSL2-L165-21-Ig (BSL2v2c2-Ig) polypeptide, i.e., the mature
sequence of BSL2-L165-21-Ig. Specifically, the invention
encompasses a BSL2-L165-21-Ig (BSL2v2c2-Ig) polypeptide comprising
amino acids 29 through 480 of SEQ ID NO:135. The invention also
encompasses BSL2-L165-21-Ig (BSL2v2c2-Ig) polynucleotides
comprising nucleotides 1 through 1440, nucleotides 4 through 1440,
or nucleotides 85 through 1440 of SEQ ID NO:134. Also encompassed
are recombinant vectors comprising these polynucleotides, and host
cells comprising these vectors.
[0176] It is also possible that under certain conditions the BSL2
signal sequence cleavage site may vary. The invention therefore
encompasses polypeptides that add or subtract 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 more contiguous
amino acids from the N-terminus of the polypeptides described in
the three proceeding paragraphs. Polynucleotides encoding these
polypeptides are also encompassed by the invention, as well as
vectors and host cells comprising these polynucleotides.
[0177] The invention also relates to isolated, synthesized and/or
recombinant portions or fragments of a BSL1 (e.g., SEQ ID NO:2),
BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15)
protein or polypeptide as described herein. Polypeptide fragments
(i.e., peptides) can be made which have full or partial function on
their own, or which when mixed together (though fully, partially,
or nonfunctional alone), spontaneously assemble with one or more
other polypeptides to reconstitute a functional protein having at
least one functional characteristic of a BSL1, BSL2, or BSL3
protein of this invention. In addition, B7-related polypeptide
fragments may comprise, for example, one or more domains of the
polypeptide (e.g., the transmembrane or extracellular domain)
disclosed herein.
[0178] The polypeptides of the present invention, including
function-conservative variants, may be isolated from wild-type or
mutant cells (e.g., human cells or cell lines), from heterologous
organisms or cells (e.g., bacteria, yeast, insect, plant, and
mammalian cells), or from cell-free translation systems (e.g.,
wheat germ, microsomal membrane, or bacterial extracts) in which a
protein-coding sequence has been introduced and expressed.
Furthermore, the polypeptides may be part of recombinant fusion
proteins. The polypeptides can also, advantageously, be made by
synthetic chemistry. Polypeptides may be chemically synthesized by
commercially available automated procedures, including, without
limitation, exclusive solid phase synthesis, partial solid phase
methods, fragment condensation or classical solution synthesis.
Both the naturally occurring and recombinant forms of the
polypeptides of the invention can advantageously be used to screen
compounds for binding activity. The polypeptides of the invention
also find use as therapeutic agents as well as antigenic components
to prepare antibodies as described in detail herein.
[0179] Antibodies to B7-related Polypeptides
[0180] Antibodies directed against the B7-related polypeptides of
the present invention, e.g., BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g.,
SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15), or antigenic
or immunogenic epitopes thereof, can be, for example, polyclonal or
monoclonal antibodies. The present invention also includes
chimeric, single chain, and humanized antibodies, as well as Fab,
F(ab').sub.2, or Fv fragments, or the product of an Fab expression
library. Various procedures known in the art may be used for the
production of such antibodies and antibody fragments.
[0181] Antibodies generated against the polypeptides or peptides
corresponding to one or more of the B7-related sequences of the
present invention can be obtained by direct injection of the
polypeptides or peptides into an animal, or by administering the
polypeptides or peptides to an animal, preferably a nonhuman
animal. The antibodies so obtained will then bind to the
polypeptides or peptides. In this manner, even a sequence encoding
only a fragment of a polypeptide can be used to generate antibodies
binding to the whole native polypeptide. Such antibodies can be
used, for example, to isolate the polypeptide from tissue
expressing that polypeptide.
[0182] For the preparation of monoclonal antibodies, any technique
that provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein (1975) Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al. (1983) Immunol.
Today, 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole et al. (1985) Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Techniques
described for the production of single chain antibodies (U.S. Pat.
No. 4,946,778) can be adapted to produce single chain antibodies to
immunogenic polypeptide products of this invention. Also,
transgenic mice may be used to express humanized antibodies to
immunogenic polypeptide products of this invention.
[0183] The present invention encompasses polypeptides comprising,
or alternatively, consisting of, an epitope of the polypeptide
having an amino acid sequence of one or more of the BSL1, BSL2, or
BSL3 amino acid sequences as set forth in FIGS. 1-6. The present
invention further encompasses polynucleotide sequences encoding an
epitope of a polypeptide sequence of BSL1, BSL2, or BSL3 of the
invention. Typically, BSL1, BSL2, or BSL3 epitopes comprise
hydrophilic regions of the corresponding polypeptides (e.g., SEQ ID
NO:2, SEQ ID NO:7, 11, or 13, or SEQ ID NO:15). Hydrophilic regions
can be determined by any method known in the art, for example,
Kyte-Doolittle Hydrophilicity Plots (e.g., using the program bundle
from Genetics Computer Group). In addition, the antigenic index can
be determined directly using the Jameson-Wolf method (e.g., using
the program bundle from Genetics Computer Group).
[0184] Non-limiting examples of BSL2-4616811 (BSL2vcvc) sequences
which may be used as epitopes include sequences comprising amino
acids 68 through 109; amino acids 148 through 186; amino acids 284
through 326; or amino acids 361 through 407 of SEQ ID NO:7. This
invention also encompasses polynucleotides encoding these epitopes,
and vectors and host cells comprising these polynucleotides. For
example, such polynucleotides may comprise nucleotides 202 through
327; nucleotides 442 through 558; nucleotides 850 through 978; or
nucleotides 1081 through 1221 of SEQ ID NO:131. Similarly, these
polynucleotides may comprise nucleotides 322 through 447;
nucleotides 562 through 678; nucleotides 970 through 1098; or
nucleotides 1201 through 1341 of SEQ ID NO:6.
[0185] In preferred embodiments, the following immunogenic and/or
antigenic epitopes are encompassed by the present invention:
eptitopes comprising from about amino acid 68 to about amino acid
74, from about amino acid 75 to about amino acid 81, from about
amino acid 82 to about amino acid 88, from about amino acid 89 to
about amino acid 95, from about amino acid 96 to about amino acid
102, from about amino acid 103 to about amino acid 109, from about
amino acid 148 to about amino acid 154, from about amino acid 155
to about amino acid 161, from about amino acid 162 to about amino
acid 168, from about amino acid 169 to about amino acid 175, from
about amino acid 176 to about amino acid 182, from about amino acid
183 to about amino acid 186, from about amino acid 284 to about
amino acid 290, from about amino acid 291 to about amino acid 297,
from about amino acid 298 to about amino acid 304, from about amino
acid 305 to about amino acid 311, from about amino acid 312 to
about amino acid 318, from about amino acid 319 to about amino acid
326, from about amino acid 361 to about amino acid 367, from about
amino acid 368 to about amino acid 374, from about amino acid 375
to about amino acid 381, from about amino acid 387 to about amino
acid 393, from about amino acid 394 to about amino acid 400, and/or
from about amino acid 401 to about amino acid 407 of SEQ ID NO:7.
In this context, the term "about" should be construed to mean 1, 2,
3, 4, or 5 more amino acids in either the N- or C-terminal
direction of the above referenced epitopes. Polynucleotides
encoding these polypeptides are also provided, as well as vectors
and host cells comprising these polynucleotides.
[0186] The term "epitopes" as used herein, refers to portions of a
polypeptide (e.g., peptides) having antigenic or immunogenic
activity in an animal, preferably a mammal, and most preferably a
human. In a preferred embodiment, the present invention encompasses
a polypeptide comprising an epitope, as well as the polynucleotide
encoding this polypeptide. An "immunogenic epitope" as used herein,
refers to a portion of a protein that elicits an antibody response
in an animal, as determined by any method known in the art, for
example, by the methods for generating antibodies described infra.
(See, for example, Geysen et al. (1983) Proc. Natl. Acad. Sci. USA,
81:3998-4002). The term "antigenic epitope" as used herein refers
to a portion of a protein to which an antibody can
immunospecifically bind to its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding, but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic. Either the
full-length protein or an antigenic peptide fragment can be used.
Antibodies are preferably prepared from these regions or from
discrete fragments in regions of the BSL1, BSL2, or BSL3 nucleic
acid and amino acid sequences comprising an epitope.
[0187] Moreover, antibodies can also be prepared from any region of
the polypeptides and peptides of the B7-related sequences as
described herein. A preferred fragment generates the production of
an antibody that diminishes or completely prevents interaction with
a binding partner. In addition, antibodies can be developed against
an entire BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or
13), or BSL3 (e.g., SEQ ID NO:15) polypeptide or portions of the
polypeptide, for example, a carboxy-terminal domain, an
amino-terminal extracellular domain, an entire transmembrane
domain, specific transmembrane segments, or any portions of these
regions. Antibodies can also be developed against specific
functional sites, such as the site of binding, or sites that are
glycosylated, phosphorylated, myristylated, or amidated, for
example. Also useful for antibody production are variable/constant
(vc) domains of the B7-related polypeptides, e.g., the v1c2, v2c2,
or v1c1v2c2 domains of BSL2 (see below). Polypeptide or peptide
fragments that function as epitopes may be produced by any
conventional means. (See, e.g., Houghten (1985) Proc. Natl. Acad.
Sci. USA, 82:5131-5135; and as described in U.S. Pat. No.
4,631,211).
[0188] In the present invention, antigenic epitopes preferably
contain a sequence of at least 4, at least 5, at least 6, at least
7, more preferably at least 8, at least 9, at least 10, at least
11, at least 12, at least 13, at least 14, at least 15, at least
20, at least 25, at least 30, at least 40, at least 50, and, most
preferably, between about 15 to about 30 contiguous amino acids.
Preferred polypeptides comprising immunogenic or antigenic epitopes
are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, or 100 contiguous amino acid residues in
length. Additional non-exclusive preferred antigenic epitopes
include the antigenic epitopes disclosed herein, as well as
portions thereof, as well as any combination of two, three, four,
five or more of these antigenic epitopes. Antigenic epitopes are
useful, for example, to raise antibodies, including monoclonal
antibodies that specifically bind the epitope. In addition,
antigenic epitopes can be used as the target molecules in
immunoassays. (See, for instance, Wilson et al. (1984) Cell,
37:767-778; and Sutcliffe et al. (1983) Science, 219:660-666). Such
fragments as described herein are not to be construed, however, as
encompassing any fragments that may be disclosed prior to the
invention.
[0189] Similarly, immunogenic epitopes can be used, for example, to
induce antibodies according to methods well known in the art. (See,
for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow
et al. (1985) Proc. Natl. Acad. Sci. USA, 82:910-914; and Bittle et
al. (1985) J. Gen. Virol., 66:2347-2354). Preferred immunogenic
epitopes include the immunogenic epitopes disclosed herein, as well
as any combination of two, three, four, five or more of these
immunogenic epitopes.
[0190] B7-related polypeptides of the invention comprising one or
more immunogenic epitopes that elicit an antibody response can be
introduction together with a carrier protein, such as an albumin,
to an animal system (such as rabbit or mouse). Alternatively, if
the polypeptide is of sufficient length (e.g., at least about 25
contiguous amino acids), the polypeptide can be presented without a
carrier. However, immunogenic epitopes comprising as few as 5 to 10
amino acids have been shown to be sufficient to raise antibodies
capable of binding to, at the very least, linear epitopes in a
denatured polypeptide (e.g., in Western blotting).
[0191] Epitope-bearing polypeptides of the present invention may be
used to induce antibodies according to methods well known in the
art including, but not limited to, in vivo immunization, in vitro
immunization, and phage display methods. See, e.g., Sutcliffe et
al., supra; Wilson et al., supra; and Bittle et al., supra). If in
vivo immunization is used, animals can be immunized with free
peptide; however, the anti-peptide antibody titer may be boosted by
coupling the peptide to a macromolecular carrier, such as keyhole
limpet hemacyanin (KLH), or tetanus toxoid (TT). For instance,
peptides containing cysteine residues can be coupled to a carrier
using a linker such as maleimidobenzoyl-N-hydroxysuccinimide ester
(MBS), while other peptides may be coupled to carriers using a more
general linking agent, such as glutaraldehyde.
[0192] Epitope bearing peptides of the invention may also be
synthesized as multiple antigen peptides (MAPs), first described by
J. P. Tam et al. (1995) Biomed. Pept, Proteins, Nucleic Acids, 199,
1(3):123-32; and Calvo, et al. (1993) J. Immunol., 150(4):1403-12),
which are hereby incorporated by reference in their entirety
herein. MAPs contain multiple copies of a specific peptide attached
to a non-immunogenic lysine core. MAP peptides usually contain four
or eight copies of the peptide, which are often referred to as MAP4
or MAP8 peptides. By way of non-limiting example, MAPs can be
synthesized onto a lysine core matrix attached to a polyethylene
glycol-polystyrene (PEG-PS) support. The peptide of interest is
synthesized onto the lysine residues using
9-fluorenylmethoxycarbonyl (Fmoc) chemistry. For example, Applied
Biosystems (Foster City, Calif.) offers commercially available MAP
resins, such as, for example, the Fmoc Resin 4 Branch and the Fmoc
Resin 8 Branch, which can be used to synthesize MAPs. Cleavage of
MAPs from the resin is performed with standard trifloroacetic acid
(TFA)-based cocktails known in the art. Purification of MAPs,
except for desalting, is not generally necessary. MAP peptides can
be used in immunizing vaccines which elicit antibodies that
recognize both the MAP and the native protein from which the
peptide was derived.
[0193] Epitope-bearing peptides of the invention can also be
incorporated into a coat protein of a virus, which can then be used
as an immunogen or a vaccine with which to immunize animals,
including humans, in order stimulate the production of anti-epitope
antibodies. For example, the V3 loop of the gp120 glycoprotein of
the human immunodeficiency virus type 1 (HIV-1) has been engineered
to be expressed on the surface of rhinovirus. Immunization with
rhinovirus displaying the V3 loop peptide yielded apparently
effective mimics of the HIV-1 immunogens (as measured by their
ability to be neutralized by anti-HIV-1 antibodies as well as by
their ability to elicit the production of antibodies capable of
neutralizing HIV-1 in cell culture). This techniques of using
engineered viral particles as immunogens is described in more
detail in Smith et al. (1997) Behring Inst Mitt Feb, 98:229-39;
Smith et al. (1998) J. Virol. 72:651-659; and Zhang et al. (1999)
Biol. Chem. 380:365-74), which are hereby incorporated by reference
herein in their entireties.
[0194] Epitope bearing polypeptides of the invention can be
modified, for example, by the addition of amino acids at the amino-
and/or carboxy-terminus of the peptide. Such modifications are
performed, for example, to alter the conformation of the epitope
bearing polypeptide such that the epitope will have a conformation
more closely related to the structure of the epitope in the native
protein. An example of a modified epitope-bearing polypeptide of
the invention is a polypeptide in which one or more cysteine
residues have been added to the polypeptide to allow for the
formation of a disulfide bond between two cysteines, thus resulting
in a stable loop structure of the epitope-bearing polypeptide under
non-reducing conditions. Disulfide bonds can form between a
cysteine residue added to the polypeptide and a cysteine residue of
the naturally-occurring epitope, or between two cysteines which
have both been added to the naturally-occurring epitope-bearing
polypeptide.
[0195] In addition, it is possible to modify one or more amino acid
residues of the naturally-occurring epitope-bearing polypeptide by
substitution with cysteines to promote the formation of disulfide
bonded loop structures. Cyclic thioether molecules of synthetic
peptides can be routinely generated using techniques known in the
art, e.g., as described in PCT publication WO 97/46251,
incorporated in its entirety by reference herein. Other
modifications of epitope-bearing polypeptides contemplated by this
invention include biotinylation.
[0196] For the production of antibodies in vivo, host animals, such
as rabbits, rats, mice, sheep, or goats, are immunized with either
free or carrier-coupled peptides or MAP peptides, for example, by
intraperitoneal and/or intradermal injection. Injection material is
typically an emulsion containing about 100 .mu.g of peptide or
carrier protein and Freund's adjuvant, or any other adjuvant known
for stimulating an immune response. Several booster injections may
be needed, for instance, at intervals of about two weeks, to
provide a useful titer of anti-peptide antibody which can be
detected, for example, by ELISA assay using free peptide adsorbed
to a solid surface. The titer of anti-peptide antibodies in serum
from an immunized animal can be increased by selection of
anti-peptide antibodies, e.g., by adsorption of the peptide onto a
solid support and elution of the selected antibodies according to
methods well known in the art.
[0197] As one having skill in the art will appreciate, and as
discussed above, the B7-related polypeptides of the present
invention, which comprise an immunogenic or antigenic epitope, can
be fused to other polypeptide sequences. For example, the
polypeptides of the present invention can be fused with the
constant domain of immunoglobulins (IgA, IgE, IgG, IgD, or IgM), or
portions thereof, e.g., CH1, CH2, CH3, or any combination thereof,
and portions thereof, or with albumin (including, but not limited
to, recombinant human albumin, or fragments or variants thereof
(see, e.g., U.S. Pat. No. 5,876,969; EP Patent No. 0 413 622; and
U.S. Pat. No. 5,766,883, incorporated by reference in their
entirety herein), thereby resulting in chimeric polypeptides. Such
fusion proteins may facilitate purification and may increase
half-life in vivo. This has been shown for chimeric proteins
containing the first two domains of the human CD4-polypeptide and
various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins. See, e.g., Traunecker et al.
(1988) Nature 331:84-86).
[0198] Enhanced delivery of an antigen across the epithelial
barrier to the immune system has been demonstrated for antigens
(e.g., insulin) conjugated to an FcRn binding partner, such as IgG
or Fc fragments (see, e.g., PCT Publications WO 96/22024 and WO
99/04813). IgG fusion proteins that have a disulfide-linked dimeric
structure due to the IgG portion disulfide bonds have also been
found to be more efficient in binding and neutralizing other
molecules than are monomeric polypeptides, or fragments thereof,
alone. See, e.g., Fountoulakis et al. (1995) J. Biochem.
270:3958-3964).
[0199] Nucleic acids encoding epitopes can also be recombined with
a gene of interest as an epitope tag (e.g., the hemagglutinin
("HA") tag or flag tag) to aid in detection and purification of the
expressed polypeptide. For example, a system for the ready
purification of non-denatured fusion proteins expressed in human
cell lines has been described (Janknecht et al. (1991) Proc. Natl.
Acad. Sci. USA, 88:8972-897). In this system, the gene of interest
is subcloned into a vaccinia recombination plasmid such that the
open reading frame of the gene is translationally fused to an
amino-terminal tag having six histidine residues. The tag serves as
a matrix binding domain for the fusion protein. Extracts from cells
infected with the recombinant vaccinia virus are loaded onto a
Ni.sup.2+ nitriloacetic acid-agarose column and histidine-tagged
proteins are selectively eluted with imidazole-containing
buffers.
[0200] Additional fusion proteins of the invention can be generated
by employing the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling can be employed to modulate the
activities of polypeptides of the invention, such methods can be
used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S.
Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and
5,837,458, and Patten et al. (1997) Curr. Opin. Biotechnol.
8:724-33; Harayama (1998) Trends Biotechnol. 16(2):76-82; Hansson,
et al. (1999) J. Mol. Biol. 287:265-76; and Lorenzo and Blasco
(1998) Biotechniques, 24(2):308-313, the contents of each of which
are hereby incorporated by reference in its entirety).
[0201] In an embodiment of the invention, alteration of
polynucleotides corresponding to one or more of the B7-related
polynucleotide sequences as set forth in FIGS. 1-6, and the
polypeptides encoded by these polynucleotides, can be achieved by
DNA shuffling. DNA shuffling involves the assembly of two or more
DNA segments by homologous or site-specific recombination to
generate variation in the polynucleotide sequence. In another
embodiment, polynucleotides of the invention, or their encoded
polypeptides, may be altered by being subjected to random
mutagenesis by error-prone PCR, random nucleotide insertion, or
other methods, prior to recombination. In another embodiment, one
or more components, motifs, sections, parts, domains, fragments,
etc., of a polynucleotide encoding a polypeptide of this invention
may be recombined with one or more components, motifs, sections,
parts, domains, fragments, etc. of one or more heterologous
molecules.
[0202] Another aspect of the present invention relates to
antibodies and T-cell antigen receptors (TCRs), which
immunospecifically bind to a polypeptide, polypeptide fragment, or
variant one or more of the BSL1, BSL2, or BSL3 amino acid sequences
as set forth in FIGS. 1-6, and/or an epitope thereof, of the
present invention (as determined by immunoassays well known in the
art for assaying specific antibody-antigen binding). The basic
antibody structural unit of an antibody or immunoglobulin is known
to comprise a tetramer. Each tetramer is composed of two identical
pairs of polypeptide chains, each pair having one "light" (about 25
kDa) and one "heavy" chain (about 50-70 kDa). The amino terminal
portion of each chain includes a variable region of about 100 to
110 or more amino acids; the variable region is primarily
responsible for antigen recognition. The carboxy-terminal portion
of each chain defines a constant region that is primarily
responsible for immunoglobulin effector function. Immunoglobulin
light chains, including human light chains, are of the kappa and
lambda types. Immunoglobulin heavy chain isotypes include IgM, IgD,
IgG, IgA, and IgE. (See, generally, W. Paul, Ed., (1989)
Fundamental Immunology, Ch. 7, 2nd ed., Raven Press, N.Y.,
incorporated herein by reference in its entirety). The variable
regions of each light/heavy chain pair form the antibody or
immunoglobulin binding site. Thus, for example, an intact IgG
antibody has two binding sites. Except in bifunctional or
bispecific antibodies, the two binding sites are the same.
[0203] The chains of an immunoglobulin molecule exhibit the same
general structure of relatively conserved framework regions (FR)
joined by three hypervariable regions, also called complementarity
determining regions or CDRs. The CDRs of the heavy and the light
chains of each pair are aligned by the framework regions, thus
enabling binding to a specific epitope. From N-terminus to
C-terminus, both the light and heavy chains comprise the domains
FRI, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino
acids to each domain is in accordance with the definitions of Kabat
Sequences of Proteins of Immunological Interest (National
Institutes of Health, Bethesda, Md. (1987 and 1991)); Chothia and
Lesk (1987) J. Mol. Biol. 196:901-917; or Chothia et al. (1989)
Nature, 342:878-883.
[0204] A bispecific or bifunctional antibody is an artificial
hybrid antibody having two different heavy/light chain pairs and
two different binding sites. Bispecific antibodies can be produced
by a variety of methods, including fusion of hybridomas or linking
of Fab' fragments. (See, e.g., Songsivilai & Lachmann (1990)
Clin. Exp. Immunol. 79:315-321; Kostelny et al. (1992) J. Immunol.
148:1547 1553). In addition, bispecific antibodies can be formed as
"diabodies" (See, Holliger et al. (1993) Proc. Natl. Acad. Sci.
USA, 90:6444-6448), or "Janusins" (See, Traunecker et al.
(1991)EMBO J., 10:3655-3659 and Traunecker et al. (1992) Int. J.
Cancer Suppl. 7:51-52).
[0205] Antibodies of the invention include, but are not limited to,
polyclonal, monoclonal, multispecific, human, humanized or chimeric
antibodies, single chain antibodies, Fab fragments, F(ab')
fragments, fragments produced by a Fab expression library,
anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id
antibodies to antibodies of the invention), intracellularly made
antibodies (i.e., intrabodies), and epitope-binding fragments of
any of the above. The term "antibody", as used herein, refers to
immunoglobulin molecules and immunologically active portions or
fragments of immunoglobulin molecules, i.e., molecules that contain
an antigen binding site that immunospecifically binds an antigen.
The immunoglobulin molecules of the invention can be of any type
(e.g., IgG, IgE, IgM, IgD, IgA and IgY), class or subclass (e.g.,
IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) of immunoglobulin molecule.
In a preferred embodiment, the immunoglobulin is an IgG1 isotype.
In another preferred embodiment, the immunoglobulin is an IgG2
isotype. In another preferred embodiment, the immunoglobulin is an
IgG4 isotype.
[0206] Immunoglobulins may have both a heavy and a light chain. An
array of IgG, IgE, IgM, IgD, IgA, and IgY heavy chains can be
paired with a light chain of the kappa or lambda types. Most
preferably, the antibodies of the present invention are human
antigen-binding antibodies and antibody fragments and include, but
are not limited to, Fab, Fab' F(ab') 2, Fd, single-chain Fvs
(scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and
fragments comprising either a V.sub.L or V.sub.H domain.
Antigen-binding antibody fragments, including single-chain
antibodies, can comprise the variable region(s) alone or in
combination with the entirety or a portion of the following: hinge
region, and CH1, CH2, and CH3 domains. Also included in connection
with the invention are antigen-binding fragments also comprising
any combination of variable region(s) with a hinge region, and CH1,
CH2, and CH3 domains. The antibodies of the invention may be from
any animal origin including birds and mammals. Preferably, the
antibodies are of human, murine (e.g., mouse and rat), donkey,
sheep, rabbit, goat, guinea pig, camel, horse, or chicken origin.
As used herein, "human" antibodies include antibodies having the
amino acid sequence of a human immunoglobulin and include
antibodies isolated from human immunoglobulin libraries or from
animals transgenic for one or more human immunoglobulin and that do
not express endogenous immunoglobulins, as described infra and, for
example, in U.S. Pat. No. 5,939,598.
[0207] The antibodies of the present invention can be monospecific,
bispecific, trispecific, or of greater multispecificity.
Multispecific antibodies can be specific for different epitopes of
a polypeptide of the present invention, or can be specific for both
a polypeptide of the present invention, and a heterologous epitope,
such as a heterologous polypeptide or solid support material. (See,
e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO
92/05793; Tuft et al. (1991) J. Immunol. 147:60-69; U.S. Pat. Nos.
4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; and Kostelny
et al. (1992) J. Immunol. 148:1547-1553).
[0208] Antibodies of the present invention can be described or
specified in terms of the epitope(s) or portion(s) of a polypeptide
of the present invention that they recognize or specifically bind.
The epitope(s) or polypeptide portion(s) can be specified, e.g., by
N-terminal and C-terminal positions, by size in contiguous amino
acid residues, or as presented in the sequences defined in FIGS.
1-6, herein. Further included in accordance with the present
invention are antibodies that bind to polypeptides encoded by
polynucleotides that hybridize to a polynucleotide of the present
invention under stringent, or moderately stringent, hybridization
conditions as described herein.
[0209] The antibodies of the invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) can bind immunospecifically to a polypeptide or
polypeptide fragment or variant human B7-related polypeptide as set
forth in FIGS. 1-6 and/or monkey B7-related polypeptide.
[0210] By way of non-limiting example, an antibody can be
considered to bind to a first antigen preferentially if it binds to
the first antigen with a dissociation constant (Kd) that is less
than the antibody's Kd for the second antigen. In another
non-limiting embodiment, an antibody can be considered to bind to a
first antigen preferentially if it binds to the first antigen with
an affinity that is at least one order of magnitude less than the
antibody's association constant (Ka) for the second antigen. In
another non-limiting embodiment, an antibody can be considered to
bind to a first antigen preferentially if it binds to the first
antigen with an affinity that is at least two orders of magnitude
less than the antibody's Kd for the second antigen.
[0211] In another nonlimiting embodiment, an antibody may be
considered to bind to a first antigen preferentially if it binds to
the first antigen with an off rate (Koff) that is less than the
antibody's Koff for the second antigen. In another nonlimiting
embodiment, an antibody can be considered to bind to a first
antigen preferentially if it binds to the first antigen with an
affinity that is at least one order of magnitude less than the
antibody's Koff for the second antigen. In another nonlimiting
embodiment, an antibody can be considered to bind to a first
antigen preferentially if it binds to the first antigen with an
affinity that is at least two orders of magnitude less than the
antibody's Koff for the second antigen.
[0212] Antibodies of the present invention can also be described or
specified in terms of their binding affinity to a B7-related
polypeptide of the present invention. Preferred binding affinities
include those with a dissociation constant or Kd of less than
5.times.10.sup.-2 M, 1.times.10.sup.-2 M, 5.times.10.sup.-3 M,
1.times.10.sup.-3 M, 5.times.10.sup.-4 M, or 1.times.10.sup.-4 M.
More preferred binding affinities include those with a dissociation
constant or Kd less than 5.times.10.sup.-5 M, 1.times.10.sup.-5 M,
5.times.10.sup.-4 M, 1.times.10.sup.-6 M, 5.times.10.sup.-7 M,
1.times.10.sup.-7 M, 5.times.10.sup.-8 M, or 1.times.10.sup.-8 M.
Even more preferred antibody binding affinities include those with
a dissociation constant or Kd of less than 5.times.10.sup.-9 M,
1.times.10.sup.-9 M, 5.times.10.sup.-10 M, 1.times.10.sup.-10 M,
5.times.10.sup.-11 M, 1.times.10.sup.-11 M, 5.times.10.sup.-12 M,
1.times.10 .sup.-12 M, 5.times.10.sup.-13 M, 1.times.10.sup.-13 M,
5.times.10.sup.-14 M, 1.times.10.sup.-14 M, 5.times.10.sup.-15 M,
or 1.times.10.sup.-15 M.
[0213] In specific embodiments, antibodies of the invention bind to
B7-related polypeptides of the invention, or fragments, or variants
thereof, with an off rate (Koff) of less than or equal to about
5.times.10.sup.-2 sec.sup.-1, 1.times.10.sup.-2 sec.sup.-1,
5.times.10.sup.-3 sec.sup.-1, or 1.times.10.sup.-3 sec.sup.-1. More
preferably, antibodies of the invention bind to B7-related
polypeptides of the invention or fragments or variants thereof with
an off rate (Koff) of less than or equal to about 5.times.10.sup.-4
sec.sup.-1, 1.times.10.sup.-4 sec.sup.-1, 5.times.10.sup.-5
sec.sup.-1, 1.times.10.sup.-5 sec.sup.-1, 5.times.10.sup.-6
sec.sup.-1, 1.times.10.sup.-6 sec.sup.-1, 5.times.10.sup.-7
sec.sup.-1, or 1.times.10.sup.-7 sec.sup.-1.
[0214] In other embodiments, antibodies of the invention bind to
B7-related polypeptides of the invention or fragments or variants
thereof with an on rate (Kon) of greater than or equal to
1.times.10.sup.3 M.sup.-1 sec.sup.-1, 5.times.10.sup.3 M.sup.-1
sec.sup.-1, 1.times.10.sup.4 M.sup.-1 sec.sup.-1, or
5.times.10.sup.4 M.sup.-1 sec.sup.-1. More preferably, antibodies
of the invention bind to B7-related polypeptides of the invention
or fragments or variants thereof with an on rate greater than or
equal to 1.times.10.sup.5 M.sup.-1 sec.sup.-1, 5.times.10.sup.5
M.sup.-1 sec.sup.-1, 1.times.10.sup.6 M.sup.-1 sec.sup.-1,
5.times.10.sup.-6 M.sup.-1 sec.sup.-1 , or 1.times.10.sup.7
M.sup.-1 sec.sup.-1.
[0215] The present invention also provides antibodies that
competitively inhibit the binding of an antibody to an epitope of
the invention as determined by any method known in the art for
determining competitive binding, for example, the immunoassays as
described herein. In preferred embodiments, the antibody
competitively inhibits binding to an epitope by at least 95%, at
least 90%, at least 85%, at least 80%, at least 75%, at least 70%,
at least 60%, or at least 50%.
[0216] Antibodies of the present invention may act as agonists or
antagonists of the B7-related polypeptides of the present
invention. For example, the present invention includes antibodies
that disrupt the intra-cellular or inter-cellular activity, or
interactions, of the polypeptides of the invention either partially
or fully. The invention includes BSL1, BSL2, and BSL3-specific
antibodies and antibody specific for the corresponding BSL-binding
partner complexes. The invention also includes BSL1-, BSL2-, or
BSL3-specific antibodies which do not prevent interaction with a
cognate binding partner (e.g., ligand), but do prevent activation.
Activation (i.e., signaling) can be determined by techniques
described herein or as otherwise known in the art. In specific
embodiments, antibodies are provided that inhibit BSL1, BSL2, or
BSL3 binding activity or activation activity by at least 95%, at
least 90%, at least 85%, at least 80%, at least 75%, at least 70%,
at least 60%, or at least 50% of the activity in the absence of the
antibody.
[0217] In another embodiment of the present invention, antibodies
that immunospecifically bind to a B7-related polypeptide of the
invention or a fragment or variant thereof, comprise a polypeptide
having the amino acid sequence of any one of the heavy chains
expressed by an anti-BSL1,-BSL2, or -BSL3 antibody-expressing cell
line of the invention, and/or any one of the light chains expressed
by an anti-BSL1, -BSL2, or -BSL3 antibody-expressing cell line of
the invention. In another embodiment of the present invention,
antibodies that immunospecifically bind to a B7-related polypeptide
of the invention or a fragment or variant thereof, comprise a
polypeptide having the amino acid sequence of any one of the
V.sup.H domains of a heavy chain expressed by an anti-BSL1,-BSL2,
or -BSL3 antibody-expressing cell line, and/or any one of the
V.sub.L domains of a light chain expressed by an anti-BSL1,-BSL2,
or -BSL3 antibody-expressing cell line. In preferred embodiments,
antibodies of the present invention comprise the amino acid
sequence of a V.sub.H domain and V.sub.L domain expressed by a
single anti-BSL1,-BSL2, or -BSL3 antibody-expressing cell line. In
alternative embodiments, antibodies of the present invention
comprise the amino acid sequence of a V.sub.H domain and a V.sub.L
domain expressed by two different anti-BSL1, -BSL2, or -BSL3
antibody-expressing cell lines.
[0218] Molecules comprising, or alternatively consisting of,
antibody fragments or variants of the V.sub.H and/or V.sub.L
domains expressed by an anti-BSL1,-BSL2, or -BSL3
antibody-expressing cell line that immunospecifically bind to a
B7-related polypeptide of the invention are also encompassed by the
invention, as are nucleic acid molecules encoding these V.sub.H and
V.sub.L domains, molecules, fragments and/or variants.
[0219] The present invention also provides antibodies that
immunospecificially bind to a polypeptide, or polypeptide fragment
or variant of a B7-related polypeptide such as BSL1 (e.g., SEQ ID
NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID
NO:15), wherein said antibodies comprise, or alternatively consist
of, a polypeptide having an amino acid sequence of any one, two,
three, or more of the V.sub.H CDRs contained in a heavy chain
expressed by one or more anti-BSL1,-BSL2, or -BSL3 antibody
expressing cell lines. In particular, the invention provides
antibodies that immunospecifically bind to a B7-related polypeptide
of the invention, comprising, or alternatively consisting of, a
polypeptide having the amino acid sequence of a V.sub.H CDR1
contained in a heavy chain expressed by one or more
anti-BSL1,-BSL2, or -BSL3 antibody expressing cell lines. In
another embodiment, antibodies that immunospecifically bind to a
B7-related polypeptide of the invention, comprise, or alternatively
consist of, a polypeptide having the amino acid sequence of a
V.sub.H CDR2 contained in a heavy chain expressed by one or more
anti-BSL1,-BSL2, or -BSL3 antibody expressing cell lines. In a
preferred embodiment, antibodies that immunospecifically bind to a
B7-related polypeptide of the invention, comprise, or alternatively
consist of, a polypeptide having the amino acid sequence of a
V.sub.H CDR3 contained in a heavy chain expressed by one or more
anti-BSL1,-BSL2, or -BSL3 antibody expressing cell line of the
invention. Molecules comprising, or alternatively consisting of,
these antibodies, or antibody fragments or variants thereof, that
immunospecifically bind to a B7-related polypeptide (e.g., BSL1,
BSL2, or BSL3) or a polypeptide fragment or variant thereof are
also encompassed by the invention, as are nucleic acid molecules
encoding these antibodies, molecules, fragments and/or
variants.
[0220] The present invention also provides antibodies that
immunospecificially bind to a polypeptide, or polypeptide fragment
or variant of a B7-related polypeptide disclosed herein, wherein
said antibodies comprise, or alternatively consist of, a
polypeptide having an amino acid sequence of any one, two, three,
or more of the V.sub.L CDRs contained in a heavy chain expressed by
one or more anti-BSL1,-BSL2, or -BSL3 antibody expressing cell
lines of the invention. In particular, the invention provides
antibodies that immunospecifically bind to a B7-related polypeptide
disclosed herein, comprising, or alternatively consisting of, a
polypeptide having the amino acid sequence of a V.sub.L CDR1
contained in a heavy chain expressed by one or more
anti-BSL1,-BSL2, or -BSL3 antibody-expressing cell lines of the
invention. In another embodiment, antibodies that
immunospecifically bind to a B7-related polypeptide of the
invention, comprise, or alternatively consist of, a polypeptide
having the amino acid sequence of a V.sub.L CDR2 contained in a
heavy chain expressed by one or more anti-BSL1,-BSL2, or -BSL3
antibody-expressing cell lines of the invention. In a preferred
embodiment, antibodies that immunospecifically bind to a B7-related
polypeptide of the invention, comprise, or alternatively consist of
a polypeptide having the amino acid sequence of a V.sub.L CDR3
contained in a heavy chain expressed by one or more BSL1,-BSL2, or
-BSL3 antibody-expressing cell lines of the invention. Molecules
comprising, or alternatively consisting of, these antibodies, or
antibody fragments or variants thereof, that immunospecifically
bind to a B7-related polypeptide such as BSL1 (e.g., SEQ ID NO:2),
BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15),
or a polypeptide fragment or variant thereof are also encompassed
by the invention, as are nucleic acid molecules encoding these
antibodies, molecules, fragments and/or variants.
[0221] The present invention also provides antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants) that immunospecifically bind to a B7-related
polypeptide, or polypeptide fragment or variant disclosed herein,
wherein the antibodies comprise, or alternatively consist of, one,
two, three, or more V.sub.H CDRs, and one, two, three or more
V.sub.L CDRs, as contained in a heavy chain or light chain
expressed by one or more anti-BSL1, -BSL2, or -BSL3
antibody-expressing cell lines of the invention. In particular, the
invention provides antibodies that immunospecifically bind to a
polypeptide or polypeptide fragment or variant of a B7-related
polypeptide disclosed herein, wherein the antibodies comprise, or
alternatively consist of, a V.sub.H CDR1 and a V.sub.L CDR1, a
V.sub.H CDR1 and a V.sub.L CDR2, a V.sub.H CDR1 and a V.sub.L CDR3,
a V.sub.H CDR2 and a V.sub.L CDR1, V.sub.H CDR2 and V.sub.L CDR2, a
V.sub.H CDR2 and a V.sub.L CDR3, a V.sub.H CDR3 and a V.sub.H CDR1,
a V.sub.H CDR3 and a V.sub.L CDR2, a V.sub.H CDR3 and a V.sub.L
CDR3, or any combination thereof, of the V.sub.H CDRs and V.sub.L
CDRs contained in a heavy chain or light chain immunoglobulin
molecule expressed by one or more anti-BSL1, -BSL2, or -BSL3
antibody-expressing cell lines of the invention. In a preferred
embodiment, one or more of these combinations are from a single
anti-BSL1,-BSL2, or -BSL3 antibody-expressing cell line of the
invention. Molecules comprising, or alternatively consisting of,
fragments or variants of these antibodies that immunospecifically
bind to a B7-related polypeptide such as BSL1 (e.g., SEQ ID NO:2),
BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15)
are also encompassed by the invention, as are nucleic acid
molecules encoding these antibodies, molecules, fragments or
variants.
[0222] The present invention also provides nucleic acid molecules,
generally isolated, encoding an antibody of the invention
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof). In a specific embodiment,
a nucleic acid molecule of the invention encodes an antibody
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), comprising, or
alternatively consisting of, a V.sub.H domain having an amino acid
sequence of any one of the V.sub.H domains of a heavy chain
expressed by an anti-BSL1,-BSL2, or -BSL3 antibody-expressing cell
line of the invention and a V.sub.L domain having an amino acid
sequence of a light chain expressed by an anti-BSL1,-BSL2, or -BSL3
antibody-expressing cell line of the invention. In another
embodiment, a nucleic acid molecule of the invention encodes an
antibody (including molecules comprising, or alternatively
consisting of, antibody fragments or variants thereof), comprising,
or alternatively consisting of, a V.sub.H domain having an amino
acid sequence of any one of the V.sub.H domains of a heavy chain
expressed by an anti-BSL1, -BSL2, or -BSL3 antibody-expressing cell
line of the invention, or a V.sub.L domain having an amino acid
sequence of a light chain expressed by an anti-BSL1,-BSL2, or -BSL3
antibody-expressing cell line of the invention.
[0223] The present invention also provides antibodies that
comprise, or alternatively consist of, variants (including
derivatives) of the antibody molecules (e.g., the V.sub.H domains
and/or V.sub.L domains) described herein, which antibodies
immunospecifically bind to a B7-related polypeptide or fragment or
variant thereof, as disclosed herein.
[0224] Standard techniques known to those of skill in the art can
be used to introduce mutations in the nucleotide sequence encoding
a molecule of the invention, including, for example, site-directed
mutagenesis and PCR-mediated mutagenesis which result in amino acid
substitutions. Preferably the molecules are immunoglobulin
molecules. Also, preferably, the variants (including derivatives)
encode less than 50 amino acid substitutions, less than 40 amino
acid substitutions, less than 30 amino acid substitutions, less
than 25 amino acid substitutions, less than 20 amino acid
substitutions, less than 15 amino acid substitutions, less than 10
amino acid substitutions, less than 5 amino acid substitutions,
less than 4 amino acid substitutions, less than 3 amino acid
substitutions, or less than 2 amino acid substitutions, relative to
the reference V.sub.H domain, V.sub.H CDR1, V.sub.H CDR2, V.sub.H
CDR3, V.sub.L domain, V.sub.L CDR1, V.sub.L CDR2, or V.sub.L
CDR3.
[0225] A "conservative amino acid substitution" is one in which the
amino acid residue is replaced with an amino acid residue having a
side chain with a similar charge. Families of amino acid residues
having side chains with similar charges have been defined in the
art. These families include amino acids with basic side chains
(e.g., lysine, arginine, histidine), acidic side chains (e.g.,
aspartic acid, glutamic acid), uncharged polar side chains (e.g.,
glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine), nonpolar side chains (e.g., alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan),
beta-branched side chains (e.g., threonine, valine, isoleucine) and
aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan,
histidine). Alternatively, mutations can be introduced randomly
along all or part of the coding sequence, such as by saturation
mutagenesis. The resultant mutants can be screened for biological
activity to identify mutants that retain activity.
[0226] For example, it is possible to introduce mutations only in
framework regions or only in CDR regions of an antibody molecule.
Introduced mutations can be silent or neutral missense mutations,
i.e., have no, or little, effect on an antibody's ability to bind
antigen. These types of mutations can be useful to optimize codon
usage, or to improve hybridoma antibody production. Alternatively,
non-neutral missense mutations can alter an antibody's ability to
bind antigen. The location of most silent and neutral missense
mutations is likely to be in the framework regions, while the
location of most non-neutral missense mutations is likely to be in
the CDRs, although this is not an absolute requirement. One of
skill in the art is able to design and test mutant molecules with
desired properties, such as no alteration in antigen binding
activity or alteration in binding activity (e.g., improvements in
antigen binding activity or change in antibody specificity).
Following mutagenesis, the encoded protein may routinely be
expressed and the functional and/or biological activity of the
encoded protein can be determined using techniques described herein
or by routinely modifying techniques known and practiced in the
art.
[0227] In a specific embodiment, an antibody of the invention
(including a molecule comprising, or alternatively consisting of,
an antibody fragment or variant thereof), that immunospecifically
binds to B7-related polypeptides or fragments or variants disclosed
herein, comprises, or alternatively consists of, an amino acid
sequence encoded by a nucleotide sequence that hybridizes to a
nucleotide sequence that is complementary to that encoding one of
the V.sub.H or V.sub.L domains expressed by one or more
anti-BSL1,-BSL2, or -BSL3 antibody-expressing cell lines of the
invention, preferably under stringent conditions, e.g.,
hybridization to filter-bound DNA in 6.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C. followed by
one or more washes in 0.2.times. SSC/0.1% SDS at about
50-65.degree. C., preferably under highly stringent conditions,
e.g., hybridization to filter-bound nucleic acid in 6.times. SSC at
about 45.degree. C. followed by one or more washes in 0.1.times.
SSC/0.2% SDS at about 68.degree. C., or under other stringent
hybridization conditions which are known to those of skill in the
art (see, for example, F. M. Ausubel et al., eds. (1989) Current
Protocols in Molecular Biology, Vol. I, Green Publishing
Associates, Inc. and John Wiley & Sons, Inc., New York at pages
6.3.1-6.3.6 and 2.10.3). Nucleic acid molecules encoding these
antibodies are also encompassed by the invention.
[0228] It is well known within the art that polypeptides, or
fragments or variants thereof, with similar amino acid sequences
often have similar structure and many of the same biological
activities. Thus, in one embodiment, an antibody (including a
molecule comprising, or alternatively consisting of, an antibody
fragment or variant thereof), that immunospecifically binds to a
B7-related polypeptide or fragments or variants of a B7-related
polypeptide disclosed herein, comprises, or alternatively consists
of, a V.sub.H domain having an amino acid sequence that is at least
35%, at least 40%, at least 45%, at least 50%, at least 55%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, or at least 99% identical
to the amino acid sequence of a V.sub.H domain of a heavy chain
expressed by an anti-BSL1, -BSL2, or -BSL3 antibody-expressing cell
line of the invention.
[0229] In another embodiment, an antibody (including a molecule
comprising, or alternatively consisting of, an antibody fragment or
variant thereof), that immunospecifically binds to a B7-related
polypeptide or fragments or variants of a B7-related polypeptide
disclosed herein, comprises, or alternatively consists of, a
V.sub.L domain having an amino acid sequence that is at least 35%,
at least 40%, at least 45%, at least 50%, at least 55%, at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, or at least 99% identical to
the amino acid sequence of a V.sub.L domain of a light chain
expressed by an anti-BSL1,-BSL2, or -BSL3 antibody-expressing cell
line of the invention.
[0230] The present invention also provides antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof), that down-regulate the cell-surface
expression of a B7-related polypeptide of the invention, as
determined by any method known in the art such as, for example,
FACS analysis or immunofluorescence assays. By way of a
non-limiting hypothesis, such down- regulation may be the result of
antibody induced internalization of B7-related polypeptide of the
invention. Such antibodies can comprise, or alternatively consist
of, a portion (e.g., V.sub.H CDR1, V.sub.H CDR2, V.sub.H CDR3,
V.sub.L CDR1, V.sub.L CDR2, or V.sub.L CDR3) of a V.sub.H or
V.sub.L domain having an amino acid sequence of an antibody of the
invention, or a fragment or variant thereof.
[0231] In another embodiment, an antibody that down-regulates the
cell-surface expression of a B7-related polypeptide of the
invention comprises, or alternatively consists of, a polypeptide
having the amino acid sequence of a V.sub.H domain of an antibody
of the invention, or a fragment or variant thereof and a V.sub.L
domain of an antibody of the invention, or a fragment or variant
thereof. In another embodiment, an antibody that down-regulates the
cell-surface expression of a B7-related polypeptide of the
invention comprises, or alternatively consists of, a polypeptide
having the amino acid sequence of a V.sub.H domain and a V.sub.L
domain from a single antibody (or scFv or Fab fragment) of the
invention, or fragments or variants thereof. In another embodiment,
an antibody that down-regulates the cell-surface expression of a
B7-related polypeptide of the invention comprises, or alternatively
consists of, a polypeptide having the amino acid sequence of a
V.sub.H domain of an antibody of the invention, or a fragment or
variant thereof. In another embodiment, an antibody that
down-regulates the cell-surface expression of a B7-related
polypeptide of the invention comprises, or alternatively consists
of, a polypeptide having the amino acid sequence of a V.sub.L
domain of an antibody of the invention, or a fragment or variant
thereof.
[0232] In a preferred embodiment, an antibody that down-regulates
the cell-surface expression of a B7-related polypeptide of the
invention comprises, or alternatively consists of, a polypeptide
having the amino acid sequence of a V.sub.H CDR3 of an antibody of
the invention, or a fragment or variant thereof. In another
preferred embodiment, an antibody that down-regulates the
cell-surface expression of a B7-related polypeptide of the
invention comprises, or alternatively consists of, a polypeptide
having the amino acid sequence of a V.sub.L CDR3 of an antibody of
the invention, or a fragment or variant thereof. Nucleic acid
molecules encoding these antibodies are also encompassed by the
invention.
[0233] In another preferred embodiment, an antibody that enhances
the activity of a B7-related polypeptide, or a fragment or variant
disclosed herein, comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a V.sub.L CDR3 of an
antibody of the invention, or a fragment or variant thereof.
Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0234] As nonlimiting examples, antibodies of the present invention
can be used to purify, detect, and target the polypeptides of the
present invention, including both in vitro and in vivo diagnostic,
detection, screening, and/or therapeutic methods. For example, the
antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of the B7-related polypeptides of
the present invention in biological samples. (See, e.g., Harlow et
al. (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, 2nd Ed., which is incorporated by reference
herein in its entirety).
[0235] By way of another nonlimiting example, antibodies of the
invention can be administered to individuals as a form of passive
immunization. Alternatively, antibodies of the present invention
can be used for epitope mapping to identify the epitope(s) that are
bound by the antibody. Epitopes identified in this way can, in
turn, for example, be used as vaccine candidates, i.e., to immunize
an individual to elicit antibodies against the naturally-occurring
forms of one or more B7-related polypeptides of the invention.
[0236] As discussed in more detail below, the antibodies of the
present invention can be used either alone or in combination with
other compositions. The antibodies can further be recombinantly
fused to a heterologous polypeptide at the N-or C-terminus, or
chemically conjugated (including covalent and non-covalent
conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention can be recombinantly fused or
conjugated to molecules that are useful as labels in detection
assays and to effector molecules such as heterologous polypeptides,
drugs, radionucleotides, or toxins. See, e.g., PCT publications WO
92/08495; WO 91/14438; WO 89112624; U.S. Pat. No. 5,314,995 and EP
396, 387.
[0237] The antibodies of the invention include derivatives that are
modified, i.e., by the covalent attachment of any type of molecule
to the antibody. For example, without limitation, the antibody
derivatives include antibodies that have been modified, e.g., by
glycosylation, acetylation, pegylation, phosphorylation, amidation,
derivatization by known protecting/blocking groups, proteolytic
cleavage, linkage to a cellular ligand or other protein, etc. Any
of numerous chemical modifications may be carried out by known
techniques, including, but not limited to, specific chemical
cleavage, acetylation, formylation, metabolic synthesis of
tunicamycin, etc. Additionally, the derivative can contain one or
more non-classical amino acids.
[0238] The antibodies of the present invention may be generated by
any suitable method known in the art. Polyclonal antibodies
directed against an antigen or immunogen of interest can be
produced by various procedures well known in the art. For example,
a B7-related polypeptide or peptide of the invention can be
administered to various host animals as elucidated above to induce
the production of sera containing polyclonal antibodies specific
for the antigen. Various adjuvants may be used to increase the
immunological response, depending on the host species; adjuvants
include, but are not limited to, Freund's (complete and
incomplete), mineral gels such as aluminum hydroxide, surface
active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and potentially useful human adjuvants such as BCG
(bacille Calmette-Guerin) and corynebacterium parvum. Such
adjuvants are also well known in the art.
[0239] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art, including the use of hybridoma,
recombinant and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques as known and practiced in the art (as taught,
for example, in Harlow et al. (1988) Antibodies: A Laboratory
Manual (Cold Spring Harbor Laboratory Press, 2nd Ed.; and
Hammerling, et al., (1981) Monoclonal Antibodies and T-Cell
Hybridomas, Elsevier, N.Y., pages 563-681, the contents of which
are incorporated herein by reference in their entireties). The term
"monoclonal antibody" as used herein is not limited to antibodies
produced through hybridoma technology. The term "monoclonal
antibody" refers to an antibody that is derived from a single
clone, including any eukaryotic, prokaryotic, or phage clone, and
not the method by which it is produced.
[0240] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art.
In a nonlimiting example, mice can be immunized with a polypeptide
or peptide of the invention, or with a cell expressing the
polypeptide or peptide. Once an immune response is detected, e.g.,
antibodies specific for the antigen are detected in the sera of
immunized mice, the spleen is harvested and splenocytes are
isolated. The splenocytes are then fused by well known techniques
to any suitable myeloma cells, for example cells from cell line
SP2/0 or P3X63-AG8.653 available from the ATCC. Hybridomas are
selected and cloned by limiting dilution techniques. The hybridoma
clones are then assayed by methods known in the art to determine
and select those cells that secrete antibodies capable of binding
to a polypeptide of the invention. Ascites fluid, which generally
contains high levels of antibodies, can be generated by immunizing
mice with positive hybridoma clones.
[0241] Accordingly, the present invention encompasses methods of
generating monoclonal antibodies, as well as the antibodies
produced by these methods, comprising culturing a hybridoma cell
secreting an antibody of the invention wherein, preferably, the
hybridoma is generated by fusing splenocytes isolated from a mouse
immunized with a B7-related polypeptide or peptide antigen of the
invention with myeloma cells and then screening the hybridomas
resulting from the fusion for hybridoma clones that secrete an
antibody that binds to a polypeptide of the invention such as BSL1
(e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3
(e.g., SEQ I NO:15).
[0242] Another well known method for producing both polyclonal and
monoclonal human B cell lines is transformation using Epstein Barr
Virus (EBV). Protocols for generating EBV-transformed B cell lines
are commonly known in the art (see, for example, the protocol
outlined in Chapter 7.22 of Coligan et al., Eds., (1994) Current
Protocols in Immunology, John Wiley & Sons, NY, which is hereby
incorporated by reference herein in its entirety). The source of B
cells for transformation is commonly human peripheral blood, but B
cells for transformation can also be obtained from other sources
including, but not limited to, lymph node, tonsil, spleen, tumor
tissue, and infected tissues. Tissues are generally prepared as
single cell suspensions prior to EBV transformation. In addition,
T-cells that may be present in the B cell samples can be either
physically removed or inactivated (e.g., by treatment with
cyclosporin A). The removal of T-cells is often advantageous,
because T-cells from individuals seropositive for anti-EBV
antibodies can suppress B cell immortalization by EBV. In general,
a sample containing human B cells is inoculated with EBV and
cultured for 3-4 weeks. A typical source of EBV is the culture
supernatant of the B95-8 cell line (ATCC; VR-1492). Physical signs
of EBV transformation can generally be seen toward the end of the
3-4 week culture period.
[0243] By phase-contrast microscopy, transformed cells appear
large, clear and "hairy"; they tend to aggregate in tight clusters
of cells. Initially, EBV lines are generally polyclonal. However,
over prolonged periods of cell culture, EBV lines can become
monoclonal as a result of the selective outgrowth of particular B
cell clones. Alternatively, polyclonal EBV transformed lines can be
subcloned (e.g., by limiting dilution) or fused with a suitable
fusion partner and plated at limiting dilution to obtain monoclonal
B cell lines. Suitable fusion partners for EBV transformed cell
lines include mouse myeloma cell lines (e.g., SP2/0, X63-Ag8.653),
heteromyeloma cell lines (human.times.mouse; e.g., SPAM-8,
SBC-H20,.and CB-F7), and human cell lines (e.g., GM 1500, SKO-007,
RPMI 8226, and KR-4). Thus, the present invention also includes a
method of generating polyclonal or monoclonal human antibodies
against polypeptides of the invention or fragments thereof,
comprising EBV-transformation of human B cells.
[0244] Antibody fragments that recognize specific epitopes can be
generated by known techniques. For example, Fab and F(ab')2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F (ab') 2 fragments).
F(ab')2 fragments contain the variable region, the light chain
constant region and the CH1 domain of the heavy chain.
[0245] Antibodies encompassed by the present invention can also be
generated using various phage display methods known in the art. In
phage display methods, functional antibody domains are displayed on
the surface of phage particles that carry the polynucleotide
sequences encoding them. In a particular embodiment, such phage can
be utilized to display antigen binding domains expressed from a
repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an antigen binding domain that binds to
the antigen of interest can be selected or identified with antigen,
e.g., using labeled antigen or antigen bound or captured onto a
solid surface or bead. Phage used in these methods are typically
filamentous phage including fd and M13 binding domains expressed
from phage with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII
protein. Examples of phage display methods that can be used to make
the antibodies of the present invention include those disclosed in
Brinkman et al. (1995) J. Immunol. Methods, 182:41-50; Ames et al.
(1995) J. Immunol. Methods, 184:177-186; Kettleborough et al.
(1994) Eur. J. Immunol. 24:952-958; Persic et al. (1997) Gene,
187:9-18; Burton et al. (1994) Advances in Immunology, 57:191-280;
PCT application No. PCT/GB91/01134; PCT publications WO 90/02809;
WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO
95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484;
5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908;
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108, each of
which is incorporated herein by reference in its entirety.
[0246] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail below. For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2
fragments can also be employed using methods known in the art such
as those disclosed in PCT publication WO 92/22324; Mullinax et al.
(1992) BioTechniques, 12(6):864-869; Sawai et al. (1995) AJRI,
34:2634; and Better et al. (1988) Science, 240:1041-1043, which are
hereby incorporated by reference herein in their entireties.
[0247] Examples of techniques that can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al. (1991) Methods
Enzymol., 203:46-88; Shu et al. (1993) Proc. Nat. Acad. Sci. USA,
90:7995-7999; and Skerra et al. (1988) Science, 240:1038-1040. For
some uses, including the in vivo use of antibodies in humans and in
in vitro detection assays, it may be preferable to use chimeric,
humanized, or human antibodies. A chimeric antibody is a molecule
in which different portions of the antibody are derived from
different animal species, such as antibodies having a variable
region derived from a murine monoclonal antibody and a human
immunoglobulin constant region. Methods for producing chimeric
antibodies are known in the art. (See, e.g., Morrison (1985)
Science, 229:1202; Oi et al. (1986) BioTechniques, 4:214; Gillies
et al. (1989) J. Immunol. Methods, 125:191-202; and U.S. Pat. Nos.
5,807,715; 4,816,567; and 4,816,397, which are incorporated herein
by reference in their entirety).
[0248] Humanized antibodies are antibody molecules from non-human
species antibody that bind to the desired antigen and have one or
more complementarity determining regions (CDRs) from the nonhuman
species and framework regions from a human immunoglobulin molecule.
Often, framework residues in the human framework regions are
substituted with the corresponding residues from the CDR donor
antibody to alter, preferably improve, antigen binding. These
framework substitutions are identified by methods well known in the
art, e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding, and by sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; and Riechmann et al. (1988) Nature, 332:323,
which are incorporated herein by reference in their entireties).
Antibodies can be humanized using a variety of techniques known in
the art, including, for example, CDR-grafting (EP 239,400; PCT
publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and
5,585,089); veneering or resurfacing (EP 592,106; EP 519,596;
Padlan (1991) Molecular Immunology, 28:489-498; Studnicka et al.
(1994) Protein Engineering, 7(6):805-814; Roguska et al. (1994)
Proc. Natl. Acad. Sci. USA, 91:969-973; and chain shuffling (U.S.
Pat. No. 5,565,332).
[0249] Completely human antibodies can be made by a variety of
methods known in the art, including the phage display methods
described above, using antibody libraries derived from human
immunoglobulin sequences. See also, U.S. Pat. Nos. 4,444,887 and
4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO
98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741;
each of which is incorporated herein by reference in its
entirety.
[0250] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients, so as to avoid or
alleviate immune reaction to foreign protein. Human antibodies can
be made by a variety of methods known in the art, including the
phage display methods described above, using antibody libraries
derived from human immunoglobulin sequences. See also, U.S. Pat.
Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety.
[0251] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes can be introduced randomly, or by homologous
recombination, into mouse embryonic stem cells. Alternatively, the
human variable region, constant region, and diversity region may be
introduced into mouse embryonic stem cells, in addition to the
human heavy and light chain genes. The mouse heavy and light chain
immunoglobulin genes can be rendered nonfunctional separately or
simultaneously with the introduction of human immunoglobulin loci
by homologous recombination. In particular, homozygous deletion of
the J.sub.H region prevents endogenous antibody production. The
modified embryonic stem cells are expanded and microinjected into
blastocysts to produce chimeric mice. The chimeric mice are then
bred to produce homozygous offspring that express human antibodies.
The transgenic mice are immunized in the normal fashion with a
selected antigen, e.g., all or a portion of a polypeptide of the
invention.
[0252] Monoclonal antibodies directed against the antigen can be
obtained from the immunized transgenic mice using conventional
hybridoma technology. The human immunoglobulin transgenes harbored
by the transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation.
[0253] Thus, using such a technique, it is possible to produce
useful human IgG, IgA, IgM and IgE antibodies. For an overview of
the technology for producing human antibodies, see Lonberg and
Huszar (1995) Intl. Rev. Immunol. 13:65-93. For a detailed
discussion of the technology for producing human antibodies and
human monoclonal antibodies and protocols for producing such
antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047;
WO 96/34096; WO 96133735; European Patent No. 0 598 877; U.S. Pat.
Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016;
5,545,806; 5,814,318; 5,885,793; 5,916,771; 5,939,598; 6,075,181;
and 6,114,598, which are incorporated by reference herein in their
entirety. In addition, companies such as Abgenix, Inc. (Fremont,
Calif.) and Genpharm (San Jose, Calif.) can be engaged to provide
human antibodies directed against a selected antigen using
technology similar to the above described technologies.
[0254] Completely human antibodies that recognize a selected
epitope can be generated using a technique referred to as "guided
selection". In this approach, a selected non-human monoclonal
antibody, e.g., a mouse antibody, is used to guide the selection of
a completely human antibody recognizing the same epitope (Jespers
et al. (1988) BioTechnology, 12:899-903).
[0255] Further, antibodies to the polypeptides of the invention
can, in turn, be utilized to generate anti-idiotypic antibodies
that "mimic" B7-related polypeptides of the invention using
techniques well known to those skilled in the art. (See, e.g.,
Greenspan and Bona (1989) FASEB J. 7(5):437-444 and Nissinoff
(1991) J. Immunol. 147(8):2429-2438). For example, antibodies which
bind to and competitively inhibit polypeptide multimerization
and/or binding of a polypeptide of the invention to a ligand can be
used to generate anti-idiotypes that "mimic" one or more of the
BSL-1, BSL2, or BSL2 polypeptide domains and, as a consequence,
bind to and neutralize the polypeptide and/or its binding partner,
e.g., in therapeutic regimens. Such neutralizing anti-idiotypes or
Fab fragments of such anti-idiotypes can be used to neutralize
polypeptide activity. For example, such anti-idiotypic antibodies
can be used to bind a polypeptide of the invention and/or to bind
its, and thereby activate or block its biological activity.
[0256] Intrabodies are antibodies, often scFvs, that are expressed
from a recombinant nucleic acid molecule and are engineered to be
retained intracellularly (e.g., retained in the cytoplasm,
endoplasmic reticulum, or periplasm of the host cells). Intrabodies
can be used, for example, to ablate the function of a protein to
which the intrabody binds. The expression of intrabodies can also
be regulated through the use of inducible promoters in the nucleic
acid expression vector comprising nucleic acid encoding the
intrabody. Intrabodies of the invention can be produced using
methods known in the art, such as those disclosed and reviewed in
Chen et al. (1994) Hum. Gene Ther. 5:595-601; W. A. Marasco (1997)
Gene Ther. 4:11-15; Rondon and Marasco (1997) Annu. Rev. Microbiol.
51:257-283; Proba et al. (1998) J. Mol. Biol. 275:245-253; Cohen et
al. (1998) Oncogene, 17:2445-2456; Ohage and Steipe (1999) J. Mol.
Biol. 291:1119-1128; Ohage et al. (1999) J. Mol. Biol.
291:1129-1134; Wirtz and Steipe (1999) Protein Sci. 8:2245-2250;
Zhu et al. (1999) J. Immunol. Methods, 231:207-222.
[0257] XenoMouse Technology Antibodies in accordance with the
invention are preferably pre0pared by the utilization of a
transgenic mouse that has a substantial portion of the human
antibody producing genome inserted, but that is rendered deficient
in the production of endogenous murine antibodies (e.g., XenoMouse
strains available from Abgenix Inc., Fremont, Calif.). Such mice
are capable of producing human immunoglobulin molecules and
antibodies and are virtually deficient in the production of murine
immunoglobulin molecules and antibodies. Technologies utilized for
achieving the same are disclosed in the patents, applications, and
references disclosed herein.
[0258] The ability to clone and reconstruct megabase-sized human
loci in YACs and to introduce them into the mouse germine provides
a powerful approach to elucidating the functional components of
very large or crudely mapped loci, as well as generating useful
models of human disease. Furthermore, the utilization of such
technology for substitution of mouse loci with their human
equivalents could provide unique insights into the expression and
regulation of human gene products during development, their
communication with other systems, and their involvement in disease
induction and progression. An important practical application of
such a strategy is the "humanization" of the mouse humoral immune
system. Introduction of human immunoglobulin (Ig) loci into mice in
which the endogenous Ig genes have been inactivated offers the
opportunity to study the mechanisms underlying programmed
expression and assembly of antibodies as well as their role in B
cell development. Furthermore, such a strategy could provide an
ideal source for the production of fully human monoclonal
antibodies: an important milestone toward fulfilling the promise of
antibody therapy in human disease.
[0259] Fully human antibodies are expected to minimize the
immunogenic and allergic responses intrinsic to mouse or
mouse-derivatized monoclonal antibodies and thus to increase the
efficacy and safety of the administered antibodies. The use of
fully human antibodies can be expected to provide a substantial
advantage in the treatment of chronic and recurring human diseases,
such as cancer, which require repeated antibody
administrations.
[0260] One approach toward this goal was to engineer mouse strains
deficient in mouse antibody production to harbor large fragments of
the human Ig loci in anticipation that such mice would produce a
large repertoire of human antibodies in the absence of mouse
antibodies. Large human Ig fragments would preserve the large
variable gene diversity as well as the proper regulation of
antibody production and expression. By exploiting the mouse
machinery for antibody diversification and selection and the lack
of immunological tolerance to human proteins, the reproduced human
antibody repertoire in these mouse strains should yield high
affinity antibodies against any antigen of interest, including
human antigens. Using the hybridoma technology, antigen-specific
human monoclonal antibodies with the desired specificity could be
readily produced and selected.
[0261] This general strategy was demonstrated in connection with
the generation of the first "XenoMouseT" strains as published in
1994. See Green et al. (1994) Nature Genetics, 7:13-21. The
XenoMouse strains were engineered with yeast artificial chromosomes
(YACS) containing 245-kb and 10,190-kb-sized germine configuration
fragments of the human heavy chain locus and kappa light chain
locus, respectively, which contained core variable and constant
region sequences. Id. The human Ig containing YACs proved to be
compatible with the mouse system for both rearrangement and
expression of antibodies and were capable of substituting for the
inactivated mouse Ig genes. This was demonstrated by their ability
to induce B-cell development, to produce an adult-like human
repertoire of fully human antibodies, and to generate
antigen-specific human monoclonal antibodies. These results also
suggested that introduction of larger portions of the human Ig loci
containing greater numbers of V genes, additional regulatory
elements, and human Ig constant regions might recapitulate
substantially the full repertoire that is characteristic of the
human humoral response to infection and immunization. The work of
Green et al. was recently extended to the introduction of greater
than approximately 80% of the human antibody repertoire through the
use of megabase-sized, germline configuration YAC fragments of the
human heavy chain loci and kappa light chain loci, respectively, to
produce XenoMouse mice. See Mendez et al. (1997) Nature Genetics,
15:146-156; Green and Jakobovits (1998) J. Exp. Med. 188:483-495;
and Green (1999) J. Immunol. Methods, 231:11-23, the disclosures of
which are hereby incorporated herein by reference.
[0262] Human anti-mouse antibody (HAMA) responses have led the
industry to prepare chimeric or otherwise humanized antibodies.
While chimeric antibodies typically are comprised of a human
constant region and a murine variable region, it is expected that
certain human anti-chimeric antibody (HACA) responses will be
observed, particularly in treatments involving chronic or
multi-dose utilizations of the antibody. Thus, it is desirable to
provide fully human antibodies against B7-related polypeptides of
the invention in order to vitiate concerns and/or effects of HAMA
or HACA responses.
[0263] Polypeptide antibodies of the invention may be chemically
synthesized or produced through the use of recombinant expression
systems. Accordingly, the invention further embraces
polynucleotides comprising a nucleotide sequence encoding an
antibody of the invention and fragments thereof. The invention also
encompasses polynucleotides that hybridize under stringent or lower
stringency hybridization conditions, e.g., as defined supra, to
polynucleotides that encode an antibody, preferably, an antibody
that specifically binds to a polypeptide of the invention,
preferably, an antibody that binds to a polypeptide having the
amino acid sequence of one or more of the B7-related sequences as
set forth in FIGS. 1-6.
[0264] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody can be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al. (1994) BioTechniques, 17:242), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, the annealing and
ligating of those oligonucleotides, and then the amplification of
the ligated oligonucleotides by PCR.
[0265] Alternatively, a polynucleotide encoding an antibody can be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin can be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, (or a nucleic acid,
preferably poly(A).sup.+ RNA, isolated from), any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence. Alternatively, cloning using an oligonucleotide probe
specific for the particular gene sequence to identify, e.g., a cDNA
clone from a cDNA library that encodes the antibody can be
employed. Amplified nucleic acids generated by PCR can then be
cloned into replicable cloning vectors using any method well known
in the art.
[0266] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody are determined, the nucleotide sequence of
the antibody can be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al. (1990) Molecular
Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.; and Ausubel et al., eds.,
(1998) Current Protocols in Molecular Biology, John Wiley &
Sons, NY, which are both incorporated by reference herein in their
entireties), to generate antibodies having a different amino acid
sequence, for example, to create amino acid substitutions,
deletions, and/or insertions.
[0267] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains can be inspected to
identify the sequences of the CDRs by methods that are well known
in the art, e.g., by comparison to known amino acid sequences of
other heavy and light chain variable regions, to determine the
regions of sequence hypervariability. Using routine recombinant DNA
techniques, one or more of the CDRs can be inserted within
framework regions, e.g., into human framework regions, to humanize
a non-human antibody, as described supra. The framework regions can
be naturally occurring or consensus framework regions, and
preferably, are human framework regions (see, e.g., Chothia et al.
(1998) J. Mol. Biol. 278:457-479 for a listing of human framework
regions).
[0268] Preferably, the polynucleotide generated by the combination
of the framework regions and CDRs encodes an antibody that
specifically binds to a B7-related polypeptide of the invention.
Also preferably, as discussed supra, one or more amino acid
substitutions can be made within the framework regions; such amino
acid substitutions are performed with the goal of improving binding
of the antibody to its antigen. In addition, such methods can be
used to make amino acid substitutions or deletions of one or more
variable region cysteine residues participating in an intrachain
disulfide bond to generate antibody molecules lacking one or more
intrachain disulfide bonds. Other alterations to the polynucleotide
are encompassed by the present invention and are within the skill
of the art.
[0269] For some uses, such as for in vitro affinity maturation of
an antibody of the invention, it is useful to express the V.sub.H
and V.sub.L domains of the heavy and light chains of one or more
antibodies of the invention as single chain antibodies, or Fab
fragments, in a phage display library using phage display methods
as described supra. For example, the cDNAs encoding the V.sub.H and
V.sub.L domains of one or more antibodies of the invention can be
expressed in all possible combinations using a phage display
library, thereby allowing for the selection of V.sub.H/V.sub.L
combinations that bind to the B7-related polypeptides according to
the present invention with preferred binding characteristics such
as improved affinity or improved off rates. In addition, V.sub.H
and V.sub.L segments, particularly, the CDR regions of the V.sub.H
and V.sub.L domains of one or more antibodies of the invention, can
be mutated in vitro. Expression of V.sub.H and V.sub.L domains with
"mutant" CDRs in a phage display library allows for the selection
of V.sub.H/V.sub.L combinations that bind to B7-related
polypeptides of the invention with preferred binding
characteristics such as improved affinity or improved off
rates.
[0270] In phage display methods, functional antibody domains are
displayed on the surface of phage particles that carry the
polynucleotide sequences encoding them. In particular, DNA
sequences encoding the V.sub.H and V.sub.L domains are amplified
from animal cDNA libraries (e.g., human or murine cDNA libraries of
lymphoid tissues) or from synthetic cDNA libraries. The DNA
encoding the V.sub.H and V.sub.L domains are joined together by an
scFv linker by PCR and cloned into a phagemid vector (e.g., p
CANTAB 6 or pComb 3 HSS). The vector is introduced into E. coli via
electroporation and the E. coli is infected with helper phage.
Phage used in these methods are typically filamentous phage,
including fd and M13, and the V.sub.H and V.sub.L domains are
usually recombinantly fused either to the phage gene III or gene
VIII. Phage expressing an antigen binding domain that binds to an
antigen of interest (i.e., a B7-related polypeptide of the
invention or a fragment thereof) can be selected or identified with
antigen, e.g., using labeled antigen or antigen bound or captured
onto a solid surface or bead.
[0271] The antibodies according to the invention can be produced by
any method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis, by intracellular immunization
(i.e., intrabody technology), or preferably, by recombinant
expression techniques. Methods of producing antibodies include, but
are not limited to, hybridoma technology, EBV transformation, and
other methods discussed herein as well as through the use
recombinant DNA technology, as discussed below.
[0272] Recombinant expression of an antibody of the invention, or
fragment, derivative, variant or analog thereof, (e.g., a heavy or
light chain of an antibody of the invention or a single chain
antibody of the invention), requires construction of an expression
vector containing a polynucleotide that encodes the antibody. Once
a polynucleotide encoding an antibody molecule or a heavy or light
chain of an antibody, or portion thereof (preferably containing the
heavy or light chain variable domain), of the invention has been
obtained, the vector for the production of the antibody molecule
can be produced by recombinant DNA technology using techniques well
known in the art. Methods for preparing a protein by expressing a
polynucleotide encoding an antibody are described herein. Methods
that are well known to those skilled in the art can be used to
construct expression vectors containing antibody coding sequences
and appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus embraces replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, or a heavy or light chain thereof, or a heavy or
light chain variable domain, operably linked to a promoter. Such
vectors can include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464)
and the variable domain of the antibody can be cloned into such a
vector for expression of the entire heavy or light chain.
[0273] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
Thus, the invention includes host cells containing a polynucleotide
encoding an antibody of the invention, or a heavy or light chain
thereof, or a single chain antibody of the invention, operably
linked to a heterologous promoter. In preferred embodiments for the
expression of double-chained antibodies, vectors encoding both the
heavy and light chains may be co-expressed in the host cell for
expression of the entire immunoglobulin molecule, as detailed
below.
[0274] A variety of host expression vector systems can be utilized
to express the antibody molecules of the invention. Such expression
systems represent vehicles by which the coding sequences of
interest can be expressed, their encoded products produced and
subsequently purified. These systems also represent cells that can,
when transformed or transfected with the appropriate nucleotide
coding sequences, express an antibody molecule of the invention in
situ. Cell expression systems include, but are not limited, to
microorganisms such as bacteria (e.g., E. coli, B. subtilis)
transformed with recombinant bacteriophage DNA, plasmid DNA or
cosmid DNA expression vectors containing antibody coding sequences;
yeast (e.g., Saccharomyces or Pichia) transformed with recombinant
yeast expression vectors containing antibody coding sequences;
insect cell systems infected with recombinant virus expression
vectors (e.g., baculovirus) containing antibody coding sequences;
plant cell systems infected with recombinant virus expression
vectors (e.g., cauliflower mosaic virus (CaMV) or tobacco mosaic
virus (TMV)), transformed with recombinant plasmid expression
vectors (e.g., Ti plasmid) containing antibody coding sequences; or
mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3, NSO cells)
harboring recombinant expression constructs containing promoters
derived from the genome of mammalian cells (e.g., metallothionein
promoter) or from mammalian viruses (e.g., the adenovirus late
promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial
cells such as E. coli, and more preferably, eukaryotic cells,
especially for the expression of whole recombinant antibody
molecules, are used for the expression of a recombinant antibody
molecule. For example, mammalian cells such as Chinese hamster
ovary (CHO) cells, in conjunction with a vector such as the major
intermediate early gene promoter element from human
cytomegalovirus, is an effective expression system for antibodies
(Foecking et al. (1986) Gene, 45:101; Cockett et al. (1990)
BioTechnology, 8:2).
[0275] In bacterial systems, a number of expression vectors can be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced for the generation of
pharmaceutical compositions of an antibody molecule, for example,
vectors that direct the expression of high levels of fusion protein
products that are readily purified are often desirable. Such
vectors include, but are not limited to, the E. coli expression
vector pUR278 (Ruther et al. (1983) EMBO J. 2:1791), in which the
antibody coding sequence can be ligated individually into the
vector in-frame with the lacZ coding region so that a fusion
protein is produced; pIN vectors (Inouye & Inouye (1985)
Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster (1989) J.
Biol. Chem. 24:5503-5509; and the like). pGEX vectors may also be
used to express foreign polypeptides as fusion proteins with
glutathione S-transferase (GST). In general, such fusion proteins
are soluble and can easily be purified from lysed cells by
adsorption and binding to matrix glutathione-agarose beads followed
by elution in the presence of free glutathione. The pGEX vectors
are designed to include thrombin or factor Xa protease cleavage
sites so that the cloned target gene product can be released from
the GST moiety.
[0276] In an insect system, Autographa califormica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera figuriperda cells. The
antibody coding sequence may be cloned individually into
non-essential regions (for example the polyhedrin gene) of the
virus and placed under control of an AcNPV promoter (for example
the polyhedrin promoter).
[0277] In mammalian host cells, a number of viral based expression
systems can be utilized. In cases in which an adenovirus is used as
an expression vector, the antibody coding sequence of interest can
be ligated to an adenovirus transcription/translation control
complex, e.g., the late promoter and tripartite leader sequence.
This chimeric gene can then be inserted in the adenovirus genome by
in vitro or in vivo recombination. Insertion in a non-essential
region of the viral genome (e.g., region E1 or E3) results in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts. (See, e.g., Logan and Shenk
(1984) Proc. Natl. Acad. Sci. USA, 81:355-359). Specific initiation
signals can also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in-phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression can be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see Bittner et al. (1987) Methods in Enzymol.
153:51-544).
[0278] In addition, a host cell strain can be chosen to modulate
the expression of the inserted sequences, or modify and process the
gene product in the specific fashion desired. Such modifications
(e.g., glycosylation) and processing (e.g., cleavage) of protein
products can be important for the function of the protein.
[0279] Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells that possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product can be used. Such mammalian
host cells include, but are not limited to, CHO, VERY, BHK, HeLa,
COS, MDCK, 293, 3T3, W138, and in particular, breast cancer cell
lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and
normal mammary gland cell lines such as, for example, CRL7030 and
Hs578Bst.
[0280] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
that stably express the antibody molecule can be engineered. Rather
than using expression vectors that contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoters, enhancer
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, such genetically engineered cells can be allowed to grow for
1-2 days in an enriched medium, and then are typically replated in
a selective medium. A selectable marker in the recombinant plasmid
confers resistance to the selection and allows cells to stably
integrate the plasmid into their chromosomes and grow to form foci
which, in turn, can be cloned and expanded into cell lines. This
method can advantageously be used to engineer cell lines expressing
the antibody molecule. Such engineered cell lines are particularly
useful in screening and evaluation of compounds that interact
directly or indirectly with the antibody molecule.
[0281] A number of selection systems can be used, including but not
limited to, herpes simplex virus thymidine kinase (HSV TK), (Wigler
et al. (1977) Cell, 11:223), hypoxanthine-guanine
phosphoribosyltransferase (HGPRT), (Szybalska and Szybalski (1992)
Proc. Natl. Acad. Sci. USA, 48:202), and adenine
phosphoribosyltransferase (Lowy et al. (1980) Cell, 22:817) genes
can be employed in tk-, hgprt-, or aprt-cells (APRT),
respectively.
[0282] In addition, anti-metabolite resistance can be used as the
basis of selection for the following genes: dhfr, which confers
resistance to methotrexate (Wigler et al. (1980) Proc. Natl. Acad.
Sci. USA, 77:357; and O'Hare et al. (1981) Proc. Natl. Acad. Sci.
USA, 78:1527); gpt, which confers resistance to mycophenolic acid
(Mulligan and Berg (1981) Proc. Natl. Acad. Sci. USA, 78:2072);
neo, which confers resistance to the aminoglycoside G418 (Clinical
Pharmacy, 12:488-505; Wu and Wu (1991) Biotherapy, 3:87-95;
Tolstoshev (1993) Ann. Rev. Pharmacol. Toxicol. 32:573-596;
Mulligan (1993) Science, 260:926-932; Anderson (1993) Ann. Rev.
Biochem. 62:191-21; May (1993) TIB TECH, 11(5):155-215; and hygro,
which confers resistance to hygromycin (Santerre et al. (1984)
Gene, 30:147). Methods commonly known in the art of recombinant DNA
technology can be routinely applied to select the desired
recombinant clone; such methods are described, for example, in
Ausubel et al., eds., (1990) Current Protocols in Molecular
Biology, John Wiley & Sons, NY; Kriegler (1990) Gene Transfer
and Expression, A Laboratory Manual, Stockton Press, NY; in
Chapters 12 and 13, Dracopoli et al., eds., (1994) Current
Protocols in Human Genetics, John Wiley & Sons, NY;
Colberre-Garapin et al. (1981) J. Mol. Biol. 150:1, which are
incorporated by reference herein in their entireties.
[0283] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel (1987) The Use of Vectors Based on Gene Amplification for
the Expression of Cloned Genes in Mammalian Cells In DNA Cloning,
Vol. 3. Academic Press, New York). When a marker in the vector
system expressing an antibody is amplifiable, an increase in the
level of inhibitor present in the host cell culture will increase
the number of copies of the marker gene. Since the amplified region
is associated with the antibody gene, production of the antibody
will also increase (Crouse et al. (1983) Mol. Cell. Biol.
3:257).
[0284] Vectors that use glutamine synthase (GS) or DHFR as the
selectable markers can be amplified in the presence of the drugs
methionine sulphoximine or methotrexate, respectively. An advantage
of glutamine synthase based vectors is the availability of cell
lines (e.g., the murine myeloma cell line, NSO) which are glutamine
synthase negative. Glutamine synthase expression systems can also
function in glutamine synthase expressing cells (e.g. Chinese
Hamster Ovary (CHO) cells) by providing additional inhibitor to
prevent the functioning of the endogenous gene.
[0285] Vectors that express glutamine synthase as the selectable
marker include, but are not limited to, the pEE6 expression vector
(described in Stephens and Cockett (1989) Nucl Acids. Res.
17:7110). A glutamine synthase expression system and components
thereof are detailed in PCT publications: W087/04462; W086/05807;
W089/01036; W089/10404; and W091/06657, which are incorporated by
reference herein in their entireties. In addition, glutamine
synthase expression vectors that can be used in accordance with the
present invention are commercially available from suppliers,
including, for example, Lonza Biologics, Inc. (Portsmouth, N.H.).
The expression and production of monoclonal antibodies using a GS
expression system in murine myeloma cells has been described
(Bebbington et al. (1992) BioTechnology, 10:169 and in Biblia and
Robinson (1995) Biotechnol. Prog. 11:1, which are incorporated by
reference herein in their entireties).
[0286] A host cell can be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors can contain identical
selectable markers, which enable equal expression of heavy and
light chain polypeptides. Alternatively, a single vector can be
used which encodes, and is capable of expressing, both the heavy
and light chain polypeptides. In such situations, the light chain
should be placed before the heavy chain to avoid an excess of toxic
free heavy chain (Proudfoot (1986) Nature, 322:52; Kohler (1980)
Proc. Natl. Acad. Sci. USA, 77:2197). The coding sequences for the
heavy and light chains can comprise cDNA or genomic DNA.
[0287] Once an antibody molecule of the invention has been produced
by an animal, chemically synthesized, or recombinantly expressed,
it can be purified by any method known in the art for the
purification of an immunoglobulin or polypeptide molecule, for
example, by chromatography (e.g., ion exchange, affinity,
particularly by affinity for the specific antigen, Protein A, and
sizing column chromatography), centrifugation, differential
solubility, or by any other standard technique for the purification
of proteins. In addition, the antibodies of the present invention
or fragments thereof can be fused to heterologous polypeptide
sequences described herein or otherwise known in the art, to
facilitate purification.
[0288] The present invention encompasses antibodies that are
recombinantly fused or chemically conjugated (including both
covalently and non-covalently conjugated) to a polypeptide (or
portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70,
80, 90 or 100 contiguous amino acids of the polypeptide) of the
present invention, such as BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g.,
SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15), to generate
fusion proteins. The fusion does not necessarily need to be direct,
but can occur through linker sequences. The antibodies can be
specific for antigens other than polypeptides (or portions thereof,
preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100
contiguous amino acids of the polypeptide) of the present
invention. For example, antibodies can be used to target the
polypeptides of the present invention to particular cell types,
either in vitro or in vivo, by fusing or conjugating the
polypeptides of the present invention to antibodies specific for
particular cell surface receptors.
[0289] Polypeptides and/or antibodies of the present invention
(including fragments or variants thereof) can be fused to either
the N-terminal or C-terminal end of the heterologous protein (e.g.,
immunoglobulin Fc polypeptide or human serum albumin polypeptide).
Antibodies of the invention can also be fused to albumin
(including, but not limited to, recombinant human serum albumin
(see, e.g., U.S. Pat. No. 5,876,969, issued Mar. 2,1999; EP Patent
0 413 622; and U.S. Pat. No. 5,766,883, issued Jun. 16, 1998,
incorporated herein by reference in their entirety), resulting in
chimeric polypeptides. In a preferred embodiment, polypeptides
and/or antibodies of the present invention (including fragments or
variants thereof) are fused with the mature form of human serum
albumin (i.e., amino acids 1-585 of human serum albumin as shown in
FIGS. 1 and 2 of EP Patent 0 322 094, which is herein incorporated
by reference in its entirety). In another preferred embodiment,
polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) are fused with polypeptide fragments
comprising, or alternatively consisting of, amino acid residues 1-z
of human serum albumin, where z is an integer from 369 to 419, as
described in U.S. Pat. No. 5,766,883 incorporated herein by
reference in its entirety.
[0290] BSL1 (e.g., SEQ ID NO:4), BSL2 (e.g., SEQ ID NO:8, SEQ ID
NO:132, or SEQ ID NO:134), or BSL3 (e.g., SEQ ID NO:16)
polynucleotides encoding fusion proteins, and antibodies to these
fusion proteins, are also encompassed by the invention. Such fusion
proteins may, for example, facilitate purification and may increase
half-life in vivo. Antibodies fused or conjugated to the
polypeptides of the present invention may also be used in in vitro
immunoassays and purification methods using methods known in the
art. See, e.g., Harbor et al., supra, and PCT publication WO
93/21232; EP 439, 095; Naramura et al. (1994) Immunol. Lett.
39:91-99; U.S. Pat. No. 5,474,981; Gillies et al. (1992) Proc.
Natl. Acad. Sci. USA, 89:1428-1432; Fell et al. (1991) J. Immunol.
146:2446-2452, which are incorporated by reference herein in their
entireties. Antibodies to BSL1 (e.g., SEQ ID NO:5), BSL2 (e.g., SEQ
ID NO:9, SEQ ID NO:133, or SEQ ID NO:135), or BSL3 (e.g., SEQ ID
NO:17) fusion proteins can be used in any of the antibody-based
methods for polypeptide identification, purification, and for
antibody-format assays for diagnosis, treatment, and monitoring
known in the art and/or disclosed herein.
[0291] The present invention further includes compositions
comprising the B7-related polypeptides of the present invention
fused or conjugated to antibody domains other than the variable
region domain. For example, the polypeptides of the present
invention can be fused or conjugated to an antibody Fc region, or
portion thereof. The antibody portion fused to a polypeptide of the
present invention can comprise the constant region, hinge region,
CH1 domain, CH2 domain, CH3 domain, or any combination of whole
domains or portions thereof. The polypeptides can also be fused or
conjugated to the above antibody portions to form multimers. For
example, Fc portions fused to the polypeptides of the present
invention can form dimers through disulfide bonding between the Fc
portions. Higher multimeric forms can be made by fusing the
polypeptides to portions of IgA and IgM. Methods for fusing or
conjugating the polypeptides of the present invention to antibody
portions are known in the art. (See, e.g., U.S. Pat. Nos.
5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946;
EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570;
Ashkenazi et al. (1991) Proc. Natl. Acad. Sci. USA, 88:10535-10539;
Zheng et al. (1995) J. Immunol. 154:5590-5600; and Vil et al.,
Proc. Natl. Acad. Sci. USA, 89:11337-11341, which are hereby
incorporated by reference herein in their entireties).
[0292] As discussed supra, the polypeptides corresponding to a
polypeptide, polypeptide fragment, or a variant of one or more of a
B7-related amino acid sequence as set forth in FIGS. 1-6 can be
fused or conjugated to the above antibody portions to increase the
in vivo half life of the polypeptides, or for use in immunoassays
using methods known in the art. Further, the polypeptides
corresponding to one or more of the B7-related sequences as set
forth in FIGS. 1-6 can be fused or conjugated to the above antibody
portions to facilitate purification. For guidance, chimeric
proteins having the first two domains of the human CD4 polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins have been described. (EP
394,827; Traunecker et al. (1988) Nature, 331:84-86). The
polypeptides of the present invention fused or conjugated to an
antibody, or portion thereof, having disulfide-linked dimeric
structures (due to the IgG), for example, can also be more
efficient in binding and neutralizing other molecules, than the
monomeric secreted protein or protein fragment alone. (Fountoulakis
et al. (1995) J. Biochem. 270:3958-3964). In many cases, the Fc
portion in a fusion protein is beneficial in therapy, diagnosis,
and/or screening methods, and thus can result in, for example,
improved pharmacokinetic properties. (EP A 232, 262). In drug
discovery, for example, human proteins, such as hIL-5, have been
fused with Fc portions for the purpose of high-throughput screening
assays to identify antagonists of hIL-5. (See, Bennett et al.
(1995) J. Molecular Recognition, 8:52-58; and Johanson et al.
(1995) J. Biol. Chem. 270:9459-9471). Alternatively, deleting the
Fc portion after the fusion protein has been expressed, detected,
and purified, may be desired. For example, the Fc portion may
hinder therapy and diagnosis if the fusion protein is used as an
antigen for immunizations.
[0293] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide, to
facilitate their purification. In preferred embodiments, the marker
amino acid sequence is a hexa-histidine peptide, such as the tag
provided in a pQE vector (QIAGEN, Inc., Chatsworth, Calif.), among
others, many of which are commercially available. As described in
Gentz et al. (1989) Proc. Natl. Acad. Sci. USA, 86:821-824, for
instance, hexa histidine provides for convenient purification of
the fusion protein. Other peptide tags useful for purification
include, but are not limited to, the "HA" tag, which corresponds to
an epitope derived from the influenza hemagglutinin (HA) protein
(Wilson et al. (1984) Cell, 37:767) and the "flag" tag.
[0294] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic or therapeutic agent.
The antibodies can be used diagnostically to, for example, monitor
the development or progression of a tumor as part of a clinical
testing procedure, for example, to determine the efficacy of a
given treatment regimen. Detection can be facilitated by coupling
the antibody to a detectable substance. Nonlimiting examples of
detectable substances include various enzymes, prosthetic groups,
fluorescent materials, luminescent materials, bioluminescent
materials, radioactive materials, positron emitting metals using
various positron emission tomographies, and nonradioactive
paramagnetic metal ions. The detectable substance can be coupled or
conjugated either directly to the antibody (or fragment thereof) or
indirectly, through an intermediate (such as, for example, a linker
known in the art) using techniques known in the art. (See, for
example, U.S. Pat. No. 4,741,900 for metal ions that can be
conjugated to antibodies for use as diagnostics according to the
present invention).
[0295] Nonlimiting examples of suitable enzymes include horseradish
peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase; nonlimiting examples of suitable prosthetic
group complexes include streptavidin/biotin and avidin/biotin;
nonlimiting examples of suitable fluorescent materials include
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; a nonlimiting example of a luminescent material
includes luminol; nonlimiting examples of bioluminescent materials
include luciferase, luciferin, and aequorin; and nonlimiting
examples of suitable radioactive material include iodine
(.sup.125I, .sup.131I), carbon (.sup.14C), sulfur (3sus), tritium
(.sup.3H), indium (.sup.111In and other radioactive isotopes of
inidium), technetium (.sup.99Tc, .sup.99mTc), thallium (20'Ti),
gallium (.sup.68Ga, .sup.67Ga), palladium (.sup.103Pd), molybdenum
(.sup.99Mo), xenon (.sup.133Xe), fluorine (.sup.19F),.sup.153Sm,
.sup.177Lu, Gd, radioactive Pm, radioactive La, radioactive Yb,
.sup.166Ho, .sup.90Y, radioactive Sc, radioactive Re, radioactive
Re, .sup.142Pr, .sup.105Rh, and .sup.97Ru.
[0296] In specific embodiments, the B7-related polypeptides of the
invention are attached to macrocyclic chelators useful for
conjugating radiometal ions, including, but not limited to,
.sup.111I, .sup.177Lu, .sup.90Y, .sup.166Ho, and .sup.153Sm, to
polypeptides. In a preferred embodiment, the radiometal ion
associated with the macrocyclic chelators attached to the
B7-related polypeptides of the invention is .sup.111In. In another
preferred embodiment, the radiometal ion associated with the
macrocyclic chelator attached to the B7-related polypeptides of the
invention is .sup.90Y. In specific embodiments, the macrocyclic
chelator is 1, 4, 7, 10-tetraazacyclododecane-N, N.varies., N",
N'"-tetraacetic acid (DOTA). In other specific embodiments, the
DOTA is attached to the B7-related polypeptides of the invention
via a linker molecule.
[0297] Examples of linker molecules useful for conjugating DOTA to
a polypeptide are commonly known in the art. (See, for example,
DeNardo et al. (1998) Clin. Cancer Res. 4(10):2483-90; Peterson et
al. (1999) Bioconjug. Chem. 10(4):553-557; and Zimmerman et al.
(1999) Nucl. Med. Biol. 26(8): 943-950, which are hereby
incorporated by reference in their entirety. In addition, U.S. Pat.
Nos. 5,652,361 and 5,756,065, which disclose chelating agents that
can be conjugated to antibodies and methods for making and using
them, are hereby incorporated by reference in their entireties.
Though U.S. Pat. Nos. 5,652,361 and 5,756,065 focus on conjugating
chelating agents to antibodies, one skilled in the art can readily
adapt the methods disclosed therein in order to conjugate chelating
agents to other polypeptides.
[0298] Antibodies can also be attached to solid supports, which are
particularly useful for immunoassays or purification of the target
antigen. Such solid supports include, but are not limited to,
glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
[0299] Techniques for conjugating therapeutic moieties to
antibodies are well known, see, e.g., Arnon et al. (1985)
"Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer
Therapy", Monoclonal Antibodies And Cancer Therapy, Reisfeld et
al., eds., Alan R. Liss, Inc., pp. 243-56; Hellstrom et al. (1987)
"Antibodies For Drug Delivery", Controlled Drug Delivery, 2nd Ed.,
Robinson et al. (eds.), Marcel Deldcer, Inc., pp. 623-53; Thorpe,
(1985) "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al., eds., pp. 475-506; Baldwin et al.,
eds., (1985) "Analysis, Results, And Future Prospective Of The
Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy",
Monoclonal Antibodies For Cancer Detection And Therapy, Academic
Press, pp. 303-316; and Thorpe et al. (1982) Immunol. Rev.
62:119-158. Alternatively, an antibody can be conjugated to a
second antibody to form an antibody heteroconjugate, e.g., as
described in U.S. Pat. No. 4,676,980 to Segal, which is
incorporated herein by reference in its entirety. An antibody,
i.e., an antibody specific for a B7-related polypeptide of this
invention, with or without a therapeutic moiety conjugated to it,
and administered alone or in combination with cytotoxic factor(s)
and/or cytokine(s), can be used as a therapeutic.
[0300] The antibodies of the invention can be utilized for
immunophenotyping of cell lines and biological samples. The
translation product of the BSL1, BSL2, or BSL3-encoding sequences
of the present invention can be useful as cell specific marker(s),
or more specifically, as cellular marker(s) that are differentially
expressed at various stages of differentiation and/or maturation of
particular cell types. Monoclonal antibodies directed against a
specific epitope, or combination of epitopes, allow for the
screening of cellular populations expressing the marker. Various
techniques utilizing monoclonal antibodies can be employed to
screen for cellular populations expressing the marker(s), including
magnetic separation using antibody-coated magnetic beads, "panning"
with antibody(ies) attached to a solid matrix (i.e., tissue culture
plate), and flow cytometry (See, e.g., U.S. Pat. No. 5,985,660; and
Morrison et al. (1999) Cell, 96:737-749).
[0301] These techniques allow for the screening of particular
populations of cells, such as might be found with hematological
malignancies (i.e. minimal residual disease (MRD) in acute leukemic
patients) and "non-self" cells in transplantations to prevent
Graft-versus-Host Disease (GVHD). Alternatively, these techniques
allow for the screening of hematopoietic stem and progenitor cells
capable of undergoing proliferation and/or differentiation, as
might be found in human umbilical cord blood.
[0302] Antibodies according to this invention can be assayed for
immunospecific binding by any method known in the art. The
immunoassays which can be used include, but are not limited to,
competitive and non-competitive assay systems using techniques such
as BIAcore analysis, FACS (Fluorescence Activated Cell Sorter)
analysis, immunofluorescence, immunocytochemistry, Western blots,
radioimmunoassays, ELISA (enzyme linked immunosorbent assays),
"sandwich" immunoassays, immunoprecipitation assays, precipitin
reactions, gel diffusion precipitin reactions, immunodiffusion
assays, agglutination assays, complement fixation assays,
immunoradiometric assays, fluorescent immunoassays, protein A
immunoassays, to name but a few. Such assays are routine and well
known and practiced in the art (see, e.g., Ausubel et al, eds.,
(1994) Current Protocols in Molecular Biology, Vol. 1, John Wiley
& Sons, Inc., New York, which is incorporated by reference
herein in its entirety). Nonlimiting, exemplary immunoassays are
described briefly below.
[0303] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (i.e., 1%
NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M
NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented
with protein phosphatase and/or protease inhibitors (e.g., EDTA,
PMSF, aprotinin, sodium vanadate); adding the antibody of interest
to the cell lysate; incubating for a period of time (e.g., 1 to 4
hr) at 4.degree. C.; adding protein A and/or protein G sepharose
beads to the cell lysate; incubating for about 60 min or more at
4.degree. C.; washing the beads in lysis buffer; and resuspending
the beads in SDS/sample buffer. The ability of the antibody of
interest to immunoprecipitate a particular antigen can be assessed
by, for example, Western blot analysis. One of skill in the art
would be knowledgeable as to the parameters that can be modified to
increase the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols, see, e.g., Ausubel et al, eds., (1994) Current Protocols
in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New
York, at 10.16.1.
[0304] Western blot analysis generally comprises preparing protein
samples; electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS PAGE depending on the molecular weight of the
antigen); transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon; blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or nonfat
milk); washing the membrane in washing buffer (e.g.,
PBS-Tween.RTM.20); blocking the membrane with primary antibody (the
antibody of interest) diluted in blocking buffer; washing the
membrane in washing buffer; blocking the membrane with a secondary
antibody (which recognizes the primary antibody, e.g., an
anti-human antibody) conjugated to an enzymatic substrate (e.g.,
horseradish peroxidase or alkaline phosphatase) or radioactive
molecule (e.g., .sup.32P or .sub.125I) diluted in blocking buffer;
washing the membrane in wash buffer; and detecting the presence of
the antigen. One of skill in the art would be knowledgeable as to
the parameters that can be modified to increase the signal detected
and to reduce the background noise. For further discussion
regarding Western blot protocols, see, e.g., Ausubel et al, eds.
(1994) Current Protocols in Molecular Biology, Vol. 1, John Wiley
& Sons, Inc., New York, at 10.8.1.
[0305] ELISAs comprise preparing antigen; coating the wells of a 96
well microtiter plate with antigen; adding to the wells the
antibody of interest conjugated to a detectable compound such as an
enzymatic substrate (e.g., horseradish peroxidase or alkaline
phosphatase); incubating for a period of time; and detecting the
presence of the antigen. In ELISAs, the antibody of interest does
not have to be conjugated to a detectable compound; instead, a
second antibody (which recognizes the antibody of interest)
conjugated to a detectable compound can be added to the wells.
Further, instead of coating the wells with antigen, the antibody
can be first coated onto the well. In this case, a second antibody
conjugated to a detectable compound can be added to the
antibody-coated wells following the addition of the antigen of
interest. One of skill in the art would be knowledgeable as to the
parameters that can be modified to increase the signal detected, as
well as other variations of ELISAs known in the art.
[0306] In the initial steps, an ELISA assay may involve preparing
an antibody specific to antigens of a B7-related polypeptide or
peptide fragments thereof, preferably a monoclonal antibody. In
addition, a reporter antibody can be used to recognize and bind to
the monoclonal antibody. To the reporter antibody a detectable
reagent may be attached, such as a radioactive isotope, a
fluorescent moiety, or, in this example, an enzyme, such as
horseradish peroxidase. To carry out an ELISA assay, a sample can
be removed from a host, e.g., a patient sample, and incubated on a
solid support, e.g., wells of a microtiter plate, or a polystyrene
dish, to which the proteins in the sample can bind. Any free
protein binding sites on the dish may then be blocked by incubating
with a non-specific protein such as bovine serum albumin. The
monoclonal antibody can then be added to the solid support, e.g.,
the wells or the dish, and allowed to incubate.
[0307] During the incubation time, the monoclonal antibodies may
attach to any B7-related polypeptides or peptides that have
attached to the polystyrene dish. All unbound monoclonal antibody
can then be washed away using an appropriate buffer solution. The
reporter antibody, e.g., linked to horseradish peroxidase, can be
added to the support, thereby resulting in the binding of the
reporter antibody to any monoclonal antibody that has bound to
B7-related polypeptides or peptides that are present in the sample.
Unattached reporter antibody can then be washed away. Peroxidase
substrate can be added to the support and the amount of color
developed in a given time period can be taken to provide a
measurement of the amount of B7-related polypeptides or peptides
that are present in a given volume of patient sample when compared
against a standard curve. For further discussion regarding ELISAs,
see, e.g., Ausubel et al, eds. (1994) Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York,
at 11.2.1.
[0308] The binding affinity of an antibody to an antigen and the
off-rate of an antibody-antigen interaction can be determined by
competitive binding assays. One example of a competitive binding
assay is a radioimmunoassay involving the incubation of labeled
antigen (e.g., .sup.3H or 125I), or a fragment or variant thereof,
with the antibody of interest in the presence of increasing amounts
of labeled antigen, and the detection of the antibody bound to the
labeled antigen. The affinity of the antibody of interest for a
B7-related polypeptide of the invention and the binding off rates
can be determined from the data by Scatchard plot analysis.
Competition with a second antibody can also be determined using
radioimmunoassays. In this case, a B7-related polypeptide such as
BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or
BSL3 (e.g., SEQ ID NO:15) is incubated with antibody of interest
conjugated to a labeled compound (e.g., a compound labeled with
.sup.3H or 125I) in the presence of increasing amounts of an
unlabeled second antibody. This kind of competitive assay between
two antibodies, may also be used to determine if two antibodies
bind to the same or different epitopes.
[0309] In a preferred embodiment, BIAcore kinetic analysis is used
to determine the binding on and off rates of antibodies (including
antibody fragments or variants thereof) to a B7-related
polypeptide, or fragments or variants of a B7-related polypeptide
disclosed herein. Kinetic analysis comprises analyzing the binding
and dissociation of antibodies from chips with immobilized
B7-related polypeptide such as BSL1 (e.g., SEQ ID NO:2), BSL2
(e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15) on the
chip surface. Assays Utilizing B7-Related Nucleic Acids or
Polypeptides
[0310] Expression Analysis of B7-Related Factors:
[0311] Several well-established techniques can be used to determine
the expression levels, patterns, and cell-type specificity of the
B7-related factors. For example, mRNA levels can be determined
utilizing Northern blot analysis (J. C. Alwine et al. (1977) Proc.
Natl. Acad. Sci. USA 74:5350-5354; I. M. Bird (1998) Methods Mol.
Biol. 105:325-36.), whereby poly(A).sup.+ RNA is isolated from
cells, separated by gel electrophoresis, blotted onto a support
surface (e.g., nitrocellulose or Immobilon-Ny+ (Millipore Corp.,
Bedford, Mass.)), and incubated with a labeled (e.g., fluorescently
labeled or radiolabeled) oligonucleotide probe that is capable of
hybridizing with the mRNA of interest. Alternatively, mRNA levels
can be determined by quantitative (for review, see W. M. Freeman et
al. (1999) Biotechniques 26:112-122) or semi-quantitative RT-PCR
analysis (Ren et al. Mol. Brain Res. 59:256-63). In accordance with
this technique, poly(A).sup.+ RNA is isolated from cells, used for
cDNA synthesis, and the resultant cDNA is incubated with PCR
primers that are capable of hybridizing with the template and
amplifying the template sequence to produce levels of the PCR
product that are proportional to the cellular levels of the mRNA of
interest. Another technique, in situ hybridization, can also be
used to determine mRNA levels (reviewed by A. K. Raap (1998) Mutat.
Res. 400:287-298). In situ hybridization techniques allow the
visual detection of mRNA in a cell by incubating the cell with a
labeled (e.g., fluorescently labeled or digoxigenin labeled)
oligonucleotide probe that hybridizes to the mRNA of interest, and
then examining the cell by microscopy.
[0312] Chromosomal Mapping of B7-Related Genes:
[0313] The chromosomal location of B7-related genes can be
determined by various techniques known in the art. For example,
high-resolution chromosomal banding can be used (reviewed by M.
Ronne (1990) In Vivo 4:337-65). High-resolution banding techniques
utilize elongated chromosomes from cells at early mitotic stages,
which have been synchronized using DNA-synthesis inhibitors (e.g.,
methotrexate or thymidine) or DNA-binding agents (e.g., ethidium
bromide). However, these techniques can only be used to map a gene
to a relatively large region of a chromosome (.about.3 Mb). For
more accurate gene mapping, fluorescence in situ hybridization
(FISH) techniques can be used. In particular, high-resolution FISH
techniques (A. Palotie et al. (1996) Ann. Med. 28:101-106) utilize
free chromatin, DNA fibers, or mechanically-stretched chromosomes
to map gene sequences ranging from several kilobases to 300-kb in
size. Alternatively, the chromosomal location of a gene can be
determined from the appropriate genome database, for example, the
Homo sapiens genome database available at the Entrez Genome website
(National Center for Biotechnology Information, Bethesda, Md.).
[0314] Identification of T-Cell Ligands:
[0315] The B7-related polypeptides or peptides disclosed herein can
be used to identify their cognate ligands on immune or inflammatory
response cells, such as T-cells (i.e., CD28- or CTLA-4-related
ligands). Candidate ligands, or fragments derived therefrom, can be
identified and analyzed by many well-known methods in the art (see
T. E. Creighton, Ed. (1997) Proteins Structure: A Practical
Approach, IRL Press at Oxford Press, Oxford, England). For example,
T-cell ligands that bind to the B7-related polypeptides or peptides
can be identified from extracts or lysates obtained from animal,
preferably human, immune or inflammatory response cells (e.g.,
T-cells). The proteins obtained from these sources can be separated
into bands using sodium dodecylsulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and transferred by electroblotting, for
example, onto a suitable solid-phase support or membrane (e.g.,
nitrocellulose or polyvinylidene fluoride (PVDF)). The solid-phase
support or membrane can then be incubated with a labeled form of a
B7-related polypeptide or peptide, e.g., BSL1 (e.g., SEQ ID NO:2),
BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15).
Bands that exhibit specific binding with the labeled B7-related
polypeptide or peptide can then be identified, isolated, purified,
and analyzed by amino acid analysis and/or Edman degradation to
determine the amino acid sequence of peptides derived
therefrom.
[0316] As an alternative approach, a fusion protein comprising a
B7-related polypeptide can be attached to a solid support and
incubated with extracts obtained from cells, such as CHO or COS
cells, that are transfected with an appropriate cDNA library. For
example, a cDNA library can be constructed from resting or
activated immortal human T-cell lines, such as CEM, HUT78, or
Jurkat cell lines, or from resting or activated human T-cells
derived from peripheral blood, tonsil, spleen, thymus or other
specialized lymphoid tissues. Such cells can be activated by the
addition of anti-CD3 and anti-CD28 monoclonal antibodies,
phytohemaglutinin (PHA), or phorbol 12-myristate-13-acetate (PMA)
with ionomycin. The cDNA library construct can contain a removable
epitope tag (see above) that is different from the fusion protein,
and will facilitate purification of the library expression
product(s) that associate with the fusion protein. The isolated
library expression product(s) can then be isolated and
characterized.
[0317] In addition, a fusion protein comprising a B7-related
polypeptide can be attached to a solid support (e.g., a column
comprising beads that specifically bind to the fusion protein) and
incubated with lysates obtained from cells, such as T-cells, that
are enriched for integral membrane proteins. The cellular proteins
that associate with the fusion protein can be isolated and then
characterized using MALDI-TOF analysis (Matrix Assisted Laser
Desorption Ionization Time Of Flight Analysis; reviewed by Yates JR
3rd. (1998) J. Mass Spectrom. 33:1-19; P. Chaurand et al. (1999) J.
Am. Soc. Mass Spectrom. 10:91-103). Fusion proteins can include,
for example, FLAG.RTM.- (B. L. Brizzard et al. (1994) Biotechniques
16:730-735), 6.times.-HIS, and GST fusion proteins (see above),
which can be attached to solid supports that are conjugated with
anti-FLAG.RTM. antibodies, nickel, or glutathione molecules,
respectively. Methods of producing and purifying such fusion
proteins are well known in the art.
[0318] Another suitable ligand-binding assay is the yeast
two-hybrid system (Fields et al. (1989) Nature 340:245-246; U.S.
Pat. No. 5,283,173). The two-hybrid system relies on the
reconstitution of transcription activation activity by association
of the DNA-binding and transcription activation domains of a
transcriptional activator through protein-protein interaction. The
yeast GAL4 transcriptional activator may be used in this way,
although other transcription factors have been used and are well
known in the art. To carryout the two-hybrid assay, the GAL4
DNA-binding domain and the GAL4 transcription activation domain are
expressed, separately, as fusions to potential interacting
polypeptides. For example, one fusion protein can comprise a
B7-related polypeptide fused to the GAL4 DNA-binding domain. The
other fusion protein can comprise, for example, a T-cell cDNA
library encoded polypeptide fused to the GAL4 transcription
activation domain. If the two, coexpressed fusion proteins interact
in the nucleus of a host cell, a reporter gene (e.g. LacZ) is
activated to produce a detectable phenotype. The host cells that
show two-hybrid interactions can be used to isolate the containing
plasmids containing the cDNA library sequences. These plasmids can
be analyzed to determine the nucleic acid sequence and predicted
polypeptide sequence of the candidate T-cell ligand.
[0319] Related, in vivo, methods such as the three-hybrid (Licitra
et al. (1996) Proc. Natl. Acad. Sci. USA 93:12817-12821), and
reverse two-hybrid (Vidal et al. (1996) Proc. Natl. Acad. Sci. USA
93:10315-10320) systems may serve as alternative approaches.
Commercially available two-hybrid systems such as the CLONTECH
Matchmaker.TM. systems and protocols (CLONTECH, Palo Alto, Calif.)
may be also be used. (See also, A. R. Mendelsohn et al. (1994)
Curr. Op. Biotech. 5:482; E. M. Phizicky et al. (1995)
Microbiological Rev. 59:94; M. Yang et al. (1995) Nucleic Acids
Res. 23:1152; S. Fields et al. (1994) Trends Genet. 10:286; and
U.S. Pat. Nos. 6,283,173 and 5,468,614).
[0320] Ligand sequence(s) obtained from ligand-binding assay(s) can
be compared with subject sequences in available databases such as,
without limitation, GenPept, SWISS-PROT, and Incyte Genomics
databases (Incyte Genomics). These databases, which contain
previously identified and annotated sequences, may be searched for
the full-length polypeptide and gene sequence using, for example,
BLAST analysis (see above). In cases where the full-length
sequences of the ligands are not available, extended or overlapping
partial clones may be obtained by techniques conventionally known
and practiced in the art. Non-limiting examples of such techniques
include hybridization to plasmid or phage libraries of genomic DNA
or cDNA; PCR from the same libraries using B7-related factor primer
pairs; or hybridization or PCR directly to genomic DNA or cDNA.
These clones may then be sequenced and assembled into full-length
genes using the fragment sequence alignment program (PHRAP;
Nickerson et al. (1997) Nucleic Acids Res. 25:2745-2751).
[0321] Assays for B7-Related Factor Activity:
[0322] Screening the fragments, mutants or variants for those which
retain characteristic B7-related polypeptide activity as described
herein can be accomplished using one or more of several different
assays. For example, appropriate cells, such as CHO cells, can be
transfected with the cloned variants and then analyzed for cell
surface phenotype by indirect immunofluorescence and flow
cytometry. Cell surface expression of the transfected cells is
evaluated using a monoclonal antibody specifically reactive with a
cell surface form of a B7-related factor (see above). Production of
secreted forms of the B7-related factors can be evaluated by
immunoprecipitation using a monoclonal antibody specifically
reactive with a B7-related factor.
[0323] Other, more preferred, assays take advantage of the
functional characteristics of the B7-related factors. As previously
set forth, the binding of the B7-related factors to its T-cell
ligand(s) causes the cells to produce increased levels of
lymphokines, particularly of interleukin-2. Thus, B7-related factor
function can be assessed by measuring the synthesis of lymphokines,
such as interleukin-2 or other novel and as yet undefined
cytokines, and/or assaying for T-cell proliferation by CD28.sup.+
T-cells that have received a primary activation signal. Any one of
several conventional assays for interleukin-2 can be employed (see
C. B. Thompson (1989) Proc. Natl. Acad. Sci. USA 86:1333).
[0324] The same basic functional assays can also be used to screen
for B7-related polypeptides, peptides, fusion proteins, or
antibodies that block T-cell activation. The ability of such
proteins to block the normal costimulatory signal and induce a
state of anergy can be determined using subsequent attempts at
stimulation of the T-cells with antigen presenting cells that
express cell surface B cell activation antigen B7 and present
antigen. If the T-cells are unresponsive to the activation
attempts, as determined by IL-2 synthesis and T-cell proliferation,
a state of anergy has been induced and can be determined by methods
known in the art (see R. H. Schwartz (1990) Science
248:1349-1356).
[0325] Modulators of B7-Related Factors
[0326] The BSL1, BSL2, and BSL3 polypeptides, polynucleotides,
variants, or fragments thereof, can be used to screen for test
agents (e.g., agonists, antagonists, or inhibitors) that modulate
the levels or activity of the corresponding B7-related polypeptide.
In addition, B7-related molecules can be used to identify
endogenous modulators that bind to BSL1, BSL2, or BSL3 polypeptides
or polynucleotides in the cell. In one aspect of the present
invention, the full-length BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g.,
SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15) polypeptide
is used to identify modulators. Alternatively, variants or
fragments of a BSL1, BSL2, or BSL3 polypeptide are used. Such
fragments may comprise, for example, one or more domains of the
B7-related polypeptide (e.g., the extracellular and transmembrane
domains) disclosed herein. Of particular interest are screening
assays that identify agents that have relatively low levels of
toxicity in human cells. A wide variety of assays may be used for
this purpose, including in vitro protein-protein binding assays,
electrophoretic mobility shift assays, immunoassays, and the
like.
[0327] The term "modulator" as used herein describes any test
agent, molecule, protein, peptide, or compound with the capability
of directly or indirectly altering the physiological function,
stability, or levels of the BSL1, BSL2, and BSL3 polypeptide.
Modulators that bind to the B7-related polypeptides or
polynucleotides of the invention are potentially useful in
diagnostic applications and/or pharmaceutical compositions, as
described in detail herein. Test agents useful as modulators may
encompass numerous chemical classes, though typically they are
organic molecules, preferably small organic compounds having a
molecular weight of more than 50 and less than about 2,500 daltons.
Such molecules can comprise functional groups necessary for
structural interaction with proteins, particularly hydrogen
bonding, and typically include at least an amine, carbonyl,
hydroxyl or carboxyl group, preferably at least two of the
functional chemical groups. Test agents which can be used as
modulators often comprise cyclical carbon or heterocyclic
structures and/or aromatic or polyaromatic structures substituted
with one or more of the above functional groups. Test agents can
also comprise biomolecules including peptides, saccharides, fatty
acids, steroids, purines, pyrimidines, derivatives, structural
analogs, or combinations thereof.
[0328] Test agents finding use as modulators may include, for
example, 1) peptides such as soluble peptides, including Ig-tailed
fusion peptides and members of random peptide libraries (see, e.g.,
Lam et al. (1991) Nature 354:82-84; Houghten et al. (1991) Nature
354:84-86) and combinatorial chemistry-derived molecular libraries
made of D- and/or L-configuration amino acids; 2) phosphopeptides
(e.g., members of random and partially degenerate, directed
phosphopeptide libraries, see, e.g., Songyang et al., (1993) Cell
72:767-778); 3) antibodies (e.g., polyclonal, monoclonal,
humanized, anti-idiotypic, chimeric, and single chain antibodies as
well as Fab, F(ab').sub.2, Fab expression library fragments, and
epitope-binding fragments of antibodies); and 4) small organic and
inorganic molecules.
[0329] Test agents and modulators can be obtained from a wide
variety of sources including libraries of synthetic or natural
compounds. Synthetic compound libraries are commercially available
from, for example, Maybridge Chemical Co. (Trevillet, Cornwall,
UK), Comgenex (Princeton, N.J.), Brandon Associates (Merrimack,
N.H.), and Microsource (New Milford, Conn.). A rare chemical
library is available from Aldrich Chemical Company, Inc.
(Milwaukee, Wis.). Natural compound libraries comprising bacterial,
fungal, plant or animal extracts are available from, for example,
Pan Laboratories (Bothell, Wash.). In addition, numerous means are
available for random and directed synthesis of a wide variety of
organic compounds and biomolecules, including expression of
randomized oligonucleotides.
[0330] Alternatively, libraries of natural compounds in the form of
bacterial, fungal, plant and animal extracts can be readily
produced. Methods for the synthesis of molecular libraries are
readily available (see, e.g., DeWitt et al. (1993) Proc. Natl.
Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci.
USA 91:11422; Zuckermann et al. (1994) J. Med. Chem. 37:2678; Cho
et al. (1993) Science 261:1303; Carell et al. (1994) Angew. Chem.
Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed.
Engl. 33:2061; and in Gallop et al. (1994) J. Med. Chem. 37:1233).
In addition, natural or synthetic compound libraries and compounds
can be readily modified through conventional chemical, physical and
biochemical means (see, e.g., Blondelle et al. (1996) Trends in
Biotech. 14:60), and may be used to produce combinatorial
libraries. In another approach, previously identified
pharmacological agents can be subjected to directed or random
chemical modifications, such as acylation, alkylation,
esterification, amidification, and the analogs can be screened for
BSL1-, BSL2-, and BSL3-modulating activity.
[0331] Numerous methods for producing combinatorial libraries are
known in the art, including those involving biological libraries;
spatially addressable parallel solid phase or solution phase
libraries; synthetic library methods requiring deconvolution; the
`one-bead one-compound` library method; and synthetic library
methods using affinity chromatography selection. The biological
library approach is limited to polypeptide libraries, while the
other four approaches are applicable to polypeptide, non-peptide
oligomer, or small molecule libraries of compounds (K. S. Lam
(1997) Anticancer Drug Des. 12:145).
[0332] Libraries may be screened in solution (e.g., Houghten,
(1992) Biotechniques 13:412-421), or on beads (Lam, (1991) Nature
354:82-84), chips (Fodor, (1993) Nature 364:555-556), bacteria or
spores (Ladner U.S. Pat. No. 5,223,409), plasmids (Cull et al.
(1992) Proc. Natl. Acad. Sci. USA 89:1865-1869), or on phage (Scott
and Smith, (1990) Science 249:386-390; Devlin (1990) Science
249:404-406; Cwirla et al. (1990) Proc. Nat. Acad. Sci. USA
97:6378-6382; Felici (1991) J. Mol. Biol. 222:301-310; Ladner,
supra).
[0333] Where the screening assay is a binding assay, a BSL1, BSL2,
or BSL3 polypeptide, fusion protein, polynucleotide, analog, or
fragment thereof, may be joined to a label, where the label can
directly or indirectly provide a detectable signal. Various labels
include radioisotopes, fluorescers, chemiluminescers, enzymes,
specific binding molecules, particles, e.g. magnetic particles, and
the like. Specific binding molecules include pairs, such as biotin
and streptavidin, digoxin and antidigoxin, etc. For the specific
binding members, the complementary member would normally be labeled
with a molecule that provides for detection, in accordance with
known procedures.
[0334] A variety of other reagents may be included in the screening
assay. These include reagents like salts, neutral proteins, e.g.
albumin, detergents, etc., that are used to facilitate optimal
protein-protein binding and/or reduce non-specific or background
interactions. Reagents that improve the efficiency of the assay,
such as protease inhibitors, nuclease inhibitors, anti-microbial
agents, etc., may be used. The components are added in any order
that produces the requisite binding. Incubations are performed at
any temperature that facilitates optimal activity, typically
between 40 and 40.degree. C. Incubation periods are selected for
optimum activity, but may also be optimized to facilitate rapid
high-throughput screening. Normally, between 0.1 and 1 hour will be
sufficient. In general, a plurality of assay mixtures is run in
parallel with different agent concentrations to obtain a
differential response to these concentrations. Typically, one of
these concentrations serves as a negative control, i.e. at zero
concentration or below the level of detection.
[0335] To perform cell-free screening assays, it may be desirable
to immobilize either a BSL1, BSL2, or BSL3 polypeptide,
polynucleotide, or fragment to a surface to facilitate
identification of modulators that bind to these molecules, as well
as to accommodate automation of the assay. For example, a fusion
protein comprising a BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID
NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15) polypeptide and an
affinity-tag can be produced as described in detail herein. In one
embodiment, a GST-fusion protein comprising a BSL1, BSL2, or BSL3
polypeptide is adsorbed onto glutathione sepharose beads (Sigma
Chemical, St. Louis, Mo.) or glutathione-derivatized microtiter
plates. Cell lysates (e.g., containing .sup.35S-labeled
polypeptides) are added to the polypeptide-coated beads under
conditions to allow complex formation (e.g., at physiological
conditions for salt and pH). Following incubation, the
polypeptide-coated beads are washed to remove any unbound
polypeptides, and the amount of immobilized radiolabel is
determined. Alternatively, the complex is dissociated and the
radiolabel present in the supernatant is determined. In another
approach, the beads are analyzed by SDS-PAGE to identify BSL1-,
BSL2-, or BSL3-binding polypeptides.
[0336] Various binding assays can be used to identify agonist or
antagonists that alter the function or levels of a BSL1 (e.g., SEQ
ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ
ID NO:15) polypeptide. Such assays are designed to detect the
interaction of test agents with BSL1, BSL2, or BSL3 polypeptides,
polynucleotides, functional equivalents, or fragments thereof.
Interactions may be detected by direct measurement of binding.
Alternatively, interactions may be detected by indirect indicators
of binding, such as stabilization/destabilization of protein
structure, or activation/inhibition of biological function.
Non-limiting examples of useful binding assays are detailed
below.
[0337] Modulators that bind to BSL1, BSL2, or BSL3 polypeptides,
polynucleotides, functional equivalents, or fragments thereof, can
be identified using real-time Bimolecular Interaction Analysis
(BIA; Sjolander et al. (1991) Anal. Chem. 63:2338-2345; Szabo et
al. (1995) Curr. Opin. Struct. Biol. 5:699-705; e.g., BIAcore.TM.;
LKB Pharmacia, Sweden). Modulators can also be identified by
scintillation proximity assays (SPA, described in U.S. Pat. No.
4,568,649). Binding assays using mitochondrial targeting signals
(Hurt et al. (1985) EMBO J. 4:2061-2068; Eilers and Schatz, (1986)
Nature 322:228-231) a plurality of defined polymers synthesized on
a solid substrate (Fodor et al. (1991) Science 251:767-773) may
also be employed.
[0338] Two-hybrid systems may be used to identify modulators (see,
e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell
72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054;
Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi et al.
(1993) Oncogene 8:1693-1696; and Brent WO 94/10300). Alternatively,
three-hybrid (Licitra et al. (1996) Proc. Natl. Acad. Sci. USA
93:12817-12821), and reverse two-hybrid (Vidal et al. (1996) Proc.
Natl. Acad. Sci. USA 93:10315-10320) systems may be used.
Commercially available two-hybrid systems such as the CLONTECH
Matchmaker198 systems and protocols (CLONTECH Laboratories, Inc.,
Palo Alto, Calif.) are also useful (see also, A. R. Mendelsohn et
al. (1994) Curr. Op. Biotech. 5:482; E. M. Phizicky et al. (1995)
Microbiological Rev. 59:94; M. Yang et al. (1995) Nucleic Acids
Res. 23:1152; S. Fields et al. (1994) Trends Genet. 10:286; and
U.S. Pat. No. 6,283,173 and 5,468,614).
[0339] Several methods of automated assays have been developed in
recent years so as to permit screening of tens of thousands of test
agents in a short period of time. High-throughput screening methods
are particularly preferred for use with the present invention. The
binding assays described herein can be adapted for high-throughput
screens, or alternative screens may be employed. For example,
continuous format high throughput screens (CF-HTS) using at least
one porous matrix allows the researcher to test large numbers of
test agents for a wide range of biological or biochemical activity
(see U.S. Pat. No. 5,976,813 to Beutel et al.). Moreover, CF-HTS
can be used to perform multi-step assays.
[0340] Diagnostics
[0341] According to another embodiment of the present invention,
the B7-related polynucleotides, or fragments thereof, may be used
for diagnostic purposes. The B7-related polynucleotides that may be
used include oligonucleotide sequences, complementary RNA and DNA
molecules, and PNAs. BSL1 (e.g., SEQ ID NO:1 or 3), BSL2 (e.g., SEQ
ID NO:6, 10, 12, or 131), and BSL3 (e.g., SEQ ID NO:14)
polynucleotides, or fragments thereof, can be used to quantitate
levels of BSL1, BSL2, or BSL3 mRNA in biological samples in which
expression (or under- or overexpression) of BSL1, BSL2, and BSL3
polynucleotide may be correlated with disease. The diagnostic assay
may be used to distinguish between the absence, presence, increase,
and decrease of the expression of BSL1, BSL2, and BSL3, and to
monitor regulation of BSL1, BSL2, and BSL3 polynucleotide levels
during therapeutic treatment or intervention.
[0342] In one aspect, PCR probes can be used to detect B7-related
polynucleotide sequences, including BSL1, BSL2, and BSL3 genomic
DNA sequences and BSL1-, BSL2-, and BSL3-related nucleic acid
sequences. The specificity of the probe, whether it is made from a
highly specific region, e.g., at least 8 to 10 or 12 or 15
contiguous nucleotides in the 5' regulatory region, or a less
specific region, e.g., especially in the 3' coding region, and the
stringency of the hybridization or amplification (maximal, high,
intermediate, or low) will determine whether the probe identifies
only naturally occurring sequences encoding the B7-related
polypeptide, alleles thereof, or related sequences.
[0343] Probes may also be used for the detection of BSL1-, BSL2-,
and BSL3-related sequences, and should preferably contain at least
60%, preferably greater than 90%, identity to a BSL1 (e.g., SEQ ID
NO:1 or 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or 131), and BSL3
(e.g., SEQ ID NO:14) polynucleotide, or a complementary sequence,
or fragments thereof. The probes of this invention may be DNA or
RNA, the probes may comprise all or a fragment of the nucleotide
sequence of BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11,
or 13), or BSL3 (e.g., SEQ ID NO:15), or a complementary sequence
thereof, and may include promoter, enhancer elements, and introns
of the naturally occurring BSL1, BSL2, or BSL3 polynucleotide.
[0344] Methods for producing specific probes for B7-related
polynucleotides include the cloning of nucleic acid sequences of
BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or
BSL3 (e.g., SEQ ID NO:15), or a fragment thereof, into vectors for
the production of mRNA probes. Such vectors are known in the art,
commercially available, and may be used to synthesize RNA probes in
vitro by means of the addition of the appropriate RNA polymerases
and the appropriate labeled nucleotides. Hybridization probes may
be labeled by a variety of detector/reporter groups, e.g.,
radionucleotides such as .sup.32P or .sup.35S, or enzymatic labels,
such as alkaline phosphatase coupled to the probe via avidin/biotin
coupling systems, and the like.
[0345] A wide variety of labels and conjugation techniques are
known and employed by those skilled in the art and may be used in
various nucleic acid and amino acid assays. Means for producing
labeled hybridization or PCR probes for detecting sequences related
to polynucleotides encoding a BSL1, BSL2, or BSL3 polypeptide
include oligo-labeling, nick translation, end-labeling, or PCR
amplification using a labeled nucleotide. Alternatively, BSL1,
BSL2, or BSL3 polynucleotide sequences, or any portions or
fragments thereof, may be cloned into a vector for the production
of an mRNA probe. Such vectors are known in the art, are
commercially available, and may be used to synthesize RNA probes in
vitro by addition of an appropriate RNA polymerase, such as T7, T3,
or SP(6) and labeled nucleotides. These procedures may be conducted
using a variety of commercially available kits (e.g., from Amersham
Pharmacia Biotech, Inc., Piscataway, N.J.; Promega Corp., Madison
Wis.; and U.S. Biochemical Corp., U.S. Biochemical Amersham,
Cleveland, Ohio). Suitable reporter molecules or labels which may
be used include radionucleotides, enzymes, fluorescent,
chemiluminescent, or chromogenic agents, as well as substrates,
cofactors, inhibitors, magnetic particles, and the like.
[0346] B7-related polynucleotide sequences, or fragments, or
complementary sequences thereof, can be used in Southern or
Northern analysis, dot blot, or other membrane-based technologies;
in PCR technologies; or in dip stick, pin, ELISA or biochip assays
utilizing fluids or tissues from patient biopsies to detect the
status of, e.g., levels or overexpression of BSL1, BSL2, or BSL3,
or to detect altered BSL1, BSL2, or BSL3 expression. Such
qualitative or quantitative methods are well known in the art (G.
H. Keller and M. M. Manak (1993) DNA Probes, 2.sup.nd Ed, Macmillan
Publishers Ltd., England; D. W. Dieffenbach and G. S. Dveksler
(1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Press,
Plainview, N.Y.; B. D. Hames and S. J. Higgins (1985) Gene Probes
1, 2, IRL Press at Oxford University Press, Oxford, England).
[0347] BSL1, BSL2, and BSL3 oligonucleotides may be chemically
synthesized, generated enzymatically, or produced from a
recombinant source. Oligomers will preferably comprise two
nucleotide sequences, one with a sense orientation (5'.fwdarw.3')
and another with an antisense orientation (3'.fwdarw.5'), employed
under optimized conditions for identification of a specific gene or
condition. The same two oligomers, nested sets of oligomers, or
even a degenerate pool of oligomers may be employed under less
stringent conditions for detection and/or quantification of closely
related DNA or RNA sequences.
[0348] Methods suitable for quantifying the expression of
B7-related factors include radiolabeling or biotinylating
nucleotides, co-amplification of a control nucleic acid, and
standard curves onto which the experimental results are
interpolated (P. C. Melby et al. (1993) J. Immunol. Methods
159:235-244; and C. Duplaa et al. (1993) Anal. Biochem. 229-236).
The speed of quantifying multiple samples may be accelerated by
running the assay in an ELISA format where the oligomer of interest
is presented in various dilutions and a spectrophotometric or
calorimetric response gives rapid quantification.
[0349] In a particular aspect, a nucleic acid sequence
complementary to a B7-related polynucleotide, or fragment thereof,
may be useful in assays that detect diseases relating to aberrant
immune responses, particularly those described herein. A BSL1,
BSL2, and/or BSL3 polynucleotide can be labeled by standard
methods, and added to a biological sample from a subject under
conditions suitable for the formation of hybridization complexes.
After a suitable incubation period, the sample can be washed and
the signal is quantified and compared with a standard value. If the
amount of signal in the test sample is significantly altered from
that of a comparable negative control (normal) sample, the altered
levels of BSL1, BSL2, and/or BSL3 nucleotide sequence can be
correlated with the presence of the associated disease. Such assays
may also be used to evaluate the efficacy of a particular
prophylactic or therapeutic regimen in animal studies, in clinical
trials, or for an individual patient.
[0350] To provide a basis for the diagnosis of a disease associated
with altered expression of one or more B7-related factors, a normal
or standard profile for expression is established. This may be
accomplished by incubating biological samples taken from normal
subjects, either animal or human, with a sequence complementary to
a BSL1, BSL2, BSL3 polynucleotide, or a fragment thereof, under
conditions suitable for hybridization or amplification. Standard
hybridization may be quantified by comparing the values obtained
from normal subjects with those from an experiment where a known
amount of a substantially purified polynucleotide is used. Standard
values obtained from normal samples may be compared with values
obtained from samples from patients who are symptomatic for the
disease. Deviation between standard and subject (patient) values is
used to establish the presence of the condition.
[0351] Once the disease is diagnosed and a treatment protocol is
initiated, hybridization assays may be repeated on a regular basis
to evaluate whether the level of expression in the patient begins
to approximate that which is observed in a normal individual. The
results obtained from successive assays may be used to show the
efficacy of treatment over a period ranging from several days to
months.
[0352] With respect to diseases involving a hyperactive or
hypoactive immune response, the presence of an abnormal levels
(decreased or increased) of B7-related transcript in a biological
sample (e.g., body fluid, cells, tissues, or cell or tissue
extracts) from an individual may indicate a predisposition for the
development of the disease, or may provide a means for detecting
the disease prior to the appearance of actual clinical symptoms. A
more definitive diagnosis of this type may allow health
professionals to employ preventative measures or aggressive
treatment earlier, thereby preventing the development or further
progression of the disease.
[0353] In one particular aspect, BSL1, BSL2, and BSL3
oligonucleotides may be used for PCR-based diagnostics. For
example, PCR can be used to perform Genetic Bit Analysis (GBA) of
BSL1, BSL2, and/or BSL3 in accordance with published methods (T. T.
Nikiforov et al. (1994)Nucleic Acids Res. 22(20):4167-75; T. T.
Nikiforov et al. (1994) PCR Methods Appl. 3(5):285-91). In
PCR-based GBA, specific fragments of genomic DNA containing the
polymorphic site(s) are first amplified by PCR using one unmodified
and one phosphorothioate-modified primer. The double-stranded PCR
product is rendered single-stranded and then hybridized to
immobilized oligonucleotide primer in wells of a multi-well plate.
Notably, the primer is designed to anneal immediately adjacent to
the polymorphic site of interest. The 3' end of the primer is
extended using a mixture of individually labeled dideoxynucleoside
triphosphates. The label on the extended base is then determined.
Preferably, GBA is performed using semi-automated ELISA or biochip
formats (see, e.g., S. R. Head et al. (1997) Nucleic Acids Res.
25(24):5065-71; T. T. Nikiforov et al. (1994) Nucleic Acids Res.
22(20):4167-75).
[0354] In another embodiment of the present invention,
oligonucleotides, or longer fragments derived from at least one
B7-related polynucleotide sequence described herein may be used as
targets in a microarray (e.g., biochip) system. The microarray can
be used to monitor the expression level of large numbers of genes
simultaneously (to produce a transcript image), and to identify
genetic variants, mutations, and polymorphisms. This information
may be used to determine gene function, to understand the genetic
basis of a disease, to diagnose disease, and to develop and monitor
the activities of therapeutic or prophylactic agents. Preparation
and use of microarrays have been described in WO 95/11995 to Chee
et al.; D. J. Lockhart et al. (1996) Nature Biotechnology
14:1675-1680; M. Schena et al. (1996) Proc. Natl. Acad. Sc. USA
93:10614-10619; U.S. Pat. No. 6,015,702 to P. Lal et al.; J. Worley
et al. (2000) Microarray Biochip Technology, M. Schena, ed.,
Biotechniques Book, Natick, MA., pp. 65-86; Y. H. Rogers et al.
(1999) Anal. Biochem. 266(1):23-30; S. R. Head et al. (1999) Mol.
Cell. Probes. 13(2):81-7; S. J. Watson et al. (2000) Biol.
Psychiatry 48(12):1147-56.
[0355] In one application of the present invention, microarrays
containing arrays of B7-related polynucleotide sequences can be
used to measure the expression levels of B7-related factors in an
individual. In particular, to diagnose an individual with a
condition or disease correlated with altered BSL1, BSL2, and/or
BSL3 expression levels, a sample from a human or animal
(containing, e.g., mRNA) can be used as a probe on a biochip
containing an array of BSL1, BSL2, and/or BSL3 polynucleotides
(e.g., DNA) in decreasing concentrations (e.g., 1 ng, 0.1 ng, 0.01
ng, etc.). The test sample can be compared to samples from diseased
and normal samples. Biochips can also be used to identify BSL1,
BSL2, and BSL3 mutations or polymorphisms in a population,
including but not limited to, deletions, insertions, and
mismatches. For example, mutations can be identified by: (i)
placing B7-related polynucleotides of this invention onto a
biochip; (ii) taking a test sample (containing, e.g., mRNA) and
adding the sample to the biochip; (iii) determining if the test
samples hybridize to the B7-related polynucleotides attached to the
chip under various hybridization conditions (see, e.g., V. R.
Chechetkin et al. (2000) J. Biomol. Struct. Dyn. 18(1):83-101).
Alternatively microarray sequencing can be performed (see, e.g., E.
P. Diamandis (2000) Clin. Chem. 46(10):1523-5).
[0356] In another embodiment of this invention, a B7-related
nucleic acid sequence, or a complementary sequence, or fragment
thereof, can be used as probes which are useful for mapping the
naturally occurring genomic sequence. The sequences may be mapped
to a particular chromosome, to a specific region of a chromosome,
or to artificial chromosome constructions (HACs), yeast artificial
chromosomes (YACs), bacterial artificial chromosomes (BACs),
bacterial PI constructions, or single chromosome cDNA libraries
(see C. M. Price (1993) Blood Rev., 7:127-134 and by B. J. Trask
(1991) Trends Genet. 7:149-154).
[0357] In a further embodiment of the present invention, antibodies
which specifically bind to a BSL1, BSL2, or BSL3 polypeptide may be
used for the diagnosis of conditions or diseases characterized by
underexpression or overexpression of a BSL1, BSL2, or BSL3
polynucleotide or polypeptide, or in assays to monitor patients
being treated with a BSL1, BSL2, or BSL3 polypeptide, peptide, or
fusion protein, or a BSL1, BSL2, or BSL3 agonist, antagonist, or
inhibitor. The antibodies useful for diagnostic purposes may be
prepared in the same manner as those for use in therapeutic
methods, described herein. Diagnostic assays for a BSL1, BSL2, or
BSL3 polypeptide include methods that utilize the antibody and a
label to detect the protein in biological samples (e.g., human body
fluids, cells, tissues, or extracts of cells or tissues). The
antibodies may be used with or without modification, and may be
labeled by joining them, either covalently or non-covalently, with
a reporter molecule. A wide variety of reporter molecules that are
known in the art may be used, several of which are described
herein.
[0358] A number of fluorescent materials are known and can be
utilized to label a B7-related polypeptide or antibodies that
specifically bind thereto. These include, for example, fluorescein,
rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow. A
particular detecting material is anti-rabbit antibody prepared in
goats and conjugated with fluorescein through an isothiocyanate.
B7-related polypeptides or antibodies thereto can also be labeled
with a radioactive element or with an enzyme. The radioactive label
can be detected by any of the currently available counting
procedures. Preferred isotopes include .sup.3 H, .sup.14 C, .sup.32
P, .sup.35 S, .sup.36 Cl, .sup.51 Cr, .sup.57 Co, .sup.58 Co,
.sup.59 Fe, .sup.90 Y, .sup.125 I, .sup.131 I, and .sup.186 Re.
Enzyme labels are likewise useful, and can be detected by any of
the presently utilized calorimetric, spectrophotometric,
fluorospectrophotometric, amperometric, or gasometric techniques.
The enzyme can be conjugated by reaction with bridging molecules
such as carbodiimides, diisocyanates, glutaraldehyde, and the like.
Many enzymes, which can be used in these procedures, are known and
can be utilized. Preferred are peroxidase, .beta.-glucuronidase,
.beta.-D-glucosidase, .beta.-D-galactosidase, urease, glucose
oxidase plus peroxidase, and alkaline phosphatase (see, e.g., U.S.
Pat. Nos. 3,654,090; 3,850,752; and 4,016,043).
[0359] Antibody-based diagnostics and their application are
familiar to those skilled in the art and may be used in accordance
with the present invention. As non-limiting examples, "competitive"
(U.S. Pat. Nos. 3,654,090 and 3,850,752), "sandwich" (U.S. Pat. No.
4,016,043), and "double antibody," or "DASP" assays may be used.
Several procedures including ELISA, RIA, and FACS for measuring
B7-related polypeptide levels are known in the art and provide a
basis for diagnosing altered or abnormal levels of B7-related
polypeptide expression. Normal or standard values for B7-related
polypeptide expression are established by incubating biological
samples taken from normal subjects, preferably human, with antibody
to the B7-related polypeptide under conditions suitable for complex
formation. The amount of standard complex formation may be
quantified by various methods; photometric means are preferred.
Levels of the B7-related polypeptide expressed in the subject
sample, negative control (normal) sample, and positive control
(disease) sample are compared with the standard values. Deviation
between standard and subject values establishes the parameters for
diagnosing disease.
[0360] In another of its aspects, this invention relates to
diagnostic kits for detecting B7-related polynucleotide(s) or
polypeptide(s) as it relates to a disease or susceptibility to a
disease, particularly the disorders of the immune system described
herein. Such kits comprise one or more of the following: (a) a
B7-related polynucleotide, preferably the nucleotide sequence of
BSL1 (e.g., SEQ ID NO:1 or 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or
131), or BSL3 (e.g., SEQ ID NO:14), or a fragment thereof; or (b) a
nucleotide sequence complementary to that of (a); or (c) a
B7-related polypeptide, preferably the polypeptide of BSL1 (e.g.,
SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g.,
SEQ ID NO:15), or a fragment thereof; or (d) an antibody to a
B7-related polypeptide, preferably to the polypeptide of BSL1
(e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3
(e.g., SEQ ID NO:15), or an antibody bindable fragment thereof. It
will be appreciated that in any such kits, (a), (b), (c), or (d)
may comprise a substantial component and that instructions for use
can be included. The kits may also contain peripheral reagents such
as buffers, stabilizers, etc.
[0361] The present invention also includes a test kit for genetic
screening that can be utilized to identify mutations in B7-related
factors. By identifying patients with mutated BSL1, BSL2, and/or
BSL2 DNA and comparing the mutation to a database that contains
known mutations in BSL1, BSL2, and BSL3, and a particular condition
or disease, identification and/or confirmation of, a particular
condition or disease can be made. Accordingly, such a kit would
comprise a PCR-based test that would involve transcribing the
patients mRNA with a specific primer, and amplifying the resulting
cDNA using another set of primers. The amplified product would be
detectable by gel electrophoresis and could be compared with known
standards for BSL1, BSL2, and/or BSL3. Preferably, this kit would
utilize a patient's blood, serum, or saliva sample, and the DNA
would be extracted using standard techniques. Primers flanking a
known mutation would then be used to amplify a fragment of BSL1,
BSL2, and/or BSL3. The amplified piece would then be sequenced to
determine the presence of a mutation.
[0362] Therapeutics
[0363] Pharmaceutical Compositions:
[0364] The present invention contemplates compositions comprising a
B7-related nucleic acid, polypeptide, fusion protein, antibody,
ligand, modulator (e.g., agonist, antagonist, or inhibitor), or
fragments or functional variants thereof, and a physiologically
acceptable carrier, excipient, or diluent as described in detail
herein. The present invention further contemplates pharmaceutical
compositions useful in practicing the therapeutic methods of this
invention. Preferably, a pharmaceutical composition includes, in
admixture, a pharmaceutically acceptable excipient (carrier) and
one or more of a B7-related polypeptide, fusion protein, nucleic
acid, ligand, modulator, antibody, or fragment or functional
equivalent thereof, as described herein, as an active ingredient.
Because B7-related polypeptides or peptides are naturally occurring
cellular components, they may be administered to an individual's
circulatory system with minimal risk of undesired immunological
complications.
[0365] The preparation of pharmaceutical compositions that contain
biological reagents as active ingredients is well understood in the
art. Typically, such compositions are prepared as injectables,
either as liquid solutions or suspensions, however, solid forms
suitable for solution in, or suspension in, liquid prior to
injection can also be prepared. The preparation can also be
emulsified. The active therapeutic ingredient is often mixed with
excipients that are pharmaceutically acceptable and compatible with
the active ingredient. Suitable excipients are, for example, water,
saline, dextrose, glycerol, ethanol, or the like and combinations
thereof. In addition, if desired, the composition can contain minor
amounts of auxiliary substances such as wetting or emulsifying
agents, pH-buffering agents, which enhance the effectiveness of the
active ingredient.
[0366] Pharmaceutical compositions can be produced and employed in
treatment protocols according to established methods depending on
the disorder or disease to be treated (see, for example, P. D.
Mayne (1996) Clinical Chemistry in Diagnosis and Treatment,
6.sup.th ed., Oxford University Press, Oxford, England; Gilman et
al., Eds. (1990) Goodman and Gilman's: The Pharmacological Basis of
Therapeutics, 8th ed., Pergamon Press; Avis et al., Eds. (1993)
Pharmaceutical Dosage Forms: Parenteral Medications, Dekker, New
York, N.Y.; and Lieberman et al., Eds. (1990) Pharmaceutical Dosage
Forms: Disperse Systems, Dekker, New York, N.Y.).
[0367] Pharmaceutical compositions may be produced as neutral or
salt forms. Salts can be formed with many acids, including, but not
limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic
and succinic acids. Compositions can take the form of solutions,
suspensions, suppositories, tablets, pills, capsules, sustained
release compounds, or powders. Such formulations can contain
10%-95% (w/w) of the active ingredient, preferably 25%-70% (w/w).
If the active compound is administered by injection, for example,
about 1 .mu.g-3 mg and preferably from about 20 .mu.g-500 .mu.g of
active compound (e.g., B7-related fusion protein or antibody) per
dosage unit may be administered. Pharmaceutical preparations and
compositions can also contain one or more physiologically
acceptable carrier(s), excipient(s), diluent(s), disintegrant(s),
lubricant(s), plasticizer(s), filler(s), colorant(s), dosage
vehicle(s), absorption enhancer(s), stabilizer(s), or
bacteriocide(s). The production and formulation of such
compositions and preparations are carried out by methods known and
practiced in the art.
[0368] Exemplary Formulations are Given Below:
[0369] Intravenous Formulation I:
2 Ingredient mg/ml BSL1, BSL2, or BSL3 MAb 5.0 dextrose USP 45.0
sodium bisulfite USP 3.2 edetate disodium USP 0.1 water for
injection q.s.a.d. 1.0 ml Intravenous Formulation II: BSL1, BSL2,
or BSL3 MAb 5.0 sodium bisulfite USP 3.2 disodium edetate USP 0.1
water for injection q.s.a.d. 1.0 ml Intravenous Formulation III
BSL1, BSL2, or BSL3 protein, Ig-fusion protein, or agonist 10.0
sodium bisulfite USP 3.2 disodium edetate USP 0.1 water for
injection q.s.a.d. 1.0 ml Intravenous Formulation IV BSL1, BSL2, or
BSL3 protein, Ig-fusion protein, or agonist 10.0 dextrose USP 45.0
sodium bisulfite USP 3.2 edetate disodium USP 0.1 water for
injection q.s.a.d. 1.0 ml
[0370] As used herein, "pg" means picogram, "ng" means nanogram,
".mu.g" mean microgram, "mg" means milligram, ".mu.l" mean
microliter, "ml" means milliliter, and "I" means liter.
[0371] Following the preparation of pharmaceutical compositions,
they may be placed in appropriate containers and labeled for the
treatment of indicated conditions. Such labeling can include
amount, frequency, and method of administration. Preparations may
be administered systemically by oral or parenteral routes.
Non-limiting parenteral routes of administration include
subcutaneous, intramuscular, intraperitoneal, intravenous,
transdermal, inhalation, intranasal, intra-arterial, intrathecal,
enteral, sublingual, or rectal administration.
[0372] A therapeutically effective amount of a pharmaceutical
composition containing one or more B7-related polypeptides, fusion
proteins, peptide fragments, or antibodies that specifically react
with these components is an amount sufficient to reduce,
ameliorate, or eliminate a disease or disorder related to altered
activation levels of immune or inflammatory response cells, such as
T-cells. An effective amount can be introduced in one
administration or over repeated administrations to an individual
being treated. Therapeutic administration can be followed by
prophylactic administration, after treatment of the disease. A
prophylactically effective amount is an amount effective to prevent
disease and will depend upon the specific illness and subject. The
therapeutically effective dose may be estimated initially, for
example, either in cell culture assays or in animal models, usually
mice, rats, rabbits, dogs, sheep, goats, pigs, or non-human
primates. The animal model may also be used to determine the
maximum tolerated dose and appropriate route of administration.
Such information can then be used to determine useful doses and
routes for administration in humans.
[0373] Administration of the therapeutic compositions of the
present invention to a subject can be carried out using known
procedures, at dosages and for periods of time effective to achieve
the desired result. For example, a therapeutically active amount of
B7-related polypeptides, fusion proteins, peptides, or antibodies
that react with these components may vary according to factors such
as the age, sex, and weight of the individual, and the ability of
the treatment to elicit a desired response in the individual.
Dosages may be adjusted to provide the optimum therapeutic
response. For example, several sequential doses may be administered
daily or the dose may be proportionally reduced as indicated by the
exigencies of the therapeutic situation.
[0374] Gene Transfer Therapy:
[0375] In addition, host cells that are genetically engineered to
carry the gene encoding a B7-related polypeptide, fusion protein,
or peptide fragment comprising a fragment of a BSL1 (e.g., SEQ ID
NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID
NO:15) polypeptide sequence, can be introduced into an individual
in need of immunomodulation. Following expression and production of
the B7-related polypeptide or peptide by the host cell, the
so-produced B7-related polypeptide, fusion protein, or peptide can
act to bind CD28/CTLA-4 and/or CD28-/CTLA-4-related ligand(s) to
modulate the activation of immune or inflammatory response cells
(e.g., T-cells) in the recipient. Host cells may be genetically
engineered by a variety of molecular techniques and methods known
to those having skill in the art, for example, transfection,
infection, or transduction. Transduction as used herein commonly
refers to cells that have been genetically engineered to contain a
foreign or heterologous gene via the introduction of a viral or
non-viral vector into the cells. Transfection more commonly refers
to cells that have been genetically engineered to contain a foreign
gene harbored in a plasmid, or non-viral vector. Host cells can be
transfected or transduced by different vectors and thus can serve
as gene delivery vehicles to transfer the expressed products into
muscle.
[0376] Although viral vectors are preferred for gene transfer
therapies, cells can be genetically engineered to contain nucleic
acid sequences encoding the desired gene product(s) by various
methods known in the art. For example, cells can be genetically
engineered by fusion, transfection, lipofection mediated by the use
of liposomes, electroporation, precipitation with DEAE-Dextran or
calcium phosphate, particle bombardment (biolistics) with nucleic
acid-coated particles (e.g., gold particles), microinjection, or
genetically engineered microorganisms (K. Yazawa et al. (2000)
Cancer Gene Ther. 7:269-274). Vectors for introducing heterologous
(i.e., foreign) nucleic acid (DNA or RNA) into muscle cells for the
expression of active bioactive products are well known in the art.
Such vectors possess a promoter sequence, preferably a promoter
that is cell-specific and placed upstream of the sequence to be
expressed. The vectors may also contain, optionally, one or more
expressible marker genes for expression as an indication of
successful transfection and expression of the nucleic acid
sequences contained in the vector. In addition, vectors can be
optimized to minimize undesired immunogenicity and maximize
long-term expression of the desired gene product(s) (see Nabel
(1999) Proc. Natl. Acad. Sci. USA 96:324-326). Moreover, vectors
can be chosen based on cell-type that is targeted for treatment.
For example, vectors for the treatment of tumor or cancer cells
have been described (P. L. Hallenbeck et al. (1999) Hum. Gene Ther.
10:1721-1733; T. Shibata et al. (2000) Gene Ther. 7:493-498; M.
Puhlmann et al. (2000) Cancer Gene Ther. 7:66-73; N. Krauzewicz et
al. (2000) Adv. Exp. Med. Biol. 465:73-82).
[0377] Illustrative examples of vehicles or vector constructs for
transfection or infection of the host cells include
replication-defective viral vectors, DNA virus or RNA virus
(retrovirus) vectors, such as adenovirus, herpes simplex virus and
adeno-associated viral vectors. Adeno-associated virus vectors are
single stranded and allow the efficient delivery of multiple copies
of nucleic acid to the cell's nucleus. Preferred are adenovirus
vectors. The vectors will normally be substantially free of any
prokaryotic DNA and may comprise a number of different functional
nucleic acid sequences. An example of such functional sequences may
be a DNA region comprising transcriptional and translational
initiation and termination regulatory sequences, including
promoters (e.g., strong promoters, inducible promoters, and the
like) and enhancers which are active in the host cells. Also
included as part of the functional sequences is an open reading
frame (polynucleotide sequence) encoding a protein of interest.
Flanking sequences may also be included for site-directed
integration. In some situations, the 5'-flanking sequence will
allow homologous recombination, thus changing the nature of the
transcriptional initiation region, so as to provide for inducible
or noninducible transcription to increase or decrease the level of
transcription, as an example.
[0378] In general, the encoded and expressed B7-related factor may
be intracellular, i.e., retained in the cytoplasm, nucleus, or an
organelle of a cell, or may be secreted by the cell. For secretion,
the natural signal sequence present in the B7-related structural
gene may be retained. When the polypeptide or peptide is a fragment
of a B7-related factor that is larger, a signal sequence may be
provided so that, upon secretion and processing at the processing
site, the desired protein will have the natural sequence. Specific
examples of coding sequences of interest for use in accordance with
the present invention include the BSL1 (e.g., SEQ ID NO:2), BSL2
(e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15)
polypeptide coding sequences. As previously mentioned, a marker may
be present for selection of cells containing the vector construct.
The marker may be an inducible or non-inducible gene and will
generally allow for positive selection under induction, or without
induction, respectively. Examples of marker genes include neomycin,
dihydrofolate reductase, glutamine synthetase, and the like.
[0379] The vector employed will generally also include an origin of
replication and other genes that are necessary for replication in
the host cells, as routinely employed by those having skill in the
art. As an example, the replication system comprising the origin of
replication and any proteins associated with replication encoded by
a particular virus may be included as part of the construct. The
replication system must be selected so that the genes encoding
products necessary for replication do not ultimately transform the
cells. Such replication systems are represented by
replication-defective adenovirus (see G. Acsadi et al. (1994) Hum.
Mol. Genet. 3:579-584) and by Epstein-Barr virus. Examples of
replication defective vectors, particularly, retroviral vectors
that are replication defective, are BAG, (see Price et al. (1987)
Proc. Natl. Acad. Sci. USA, 84:156; Sanes et al. (1986) EMBO J.,
5:3133). It will be understood that the final gene construct may
contain one or more genes of interest, for example, a gene encoding
a bioactive metabolic molecule. In addition, cDNA, synthetically
produced DNA or chromosomal DNA may be employed utilizing methods
and protocols known and practiced by those having skill in the
art.
[0380] According to one approach for gene therapy, a vector
encoding a B7-related factor is directly injected into the
recipient cells (in vivo gene therapy). Alternatively, cells from
the intended recipients are explanted, genetically modified to
encode a B7-related factor, and reimplanted into the donor (ex vivo
gene therapy). An ex vivo approach provides the advantage of
efficient viral gene transfer, which is superior to in vivo gene
transfer approaches. In accordance with ex vivo gene therapy, the
host cells are first infected with engineered viral vectors
containing at least one B7-related gene encoding a B7-related gene
product, suspended in a physiologically acceptable carrier or
excipient such as saline or phosphate buffered saline, and the
like, and then administered to the host. The desired gene product
is expressed by the injected cells, which thus introduce the gene
product into the host. The introduced gene products can thereby be
utilized to treat or ameliorate a disorder that is related to
altered levels of the activation of immune or inflammatory response
cells (e.g., T-cells).
[0381] Methods of Immunomodulation:
[0382] In accordance with the present invention, the BSL1, BSL2,
and BSL3 nucleic acid and polypeptide sequences can be used in the
development of therapeutic reagents having the ability to either
up-regulate (amplify) or down-regulate (suppress) immune responses
(e.g., T-cell activation). In particular, B7-related polypeptides
may interact with CD28 and thereby up-regulate immune cell
activity. Alternatively, B7-related polypeptides may interact with
CTLA-4 and thereby down-regulate immune cell activity. For example,
soluble, dimeric forms of the B7-related polypeptides that bind to
the CD28 and/or CD28-related ligand(s) but fail to provide a
costimulatory signal to T-cells, can be used to block T-cell
activation, and thereby provide a specific means by which to induce
tolerance in a subject. Similarly, antibodies directed against one
or more B7-related factors can be used to block the interaction
between the B7-related factors and their cognate ligand(s), thereby
preventing the activation of immune or inflammatory response cells
(e.g., T-cells). In addition, fusion proteins comprising at least a
fragment of a B7-related factor fused to at least the Fc domain of
an IgG molecule can be used to up- or down-regulate cells
expressing the cognate ligand(s) of the B7-related factor (e.g.,
T-cells). Furthermore, antisense or triplex oligonucleotides that
bind to the nucleotide sequence of one or more B7-related factors
can be used to decrease the expression these factors. In contrast,
cell surface, multivalent forms of B7-related factors that bind to
CD28 and/or CD28-related ligand(s) and provide a costimulatory
signal to immune or inflammatory response cells, such as T-cells,
can be used to increase the activation of these cells. It is also
possible to utilize more than one B7-related polypeptide, fusion
protein, antibody, or therapeutically active fragments thereof, in
order to up-regulate or down-regulate the activity of immune or
inflammatory cells (e.g., T-cells) in an animal or human
subject.
[0383] In addition, it may also be advantageous to employ
B7-related therapeutics in conjunction with other therapeutics,
surgeries, or treatments. For example, pharmaceutical compositions
comprising BSL2vcvc-Ig or anti-BLS2 MAbs may be co-administered
with one or more immunosuppressants including, but not limited to,
corticosteroids such as cortisone, hydrocortisone (e.g.,
Cortef.RTM.), prednisone (e.g., Deltasone.RTM., Meticorten.RTM., or
Orasone.RTM.), prednisolone (e.g., Delta-Cortef.RTM.,
Pediapred.RTM., or Prelone.RTM.), triamcinolone (e.g.,
Aristocort.RTM. or Kenacort.RTM.), methylprednisolone (e.g.,
Medrol.RTM.), dexamethasone (e.g., Decadron.RTM., Dexone.RTM., or
Hexadrol.RTM.), and betamethasone (e.g., Celestone.RTM.); and other
drugs including tacrolimus (e.g., Prograf.RTM. or FK506);
azathioprine (e.g., Imuran); methotrexate (e.g., Rheumatrex.RTM.);
glatiramer acetate (e.g., Copaxone.RTM.); cladribine (Leustatin);
cyclophosphamide (e.g., Endoxan.RTM., Cytoxan.RTM., or
Neosar.RTM.); Roquinimex (e.g., Linomide.RTM.); mitoxantrone (e.g.,
Novantrone.RTM.); mycophenolate mofetil (e.g., Cellcept.RTM.);
cyclosporine (e.g., cyclosporin A; Sandimmune.RTM.); rapamycin
(FRAP/mTOR inhibitor; sirolimus, e.g., Rapamune.RTM.);
antithymocyte antibodies, for example, lymphocyte immune globulin
(Atgam.RTM.), anti-Tac, and Rh(D) immune globulin (e.g., Rhogam or
Gamulin); and similar drugs. In contrast, pharmaceutical
compositions comprising BSL3-Ig may be co-administered with one or
more immunostimulants, including, but not limited to, Bacille
Calmette-Guerin (BCG), Levamisole, intravenous immune globulin
(IVIG); cytokines such as interferon-.alpha., interferon-.gamma.,
interferon-.alpha.-1b, IL-2 (e.g., recombinant human IL-2), G-CSF,
and GM-CSF, and similar drugs.
[0384] Given the structure and function of the B7-related factors
disclosed herein, it is possible to up-regulate or down-regulate
the function of a B7-related factor in a number of ways.
Down-regulating or preventing one or more B7-related factor
functions (i.e., preventing high level lymphokine synthesis by
activated T-cells) should be useful in treating autoimmune
diseases, such as rheumatoid arthritis, multiple sclerosis, Lupus
erythematosus, Hashimoto's thyroiditis, primary mixedema, Graves'
disease, pernicious anemia, autoimmune atrophic gastritis, insulin
dependent diabetes mellitus, good pasture's syndrome, myasthenia
gravis, pemphigus, Crohn's disease, sympathetic opthalmia,
autoimmune uveitis, autoimmune hemolytic anemis, idiopathic
thrombocytopenia, primary biliary cirrhosis, ulcerative colitis,
Sjogren's syndrome, polymyositis and mixed connective tissue
disease. B7-related factors may also be down-regulated for the
treatment of inflammation related to psoriasis, chronic obstructive
pulmonary disease, asthma, and atherosclerosis. In addition,
B7-related factors may be down-regulated for the treatment of
tissue, bone marrow, and organ transplantation, and graft versus
host disease. For example, blockage of T-cell function should
result in reduced tissue destruction in tissue transplantation.
Typically, in tissue transplants, rejection of the transplant is
initiated by its recognition as foreign material, followed by an
immune reaction that destroys the transplant. The B7-related
molecules of the present invention can also be used to treat or
prevent cancers as described in detail below.
[0385] The B7-related nucleic acid molecules provided by the
present invention can be used to design therapeutics to block the
function of one or more B7-related factors. In particular,
antisense or triplex oligonucleotides can be administered to
prevent the expression of the BSL1, BSL2, and/or BSL3 factors. For
example, an oligonucleotide (e.g., DNA oligonucleotide) that
hybridizes to a BSL1, BSL2, and/or BSL3 mRNA can be used to target
the mRNA for RnaseH digestion. Alternatively, an oligonucleotide
that hybridizes to the translation initiation site of a BSL1 (e.g.,
SEQ ID NO:1 or 3), BSL2 (e.g., SEQ ID NO:6, 10,12, or 131), or BSL3
(e.g., SEQ ID NO:14) mRNA be used to prevent translation of the
mRNA. In another approach, oligonucleotides that bind to the
double-stranded DNA of the BSL1, BSL2, and/or BSL3 gene(s) can be
administered. Such oligonucleotides can form a triplex construct
and prevent the unwinding and transcription of the DNA encoding the
targeted B7-related factor. In all cases, the appropriate
oligonucleotide can be synthesized, formulated as a pharmaceutical
composition, and administered to a subject. The synthesis and
utilization of antisense and triplex oligonucleotides have been
previously described (e.g., H. Simon et al. (1999) Antisense
Nucleic Acid Drug Dev. 9:527-31; F. X. Barre et al. (2000) Proc.
Natl. Acad. Sci. USA 97:3084-3088; R. Elez et al. (2000) Biochem.
Biophys. Res. Commun. 269:352-6; E. R. Sauter et al. (2000) Clin.
Cancer Res. 6:654-60).
[0386] In the context of this invention, antisense oligonucleotides
are naturally-occurring oligonucleotide species or synthetic
species formed from naturally-occurring subunits or their close
homologues. Antisense oligonucleotides may also include moieties
that function similarly to oligonucleotides, but have
non-naturally-occurring portions. Thus, antisense oligonucleotides
may have altered sugar moieties or inter-sugar linkages. Exemplary
among these are phosphorothioate and other sulfur containing
species which are known in the art.
[0387] In preferred embodiments, at least one of the phosphodiester
bonds of the antisense oligonucleotide has been substituted with a
structure that functions to enhance the ability of the compositions
to penetrate into the region of cells where the RNA whose activity
is to be modulated is located. It is preferred that such
substitutions comprise phosphorothioate bonds, methyl phosphonate
bonds, or short chain alkyl or cycloalkyl structures. In accordance
with other preferred embodiments, the phosphodiester bonds are
substituted with structures which are, at once, substantially
non-ionic and non-chiral, or with structures which are chiral and
enantiomerically specific. Persons of ordinary skill in the art
will be able to select other linkages for use in the practice of
the invention.
[0388] Antisense oligonucleotides may also include species that
include at least some modified base forms. Thus, purines and
pyrimidines other than those normally found in nature may be so
employed. Similarly, modifications on the furanosyl portions of the
nucleotide subunits may also be effected, as long as the essential
tenets of this invention are adhered to. Examples of such
modifications are 2'-O-alkyl- and 2'-halogen-substituted
nucleotides. Some non-limiting examples of modifications at the 2'
position of sugar moieties which are useful in the present
invention include OH, SH, SCH.sub.3, F, OCH.sub.3, OCN,
O(CH.sub.2)n NH.sub.2 and O(CH.sub.2)n CH.sub.3, where n is from 1
to about 10. Such antisense oligonucleotides are functionally
interchangeable with natural oligonucleotides or synthesized
oligonucleotides, which have one or more differences from the
natural structure. All such analogs are comprehended by this
invention so long as they function effectively to hybridize with
BSL1, BSL2, or BSL3 DNA or RNA to inhibit the function thereof.
[0389] For antisense therapeutics, the oligonucleotides in
accordance with this invention preferably comprise from about 3 to
about 50 subunits. It is more preferred that such oligonucleotides
and analogs comprise from about 8 to about 25 subunits and still
more preferred to have from about 12 to about 20 subunits. As
defined herein, a "subunit" is a base and sugar combination
suitably bound to adjacent subunits through phosphodiester or other
bonds.
[0390] Antisense oligonulcleotides can be produced by standard
techniques (see, e.g., Shewmaker et al., U.S. Pat. No. 5,107,065).
The oligonucleotides used in accordance with this invention may be
conveniently and routinely made through the well-known technique of
solid phase synthesis. Equipment for such synthesis is available
from several vendors, including PE Applied Biosystems (Foster City,
Calif.). Any other means for such synthesis may also be employed,
however, the actual synthesis of the oligonucleotides is well
within the abilities of the practitioner. It is also will known to
prepare other oligonucleotide such as phosphorothioates and
alkylated derivatives.
[0391] The oligonucleotides of this invention are designed to be
hybridizable with BSL1, BSL2, or BSL3 RNA (e.g., mRNA) or DNA. For
example, an oligonucleotide (e.g., DNA oligonucleotide) that
hybridizes to B7-related mRNA can be used to target the mRNA for
RnaseH digestion. Alternatively, an oligonucleotide that hybridizes
to the translation initiation site of B7-related mRNA can be used
to prevent translation of the mRNA. In another approach,
oligonucleotides that bind to the double-stranded DNA of BSL1,
BSL2, or BSL3 can be administered. Such oligonucleotides can form a
triplex construct and inhibit the transcription of the DNA encoding
BSL1, BSL2, or BSL3 polypeptides. Triple helix pairing prevents the
double helix from opening sufficiently to allow the binding of
polymerases, transcription factors, or regulatory molecules. Recent
therapeutic advances using triplex DNA have been described (see,
e.g., J. E. Gee et al. (1994) Molecular and Immunologic Approaches,
Futura Publishing Co., Mt. Kisco, N.Y.).
[0392] As non-limiting examples, antisense oligonucleotides may be
targeted to hybridize to the following regions: mRNA cap region;
translation initiation site; translational termination site;
transcription initiation site; transcription termination site;
polyadenylation signal; 3' untranslated region; 5' untranslated
region; 5' coding region; mid coding region; and 3' coding region.
Preferably, the complementary oligonucleotide is designed to
hybridize to the most unique 5' sequence in BSL1, BSL2, or BSL3,
including any of about 15-35 nucleotides spanning the 5' coding
sequence. Appropriate oligonucleotides can be designed using OLIGO
software (Molecular Biology Insights, Inc., Cascade, Colo.).
[0393] In accordance with the present invention, the antisense
oligonucleotide can be synthesized, formulated as a pharmaceutical
composition, and administered to a subject. The synthesis and
utilization of antisense and triplex oligonucleotides have been
previously described (e.g., H. Simon et al. (1999) Antisense
Nucleic Acid Drug Dev. 9:527-31; F. X. Barre et al. (2000) Proc.
Natl. Acad. Sci. USA 97:3084-3088; R. Elez et al. (2000) Biochem.
Biophys. Res. Commun. 269:352-6; E. R. Sauter et al. (2000) Clin.
Cancer Res. 6:654-60). Alternatively, expression vectors derived
from retroviruses, adenovirus, herpes or vaccinia viruses, or from
various bacterial plasmids may be used for delivery of nucleotide
sequences to the targeted organ, tissue or cell population. Methods
which are well known to those skilled in the art can be used to
construct recombinant vectors which will express nucleic acid
sequence that is complementary to the nucleic acid sequence
encoding a BSL1, BSL2, or BSL3 polypeptide. These techniques are
described both in Sambrook et al. (1989) and in Ausubel et al.
(1992). For example, BSL1, BSL2, or BSL3 expression can be
inhibited by transforming a cell or tissue with an expression
vector that expresses high levels of untranslatable sense or
antisense sequences. Even in the absence of integration into the
DNA, such vectors may continue to transcribe RNA molecules until
they are disabled by endogenous nucleases. Transient expression may
last for a month or more with a non-replicating vector, and even
longer if appropriate replication elements included in the vector
system.
[0394] Various assays may be used to test the ability of specific
antisense oligonucleotides to inhibit BSL1, BSL2, or BSL3
expression. For example, mRNA levels can be assessed Northern blot
analysis (Sambrook et al. (1989); Ausubel et al. (1992); J. C.
Alwine et al. (1977) Proc. Natl. Acad. Sci. USA 74:5350-5354; I. M.
Bird (1998) Methods Mol. Biol. 105:325-36), quantitative or
semi-quantitative RT-PCR analysis (see, e.g., W. M. Freeman et al.
(1999) Biotechniques 26:112-122; Ren et al. (1998) Mol. Brain Res.
59:256-63; J. M. Cale et al. (1998), Methods Mol. Biol.
105:351-71), or in situ hybridization (reviewed by A. K. Raap
(1998) Mutat. Res. 400:287-298). Alternatively, antisense
oligonucleotides may be assessed by measuring levels of BSL1, BSL2,
or BSL3 polypeptide, e.g., by western blot analysis, indirect
immunofluorescence, immunoprecipitation techniques (see, e.g., J.
M. Walker (1998) Protein Protocols on CD-ROM, Humana Press, Totowa,
N.J.).
[0395] The B7-related polypeptide sequences provided by the present
invention may also be useful in the design of therapeutic agents to
block or enhance the activity of immune response cells (e.g.,
T-cells). For example, a fusion protein comprising the soluble
portion of a B7-related polypeptide conjugated with the Fc domain
of human IgG can be constructed by standard recombinant techniques,
described above. The BSL1-Ig (e.g., SEQ ID NO:5), BSL2-Ig (e.g.,
SEQ ID NO:9, SEQ ID NO:133, or SEQ ID NO:135), and/or BSL3-Ig
(e.g., SEQ ID NO:17), fusion proteins can be prepared as a
pharmaceutical composition and administered to a subject. The
BSL1-Ig, BSL2-Ig, and/or BSL3-Ig fusion proteins can be used to
target specific T-cells for destruction, thereby reducing overall
T-cell activation. Such treatment methods can be modeled on animal
experiments, which utilize CTLA-4-Ig to prevent cardiac allograft
rejection (Turka et al., supra). It will be understood by a person
skilled in the art that such methods may be adapted for use in
humans, and for use with other conditions, including various
transplants and autoimmune diseases. Alternatively, certain
BSL1-Ig, BSL2-Ig, and/or BSL3-Ig fusion proteins can be used to
enhance T-cell activation. For example, BSL3-Ig fusion proteins can
be used as co-stimulatory molecules as disclosed in detail
herein.
[0396] As an alternative approach, antibodies that specifically
react with B7-related polypeptides or peptides can be used to block
the activity of immune or inflammatory response cells (e.g.,
T-cells). Antibodies or related antibody fragments that bind to
peptides or polypeptides comprising the BSL1 (e.g., SEQ ID NO:2),
BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15)
sequences can be formulated as pharmaceutical compositions and
administered alone or in combination to a subject. Such antibodies
can then inhibit the interaction of the B7-related polypeptides
with CD28 and/or CD28-related ligands, and thereby prevent T-cell
activation. Treatments utilizing antibodies directed against
B7-related factors may be modeled on animal experiments, which use
antibodies against CD28, B7-1, or B7-2 (D. J. Lenshow et al. (1995)
Transplantation 60:1171-1178; Y. Seko et al. (1998) Circ. Res.
83:463-469; A. Haczku et al. (1999) Am. J. Respir. Crit. Care Med.
159:1638-1643). One skilled in the art may adapt such methods for
use in humans, and for use with various conditions involving
inflammation or transplantation. It is noted that antibody-based
therapeutics produced from non-human sources can cause an undesired
immune response in human subjects. To minimize this problem,
chimeric antibody derivatives can be produced. Chimeric antibodies
combine a non-human animal variable region with a human constant
region. Chimeric antibodies can be constructed according to methods
known in the art (see Morrison et al. (1985) Proc. Natl. Acad. Sci.
USA 81:6851; Takeda et al. (1985) Nature 314:452; U.S. Pat. No.
4,816,567 of Cabilly et al.; U.S. Pat. No. 4,816,397 of Boss et
al.; European Patent Publication EP 171496; EP 0173494; United
Kingdom Patent GB 2177096B). In addition, antibodies can be further
"humanized" by any of the techniques known in the art, (e.g., Teng
et al. (1983) Proc. Natl. Acad. Sci. USA 80:7308-7312; Kozbor et
al. (1983) Immunology Today 4: 7279; Olsson et al. (1982) Meth.
Enzymol. 92:3-16; International Patent Application No. WO 92/06193;
EP 0239400). Humanized antibodies can be also be obtained from
commercial sources (e.g., Scotgen Limited, Middlesex, Great
Britain). Immunotherapy with a humanized antibody may result in
increased long-term effectiveness for the treatment of chronic
disease situations or situations requiring repeated antibody
treatments.
[0397] In yet another approach, an isolated ligand of a B7-related
factor can be used to down-regulate the activity of immune or
inflammatory response cells (e.g., T-cells). For example, a soluble
fusion protein comprising a B7-related factor ligand can be
produced, isolated, and used to produce a pharmaceutical
composition in accordance with the methods described in detail
herein. This pharmaceutical composition can then be administered to
a subject to bind to one or more endogenous B7-related factor(s)
and block the activation of immune or inflammatory response cells
(e.g., T-cells) as previously described.
[0398] Up-regulation of a B7-related factor function may also be
useful in therapy. Because viral infections are cleared primarily
by cytotoxic T-cells, an increase in cytotoxic activity would be
therapeutically useful in situations where more rapid or thorough
clearance of an infective viral agent would be beneficial to an
animal or human subject. Notably, B7-1 acts to increase the
cytotoxicity of T-cells though interactions with its cognate
ligand(s). Thus, soluble active forms of B7-related polypeptides
can be administered for the treatment of local or systemic viral
infections, such as immunodeficiency (e.g., HIV), papilloma (e.g.,
HPV), herpes (e.g., HSV), encephalitis, influenza (e.g., human
influenza virus A), and common cold (e.g., human rhinovirus) viral
infections. For example, pharmaceutical formulations of active
multivalent B7-related factors can be administered topically to
treat viral skin diseases such as herpes lesions or shingles, or
genital warts. Alternatively, pharmaceutical compositions of
active, multivalent B7-related factors can be administered
systemically to treat systemic viral diseases such as AIDS,
influenza, the common cold, or encephalitis.
[0399] In addition, modulation of B7-related factor function may be
useful in the induction of tumor immunity. For example, tumor cells
(e.g., sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, or
carcinoma cells) can be genetically engineered to carry a nucleic
acid encoding at least a fragment of at least one B7-related
factor, such as BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7,
11, or 13), or BSL3 (e.g., SEQ ID NO:15), and then administered to
a subject to traverse tumor-specific tolerance in the subject.
Notably, ectopic expression of B7-1 in B7 negative murine tumor
cells has been shown to induce T-cell mediated specific immunity
accompanied by tumor rejection and prolonged protection to tumor
challenge in mice (L. Chen et al., supra; S. Townsend et al.,
supra; S. Baskar et al., supra). Tumor or cancer cell gene therapy
treatments utilizing B7-related factors may be modeled on animal
experiments (see K. Dunussi-Joannopoulos et al. (1997) J. Pediatr.
Hematol. Oncol. 19:356-340; K. Hiroishi et al. (1999) Gene Ther.
6:1988-1994; B. K. Martin et al. (1999) J. Immunol. 162:6663-6670;
M. Kuiper et al. (2000) Adv. Exp. Med. Biol. 465:381-390), or human
phase I trial experiments (H. L. Kaufman et al. (2000) Hum. Gene
Ther. 11:1065-1082), which use B7-1 or B7-2 for gene transfer
therapy. It will be understood that such methods may be adapted for
use with various tumor or cancer cells. Additionally, tumor
immunity may be achieved by administration of a B7-related fusion
protein that directly stimulates the immune cells (see e.g.,
International Patent Application No. WO 01/21796 to V. Ling et
al.).
[0400] The experiments described herein indicate that
BSL2-4616811-Ig (BSL2vcvc-Ig) fusion protein can be used alone or
in conjunction with one or more anti-BSL2 MAbs for therapeutic
applications. BSL2vcvc ligand(s) and MAbs against BSL2 ligand(s)
may also be useful as therapeutics. In particular, BSL2vcvc-Ig
fusion protein (e.g., SEQ ID NO:9) can be used to inhibit disease
progression in any disease where excessive or inappropriate
activation of T-cells plays an important role. Such diseases would
include, for example, acute and chronic transplant rejection,
rheumatoid arthritis, multiple sclerosis, psoriasis, or other
diseases described in detail herein. In addition, BSL2vcvc-Ig may
also be used for specific applications such as
xenotransplantation.
[0401] The experiments described herein demonstrate that anti-BSL2
MAbs (e.g., anti-BSL2-1 MAb, anti-BSL2-2 MAb, anti-BSL2-3 MAb,
anti-BLS2-4 MAb, and anti-BSL2-5 MAb) function synergistically with
BSL2-4616811-Ig (BSL2vcvc-Ig) to inhibit T-cell proliferation. This
indicates that anti-BSL2 MAbs may be used alone as therapeutics, if
endogenous BSL2vcvc is expressed in sufficient amount by the
subject's cells. If insufficient endogenous BSL2vcvc is expressed,
co-administration of anti BSL2 MAbs with BSL2vcvc-Ig may be more
effective than administration of either alone. In certain cases,
however, it may be desirable to administer either BSL2-4616811-Ig
(BSL2vcvc-Ig) or anti-BSL2 MAbs separately.
[0402] It may also be possible to engineer a bi-specific monoclonal
antibody that could bring together endogenous BSL2vcvc and
endogenous BSL2vcvc ligand on T-cells. The bi-specific antibody may
thereby mimic the effect of co-administration of BSL2-4616811-Ig
(BSL2vcvc-Ig) and one or more anti-BSL2 MAbs. In addition,
signaling MAbs raised against BSL2vcvc ligand may be used to mimic
the effect of BSL2vcvc-Ig, whereas blocking MAbs raised against
BSL2vcvc ligand may act as immunostimulatory factors. It is also
possible that soluble BSL2vcvc ligand may be used as an
immunostimulatory factor.
[0403] Pharmacogenetics:
[0404] The B7-related polypeptides and polynucleotides of the
present invention are also useful in pharmacogenetic analysis,
i.e., the study of the relationship between an individual's
genotype and that individual's response to a therapeutic
composition or drug. See, e.g., Eichelbaum, M. (1996) Clin. Exp.
Pharmacol. Physiol. 23(10-11):983-985, and Linder, M. W. (1997)
Clin. Chem. 43(2):254-266. The genotype of the individual can
determine the way a therapeutic acts on the body or the way the
body metabolizes the therapeutic. Further, the activity of drug
metabolizing enzymes affects both the intensity and duration of
therapeutic activity. Differences in the activity or metabolism of
therapeutics can lead to severe toxicity or therapeutic failure.
Accordingly, a physician or clinician may consider applying
knowledge obtained in relevant pharmacogenetic studies in
determining whether to administer a B7-related polypeptide,
polynucleotide, functional equivalent, fragment, or modulator, as
well as tailoring the dosage and/or therapeutic or prophylactic
treatment regimen with a B7-related polypeptide, polynucleotide,
functional equivalent, fragment, or modulator.
[0405] In general, two types of pharmacogenetic conditions can be
differentiated. Genetic conditions can be due to a single factor
that alters the way the drug act on the body (altered drug action),
or a factor that alters the way the body metabolizes the drug
(altered drug metabolism). These conditions can occur either as
rare genetic defects or as naturally occurring polymorphisms. For
example, glucose-6-phosphate dehydrogenase deficiency (G6PD) is a
common inherited enzymopathy which, results in haemolysis after
ingestion of oxidant drugs (anti-malarials, sulfonamides,
analgesics, nitrofurans) and consumption of fava beans.
[0406] The discovery of genetic polymorphisms of drug metabolizing
enzymes (e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450
enzymes CYP2D6 and CYP2C19) has provided an explanation as to why
some patients do not obtain the expected drug effects or show
exaggerated drug response and serious toxicity after taking the
standard and safe dose of a drug. These polymorphisms are expressed
in two phenotypes in the population, the extensive metabolizer (EM)
and poor metabolizer (PM). The prevalence of PM is different among
different populations. The gene coding for CYP2D6 is highly
polymorphic and several mutations have been identified in PM, which
all lead to the absence of functional CYP2D6. Poor metabolizers
quite frequently experience exaggerated drug response and side
effects when they receive standard doses. If a metabolite is the
active therapeutic moiety, PM show no therapeutic response. This
has been demonstrated for the analgesic effect of codeine mediated
by its CYP2D6-formed metabolite morphine. At the other extreme,
ultra-rapid metabolizers fail to respond to standard doses. Recent
studies have determined that ultra-rapid metabolism is attributable
to CYP2D6 gene amplification.
[0407] By analogy, genetic polymorphism or mutation may lead to
allelic variants of BSL1, BSL2, and/or BSL3 in the population which
have different levels of activity. The BSL1, BSL2, and/or BSL3
polypeptides or polynucleotides thereby allow a clinician to
ascertain a genetic predisposition that can affect treatment
modality. Thus, in a BSL-based treatment, polymorphism or mutation
may give rise to individuals that are more or less responsive to
treatment. Accordingly, dosage would necessarily be modified to
maximize the therapeutic effect within a given population
containing the polymorphism. As an alternative to genotyping,
specific polymorphic polypeptides or polynucleotides can be
identified.
[0408] To identify genes that predict drug response, several
pharmacogenetic methods can be used. One pharmacogenomics approach,
"genome-wide association", relies primarily on a high-resolution
map of the human genome. This high-resolution map shows previously
identified gene-related markers (e.g., a "bi-alielic" gene marker
map which consists of 60,000-100,000 polymorphic or variable sites
on the human genome, each of which has two variants). A
high-resolution genetic map can then be compared to a map of the
genome of each of a statistically significant number of patients
taking part in a Phase II/III drug trial to identify markers
associated with a particular observed drug response or side effect.
Alternatively, a high-resolution map can be generated from a
combination of some 10 million known single nucleotide
polymorphisms (SNPs) in the human genome. As used herein, a "SNP"
is a common alteration that occurs in a single nucleotide base in a
stretch of DNA. For example, a SNP may occur once per every 1000
bases of DNA. A SNP may be involved in a disease process, however,
the vast majority may not be disease-associated. Given a genetic
map based on the occurrence of such SNPs, individuals can be
grouped into genetic categories depending on a particular pattern
of SNPs in their individual genome. In this way, treatment regimens
can be tailored to groups of genetically similar individuals,
taking into account traits that may be common among such
genetically similar individuals. See, e.g., D. R. Pfost et al.
(2000) Trends Biotechnol. 18(8):334-8.
[0409] As another example, the "candidate gene approach", can be
used. According to this method, if a gene that encodes a drug
target is known, all common variants of that gene can be fairly
easily identified in the population and it can be determined if
having one version of the gene versus another is associated with a
particular drug response.
[0410] As yet another example, a "gene expression profiling
approach", can be used. This method involves testing the gene
expression of an animal treated with a drug (e.g., a B7-related
polypeptide, polynucleotide, functional equivalent, fragment, or
modulator) to determine whether gene pathways related to toxicity
have been turned on.
[0411] Information obtained from one of the pharmacogenetics
approaches described herein can be used to determine appropriate
dosage and treatment regimens for prophylactic or therapeutic
treatment an individual. This knowledge, when applied to dosing or
drug selection, can avoid adverse reactions or therapeutic failure
and thus enhance therapeutic or prophylactic efficiency when
treating a subject with a B7-related polypeptide, polynucleotide,
functional equivalent, fragment, or modulator.
[0412] B7-related polypeptides or polynucleotides are also useful
for monitoring therapeutic effects during clinical trials and other
treatment. Thus, the therapeutic effectiveness of an agent that is
designed to increase or decrease gene expression, polypeptide
levels, or activity can be monitored over the course of treatment
using the B7-related polypeptides or polynucleotides. For example,
monitoring can be performed by: (i) obtaining a pre-administration
sample from a subject prior to administration of the agent; (ii)
detecting the level of expression or activity of the polypeptide in
the pre-administration sample; (iii) obtaining one or more
post-administration samples from the subject; (iv) detecting the
level of expression or activity of the polypeptide in the
post-administration samples; (v) comparing the level of expression
or activity of the polypeptide in the pre-administration sample
with the polypeptide in the post-administration sample or samples;
and (vi) increasing or decreasing the administration of the agent
to the subject accordingly.
[0413] Animal Models
[0414] B7-related polynucleotides such as BSL1 (e.g., SEQ ID NO:1
or 3), BSL2 (e.g., SEQ ID NO:6, 10, 12, or 131), or BSL3 (e.g., SEQ
ID NO:14) can be used to generate genetically altered non-human
animals or human cell lines. Any non-human animal can be used;
however typical animals are rodents, such as mice, rats, or guinea
pigs. Genetically engineered animals or cell lines can carry a gene
that has been altered to contain deletions, substitutions,
insertions, or modifications of the polynucleotide sequence (e.g.,
exon sequence). Such alterations may render the gene nonfunctional,
(i.e., a null mutation) producing a "knockout" animal or cell line.
In addition, genetically engineered animals can carry one or more
exogenous or non-naturally occurring genes, e.g., "transgenes" or
"orthologues", that are derived from different organisms (e.g.,
humans), or produced by synthetic or recombinant methods.
Genetically altered animals or cell lines can be used to study
BSL1, BSL2, or BSL3 function, regulation, and to develop treatments
for BSL1-, BSL2-, or BSL3-related diseases. In particular, knockout
animals and cell lines can be used to establish animal models and
in vitro models for analysis of BSL1-, BSL2-, or BSL3-related
diseases. In addition, transgenic animals expressing human BSL1,
BSL2, or BSL3 can be used in drug discovery efforts.
[0415] A "transgenic animal" is any animal containing one or more
cells bearing genetic information altered or received, directly or
indirectly, by deliberate genetic manipulation at a subcellular
level, such as by targeted recombination or microinjection or
infection with recombinant virus. The term "transgenic animal" is
not intended to encompass classical cross-breeding or in vitro
fertilization, but rather is meant to encompass animals in which
one or more cells are altered by, or receive, a recombinant DNA
molecule. This recombinant DNA molecule may be specifically
targeted to a defined genetic locus, may be randomly integrated
within a chromosome, or it may be extrachromosomally replicating
DNA.
[0416] As used herein, the term "orthologue" denotes a gene or
polypeptide obtained from one species that has homology to an
analogous gene or polypeptide from a different species. For
example, the human BSL3 (e.g., SEQ ID NO:15) and mouse AF142780
polypeptides are orthologues.
[0417] Transgenic animals can be selected after treatment of
germline cells or zygotes. For example, expression of an exogenous
BSL1, BSL2, or BSL3 gene or a variant can be achieved by operably
linking the gene to a promoter and optionally an enhancer, and then
microinjecting the construct into a zygote (see, e.g., Hogan et al.
(1994) Manipulating the Mouse Embryo, A Laboratory Manual, Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). Such
treatments include insertion of the exogenous gene and disrupted
homologous genes. Alternatively, the gene(s) of the animals may be
disrupted by insertion or deletion mutation of other genetic
alterations using conventional techniques (see, e.g., Capecchi,
(1989) Science, 244:1288; Valancuis et al. (1991) Mol. Cell Biol.,
11:1402; Hasty et al. (1991) Nature, 350:243; Shinkai et al. (1992)
Cell, 68:855; Mombaerts et al. (1992) Cell, 68:869; Philpott et al.
(1992) Science, 256:1448; Snouwaert et al. (1992) Science,
257:1083; Donehower et al. (1992) Nature, 356:215).
[0418] In one aspect of the invention, BSL1, BSL2, or BSL3 knockout
mice can be produced in accordance with well-known methods (see,
e.g., M. R. Capecchi, (1989) Science, 244:1288-1292; P. Li et al.
(1995) Cell 80:401-411; L. A. Galli-Taliadoros et al. (1995) J.
Immunol. Methods 181(1):1-15; C. H. Westphal et al. (1997) Curr.
Biol. 7(7):530-3; S. S. Cheah et al. (2000) Methods Mol. Biol.
136:455-63). The human BSL1, BSL2, and BSL3 clones can be used
isolate murine homologues. Murine homologues can then be used to
prepare a murine BSL1, BSL2, or BSL3 targeting construct that can
disrupt BSL1, BSL2, or BSL3 in the mouse by homologous
recombination at the corresponding chromosomal locus. The targeting
construct can comprise a disrupted or deleted murine BSL1, BSL2, or
BSL3 sequence that inserts in place of the functioning fragment of
the native mouse gene. For example, the construct can contain an
insertion in the murine BSL1, BSL2, or BSL3 protein-coding
region.
[0419] Preferably, the targeting construct contains markers for
both positive and negative selection. The positive selection marker
allows the selective elimination of cells that lack the marker,
while the negative selection marker allows the elimination of cells
that carry the marker. In particular, the positive selectable
marker can be an antibiotic resistance gene, such as the neomycin
resistance gene, which can be placed within the coding sequence of
murine BSL1, BSL2, or BSL3 to render it non-functional, while at
the same time rendering the construct selectable. The herpes
simplex virus thymidine kinase (HSV tk) gene is an example of a
negative selectable marker that can be used as a second marker to
eliminate cells that carry it. Cells with the HSV tk gene are
selectively killed in the presence of gangcyclovir. As an example,
a positive selection marker can be positioned on a targeting
construct within the region of the construct that integrates at the
BSL1, BSL2, or BSL3 locus. The negative selection marker can be
positioned on the targeting construct outside the region that
integrates at the BSL1, BSL2, or BSL3 locus. Thus, if the entire
construct is present in the cell, both positive and negative
selection markers will be present. If the construct has integrated
into the genome, the positive selection marker will be present, but
the negative selection marker will be lost.
[0420] The targeting construct can be employed, for example, in
embryonal stem cell (ES). ES cells may be obtained from
pre-implantation embryos cultured in vitro (M. J. Evans et al.
(1981) Nature 292:154-156; M. O. Bradley et al. (1984) Nature
309:255-258; Gossler et al. (1986) Proc. Natl. Acad. Sci. USA
83:9065-9069; Robertson et al. (1986) Nature 322:445-448; S. A.
Wood et al. (1993) Proc. Natl. Acad. Sci. USA 90:4582-4584).
Targeting constructs can be efficiently introduced into the ES
cells by standard techniques such as DNA transfection or by
retrovirus-mediated transduction. Following this, the transformed
ES cells can be combined with blastocysts from a non-human animal.
The introduced ES cells colonize the embryo and contribute to the
germ line of the resulting chimeric animal (R. Jaenisch, (1988)
Science 240:1468-1474). The use of gene-targeted ES cells in the
generation of gene-targeted transgenic mice has been previously
described (Thomas et al. (1987) Cell 51:503-512) and is reviewed
elsewhere (Frohman et al. (1989) Cell 56:145-147; Capecchi (1989)
Trends in Genet. 5:70-76; Baribault et al. (1989) Mol. Biol. Med.
6:481-492; Wagner, (1990) EMBO J. 9:3025-3032; Bradley et al.
(1992) Bio/Technology 10: 534-539).
[0421] Several methods can be used to select homologously
recombined murine ES cells. One method employs PCR to screen pools
of transformant cells for homologous insertion, followed by
screening individual clones (Kim et al. (1988) Nucleic Acids Res.
16:8887-8903; Kim et al. (1991) Gene 103:227-233). Another method
employs a marker gene is constructed which will only be active if
homologous insertion occurs, allowing these recombinants to be
selected directly (Sedivy et al. (1989) Proc. Natl. Acad. Sci. USA
86:227-231). For example, the positive-negative selection (PNS)
method can be used as described above (see, e.g., Mansour et al.
(1988) Nature 336:348-352; Capecchi (1989) Science 244:1288-1292;
Capecchi, (1989) Trends in Genet. 5:70-76). In particular, the PNS
method is useful for targeting genes that are expressed at low
levels.
[0422] The absence of functional BSL1, BSL2, or BSL3 in the
knockout mice can be confirmed, for example, by RNA analysis,
protein expression analysis, and functional studies. For RNA
analysis, RNA samples are prepared from different organs of the
knockout mice and the BSL1, BSL2, or BSL3 transcript is detected in
Northern blots using oligonucleotide probes specific for the
transcript. For protein expression detection, antibodies that are
specific for the BSL1, BSL2, or BSL3 polypeptide are used, for
example, in flow cytometric analysis, immunohistochemical staining,
and activity assays. Alternatively, functional assays are performed
using preparations of different cell types collected from the
knockout mice.
[0423] Several approaches can be used to produce transgenic mice.
In one approach, a targeting vector is integrated into ES cell by
homologous recombination, an intrachromosomal recombination event
is used to eliminate the selectable markers, and only the transgene
is left behind (A. L. Joyner et al. (1989) Nature 338(6211):153-6;
P. Hasty et al. (1991) Nature 350(6315):243-6; V. Valancius and 0.
Smithies, (1991) Mol. Cell Biol. 11(3):1402-8; S. Fiering et al.
(1993) Proc. Natl. Acad. Sci. USA 90(18):8469-73). In an
alternative approach, two or more strains are created; one strain
contains the gene knocked-out by homologous recombination, while
one or more strains contain transgenes. The knockout strain is
crossed with the transgenic strain to produce new line of animals
in which the original wild-type allele has been replaced (although
not at the same site) with a transgene. Notably, knockout and
transgenic animals can be produced by commercial facilities (e.g.,
The Lerner Research Institute, Cleveland, Ohio; B&K Universal,
Inc., Fremont, Calif.; DNX Transgenic Sciences, Cranbury, N.J.;
Incyte Genomics, Inc., St. Louis, Mo.).
[0424] Transgenic animals (e.g., mice) containing a nucleic acid
molecule which encodes human BSL1 (e.g., SEQ ID NO:2), BSL2 (e.g.,
SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15) polypeptide,
may be used as in vivo models to study the effects of altered
expression of BSL1, BSL2, or BSL3. Such animals can also be used in
drug evaluation and discovery efforts to find compounds effective
to inhibit or modulate the activity of BSL1, BSL2, or BSL3, such as
for example compounds for treating immune system disorders,
diseases, or conditions. One having ordinary skill in the art can
use standard techniques to produce transgenic animals which produce
human BSL1, BSL2, or BSL3 polypeptide, and use the animals in drug
evaluation and discovery projects (see, e.g., U.S. Pat. No.
4,873,191 to Wagner; U.S. Pat. No. 4,736,866 to Leder).
[0425] In another embodiment of the present invention, the
transgenic animal can comprise a recombinant expression vector in
which the nucleotide sequence that encodes human BSL1 (e.g., SEQ ID
NO:2), BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID
NO:15) is operably linked to a tissue specific promoter whereby the
coding sequence is only expressed in that specific tissue. For
example, the tissue specific promoter can be a mammary cell
specific promoter and the recombinant protein so expressed is
recovered from the animal's milk.
[0426] In yet another embodiment of the present invention, a BSL1,
BSL2, or BSL3 "knockout" can be produced by administering to the
animal antibodies (e.g., neutralizing antibodies) that specifically
recognize an endogenous BSL1, BSL2, or BSL3 polypeptide. The
antibodies can act to disrupt function of the endogenous BSL1,
BSL2, or BSL3 polypeptide, and thereby produce a null phenotype. In
one specific example, a murine BSL1, BSL2, or BSL3 polypeptide or
peptide can be used to generate antibodies. These antibodies can
then be given to a mouse to knockout the function of the
corresponding mouse protein.
[0427] In addition, non-mammalian organisms may be used to study
BSL1, BSL2, or BSL3, and their related diseases. For example, model
organisms such as C. elegans, D. melanogaster, and S. cerevisiae
may be used. BSL1, BSL2, or BSL3 homologues can be identified in
these model organisms, and mutated or deleted to produce a BSL1-,
BSL2-, or BSL3-deficient strain. Human BSL1 (e.g., SEQ ID NO:2),
BSL2 (e.g., SEQ ID NO:7, 11, or 13), or BSL3 (e.g., SEQ ID NO:15)
can then be tested for the ability to "complement" the deficient
strain. BSL1-, BSL2-, or BSL3-deficient strains can also be used
for drug screening. The study of BSL1, BSL2, or BSL3 homologues can
facilitate the understanding of the biological function
corresponding human gene, and assist in the identification of
binding proteins (e.g., agonists and antagonists).
[0428] Embodiments
[0429] This invention encompasses, but is not limited to, the
following embodiments.
[0430] Section 1:
[0431] An isolated nucleic acid molecule encoding a polypeptide
comprising amino acid sequence SEQ ID NO:7.
[0432] An isolated nucleic acid molecule encoding a polypeptide
comprising amino acids 2-534 of SEQ ID NO:7.
[0433] An isolated nucleic acid molecule encoding a polypeptide
comprising amino acids 29-534 of SEQ ID NO:7.
[0434] An isolated nucleic acid molecule encoding a polypeptide
comprising at least 210 contiguous amino acids of SEQ ID NO:7.
[0435] An isolated nucleic acid molecule encoding a polypeptide
selected from the group consisting of a) a polypeptide comprising
amino acids 284-326 of SEQ ID NO:7; and b) a polypeptide comprising
amino acids 361-407 of SEQ ID NO:7.
[0436] An isolated nucleic acid molecule encoding a peptide
selected from the group consisting of a) a polypeptide comprising
from about amino acid 284 to about amino acid 290 of SEQ ID NO:7;
b) a peptide comprising from about amino acid 291 to about amino
acid 297 of SEQ ID NO:7; c) a peptide comprising from about amino
acid 298 to about amino acid 304 of SEQ ID NO:7; d) a peptide
comprising from about amino acid 305 to about amino acid 311 of SEQ
ID NO:7; e) a peptide comprising from about amino acid 312 to about
amino acid 318 of SEQ ID NO:7; f) a peptide comprising from about
amino acid 319 to about amino acid 326 of SEQ ID NO:7; g) a peptide
comprising from about amino acid 361 to about amino acid 367 of SEQ
ID NO:7; h) a peptide comprising from about amino acid 368 to about
amino acid 374 of SEQ ID NO:7; i) a peptide comprising from about
amino acid 375 to about amino acid 381 of SEQ ID NO:7; j) a peptide
comprising from about amino acid 387 to about amino acid 393 of SEQ
ID NO:7, k) a peptide comprising from about amino acid 394 to about
amino acid 400 of SEQ ID NO:7; and l) a peptide comprising from
about amino acid 401 to about amino acid 407 of SEQ ID NO:7.
[0437] An isolated nucleic acid molecule comprising a nucleotide
sequence selected from the group consisting of SEQ ID NO:6 and
131.
[0438] An isolated nucleic acid molecule comprising nucleotides
121-1722 of SEQ ID NO:6.
[0439] An isolated nucleic acid molecule comprising a nucleotide
sequence selected from the group consisting of a) a nucleotide
sequence comprising nucleotides 4-1602 of SEQ ID NO:131; and b) a
nucleotide sequence comprising nucleotides 124-1722 of SEQ ID
NO:6.
[0440] An isolated nucleic acid molecule comprising a nucleotide
sequence selected from the group consisting of a) a nucleotide
sequence comprising nucleotides 85-1602 of SEQ ID NO:131; and b) a
nucleotide sequence comprising nucleotides 205-1722 of SEQ ID
NO:6.
[0441] An isolated nucleic acid molecule comprising a nucleotide
sequence selected from the group consisting of a) a nucleotide
sequence comprising nucleotides 850-978 of SEQ ID NO:131; b) a
nucleotide sequence comprising nucleotides 1081-1221 of SEQ ID
NO:131; c) a nucleotide sequence comprising nucleotides 970-1098 of
SEQ ID NO:6; and d) a nucleotide sequence comprising nucleotides
1201-1341 of SEQ ID NO:6.
[0442] An isolated nucleic acid molecule comprising at least 630
contiguous nucleotides of SEQ ID NO:6.
[0443] An isolated nucleic acid molecule which is complementary to
the nucleic acid molecule of any one of the preceding embodiments
in section 1.
[0444] An isolated nucleic fusion acid molecule encoding amino acid
sequence SEQ ID NO:9.
[0445] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 1-465 of SEQ ID NO:9; and
b) a nucleotide sequence encoding amino acids 466-698 of SEQ ID
NO:9.
[0446] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 2-465 of SEQ ID NO:9; and
b) a nucleotide sequence encoding amino acids 466-698 of SEQ ID
NO:9.
[0447] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 29-465 of SEQ ID NO:9; and
b) a nucleotide sequence encoding amino acids 466-698 of SEQ ID
NO:9.
[0448] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding at least 210 contiguous amino acids of
SEQ ID NO:7; and b) a nucleotide sequence encoding amino acids
466-698 of SEQ ID NO:9.
[0449] An isolated nucleic acid fusion molecule comprising a)
nucleotide sequence comprising nucleotides 1-1394 of SEQ ID NO:8;
and b) a nucleotide sequence comprising nucleotides 1396-2094 of
SEQ ID NO:8.
[0450] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising nucleotides 4-1394 of SEQ ID NO:8;
and b) a nucleotide sequence comprising nucleotides 1396-2094 of
SEQ ID NO:8.
[0451] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising nucleotides 85-1394 of SEQ ID NO:8;
and b) a nucleotide sequence comprising nucleotides 1396-2094 of
SEQ ID NO:8.
[0452] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising at least 630 contiguous nucleotides
of SEQ ID NO:6; and b) a nucleotide sequence comprising nucleotides
1396-2094 of SEQ ID NO:8.
[0453] A vector comprising the nucleic acid molecule according to
any one of the preceding embodiments in section 1.
[0454] A vector comprising the nucleic acid fusion molecule
according to any one of the preceding embodiments in section 1.
[0455] A host cell comprising a vector that comprises the nucleic
acid molecule according to any one of the preceding embodiments in
section 1. In various embodiments, the host cell is selected from
the group consisting of bacterial, yeast, insect, mammalian, and
plant cells.
[0456] A host cell comprising a vector that comprises the nucleic
acid fusion molecule according to any one of the preceding
embodiments in section 1. In various embodiments, the host cell is
selected from the group consisting of bacterial, yeast, insect,
mammalian, and plant cells.
[0457] An isolated polypeptide comprising an amino acid sequence
SEQ ID NO:7.
[0458] An isolated polypeptide comprising amino acids 2-534 of SEQ
ID NO:7.
[0459] An isolated polypeptide comprising amino acids 29-534 of SEQ
ID NO:7.
[0460] An isolated polypeptide comprising at least 210 contiguous
amino acids of SEQ ID NO:7.
[0461] An isolated polypeptide selected from the group consisting
of a) a polypeptide comprising amino acids 284-326 of SEQ ID NO:7;
and b) a polypeptide comprising amino acids 361-407 of SEQ ID
NO:7.
[0462] An isolated peptide selected from the group consisting of a)
a peptide comprising from about amino acid 284 to about amino acid
290 of SEQ ID NO:7; b) a peptide comprising from about amino acid
291 to about amino acid 297 of SEQ ID NO:7; c) a peptide comprising
from about amino acid 298 to about amino acid 304 of SEQ ID NO:7;
d) a peptide comprising from about amino acid 305 to about amino
acid 311 of SEQ ID NO:7; e) a peptide comprising from about amino
acid 312 to about amino acid 318 of SEQ ID NO:7; f) a peptide
comprising from about amino acid 319 to about amino acid 326 of SEQ
ID NO:7; g) a peptide comprising from about amino acid 361 to about
amino acid 367 of SEQ ID NO:7; h) a peptide comprising from about
amino acid 368 to about amino acid 374 of SEQ ID NO:7; i) a peptide
comprising from about amino acid 375 to about amino acid 381 of SEQ
ID NO:7; j) a peptide comprising from about amino acid 387 to about
amino acid 393 of SEQ ID NO:7, k) a peptide comprising from about
amino acid 394 to about amino acid 400 of SEQ ID NO:7; and l) a
peptide comprising from about amino acid 401 to about amino acid
407 of SEQ ID NO:7.
[0463] An isolated fusion polypeptide comprising amino acid
sequence SEQ ID NO:9.
[0464] An isolated fusion polypeptide comprising a) amino acids
1-465 of SEQ ID NO:9; and b) amino acids 466-698 of SEQ ID
NO:9.
[0465] An isolated fusion polypeptide comprising a) amino acids
2-465 of SEQ ID NO:9; and b) amino acids 466-698 of SEQ ID
NO:9.
[0466] An isolated fusion polypeptide comprising a) amino acids
29-465 of SEQ ID NO:9; and b) amino acids 466-698 of SEQ ID
NO:9.
[0467] An isolated fusion polypeptide comprising a) at least 210
contiguous amino acids of SEQ ID NO:7; and b) amino acids 466-698
of SEQ ID NO:9.
[0468] An isolated antibody that binds to the polypeptide according
to the any one of the preceding embodiments in section 1. In a
specific aspect, the antibody is monoclonal.
[0469] An isolated antibody that binds to the peptide according to
the any one of the preceding embodiments in section 1. In a
specific aspect, the antibody is monoclonal.
[0470] An isolated antibody that binds to the fusion polypeptide
according to the any one of the preceding embodiments in section 1.
In a specific aspect, the antibody is monoclonal.
[0471] A hybridoma cell which produces the antibody according to
any one of the preceding embodiments in section 1.
[0472] A pharmaceutical composition comprising the nucleic acid
molecule according to any one of the preceding embodiments in
section 1, and a physiologically acceptable carrier, excipient, or
diluent.
[0473] A pharmaceutical composition comprising the nucleic acid
fusion molecule according to any one of the preceding embodiments
in section 1, and a physiologically acceptable carrier, excipient,
or diluent.
[0474] A pharmaceutical composition comprising the polypeptide
according to any one of the preceding embodiments in section 1, and
a physiologically acceptable carrier, excipient, or diluent.
[0475] A pharmaceutical composition comprising the peptide
according to any one of the preceding embodiments in section 1, and
a physiologically acceptable carrier, excipient, or diluent.
[0476] A pharmaceutical composition comprising the fusion
polypeptide according to any one of the preceding embodiments in
section 1, and a physiologically acceptable carrier, excipient, or
diluent.
[0477] A pharmaceutical composition comprising a host cell that
comprises the nucleic acid molecule according to any one of the
preceding embodiments in section 1, and a physiologically
acceptable carrier, excipient, or diluent.
[0478] A pharmaceutical composition comprising a host cell that
comprises the nucleic acid fusion molecule according to any one of
the preceding embodiments in section 1, and a physiologically
acceptable carrier, excipient, or diluent.
[0479] A pharmaceutical composition comprising an antibody that
binds to the polypeptide according to any one of the preceding
embodiments in section 1, and a physiologically acceptable carrier,
excipient, or diluent.
[0480] A pharmaceutical composition comprising an antibody that
binds to the peptide according to any one of the preceding
embodiments in section 1, and a physiologically acceptable carrier,
excipient, or diluent.
[0481] A pharmaceutical composition comprising an antibody that
binds to the fusion polypeptide according to any one of the
preceding embodiments in section 1, and a physiologically
acceptable carrier, excipient, or diluent.
[0482] A method of suppressing a T-cell-mediated immune response in
a subject comprising: administering to the subject at least one
pharmaceutical composition selected from the group consisting of a)
a pharmaceutical composition comprising the isolated fusion
polypeptide according to any one of the preceding embodiments in
section 1; b) a pharmaceutical composition comprising the antibody
according to any one or the preceding embodiments in section 1; c)
a pharmaceutical composition comprising a host cell that comprises
the nucleic acid fusion molecule according to any one of the
preceding embodiments in section 1; and d) a pharmaceutical
composition comprising the nucleic acid fusion molecule according
to any one of the preceding embodiments in section 1; in an amount
effective to suppress the T-cell-mediated immune response.
[0483] In various aspects, the subject is affected with a condition
selected from the group consisting of tissue rejection, bone marrow
rejection, organ transplant rejection, and graft versus host
disease. In another aspect, the subject is affected with a
condition associated with inflammation. In other aspects, the
inflammation-associated condition is selected from the group
consisting of psoriasis, chronic obstructive pulmonary disease,
asthma, and atherosclerosis. In yet another aspect, the subject is
affected with an autoimmune disease. In further aspects, the
autoimmune disease is selected from the group consisting of
rheumatoid arthritis, multiple sclerosis, Lupus erythematosus,
Hashimoto's thyroiditis, primary mixedema, Graves' disease,
pernicious anemia, autoimmune atrophic gastritis, insulin dependent
diabetes mellitus, good pasture's syndrome, myasthenia gravis,
pemphigus, Crohn's disease, sympathetic opthalmia, autoimmune
uveitis, autoimmune hemolytic anemis, idiopathic thrombocytopenia,
primary biliary cirrhosis, ulcerative colitis, Sjogren's syndrome,
polymyositis, and mixed connective tissue disease.
[0484] A kit for detecting a B7-related nucleic acid molecule
comprising a) the isolated nucleic acid molecule according to any
one of the preceding embodiments in section 1; and b) at least one
component to detect binding of the isolated nucleic acid molecule
to the B7-related nucleic acid molecule.
[0485] A kit for detecting a B7-related nucleic acid molecule
comprising a) the isolated nucleic acid fusion molecule according
to any one of the preceding embodiments in section 1; and b) at
least one component to detect binding of the isolated nucleic acid
fusion molecule to the B7-related nucleic acid molecule.
[0486] A kit for detecting a B7-related polypeptide comprising a)
the isolated antibody according to any one of the preceding
embodiments in section 1; and b) at least one component to detect
binding of the isolated antibody to a B7-related polypeptide
sequence.
[0487] A transgenic non-human animal comprising the nucleic acid
molecule according to any one of the preceding embodiments in
section 1.
[0488] A transgenic non-human animal comprising the nucleic acid
fusion molecule according to any one of the preceding embodiments
in section 1.
[0489] A cell line comprising the nucleic acid molecule according
to any one of the preceding embodiments in section 1.
[0490] A cell line comprising the nucleic acid fusion molecule
according to any one of the preceding embodiments in section 1.
[0491] An isolated BSL2vcvc nucleic acid molecule corresponding to
ATCC No. PTA-1993, deposited on Jun. 6, 2000.
[0492] An isolated BSL2vcvc-Ig nucleic acid fusion molecule
corresponding to ATCC Deposit No. ______, deposited Feb. 8,
2002.
[0493] An isolated BSL2vcvc polypeptide encoded by the nucleic acid
molecule corresponding to ATCC No. PTA-1993, deposited on Jun. 6,
2000.
[0494] An isolated BSL2vcvc-Ig fusion polypeptide encoded by the
nucleic acid fusion molecule corresponding to ATCC Deposit No.
______, deposited Feb. 8, 2002.
[0495] A host cell comprising the BSL2vcvc nucleic acid molecule
corresponding to ATCC No. PTA-1993, deposited on Jun. 6, 2000.
[0496] A host cell comprising the BSL2vcvc-Ig nucleic acid fusion
molecule corresponding to ATCC Deposit No. ______, deposited Feb.
8, 2002.
[0497] A hybridoma cell that produces antibodies to BSL2vcvc
corresponding to ATCC No. ______ deposited Feb. 8, 2002.
[0498] An anti-BSL2vcvc antibody produced by the hybridoma cell
corresponding to ATCC No. ______ deposited Feb. 8, 2002.
[0499] Section 2:
[0500] An isolated nucleic fusion acid molecule encoding amino acid
sequence SEQ ID NO:135.
[0501] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 1-246 of SEQ ID NO:135;
and b) a nucleotide sequence encoding amino acids 249-480 of SEQ ID
NO:135.
[0502] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 2-246 of SEQ ID NO:135;
and b) a nucleotide sequence encoding amino acids 249-480 of SEQ ID
NO:135.
[0503] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 29-246 of SEQ ID NO:135;
and b) a nucleotide sequence encoding amino acids 249-480 of SEQ ID
NO:135.
[0504] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding at least 90 contiguous amino acids of
SEQ ID NO:11; and b) a nucleotide sequence encoding amino acids
249-480 of SEQ ID NO:135.
[0505] An isolated nucleic acid fusion molecule comprising a)
nucleotide sequence comprising nucleotides 1-738 of SEQ ID NO:134;
and b) a nucleotide sequence comprising nucleotides 745-1440 of SEQ
ID NO:134.
[0506] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising nucleotides 4-738 of SEQ ID NO:134;
and b) a nucleotide sequence comprising nucleotides 745-1440 of SEQ
ID NO:134.
[0507] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising nucleotides 85-738 of SEQ ID NO:134;
and b) a nucleotide sequence comprising nucleotides 745-1440 of SEQ
ID NO:134.
[0508] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising at least 270 contiguous nucleotides
of SEQ ID NO:10; and b) a nucleotide sequence comprising
nucleotides 745-1440 of SEQ ID NO:134.
[0509] A vector comprising the nucleic acid fusion molecule
according to any one of the preceding embodiments in section 2.
[0510] A host cell comprising a vector that comprises the nucleic
acid fusion molecule according to any one of the preceding
embodiments in section 2. In various embodiments, the host cell is
selected from the group consisting of bacterial, yeast, insect,
mammalian, and plant cells.
[0511] An isolated fusion polypeptide comprising amino acid
sequence SEQ ID NO:135.
[0512] An isolated fusion polypeptide comprising a) amino acids
1-246 of SEQ ID NO:135; and b) amino acids 249-480 of SEQ ID
NO:135.
[0513] An isolated fusion polypeptide comprising a) amino acids
2-246 of SEQ ID NO:135; and b) amino acids 249-480 of SEQ ID
NO:135.
[0514] An isolated fusion polypeptide comprising a) amino acids
29-246 of SEQ ID NO:135; and b) amino acids 249-480 of SEQ ID
NO:135.
[0515] An isolated fusion polypeptide comprising a) at least 90
contiguous amino acids of SEQ ID NO:11; and b) amino acids 249-480
of SEQ ID NO:135.
[0516] An isolated antibody that binds to the fusion polypeptide
according to the any one of the preceding embodiments in section 2.
In a specific aspect, the antibody is monoclonal.
[0517] A hybridoma cell which produces the antibody according to
any one of the preceding embodiments in section 2.
[0518] A pharmaceutical composition comprising the nucleic acid
fusion molecule according to any one of the preceding embodiments
in section 2, and a physiologically acceptable carrier, excipient,
or diluent.
[0519] A pharmaceutical composition comprising the fusion
polypeptide according to any one of the preceding embodiments in
section 2, and a physiologically acceptable carrier, excipient, or
diluent.
[0520] A pharmaceutical composition comprising a host cell
according to any one of the preceding embodiments in section 2, and
a physiologically acceptable carrier, excipient, or diluent.
[0521] A pharmaceutical composition comprising the antibody
according to any one of the preceding embodiments in section 2, and
a physiologically acceptable carrier, excipient, or diluent.
[0522] An isolated BSL2v2c2 nucleic acid fusion molecule
corresponding to ATCC Deposit No. ______, deposited Feb. 8,
2002.
[0523] An isolated BSL2v2c2 fusion polypeptide encoded by the
nucleic acid fusion molecule corresponding to ATCC Deposit No.
_____, deposited Feb. 8, 2002.
[0524] A host cell comprising the BSL2v2c2 nucleic acid fusion
molecule corresponding to ATCC Deposit No. ______ deposited Feb. 8,
2002.
[0525] Section 3:
[0526] An isolated nucleic fusion acid molecule encoding amino acid
sequence SEQ ID NO:133.
[0527] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 1-226 of SEQ ID NO:133;
and b) a nucleotide sequence encoding amino acids 229-480 of SEQ ID
NO:133.
[0528] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 2-226 of SEQ ID NO:133;
and b) a nucleotide sequence encoding amino acids 229-480 of SEQ ID
NO:133.
[0529] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding amino acids 29-226 of SEQ ID NO:13;
and b) a nucleotide sequence encoding amino acids 229-480 of SEQ ID
NO:133.
[0530] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence encoding at least 170 contiguous amino acids of
SEQ ID NO:13; and b) a nucleotide sequence encoding amino acids
229-480 of SEQ ID NO:133.
[0531] An isolated nucleic acid fusion molecule comprising a)
nucleotide sequence comprising nucleotides 1-738 of SEQ ID NO:132;
and b) a nucleotide sequence comprising nucleotides 745-1440 of SEQ
ID NO:132.
[0532] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising nucleotides 4-738 of SEQ ID NO:132;
and b) a nucleotide sequence comprising nucleotides 745-1440 of SEQ
ID NO:132.
[0533] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising nucleotides 85-738 of SEQ ID NO:132;
and b) a nucleotide sequence comprising nucleotides 745-1440 of SEQ
ID NO:132.
[0534] An isolated nucleic acid fusion molecule comprising a) a
nucleotide sequence comprising at least 410 contiguous nucleotides
of SEQ ID NO:12; and b) a nucleotide sequence comprising
nucleotides 745-1440 of SEQ ID NO:132.
[0535] A vector comprising the nucleic acid fusion molecule
according to any one of the preceding embodiments in section 3.
[0536] A host cell comprising a vector that comprises the nucleic
acid fusion molecule according to any one of the preceding
embodiments in section 3. In various embodiments, the host cell is
selected from the group consisting of bacterial, yeast, insect,
mammalian, and plant cells.
[0537] An isolated fusion polypeptide comprising amino acid
sequence SEQ ID NO:133.
[0538] An isolated fusion polypeptide comprising a) amino acids
1-226 of SEQ ID NO:133; and b) amino acids 229-480 of SEQ ID
NO:133.
[0539] An isolated fusion polypeptide comprising a) amino acids
2-226 of SEQ ID NO:133; and b) amino acids 229-480 of SEQ ID
NO:133.
[0540] An isolated fusion polypeptide comprising a) amino acids
29-226 of SEQ ID NO:133; and b) amino acids 229-480 of SEQ ID
NO:133.
[0541] An isolated fusion polypeptide comprising a) at least 170
contiguous amino acids of SEQ ID NO:13; and b) amino acids 229-480
of SEQ ID NO:133.
[0542] An isolated antibody that binds to the fusion polypeptide
according to the any one of the preceding embodiments in section 3.
In a specific aspect, the antibody is monoclonal.
[0543] A hybridoma cell which produces the antibody according to
any one of the preceding embodiments in section 3.
[0544] A pharmaceutical composition comprising the nucleic acid
fusion molecule according to any one of the preceding embodiments
in section 3, and a physiologically acceptable carrier, excipient,
or diluent.
[0545] A pharmaceutical composition comprising the fusion
polypeptide according to any one of the preceding embodiments in
section 3, and a physiologically acceptable carrier, excipient, or
diluent.
[0546] A pharmaceutical composition comprising a host cell
according to any one of the preceding embodiments in section 3, and
a physiologically acceptable carrier, excipient, or diluent.
[0547] A pharmaceutical composition comprising the antibody
according to any one of the preceding embodiments in section 3, and
a physiologically acceptable carrier, excipient, or diluent.
[0548] An isolated BSL2v1c2 nucleic acid fusion molecule
corresponding to ATCC Deposit No. ______, deposited Feb. 8,
2002.
[0549] An isolated BSL2v1c2 fusion polypeptide encoded by the
nucleic acid fusion molecule corresponding to ATCC Deposit No.
______, deposited Feb. 8, 2002.
[0550] A host cell comprising the BSL2v1c2 nucleic acid fusion
molecule corresponding to ATCC Deposit No. ______, deposited Feb.
8, 2002.
EXAMPLES
[0551] The examples as set forth herein are meant to exemplify the
various aspects of the present invention and are not intended to
limit the invention in any way.
Example 1
Identification of BSL1
[0552] Preparation of Monocytes:
[0553] Human monocytes were obtained from peripheral blood
mononuclear cells by elutriation. The elutriation buffer contained
1 L RPMI (GibcoBRL/Life Technologies Inc., Rockville, Md.; Cat.
#11875-085) with 2.5 mM EDTA and 10 .mu.g/ml polymyxin B. The
buffer was prepared 1 day prior to the elutriation procedure, and
stored at room temperature. For the elutriation procedure, 225 ml
EDTA whole blood/donor was obtained and prepared. Twenty
milliliters of elutriation buffer was added to twelve 50 ml
centrifuge tubes, and the 225 ml of blood was divided equally among
the tubes. Twelve milliliters of ficoll solution (lymphocyte
separation medium) was used to underlay the mixture in each tube
(AccuPrep Lymphocytes, Accurate Scientific Co.; Cat. # 1053980).
The tubes were centrifuged at 1800 rpm for 25 min (minutes).
[0554] Sheep's red blood cells (SRBC) were prepared by the
following procedure. Twelve milliliters of Sheep Blood Alsever's
(Colorado Serum Co., Denver, Colo.; Cat. # CS1112) was resuspended,
and centrifuged at 2000 rpm for 10 min. The top coating of the SRBC
pellet was removed, and the pellet was washed 2 times with
elutriation buffer. Following each wash, the pellet was centrifuged
at 2200 rpm for 8 min. After the second wash, the pellet was
resuspended in 5 ml elutriation buffer and refrigerated.
[0555] Following centrifugation, the supernatant from the ficoll
underlay tubes was aspirated to leave behind approximately 5 ml of
the interface layer. The interface layer was then carefully removed
to a new tube, without disturbing the red cell pellet in each tube.
The interface layers of two 50 ml tubes was combined and
transferred to a new 50 ml tube, resulting in a total of six 50 ml
tubes. Elutriation buffer was added to each tube to bring the final
volume to 50 ml per tube. The tubes were centrifuged at 1800 rpm
for 10 min, and the supernatant was removed. The peripheral blood
monocytes from each donor were combined and divided between two
tubes, and resuspended in 40 ml elutriation buffer per tube. The
tubes were centrifuged at 1500 rpm for 10 min, the supernatant was
aspirated, and the pellet was resuspended in 30 ml elutriation
buffer per tube.
[0556] Following this step, 3 ml of washed SRBC was added to each
tube, and the mixture was centrifuged at 1000 rpm for 5 min. The
pellet was incubated on ice for at least 1 hr (hour), and each
pellet was gently resuspended by inverting the tubes. Twelve
milliliters of ficoll was used to underlay the mixture in each
tube. The tubes were centrifuged at 2500 rpm for 20 min, and the
interface layers were removed to new tubes as previously described.
The interface layers were then resuspended in 10 ml elutriation
buffer and stored on ice until the start of the elutriation
procedure. It is noted the purification of T-cells using their
affinity to SRBCs is termed E-rosetting.
[0557] Elutriation of Monocytes:
[0558] Elutriation was performed as follows. The elutriation pump
speed was set to .about.65 ml/min, and the storage ethanol was
removed from the feed lines for the pump. The feed lines, chambers,
and rotor were washed with .about.100 ml distilled water. Pump
speed was reduced to 50 ml/min, and elutriation buffer was passed
through the feed lines, chamber, and rotor. The feed lines were
checked for the presence of bubbles, and any bubbles were removed.
The centrifuge speed was then set at 1950.+-.1 rpm, and the pump
was calibrated at 15 ml/min. The pump speed was then reduced to 11
ml/min and the stopcock to the chamber was closed.
[0559] To load cells, the loading syringe stopcock was closed and
the outlet pipette was placed in the 50 ml sample tube labeled as
11 ml/min fraction. The cells were mixed and added to the loading
syringe. The stopcock of the loading syringe was opened and the
feeding tube was rinsed with 10 ml elutriation buffer. When
.about.0.5 ml cells remained in the syringe, elutriation buffer was
added and this step was repeated one more time. Following this
step, the loading syringe stopcock was closed and the chamber
stopcock was opened.
[0560] Fifty milliliter fractions were collected at 11 (2
fractions), 14, 16, and 36 (2 fractions) ml/min pump speeds, and
then placed on ice. In accordance with previous observations, the
monocytes were predicted to be in the 36 ml/min fraction. The
monocyte fraction was centrifuged at 1800 rpm for 8 min, and the
cells were resuspended in 10 ml 25% fetal bovine serum/RPMI with 1
.mu.g/ml polymyxin B. The cells were counted and stored on ice
until use.
[0561] Cell Culture Conditions:
[0562] The isolated peripheral blood monocytes were resuspended in
RPMI 1640 medium containing 10% fetal bovine serum (Hyclone, Logan,
Utah) supplemented with penicillin/streptomycin, 2 mM glutamine, 1%
non-essential amino acids, 1 mM sodium pyruvate, and IL-4 (75
ng/ml) and GM-CSF (15 ng/ml) cytokines (each from GibcoBRL). The
cell suspension (5.times.10.sup.5 cells/ml) was transferred to
tissue culture flasks and incubated in chambers containing 5%
CO.sub.2 at 37.degree. C. for 7 days. Following the incubation
period, the cell cultures were pipetted vigorously to remove cells
from the flask. The human monocytic cell line THP1 was grown at
37.degree. C. in 5% CO.sub.2 to a final concentration of
5.times.10.sup.5 cells/ml in RPMI 1640 medium containing 10% fetal
bovine serum supplemented with penicillin/streptomycin and 2 mM
glutamine.
[0563] Poly(A).sup.+ RNA Isolation:
[0564] GM-CSF/IL-4 differentiated human peripheral blood
mononuclear cells (2.times.10.sup.8 cells) and THP1 human monocytes
(2.times.10.sup.8 cells) were washed twice with PBS (GibcoBRL) at
4.degree. C. Poly(A).sup.+ RNA was isolated directly using the Fast
Track.TM. 2.0 kit (Invitrogen Corp., Carlsbad, Calif.).
[0565] Subtraction Library Construction:
[0566] A cDNA subtraction library was made using the CLONTECH
PCR-Select.TM. cDNA Subtraction Kit (CLONTECH, Palo Alto, Calif.).
Manufacturer's protocols were followed using 2.0 .mu.g of
GM-CSF/IL-4 differentiated human peripheral blood monocyte poly
(A).sup.+ RNA as the tester sample and 2.0 .mu.g of resting THP1
monocyte poly(A).sup.+ RNA as the driver sample. Ten secondary PCRs
were combined and run on a 1.2% agarose gel. Fragments ranging from
approximately 0.3-kb to 1.5-kb were gel purified using the QIAGEN
gel extraction kit (QIAGEN, Valencia, Calif.) and inserted into the
TA cloning vector, pCR2.1 (Invitrogen). The construct was used for
transformation into TOP10F' competent E. coli (Invitrogen), and
transformants were plated onto Lauria-Bertani (LB) plates
containing 50 .mu.g/ml ampicillin. Approximately 300 clones were
isolated and grown in LB broth containing similar concentrations of
ampicillin. Plasmids were isolated using QIAGEN miniprep spin
(QIAGEN) and sequenced using ABI cycle sequencers (ABI Prism, PE
Applied Biosystems).
[0567] Full-Length Cloning:
[0568] To clone the 5' and 3' ends of BSL1, the SMART.TM. RACE
(rapid amplification of cDNA ends) cDNA Amplification kit
(CLONTECH) was used according to the manufacturer's directions. The
5' and 3' RACE libraries were constructed using 1.0 .mu.g of
poly(A).sup.+ RNA template obtained from human microvascular
endothelial cell treated with TNF-alpha for 1 hr. The 5'-RACE-PCR
mixture contained 1.5 .mu.l of 5'-RACE ready cDNA, 0.4 .mu.M JNF
155 primer (5'-GGCATAATAAGATGGCTCCC-3'; SEQ ID NO:21), 1.times.
Universal Primer Mix (UPM), 200 .mu.M dNTP, 1.times. Advantaq Plus
PCR buffer (CLONTECH), and 1.times. Advantaq Plus Polymerase
(CLONTECH) in a total volume of 25 .mu.l. The 3'-RACE-PCR mixture
contained the same buffer conditions, 3'-RACE ready cDNA, and 0.4
.mu.M JNF 154 primer (5'-CATGAACTGACATGTCAGGC-3'; SEQ ID NO:22).
Both reactions were incubated using a traditional touchdown PCR
approach: 5 cycles of incubation at 94.degree. C. for 30 sec
(seconds), 65.degree. C. for 30 sec, and 72.degree. C. for 3 min; 5
cycles of incubation at 94.degree. C. for 30 sec, 63.degree. C. for
30 sec, and 72.degree. C. for 3 min; and 15 cycles of incubation at
94.degree. C. for 30 sec, 62.degree. C. for 30 sec, and 72.degree.
C. for 3 min.
[0569] The PCR products were isolated by electrophoresis using a
2.0% agarose gel, and DNA was visualized by ethidium bromide
staining. An 888-bp fragment from the 5'-RACE reaction and a
1,110-bp fragment from the 3'-RACE reaction were purified using the
QIAGEN gel extraction kit and resuspended in 10 .mu.l distilled
water. Six microliters of each fragment was ligated into pCR2.1-TA
cloning vector (Invitrogen), and the ligation mixture was used for
transformation into TOP10F' ultracompetent E. coli cells
(Invitrogen). Transformants were plated onto LB plates supplemented
with 50 .mu.g/ml ampicillin, 40 mg/ml X-gal, and 100 mM IPTG.
Colonies were isolated and grown overnight at 37.degree. C. in 4 ml
of LB-broth supplemented with 50 .mu.g/ml ampicillin. Plasmids were
isolated using the QIAGEN miniprep spin kit (QIAGEN), resuspended
in 30 .mu.l distilled water, and sequenced using an ABI cycle
sequencer (ABI Prism, PE Applied Biosystems).
[0570] To generate the full-length clone, JNF155RACE5.1,
JNF154RACE3.2, and pCR2.1 were ligated together. JNF155RACE5.1 was
doubly digested with Xhol and HindIII. JNF154RACE3.2 was doubly
digested with HindIII and EcoRI. The TA cloning vector (Invitrogen)
was digested with Xhol and EcoRI. Each fragment was purified using
the QIAGEN gel extraction kit and resuspended in water. One
microliter of each digested fragment was ligated together in the
same reaction using T4 DNA ligase. The ligation mixture was used
for transformation into TOP10F' E. coli ultracompetent cells.
Transformants were plated onto LB plates containing 50 .mu.g/ml
ampicillin, 40 mg/ml X-gal, and 100 mM IPTG. Colonies were isolated
from the plates, and grown in LB broth containing 50 .mu.g/ml
ampicillin overnight at 37.degree. C. Plasmids containing
full-length BSL1 were purified using the QIAGEN miniprep spin kit
(QIAGEN), and sequenced (ABI cycle sequencer; PE Applied
Biosystems). The plasmid carrying DNA encoding the full-length BSL1
sequence (pTADV:BSL1) was deposited with the American Type Culture
Collection (ATCC, 10801 University Blvd., Manassas, Va. 20110-2209
USA), under ATCC Designation No. PTA-1989, on Jun. 6, 2000.
Example 2
Characterization of BSL1
[0571] Sequence Analysis of the BSL1 Clones:
[0572] The full-length BSL1 nucleotide and predicted amino acid
sequence was determined from a clone isolated from TNF-alpha
treated human microvascular endothelial cell cDNA subtraction
library (FIGS. 1A-1B) and a clone isolated from a GM-CSF/IL-4
differentiated human monocyte cDNA library (FIG. 1C). The
sequencing primers for the BSL1 clones are shown in Table 1.
3TABLE 1 Primer Sequence SEQ ID NO: JNF 292 forward
GATTTACAAAGAGAGGTCGG 23 JNF 298 reverse AGGGTTATTTTAAGTAGGGAGC 24
JNF 293 forward GGAAATGTATGTTAAAAGCACG 25 JNF 297 reverse
GGCATGGATCCTCAGCCCTGGG 26 JNF 294 forward GAGACCCATGGGGTCTCCAGGG 27
JNF 296 reverse GTTCAAGCACAACGAATGAGGC 28 JNF 295 forward
TGGCTTTGCCACATGTCAAGGG 29
[0573] Both BSL1 clones had identical coding sequences, however,
the clone obtained from the differentiated human monocyte cDNA
library contained a different sequence in the 3' untranslated
region of the BSL1 gene (FIG. 2B; see bold text). The nucleotide
and predicted amino acid sequences of BSL1 are shown in FIGS.
1A-1C.
[0574] EST clones encoding BSL1 were identified from public
(GenBank) and private (Incyte Genomics) databases, and are shown in
Table 2.
4TABLE 2 Data- Length Position Clone ID base Tissue (bp) (1-3797)
AI733919 GenBank Ovary tumor 429 401-829 AA292201 GenBank Ovary
tumor 430 401-830 AA399416 GenBank Ovary tumor 325 506-830
3166966H1 Incyte CD4.sup.+ T lymphos t/CD3, CD28 Ab's 197 415-611
4415633H1 Incyte Peripheral Blood Monocytes, t/anti- 253 542-794
IL-b, LPS AA368815 GenBank Placenta, fetal 55 998-1052 5611256H1
Incyte Peripheral Blood Monocytes, t/anti- 254 1005-1258 IL-10,
LPS, SUB 5048659F6 Incyte Placenta, fetal 332 1016-1347 3680369H1
Incyte Lung, aw/asthma 240 1203-1442 AI202916 GenBank Germ cell
tumor, pool, SUB 259 1381-1639 AA373164 GenBank Lung fibroblast
line, HSC172, fetal 274 1416-1689 4354914H1 Incyte Fat, auxiliary,
aw/breast adenoCA 288 1449-1736 AA037078 GenBank Fibroblasts,
senescent 365 1529-1893 171033R6 Incyte Bone Marrow 273 1785-2057
R30906/ GenBank Placenta, neonatal 1932 1867-3798 R30861*
*Full-length sequence not known.
[0575] It is noted that the BSL1 coding sequence and predicted
amino acid sequence have also been identified as B7-H1 and PD-L1
(H. Dong et al. (1999) Nature Med. 5:1365-9; GenPept Accession No.
NP.sub.--054862; G. J. Freeman et al. (2000)J. Exp. Med.
192:1027-1034). In addition, a murine homologue of B7-H1 has been
identified (H. Tamura et al. (2001)Blood 97:1809-1816). Notably,
the mouse and human B7-H1 factors have been described as
costimulatory molecules (H. Dong et al. (1999) Nature Med.
5:1365-9; H. Tamura et al. (2001) Blood 97:1809-1816), whereas
PD-L1 has been described as an inhibitor of T-cell proliferation
(G. J. Freeman et al. (2000) J. Exp. Med. 192:1027-1034).
[0576] Chromosomal Mapping:
[0577] BSL1 was previously mapped utilizing radiation hybrid
mapping (T. Ishida et al. (1999) CytoGenet. Cell Genet. 85:232-6).
Analysis of NCBI's Genemap '99 using GenBank EST AA399416 indicated
that the BSL1 gene was linked to chromosome 9p24 with the order of
AFM274xe1- stSG46389 (BSL1)-AFM242xh6.
[0578] BSL1 Expression Analysis:
[0579] BSL1 expression patterns were determined by Northern blot
analysis of several cell types, including resting peripheral blood
T-cells, peripheral blood T-cells stimulated with
anti-CD3/anti-CD28 antibodies, peripheral blood T-cells stimulated
with phorbol 12 myristate 13 acetate (PMA), peripheral blood
T-cells stimulated with phytohemaglutinin (PHA), resting THP1
monocytes, THP1 stimulated with lipopolysacharide (LPS), resting
peripheral blood monocytes, resting peripheral blood monocytes
stimulated with PHA, resting peripheral blood monocytes stimulated
with GM-CSF and IL-4, RAJI B cells, RAMOS B cells, resting human
microvascular endothelial cells (HMVEC), HMVEC stimulated with
TNF-alpha, and serum starved H292 human lung epithelial cells.
[0580] Cell Culture Conditions:
[0581] Peripheral blood T-cells were grown in RPMI 1640 (Hyclone)
with 10% human serum at 37.degree. C. in 5% CO.sub.2 for 48 hr.
Peripheral blood T-cells stimulated with anti-CD3 and anti-CD28
antibodies were grown in RPMI 1640 with 10% human serum at
37.degree. C. in 5% CO.sub.2 for 24-72 hr in the presence of 1
.mu.g/ml anti-CD3 monoclonal antibodies (MAb G19.4; P. S. Linsley
et al. (1993) Ann. Rev. Immunol. 11:191-212) and 1 .mu.g/ml
anti-CD28 monoclonal antibodies (MAb 9.3; Linsley et al., supra).
Peripheral blood T-cells stimulated with PMA and ionomycin were
grown in RPMI 1640 (Hyclone) with 10% human serum at 37.degree. C.
in 5% CO.sub.2 for 48 hr in the presence of 30 ng/ml PMA with 1
.mu.M ionomycin. Peripheral blood T-cells stimulated with PHA were
grown in RPMI 1640 (Hyclone) with 10% human serum at 37.degree. C.
in 5% CO.sub.2 for 48 hr in the presence of 3 .mu.g/ml PHA. THP1
cells obtained from an immortal human monocytic cell line were
grown in RPMI 1640 (Hyclone) with 10% fetal bovine serum at
37.degree. C. in 5% CO.sub.2 with or without 100 ng/ml LPS for 2
hr. Peripheral blood monocytes were grown in RPMI 1640 (Hyclone)
with 25% fetal bovine serum in teflon plates at 37.degree. C. in 5%
CO.sub.2 with or without 1 .mu.g/ml PHA or 15 ng/ml GM-CSF with 75
ng/ml IL-4 for 7 days. RAJI and RAMOS cells obtained from immortal
human B cell lines were grown in RPMI 1640 (Hyclone) with 10% fetal
bovine serum at 37.degree. C. in 5% CO.sub.2. HMVEC were grown in
DMEM with 10% fetal bovine serum at 37.degree. C. in 5% CO.sub.2
with or without 10 ng/ml TNF-alpha for 1-24 hr. H292 cells obtained
from an immortal human lung epithelial cell line were grown in
RPM11640 (Hyclone) with 10% fetal bovine serum at 37.degree. C. in
5% CO.sub.2, and then grown in serum free medium for 16 hr prior to
harvest.
[0582] Northern Blot Analysis:
[0583] For Northern blot analysis, 0.5 .mu.g of total poly(A).sup.+
RNA obtained from each cell type was separated on a 1.2% agarose
gel containing 3% formaldehyde, and transferred to a Hybond-N+
nylon membrane (Amersham) overnight using 20.times. SSC as transfer
buffer. The membrane was then auto-crosslinked, washed with
4.times. SSPE, and allowed to air-dry. The membrane was then
prehybridized at 65.degree. C. in ExpressHyb solution (CLONTECH)
for 1 hr, and then hybridized with a [.sup.32P]-dCTP-radiolabeled
(NEN, Boston, Mass.) random primed BSL1 cDNA probe. The probe was
obtained from a 666-bp BSL1 HindIII/PstI fragment (FIG. 6A), which
was purified using the NucTrap purification column (Stratagene),
and radiolabeled to have a specific activity of 2.0.times.10.sup.6
cpm/ml. Following hybridization, the membrane was washed in
2.0.times. SSC with 0.05% SDS at 65.degree. C., and exposed to film
for 72 hr at -70.degree. C.
[0584] A 3.8-kb BSL1 mRNA transcript was detected in several cell
types. In particular, high levels of BSL1 mRNA were detected in
peripheral blood monocytes stimulated with PHA, and in HMVEC
stimulated with TNF-alpha (FIG. 7D). Moderate levels of BSL1 mRNA
were detected in peripheral blood T-cells following stimulation
with anti-CD3 and anti-CD28 monoclonal antibodies for 72 hr (FIG.
7D). Moderate levels of BSL1 mRNA were also observed in THP1 cells
stimulated with LPS (FIG. 7D). However, BSL1 mRNA was not detected
in resting THP1 cells, resting BJAB cells, LPS-activated BJAB
cells, resting peripheral blood T-cells, PBT-activated peripheral
blood T-cells, or GM-CSF/IL-4-activated peripheral blood monocytes
(FIG. 7D). In addition, BSL1 mRNA was not detected in resting RAJI
cells, resting RAMOS cells, or serum starved H292 cells (FIG.
7D).
[0585] BSL1-Ig Fusion Construct:
[0586] The DNA fragment corresponding to the BSL1 predicted
extracellular domain (ECD; amino acids 23-290 of SEQ ID NO:12) was
amplified by PCR utilizing full-length BSL1-pCR2.1 as a template,
and oligonucleotide primers that hybridized to the 5' and 3' ends
of the BSL1 ECD: JNF 184 forward primer 5'-TCAGGTACTAGTGTT
CCCMGGACCTATATGTGG-3'; SEQ ID NO:30); and JNF 185 reverse primer
(5'-GATTCGAGATCTCCTCGAGTCCTTTCATTTGGAGGATGTGC C-3' (SEQ ID NO:31).
PCR was performed using .about.100 ng template DNA, 0.4 .mu.M of
each primer, 200 .mu.M dNTP, 1.times. Advantage 2 PCR buffer, and
1.times. Advantage 2 Polymerase (CLONTECH) in a total volume of 50
.mu.l. The PCR mixture was incubated at 94.degree. C. for 30 sec,
62.degree. C. for 30 sec, and 72.degree. C. for 1 min, and this was
repeated for 30 cycles. The PCR products were separated by gel
electrophoresis on a 1.2% agarose gel, and the DNA was visualized
by ethidium bromide staining. A 680-bp fragment corresponding to
the BSL1 ECD was purified from the agarose gel using the QIAGEN gel
extraction kit (QIAGEN), and resuspended in 32 .mu.l distilled
water.
[0587] The BSL1 ECD fragment was then digested using Spel and Bg/II
restriction endonucleases and directionally cloned into
SpeI/BamHI-digested PD19 vector using 5 units (U)/.mu.l T4 DNA
ligase (GibcoBRL). The ligation mixture was used for transformation
into DH5-alpha competent E. coli cells (GibcoBRL), and
transformants were plated onto Lauria-Bertani (LB) plates
containing 50 .mu.g/ml ampicillin. Plates were incubated overnight
at 37.degree. C., and colonies were isolated and grown overnight at
37.degree. C. in LB broth containing 50 .mu.g/ml ampicillin.
Plasmids were isolated using the QIAGEN miniprep spin kit,
resuspended in 50 .mu.l distilled water, and sequenced using ABI
cycle sequencer (PE Biosystems, Foster City, Calif.). Primer
sequences were as follows: sense JNF 184 (5'-TCAGGTACTAG
TGTTCCCAAGGACCATATGTGG-3'; SEQ ID NO:32) and anti-sense JNF 185
(5'-GATTCGAGATCTCCTCGAGTCTTTCATTGGGGATGTGCC-3'; SEQ ID NO:33).
[0588] The plasmid carrying DNA encoding BSL1-Ig (pD19:BSL1Ig) was
deposited with the American Type Culture Collection (ATCC, 10801
University Blvd., Manassas, Va. 20110-2209 USA), under ATCC
Designation No. PTA-1992, on Jun. 6, 2000. The nucleotide and
predicted amino acid sequence of BSL1-Ig is shown in FIGS.
2A-2B.
[0589] BSL1 monoclonal antibodies: The BSL1 -Ig fusion protein was
purified by affinity purification as described for BSL3-Ig, below.
The purified fusion protein was then used to immunize mice using
the protocol described for BSL3-Ig. Following this, hybridoma cell
lines were constructed and BSL1 monoclonal antibodies (MAbs) were
isolated as described for BSL3, below. In addition, BSL1 MAbs were
screened for specificity by whole-cell ELISA. For whole cell ELISA,
COS cells were transiently transfected with full length BSL1
(L156-3). Cells were lifted with versene on day 4 following
transfection. Cells were washed twice in PBS and resuspended in PBS
with 10% FBS at a concentration of 5.0.times.10.sup.6 cells/ml.
Then, 50 .mu.l of cells were added to each well of a Falcon 3911
96-well plate and incubated on ice for 30 min. Next, 50 .mu.l
supernatant from the putative BSL1 hybridomas was added per well
and incubated on ice for 30 min. Cells were washed twice in PBS.
Cells were then resuspended in goat anti-mouse HRP-conjugated
secondary antibodies (Amersham; Cat. # NA9310) diluted 1:1000 in
PBS. Cells were incubated on ice for 30 min, washed twice in PBS,
and resuspended in 125 .mu.l PBS. Following this, cells were
transferred to a fresh plate. Cells were washed in PBS and
resuspended in 25 .mu.l PBS. Next, 125 .mu.l Peroxidase solution B
(KPL, Gaithersburg, Md.; Cat. #50-65-00) with TMB peroxidase
substrate (KPL; Cat. # 50-76-01) was added. Color was allowed to
develop. Cells were pelleted, and 100 .mu.l supernatant was
transferred to an Immulon 2 plate. The signal was quenched with 100
.mu.l 1 N sulfuric acid, and the plates were read at
OD.sub.450/OD.sub.630.
Example 3
Identification of BSL2
[0590] Database Searches:
[0591] BSL2 was identified by BLAST and FASTA analysis of the
Incyte Genomics sequence databases (Incyte Genomics) utilizing the
B7-1 or B7-2 amino acid sequences as query sequences. For BLAST
analysis, the BLOSSUM-62 scoring matrix was used (S. Henikoff et
al. (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919), and the
remaining parameters were set to the default designations. For
FASTA analysis, all the parameters were set to the default
designations (W. R. Pearson et al. (1988) Proc. Natl. Acad. Sci.
USA 85:2444-2448). The sequence database searches identified two
Incyte Genomics `templates`: 252899.6 and the potential splice
variant 252899.8. It is noted that Incyte Genomics templates are
consensus EST sequences that are considered to represent mRNA
transcripts.
[0592] Sequence Analysis of the BSL2 Clone:
[0593] Incyte Genomics template 252899.8 was used to identify
Incyte Genomics clone 4616811. Incyte Genomics clone 4616811
belonged to Incyte Genomics Library ID No. BRAYDIT01, which was
originally constructed using poly(A).sup.+ RNA from diseased
hypothalamus tissue. Incyte Genomics clone 4616811 was obtained
from Incyte Genomics and used for sequence analysis (ABI cycle
sequencer, PE Biosystems) with the primers shown in Table 3.
5TABLE 3 Clone Primer Sequence SEQ ID NO: 4616811 392.423
GGTGCACAGCTTTGCTGA 34 4616811 392.415 GCTGTGCACCAGCTGTTT 35 4616811
392.439 GCTATGAAAGGTCCAGAG 36 4616811 392.499 GAATCTGGTGGTGTCCAA 37
4616811 392.1716 CTCTGTCACCATCACAGG 38 4616811 392.852
CTCTGTCACCATCACACC 39 4616811 392.523 GAAATCCCGGATGCTCAC 40 4616811
392.766A ACCACACGTGTTCCAGCA 41 4616811 392.766B TGCTGGAACACGTGTGGT
42 4616811 392.383 GGCCCTCAGCAAAGCTGT 43 4616811 392.1448
AGCTGTAGGTGCCATTCG 44 4616811 392.892 AGGGACCTGGACCTCCAC 45 4616811
392.1528 TGGGGGGAATGTCATAGG 46 4616811 392.1215 AGCAGGCAGGATGACTTA
47 4616811 392.1242 AACAGACCACCCACAACG 48 6487516 314.570
GCAAATGGCACCTACAGC 49 6487516 314.634 TGTGGGGTGTGATGGTGA 50 6487516
314.450 ATGAAAGGTCCAGAGGGC 51 6487516 314.584 ACCCATAATTCTTACCCA 52
6487516 314.824 CACAGCTCTGTTTGATCT 53 6487516 314.644
CTCCTACCCTCTGGCTGC 54
[0594] Notably, the predicted amino acid sequence of Incyte
Genomics clone 4616811 contained 2 sets of v/c (variable/constant
domain) folds, whereas typical B7-related amino acid sequences
contain only 1 set of v/c folds. Seqweb Gap (Genetics Computer
Group) analysis indicated that the BSL2-616811 sequence shared less
than 50% sequence identity with B7-1B7-2, BSL1/B7-H1 nucleotide
sequences, while the BSL2-4616811 amino acid sequence shared less
than 35% sequence identity with the B7-1, B7-2, and BSL1/B7-H1
amino acid sequences. A sequence similar to BSL2-46167711 has also
been identified as an amyloid precursor protease in International
Patent Application No. WO 00/68266 to G. W. Becker et al.
[0595] The nucleotide and predicted amino acid sequences of Incyte
Genomics clone 4616811 (BSL2-4616811) are shown in FIGS. 3A-3B and
3G. The plasmid carrying DNA encoding BSL2-4616811
(pINCY:BSL2-461811) was deposited with the American Type Culture
Collection (ATCC, 10801 University Blvd., Manassas, Va. 20110-2209
USA), under ATCC Designation No. PTA-1993, on Jun. 6, 2000.
[0596] Full-Length Cloning:
[0597] To verify the sequence of Incyte Genomics clone 4616811, PCR
primers were designed to amplify the nucleotide sequence from the
predicted translation start codon to the predicted translation stop
codon of the clone: forward primer BSL2-7 (5'-ATGCTGCGTCGGCG-3';
SEQ ID NO:55); reverse primer BSL2-8
(5'-TCAGGCTATTTCTTGTCCATCATC-3'; SEQ ID NO:56).
[0598] A HMVEC library was constructed utilizing the SMART.TM. RACE
cDNA Amplification Kit (CLONTECH) according to manufacturer's
instructions, using poly(A).sup.+ RNA obtained from human
microvascular endothelial cells treated with TNF-alpha for 1 hr as
the RACE reaction template. The PCR mixture included 1 .mu.l
PCR-ready HMVEC library, 5 .mu.l PCR buffer (GibcoBRL), 1.5 .mu.l
50 mM MgCl.sub.2, 1 .mu.l 10 mM dNTPs (Boehringer Mannheim
Biochemicals/Roche Molecular Biochemicals, Indianapolis, Ind.), 25
pMol BSL2-7 primer, 25 pMol BSL2-8 primer, and 1 .mu.l CLONTECH
Advantage Enzyme mix in a total volume of 50 .mu.l. PCR was
performed in a PE Biosystems Thermal Cycler model 9700. The PCR
mixture was incubated at 94.degree. C. for 1 min, followed by 35
cycles of incubation at 94.degree. C. for 30 sec, 60.degree. C. for
30 sec, and 72.degree. C. for 45 sec, followed by incubation at
72.degree. C. for 10 min.
[0599] One microliter of the PCR mixture was ligated directly into
pCR2.1 (Invitrogen) according to the manufacturer's directions. One
half of the ligation mixture was used for transformation into
Max-Efficiency DH5-alpha E coli cells (GibcoBRL) in accordance with
the manufacturer's directions. Transformants were plated onto LB
agar plates with 100 .mu.g/ml ampicillin and 30 .mu.g/ml X-gal and
incubated at 37.degree. C. overnight. White colonies were isolated
and grown overnight at 37.degree. C. in 5 ml LB broth containing
100 .mu.g/ml ampicillin.
[0600] Plasmid DNA was isolated from the bacterial culture using
Spin Miniprep kit (QIAGEN) according to the manufacturer's
directions. DNA was digested with EcoRI to release the cloned
insert, and the digestion mixture was analyzed by electrophoresis
on a 1% agarose gel. Insert fragments larger than 700-bp were
sequenced using the vector-specific M13 (5'-GTTTTCCCAGTCACGAC-3';
SEQ ID NO:57) and M13 reverse (5'-CAGGAAACAGCTATGAC-3'; SEQ ID
NO:58) sequencing primers (ABI cycle sequencer, PE Applied
Biosystems).
[0601] Sequence analysis indicated that two splice variants of BSL2
had been cloned: BSL2-L165-21 and BSL2-L165-35b. The BSL2-L165-21
and BSL2-L165-35b splice variants encoded amino acid sequences that
each contained one v/c fold and were .about.95% identical to one
another. Seqweb Gap analysis (Genetics Computer Group) also
indicated that the BSL2-L165-21 and BSL2-L165-35b nucleotide
sequences shared less than w 50% sequence identity with B7-1, B7-2,
and BSL1/B7-H1 nucleotide sequences, while the BSL2-L165-21 and
BSL2-L165-35b amino acid sequences shared less than 35% sequence
identity with the B7-1, B7-2, and BSL1/B7-H1 amino acid
sequences.
[0602] Sequence analysis further indicated that the amino acid and
nucleotide sequences of BSL2-L165-21 shared less than 99% sequence
identity with the PRO352 amino acid and nucleotide sequences,
respectively, reported in International Patent Application No. WO
99/46281 to K. P. Baker et al. The amino acid and nucleotide
sequences of BSL2-L165-35b shared less than 99.5% sequence identity
with the PRO352 amino acid and nucleotide sequences,
respectively.
[0603] Amino acid sequence alignments using GCG Gap program (GCG,
Madison, Wis.) indicated that the longest stretch of identical
amino acid residues shared by BSL2-L165-21 and PRO352 was 88
contiguous amino acids in length. The longest stretch of identical
amino acid residues shared by BSL2-L165-35b and PRO352 was 168
contiguous amino acids in length. Analysis with ClustaIW (J. D.
Thompson et al. (1994) Nucleic Acids Res. 22:4673-4680 indicated
that the longest stretch of identical amino acids shared by
BSL2-4616811 and PRO352 was 206 contiguous amino acids in
length.
[0604] Nucleotide sequence alignments indicated that the longest
stretch of identical bases shared by BSL2-L165-21 and PRO352 was
254 contiguous nucleotides in length. The longest stretch of
identical bases shared by BSL2-L165-35b and PRO352 was 305
contiguous nucleotides in length. The longest stretch of identical
bases shared by BSL2-4616811 and PRO352 was 618 contiguous
nucleotides in length. Notably, BSL2-L165-35b has also been
identified as B7-H3, a co-stimulatory molecule for T-cell
activation (A. I. Chapoval et al. (2001) Nature Immunology
2:269-274).
[0605] The nucleotide and predicted amino acid sequences of the
BSL2-L165-21 splice variant are shown in FIGS. 3C-3D, while the
nucleotide and predicted amino acid sequences of BSL2-L165-35b are
shown in FIGS. 3E-3F. The plasmid carrying DNA encoding
BSL2-L165-21 (pCR2.1:BSL2-L165-21) was deposited with the American
Type Culture Collection (ATCC, 10801 University Blvd., Manassas,
Va. 20110-2209 USA), under ATCC Designation No. PTA-1987, on Jun.
6, 2000. In addition, the plasmid carrying DNA encoding
BSL2-L165-35b (pCR2.1:BSL2-L165-35b) was deposited with the
American Type Culture Collection (ATCC, 10801 University Blvd.,
Manassas, Va. 20110-2209 USA), under ATCC Designation No. PTA-1988,
on Jun. 6, 2000.
Example 4
Characterization of BSL2
[0606] BSL2 Expression Analysis:
[0607] BSL2 expression patterns were determined by Northern blot
analysis of various tissue and cell types, using the
BSL2-4616811-derived probe that binds to the various forms of BSL2
(e.g., BSL2vcvc, BSL2v2c2, and BSL2v1c2). The procedure described
for BSL1 was used (see above), and results are shown in FIG. 6B. A
3.6-kb BSL2 mRNA transcript was detected in several cell types. In
particular, high levels of BSL2 mRNA were detected in all HMVEC
stimulated with TNF-alpha. Moderate levels of BSL2 mRNA were
detected in resting THP1 cells, and THP1 cells activated with LPS
(FIG. 7D). In contrast, low levels of BSL2 mRNA were detected in
peripheral blood monocytes stimulated with PHA or GM-CSF/IL-4, and
BSL2 mRNA was not detected in resting or stimulated peripheral
blood T-cells, or in resting RAJI cells, resting RAMOS cells, or
serum starved H292 cells (FIG. 7D).
[0608] PCR Assay to Determine Relative Abundance of BSL2-4616811
(BSL2vcvc) and BSL2-L165-35b (BSL2v1c2):
[0609] To determine whether BSL2-4616811 (BSL2vcvc) or
BSL2-L165-35b (BSL2v1c2) was predominant species of BSL2, and
whether predominance corresponded with cell type and/or stimulus
type, the following experimental approach was used. Analysis of the
genomic sequence of BSL2 indicated that the sequence includes
several exons separated by introns. It was presumed that a primary
transcript was produced from this sequence, and the primary
transcript was spliced to yield BSL2-4616811 mature RNA. Analysis
of BSL2-4616811 sequence showed that it coded for the following: a
5' UTR, an initiating ATG, a signal peptide sequence, a variable Ig
fold (v1), an Ig constant fold (c1), an Ig V fold (v2), an Ig C
fold (c2), a short hinge a putative transmembrane domain, a short
cytoplasmic tail, a stop codon, and a 3' UTR.
[0610] The BSL2-4616811 coding sequence appeared unique in the
human genome, as the v1 and c1 (v1 c1) sequence was about 95%
identical to the v2 and c2 (v2c2) sequence at the amino acid level.
Importantly, all of the structurally important residues were
conserved in the v1c1 and v2c2 amino acid sequences, and most of
the changes from v1c1 to v2c2 were conservative changes. A
schematic of the BSL2-4616811 (BSL2vcvc), BSL2-L165-21 (BSL2v2c2),
and BSL2-L165-35b (BSL2v1c2) v/c domains is show in FIG. 3H.
[0611] Despite the 96% identity between v1c1 and v2c2 at the
nucleotide level, sequence comparison between the two regions using
GCG Gap revealed one short region of relatively low homology. A
forward primer designated BSL2-9 was designed to take advantage of
this short region of low homology. BSL2-9 was designed to bind
specifically to v1 (FIG. 8E demonstrates the specificity of the
BSL2-9 primer). A reverse primer, BSL2-11 was designed to hybridize
to the hinge sequence.
[0612] Notably, the BSL2-4616811 transcript contained both the
BSL2-9 v1-binding site in v1 and the homologous site in v2. The
BSL2-L165-35b transcript contained only the BSL2-9 v1 binding site.
The BSL2-L165-21 transcript contained only the v2 site.
Accordingly, PCR performed with primers BSL2-9 and BSL2-11 was
expected to produce: 1) a PCR product of approximately 1150-bp,
representing BSL2-4616811; or 2) a PCR product of about 550-bp,
representing BSL2-L165-35b.
[0613] PCR was initially conducted with BSL2-4616811 plasmid to
confirm the specificity of the BSL2-9 primer. PCR was performed
using 2 .mu.l of 10 ng/.mu.l BSL2-4616811 plasmid DNA, 5 .mu.l PCR
buffer (GibcoBRL), 1.5 .mu.l of 25 mM MgCl.sub.2 (GibcoBRL), 1
.mu.l of 10 mM dNTPs (GibcoBRL), 2.5 .mu.l of 10 pMol/.mu.l BSL2-9
primer (5' TGGTGCACAGCTTTGCT 3'; SEQ ID NO:59), 2.5 .mu.l of 10
pMol/.mu.l BSL2-11 primer (5' TCTGGGGGGAATGTCAT 3'; SEQ ID NO:60),
0.5 .mu.l of 5 U/.mu.l GibcoBRL platinum Taq DNA polymerase (Cat. #
10966-018), and 35 .mu.l dH.sub.2O. PCR was performed on a PE
Biosystems 9700 using the following cycling conditions: 94.degree.
C. for 30 sec; followed by 35 cycles of 94.degree. C. for 30 sec,
61.degree. C. for 30 sec, 72.degree. C. for 60 sec; followed by
72.degree. C. for 10 min. Following this, 40 .mu.l of the PCR
reaction was run on a 1.2% agarose gel next to Lambda BstEII DNA
ladder (New England Biolabs Beverly, Mass.; Cat. # 301-4S). The
1150-bp band was predominant, indicating that the BSL2-9 PCR primer
was specific for the BSL2-4616811 sequence (FIG. 8E).
[0614] RAJI, RAMOS, PM-LCL, PL-LCL, and CE-LCL B-like cell lines;
HL-60 and Thp1 monocytic like cell lines; and CEM and Hut78 T-like
cell lines were grown in RPMI 1640 with 10% FBS and 1% GibcoBRL
penicillin/streptomycin to a concentration of 5.times.10.sup.5
cells/mi. The cultures were split and one-half of the B-like and
T-like cell cultures were stimulated with 30 ng/ml PMA and 1 .mu.M
ionomycin for 24 hr. Monocytic cell lines were stimulated with 1
.mu.g/ml LPS for 24 hr. Early passage HUVEC were grown to 90%
confluence, and one-half of the culture was stimulated with 10
ng/ml TNF.alpha., and harvested at 6 or 24 hr. Unstimulated HUVEC
were harvested at 24 hr.
[0615] Peripheral blood T-cells from two donors were purified as
described, above. Cells were added (1.times.10.sup.6 cells/ml) to
RPMI 1640 with 10% human serum and 1% GibcoBRL
penicillin/streptomycin. Cells were then incubated at 37.degree. C.
in 5% CO.sub.2 for 72 hr. T75 flasks were coated with 1 .mu.g/ml
CD3 MAb G19.4 (described herein) in PBS for 4 hr at 37.degree. C.
The flask was washed twice with PBS, and cells were added
(1.times.10.sup.5 cells/ml) in RPMI 1640 with 10% human serum and
1% GibcoBRL penicillin/streptomycin. CD28 MAb 9.3 (described
herein) was added to a final concentration of 1 .mu.g/ml. Cells
were grown at 37.degree. C. in 5% CO.sub.2 for 72 hr. Cells were
added (1.times.10.sup.6 cells/ml) to RPMI 1640 with 10% human serum
and 1% GibcoBRL penicillin/streptomycin. PMA was added to 30 ng/ml
and ionomycin was added to 1 .mu.M and incubated at 37.degree. C.
in 5% CO.sub.2 for 48 hr. Proliferation of stimulated T-cells was
confirmed visually. All cell types were pelleted and frozen on dry
ice and stored at -70.degree. C. until use.
[0616] Total RNA was prepared using the Invitrogen (Carlsbad,
Calif.) SNAP total RNA isolation kit (Cat. # K1950-01) according to
the manufacturer's instructions. First strand cDNA was produced
using the GibcoBRL Superscript First-Strand Synthesis System for
RT-PCR (Cat. # 11904-018) according to the manufacturer's
instructions for oligo dT priming. PCR was performed using 2 .mu.l
first strand cDNA, 5 .mu.l PCR buffer (GibcoBRL), 1.5 .mu.l of 25
mM MgCl.sub.2 (GibcoBRL), 1 .mu.l of 10 mM dNTPs (GibcoBRL), 2.5
.mu.l of 10 pMol/.mu.l BSL2-9 primer (5' TGGTGCACAGCTTTGCT 3'; SEQ
ID NO:61), 2.5 .mu.l of 10 pMol/.mu.l BSL2-11 primer (5'
TCTGGGGGGAATGTCAT 3'; SEQ ID NO:62), 0.5 .mu.l of 5 U/.mu.l
GibcoBRL platinum Taq DNA polymerase (Cat. # 10966-018), and 35
.mu.l dH.sub.2O. PCR was performed on a PE Biosystems 9700 using
the following cycling conditions: 94.degree. C. for 30 sec;
followed by 35 cycles of 94.degree. C. for 30 sec, 61.degree. C.
for 30 sec, 72.degree. C. for 60 sec; followed by 72.degree. C. for
10 min. Following this, 40 .mu.l of the PCR reaction mixture was
run on a 1.2% agarose gel.
[0617] PCR analysis indicated that certain cell types contained
predominantly the BSL2-4616811 (BSL2vcvc) transcript, with or
without stimulation. Unstimulated and stimulated PL-LCL cells
showed higher levels of the BSL2-4616811 transcript than the than
the BSL2-L165-35b transcript (FIG. 8A). Both unstimulated and
stimulated HUVEC cells showed higher levels of the BSL2-4616811
transcript than the BSL2-L165-35b transcript (FIG. 8B).
[0618] In contrast, other cell types contained predominantly the
BSL2-L165-35b (BSL2v1c2) transcript, with or without stimulation.
Stimulated RAJI cells, and unstimulated and stimulated RAMOS cells
showed higher levels of the BSL2-L165-35b transcript than the
BSL2-4616811 transcript (FIG. 8A). Unstimulated and stimulated HL60
cells showed higher levels of the BSL2-L165-35b transcript than the
BSL2-4616811 transcript (FIG. 8B).
[0619] In addition, certain cell types showed an increase in
BSL2-4616811 (BSL2vcvc) transcript levels upon activation.
Unstimulated PM-LCL cells showed higher levels of the BSL2-4616811
transcript, which increased relative to the BSL2-L165-35b
transcript upon stimulation (FIG. 8A). Similarly, unstimulated
CE-LCL cells showed higher levels of the BSL2-4616811 transcript,
which increased relative to the BSL2-L165-35b transcript upon
stimulation (FIG. 8B). Unstimulated Thp1 cells showed equivalent
levels of the BSL2-4616811 and the BSL2-L165-35b transcript,
however, levels of the BSL2-4616811 transcript increased upon
stimulation (FIG. 8B). Unstimulated peripheral blood T-cells from
donor 079 showed predominantly BSL-L165-35b but shifted to
predominantly BSL2-4616811 upon stimulation. Peripheral blood
T-cells from donor 124 showed a less dramatic shift from
BSL2-L165-35b to BSL2-4616811 upon stimulation (FIG. 8C).
Unstimulated CEM cells showed higher levels of the BSL2-L165-35b
transcript, but levels of the BSL2-4616811 transcript increased
upon activation (FIG. 8D).
[0620] Other cell types showed an increase in BSL2-L165-35b
(BSL2v1c2) levels upon activation. Unstimulated HUT78 cells showed
higher levels of the BSL2-4616811 transcript, but levels of the
BSL2-L165-35b transcript increased upon activation (FIG. 8D). These
results, coupled with the conservation of the amino acid sequences
in all four Ig folds, the conservation of structurally important
amino acid residues in all four Ig folds, and the conservative
nature of the amino acid differences between v1c1 and v2c2, support
a function for BSL2-4616811 (BSL2vcvc) which is distinct from
BSL2-L165-35b (BSL2v1c2) and BSL2-L165-21 (BSL2v2c2).
[0621] To rule out the presence of PCR artifacts, the PCR product
from HUVEC activated with TNF.alpha. for 24 hr was cloned using the
Invitrogen Original TA Cloning Kit (Cat. # K2000-01) according to
the manufacturer's directions. The construct was used for
transformation into bacterial cells, and 25 white colonies were
isolated and grown in LB with 100 .mu.g/ml ampicillin. DNA preps
were made and sequencing was performed. Of the 25 clones, 10 clones
did not contain insert, 3 clones did not produce readable sequence,
3 clones contained BSL2-related sequences with extensive deletions,
and the remaining 9 clones produced sequence consistent with
BSL2-4616811.
[0622] It was noted that no PCR product corresponding to
BSL2-4616811 or BSL2-L165-35b was observed in unstimulated RAJI
cells. To confirm this result, PCR was repeated for unstimulated
and unstimulated RAJI cells as previously described. Again, no PCR
product was detected for the unstimulated RAJI cells. Following
this, PCR was performed using G3PDH primers with template isolated
from unstimulated and stimulated RAJI cells. Cycling conditions
were identical to those described above, except the annealing
temperature was 55.degree. C., and the extension time was 45 sec.
Relatively equal amounts of G3PDH product was detected for both
unstimulated and stimulated RAJI cells. This provided further
support for the observation that unstimulated RAJI cells do not
contain detectable BSL2 transcript.
[0623] BSL2-L165-35b-Ig (BSL2v1 c2-Ig) Fusion Construct:
[0624] BSL2-L165-35b-Ig (BSL2v1c2-Ig) was constructed as follows.
The extracellular domain of BSL2-L165-35b was amplified by PCR from
an L165-35b DNA preparation. The PCR reaction included 1 .mu.l of a
1/1000 dilution of the L165-35b template, PCR buffer, dNTP, and
MgCl.sub.2 from Gibco (described herein), 2.5 .mu.l of 10 .mu.M
primer BSL2-L165-21-Ig-1, 2.5 .mu.l of 10 .mu.M primer
BSL2-L165-21-Ig-2 (both primers were described for the
BSL2-4616811-Ig construction, below), and 1 .mu.l CLONTECH AdvanTaq
Plus (Palo Alto, Calif.; Cat. # 8431-1) in a total volume of 50
.mu.l. PCR conditions included incubation at 94.degree. C. for 1
min; followed by 20 cycles of incubation at 94.degree. C. for 30
sec, 59.degree. C. for 30 sec, 72.degree. C. for 45 sec; followed
by incubation at 72.degree. C. for 10 min. PCR was performed on a
PE Applied Biosystems (Perkin-Elmer, Foster City, Calif.) GeneAmp
PCR System 9700 thermal cycler.
[0625] Following PCR, 10 .mu.l of the reaction mixture was run on a
1.2% agarose/0.5.times. TBE gel to check for product. The remainder
of the PCR reaction mixture was digested at 37.degree. C. with 20 U
KpnI (Roche Molecular, Indianapolis Ind.; Cat. # 899186) and 20 U
EcoRI (Roche Molecular, Cat. # 703737) in a total volume of 80
.mu.l for 16 hr. The digestion mixture was run on a 1.2%
agarose/0.5% TBE gel. A predominant band of about 700-bp was
purified using the QIAGEN Qiaquick Gel Extraction Kit (Valencia
Calif.; Cat. # 28704). Following this, 5 .mu.l of 50 .mu.l
recovered product was run on a 1.2% agarose/0.5% TBE gel and the
DNA concentration was estimated as 10 ng/.mu.l. Then, 15 ng
recovered product was ligated into 30 ng of L200-1 (vector
described herein) digested with KpnI plus EcoRI using 5 U Gibco T4
DNA ligase (Cat. # 15224-041) in a total volume of 10 .mu.l
(ligation number L315). The reaction was incubated at 14.degree. C.
for 3 hr.
[0626] One-half of the reaction mixture was used for transformation
into Gibco MaxEfficiency DH5.alpha. competent E coli (Cat. #
18256-012). Transformants were plated on LB plates plus 100
.mu.g/ml ampicillin and incubated at 37.degree. C. for 18 hr.
Bacterial colonies were grown in 5 ml LB plus 100 .mu.l/ml
ampicillin for 16 hr. DNA preps were made using QIAGEN Qiaprep Spin
Miniprep Kit (Cat. # 27106). Isolates L315-1 and L315-3 were
determined by sequence analysis to be correct. The BSL2-L165-35b-Ig
fusion was produced by transient transfection of COS as described
for BSL2-4616811-Ig, below. BSL2-L165-35b-Ig fusion protein was
purified using methods described herein. The concentration of the
BSL2-L165-35b-Ig fusion protein was estimated by absorbance at 280
nm assuming an extinction coefficient of 1.4. The nucleotide and
predicted amino acid sequence of BSL2-L165-35b-Ig (BLS2v1c2-Ig) is
shown in FIGS. 4C-4D.
[0627] BSL2-L165-21-Ig (BSL2v2c2-Ig) Fusion Construct:
[0628] PCR amplification of the BLS2-L165-21 cDNA template was
performed using BSL2-L165-21-Ig-1 and BSL2-L165-21-Ig-2 primers
(both primers described for the BSL2-4616811-Ig construction,
below). The PCR reaction mixture included 42 .mu.l GibcoBRL PCR
Super Mix; 2 .mu.l template (approximately 300 ng/.mu.l; diluted
1:100); 2.5 .mu.l of 1 pM/.mu.l BSL2 L165-21 lg-1 primer; 2.5 .mu.l
of 1 pM/.mu.l BSL2 L165-21 lg-2 primer; and 1 .mu.l CLONTECH
Advantage 2 DNA Polymerase mix. The PCR reaction was carried out as
follows. The reaction mixture was incubated at 95.degree. C. for 5
min, followed by 35 cycles of incubation at 95.degree. C. for 45
sec, 58.5.degree. C. for 45 sec, and 72.degree. C. for 90 sec,
followed by incubation at 72.degree. C. for 5 min. The reaction
mixture was then held at 4.degree. C.
[0629] Following this, the PCR product was cloned into a TA vector
(Invitrogen; Cat. # K2000-01 and K2000-40) using the protocol
provided by the manufacturer. The ligation reaction included 5
.mu.l H.sub.2O; 1 .mu.l 10.times. buffer (Roche, Mannheim,
Germany); 2 .mu.l vector pCR2.1; 1 .mu.l PCR product (unpurified);
and 1 .mu.l T4 Ligase (Roche). One-half of the ligation mixture was
used for transformation into max efficiency DH5.alpha. competent
cells (Invitrogen) and plated as described, above. White colonies
were isolated and grown in culture, and minipreps were performed
(QIAGEN). The miniprep DNA and vector L200-1 (described herein)
were digested with KpnI and EcoRI in SuRE/Cut Buffer A (Boehringer
Mannheim, Mannheim, Germany). The digestion mixture included 14
.mu.l miniprep DNA or L200-1 vector; 2 .mu.l KpnI; 2 .mu.l EcoRI; 2
.mu.l 10.times. Buffer A; and 10 .mu.l dH.sub.2O. The digestion
mixture was electrophoresed on a 1% SeaPlaque Low Melt agarose gel
(FMC, Rockland, Me.). Bands of approximately 750-bp from the
miniprep DNA and approximately 6200-bp from the L200-1 vector were
excised and melted at 65.degree. C.
[0630] Next, ligation reactions were carried out in 10 .mu.l total
volume. The ligation reactions included reagents listed in the
table below.
6 5:1 Insert:Vector 2:1 Insert:Vector Control Insert BSL2-L165-21 5
.mu.l 2 .mu.l 0 .mu.l Vector L200-1 1 .mu.l 1 .mu.l 1 .mu.l T4
Ligase (Roche) 1 .mu.l 1 .mu.l 1 .mu.l 10 X Ligation Buffer 1 .mu.l
1 .mu.l 1 .mu.l (Roche) dH.sub.2O 2 .mu.l 5 .mu.l 7 .mu.l
[0631] Ligation reactions were incubated overnight at 14.degree. C.
After this, the ligation mixture was used for transformation into
DH5.alpha. Max Efficiency Cells (Invitrogen). For transformations,
100 .mu.l of cells were aliquotted into pre-chilled 14 ml snap cap
tubes (Falcon, Becton Dickinson, Franklin Lakes, N.J.). Next, 2
.mu.l of DNA was added to the cells, and cells were incubated on
ice for 25-30 min. Cells were heat-shocked at 42.degree. C. for 45
sec, and then placed back on ice for at least 2 min. Following
this, 900 .mu.l of SOC growth medium (GibcoBRL) was added to each
tube. The tubes were incubated for 1 hr at 37.degree. C. After
this, the cells were plated onto LB plates supplemented with 100
.mu.g/ml ampicillin. Plates were then incubated at 37.degree. C.
overnight.
[0632] Individual colonies were isolated and grown in 3 ml of LB
growth medium supplemented with 100 .mu.g/ml ampicillin. An initial
miniprep was performed using a commercially available kit (QIAGEN,
Valencia, Calif.; Cat. # 27106) to confirm insert orientation and
sequence quality. All miniprep samples tested were shown to contain
the correct insert orientation. After testing for sequence quality,
a Plasmid Giga Prep kit (QIAGEN; Cat. # 12191) was used for
large-scale production of DNA. For the Giga Prep, 2.5 L of culture
was divided into three flasks. These flasks were incubated
approximately 15 hr, but not longer 18 hr. Following this, a Giga
Prep was performed according to the manufacturer's directions. The
nucleotide and predicted amino acid sequence of BSL2-L165-21-Ig
(BLS2v2c2-Ig) is shown in FIGS. 4E-4F.
[0633] BSL2-4616811-Ig (BSL2vcvc-Ig) fusion construct: To construct
the BSL2-4616811-Ig (BSL2vcvc-Ig) plasmid, the BSL2-4616811
extracellular domain was PCR amplified from first strand cDNA
(GibcoBRL Cat. # 11904-018). cDNA was prepared from RNA purified
from THP1 cells stimulated with 100 ng/ml LPS for 2 hr. RNA was
purified using Invitrogen FastTrack 2.0 (Cat. # K1593-02). The PCR
reaction included 1 .mu.l cDNA; 5 .mu.l GibcoBRL 10.times. PCR
buffer; 1.5 .mu.l of 25 mM MgCl.sub.2; 1 .mu.l of 10 mM dNTPs
(Boehringer-Mannheim); 2.5 .mu.l BSL2-L165-21-Ig-1 primer (10
pM/.mu.l); 2.5 .mu.l BSL2-L165-21-Ig-2 primer (10 pM/.mu.l); 1
.mu.l CLONTECH Advantage polymerase (Cat. # 8417-1); and 35.5 .mu.l
milliQ H.sub.2O. The primers contained the following sequences:
BSL2-L165-21-Ig-1: 5' gg ggt acc ATG CTG CGT CGG CG 3' (SEQ ID
NO:63); and BSL2-L165-21-Ig-2: 5' cg gaa ttc TGG GGG GAA TGT CAT AG
3' (SEQ ID NO:64). PCR samples were incubated at 94.degree. C. for
1 min; followed by 35 cycles of incubation at 94.degree. C. for 30
sec, 59.degree. C. for 30 sec, and 72.degree. C. for 45 sec;
followed by incubation at 72.degree. C. for 10 min.
[0634] Following this, 30 .mu.l of the PCR reaction was run on a
1.2% agarose/0.5.times. TBE gel. A band of approximately 1100-bp
was excised and purified using QIAGEN Gel Extraction Kit (Cat. #
28704). One microliter of the purified PCR product (L254) was
ligated into pCR2.1 using the TA cloning kit (Invitrogen; Cat. #
K2050-01). Five microliters of the ligation mixture was used for
transformation into MAX Efficiency DH5-alpha competent bacteria
(GibcoBRL; Cat. # 18258-012), and transformants were plated onto LB
plates containing 100 .mu.g/ml ampicillin and 800 .mu.g X-Gal.
[0635] White colonies were inoculated into 5 ml LB broth containing
100 .mu.g/ml ampicillin, and grown at 37.degree. C. for 18 hr.
Plasmid DNA was purified with QIAGEN spin miniprep kit (Cat. #
27106). Plasmid DNA was digested with KpnI and EcoRI. Plasmids
containing inserts of about 1300-bp were sequenced using Applied
Biosystems automated DNA sequencers (ABI 3700 capillary array
sequencers). L254-7 was determined to contain wild-type
BSL2-4616811 sequence.
[0636] The Fc portion of human IgG1 was PCR amplified using 0.001
.mu.l BSL1-Ig, described herein; 5 .mu.l GibcoBRL PCR buffer; 1.5
.mu.l of 25 mM MgCl.sub.2; 1 .mu.l of 10 mM dNTPs
(Boehringer-Mannheim); 2.5 .mu.l lg-1 primer (10 pM/.mu.l) 2.5
.mu.l BSL1lg-2 primer (10 pM/.mu.l); 1 .mu.l CLONTECH Advantage
polymerase; and 36 .mu.l dH.sub.2O. The primers contained the
following sequences: IgG-1: 5'g gaa ttc GAG CCC AAA TCT TGT GAC AA
3' (SEQ ID NO:65); and BSL1 lg-2 gc gc tct aga TCA TTT ACC CGG AGA
CAG G (SEQ ID NO:66). PCR samples were incubated at 94.degree. C.
for 1 min; followed by 25 cycles of incubation at 94.degree. C. for
30 sec, 59.degree. C. for 30 sec, and 72.degree. C. for 30 sec;
followed by incubation at 72.degree. C. for 10 min.
[0637] Following this, 30 .mu.l of the PCR reaction was run on a
1.2% agarose/0.5.times. TBE gel. A band of about 700-bp was excised
and purified using QIAGEN Qiaquick gel extraction kit. Two
microliters of the purified fragment (L174) was ligated into pCR2.1
using the TA cloning kit (Invitrogen). Five microliters of the
ligation mixture was used for transformation into GibcoBRL MAX
Efficiency DH5-alpha competent bacteria, and transformants were
plated onto LB plates containing 100 .mu.g/ml ampicillin and 800
.mu.g X-gal. Plates were incubated for 18 hr at 37.degree. C. White
colonies were inoculated into 5 ml LB broth containing 100 .mu.g/ml
ampicillin and grown at 37.degree. C. for 18 hr. Plasmid DNA was
prepared using QIAGEN Qiaprep spin miniprep kit. Plasmid DNA was
digested with EcoRI and run on an agarose gel. Plasmids containing
inserts of about 900-bp were sequenced. L174-3 was determined to
contain wild-type human IgG1 Fc sequence.
[0638] L174-3 was digested with EcoRI/XbaI and separated on a 1.2%
agarose/0.5.times. TBE gel. A band of about 750-bp was excised and
purified using QIAGEN gel extraction kit. Ten microliters of the
purified fragment was run on an agarose gel next to a standard to
obtain an estimate of the concentration. Approximately 20 ng of the
EcoRI/XbaI fragment was ligated (Ligation 200) into 40 ng of
EcoRI/XbaI digested pCDNA3.1+ vector (Invitrogen) using GibcoBRL
high concentration T4 DNA ligase (5 U/.mu.l) diluted in GibcoBRL T4
DNA ligase buffer. Five microliters of the ligation mixture was
used for transformation into MAX Efficiency DH5-alpha competent
bacteria (GibcoBRL), and transformants were plated onto LB plates
containing 100 .mu.g/ml ampicillin. Plates were incubated at
37.degree. C. for 18 hr. Colonies were inoculated into LB broth
containing 100 .mu.g/ml ampicillin. Plasmid DNA was purified using
QIAGEN spin miniprep kit and sequenced. The L200-1 sequence was
determined to be identical to the L174-3 sequence.
[0639] The L254-7 BSL2-4146811 construct was digested with
KpnI/EcoRI. A band of about 1300-bp was excised from a 1.2%
agarose/0.5.times. TBE gel and ligated into the L200-1 Fc construct
digested with KpnI/EcoRI. Five microliters of the ligation reaction
was used for transformation into MAX Efficiency DH5-alpha cells and
plated onto LB plates containing 100 .mu.g/ml ampicillin. Colonies
were grown, and plasmid DNA was purified as above. Plasmid DNA was
digested with KpnI/XbaI and separated on an agarose gel as above.
Plasmids containing a band of about 2-kb were sequenced as above.
BSL2-4616811-Ig was determined to contain the wild-type
BSL2-4616811 and wild-type human IgG1 sequences. The nucleotide and
predicted amino acid sequence of BSL2-4616811-Ig (BSL2vcvc-Ig) is
shown in FIGS. 4A-4B. Plasmids comprising BSL2vcvc-Ig, BSL2v1c2-Ig,
or BSL2v2c2-Ig sequences were deposited as a mixture with the
American Type Culture Collection (ATCC, 10801 University Blvd.,
Manassas, Va. 20110-2209 USA), under ATCC Designation No. ______,
on Feb. 8, 2002.
[0640] BSL2-4616811-Ig (BSL2vcvc-Ig) and BSL2-L165-35b (BSL2v1c2)
Construction for Expression in CHO Cells:
[0641] The extracellular domain of human BSL2 containing either a
vc (BSL2v1c2) or vcvc (BSL2vcvc) region was PCR amplified from cDNA
and cloned into mammalian expression vector pD16 (described in U.S.
Pat. No. 6,051,228) using established methods (described by E.
Kondri et al. (1997) BioTechniques 23(5): 830-833). The primers
included a vcvc forward primer (5' ACT ATA GGG AGA CCC AAG CTT GGT
ACC GGA TCC ATG CTG CGT CGG CGG GGC AGC CCT GGC 3'; SEQ ID NO:136);
vcvc and v1c2 reverse primer (5' GTC ACA AGA TTT GGG CTC CGG ATC
CTC TGG GGG GAA TGT CAT AGG CTG CCC 3'; SEQ ID NO:137), and v1c2
forward primer (5' CAA GCT TGG TAC CGG ATC CAT GGA AGC CCC AGC TCA
GCT TCT CTT CCT CCT GCT ACT CTG GCT CCC AGA TAC CAC CGG MC AGG AGC
CCT GGA GGT CCA G 3'; SEQ ID NO:138). The CHO vcvc construct
incorporated the native signal peptide sequence and the CHO v1c2
construct incorporated the cd40 signal peptide sequence to direct
the secretion of protein from mammalian cells. In addition, a stop
codon was added to the end of the Ig sequence using a PCR
primer.
[0642] The vector backbone was derived from the Invitrogen plasmid
pcDNA3 and contained the following modifications. The neomycin
resistance gene from pcDNA3 was replaced with the dihydrofolate
reductase (DHFR) under control of the SV40 promoter missing the
enhancer (also referred to as "weakened DHFR"). The SV40 promoter
contained the SV40 origin of replication, so the vector could be
used for transient expression of protein. The CMV promoter was used
to express the fusion of interest, and the polyadenylation signal
was obtained from the bovine growth hormone gene. The expression
cassette for the fusion of interest was flanked by transcription
termination sequences (i.e. 5' to the promoter and 3' to the
poly(A).sup.+ site). The ampicillin resistance gene and ColE1
origin was included to allow plasmid propagation in E. coli All DNA
fragments for cloning purposes were prepared by using standard
molecular cloning methodologies (J. Sambrook (1989)Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories
Press, Cold Spring Harbor, N.Y.). The coding region was confirmed
by DNA sequence analysis. BSL2-Ig (BSL2vcvc-Ig or
BSL2v1c2-Ig)-producing cell lines were generated by transfecting
CHO DG44 cells (G. Urlaub et al. (1986) Somat. Cell. Mol. Genet.
12(6):555-66) with an expression vector (pD16.hBSL2.1g; either
BSL2vcvc-Ig or BSL2v1c2-Ig) using a modified method of the high
copy electroporation (J. Barsoum (1990) DNA and Cell Biol.
9:293-300; U.S. Pat. No. 4,956,288). For electroporation, 200 .mu.g
of vector (pD16.hBSL2.1g; either BSL2vcvc-Ig or BSL2v1c2-Ig) and
sheared herring sperm DNA (as carrier) were co-precipitated with
ethanol and resuspended in sterile PF CHO protein-free medium (JRH
Biosciences, Lenexa, Kans.) CHO DG44 cells were obtained in
exponential growth phase, and PF CHO was used as the
electroporation medium. Cells were electroporated at 300 volts, 960
.mu.F in a Bio-Rad gene pulser. Serum was omitted at all times
during the process of cell line generation.
[0643] Following electroporation, cells were allowed to recover one
day in non-selective media (PF CHO with 10 .mu.g/ml recombinant
insulin, 4 mM L-glutamine, 4 .mu.g/ml hypoxantine, and 0.72
.mu.g/ml thymidine). Cells were then seeded in 96-well plates at
250 or 1000 cells/well in selective media. Selective media was PF
CHO with 10 .mu.g/ml recombulin (recombinant insulin; GibcoBRL,
Cat. # 28150-019), 4 mM L-glutamine, and 50 or 100 nM MTX
(methotrexate). The plates were screened two weeks
post-electroporation by ELISA for the selection of masterwells
producing the highest level of BSL2-Ig (BSL2vcvc-Ig or BSL2v1c2-Ig)
fusion protein. As used herein, a "masterwell" is a well containing
transfected cells that have not been clonally isolated.
[0644] The cell lines (10 masterwells) expressing the highest
levels of BSL2-Ig (BSL2vcvc-Ig or BSL2v1c2-Ig) were selected for
further amplification. The cell lines were passed once per week
through increasing concentrations of MTX (50 nM.fwdarw.100
nM.fwdarw.250 nM.fwdarw.500 nm). T-flasks were seeded at
2-5.times.10.sup.4 cells/ml, depending on the cells' tolerance to
the prior MTX level. Amplification was assessed by comparing titers
of amplified and non-amplified masterwells in 7-day expression
assays performed in 12-well tissue culture plates. Protein
expression levels were assayed by enzyme linked immunosorbant assay
(ELISA) and confirmed by SDS-PAGE (sodium dodecyl
sulfate-polyacrylamide gel electrophoresis).
[0645] Fusion protein (BSL2vcvc-Ig or BSL2v1c2-Ig) was isolated by
affinity purification using a protein A column. The protein was
eluted from the column by five volumes of 0.1 M citrate pH 3, into
one volume Tris pH 3. The eluted protein solution was dialyzed
against PBS. To freeze transfected CHO cells, the culture was
frozen while in exponential growth phase, as established by cell
counts. The cultures showed high viability levels (>9% by trypan
blue exclusion).
[0646] BSL2 Monoclonal Antibodies:
[0647] The BSL2-4616811-Ig (BSL2vcvc-Ig) fusion protein was
purified by affinity purification following expression in COS cells
as described for BSL3-Ig, below. It is noted that the
BSL2-4616811-Ig fusion protein used in the experiments that follow
was isolated from COS cells, unless indicated otherwise. The
purified BSL2-4616811-Ig fusion protein was used to immunize mice
using the protocol described for BSL3-Ig, except that a fourth
boost was used. Following this, hybridoma cell lines were
constructed and anti-BSL2 MAbs were isolated as described for BSL3,
below. Hybridoma cells producing anti-BSL2-1 F7G2 MAb,
anti-BLS2-3E6D3 MAb, anti-BSL2-4C2C6 MAb, or anti-BLS2-5D7E2 MAb
were deposited with the American Type Culture Collection (ATCC,
10801 University Blvd., Manassas, Va. 20110-2209 USA), under ATCC
Designation No. ______, ______, ______, and ______, respectively,
on Feb. 8, 2002.
Example 5
Identification of BSL3
[0648] Database Searches:
[0649] BSL3 was identified by BLAST and FASTA analysis of the
Incyte Genomics sequence databases utilizing the B7-1 or B7-2
proteins as query sequences, and the parameters described for the
BSL2 searches. The sequence database searches identified Incyte
Genomics `gene` 117327. It is noted that an Incyte Genomics gene is
an EST sequence that is grouped with similar sequences, and
considered to represent the product of a single genomic locus. The
Incyte Genomics gene 17327 has since been renamed as Incyte
Genomics gene 899898. In a secondary screen, the BLAST and FASTA
programs were used to search the Incyte Genomics sequence databases
for sequences related to the mouse AF142780 gene (potential
orthologue of the 117327 gene), using the previously described
search parameters. These searches identified Incyte Genomics gene
143522.
[0650] The 143522 and 117327 genes were then used to identify
Incyte Genomics clones 3844031 and 3207811, respectively. The
3844031 clone belongs to Incyte Genomics Library ID No. DENDTNT01,
which was originally constructed utilizing poly(A).sup.+ RNA
isolated from untreated dendritic cells from peripheral blood. The
3207811 clone belongs to Incyte Genomics Library ID No. PENCNOT03,
which was originally constructed utilizing poly(A).sup.+ RNA
isolated from corpus cavernosum tissue. The 3844031 and 3207811
clones were obtained from Incyte Genomics, and sequenced (ABI cycle
sequencer, PE Biosystems) using the primers shown in Table 4.
7TABLE 4 Clone Primer Sequence SEQ ID NO: 3844031 316.491
GAAGGCCTCTACCAGGTC 67 3844031 316.512 CTTTAGGCGCAGAACACT 68 3844031
316.203 AAGGGTCAGCTAATGCTC 69 3844031 316.379 TCAGTTTGCACATCTGTA 70
3844031 316.1538 TATGCTATCAAGATTCCA 71 3844031 316.1839
GTAAAGTGCAGTAGTGCT 72 3844031 316.1601 TATGAGCTCACAGACAGG 73
3207811 315.560 AGGTTCAGATAGCACTGT 74 3207811 315.468
ACTTATCTGAAATTGCTG 75 3207811 315.493 TTGATATGCTCATACGTT 76 3207811
315.1011 GAATTCTGTGGGTCCAGG 77 3207811 315.601 CATGTTTAATGGTGGTTT
78 3207811 315.498 AAAGCTGTATTCTTCAAA 79
[0651] Full-Length Cloning of BSL3
[0652] To clone the 5' end of BSL3, the SMART.TM. RACE cDNA
Amplification kit (CLONTECH) was used according to the
manufacturer's directions. The 5' RACE library was constructed
using 1.0 .mu.g of poly(A).sup.+ RNA template obtained from human
microvascular endothelial cell treated with TNF-alpha for 1 hr. The
5' RACE reaction mixture contained 2 .mu.l RACE-ready cDNA,
1.times. PCR buffer (GibcoBRL), 200 .mu.M dNTP (Boehringer
Mannheim), 1.5 mM MgCl.sub.2, 1 .mu.l CLONTECH Advantage enzyme
mix, 1.times. CLONTECH SMART primer, and 25 pMol BSL3 3' specific
primer (BSL3-2 5'-GAACACTGGTGACCTGGTAGAG-3'; SEQ ID NO:80) in a
total volume of 50 .mu.l. The 5' RACE reaction was performed in a
GeneAmp PCR System 9700 machine (PE Applied Biosystems) using an
initial denaturation step of incubation at 94.degree. C. for 1 min;
followed by 35 cycles of incubation at 94.degree. C. for 30 sec,
62.degree. C. for 30 sec, 72.degree. C. for 30 sec; followed by
incubation at 72.degree. C. for 10 min.
[0653] The PCR products were analyzed by gel electrophoresis using
a 1.2% agarose gel (GibcoBRL) with 0.5.times. TBE and 10 .mu.g/ml
ethidium bromide (Bio-Rad). An .about.875-bp fragment was excised
from the gel and purified using the QIAGEN Qiaquick Gel Extraction
kit according to the manufacturers directions. One microliter of
the purified fragment was mixed with 2 .mu.l pCR2.1 pTADV cloning
vector (CLONTECH), 2 .mu.l ligation cocktail (GibcoBRL), and 4 U T4
DNA ligase (GibcoBRL) in a total volume of 10 .mu., and the
ligation mixture was incubated at 14.degree. C. for 4 hr. Five
microliters of the ligation mixture was used for transformation
into Max-Efficiency DH5-alpha E. coli cells (GibcoBRL) according to
the manufacturers directions, and transformants were plated onto LB
plates containing 100 .mu.g/ml ampicillin and 30 .mu.g/ml X-gal.
White colonies were picked and grown in 5 ml of LB broth containing
100 .mu.g/ml ampicillin. DNA was purified from the bacteria using
the Qiaprep Spin Miniprep Kit (QIAGEN). Plasmid DNA was digested
with EcoRI and analyzed by agarose gel electrophoresis. Plasmid
isolates containing an EcoRI fragment of approximately 900-bp were
retained for sequencing (ABI cycle sequencer, PE Biosystems). The
sequence was analyzed by Seqweb Gap (Genetics Computer Group).
[0654] The 5' RACE library was then used as a template for PCR
amplification. The PCR mixture contained 1 .mu.g 5' RACE library
template, 1.times. PCR buffer (GibcoBRL), 200 .mu.M dNTP
(Boehringer Mannheim), 1.5 mM MgCl.sub.2, 1 .mu.l CLONTECH
Advantage enzyme mix, 25 pMol forward primer (BSL3-3:
5'-CCGGGGTACCATGATCTTCCTCCTGCTMTGTTG-3'; SEQ ID NO:81), and 25 pMol
reverse primer (BSL3-4: 5'-GCGCTCTAGATCAGATAGCACTG- TTCACTTCCC-3';
SEQ ID NO:82) in a total volume of 50 .mu.l. PCR was performed in a
GeneAmp PCR System 9700 (PE Applied Biosystems) machine using an
initial denaturation step of incubation at 94.degree. C. for I min;
followed by 30 cycles of incubation at 94.degree. C. for 30 sec,
60.degree. C. for 30 sec, 72.degree. C. for 30 sec; followed by
incubation at 72.degree. C. for 10 min.
[0655] An .about.800-bp BSL3 PCR product was obtained. To clone the
BSL3 fragment, 1 .mu.l of the PCR product was mixed with 2 .mu.l
pCR2.1 cloning vector (Invitrogen), 2 .mu.l ligation buffer
(GibcoBRL), 4 U T4 DNA ligase (GibcoBRL), and 4 .mu.l H.sub.2O. The
ligation mixture was incubated at 14.degree. C. for 4 hr, and 5
.mu.l microliters of the mixture was used to transfect
Max-Efficiency DH5-alpha E coli cells (GibcoBRL). Transformants
were plated onto LB agar plates containing 100 .mu.g/ml ampicillin
and 30 .mu.g/ml X-gal. Eighteen white colonies were isolated and
grown in 5 ml of LB broth containing 100 .mu.g/ml of ampicillin.
DNA was purified from the bacterial culture using the Qiaprep Spin
Miniprep Kit (QIAGEN) according to the manufacturer's directions.
Plasmid DNA was digested with EcoRI and analyzed by agarose gel
electrophoresis. Sixteen plasmid isolates contained an EcoRI
fragment of .about.800-bp, and were retained for sequencing (ABI
cycle sequencer, PE Biosystems) using the vector-specific M13 and
M13 reverse primers (see above).
[0656] Seqweb Gap (Genetics Computer Group) analysis indicated the
optimal alignment of the sequences of the BSL3 Incyte Genomics
clones and the BSL3 5' RACE product. Seqweb Gap analysis (Genetics
Computer Group) also indicated that the BSL3 nucleotide sequence
shared less than 55% sequence identity with B7-1, B7-2, or
BSL1/B7-H1 nucleotide sequences, while the BSL3 amino acid sequence
shared less than 45% sequence identity with the B7-1, B7-2, and
BSL1/B7-H1 amino acid sequences.
[0657] In addition, the BSL3 C-terminal amino acid sequence shared
less than 98% identity to the amino acid sequence encoded by
GenBank Accession No. AK001872, over a stretch of 174 amino acids.
Amino acid sequence alignments using the GCG Gap program indicated
that the longest stretch of identical residues shared by BSL3 and
AK001872 was 99 contiguous amino acids in length. Nucleotide
sequence alignments using GCG Gap indicated that the longest
stretch of identical bases shared by BSL3 and AK001872 was 239
contiguous nucleotides in length. Notably, a mouse orthologue of
BSL3 was identified from the GenBank Database (Accession No.
AF142780). The BSL3 N-terminal amino acid sequence shared
approximately 70% sequence identity with the amino acid sequence
corresponding to mouse AF142780, over a stretch of 250 amino acids.
In addition, it was noted that BSL3 has also been identified as
PD-L2, an apparent inhibitor of T-cell proliferation (Y. Latchman
et al. (2001) Nature Immunology 2:261-268).
[0658] The nucleotide and predicted amino acid sequences of BSL3
are shown in FIGS. 5A-5B. The plasmid carrying DNA encoding BSL3
(pCR2.1:BSL3) was deposited with the American Type Culture
Collection (ATCC, 10801 University Blvd., Manassas, Va. 20110-2209
USA), under ATCC Designation No. PTA-1986, on Jun. 6, 2000. It is
noted that all ATCC deposits described herein were made in
accordance with the Budapest Treaty.
[0659] The BSL1, BSL2, and BSL3 sequence information is summarized
in Table 5.
8TABLE 5 Nucleic Amino Acid Acid AA BSL Sequence (NA) SEQ NA FIG
(AA) SEQ FIG. NO. Name ID NO: NO. ID NO: NO. 1 BSL1 (TNF-.alpha.) 1
1A 2 1B 1 BSL1 3 1C 2 1B (GM-CSF/IL-4) 1 BSL1-Ig 4 2A 5 2B 2
BSL2-4616811 6 and 131 3A and 3G 7 3B (BSL2vcvc) 2 BSL2-L165-21 10
3C 11 3D (BSL2v2c2) 2 BSL2-L165-35b 12 3E 13 3F (BSL2v1c2) 2
BSL2-4616811-Ig 8 4A 9 4B (BSL2vcvc-Ig) 2 BSL2-L165-35b-Ig 132 4C
133 4D (BSL2v1c2-Ig) 2 BSL2-L165-21-Ig 134 4E 135 4F (BSL2v2c2-Ig)
3 BSL3-L143 14 5A 15 5B 3 BSL3-L232-6-Ig 16 6A 17 6B
Example 6
Characterization of BSL3
[0660] BSL3 Expression Analysis:
[0661] BSL3 expression patterns were determined by Northern blot
analysis of various cell types, using the BSL3 probe shown in FIG.
7C, and the procedure described for BSL1. A 2.7-kb BSL3 mRNA
transcript was detected in several cell types. In particular, high
levels of BSL3 mRNA were detected in all HMVEC stimulated with
TNF-alpha (FIG. 7D). Moderate levels of BSL3 mRNA were detected in
peripheral blood monocytes stimulated with PHA or GM-CSF/IL-4 (FIG.
7D). However, or BSL3 mRNA was not detected in any of the remaining
cell types (FIG. 7D).
[0662] In addition, multiple tissue Northern blots and expression
arrays were purchased from CLONTECH Laboratories and hybridized
with P.sup.32-labeled BSL3 probe. Briefly, a 900-bp BSL3 fragment
(BSL3/KpnI+XbaI) was isolated from clone L168-2 using KpnI and XbaI
restriction endonucleases. The fragment was run on a 1.2% agarose
gel, and purified using the QIAGEN Gel Extraction Kit.
Approximately 30 ng of BSL3/KpnI+XbaI was radiolabeled (6000
Ci/mmol P.sup.32-dCTP) using the Random Primed DNA Labeling Kit
(Roche, Indianapolis, Ind.). Unincorporated nucleotides were
removed using NucTrap Probe Purification Columns (Stratagene, La
Jolla, Calif.). Radiolabeled BSL3/KpnI+XbaI probe was added at a
specific activity of 3.0.times.10.sup.6 cpm/ml of ExpressHyb
hybridization solution (CLONTECH) and incubated overnight at
65.degree. C. Blots were washed with 0.1.times. SSC/0.1% SDS at
62.degree. C. and exposed to film for 72 hr.
[0663] Northern blot analysis indicated that high levels of BSL3
transcript were present in spleen tissue; moderate levels of BSL3
transcript were present in thymus, testis, ovary, and small
intestine tissues; and low levels of BSL3 transcript were present
in heart, placenta, lung, liver, skeletal muscle, prostate, colon,
lymph node, trachea, and adrenal gland tissues, and Burkitt's
lymphoma RAJI cell line (FIG. 7E). Microarray analysis indicated
that high levels of BSL3 transcript were present in spleen tissue;
moderate levels of BSL3 transcript were present in lung, liver,
placenta, fetal spleen, lymph node, and fetal thymus tissues; and
low levels of BSL3 transcript were present in heart, aorta, corpus
callosum, left atrium, right atrium, jejunum, thymus, fetal liver,
and mammary gland tissues (FIG. 7F).
[0664] Quantitative PCR:
[0665] BSL1 and BSL3 expression patterns were determined by
quantitative PCR. Human Multiple Tissue cDNA (MTC.TM.) Panels (Cat.
# PT3158-1) were purchased from CLONTECH. For each PCR reaction, 5
.mu.l of cDNA was used. Human and murine BSL1 and BSL3 PCR primers
were designed by Primer3 program (Whitehead Institute for
Biomedical Research; Steve Rozen, Helen J. Skaletsky (1998)
Primer3) as shown in Table 6.
9TABLE 6 SEQ ID Primer Sequence NO: nucleotides human BSL1 forward
TACAAGCGAATTACTGTGAA 83 459-479 human BSL1 reverse
GATGTGCCAGAGGTAGTTCT 84 773-793 human BSL3 forward
AATAGAGCATGGCAGCAATG 85 419-439 human BSL3 reverse
GGCGACCCCATAGATGATTA 86 634-654 human 18s rRNA forward
CCAGTAAGTGCGGGTCAT 87 7-25 human 18s rRNA reverse
TTCACCTACGGAAACCTT 88 196-214
[0666] SYBR Green PCR Core Reagents (Cat. # 4306736) were purchased
from PE Applied Biosystem. Real-time PCR was performed on ABI
Prism.RTM. 5700 Sequence Detection System PE Applied Biosystem. PCR
samples were incubated at 95.degree. C. for 15 sec, 55.degree. C.
for 20 sec, and 75.degree. C. for 1 min for 40 cycles. The BSL1 PCR
product was 334-bp; the BSL3 PCR product was 235-bp; the 18S rRNA
PCR was 207-bp. Following PCR and data collection, dissociation
curve studies were performed. In addition, PCR samples were
analyzed by agarose gel electrophoresis to confirm the size of the
PCR product.
[0667] Data Processing and Presentation:
[0668] For each PCR reaction, a threshold cycle number (C.sub.T)
was generated as a read-out by the real-time PCR machine. The data
was processed according to the manual of ABI Prism.RTM. 5700
Sequence Detection System. Briefly, the C.sub.T of BSL1 and BSL3
was normalized to the C.sub.T of 18S rRNA in the each sample. The
data was then subtracted by the normalized C.sub.T in the sample
showing lowest expression levels. For BSL1, the lowest expression
levels were found in tonsil tissue. For BSL3, the lowest expression
levels were found in skeletal muscle. The final data was presented
as the fold-increase over the lowest expression levels.
[0669] Quantitative PCR indicated that high levels of BSL1
transcript were present in lymph node, spleen, lung, and placenta
tissue; moderate levels of BSL1 transcript were present in thymus
and pancreas tissue; and low levels of BSL1 transcript were present
in heart, brain, kidney, adult liver, skeletal muscle, bone marrow,
leukocyte, fetal liver, and tonsil tissue (FIG. 7G). For BSL3, high
levels of transcript were present in lymph node and spleen tissue;
and low levels of BSL3 transcript were present in thymus, lung,
tonsil, heart, pancreas, placenta, kidney, bone marrow, fetal
liver, and adult liver tissue (FIG. 7H).
[0670] BSL3-Ig (L232-6) Fusion Construct:
[0671] The BSL3-Ig (L232-6) construct was made using the following
procedure. The ECD of BSL3 was amplified by PCR using 0.01 .mu.l
pCR2.1:BSL3 (L143-4), described above; 5 .mu.l GibcoBRL PCR buffer;
1.5 .mu.l of 25 mM MgCl.sub.2; 1 .mu.l of 10 mM dNTPs; 2.5 .mu.l
BSL3-3 primer (10 pM/.mu.l); 2.5 .mu.l BSL31 g-6 primer (10
pM/.mu.l); 1 .mu.l CLONTECH Advantage polymerase; and 36 .mu.l
dH.sub.2O. The primers contained the following sequence: BSL3-3: 5'
cc gg ggt acc ATG ATC TTC CTC CTG CTA ATG TTG 3' (SEQ ID NO:89);
BSL31 g-6: 5' cg gaa ttc GGT CCT GGG TTC CAT CTG 3' (SEQ ID NO:90).
PCR samples were incubated at 94.degree. C. for 1 min; followed by
20 cycles of incubation at 94.degree. C. for 30 sec, 59.degree. C.
for 30 sec, and 72.degree. C. for 30 sec; followed by incubation at
72.degree. C. for 10 min.
[0672] Following this, 38 .mu.l of the PCR product was digested
with KpnI/EcoRI and run on a 1.2% agarose/0.5.times. TBE gel. A
band of about 650-bp was excised and purified with QIAGEN gel
extraction kit. Ten microliters of the purified fragment was run on
an agarose gel next to a size standard. Ten nanograms of fragment
(L232) was ligated to 20 ng of KpnI/EcoRI digested L200-1
(described herein). Five microliters of the ligation mixture was
used for transformation into GibcoBRL MAX Efficiency DH5-alpha
competent bacteria, and transformants were plated onto LB plates
containing 100 .mu.g/ml ampicillin. Plates were incubated at
37.degree. C. for 18 hr. Colonies were inoculated into 5 ml of LB
broth containing 100 .mu.g/ml ampicillin and grown for 18 hr at
37.degree. C. DNA was purified using QIAGEN spin miniprep kit and
digested with Pmel. The digested samples were run on an agarose gel
and plasmids that contained fragments of about 1500-bp were
sequenced. L232-6 was determined to have wild-type BSL3 sequence.
The nucleotide and predicted amino acid sequence of BSL3-Ig
(L232-6) is shown in FIGS. 6A-6B.
[0673] BSL3-Ig (L275-1) fusion construct: The BSL3-Ig (L275-1)
construct was made using the following procedure. BSL3-Ig was PCR
amplified from L232-6 using 0.001 .mu.l L232-6; 5 .mu.l GibcoBRL
PCR buffer; 1.5 .mu.l 25 mM MgCl.sub.2; 1 .mu.l 10 mM
Boehringer-Mannheim dNTPs; 2.5 .mu.l BSL3-5 primer (10 pM/.mu.l);
2.5 .mu.l BSL1Ig-2 primer (10 pM/.mu.l); 1 .mu.l CLONTECH Advantage
polymerase; and 35.5 .mu.l dH.sub.2O. The primers contained the
following sequences: BSL3-5: 5' cg gga ttc ATG ATC TTC CTC CTG CTA
ATG TT 3' (SEQ ID NO:91); and BSL1 lg-2: 5' gc gc tct aga TCA TTT
ACC CGG AGA CAG G 3' (SEQ ID NO:92). PCR samples were incubated at
94.degree. C. for 1 min; followed by 20 cycles of incubation at
94.degree. C. for 30 sec, 58.degree. C. for 30 sec, and 72.degree.
C. for 1.5 min; followed by incubation at 72.degree. C. for 10
min.
[0674] Following this, 2 .mu.l of the PCR reaction was ligated
(L262) into pCR2.1 using the TA cloning kit (Invitrogen). Five
microliters of the ligation was used for transformation into MAX
Efficiency DH5-alpha competent cells (GibcoBRL), and transformants
were plated onto LB plates containing 100 .mu.g/ml ampicillin and
800 .mu.g of X-Gal. Plates were incubated at 37.degree. C. for 18
hr. White colonies were inoculated into 5 ml of LB broth containing
100 .mu.g/ml ampicillin and grown at 37.degree. C. for 18 hr.
Plasmid DNA was purified using QIAGEN spin miniprep kit. Plasmid
DNA was digested with BamHI/XbaI and analyzed on an agarose gel.
Plasmids that contained an approximately 1300-bp fragment were
sequenced. L262-2 was determined to contain the wild-type BSL3
sequence.
[0675] L262-2 was digested with BamHI/XbaI and run on a 1.2%
agarose/0.5.times. TBE gel. An approximately 1300-bp fragment was
purified using QIAGEN gel extraction kit. Ten nanograms of the
purified fragment was ligated into 30 ng of BamHI/XbaI digested
pD18 (related to pD16 and pD17 plasmids, described in U.S. Pat. No.
6,051,228). Five microliters of the ligation was used for
transformation into GibcoBRL MAX Efficiency DH5-alpha competent
bacteria. Transformants were plated onto LB plates containing 100
.mu.g/ml ampicillin and grown at 37.degree. C. for 18 hr. Colonies
were inoculated into 5 ml of LB broth containing 100 .mu.g/ml
ampicillin and grown at 37.degree. C. for 18 hr. Plasmid DNA was
purified using QIAGEN spin miniprep kit. Plasmid DNA was digested
with BamHI plus XbaI or HindIII, and the digested samples were
analyzed on an agarose gel. As determined by restriction mapping,
L275-1 through L275-9 contained the correct construction.
[0676] Purification of BSL3-Ig Fusion Protein:
[0677] Purification of BSL3-Ig (human-IgG1) was accomplished by
one-step affinity purification. Supernatant from transiently
transfected COS cells expressing BSL3-Ig was applied to a Sepharose
column of immobilized protein A. The column was washed with PBS
until the absorbance at 280 nm reached the baseline level. Bound
protein was eluted with ImmunoPure IgG Elution Buffer (Pierce
Chemical, Rockford, Ill.; Cat. # 21004). Fractions containing the
bound protein were neutralized with 1/8 v/v of 3 M sodium
phosphate, pH 7. The resulting preparation was dialyzed against
PBS, filtered (0.2 .mu.m). All buffers contained 0.02% w/v sodium
azide.
[0678] Immunization with BSL3 Polypeptide:
[0679] For the initial immunization, mice between 1 and 3 months
were used (BalbC; Harlan, Indianapolis, Indiana). RIBI adjuvant was
prepared as follows. In one vial, 0.5 mg MPL (monophosphoryl lipid
A; RIBI Immunochemical Research, Inc., Hamilton, Mont.); 0.5 mg TDM
(synthetic trehalose dicorynomycolate; RIBI Immunochemical
Research, Inc.); and 40 .mu.l squalene with 0.2% Tween.RTM.80 were
mixed together. The mixture was warmed to 40-45.degree. C. for 5-10
min, and 2 ml of BSL3 polypeptide/PBS (125 .mu.g/ml) was added. The
solution was vortexed vigorously for several minutes. The solution
was drawn into a syringe and injected immediately into the
mice.
[0680] Dosages followed recommendations by RIBI Immunochemical
Research, Inc. For the first injection, approximately 100 .mu.g of
BSL3 polypeptide was resuspended in 250 .mu.l of 1.times. RIBI in
PBS. The mixture was injected intraperitoneally with a 21 gauge
needle. For second and later injections, boosts were given at least
3 weeks apart. Injections were at half dose. At least 3 weeks
following the third injection, once the titer reached an acceptable
level (see below), the animal was given a final boost. For final
injections, approximately 1 mg/ml of BSL3 polypeptide was
resuspended in PBS (RIBI was omitted), and the mixture was
administered intravenously via tail veins. Animals were harvested
3-4 days later.
[0681] To monitor titer levels, sera samples were taken before
initial immunization (background) and 7-10 days after each
immunization for titer monitoring. Titer levels were measured by
ELISA. Sera was harvested by eye-bleed or tail-bleed. Typically,
200 .mu.l of blood was removed for sera testing.
[0682] Hybridoma Cell Lines:
[0683] Hybridoma cell lines were constructed using the following
reagents: Iscoves Modified Dulbecco's Medium (GibcoBRL; Cat.
#12440-053); fetal bovine serum (Hyclone; Cat. # A-1115L, Lot #
11152564) heat inactivated for 30 min at 56.degree. C.;
L-glutamine-200 mm, 100.times. (GibcoBRL; Cat. # 25030-081);
penicillin/streptomycin (GibcoBRL; Cat. # 15140-122); ORIGEN
Hybridoma Cloning Factor (Igen International, Inc., Gaithersburg,
Md.; Cat. # IG50-0615, Lot #8077); HT Supplement 100.times.
(GibcoBRL; Cat. # 11067-030); HAT Supplement 100.times. (GibcoBRL;
Cat. # 31062-037); PEG 1500, (Boehringer Mannheim; Cat. # 783641);
Red Blood Cell Lysing Buffer from Lab Services (Cat. # 3KL-449);
Trypan Blue; 70% ethanol; and myeloma cells (P3.times.) from
ATCC.
[0684] The following equipment and supplies were used: laminar flow
hood; CO.sub.2 incubator; inverted microscope; 37.degree. C. water
bath; centrifuge; 96-well flat bottom tissue culture plates
(Corning; Cat. # 25860-96); Serological pipettes and Integrid petri
dishes (Falcon); 50 ml centrifuge tubes (Corning; Cat. # 430921);
15 ml conical tubes (Falcon; Cat. # 2096); autoclaved scissors and
forceps; multichannel pipette; wide orifice 200 .mu.l pipette tips
(Denville Scientific, Inc., Metuchen, N.J.; Cat. # P 105-CP); and
sterile pipette tips (VWR, Buffalo Grove, Ill.; Cat. #
53508-794).
[0685] HAT and HT medium were made as follows:
10 HAT Medium HT Medium IMDM 500 ml IMDM 500 ml L-Glutamine 2.5 ml
L-Glutamine 2.5 ml Pen/Strep 5 ml Pen/Strep 5 ml HAT Supplement 5
ml HT Supplement 5 ml Origen Hy. Clon. F. 10% Final Origen Hy.
Clon. F. 10% Final
[0686] Mice were given a final boost 3-4 days prior to fusion in
PBS intravenously or intraperitoneal. Myeloma cells were kept in
exponential growth (log phase). The mice were euthanized, and the
spleen from each mouse was aseptically harvested. The spleen was
placed in a petri dish containing warm Iscoves solution without
FBS. A spleen cell suspension was prepared and transferred to a
centrifuge tube. HAT-sensitive myeloma cells were placed in a
separate 50 ml centrifuge tube. Spleen cells and myeloma cells were
centrifuged at 400.times. g for 5 min, and the supernatant was
aspirated. The red blood cells from the spleen were lysed with 5 ml
RBC Lysing Buffer for 1 min, and the tube was filled with SF media
(hybridoma serum-free media; GibcoBRL; Cat. # 12045-076).
Splenocytes were washed with 50 ml SF media, and spleen cells and
myeloma cells were centrifuged in separate centrifuge tubes at
400.times. g for 5 min. Spleen cells and myeloma cells were counted
and resuspended in 25 ml with SF media. Myeloma cells were added to
spleen cells to give a 1:4 ratio. The mixture was centrifuged at
400.times. g for 10 min to form a tight pellet, and all media
solution was removed by aspiration.
[0687] For the cell fusion experiments, PEG, SF media, and HAT
media were incubated at 37.degree. C. One milliliter of 50% PEG was
added to the cells for 1 min (PEG was added for 30 sec and cells
were stirred for 30 sec). The PEG solution was added to the side of
the tube, and the pellet was gently stirred. With stirring, 1 ml SF
media was added to the cells for 1 min, and 8 ml of SF media was
added to the cells for 2 min. Cells were centrifuged at 400.times.
g for 10 min, and the supernatant was aspirated. Cells were gently
resuspended in 10 ml HAT selective media by aiming pipette directly
at pellet and stirring. Additional HAT media was added to bring
cell concentration to 5.times.10.sup.5 cells/ml. Cells were
aliquotted into 96-well tissue culture plates at 5.times.10.sup.4
cells/well. After 3 days, HT media was added at 100 .mu.l/well.
Approximately 10 days later, clones were tested for antibody
production. Positive clones were expanded to one well of a 24-well
plate. Positive clones were then re-tested, isotyped, and expanded
to T25 (0.25 cm square tissue culture flask).
[0688] ELISA Analysis:
[0689] To test for positive clones, ELISA analysis was performed
using the following reagents and supplies: carbonate/bicarbonate pH
9.6 (Sigma, St. Louis, Mo.; Cat. # C-3041) for coat; Immulon 2
ELISA plates (Dynex, Chantilly, Va.; Cat. # 0110103455); 10.times.
PBS (GibcoBRL) made to 1.times. concentration; wash buffer
comprising Tween.RTM.20 (0.05% final concentration) in 1.times.
PBS; block buffer/sample diluent comprising wash buffer with 5% NFM
non-fat milk; and chromogen mixture comprising 50% TMB (Kirkegaard
& Perry Labs Gaithersburg, Md.; Cat. # 50-76-01) and 50%
peroxidase (Kirkegaard & Perry Labs Cat. # 50-65-00).
[0690] For ELISA, plates were coated with 75 .mu.i/well (1
.mu.g/ml) BSL3-Ig in carbonate/bicarbonate overnight at 4.degree.
C. Plates were washed with PBS Tween.RTM.20 (using Skatron), and
blocked with 300 .mu.l block buffer for 45 min at room temperature.
Plates were flicked dry and incubated with 75 .mu.l/well sera
diluted in blocking buffer (sera was diluted 1:50 for highest
concentration and then serially diluted by factors of three) for 45
min at room temperature, and washed as before. Plates were then
incubated with 75 .mu.l/well anti-mouse IgG in blocking buffer
(1:10000 dilution; HRP-labeled; Amersham Pharmacia Biotech,
Piscataway, N.J.) for 45 min at room temperature, and washed as
before. Following this, plates were incubated with 100 .mu.l/well
chromogen mixture, and incubated up to 15 min at room temperature.
The signal was quenched with 100 .mu.l 1N sulfuric acid, and
samples were read at 450/630 nm. Using ELISA, supernatants from
hybridomas were initially screened against BSL3-Ig fusion protein,
and then screened against Ig protein alone. Hybridomas that
produced antibodies that bound to BSL3-Ig, but not Ig, were
designated as positive clones.
[0691] Subcloning:
[0692] Positive clones from the initial fusion plate were expanded.
Once growing, cells were put through two rounds of single cell
cloning to ensure that they were monoclonal. Each hybridoma was
plated in a 96-well tissue culture plate at a concentration of 0.5
cells/well or less. Once macroscopic colonies formed, supernatants
were screened by ELISA. Positive clones from each hybridoma were
titered by ELISA. The clones giving rise to the strongest signals
were expanded and put through a second round of cloning. Positive
clones were again screened by ELISA and titered. The clones giving
rise to the strongest signal were expanded and frozen back.
Example 7
Assays using BSL Monoclonal Antibodies
[0693] FACS Analysis of Lung Epithelial Cells Using BSL1 and BSL2
Monoclonal Antibodies:
[0694] A549, a lung epithelium cell line was cultured in RPM11640
(GibcoBRL Cat. # 11875-005) plus 10% FBS (Summit, Ft Collins,
Colo.; Cat. # S-100-05) and 1% penicillin-streptomycin (GibcoBRL
Cat. # 15140-122) at 37.degree. C. in 5% CO.sub.2 to 90% confluence
in a T75 flask (Becton Dickinson, Franklin Lakes, N.J.; Cat. #
353111). Cells were lifted with Versene (GibcoBRL Cat. # 15040-066)
and washed twice in RPMI 1640. Cells were added to a 96-well plate
(Becton Dickinson Cat. # 353077; 2.5.times.10.sup.5 cells per
well), and centrifuged at 2000 RPM in a Beckman tabletop
centrifuge. Next, cells were resuspended in RPMI 1640 or RPMI1640
with 1 .mu.g negative control antibody (MAb 15E10 AA3; also called
MAb 15E10A3, MAb 3-13E10A3, or MAb 3.sub.--15) or hybridoma
supernatant, and incubated on ice for 30 min. It is noted that MAb
15E10AA3 does not recognize the BSL2 or BSL3 polypeptides, but is
the identical isotype as the anti-BSL2 antibodies. Cells were then
washed twice in RPMI 1640, and resuspended in goat anti-mouse
anti-Fc FITC conjugated antibodies (BioSource, Camarillo, Calif.;
Cat. # AMI4408) diluted 1:50 in RPMI 1640. Following this, cells
were incubated on ice for 30 min, washed twice in RPMI 1640,
resuspended in RPMI 1640, and analyzed on a Becton Dickinson
FACScan. Results of FACS analysis are shown for anti-BSL1 MAb
32F9A7 (FIG. 9A) and anti-BSL2-4616811 MAbs (FIG. 9B). It is noted
that all MAbs bound to the A549 cells. It is also noted that
anti-BSL2 MAb 1 F7G2, anti-BSL2 MAb 2B10D7, anti-BSL2 MAb 3E6D3,
anti-BSL2 MAb 4C2C6, and anti-BSL2 MAb 5D7E2 are also termed
anti-BSL2-1 MAb, anti-BSL2-2 MAb, anti-BSL2-3 MAb, anti-BLS2-4 MAb,
and anti-BSL2-5 MAb, respectively, as described herein.
[0695] FACS Analysis of Various Cell Types Using BSL3 Monoclonal
Antibodies:
[0696] To determine whether BSL3 polypeptide was expressed on the
surface of various cell types, cells were grown in media as shown
in Table 7, below. HUT 78 was supplemented with 20% FBS (Summit
Biotechnology, Ft Collins, Colo.; Cat. # S-100-05). All other cell
lines were supplemented with 10% Summit FBS. In addition, all cell
lines were supplemented with 1% penicillin/streptomycin (GibcoBRL;
Cat. # 15140-122). All cell lines were grown at 37.degree. C. in 5%
CO.sub.2.
11 TABLE 7 CELL LINE ORIGIN MEDIA HL60 pre myeloid RPMI 1640 THP1
monocytic RPMI 1640 A549 lung epithelium RPMI 1640 H292 lung
epithelium RPMI 1640 PM LCL B lineage RPMI 1640 PL LCL B lineage
RPMI 1640 CE LCL B lineage RPMI 1640 RAMOS B lineage RPMI 1640 CEM
T lineage RPMI 1640 HUT 78 T lineage IMDM.sup.1 Jurkat T lineage
RPMI 1640.sup.2 .sup.1IMDM: GibcoBRL; Cat. # 12440-053 .sup.2RPMI
1640: GibcoBRL; Cat. # 11875-005
[0697] Cells were grown to about 5.times.10.sup.5 cells/ml. Cells
were washed twice in serum free RPMI 1640 and resuspended to give a
final concentration of 2.5.times.10.sup.6 cells/ml. Anti-BSL3 MAb
1A4A1 antibodies or isotype control MAb 15E10A3 antibodies (also
called MAb 15E10M3, MAb 3-15E10A3, and MAb 3.sub.--15) were added
to 5 .mu.g/ml and incubated at 4.degree. C. for 30 min. Cells were
washed twice in serum free RPMI 1640 and resuspended in serum free
RPMI 1640 plus 2% goat anti-mouse IgG conjugated to FITC
(BioSource, Camarillo, Calif.; Cat. # AMI4408). Cells were
incubated 30 min at 4.degree. C. Cells were washed twice in serum
free RPMI 1640 and analyzed on a Becton Dickinson FACScan (Becton
Dickinson, Franklin Lakes, N.J.). BSL3 polypeptide was expressed on
A549 (lung epithelium), H292 (lung epithelium), PM LCL (B lineage),
PL LCL (B lineage), CE LCL (B lineage), and HUT78 (T lineage) cells
(FIG. 9C).
[0698] FACS Analysis of Human Umbilical Vein Endothelial Cells
using BSL3 Monoclonal Antibodies:
[0699] Anti-BSL3 monoclonal antibodies were used to measure BSL3
polypeptide levels on human umbilical vein endothelial cells with
or without TNF-alpha stimulation. Human umbilical vein endothelial
cells (HUVEC) were grown to confluence at 37.degree. C. with 5%
CO.sub.2 in EGM media (Clonetics, Walkersville, Md.; Cat. #
CC-4176). TNF-alpha was omitted or added to 10 ng/ml for 24 hr.
Cells were lifted with Versene (GibcoBRL; Cat. # 15040-066) and
prepared for flow cytometry using anti-BSL3 MAb 1A4A1 antibodies as
described above. As a control, flow cytometry was performed without
antibodies. The results indicated that BSL3 polypeptide levels
increased on TNF-alpha stimulated HUVEC (FIG. 9D). This increase
was not observed in unstimulated cells (FIG. 9D).
[0700] FACS Analysis of Human Peripheral Blood Monocytes Using BSL3
Monoclonal Antibodies:
[0701] Anti-BSL3 monoclonal antibodies were used to measure BSL3
polypeptide levels on human peripheral blood monocytes with or
without GM-CSF IL-4 or PHA stimulation. Peripheral blood monocytes
(PBMC) were purified as follows. Blood samples were aliquotted
equally among twelve 50 ml conical tubes. One volume of elutriation
buffer (at room temperature) was added to each of the samples.
Samples were underlayed with 10 ml LSM (lymphocyte separation
mixture) ficoll solution, and centrifuged at 1800 rpm for 25 min.
The upper layer of reddish material was removed, and the LSM layer
was transferred to a new tube (6 tubes per donor). Most of the PBMC
were observed on top of the LSM layer. Elutriation buffer (50 ml)
was added to each tube, and the mixture was centrifuged at 1800 rpm
for 8 min. The supernatant was aspirated, and the PBMC were
resuspended in 15 ml elutriation buffer. The mixture was
transferred into 2 new 50 ml conical tubes. (45 ml total volume per
tube), and centrifuged at 1000 rpm for 8 min. The supernatant was
aspirated, and this process was repeated two more times.
[0702] PBMC were resuspended in flasks containing RPMI 1640 with 2%
FBS, and incubated at 37.degree. C. in 5% CO.sub.2 for 1 hr. Flasks
were rocked once every 20 min. Flasks were washed gently (twice)
with media to remove T-cells and B cells. Flasks were then washed
vigorously with RPMI 1640 plus 10% FBS and 1%
penicillin/streptomycin to obtain monocytes. PBMC were washed twice
in RPMI 1640 with 10% FBS and 1% penicillin/streptomycin. PBMC were
resuspended to 5.times.10.sup.6 cells/ml, and transferred to
flasks. PBMC were incubated at 37.degree. C. in 5% CO.sub.2 without
stimulation for 4 days. In parallel experiments, PBMC were
incubated with GM-CSF (15 ng/ml) and IL-4 (75 ng/ml) for 4 days, or
PBMC were incubated with PHA (1 .mu.g/ml) for 4 days. Flasks were
washed vigorously with RPMI 1640 to remove the monocytes. PBMC were
washed twice in RPMI 1640 examined by flow cytometry as described
for the various cell lines, above. The results indicated that BSL3
polypeptide levels increased on GM-CSF IL4 or PHA stimulated cells
(FIGS. 9E-9F). This increase was not observed in unstimulated cells
(FIGS. 9E-9F).
[0703] Peripheral Blood T Cell Costimulation:
[0704] 96-well plates (Becton Dickinson Cat. # 353072) were coated
with the indicated amount of anti-CD3 MAb G19.4 (described herein)
in PBS (GibcoBRL Cat. # 14190-144). Plates were incubated at
4.degree. C. for 16 hr. Plates were washed twice in PBS. The
following proteins were added: BSL3-Ig (15 .mu.g/ml) or Chi L6 (10
.mu.g/ml) in PBS. Chi L6 is a protein fragment that comprises the
Fc portion of human IgG, and is identical to the Fc portion used in
the BSL-Ig fusion proteins, described above. Different
concentrations of protein were used to give equivalent molarity.
Plates were incubated at 37.degree. C. for 4 hr. Plates were washed
twice in PBS. Peripheral blood T-cells were purified as described,
above. Cells were added (5.times.10.sup.4 cells per well) in RPMI
with 10% human serum (Sigma; Cat. # H-4522) and 1%
penicillin/streptomycin. Cells were incubated at 37.degree. C. in
5% CO.sub.2 for 72 hr. During the last 8 hr, cells were incubated
with an additional 50 .mu.l of media containing 50 .mu.Ci/ml
.sup.3H-thymidine (NEN; Cat. # NET-027). Cells were harvested on a
Brandel cell harvester (Brandel, Gaithersburg, Md.) using Packard
GF/C plates (Packard, Meriden, CT; Cat. # 6005174), and the plates
were air-dried overnight. After this, 50 .mu.l Microscint 20
(Packard; Cat. # 6013621) was added, and the radiolabel was counted
on a Packard Topcount NXT.
[0705] Blockade of Peripheral Blood T Cell Costimulation Using BSL2
and BSL3 Monoclonal Antibodies:
[0706] 96-well plates (Becton Dickinson Cat. # 353072) were coated
with 20 .mu.g/ml anti-CD3 MAb G19.4 (described herein) in PBS
(GibcoBRL Cat. # 14190-144). Plates were incubated at 4.degree. C.
for 16 hr. Plates were washed twice in PBS. The following proteins
were added: BSL3-Ig (15 .mu.g/ml) or L6-Ig (10 .mu.g/ml) in PBS.
Different concentrations of protein were used to give equivalent
molarity. Plates were incubated at 37.degree. C. for 4 hr. Plates
were washed twice in PBS. Peripheral blood T-cells were purified as
described, above. Cells were added (5.times.10.sup.4 cells/well) in
RPMI with 10% human serum (Sigma; Cat. # H-4522) and 1% GibcoBRL
penicillin/streptomycin. Purified anti-BSL3 MAbs or control isotype
MAbs were added to a final concentration of 20 .mu.g/ml. To assay
co-stimulation, monoclonal antibodies were omitted. Plates were
incubated at 37.degree. C. in 5% CO.sub.2 for 72 hr. During the
last 8 hr, cells were incubated in an additional 50 .mu.l of media
with 50 .mu.Ci/ml .sup.3H-thymidine (NEN; Cat. # NET-027). The
cells were harvested on a Brandel cell harvester using Packard GF/C
plates (Cat. # 6005174), and the plates were air-dried overnight.
Following this, 50 .mu.l Microscint 20 (Packard Cat. # 6013621) was
added, and the radiolabel was counted on a Packard Topcount
NXT.
[0707] The results indicated that BSL3-Ig fusion protein acted as a
co-stimulatory molecule for peripheral blood T-cells incubated with
anti-CD3 MAb G19.4 (FIGS. 10A-10D). This was confirmed with
separate peripheral blood T-cells donors: donor 078 (FIG. 10A) and
donor 124 (FIG. 10B). The results further indicated that anti-BSL3
MAbs blocked the co-stimulatory effect of the BSL3-Ig fusion
protein (FIGS. 10C-10D). This was confirmed with separate
peripheral blood T-cells donors: donor 010 (FIG. 10C) and donor 127
(FIG. 10D).
[0708] Peripheral Blood T Cell Assays:
[0709] Peripheral blood T-cell assays were performed to determine
the immunomodulatory properties of BSL2-4616811-Ig (BSL2vcvc-Ig),
monclonal antibodies directed to BSL2-4616811, and BSL2-LI
65-35b-Ig (BSL2v1c2-Ig).
[0710] 1. For the first set of experiments, 100 .mu.l of the
indicated concentration (2, 1, 0.5, 0.25, 0.13, or 0 .mu.g/ml) of
anti-CD3 MAb G19.4 (described herein) was added in triplicate to a
Costar plate (Corning Inc., Corning N.Y.; Cat. # 3595) in Gibco
DPBS (Invitrogen Corp., Grand Island, N.Y.). The plate was
incubated at 4.degree. C. for 16 hr. The plate was washed two times
in DPBS. Following this, 100 .mu.l of 30 .mu.g/ml BSL2-4616811-Ig
(BSL2vcvc-Ig) or 10 .mu.g/ml ChiL6 fusion protein was added per
well in triplicate and incubated at 37.degree. C. for 4 hr. The
plate was washed two times in DPBS. Then, 50,000 E-rosetted
peripheral blood T-cells in 200 .mu.l Gibco RPMI 1640 (Cat. #
11875-085) plus 1/100 volume Gibco penicillin-streptomycin (Cat. #
15140-122) plus 10% human serum (Sigma, St. Louis, Mo.; Cat. #
H4522) were added per well. The plate was incubated at 37.degree.
C. in 5% CO.sub.2 for 2 days.
[0711] Following this, 50 .mu.l of the same media and 1/50 volume
of Perkin-Elmer .sup.3H-thymidine (Perkin-Elmer Life Sciences Inc.,
Boston, Mass.; Cat. # NET-027) was added per well. The plate was
incubated at 37.degree. C. in 5% CO.sub.2 for 16 hr. The plate was
harvested on a Brandel harvester model CH-600 using a Packard plate
(Packard, Meriden Conn.; Cat. # 6005174). Then, 40 .mu.l Packard
Microscint 20 (Cat. # 6013621) was added per well. The plate was
counted on a Packard TopCount NXT. Data was analyzed using
Microsoft Excel 97 (Microsoft, Redmond, Wash.). Four independent
experiments were performed, each with cells isolated from two
different donors. Representative results obtained with cells
isolated from donor 100 are shown in FIG. 11A.
[0712] 2. The peripheral blood T-cells assay was performed as
described in (1), except that a constant concentration (250 ng/ml)
of anti-CD3 MAb G19.4 was used, and decreasing concentrations of
BSL2-4616811-Ig (BSL2vcvc-Ig; 90, 30, 10, 3.3, 1.1, or 0 .mu.g/ml)
and ChiL6 (30, 10, 3.3, 1.1, 0.37, 0 .mu.g/ml) fusion proteins were
used. Two independent experiments were performed, each with cells
isolated from two different donors. Representative results obtained
with cells isolated from donor 82 are shown in FIG. 11B.
[0713] 3. The peripheral blood T-cells assay was performed as
described in (1), except that 40 ng/ml anti-CD3 MAb G19.4 was used
and the plate was incubated 37.degree. C. for 4 hr. The plate was
washed twice in DPBS. Then, a decreasing concentration (100 .mu.l
of 2, 1, 0.5, 0.25, 0.13, or 0 .mu.g/ml) of anti-CD28 MAb 9.3
(described herein) was added to each well. The plate was incubated
at 4.degree. C. for 16 hr. The plate was washed twice in DPBS and
100 .mu.l of 90 .mu.g/ml BSL2-4616811-Ig (BSL2vcvc-Ig) or 30
.mu.g/ml ChiL6 was added per well in triplicate. Four independent
experiments were performed, each with cells from two different
donors. Representative results obtained with cells isolated from
donor 50 are shown in FIG. 11C.
[0714] 4. The peripheral blood T-cells assay was performed as
described in (1), except that a constant concentration (200 ng/ml)
of anti-CD3 MAb G19.4 was used, and a decreasing concentration of
BSL2-4616811-Ig (BSL2vcvc-Ig; 120,60,30, 15,7.5, or 0 .mu.g/ml),
BSL2-L165-35b-Ig (BSL2v1c2-Ig; 80, 40, 20, 10, 5, or 0 .mu.g/ml) or
ChiL6 (80, 40, 20, 10, 5, or 0 .mu.g/ml) was added. Two independent
experiments were performed, each with cells isolated from two
different donors. Representative results obtained with cells
isolated from donor 44 are shown in FIG. 11D.
[0715] 5. The peripheral blood T-cells assay was performed as
described in (1), except that the plate was initially coated with
250 ng/ml anti-CD3 MAb G19.4. Following washes, the plate was
coated with 30 .mu.g/ml BSL2-4616811-Ig (BSL2vcvc-Ig). Following
additional washes, anti-BSL2-1 MAb, anti-BSL2-5 MAb, or
non-specific 3.sub.--15 MAb (also called MAb 3-15E10A3, MAb
15E10A3, and MAb 15E10AA3) was added at decreasing concentrations
(54, 18, 9, 2.2, 0.74, or 0 .mu.g/ml) in 100 .mu.l media. T-cells
were added in 100 .mu.l media. Two independent experiments were
performed, each with cells isolated from two different donors.
Representative results obtained with cells isolated from donor 117
are shown in FIG. 11E.
[0716] 6. The peripheral blood T-cells assay was performed as
described in (1), except that the plates were coated with a
constant concentration (200 ng/ml) of anti-CD3 MAb G19.4. Following
washes, the plate was coated with 30 .mu.g/ml BSL2vcvc-Ig isolated
from CHO cells (see above). Following additional washes, either
anti-BSL2-1 MAb, anti-BSL2-2 MAb, anti-BSL2-3 MAb, anti-BSL2-4 MAb,
or non-specific MAb 3.sub.--15 was added at decreasing
concentrations (20, 10, 5, 2.5, 1.25, or 0 .mu.g/ml) in 100 .mu.l
media. T-cells were added in 100 .mu.l media. The final
concentrations of the antibodies were 10, 5, 2.5, 1.25, 0.63, 0
.mu.g/ml. Two independent experiments were performed, each with
cells isolated from two different donors. Representative results
obtained with cells isolated from donor 10 are shown in FIG.
11F.
[0717] 7. The peripheral blood T-cells assay was performed as
described in (1), except that the plates were coated with a
constant concentration (200 ng/ml) of anti-CD3 MAb G19.4. Following
washes, the plate was coated with 30 .mu.g/ml ChiL6 fusion protein.
Following additional washes, either anti-BSL2-1 MAb or non-specific
3.sub.--15 MAb was added at decreasing concentrations (40, 20, 10,
5, 2.5, or 0 .mu.g/ml), or no antibody was added, in 50 .mu.l
media. T-cells were added in 150 .mu.l media. The final
concentrations of the antibodies were 10, 5, 2.5, 1.25, 0.63, or 0
.mu.g/ml. One experiment was performed with cells isolated from two
different donors. Representative results obtained with cells
isolated from donor 12 are shown in FIG. 11G.
[0718] 8. The peripheral blood T-cells assay was performed as
described in (1), except that the plates were coated with a
constant concentration of 200 ng/ml anti-CD3 MAb G19.4. Following
washes, the plate was coated with 30 .mu.g/ml BSL3-LI 65-35b-Ig
(BSL2v1c2-Ig). Following additional washes, anti-BSL2-1 MAb or
non-specific 3.sub.--15 MAb was added at decreasing concentrations
(20, 10, 5, 2.5, 1.25, or 0 .mu.g/ml), or no antibody was added, in
100 .mu.l media. T-cells were added in 100 .mu.l media. The final
concentration of the antibodies was 10, 5, 2.5, 1.25, 0.63 or 0
.mu.g/ml. One experiment was performed with cells isolated from two
different donors. Representative results obtained with cells
isolated from donor 12 are shown in FIG. 11H.
[0719] 9. The peripheral blood T-cells assay was performed as
described in (1), except that the plates were coated with a
constant concentration (200 ng/ml) of anti-CD3 MAb G19.4. Following
washes, the plate was coated with 30 .mu.g/ml BSL2-4616811-Ig
(BSL2vcvc-Ig) isolated from CHO cells (see above). Following
additional washes, the plate was coated with decreasing
concentrations (10, 5, 2.5, 1.25, 0.63, or 0 .mu.g/ml) of
anti-BSL2-1 MAb or non-specific 3.sub.--15 MAb, or no antibody was
added. Following more washes, T-cells were added in 200 .mu.l
media. One experiment was performed with cells isolated from two
different donors. Representative results obtained from cells
isolated from donor 12 are shown in FIG. 11I.
[0720] 10. The peripheral blood T-cells assay was performed as
described in (1), except that the plates were coated with a
constant concentration (200 ng/ml) of anti-CD3 MAb G19.4. Following
washes, the plate was coated with decreasing concentrations (10, 5,
2.5,1.25, 0.63, or 0 .mu.g/ml) of anti-BSL2-1 MAb or non-specific
3.sub.--15 MAb, or no antibody was added. Following additional
washes, the plate was coated with 30 .mu.g/ml BSL2-4616811-Ig
(BS2vcvc-Ig) isolated from CHO cells (see above). Following more
washes, T-cells were added in 200 .mu.l media. One experiment was
performed with cells isolated from two different donors.
Representative results obtained from cells isolated from donor 12
are shown in FIG. 11J.
[0721] The results of these assays are summarized as follows. In
these experiments, BSL2-4616811-Ig (BSL2vcvc-Ig) fusion protein
acted as a potent inhibitor of T-cell proliferation, even at
relatively high concentrations of anti-CD3 MAb G19.4 (FIG. 11A).
The optimal inhibitory concentration of BSL2-4616811-Ig in a T-cell
proliferation assay was approximately 90 .mu.g/ml (FIG. 11B).
Moreover, BSL2-4616811-Ig-mediated inhibition of T-cell
proliferation appears to be dominant over T-cell stimulation with
anti-CD28 MAb 9.3 (FIG. 11C). In contrast, BSL2-L-165-35b-Ig
(BSL2v1c2-Ig) appears to have no effect on T-cell proliferation
(FIG. 11D).
[0722] Surprisingly, all five anti-BSL2 monoclonal antibodies (used
as soluble reagents) also have a potent inhibitory effect on T-cell
proliferation (FIGS. 11E-11F). The inhibitory effect of the BSL2
monoclonal antibodies requires the presence of the BSL2-4616811-Ig
(BSL2vcvc-Ig) fusion protein (compare FIG. 11E to FIGS. 11G-11H).
In addition, the BSL2 monoclonal antibody anti-BSL2-1 is more
effective at inhibition when soluble, than when bound to the plate,
or when bound to the plate in the presence of BSL2-4616811-Ig
(BSL2vcvc-Ig; compare FIG. 11E to FIGS. 11I-11J).
[0723] From these experiments, it is clear that the BSL2-4616811-Ig
(BSL2vcvc-Ig) fusion protein inhibits T-cell proliferation.
Moreover, it appears that the BSL2-4616811-Ig fusion protein acts
through a pathway that is dominant to the CD28 stimulatory pathway.
Interestingly, BSL2 monoclonal antibodies act synergistically with
the BSL2-4616811-Ig fusion protein in inhibiting T-cell
proliferation. While not wishing to be bound by theory, the
mechanism of this synergy may involve the signaling of anti-BSL2
(BSL2vcvc) MAbs through BSL2 present on T-cells, and the formation
of a complex on T-cells that contains anti-BSL2 MAbs bound to
endogenous BSL2 (BSL2vcvc) bound to endogenous BSL2 (BSL2vcvc)
ligand, and plate-bound BSL2-Ig (BSL2vcvc-Ig) bound to endogenous
BSL2 (BSL2vcvc) ligand. However, other mechanisms are also
possible.
[0724] Mixed Lymphocyte Reactions:
[0725] In the mixed lymphocyte reactions (MLR), 100,000 E-rosetted
peripheral blood T-cells from donor 124 were mixed with 100,000
elutriated peripheral blood monocytes (isolated as described above)
from donor 051, and BSL2-4616811-Ig, CTLA4-Ig, or ChiL6 were added.
Final concentrations were 90, 30, 10, 3.3, 1.1, or 0.37 .mu.g/ml
for BSL2-4616811-Ig (BSL2vcvc-Ig), 60, 20, 6.6, 2.2, 0.73, 0.24
.mu.g/ml for CTLA4-Ig, or 30, 10, 3.3, 1.1, 0.36, 0.12 .mu.g/ml for
ChiL6. The final volume was 200 .mu.l. A Falcon plate (Becton
Dickinson, Franklin Lakes N.J.; Cat. # 35-3077) was used. Media was
made as described above. The plate was incubated 4 days at
37.degree. C. in 5% CO.sub.2. The plate was labeled, harvested,
counted and the data analyzed as indicated above. Results are shown
in FIG. 12A.
[0726] In a second set of experiments, the MLR was performed as
described, except that final concentrations were 90, 45, 22.5,
11.25, 5.625, or 0 .mu.g/ml for BSL2-4616811-Ig (BSL2vcvc-Ig), 60,
30, 15, 7.5, 3.75, or 0 .mu.g/ml for BSL2-L165-35b-Ig
(BSL2v1c2-Ig), or 30, 15, 7.5, 3.75, 1.875, or 0 .mu.g/ml) ChiL6.
Results are shown in FIG. 12B. The results depicted in FIGS.
12A-12B support the results shown in FIGS. 11C-11D, described
above. In particular, the experiments show that BSL2-4616811-Ig
(BSL2vcvc-Ig)-mediated inhibition of T-cell proliferation appears
to be dominant over T-cell stimulation through CD28 (FIG. 12A), and
that BSL2-L165-35b-Ig (BSL2v1c2-Ig) appears to have no effect on
T-cell proliferation (FIG. 12B).
[0727] Binding Comparison of Anti-BSL2 Monoclonal Antibodies to
BSL2-4616811-Ig (BSL2vcvc-Ig) and BSL2-L165-35b-Ig (BSL2v1c2-Ig).
Plates were coated with 1 .mu.g/ml of BSL2-4616811-Ig (BSL2vcvc-Ig)
or BSL2-L165-35b-Ig (BSL2v1c2-Ig) at 50 .mu.l/well and incubated at
4.degree. C. overnight. Wells were aspirated and plates were
blocked with 200 .mu.l of 1% milk blocking solution (KPL; Cat. #
50-82-00). Plates were incubated at room temperature for 60 min.
Plates were then washed with PBS containing 0.05% Tween.RTM.20
using four washes with 300 .mu.l/well, and 2 sec between each wash
(Program BMR1). Anti-BSL2-1 MAb, anti-BSL2-2 MAb, anti-BSL2-3 MAb,
anti-BSL2-4 MAb, anti-BSL2-5, and negative control antibody 315 MAb
were added (10 .mu.g/ml; 50 .mu.l/well) and plates were incubated
at room temperature for 60 min. Plates were washed as described,
and donkey anti-mouse IgG (H+L) HRP-conjugated secondary antibody
(Jackson ImmunoResearch Laboratories, Inc., West Grove, Pa.) was
added. Plates were incubated for 60 min at room temperature, and
washed as before. Following this, 50 .mu.l/well Develop Solution
(DAKO Corp., Carprinteria, Calif., Cat. # S1599) was added. Plates
were incubated at room temperature for about 20 min. Stop Solution
was then added (2.0 N sulfuric acid; 50 .mu.l/well). Plates were
read for absorbance at 405 nm. The results shown in FIG. 13
indicate that there was no significant difference between the
binding of the anti-BSL2 monoclonal antibodies to BSL2-4616811-Ig
(BSL2vcvc-Ig) or BSL2-L165-35b-Ig (BSL2v1c2-Ig).
Example 8
Identification and Cloning of V.sub.H and V.sub.L Domains of
Antibodies Directed Against the BSL1, BSL2, or BSL3 Polypeptide
[0728] V.sub.H and V.sub.L domains may be identified and cloned
from cell lines expressing an antibody directed against a BSL1
(e.g., SEQ ID NO:2), BSL2 (e.g., SEQ ID NO:7, SEQ ID NO:11, or SEQ
ID NO:13), or BSL3 (e.g., SEQ ID NO:15) epitope by performing PCR
with V.sub.H and V.sub.L specific primers on cDNA template made
from the antibody expressing cell lines. Briefly, RNA is isolated
from the cell lines and used as a template for RT-PCR designed to
amplify the V.sub.H and V.sub.L domains of the antibodies expressed
by the EBV cell lines. Cells may be lysed using the TRIzol reagent
(Life Technologies, Rockville, Md.) and extracted with one-fifth
volume of chloroform. After addition of chloroform, the solution is
allowed to incubate at room temperature for 10 min, and then
centrifuged at 14,000 rpm for 15 min at 4.degree. C. in a tabletop
centrifuge. The supernatant is collected and RNA is precipitated
using an equal volume of isopropanol. Precipitated RNA is pelleted
by centrifuging at 14,000 rpm for 15 min at 4.degree. C. in a
tabletop centrifuge.
[0729] Following centrifugation, the supernatant is discarded and
the pellet is washed with 75% ethanol. Following the wash step, the
RNA is centrifuged again at 800 rpm for 5 min at 4.degree. C. The
supernatant is discarded and the pellet allowed to air dry. RNA is
the dissolved in DEPC water and heated to 60.degree. C. for 10 min.
Quantities of RNA can be determined using optical density
measurements. cDNA may be synthesized according to methods
well-known in the art and/or described herein from 1.5 to 2.5
micrograms of RNA using reverse transciptase and random hexamer
primers. cDNA is then used as a template for PCR amplification of
V.sub.H and V.sub.L domains. Primers used to amplify V.sub.H and
V.sub.L genes are shown in Tables 8 and 9, below.
12TABLE 8 Primer Sequences Used to Amplify V.sub.L domains SEQ
Primer name Primer Sequence ID NO: Hu Vkappa1-5'
GACATCCAGATGACCCAGTCTCC 95 Hu Vkappa2a-5' GATGTTGTGATGAGTCAGTCTCC
96 Hu Vkappa2b-5' GATATTGTGATGACTCAGTCTCC 97 Hu Vkappa3-5'
GAAATTGTGTTGACGCAGTGTCC 98 Hu Vkappa4-5' GACATCGTGATGACCCAGTCTCC 99
Hu Vkappa5-5' GAAACGACACTCACGCAGTCTCG 100 Hu Vkappa6-5'
GAAATTGTGCTGACTCAGTCTCC 101 Hu Vlambda1-5' CAGTCTGTGTTGACGCAGCCGGC
102 Hu Vlambda2-5' CAGTCTGCCCTGACTCAGCCTGC 103 Hu Vlambda3-5'
TCCTATGTGCTGACTCAGCCACC 104 Hu Vlambda3b-5' TCTTCTGAGCTGACTCAGGACCC
105 Hu Vlambda4-5' GACGTTATACTGACTCAACCGCC 106 Hu Vlambda5-5'
CAGGCTGTGCTCACTCAGCCGTC 107 Hu Vlambda6-5' AATTTTATGCTGACTCAGCCCCA
108 Hu Jkappa1-3' ACGTTTGATTTCCACCTTGGTGCC 109 Hu Jkappa2-3'
ACGTTTGATCTCCAGCTTGGTGGG 110 Hu Jkappa3-3' ACGTTTGATATCCACTTTGGTCCC
111 Hu Jkappa4-3' ACGTTTGATGTCCACCTTGGTCCC 112 Hu Jkappa5-3'
ACGTTTAATCTCCAGTCGTGTCCC 113 Hu Vlambda1-3' GAGTCTGTGTTGACGCAGCCGCC
114 Hu Vlambda2-3' CAGTCTGCCCTGACTCAGCCTGC 115 Hu Vlambda3-3'
TCCTATGTGCTGACTCAGCCACC 116 Hu Vlambda3b-3' TCTTCTGAGCTGACTCAGGACCC
117 Hu Vlambda4-3' CACGTTATACTGACTCAACCGCC 118 Hu Vlambda5-3'
CAGGGTGTGCTCACTCAGCCGTC 119 Hu Vlambda6-3' AATTTTATGCTGACTCAGCCCCA
120
[0730]
13TABLE 9 Primer Sequences Used to Amplify V.sub.H domains. Primer
name Primer Sequence SEQ ID NO: Hu VH1-5' CAGGTGCAGCTGGTGCAGTCTGG
121 Hu VH2-5' CAGGTCAACTTAAGGGAGTCTGG 122 Hu VH3-5'
GAGGTGCAGCTGGTGGAGTCTGG 123 Hu VH4-5' CAGGTGCAGCTGCAGGAGTCGGG 124
Hu VH5-5' GAGGTGCAGCTGTTGCAGTCTGG 125 Hu VH6-5'
CAGGTACAGCTGCAGCAGTCAGG 126 Hu JH1-5' TGAGGAGACGGTGACCAGGGTGCC 127
Hu JH3-5' TGAAGAGACGGTGACCATTGTCCC 128 Hu JH4-5'
TGAGGAGACGGTGACCAGGGTTCC 129 Hu JH6-5' TGAGGAGACGGTGACCGTGGTCCC
130
[0731] Typically a PCR reaction makes use of a single 5' primer and
a single 3' primer. At times, when the amount of available RNA
template is limiting, or for greater efficiency, groups of 5'
and/or 3' primers may be used. For example, all five V.sub.H-5'
primers and all J.sub.H-3' primers may be used in a single PCR
reaction. The PCR reaction is carried out in a 50 .mu.l volume
containing 1.times. PCR buffer, 2 mM each dNTP, 0.7 U High Fidelity
Taq polymerase, 5' primer mix, 3' primer mix, and 7.5 .mu.l cDNA.
The 5' and 3' primer mix of both V.sub.H and V.sub.L can be made by
pooling together 22 pmole and 28 pmole, respectively, of each of
the individual primers. PCR conditions include incubation at
96.degree. C. for 5 min; followed by 25 cycles of incubation at
94.degree. C. for 1 min, 50.degree. C. for 1 min, and 72.degree. C.
for 1 min; followed by an extension cycle of 72.degree. C. for 10
min. After the reaction has been completed, sample tubes may be
stored at 4.degree. C.
[0732] PCR samples are then electrophoresed on a 1.3% agarose gel.
DNA bands of the expected sizes (506-bp for V.sub.H domains, and
344-bp for V.sub.L domains) can be cut out of the gel and purified
using methods well known in the art and/or described herein.
Purified PCR products can be ligated into a PCR cloning vector (TA
vector from Invitrogen Inc., Carlsbad, Calif.). Individual cloned
PCR products can be isolated after transformation into E. coli and
blue/white color selection. Cloned PCR products may then be
sequenced using methods commonly known in the art and/or described
herein.
[0733] The PCR bands containing the V.sub.H domain and the V.sub.L
domains can also be used to create full-length Ig expression
vectors. V.sub.H and V.sub.L domains can be cloned into vectors
containing the nucleotide sequences of a heavy (e.g., human IgG1 or
human IgG4) or light chain (human kappa or human lambda) constant
regions such that a complete heavy or light chain molecule could be
expressed from these vectors when transfected into an appropriate
host cell. Further, when cloned heavy and light chains are both
expressed in one cell line (from either one or two vectors), they
can assemble into a complete functional antibody molecule that is
secreted into the cell culture medium. Methods using
polynucleotides encoding V.sub.H and V.sub.L antibody domain to
generate expression vectors that encode complete antibody molecules
are well known within the art.
[0734] As various changes can be made in the above compositions and
methods without departing from the scope and spirit of the
invention, it is intended that all subject matter contained in the
above description, shown in the accompanying drawings, or defined
in the appended claims be interpreted as illustrative, and not in a
limiting sense.
[0735] The contents of all patents, patent applications, published
articles, books, reference manuals, texts and abstracts cited
herein are hereby incorporated by reference in their entirety to
more fully describe the state of the art to which the present
invention pertains.
Sequence CWU 1
1
138 1 1604 DNA Homo sapiens 1 acgcgggggt gccgcgcggc cccagttctg
cgcagcttcc cgaggctccg caccagccgc 60 gcttctgtcc gcctgcaggg
cattccagaa agatgaggat atttgctgtc tttatattca 120 tgacctactg
gcatttgctg aacgcattta ctgtcacggt tcccaaggac ctatatgtgg 180
tagagtatgg tagcaatatg acaattgaat gcaaattccc agtagaaaaa caattagacc
240 tggctgcact aattgtctat tgggaaatgg aggataagaa cattattcaa
tttgtgcatg 300 gagaggaaga cctgaaggtt cagcatagta gctacagaca
gagggcccgg ctgttgaagg 360 accagctctc cctgggaaat gctgcacttc
agatcacaga tgtgaaattg caggatgcag 420 gggtgtaccg ctgcatgatc
agctatggtg gtgccgacta caagcgaatt actgtgaaag 480 tcaatgcccc
atacaacaaa atcaaccaaa gaattttggt tgtggatcca gtcacctctg 540
aacatgaact gacatgtcag gctgagggct accccaaggc cgaagtcatc tggacaagca
600 gtgaccatca agtcctgagt ggtaagacca ccaccaccaa ttccaagaga
gaggagaagc 660 ttttcaatgt gaccagcaca ctgagaatca acacaacaac
taatgagatt ttctactgca 720 cttttaggag attagatcct gaggaaaacc
atacagctga attggtcatc ccagaactac 780 ctctggcaca tcctccaaat
gaaaggactc acttggtaat tctgggagcc atcttattat 840 gccttggtgt
agcactgaca ttcatcttcc gtttaagaaa agggagaatg atggatgtga 900
aaaaatgtgg catccaagat acaaactcaa agaagcaaag tgatacacat ttggaggaga
960 cgtaatccag cattggaact tctgatcttc aagcagggat tctcaacctg
tggtttaggg 1020 gttcatcggg gctgagcgtg acaagaggaa ggaatgggcc
cgtgggatgc aggcaatgtg 1080 ggacttaaaa ggcccaagca ctgaaaatgg
aacctgcgaa agcagaggag gagaatgaag 1140 aaagatggag tcaaacaggg
agcctggagg gagaccttga tactttcaaa tgcctgaggg 1200 gctcatcgac
gcctgtgaca gggagaaagg atacttctga acaaggagcc tccaagcaaa 1260
tcatccattg ctcatcctag gaagacgggt tgagaatccc taatttgagg gtcagttcct
1320 gcagaagtgc cctttgcctc cactcaatgc ctcaatttct tttctgcatg
actgagagtc 1380 tcagtgttgg aacgggacag tatttatgta tgagtttttc
ctatttattt tgagtctgtg 1440 aggtcttctt gtcatgtgag tgtggttgtg
aatgatttct tttgaagata tattgtagta 1500 gatgttacaa ttttgtcgcc
aaactaaact tgctgcttaa tgatttgctc acatctagta 1560 aaacatggag
tattcaaaaa aaaaaaaaaa aaaaaaaaaa aaaa 1604 2 290 PRT Homo sapiens 2
Met Arg Ile Phe Ala Val Phe Ile Phe Met Thr Tyr Trp His Leu Leu 1 5
10 15 Asn Ala Phe Thr Val Thr Val Pro Lys Asp Leu Tyr Val Val Glu
Tyr 20 25 30 Gly Ser Asn Met Thr Ile Glu Cys Lys Phe Pro Val Glu
Lys Gln Leu 35 40 45 Asp Leu Ala Ala Leu Ile Val Tyr Trp Glu Met
Glu Asp Lys Asn Ile 50 55 60 Ile Gln Phe Val His Gly Glu Glu Asp
Leu Lys Val Gln His Ser Ser 65 70 75 80 Tyr Arg Gln Arg Ala Arg Leu
Leu Lys Asp Gln Leu Ser Leu Gly Asn 85 90 95 Ala Ala Leu Gln Ile
Thr Asp Val Lys Leu Gln Asp Ala Gly Val Tyr 100 105 110 Arg Cys Met
Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr Val 115 120 125 Lys
Val Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg Ile Leu Val Val 130 135
140 Asp Pro Val Thr Ser Glu His Glu Leu Thr Cys Gln Ala Glu Gly Tyr
145 150 155 160 Pro Lys Ala Glu Val Ile Trp Thr Ser Ser Asp His Gln
Val Leu Ser 165 170 175 Gly Lys Thr Thr Thr Thr Asn Ser Lys Arg Glu
Glu Lys Leu Phe Asn 180 185 190 Val Thr Ser Thr Leu Arg Ile Asn Thr
Thr Thr Asn Glu Ile Phe Tyr 195 200 205 Cys Thr Phe Arg Arg Leu Asp
Pro Glu Glu Asn His Thr Ala Glu Leu 210 215 220 Val Ile Pro Glu Leu
Pro Leu Ala His Pro Pro Asn Glu Arg Thr His 225 230 235 240 Leu Val
Ile Leu Gly Ala Ile Leu Leu Cys Leu Gly Val Ala Leu Thr 245 250 255
Phe Ile Phe Arg Leu Arg Lys Gly Arg Met Met Asp Val Lys Lys Cys 260
265 270 Gly Ile Gln Asp Thr Asn Ser Lys Lys Gln Ser Asp Thr His Leu
Glu 275 280 285 Glu Thr 290 3 3600 DNA Homo sapiens 3 acgcgggggt
gccgcgcggc cccagttctg cgcagcttcc cgaggctccg caccagccgc 60
gcttctgtcc gcctgcaggg cattccagaa agatgaggat atttgctgtc tttatattca
120 tgacctactg gcatttgctg aacgcattta ctgtcacggt tcccaaggac
ctatatgtgg 180 tagagtatgg tagcaatatg acaattgaat gcaaattccc
agtagaaaaa caattagacc 240 tggctgcact aattgtctat tgggaaatgg
aggataagaa cattattcaa tttgtgcatg 300 gagaggaaga cctgaaggtt
cagcatagta gctacagaca gagggcccgg ctgttgaagg 360 accagctctc
cctgggaaat gctgcacttc agatcacaga tgtgaaattg caggatgcag 420
gggtgtaccg ctgcatgatc agctatggtg gtgccgacta caagcgaatt actgtgaaag
480 tcaatgcccc atacaacaaa atcaaccaaa gaattttggt tgtggatcca
gtcacctctg 540 aacatgaact gacatgtcag gctgagggct accccaaggc
cgaagtcatc tggacaagca 600 gtgaccatca agtcctgagt ggtaagacca
ccaccaccaa ttccaagaga gaggagaagc 660 ttttcaatgt gaccagcaca
ctgagaatca acacaacaac taatgagatt ttctactgca 720 cttttaggag
attagatcct gaggaaaacc atacagctga attggtcatc ccagaactac 780
ctctggcaca tcctccaaat gaaaggactc acttggtaat tctgggagcc atcttattat
840 gccttggtgt agcactgaca ttcatcttcc gtttaagaaa agggagaatg
atggatgtga 900 aaaaatgtgg catccaagat acaaactcaa agaagcaaag
tgatacacat ttggaggaga 960 cgtaatccag cattggaact tctgatcttc
aagcagggat tctcaacctg tggtttaggg 1020 gttcatcggg gctgagcgtg
acaagaggaa ggaatgggcc cgtgggatgc aggcaatgtg 1080 ggacttaaaa
ggcccaagca ctgaaaatgg aacctgcgaa agcagaggag gagaatgaag 1140
aaagatggag tcaaacaggg agcctggagg gagaccttga tactttcaaa tgcctgaggg
1200 gctcatcgac gcctgtgaca gggagaaagg atacttctga acaaggagcc
tccaagcaaa 1260 tcatccattg ctcatcctag gaagacgggt tgagaatccc
taatttgagg gtcagttcct 1320 gcagaagtgc cctttgcctc cactcaatgc
ctcaatttct tttctgcatg actgagagtc 1380 tcagtgttgg aacgggacag
tatttatgta tgagtttttc ctatttattt tgagtctgtg 1440 aggtcttctt
gtcatgtgag tgtggttgtg aatgatttct tttgaagata tattgtagta 1500
gatgttacaa ttttgtcgcc aaactaaact tgctgcttaa tgatttgctc acatctagta
1560 aaacatggag tatttgtaag gtgcttggtc tcctctataa ctacaagtat
acattggaag 1620 cataaagatc aaaccgttgg ttgcatagga tgtcaccttt
atttaaccca ttaatactct 1680 ggttgaccta atcttattct cagacctcaa
gtgtctgtgc agtatctgtt ccatttaaat 1740 atcagcttta caattatgtg
gtagcctaca cacataatct catttcatcg ctgtaaccac 1800 cctgttgtga
taaccactat tattttaccc atcgtacagc tgaggaagca aacagattaa 1860
gtaacttgcc caaaccagta aatagcagac ctcagactgc cacccactgt ccttttataa
1920 tacaatttac agctatattt tactttaagc aattctttta ttcaaaaacc
atttattaag 1980 tgcccttgca atatcaatcg ctgtgccagg cattgaatct
acagatgtga gcaagacaaa 2040 gtacctgtcc tcaaggagct catagtataa
tgaggagatt aacaagaaaa tgtattatta 2100 caatttagtc cagtgtcata
gcataaggat gatgcgaggg gaaaacccga gcagtgttgc 2160 caagaggagg
aaataggcca atgtggtctg ggacggttgg atatacttaa acatcttaat 2220
aatcagagta attttcattt acaaagagag gtcggtactt aaaataaccc tgaaaaataa
2280 cactggaatt ccttttctag cattatattt attcctgatt tgcctttgcc
atataatcta 2340 atgcttgttt atatagtgtc tggtattgtt taacagttct
gtcttttcta tttaaatgcc 2400 actaaatttt aaattcatac ctttccatga
ttcaaaattc aaaagatccc atgggagatg 2460 gttggaaaat ctccacttca
tcctccaagc cattcaagtt tcctttccag aagcaactgc 2520 tactgccttt
cattcatatg ttcttctaaa gatagtctac atttggaaat gtatgttaaa 2580
agcacgtatt tttaaaattt ttttcctaaa tagtaacaca ttgtatgtct gctgtgtact
2640 ttgctatttt tatttatttt agtgtttctt atatagcaga tggaatgaat
ttgaagttcc 2700 cagggctgag gatccatgcc ttctttgttt ctaagttatc
tttcccatag cttttcatta 2760 tctttcatat gatccagtat atgttaaata
tgtcctacat atacatttag acaaccacca 2820 tttgttaagt atttgctcta
ggacagagtt tggatttgtt tatgtttgct caaaaggaga 2880 cccatgggct
ctccagggtg cactgagtca atctagtcct aaaaagcaat cttattatta 2940
actctgtatg acagaatcat gtctggaact tttgttttct gctttctgtc aagtataaac
3000 ttcactttga tgctgtactt gcaaaatcac attttctttc tggaaattcc
ggcagtgtac 3060 cttgactgct agctaccctg tgccagaaaa gcctcattcg
ttgtgcttga acccttgaat 3120 gccaccagct gtcatcacta cacagccctc
ctaagaggct tcctggaggt ttcgagattc 3180 agatgccctg ggagatccca
gagtttcctt tccctcttgg ccatattctg gtgtcaatga 3240 caaggagtac
cttggctttg ccacatgtca aggctgaaga aacagtgtct ccaacagagc 3300
tccttgttat ctgtttgtac atgtgcattt gtacagtaat tggtgtgaca gtgttctttg
3360 tgtgaattac aggcaagaat tgtggctgag caaggcacat agtctactca
gtctattcct 3420 aagtcctaac tcctccttgt ggtgttggat ttgtaaggca
ctttatccct tttgtctcat 3480 gtttcatcgt aaatggcata ggcagagatg
atacctaatt ctgcatttga ttgtcacttt 3540 ttgtacctgc attaatttaa
taaaatattc ttatttattt tgttacttgg taaaaaaaaa 3600 4 1443 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
fusion construct 4 atgcccatgg ggtctctgca accgctggcc accttgtacc
tgctggggat gctggtcgct 60 tcctgcctcg gaactagtgt tcccaaggac
ctatatgtgg tagagtatgg tagcaatatg 120 acaattgaat gcaaattccc
agtagaaaaa caattagacc tggctgcact aattgtctat 180 tgggaaatgg
aggataagaa cattattcaa tttgtgcatg gagaggaaga cctgaaggtt 240
cagcatagta gctacagaca gagggcccgg ctgttgaagg accagctctc cctgggaaat
300 gctgcacttc agatcacaga tgtgaaattg caggatgcag gggtgtaccg
ctgcatgatc 360 agctatggtg gtgccgacta caagcgaatt actgtgaaag
tcaatgcccc atacaacaaa 420 atcaaccaaa gaattttggt tgtggatcca
gtcacctctg aacatgaact gacatgtcag 480 gctgagggct accccaaggc
cgaagtcatc tggacaagca gtgaccatca agtcctgagt 540 ggtaagacca
ccaccaccaa ttccaagaga gaggagaagc ttttcaatgt gaccagcaca 600
ctgagaatca acacaacaac taatgagatt ttctactgca cttttaggag attagatcct
660 gaggaaaacc atacagctga attggtcatc ccagaactac ctctggcaca
tcctccaaat 720 gaaaggactc gaggagatcc cgaggagccc aaatcttgtg
acaaaactca cacatgccca 780 ccgtgcccag cacctgaact cctgggggga
ccgtcagtct tcctcttccc cccaaaaccc 840 aaggacaccc tcatgatctc
ccggacccct gaggtcacat gcgtggtggt ggacgtgagc 900 cacgaagacc
ctgaggtcaa gttcaactgg tacgtggacg gcgtggaggt gcataatgcc 960
aagacaaagc cgcgggagga gcagtacaac agcacgtacc gtgtggtcag cgtcctcacc
1020 gtcctgcacc aggactggct gaatggcaag gagtacaagt gcaaggtctc
caacaaagcc 1080 ctcccagccc ccatcgagaa aaccatctcc aaagccaaag
ggcagccccg agaaccacag 1140 gtgtacaccc tgcccccatc ccgggatgag
ctgaccaaga accaggtcag cctgacctgc 1200 ctggtcaaag gcttctatcc
cagcgacatc gccgtggagt gggagagcaa tgggcagccg 1260 gagaacaact
acaagaccac gcctcccgtg ctggactccg acggctcctt cttcctctac 1320
agcaagctca ccgtggacaa gagcaggtgg cagcagggga acgtcttctc atgctccgtg
1380 atgcatgagg ctctgcacaa ccactacacg cagaagagcc tctccctgtc
tccgggtaaa 1440 tga 1443 5 480 PRT Artificial Sequence Description
of Artificial Sequence Synthetic fusion construct 5 Met Pro Met Gly
Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly 1 5 10 15 Met Leu
Val Ala Ser Cys Leu Gly Thr Ser Val Pro Lys Asp Leu Tyr 20 25 30
Val Val Glu Tyr Gly Ser Asn Met Thr Ile Glu Cys Lys Phe Pro Val 35
40 45 Glu Lys Gln Leu Asp Leu Ala Ala Leu Ile Val Tyr Trp Glu Met
Glu 50 55 60 Asp Lys Asn Ile Ile Gln Phe Val His Gly Glu Glu Asp
Leu Lys Val 65 70 75 80 Gln His Ser Ser Tyr Arg Gln Arg Ala Arg Leu
Leu Lys Asp Gln Leu 85 90 95 Ser Leu Gly Asn Ala Ala Leu Gln Ile
Thr Asp Val Lys Leu Gln Asp 100 105 110 Ala Gly Val Tyr Arg Cys Met
Ile Ser Tyr Gly Gly Ala Asp Tyr Lys 115 120 125 Arg Ile Thr Val Lys
Val Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg 130 135 140 Ile Leu Val
Val Asp Pro Val Thr Ser Glu His Glu Leu Thr Cys Gln 145 150 155 160
Ala Glu Gly Tyr Pro Lys Ala Glu Val Ile Trp Thr Ser Ser Asp His 165
170 175 Gln Val Leu Ser Gly Lys Thr Thr Thr Thr Asn Ser Lys Arg Glu
Glu 180 185 190 Lys Leu Phe Asn Val Thr Ser Thr Leu Arg Ile Asn Thr
Thr Thr Asn 195 200 205 Glu Ile Phe Tyr Cys Thr Phe Arg Arg Leu Asp
Pro Glu Glu Asn His 210 215 220 Thr Ala Glu Leu Val Ile Pro Glu Leu
Pro Leu Ala His Pro Pro Asn 225 230 235 240 Glu Arg Thr Arg Gly Asp
Pro Glu Glu Pro Lys Ser Cys Asp Lys Thr 245 250 255 His Thr Cys Pro
Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser 260 265 270 Val Phe
Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 275 280 285
Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 290
295 300 Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
Ala 305 310 315 320 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr Arg Val Val 325 330 335 Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly Lys Glu Tyr 340 345 350 Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile Glu Lys Thr 355 360 365 Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 370 375 380 Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys 385 390 395 400 Leu
Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 405 410
415 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp
420 425 430 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
Lys Ser 435 440 445 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Met His Glu Ala 450 455 460 Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 465 470 475 480 6 3197 DNA Homo sapiens 6
attcggctcg agggcgactg agccaggctg ggccgcgtcc ctgagtccca gagtcggcgc
60 ggcgcggcag gggcagcctt ccaccacggg gagcccagct gtcagccgcc
tcacaggaag 120 atgctgcgtc ggcggggcag ccctggcatg ggtgtgcatg
tgggtgcagc cctgggagca 180 ctgtggttct gcctcacagg agccctggag
gtccaggtcc ctgaagaccc agtggtggca 240 ctggtgggca ccgatgccac
cctgtgctgc tccttctccc ctgagcctgg cttcagcctg 300 gcacagctca
acctcatctg gcagctgaca gataccaaac agctggtgca cagctttgct 360
gagggccagg accagggcag cgcctatgcc aaccgcacgg ccctcttccc ggacctgctg
420 gcacagggca acgcatccct gaggctgcag cgcgtgcgtg tggcggacga
gggcagcttc 480 acctgcttcg tgagcatccg ggatttcggc agcgctgccg
tcagcctgca ggtggccgct 540 ccctactcga agcccagcat gaccctggag
cccaacaagg acctgcggcc aggggacacg 600 gtgaccatca cgtgctccag
ctaccagggc taccctgagg ctgaggtgtt ctggcaggat 660 gggcagggtg
tgcccctgac tggcaacgtg accacgtcgc agatggccaa cgagcagggc 720
ttgtttgatg tgcacagcat cctgcgggtg gtgctgggtg caaatggcac ctacagctgc
780 ctggtgcgca accccgtgct gcagcaggat gcgcacagct ctgtcaccat
cacaccccag 840 agaagcccca caggagccgt ggaggtccag gtccctgagg
acccggtggt ggccctagtg 900 ggcaccgatg ccaccctgcg ctgctccttc
tcccccgagc ctggcttcag cctggcacag 960 ctcaacctca tctggcagct
gacagacacc aaacagctgg tgcacagttt caccgaaggc 1020 cgggaccagg
gcagcgccta tgccaaccgc acggccctct tcccggacct gctggcacaa 1080
ggcaatgcat ccctgaggct gcagcgcgtg cgtgtggcgg acgagggcag cttcacctgc
1140 ttcgtgagca tccgggattt cggcagcgct gccgtcagcc tgcaggtggc
cgctccctac 1200 tcgaagccca gcatgaccct ggagcccaac aaggacctgc
ggccagggga cacggtgacc 1260 atcacgtgct ccagctaccg gggctaccct
gaggctgagg tgttctggca ggatgggcag 1320 ggtgtgcccc tgactggcaa
cgtgaccacg tcgcagatgg ccaacgagca gggcttgttt 1380 gatgtgcaca
gcgtcctgcg ggtggtgctg ggtgcgaatg gcacctacag ctgcctggtg 1440
cgcaaccccg tgctgcagca ggatgcgcac ggctctgtca ccatcacagg gcagcctatg
1500 acattccccc cagaggccct gtgggtgacc gtggggctgt ctgtctgtct
cattgcactg 1560 ctggtggccc tggctttcgt gtgctggaga aagatcaaac
agagctgtga ggaggagaat 1620 gcaggagctg aggaccagga tggggaggga
gaaggctcca agacagccct gcagcctctg 1680 aaacactctg acagcaaaga
agatgatgga caagaaatag cctgaccatg aggaccaggg 1740 agctgctacc
cctccctaca gctcctaccc tctggctgca atggggctgc actgtgagcc 1800
ctgcccccaa cagatgcatc ctgctctgac aggtgggctc cttctccaaa ggatgcgata
1860 cacagaccac tgtgcagcct tatttctcca atggacatga ttcccaagtc
atcctgctgc 1920 cttttttctt atagacacaa tgaacagacc acccacaacc
ttagttctct aagtcatcct 1980 gcctgctgcc ttatttcaca gtacatacat
ttcttaggga cacagtacac tgaccacatc 2040 accaccctct tcttccagtg
ctgcgtggac catctggctg ccttttttct ccaaaagatg 2100 caatattcag
actgactgac cccctgcctt atttcaccaa agacacgatg catagtcacc 2160
ccggccttgt ttctccaatg gccgtgatac actagtgatc atgttcagcc ctgcttccac
2220 ctgcatagaa tcttttcttc tcagacaggg acagtgcggc ctcaacatct
cctggagtct 2280 agaagctgtt tcctttcccc tccttcctcc tcttgctcta
gccttaatac tggccttttc 2340 cctccctgcc ccaagtgaag acagggcact
ctgcgcccac cacatgcaca gctgtgcatg 2400 gagacctgca ggtgcacgtg
ctggaacacg tgtggttccc ccctggccca gcctcctctg 2460 cagtgcccct
ctcccctgcc catcctcccc acggaagcat gtgctggtca cactggttct 2520
ccaggggtct gtgatggggc ccctgggggt cagcttctgt ccctctgcct tctcacctct
2580 ttgttccttt cttttcatgt atccattcag ttgatgttta ttgagcaact
acagatgtca 2640 gcactgtgtt aggtgctggg ggccctgcgt gggaagataa
agttcctccc tcaaggactc 2700 cccatccagc tgggagacag acaactaact
acactgcacc ctgcggtttg cagggggctc 2760 ctgcctggct ccctgctcca
cacctcctct gtggctcaag gcttcctgga tacctcaccc 2820 ccatcccacc
cataattctt acccagagca tggggttggg gcggaaacct ggagagaggg 2880
acatagcccc tcgccacggc tagagaatct ggtggtgtcc aaaatgtctg tccaggtgtg
2940 ggcaggtggg caggcaccaa ggccctctgg acctttcata gcagcagaaa
aggcagagcc 3000 tggggcaggg cagggccagg aatgctttgg ggacaccgag
gggactgccc cccaccccca 3060 ccatggtgct attctggggc tggggcagtc
ttttcctggc ttgcctctgg ccagctcctg 3120 gcctctggta gagtgagact
tcagacgttc tgatgccttc cggatgtcat ctctccctgc 3180 cccaggaatg gaagatg
3197 7 534 PRT Homo sapiens 7 Met Leu Arg Arg Arg Gly Ser Pro Gly
Met Gly Val His Val Gly Ala 1 5
10 15 Ala Leu Gly Ala Leu Trp Phe Cys Leu Thr Gly Ala Leu Glu Val
Gln 20 25 30 Val Pro Glu Asp Pro Val Val Ala Leu Val Gly Thr Asp
Ala Thr Leu 35 40 45 Cys Cys Ser Phe Ser Pro Glu Pro Gly Phe Ser
Leu Ala Gln Leu Asn 50 55 60 Leu Ile Trp Gln Leu Thr Asp Thr Lys
Gln Leu Val His Ser Phe Ala 65 70 75 80 Glu Gly Gln Asp Gln Gly Ser
Ala Tyr Ala Asn Arg Thr Ala Leu Phe 85 90 95 Pro Asp Leu Leu Ala
Gln Gly Asn Ala Ser Leu Arg Leu Gln Arg Val 100 105 110 Arg Val Ala
Asp Glu Gly Ser Phe Thr Cys Phe Val Ser Ile Arg Asp 115 120 125 Phe
Gly Ser Ala Ala Val Ser Leu Gln Val Ala Ala Pro Tyr Ser Lys 130 135
140 Pro Ser Met Thr Leu Glu Pro Asn Lys Asp Leu Arg Pro Gly Asp Thr
145 150 155 160 Val Thr Ile Thr Cys Ser Ser Tyr Gln Gly Tyr Pro Glu
Ala Glu Val 165 170 175 Phe Trp Gln Asp Gly Gln Gly Val Pro Leu Thr
Gly Asn Val Thr Thr 180 185 190 Ser Gln Met Ala Asn Glu Gln Gly Leu
Phe Asp Val His Ser Ile Leu 195 200 205 Arg Val Val Leu Gly Ala Asn
Gly Thr Tyr Ser Cys Leu Val Arg Asn 210 215 220 Pro Val Leu Gln Gln
Asp Ala His Ser Ser Val Thr Ile Thr Pro Gln 225 230 235 240 Arg Ser
Pro Thr Gly Ala Val Glu Val Gln Val Pro Glu Asp Pro Val 245 250 255
Val Ala Leu Val Gly Thr Asp Ala Thr Leu Arg Cys Ser Phe Ser Pro 260
265 270 Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn Leu Ile Trp Gln Leu
Thr 275 280 285 Asp Thr Lys Gln Leu Val His Ser Phe Thr Glu Gly Arg
Asp Gln Gly 290 295 300 Ser Ala Tyr Ala Asn Arg Thr Ala Leu Phe Pro
Asp Leu Leu Ala Gln 305 310 315 320 Gly Asn Ala Ser Leu Arg Leu Gln
Arg Val Arg Val Ala Asp Glu Gly 325 330 335 Ser Phe Thr Cys Phe Val
Ser Ile Arg Asp Phe Gly Ser Ala Ala Val 340 345 350 Ser Leu Gln Val
Ala Ala Pro Tyr Ser Lys Pro Ser Met Thr Leu Glu 355 360 365 Pro Asn
Lys Asp Leu Arg Pro Gly Asp Thr Val Thr Ile Thr Cys Ser 370 375 380
Ser Tyr Arg Gly Tyr Pro Glu Ala Glu Val Phe Trp Gln Asp Gly Gln 385
390 395 400 Gly Val Pro Leu Thr Gly Asn Val Thr Thr Ser Gln Met Ala
Asn Glu 405 410 415 Gln Gly Leu Phe Asp Val His Ser Val Leu Arg Val
Val Leu Gly Ala 420 425 430 Asn Gly Thr Tyr Ser Cys Leu Val Arg Asn
Pro Val Leu Gln Gln Asp 435 440 445 Ala His Gly Ser Val Thr Ile Thr
Gly Gln Pro Met Thr Phe Pro Pro 450 455 460 Glu Ala Leu Trp Val Thr
Val Gly Leu Ser Val Cys Leu Ile Ala Leu 465 470 475 480 Leu Val Ala
Leu Ala Phe Val Cys Trp Arg Lys Ile Lys Gln Ser Cys 485 490 495 Glu
Glu Glu Asn Ala Gly Ala Glu Asp Gln Asp Gly Glu Gly Glu Gly 500 505
510 Ser Lys Thr Ala Leu Gln Pro Leu Lys His Ser Asp Ser Lys Glu Asp
515 520 525 Asp Gly Gln Glu Ile Ala 530 8 2097 DNA Artificial
Sequence Description of Artificial Sequence Synthetic fusion
construct 8 atgctgcgtc ggcggggcag ccctggcatg ggtgtgcatg tgggtgcagc
cctgggagca 60 ctgtggttct gcctcacagg agccctggag gtccaggtcc
ctgaagaccc agtggtggca 120 ctggtgggca ccgatgccac cctgtgctgc
tccttctccc ctgagcctgg cttcagcctg 180 gcacagctca acctcatctg
gcagctgaca gataccaaac agctggtgca cagctttgct 240 gagggccagg
accagggcag cgcctatgcc aaccgcacgg ccctcttccc ggacctgctg 300
gcacagggca acgcatccct gaggctgcag cgcgtgcgtg tggcggacga gggcagcttc
360 acctgcttcg tgagcatccg ggatttcggc agcgctgccg tcagcctgca
ggtggccgct 420 ccctactcga agcccagcat gaccctggag cccaacaagg
acctgcggcc aggggacacg 480 gtgaccatca cgtgctccag ctaccagggc
taccctgagg ctgaggtgtt ctggcaggat 540 gggcagggtg tgcccctgac
tggcaacgtg accacgtcgc agatggccaa cgagcagggc 600 ttgtttgatg
tgcacagcat cctgcgggtg gtgctgggtg caaatggcac ctacagctgc 660
ctggtgcgca accccgtgct gcagcaggat gcgcacagct ctgtcaccat cacaccccag
720 agaagcccca caggagccgt ggaggtccag gtccctgagg acccggtggt
ggccctagtg 780 ggcaccgatg ccaccctgcg ctgctccttc tcccccgagc
ctggcttcag cctggcacag 840 ctcaacctca tctggcagct gacagacacc
aaacagctgg tgcacagttt caccgaaggc 900 cgggaccagg gcagcgccta
tgccaaccgc acggccctct tcccggacct gctggcacaa 960 ggcaatgcat
ccctgaggct gcagcgcgtg cgtgtggcgg acgagggcag cttcacctgc 1020
ttcgtgagca tccgggattt cggcagcgct gccgtcagcc tgcaggtggc cgctccctac
1080 tcgaagccca gcatgaccct ggagcccaac aaggacctgc ggccagggga
cacggtgacc 1140 atcacgtgct ccagctaccg gggctaccct gaggctgagg
tgttctggca ggatgggcag 1200 ggtgtgcccc tgactggcaa cgtgaccacg
tcgcagatgg ccaacgagca gggcttgttt 1260 gatgtgcaca gcgtcctgcg
ggtggtgctg ggtgcgaatg gcacctacag ctgcctggtg 1320 cgcaaccccg
tgctgcagca ggatgcgcac ggctctgtca ccatcacagg gcagcctatg 1380
acattccccc cagaattcga gcccaaatct tgtgacaaaa ctcacacatg cccaccgtgc
1440 ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa
acccaaggac 1500 accctcatga tctcccggac ccctgaggtc acatgcgtgg
tggtggacgt gagccacgaa 1560 gaccctgagg tcaagttcaa ctggtacgtg
gacggcgtgg aggtgcataa tgccaagaca 1620 aagccgcggg aggagcagta
caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 1680 caccaggact
ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 1740
gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac
1800 accctgcccc catcccggga tgagctgacc aagaaccagg tcagcctgac
ctgcctggtc 1860 aaaggcttct atcccagcga catcgccgtg gagtgggaga
gcaatgggca gccggagaac 1920 aactacaaga ccacgcctcc cgtgctggac
tccgacggct ccttcttcct ctacagcaag 1980 ctcaccgtgg acaagagcag
gtggcagcag gggaacgtct tctcatgctc cgtgatgcat 2040 gaggctctgc
acaaccacta cacgcagaag agcctctccc tgtctccggg taaatga 2097 9 698 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
fusion construct 9 Met Leu Arg Arg Arg Gly Ser Pro Gly Met Gly Val
His Val Gly Ala 1 5 10 15 Ala Leu Gly Ala Leu Trp Phe Cys Leu Thr
Gly Ala Leu Glu Val Gln 20 25 30 Val Pro Glu Asp Pro Val Val Ala
Leu Val Gly Thr Asp Ala Thr Leu 35 40 45 Cys Cys Ser Phe Ser Pro
Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn 50 55 60 Leu Ile Trp Gln
Leu Thr Asp Thr Lys Gln Leu Val His Ser Phe Ala 65 70 75 80 Glu Gly
Gln Asp Gln Gly Ser Ala Tyr Ala Asn Arg Thr Ala Leu Phe 85 90 95
Pro Asp Leu Leu Ala Gln Gly Asn Ala Ser Leu Arg Leu Gln Arg Val 100
105 110 Arg Val Ala Asp Glu Gly Ser Phe Thr Cys Phe Val Ser Ile Arg
Asp 115 120 125 Phe Gly Ser Ala Ala Val Ser Leu Gln Val Ala Ala Pro
Tyr Ser Lys 130 135 140 Pro Ser Met Thr Leu Glu Pro Asn Lys Asp Leu
Arg Pro Gly Asp Thr 145 150 155 160 Val Thr Ile Thr Cys Ser Ser Tyr
Gln Gly Tyr Pro Glu Ala Glu Val 165 170 175 Phe Trp Gln Asp Gly Gln
Gly Val Pro Leu Thr Gly Asn Val Thr Thr 180 185 190 Ser Gln Met Ala
Asn Glu Gln Gly Leu Phe Asp Val His Ser Ile Leu 195 200 205 Arg Val
Val Leu Gly Ala Asn Gly Thr Tyr Ser Cys Leu Val Arg Asn 210 215 220
Pro Val Leu Gln Gln Asp Ala His Ser Ser Val Thr Ile Thr Pro Gln 225
230 235 240 Arg Ser Pro Thr Gly Ala Val Glu Val Gln Val Pro Glu Asp
Pro Val 245 250 255 Val Ala Leu Val Gly Thr Asp Ala Thr Leu Arg Cys
Ser Phe Ser Pro 260 265 270 Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn
Leu Ile Trp Gln Leu Thr 275 280 285 Asp Thr Lys Gln Leu Val His Ser
Phe Thr Glu Gly Arg Asp Gln Gly 290 295 300 Ser Ala Tyr Ala Asn Arg
Thr Ala Leu Phe Pro Asp Leu Leu Ala Gln 305 310 315 320 Gly Asn Ala
Ser Leu Arg Leu Gln Arg Val Arg Val Ala Asp Glu Gly 325 330 335 Ser
Phe Thr Cys Phe Val Ser Ile Arg Asp Phe Gly Ser Ala Ala Val 340 345
350 Ser Leu Gln Val Ala Ala Pro Tyr Ser Lys Pro Ser Met Thr Leu Glu
355 360 365 Pro Asn Lys Asp Leu Arg Pro Gly Asp Thr Val Thr Ile Thr
Cys Ser 370 375 380 Ser Tyr Arg Gly Tyr Pro Glu Ala Glu Val Phe Trp
Gln Asp Gly Gln 385 390 395 400 Gly Val Pro Leu Thr Gly Asn Val Thr
Thr Ser Gln Met Ala Asn Glu 405 410 415 Gln Gly Leu Phe Asp Val His
Ser Val Leu Arg Val Val Leu Gly Ala 420 425 430 Asn Gly Thr Tyr Ser
Cys Leu Val Arg Asn Pro Val Leu Gln Gln Asp 435 440 445 Ala His Gly
Ser Val Thr Ile Thr Gly Gln Pro Met Thr Phe Pro Pro 450 455 460 Glu
Phe Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys 465 470
475 480 Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro
Pro 485 490 495 Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
Val Thr Cys 500 505 510 Val Val Val Asp Val Ser His Glu Asp Pro Glu
Val Lys Phe Asn Trp 515 520 525 Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr Lys Pro Arg Glu 530 535 540 Glu Gln Tyr Asn Ser Thr Tyr
Arg Val Val Ser Val Leu Thr Val Leu 545 550 555 560 His Gln Asp Trp
Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 565 570 575 Lys Ala
Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 580 585 590
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu 595
600 605 Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe
Tyr 610 615 620 Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
Pro Glu Asn 625 630 635 640 Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp
Ser Asp Gly Ser Phe Phe 645 650 655 Leu Tyr Ser Lys Leu Thr Val Asp
Lys Ser Arg Trp Gln Gln Gly Asn 660 665 670 Val Phe Ser Cys Ser Val
Met His Glu Ala Leu His Asn His Tyr Thr 675 680 685 Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 690 695 10 951 DNA Homo sapiens 10
atgctgcgtc ggcggggcag ccctggcatg ggtgtgcatg tgggtgcagc cctgggagca
60 ctgtggttct gcctcacagg agccctggag gtccaggtcc ctgaagaccc
agtggtggca 120 ctggtgggca ccgatgccac cctgcgctgc tccttctccc
ccgagcctgg cttcagcctg 180 gcacagctca acctcatctg gcagctgaca
gacaccaaac agctggtgca cagtttcacc 240 gaaggccggg accagggcag
cgcctatgcc aaccgcacgg ccctcttccc ggacctgctg 300 gcacaaggca
atgcatccct gaggctgcag cgcgtgcgtg tggcggacga gggcagcttc 360
acctgcttcg tgagcatccg ggatttcggc agcgctgccg tcagcctgca ggtggccgct
420 ccctactcga agcccagcat gaccctggag cccaacaagg acctgcggcc
aggggacacg 480 gtgaccatca cgtgctccag ctaccggggc taccctgagg
ctgaggtgtt ctggcaggat 540 gggcagggtg tgcccctgac tggcaacgtg
accacgtcgc agatggccaa cgagcagggc 600 ttgtttgatg tgcacagcgt
cctgcgggtg gtgctgggtg cgaatggcac ctacagctgc 660 ctggtgcgca
accccgtgct gcagcaggat gcgcacggct ctgtcaccat cacagggcag 720
cctatgacat tccccccaga ggccctgtgg gtgaccgtgg ggctgtctgt ctgtctcatt
780 gcactgctgg tggccctggc tttcgtgtgc tggagaaaga tcaaacagag
ctgtgaggag 840 gagaatgcag gagctgagga ccaggatggg gagggagaag
gctccaagac agccctgcag 900 cctctgaaac actctgacag caaagaagat
gatggacaag aaatagcctg a 951 11 316 PRT Homo sapiens 11 Met Leu Arg
Arg Arg Gly Ser Pro Gly Met Gly Val His Val Gly Ala 1 5 10 15 Ala
Leu Gly Ala Leu Trp Phe Cys Leu Thr Gly Ala Leu Glu Val Gln 20 25
30 Val Pro Glu Asp Pro Val Val Ala Leu Val Gly Thr Asp Ala Thr Leu
35 40 45 Arg Cys Ser Phe Ser Pro Glu Pro Gly Phe Ser Leu Ala Gln
Leu Asn 50 55 60 Leu Ile Trp Gln Leu Thr Asp Thr Lys Gln Leu Val
His Ser Phe Thr 65 70 75 80 Glu Gly Arg Asp Gln Gly Ser Ala Tyr Ala
Asn Arg Thr Ala Leu Phe 85 90 95 Pro Asp Leu Leu Ala Gln Gly Asn
Ala Ser Leu Arg Leu Gln Arg Val 100 105 110 Arg Val Ala Asp Glu Gly
Ser Phe Thr Cys Phe Val Ser Ile Arg Asp 115 120 125 Phe Gly Ser Ala
Ala Val Ser Leu Gln Val Ala Ala Pro Tyr Ser Lys 130 135 140 Pro Ser
Met Thr Leu Glu Pro Asn Lys Asp Leu Arg Pro Gly Asp Thr 145 150 155
160 Val Thr Ile Thr Cys Ser Ser Tyr Arg Gly Tyr Pro Glu Ala Glu Val
165 170 175 Phe Trp Gln Asp Gly Gln Gly Val Pro Leu Thr Gly Asn Val
Thr Thr 180 185 190 Ser Gln Met Ala Asn Glu Gln Gly Leu Phe Asp Val
His Ser Val Leu 195 200 205 Arg Val Val Leu Gly Ala Asn Gly Thr Tyr
Ser Cys Leu Val Arg Asn 210 215 220 Pro Val Leu Gln Gln Asp Ala His
Gly Ser Val Thr Ile Thr Gly Gln 225 230 235 240 Pro Met Thr Phe Pro
Pro Glu Ala Leu Trp Val Thr Val Gly Leu Ser 245 250 255 Val Cys Leu
Ile Ala Leu Leu Val Ala Leu Ala Phe Val Cys Trp Arg 260 265 270 Lys
Ile Lys Gln Ser Cys Glu Glu Glu Asn Ala Gly Ala Glu Asp Gln 275 280
285 Asp Gly Glu Gly Glu Gly Ser Lys Thr Ala Leu Gln Pro Leu Lys His
290 295 300 Ser Asp Ser Lys Glu Asp Asp Gly Gln Glu Ile Ala 305 310
315 12 951 DNA Homo sapiens 12 atgctgcgtc ggcggggcag ccctggcatg
ggtgtgcatg tgggtgcagc cctgggagca 60 ctgtggttct gcctcacagg
agccctggag gtccaggtcc ctgaagaccc agtggtggca 120 ctggtgggca
ccgatgccac cctgtgctgc tccttctccc ctgagcctgg cttcagcctg 180
gcacagctca acctcatctg gcagctgaca gataccaaac agctggtgca cagctttgct
240 gagggccagg accagggcag cgcctatgcc aaccgcacgg ccctcttccc
ggacctgctg 300 gcacaaggca atgcatccct gaggctgcag cgcgtgcgtg
tggcggacga gggcagcttc 360 acctgcttcg tgagcatccg ggatttcggc
agcgctgccg tcagcctgca ggtggccgct 420 ccctactcga agcccagcat
gaccctggag cccaacaagg acctgcggcc aggggacacg 480 gtgaccatca
cgtgctccag ctaccggggc taccctgagg ctgaggtgtt ctggcaggat 540
gggcagggtg tgcccctgac tggcaacgtg accacgtcgc agatggccaa cgagcagggc
600 ttgtttgatg tgcacagcgt cctgcgggtg gtgctgggtg cgaatggcac
ctacagctgc 660 ctggtgcgca accccgtgct gcagcaggat gcgcacggct
ctgtcaccat cacagggcag 720 cctatgacat tccccccaga ggccctgtgg
gtgaccgtgg ggctgtctgt ctgtctcatt 780 gcactgctgg tggccctggc
tttcgtgtgc tggagaaaga tcaaacagag ctgtgaggag 840 gagaatgcag
gagctgagga ccaggatggg gagggagaaa gctccaagac agccctgcag 900
cctctgaaac actctgacag caaagaagat gatggacaag aaatagcctg a 951 13 316
PRT Homo sapiens 13 Met Leu Arg Arg Arg Gly Ser Pro Gly Met Gly Val
His Val Gly Ala 1 5 10 15 Ala Leu Gly Ala Leu Trp Phe Cys Leu Thr
Gly Ala Leu Glu Val Gln 20 25 30 Val Pro Glu Asp Pro Val Val Ala
Leu Val Gly Thr Asp Ala Thr Leu 35 40 45 Cys Cys Ser Phe Ser Pro
Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn 50 55 60 Leu Ile Trp Gln
Leu Thr Asp Thr Lys Gln Leu Val His Ser Phe Ala 65 70 75 80 Glu Gly
Gln Asp Gln Gly Ser Ala Tyr Ala Asn Arg Thr Ala Leu Phe 85 90 95
Pro Asp Leu Leu Ala Gln Gly Asn Ala Ser Leu Arg Leu Gln Arg Val 100
105 110 Arg Val Ala Asp Glu Gly Ser Phe Thr Cys Phe Val Ser Ile Arg
Asp 115 120 125 Phe Gly Ser Ala Ala Val Ser Leu Gln Val Ala Ala Pro
Tyr Ser Lys 130 135 140 Pro Ser Met Thr Leu Glu Pro Asn Lys Asp Leu
Arg Pro Gly Asp Thr 145 150 155 160 Val Thr Ile Thr Cys Ser Ser Tyr
Arg Gly Tyr Pro Glu Ala Glu Val 165 170 175 Phe Trp Gln Asp Gly Gln
Gly Val Pro Leu Thr Gly Asn Val Thr Thr 180 185 190 Ser Gln Met Ala
Asn Glu Gln Gly Leu Phe Asp Val His Ser Val Leu 195 200 205 Arg Val
Val Leu Gly Ala Asn Gly Thr Tyr Ser Cys Leu Val Arg Asn 210
215 220 Pro Val Leu Gln Gln Asp Ala His Gly Ser Val Thr Ile Thr Gly
Gln 225 230 235 240 Pro Met Thr Phe Pro Pro Glu Ala Leu Trp Val Thr
Val Gly Leu Ser 245 250 255 Val Cys Leu Ile Ala Leu Leu Val Ala Leu
Ala Phe Val Cys Trp Arg 260 265 270 Lys Ile Lys Gln Ser Cys Glu Glu
Glu Asn Ala Gly Ala Glu Asp Gln 275 280 285 Asp Gly Glu Gly Glu Ser
Ser Lys Thr Ala Leu Gln Pro Leu Lys His 290 295 300 Ser Asp Ser Lys
Glu Asp Asp Gly Gln Glu Ile Ala 305 310 315 14 2435 DNA Homo
sapiens 14 gctttcgtca gttcctcaga actagttctg gtttgactca ctctcatgtt
acggcaaacc 60 ttaagctgaa tgaacaactt ttcttctctt gaatatatct
taacgccaaa ttttgagtgc 120 ttttttgtta cccatcctca tatgtcccag
ctggaaagaa tcctgggttg gagctactgc 180 atgttgattg ttttgttttt
ccttttggct gttcattttg gtggctacta taaggaaatc 240 taacacaaac
agcaactgtt ttttgttgtt tacttttgca tctttacttg tggagctgtg 300
gcaagtcctc atatcaaata cagaacatga tcttcctcct gctaatgttg agcctggaat
360 tgcagcttca ccagatagca gctttattca cagtgacagt ccctaaggaa
ctgtacataa 420 tagagcatgg cagcaatgtg accctggaat gcaactttga
cactggaagt catgtgaacc 480 ttggagcaat aacagccagt ttgcaaaagg
tggaaaatga tacatcccca caccgtgaaa 540 gagccacttt gctggaggag
cagctgcccc tagggaaggc ctcgttccac atacctcaag 600 tccaagtgag
ggacgaagga cagtaccaat gcataatcat ctatggggtc gcctgggact 660
acaagtacct gactctgaaa gtcaaagctt cctacaggaa aataaacact cacatcctaa
720 aggttccaga aacagatgag gtagagctca cctgccaggc tacaggttat
cctctggcag 780 aagtatcctg gccaaacgtc agcgttcctg ccaacaccag
ccactccagg acccctgaag 840 gcctctacca ggtcaccagt gttctgcgcc
taaagccacc ccctggcaga aacttcagct 900 gtgtgttctg gaatactcac
gtgagggaac ttactttggc cagcattgac cttcaaagtc 960 agatggaacc
caggacccat ccaacttggc tgcttcacat tttcatcccc tcctgcatca 1020
ttgctttcat tttcatagcc acagtgatag ccctaagaaa acaactctgt caaaagctgt
1080 attcttcaaa agacacaaca aaaagacctg tcaccacaac aaagagggaa
gtgaacagtg 1140 ctatctgaac ctgtggtctt gggagccagg gtgacctgat
atgacatcta aagaagcttc 1200 tggactctga acaagaattc ggtggcctgc
agagcttgcc atttgcactt ttcaaatgcc 1260 tttggatgac ccagcacttt
aatctgaaac ctgcaacaag actagccaac acctggccat 1320 gaaacttgcc
ccttcactga tctggactca cctctggagc ctatggcttt aagcaagcac 1380
tactgcactt tacagaatta ccccactgga tcctggaccc acagaattcc ttcaggatcc
1440 ttcttgctgc cagactgaaa gcaaaaggaa ttatttcccc tcaagttttc
taagtgattt 1500 ccaaaagcag aggtgtgtgg aaatttccag taacagaaac
agatgggttg ccaatagagt 1560 tattttttat ctatagcttc ctctgggtac
tagaagaggc tattgagact atgagctcac 1620 agacagggct tcgcacaaac
tcaaatcata attgacatgt tttatggatt actggaatct 1680 tgatagcata
atgaagttgt tctaattaac agagagcatt taaatataca ctaagtgcac 1740
aaattgtgga gtaaagtcat caagctctgt ttttgaggtc taagtcacaa agcatttgtt
1800 ttaacctgta atggcaccat gtttaatggt ggtttttttt ttgaactaca
tctttccttt 1860 aaaaattatt ggtttctttt tatttgtttt taccttagaa
atcaattata tacagtcaaa 1920 aatatttgat atgctcatac gttgtatctg
cagcaatttc agataagtag ctaaaatggc 1980 caaagcccca aactaagcct
ccttttctgg ccctcaatat gactttaaat ttgacttttc 2040 agtgcctcag
tttgcacatc tgtaatacag caatgctaag tagtcaaggc ctttgataat 2100
tggcactatg gaaatcctgc aagatcccac tacatatgtg tggagcagaa gggtaactcg
2160 gctacagtaa cagcttaatt ttgttaaatt tgttctttat actggagcca
tgaagctcag 2220 agcattagct gacccttgaa ctattcaaat gggcacatta
gctagtataa cagacttaca 2280 taggtgggcc taaagcaagc tccttaactg
agcaaaattt ggggcttatg agaatgaaag 2340 ggtgtgaaat tgactaacag
acaaatcata catctcagtt tctcaattct catgtaaatc 2400 agagaatgcc
tttagaaatt accaaagtgt tccat 2435 15 273 PRT Homo sapiens 15 Met Ile
Phe Leu Leu Leu Met Leu Ser Leu Glu Leu Gln Leu His Gln 1 5 10 15
Ile Ala Ala Leu Phe Thr Val Thr Val Pro Lys Glu Leu Tyr Ile Ile 20
25 30 Glu His Gly Ser Asn Val Thr Leu Glu Cys Asn Phe Asp Thr Gly
Ser 35 40 45 His Val Asn Leu Gly Ala Ile Thr Ala Ser Leu Gln Lys
Val Glu Asn 50 55 60 Asp Thr Ser Pro His Arg Glu Arg Ala Thr Leu
Leu Glu Glu Gln Leu 65 70 75 80 Pro Leu Gly Lys Ala Ser Phe His Ile
Pro Gln Val Gln Val Arg Asp 85 90 95 Glu Gly Gln Tyr Gln Cys Ile
Ile Ile Tyr Gly Val Ala Trp Asp Tyr 100 105 110 Lys Tyr Leu Thr Leu
Lys Val Lys Ala Ser Tyr Arg Lys Ile Asn Thr 115 120 125 His Ile Leu
Lys Val Pro Glu Thr Asp Glu Val Glu Leu Thr Cys Gln 130 135 140 Ala
Thr Gly Tyr Pro Leu Ala Glu Val Ser Trp Pro Asn Val Ser Val 145 150
155 160 Pro Ala Asn Thr Ser His Ser Arg Thr Pro Glu Gly Leu Tyr Gln
Val 165 170 175 Thr Ser Val Leu Arg Leu Lys Pro Pro Pro Gly Arg Asn
Phe Ser Cys 180 185 190 Val Phe Trp Asn Thr His Val Arg Glu Leu Thr
Leu Ala Ser Ile Asp 195 200 205 Leu Gln Ser Gln Met Glu Pro Arg Thr
His Pro Thr Trp Leu Leu His 210 215 220 Ile Phe Ile Pro Ser Cys Ile
Ile Ala Phe Ile Phe Ile Ala Thr Val 225 230 235 240 Ile Ala Leu Arg
Lys Gln Leu Cys Gln Lys Leu Tyr Ser Ser Lys Asp 245 250 255 Thr Thr
Lys Arg Pro Val Thr Thr Thr Lys Arg Glu Val Asn Ser Ala 260 265 270
Ile 16 1356 DNA Artificial Sequence Description of Artificial
Sequence Synthetic fusion construct 16 atgatcttcc tcctgctaat
gttgagcctg gaattgcagc ttcaccagat agcagcttta 60 ttcacagtga
cagtccctaa ggaactgtac ataatagagc atggcagcaa tgtgaccctg 120
gaatgcaact ttgacactgg aagtcatgtg aaccttggag caataacagc cagtttgcaa
180 aaggtggaaa atgatacatc cccacaccgt gaaagagcca ctttgctgga
ggagcagctg 240 cccctaggga aggcctcgtt ccacatacct caagtccaag
tgagggacga aggacagtac 300 caatgcataa tcatctatgg ggtcgcctgg
gactacaagt acctgactct gaaagtcaaa 360 gcttcctaca ggaaaataaa
cactcacatc ctaaaggttc cagaaacaga tgaggtagag 420 ctcacctgcc
aggctacagg ttatcctctg gcagaagtat cctggccaaa cgtcagcgtt 480
cctgccaaca ccagccactc caggacccct gaaggcctct accaggtcac cagtgttctg
540 cgcctaaagc caccccctgg cagaaacttc agctgtgtgg tctggaatac
tcacgtgagg 600 gaacttactt tggccagcat tgaccttcaa agtcagatgg
aacccaggac cgaattcgag 660 cccaaatctt gtgacaaaac tcacacatgc
ccaccgtgcc cagcacctga actcctgggg 720 ggaccgtcag tcttcctctt
ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 780 cctgaggtca
catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 840
tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac
900 aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg
gctgaatggc 960 aaggagtaca agtgcaaggt ctccaacaaa gccctcccag
cccccatcga gaaaaccatc 1020 tccaaagcca aagggcagcc ccgagaacca
caggtgtaca ccctgccccc atcccgggat 1080 gagctgacca agaaccaggt
cagcctgacc tgcctggtca aaggcttcta tcccagcgac 1140 atcgccgtgg
agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 1200
gtgctggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg
1260 tggcagcagg ggaacgtctt ctcatgctcc gtgatgcatg aggctctgca
caaccactac 1320 acgcagaaga gcctctccct gtctccgggt aaatga 1356 17 451
PRT Artificial Sequence Description of Artificial Sequence
Synthetic fusion construct 17 Met Ile Phe Leu Leu Leu Met Leu Ser
Leu Glu Leu Gln Leu His Gln 1 5 10 15 Ile Ala Ala Leu Phe Thr Val
Thr Val Pro Lys Glu Leu Tyr Ile Ile 20 25 30 Glu His Gly Ser Asn
Val Thr Leu Glu Cys Asn Phe Asp Thr Gly Ser 35 40 45 His Val Asn
Leu Gly Ala Ile Thr Ala Ser Leu Gln Lys Val Glu Asn 50 55 60 Asp
Thr Ser Pro His Arg Glu Arg Ala Thr Leu Leu Glu Glu Gln Leu 65 70
75 80 Pro Leu Gly Lys Ala Ser Phe His Ile Pro Gln Val Gln Val Arg
Asp 85 90 95 Glu Gly Gln Tyr Gln Cys Ile Ile Ile Tyr Gly Val Ala
Trp Asp Tyr 100 105 110 Lys Tyr Leu Thr Leu Lys Val Lys Ala Ser Tyr
Arg Lys Ile Asn Thr 115 120 125 His Ile Leu Lys Val Pro Glu Thr Asp
Glu Val Glu Leu Thr Cys Gln 130 135 140 Ala Thr Gly Tyr Pro Leu Ala
Glu Val Ser Trp Pro Asn Val Ser Val 145 150 155 160 Pro Ala Asn Thr
Ser His Ser Arg Thr Pro Glu Gly Leu Tyr Gln Val 165 170 175 Thr Ser
Val Leu Arg Leu Lys Pro Pro Pro Gly Arg Asn Phe Ser Cys 180 185 190
Val Val Trp Asn Thr His Val Arg Glu Leu Thr Leu Ala Ser Ile Asp 195
200 205 Leu Gln Ser Gln Met Glu Pro Arg Thr Glu Phe Glu Pro Lys Ser
Cys 210 215 220 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly 225 230 235 240 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met 245 250 255 Ile Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His 260 265 270 Glu Asp Pro Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val 275 280 285 His Asn Ala Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 290 295 300 Arg Val
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 305 310 315
320 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
325 330 335 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val 340 345 350 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 355 360 365 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 370 375 380 Trp Glu Ser Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro 385 390 395 400 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 405 410 415 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 420 425 430 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 435 440
445 Pro Gly Lys 450 18 666 DNA Homo sapiens 18 agcttttcaa
tgtgaccagc acactgagaa tcaacacaac aactaatgag attttctact 60
gcacttttag gagattagat cctgaggaaa accatacagc tgaattggtc atcccagaac
120 tacctctggc acatcctcca aatgaaagga ctcacttggt aattctggga
gccatcttat 180 tatgccttgg tgtagcactg acattcatct tccgtttaag
aaaagggaga atgatggatg 240 tgaaaaaatg tggcatccaa gatacaaact
caaagaagca aagtgataca catttggagg 300 agacgtaatc cagcattgga
acttctgatc ttcaagcagg gattctcaac ctgtggttta 360 ggggttcatc
ggggctgagc gtgacaagag gaaggaatgg gcccgtggga tgcaggcaat 420
gtgggactta aaaggcccaa gcactgaaaa tggaacctgg cgaaacagag gaggagaatg
480 aagaaagatg gagtcaaaca gggagcctgg agggagacct tgatactttc
aaatgcctga 540 ggggctcatc gacgcctgtg acagggagaa aggatacttc
tgaacaagga gcctccaagc 600 aaatcatcca ttgctcatcc taggaagacg
ggttgagaat ccctaatttg agggtcagtt 660 cctgca 666 19 3197 DNA Homo
sapiens 19 attcggctcg agggcgactg agccaggctg ggccgcgtcc ctgagtccca
gagtcggcgc 60 ggcgcggcag gggcagcctt ccaccacggg gagcccagct
gtcagccgcc tcacaggaag 120 atgctgcgtc ggcggggcag ccctggcatg
ggtgtgcatg tgggtgcagc cctgggagca 180 ctgtggttct gcctcacagg
agccctggag gtccaggtcc ctgaagaccc agtggtggca 240 ctggtgggca
ccgatgccac cctgtgctgc tccttctccc ctgagcctgg cttcagcctg 300
gcacagctca acctcatctg gcagctgaca gataccaaac agctggtgca cagctttgct
360 gagggccagg accagggcag cgcctatgcc aaccgcacgg ccctcttccc
ggacctgctg 420 gcacagggca acgcatccct gaggctgcag cgcgtgcgtg
tggcggacga gggcagcttc 480 acctgcttcg tgagcatccg ggatttcggc
agcgctgccg tcagcctgca ggtggccgct 540 ccctactcga agcccagcat
gaccctggag cccaacaagg acctgcggcc aggggacacg 600 gtgaccatca
cgtgctccag ctaccagggc taccctgagg ctgaggtgtt ctggcaggat 660
gggcagggtg tgcccctgac tggcaacgtg accacgtcgc agatggccaa cgagcagggc
720 ttgtttgatg tgcacagcat cctgcgggtg gtgctgggtg caaatggcac
ctacagctgc 780 ctggtgcgca accccgtgct gcagcaggat gcgcacagct
ctgtcaccat cacaccccag 840 agaagcccca caggagccgt ggaggtccag
gtccctgagg acccggtggt ggccctagtg 900 ggcaccgatg ccaccctgcg
ctgctccttc tcccccgagc ctggcttcag cctggcacag 960 ctcaacctca
tctggcagct gacagacacc aaacagctgg tgcacagttt caccgaaggc 1020
cgggaccagg gcagcgccta tgccaaccgc acggccctct tcccggacct gctggcacaa
1080 ggcaatgcat ccctgaggct gcagcgcgtg cgtgtggcgg acgagggcag
cttcacctgc 1140 ttcgtgagca tccgggattt cggcagcgct gccgtcagcc
tgcaggtggc cgctccctac 1200 tcgaagccca gcatgaccct ggagcccaac
aaggacctgc ggccagggga cacggtgacc 1260 atcacgtgct ccagctaccg
gggctaccct gaggctgagg tgttctggca ggatgggcag 1320 ggtgtgcccc
tgactggcaa cgtgaccacg tcgcagatgg ccaacgagca gggcttgttt 1380
gatgtgcaca gcgtcctgcg ggtggtgctg ggtgcgaatg gcacctacag ctgcctggtg
1440 cgcaaccccg tgctgcagca ggatgcgcac ggctctgtca ccatcacagg
gcagcctatg 1500 acattccccc cagaggccct gtgggtgacc gtggggctgt
ctgtctgtct cattgcactg 1560 ctggtggccc tggctttcgt gtgctggaga
aagatcaaac agagctgtga ggaggagaat 1620 gcaggagctg aggaccagga
tggggaggga gaaggctcca agacagccct gcagcctctg 1680 aaacactctg
acagcaaaga agatgatgga caagaaatag cctgaccatg aggaccaggg 1740
agctgctacc cctccctaca gctcctaccc tctggctgca atggggctgc actgtgagcc
1800 ctgcccccaa cagatgcatc ctgctctgac aggtgggctc cttctccaaa
ggatgcgata 1860 cacagaccac tgtgcagcct tatttctcca atggacatga
ttcccaagtc atcctgctgc 1920 cttttttctt atagacacaa tgaacagacc
acccacaacc ttagttctct aagtcatcct 1980 gcctgctgcc ttatttcaca
gtacatacat ttcttaggga cacagtacac tgaccacatc 2040 accaccctct
tcttccagtg ctgcgtggac catctggctg ccttttttct ccaaaagatg 2100
caatattcag actgactgac cccctgcctt atttcaccaa agacacgatg catagtcacc
2160 ccggccttgt ttctccaatg gccgtgatac actagtgatc atgttcagcc
ctgcttccac 2220 ctgcatagaa tcttttcttc tcagacaggg acagtgcggc
ctcaacatct cctggagtct 2280 agaagctgtt tcctttcccc tccttcctcc
tcttgctcta gccttaatac tggccttttc 2340 cctccctgcc ccaagtgaag
acagggcact ctgcgcccac cacatgcaca gctgtgcatg 2400 gagacctgca
ggtgcacgtg ctggaacacg tgtggttccc ccctggccca gcctcctctg 2460
cagtgcccct ctcccctgcc catcctcccc acggaagcat gtgctggtca cactggttct
2520 ccaggggtct gtgatggggc ccctgggggt cagcttctgt ccctctgcct
tctcacctct 2580 ttgttccttt cttttcatgt atccattcag ttgatgttta
ttgagcaact acagatgtca 2640 gcactgtgtt aggtgctggg ggccctgcgt
gggaagataa agttcctccc tcaaggactc 2700 cccatccagc tgggagacag
acaactaact acactgcacc ctgcggtttg cagggggctc 2760 ctgcctggct
ccctgctcca cacctcctct gtggctcaag gcttcctgga tacctcaccc 2820
ccatcccacc cataattctt acccagagca tggggttggg gcggaaacct ggagagaggg
2880 acatagcccc tcgccacggc tagagaatct ggtggtgtcc aaaatgtctg
tccaggtgtg 2940 ggcaggtggg caggcaccaa ggccctctgg acctttcata
gcagcagaaa aggcagagcc 3000 tggggcaggg cagggccagg aatgctttgg
ggacaccgag gggactgccc cccaccccca 3060 ccatggtgct attctggggc
tggggcagtc ttttcctggc ttgcctctgg ccagctcctg 3120 gcctctggta
gagtgagact tcagacgttc tgatgccttc cggatgtcat ctctccctgc 3180
cccaggaatg gaagatg 3197 20 842 DNA Homo sapiens 20 ccggggtacc
atgatcttcc tcctgctaat gttgagcctg gaattgcagc ttcaccagat 60
agcagcttta ttcacagtga cagtccctaa ggaactgtac ataatagagc atggcagcaa
120 tgtgaccctg gaatgcaact ttgacactgg aagtcatgtg aaccttggag
caataacagc 180 cagtttgcaa aaggtggaaa atgatacatc cccacaccgt
gaaagagcca ctttgctgga 240 ggagcagctg cccctaggga aggcctcgtt
ccacatacct caagtccaag tgagggacga 300 aggacagtac caatgcataa
tcatctatgg ggtcgcctgg gactacaagt acctgactct 360 gaaagtcaaa
gcttcctaca ggaaaataaa cactcacatc ctaaaggttc cagaaacaga 420
tgaggtagag ctcacctgcc aggctacagg ttatcctctg gcagaagtat cctggccaaa
480 cgtcagcgtt cctgccaaca ccagccactc caggacccct gaaggcctct
accaggtcac 540 cagtgttctg cgcctaaagc caccccctgg cagaaacttc
agctgtgtgt tctggaatac 600 tcacgtgagg gaacttactt tggccagcat
tgaccttcaa agtcagatgg aacccaggac 660 ccatccaact tggctgcttc
acattttcat cccctcctgc atcattgctt tcattttcat 720 agccacagtg
atagccctaa gaaaacaact ctgtcaaaag ctgtattctt caaaagacac 780
aacaaaaaga cctgtcacca caacaaagag ggaagtgaac agtgctatct gatctagagc
840 gc 842 21 20 DNA Artificial Sequence Description of Artificial
Sequence Primer 21 ggcataataa gatggctccc 20 22 20 DNA Artificial
Sequence Description of Artificial Sequence Primer 22 catgaactga
catgtcaggc 20 23 20 DNA Artificial Sequence Description of
Artificial Sequence Primer 23 catttacaaa gagaggtcgg 20 24 22 DNA
Artificial Sequence Description of Artificial Sequence Primer 24
agggttattt taagtaccga cc 22 25 22 DNA Artificial Sequence
Description of Artificial Sequence Primer 25 ggaaatgtat gttaaaagca
cg 22 26 22 DNA Artificial Sequence Description of Artificial
Sequence Primer 26 ggcatggatc ctcagccctg gg 22 27 22 DNA Artificial
Sequence Description of Artificial Sequence Primer 27 gagacccatg
ggctctccag gg 22 28 22 DNA Artificial Sequence Description of
Artificial Sequence Primer 28 gttcaagcac aacgaatgag gc
22 29 22 DNA Artificial Sequence Description of Artificial Sequence
Primer 29 tggctttgcc acatgtcaag gc 22 30 34 DNA Artificial Sequence
Description of Artificial Sequence Primer 30 tcaggtacta gtgttcccaa
ggacctatat gtgg 34 31 42 DNA Artificial Sequence Description of
Artificial Sequence Primer 31 gattcgagat ctcctcgagt cctttcattt
ggaggatgtg cc 42 32 33 DNA Artificial Sequence Description of
Artificial Sequence Primer 32 tcaggtacta gtgttcccaa ggaccatatg tgg
33 33 39 DNA Artificial Sequence Description of Artificial Sequence
Primer 33 gattcgagat ctcctcgagt ctttcattgg ggatgtgcc 39 34 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 34
ggtgcacagc tttgctga 18 35 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 35 gctgtgcacc agctgttt 18 36 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 36
gctatgaaag gtccagag 18 37 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 37 gaatctggtg gtgtccaa 18 38 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 38
ctctgtcacc atcacagg 18 39 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 39 ctctgtcacc atcacacc 18 40 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 40
gaaatcccgg atgctcac 18 41 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 41 accacacgtg ttccagca 18 42 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 42
tgctggaaca cgtgtggt 18 43 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 43 ggccctcagc aaagctgt 18 44 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 44
agctgtaggt gccattcg 18 45 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 45 agggacctgg acctccac 18 46 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 46
tggggggaat gtcatagg 18 47 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 47 agcaggcagg atgactta 18 48 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 48
aacagaccac ccacaacc 18 49 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 49 gcaaatggca cctacagc 18 50 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 50
tctggggtgt gatggtga 18 51 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 51 atgaaaggtc cagagggc 18 52 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 52
acccataatt cttaccca 18 53 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 53 cacagctctg tttgatct 18 54 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 54
ctcctaccct ctggctgc 18 55 14 DNA Artificial Sequence Description of
Artificial Sequence Primer 55 atgctgcgtc ggcg 14 56 24 DNA
Artificial Sequence Description of Artificial Sequence Primer 56
tcaggctatt tcttgtccat catc 24 57 17 DNA Artificial Sequence
Description of Artificial Sequence Primer 57 gttttcccag tcacgac 17
58 17 DNA Artificial Sequence Description of Artificial Sequence
Primer 58 caggaaacag ctatgac 17 59 17 DNA Artificial Sequence
Description of Artificial Sequence Primer 59 tggtgcacag ctttgct 17
60 17 DNA Artificial Sequence Description of Artificial Sequence
Primer 60 tctgggggga atgtcat 17 61 17 DNA Artificial Sequence
Description of Artificial Sequence Primer 61 tggtgcacag ctttgct 17
62 17 DNA Artificial Sequence Description of Artificial Sequence
Primer 62 tctgggggga atgtcat 17 63 22 DNA Artificial Sequence
Description of Artificial Sequence Primer 63 ggggtaccat gctgcgtcgg
cg 22 64 25 DNA Artificial Sequence Description of Artificial
Sequence Primer 64 cggaattctg gggggaatgt catag 25 65 27 DNA
Artificial Sequence Description of Artificial Sequence Primer 65
ggaattcgag cccaaatctt gtgacaa 27 66 29 DNA Artificial Sequence
Description of Artificial Sequence Primer 66 gcgctctaga tcatttaccc
ggagacagg 29 67 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 67 gaaggcctct accaggtc 18 68 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 68
ctttaggcgc agaacact 18 69 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 69 aagggtcagc taatgctc 18 70 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 70
tcagtttgca catctgta 18 71 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 71 tatgctatca agattcca 18 72 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 72
gtaaagtgca gtagtgct 18 73 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 73 tatgagctca cagacagg 18 74 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 74
aggttcagat agcactgt 18 75 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 75 acttatctga aattgctg 18 76 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 76
ttgatatgct catacgtt 18 77 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 77 gaattctgtg ggtccagg 18 78 18 DNA
Artificial Sequence Description of Artificial Sequence Primer 78
catgtttaat ggtggttt 18 79 18 DNA Artificial Sequence Description of
Artificial Sequence Primer 79 aaagctgtat tcttcaaa 18 80 22 DNA
Artificial Sequence Description of Artificial Sequence Primer 80
gaacactggt gacctggtag ag 22 81 34 DNA Artificial Sequence
Description of Artificial Sequence Primer 81 ccggggtacc atgatcttcc
tcctgctaat gttg 34 82 33 DNA Artificial Sequence Description of
Artificial Sequence Primer 82 gcgctctaga tcagatagca ctgttcactt ccc
33 83 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 83 tacaagcgaa ttactgtgaa 20 84 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 84 gatgtgccag aggtagttct
20 85 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 85 aatagagcat ggcagcaatg 20 86 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 86 ggcgacccca tagatgatta
20 87 18 DNA Artificial Sequence Description of Artificial Sequence
Primer 87 ccagtaagtg cgggtcat 18 88 18 DNA Artificial Sequence
Description of Artificial Sequence Primer 88 ttcacctacg gaaacctt 18
89 34 DNA Artificial Sequence Description of Artificial Sequence
Primer 89 ccggggtacc atgatcttcc tcctgctaat gttg 34 90 26 DNA
Artificial Sequence Description of Artificial Sequence Primer 90
cggaattcgg tcctgggttc catctg 26 91 31 DNA Artificial Sequence
Description of Artificial Sequence Primer 91 cgggattcat gatcttcctc
ctgctaatgt t 31 92 29 DNA Artificial Sequence Description of
Artificial Sequence Primer 92 gcgctctaga tcatttaccc ggagacagg 29 93
6 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Epitope tag 93 His His His His His His 1 5 94 8 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Epitope tag 94 Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 95 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 95
gacatccaga tgacccagtc tcc 23 96 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 96 gatgttgtga tgactcagtc
tcc 23 97 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 97 gatattgtga tgactcagtc tcc 23 98 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 98
gaaattgtgt tgacgcagtc tcc 23 99 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 99 gacatcgtga tgacccagtc
tcc 23 100 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 100 gaaacgacac tcacgcagtc tcc 23 101 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 101
gaaattgtgc tgactcagtc tcc 23 102 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 102 cagtctgtgt tgacgcagcc
gcc 23 103 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 103 cagtctgccc tgactcagcc tgc 23 104 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 104
tcctatgtgc tgactcagcc acc 23 105 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 105 tcttctgagc tgactcagga
ccc 23 106 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 106 cacgttatac tgactcaacc gcc 23 107 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 107
caggctgtgc tcactcagcc gtc 23 108 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 108 aattttatgc tgactcagcc
cca 23 109 24 DNA Artificial Sequence Description of Artificial
Sequence Primer 109 acgtttgatt tccaccttgg tccc 24 110 24 DNA
Artificial Sequence Description of Artificial Sequence Primer 110
acgtttgatc tccagcttgg tccc 24 111 24 DNA Artificial Sequence
Description of Artificial Sequence Primer 111 acgtttgata tccactttgg
tccc 24 112 24 DNA Artificial Sequence Description of Artificial
Sequence Primer 112 acgtttgatc tccaccttgg tccc 24 113 24 DNA
Artificial Sequence Description of Artificial Sequence Primer 113
acgtttaatc tccagtcgtg tccc 24 114 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 114 cagtctgtgt tgacgcagcc
gcc 23 115 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 115 cagtctgccc tgactcagcc tgc 23 116 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 116
tcctatgtgc tgactcagcc acc 23 117 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 117 tcttctgagc tgactcagga
ccc 23 118 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 118 cacgttatac tgactcaacc gcc 23 119 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 119
caggctgtgc tcactcagcc gtc 23 120 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 120 aattttatgc tgactcagcc
cca 23 121 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 121 caggtgcagc tggtgcagtc tgg 23 122 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 122
caggtcaact taagggagtc tgg 23 123 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 123 gaggtgcagc tggtggagtc
tgg 23 124 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 124 caggtgcagc tgcaggagtc ggg 23 125 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 125
gaggtgcagc tgttgcagtc tgc 23 126 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 126 caggtacagc tgcagcagtc
agg 23 127 24 DNA Artificial Sequence Description of Artificial
Sequence Primer 127 tgaggagacg gtgaccaggg tgcc 24 128 24 DNA
Artificial Sequence Description of Artificial Sequence Primer 128
tgaagagacg gtgaccattg tccc 24 129 24 DNA Artificial Sequence
Description of Artificial Sequence Primer 129 tgaggagacg gtgaccaggg
ttcc 24 130 24 DNA Artificial Sequence Description of Artificial
Sequence Primer 130 tgaggagacg gtgaccgtgg tccc 24 131 1602 DNA Homo
sapiens 131 atgctgcgtc ggcggggcag ccctggcatg ggtgtgcatg tgggtgcagc
cctgggagca 60 ctgtggttct gcctcacagg agccctggag gtccaggtcc
ctgaagaccc agtggtggca 120 ctggtgggca ccgatgccac cctgtgctgc
tccttctccc ctgagcctgg cttcagcctg 180 gcacagctca acctcatctg
gcagctgaca gataccaaac agctggtgca cagctttgct 240 gagggccagg
accagggcag cgcctatgcc aaccgcacgg ccctcttccc ggacctgctg 300
gcacagggca acgcatccct gaggctgcag cgcgtgcgtg tggcggacga gggcagcttc
360 acctgcttcg tgagcatccg ggatttcggc agcgctgccg tcagcctgca
ggtggccgct 420 ccctactcga agcccagcat gaccctggag cccaacaagg
acctgcggcc aggggacacg 480 gtgaccatca cgtgctccag ctaccagggc
taccctgagg ctgaggtgtt ctggcaggat 540 gggcagggtg tgcccctgac
tggcaacgtg accacgtcgc agatggccaa cgagcagggc 600 ttgtttgatg
tgcacagcat cctgcgggtg gtgctgggtg caaatggcac ctacagctgc 660
ctggtgcgca accccgtgct gcagcaggat gcgcacagct ctgtcaccat cacaccccag
720 agaagcccca caggagccgt ggaggtccag gtccctgagg acccggtggt
ggccctagtg 780 ggcaccgatg ccaccctgcg ctgctccttc tcccccgagc
ctggcttcag cctggcacag 840 ctcaacctca tctggcagct gacagacacc
aaacagctgg tgcacagttt caccgaaggc 900 cgggaccagg gcagcgccta
tgccaaccgc acggccctct tcccggacct gctggcacaa 960 ggcaatgcat
ccctgaggct gcagcgcgtg cgtgtggcgg acgagggcag cttcacctgc 1020
ttcgtgagca tccgggattt cggcagcgct gccgtcagcc tgcaggtggc cgctccctac
1080 tcgaagccca gcatgaccct ggagcccaac aaggacctgc ggccagggga
cacggtgacc 1140 atcacgtgct ccagctaccg gggctaccct gaggctgagg
tgttctggca ggatgggcag 1200 ggtgtgcccc tgactggcaa cgtgaccacg
tcgcagatgg ccaacgagca gggcttgttt 1260 gatgtgcaca gcgtcctgcg
ggtggtgctg ggtgcgaatg gcacctacag ctgcctggtg 1320 cgcaaccccg
tgctgcagca ggatgcgcac ggctctgtca ccatcacagg gcagcctatg 1380
acattccccc cagaggccct gtgggtgacc gtggggctgt ctgtctgtct cattgcactg
1440 ctggtggccc tggctttcgt gtgctggaga aagatcaaac agagctgtga
ggaggagaat 1500 gcaggagctg aggaccagga tggggaggga gaaggctcca
agacagccct gcagcctctg 1560 aaacactctg acagcaaaga agatgatgga
caagaaatag cc 1602 132 1440 DNA Homo sapiens 132 atgctgcgtc
ggcggggcag ccctggcatg ggtgtgcatg tgggtgcagc cctgggagca 60
ctgtggttct gcctcacagg agccctggag gtccaggtcc ctgaagaccc agtggtggca
120 ctggtgggca ccgatgccac cctgtgctgc tccttctccc ctgagcctgg
cttcagcctg 180 gcacagctca acctcatctg gcagctgaca gataccaaac
agctggtgca cagctttgct 240 gagggccagg accagggcag cgcctatgcc
aaccgcacgg ccctcttccc ggacctgctg 300 gcacaaggca atgcatccct
gaggctgcag cgcgtgcgtg tggcggacga gggcagcttc 360 acctgcttcg
tgagcatccg ggatttcggc
agcgctgccg tcagcctgca ggtggccgct 420 ccctactcga agcccagcat
gaccctggag cccaacaagg acctgcggcc aggggacacg 480 gtgaccatca
cgtgctccag ctaccggggc taccctgagg ctgaggtgtt ctggcaggat 540
gggcagggtg tgcccctgac tggcaacgtg accacgtcgc agatggccaa cgagcagggc
600 ttgtttgatg tgcacagcgt cctgcgggtg gtgctgggtg cgaatggcac
ctacagctgc 660 ctggtgcgca accccgtgct gcagcaggat gcgcacggct
ctgtcaccat cacagggcag 720 cctatgacat tccccccaga attcgagccc
aaatcttgtg acaaaactca cacatgccca 780 ccgtgcccag cacctgaact
cctgggggga ccgtcagtct tcctcttccc cccaaaaccc 840 aaggacaccc
tcatgatctc ccggacccct gaggtcacat gcgtggtggt ggacgtgagc 900
cacgaagacc ctgaggtcaa gttcaactgg tacgtggacg gcgtggaggt gcataatgcc
960 aagacaaagc cgcgggagga gcagtacaac agcacgtacc gtgtggtcag
cgtcctcacc 1020 gtcctgcacc aggactggct gaatggcaag gagtacaagt
gcaaggtctc caacaaagcc 1080 ctcccagccc ccatcgagaa aaccatctcc
aaagccaaag ggcagccccg agaaccacag 1140 gtgtacaccc tgcccccatc
ccgggatgag ctgaccaaga accaggtcag cctgacctgc 1200 ctggtcaaag
gcttctatcc cagcgacatc gccgtggagt gggagagcaa tgggcagccg 1260
gagaacaact acaagaccac gcctcccgtg ctggactccg acggctcctt cttcctctac
1320 agcaagctca ccgtggacaa gagcaggtgg cagcagggga acgtcttctc
atgctccgtg 1380 atgcatgagg ctctgcacaa ccactacacg cagaagagcc
tctccctgtc tccgggtaaa 1440 133 480 PRT Homo sapiens 133 Met Leu Arg
Arg Arg Gly Ser Pro Gly Met Gly Val His Val Gly Ala 1 5 10 15 Ala
Leu Gly Ala Leu Trp Phe Cys Leu Thr Gly Ala Leu Glu Val Gln 20 25
30 Val Pro Glu Asp Pro Val Val Ala Leu Val Gly Thr Asp Ala Thr Leu
35 40 45 Cys Cys Ser Phe Ser Pro Glu Pro Gly Phe Ser Leu Ala Gln
Leu Asn 50 55 60 Leu Ile Trp Gln Leu Thr Asp Thr Lys Gln Leu Val
His Ser Phe Ala 65 70 75 80 Glu Gly Gln Asp Gln Gly Ser Ala Tyr Ala
Asn Arg Thr Ala Leu Phe 85 90 95 Pro Asp Leu Leu Ala Gln Gly Asn
Ala Ser Leu Arg Leu Gln Arg Val 100 105 110 Arg Val Ala Asp Glu Gly
Ser Phe Thr Cys Phe Val Ser Ile Arg Asp 115 120 125 Phe Gly Ser Ala
Ala Val Ser Leu Gln Val Ala Ala Pro Tyr Ser Lys 130 135 140 Pro Ser
Met Thr Leu Glu Pro Asn Lys Asp Leu Arg Pro Gly Asp Thr 145 150 155
160 Val Thr Ile Thr Cys Ser Ser Tyr Arg Gly Tyr Pro Glu Ala Glu Val
165 170 175 Phe Trp Gln Asp Gly Gln Gly Val Pro Leu Thr Gly Asn Val
Thr Thr 180 185 190 Ser Gln Met Ala Asn Glu Gln Gly Leu Phe Asp Val
His Ser Val Leu 195 200 205 Arg Val Val Leu Gly Ala Asn Gly Thr Tyr
Ser Cys Leu Val Arg Asn 210 215 220 Pro Val Leu Gln Gln Asp Ala His
Gly Ser Val Thr Ile Thr Gly Gln 225 230 235 240 Pro Met Thr Phe Pro
Pro Glu Phe Glu Pro Lys Ser Cys Asp Lys Thr 245 250 255 His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser 260 265 270 Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 275 280
285 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro
290 295 300 Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His
Asn Ala 305 310 315 320 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser
Thr Tyr Arg Val Val 325 330 335 Ser Val Leu Thr Val Leu His Gln Asp
Trp Leu Asn Gly Lys Glu Tyr 340 345 350 Lys Cys Lys Val Ser Asn Lys
Ala Leu Pro Ala Pro Ile Glu Lys Thr 355 360 365 Ile Ser Lys Ala Lys
Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 370 375 380 Pro Pro Ser
Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys 385 390 395 400
Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 405
410 415 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu
Asp 420 425 430 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val
Asp Lys Ser 435 440 445 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser
Val Met His Glu Ala 450 455 460 Leu His Asn His Tyr Thr Gln Lys Ser
Leu Ser Leu Ser Pro Gly Lys 465 470 475 480 134 1440 DNA Homo
sapiens 134 atgctgcgtc ggcggggcag ccctggcatg ggtgtgcatg tgggtgcagc
cctgggagca 60 ctgtggttct gcctcacagg agccctggag gtccaggtcc
ctgaagaccc agtggtggca 120 ctggtgggca ccgatgccac cctgcgctgc
tccttctccc ccgagcctgg cttcagcctg 180 gcacagctca acctcatctg
gcagctgaca gacaccaaac agctggtgca cagtttcacc 240 gaaggccggg
accagggcag cgcctatgcc aaccgcacgg ccctcttccc ggacctgctg 300
gcacaaggca atgcatccct gaggctgcag cgcgtgcgtg tggcggacga gggcagcttc
360 acctgcttcg tgagcatccg ggatttcggc agcgctgccg tcagcctgca
ggtggccgct 420 ccctactcga agcccagcat gaccctggag cccaacaagg
acctgcggcc aggggacacg 480 gtgaccatca cgtgctccag ctaccggggc
taccctgagg ctgaggtgtt ctggcaggat 540 gggcagggtg tgcccctgac
tggcaacgtg accacgtcgc agatggccaa cgagcagggc 600 ttgtttgatg
tgcacagcgt cctgcgggtg gtgctgggtg cgaatggcac ctacagctgc 660
ctggtgcgca accccgtgct gcagcaggat gcgcacggct ctgtcaccat cacagggcag
720 cctatgacat tccccccaga attcgagccc aaatcttgtg acaaaactca
cacatgccca 780 ccgtgcccag cacctgaact cctgggggga ccgtcagtct
tcctcttccc cccaaaaccc 840 aaggacaccc tcatgatctc ccggacccct
gaggtcacat gcgtggtggt ggacgtgagc 900 cacgaagacc ctgaggtcaa
gttcaactgg tacgtggacg gcgtggaggt gcataatgcc 960 aagacaaagc
cgcgggagga gcagtacaac agcacgtacc gtgtggtcag cgtcctcacc 1020
gtcctgcacc aggactggct gaatggcaag gagtacaagt gcaaggtctc caacaaagcc
1080 ctcccagccc ccatcgagaa aaccatctcc aaagccaaag ggcagccccg
agaaccacag 1140 gtgtacaccc tgcccccatc ccgggatgag ctgaccaaga
accaggtcag cctgacctgc 1200 ctggtcaaag gcttctatcc cagcgacatc
gccgtggagt gggagagcaa tgggcagccg 1260 gagaacaact acaagaccac
gcctcccgtg ctggactccg acggctcctt cttcctctac 1320 agcaagctca
ccgtggacaa gagcaggtgg cagcagggga acgtcttctc atgctccgtg 1380
atgcatgagg ctctgcacaa ccactacacg cagaagagcc tctccctgtc tccgggtaaa
1440 135 480 PRT Homo sapiens 135 Met Leu Arg Arg Arg Gly Ser Pro
Gly Met Gly Val His Val Gly Ala 1 5 10 15 Ala Leu Gly Ala Leu Trp
Phe Cys Leu Thr Gly Ala Leu Glu Val Gln 20 25 30 Val Pro Glu Asp
Pro Val Val Ala Leu Val Gly Thr Asp Ala Thr Leu 35 40 45 Arg Cys
Ser Phe Ser Pro Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn 50 55 60
Leu Ile Trp Gln Leu Thr Asp Thr Lys Gln Leu Val His Ser Phe Thr 65
70 75 80 Glu Gly Arg Asp Gln Gly Ser Ala Tyr Ala Asn Arg Thr Ala
Leu Phe 85 90 95 Pro Asp Leu Leu Ala Gln Gly Asn Ala Ser Leu Arg
Leu Gln Arg Val 100 105 110 Arg Val Ala Asp Glu Gly Ser Phe Thr Cys
Phe Val Ser Ile Arg Asp 115 120 125 Phe Gly Ser Ala Ala Val Ser Leu
Gln Val Ala Ala Pro Tyr Ser Lys 130 135 140 Pro Ser Met Thr Leu Glu
Pro Asn Lys Asp Leu Arg Pro Gly Asp Thr 145 150 155 160 Val Thr Ile
Thr Cys Ser Ser Tyr Arg Gly Tyr Pro Glu Ala Glu Val 165 170 175 Phe
Trp Gln Asp Gly Gln Gly Val Pro Leu Thr Gly Asn Val Thr Thr 180 185
190 Ser Gln Met Ala Asn Glu Gln Gly Leu Phe Asp Val His Ser Val Leu
195 200 205 Arg Val Val Leu Gly Ala Asn Gly Thr Tyr Ser Cys Leu Val
Arg Asn 210 215 220 Pro Val Leu Gln Gln Asp Ala His Gly Ser Val Thr
Ile Thr Gly Gln 225 230 235 240 Pro Met Thr Phe Pro Pro Glu Phe Glu
Pro Lys Ser Cys Asp Lys Thr 245 250 255 His Thr Cys Pro Pro Cys Pro
Ala Pro Glu Leu Leu Gly Gly Pro Ser 260 265 270 Val Phe Leu Phe Pro
Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 275 280 285 Thr Pro Glu
Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 290 295 300 Glu
Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 305 310
315 320 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val
Val 325 330 335 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly
Lys Glu Tyr 340 345 350 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala
Pro Ile Glu Lys Thr 355 360 365 Ile Ser Lys Ala Lys Gly Gln Pro Arg
Glu Pro Gln Val Tyr Thr Leu 370 375 380 Pro Pro Ser Arg Asp Glu Leu
Thr Lys Asn Gln Val Ser Leu Thr Cys 385 390 395 400 Leu Val Lys Gly
Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 405 410 415 Asn Gly
Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 420 425 430
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 435
440 445 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu
Ala 450 455 460 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Pro Gly Lys 465 470 475 480 136 60 DNA Artificial Sequence
Description of Artificial Sequence Primer 136 actataggga gacccaagct
tggtaccgga tccatgctgc gtcggcgggg cagccctggc 60 137 51 DNA
Artificial Sequence Description of Artificial Sequence Primer 137
gtcacaagat ttgggctccg gatcctctgg ggggaatgtc ataggctgcc c 51 138 100
DNA Artificial Sequence Description of Artificial Sequence Primer
138 caagcttggt accggatcca tggaagcccc agctcagctt ctcttcctcc
tgctactctg 60 gctcccagat accaccggaa caggagccct ggaggtccag 100
* * * * *