U.S. patent application number 10/052404 was filed with the patent office on 2003-02-13 for antibodies that bind il-13 mutants.
Invention is credited to Debinski, Waldemar, Thompson, Jeffrey P..
Application Number | 20030031666 10/052404 |
Document ID | / |
Family ID | 27368701 |
Filed Date | 2003-02-13 |
United States Patent
Application |
20030031666 |
Kind Code |
A1 |
Debinski, Waldemar ; et
al. |
February 13, 2003 |
Antibodies that bind IL-13 mutants
Abstract
This invention provides antibodies that bind mutant human
interleukin 13 molecules showing varying specificity for the
restricted (IL4 independent) IL13 receptor. The mutant hIL13
molecules include those made by substituting the amino acid
residues that occur in the alpha-helix regions of native hIL13 with
various other amino acid residues. Some of the mutants retain the
ability to bind and cause signaling through IL13 receptors, while
other mutants do not.
Inventors: |
Debinski, Waldemar;
(Hershey, PA) ; Thompson, Jeffrey P.;
(Landisville, PA) |
Correspondence
Address: |
Stanley A. Kim, Ph.D., Esq.
Akerman, Senterfitt & Eidson, P.A.
222 Lakeview Avenue, Suite 400
P.O. Box 3188
West Palm Beach
FL
33402-3188
US
|
Family ID: |
27368701 |
Appl. No.: |
10/052404 |
Filed: |
January 17, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10052404 |
Jan 17, 2002 |
|
|
|
09679710 |
Oct 5, 2000 |
|
|
|
09679710 |
Oct 5, 2000 |
|
|
|
09054711 |
Apr 3, 1998 |
|
|
|
6296843 |
|
|
|
|
60157934 |
Oct 6, 1999 |
|
|
|
Current U.S.
Class: |
424/143.1 ;
530/388.22 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 2319/00 20130101; C07K 14/21 20130101; C07K 14/5437
20130101 |
Class at
Publication: |
424/143.1 ;
530/388.22 |
International
Class: |
A61K 039/395; C07K
016/28 |
Goverment Interests
[0002] This invention was made in part with Government support
under grant CA741145 awarded by the National Institutes of Health.
The Government may have certain rights in the invention.
Claims
What is claimed is:
1. An antibody that specifically binds a mutant hIL13 molecule but
not a native hIL13 molecule.
2. The antibody of claim 1, wherein the antibody is a monoclonal
antibody.
3. The antibody of claim 1, wherein the antibody is a polyclonal
antibody.
4. The antibody of claim 1, wherein the mutant hIL13 is a
polypeptide consisting of an amino acid sequence selected from the
group consisting of SEQ ID Nos: 2-23.
5. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
2.
6. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
3.
7. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
4.
8. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
5.
9. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
6.
10. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
7.
11. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
8.
12. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
9.
13. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
10.
14. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
11.
15. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
12.
16. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
13.
17. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
14.
18. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
15.
19. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
16.
20. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
17.
21. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
18.
22. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
19.
23. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
20.
24. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
21.
25. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO:
22.
26. The antibody of claim 4, wherein the mutant hIL13 is a
polypeptide consisting of the amino acid sequence of SEQ ID NO: 23.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a divisional of U.S. patent
application Ser. number 09/679,710 filed on Oct. 5, 2000, which is
a continuation-in-part of U.S. patent application Ser. number
09/054,711 filed on Apr. 3, 1998, now U.S. Pat. No. 6,296,843, and
is related to and claims the benefit of U.S. Provisional patent
application number 60/157,934 filed on Oct. 6, 1999.
BACKGROUND OF THE INVENTION
[0003] Human interleukin 13 (hIL13) is a 114 amino acid cytokine
secreted by activated T cells. Minty et al. (1993) Nature,
362:248-250; and McKenzie et al. (1993) Proc. Natl. Acad. Sci. USA,
90:3735-3739. hIL13 is involved in regulating several different
physiological responses. Among these, hIL13 has been shown to
downregulate the production of cytokines involved in inflammation.
Minty et al., supra; and de Waal Malefyt et al. (1993) J. Immunol.,
151:6370-6381. It has also been shown to upregulate expression of
major histo-compatibility class II molecules and CD23 on monocytes,
and to regulate various aspects of B cell function De Waal Malefyt
et al. (1993) Res. Immunol. 144:629-633; McKenzie et al., supra;
and de Waal Malefyt et al. (1993) J. Immunol., 151:6370-6381. In
addition to regulating cells of the immune system, IL-13 has also
been shown to act on other cell types. For example, IL13 has been
shown to modulate expression of vascular cell adhesion mole-cule-1
(VCAM-1) on endothelial cells. Sironi et al. (1994) Blood,
84:1913-1921; Bochner et al. (1995) J. Immunol., 154:799-803; and
Schnyder et al. (1996) Blood, 87:4286-4295.
[0004] Based on its predicted secondary structure, hIL13 has been
added to a growing family of growth hormone-like cytokines that all
exhibit bundled alpha-helical core topology. Bamborough et al.
(1994) Prot. Engin., 7:1077-1082. Structural analyses indicated
that hIL13 is a globular protein comprised mainly of four
alpha-helical regions (helices A, B, C, and D) arranged in a
"bundled core." Miyajima et al. (1992) Ann. Rev. Immunol., 10,
295-331.
[0005] While dissimilar at the primary amino acid level, hIL13 and
human interleukin 4 (hIL4) bind and signal through a shared
receptor complex. Zurawski et al. (1993) EMBO J., 12:2663-2670; and
Tony et al. (1994) Eur. J. Biochem., 225:659-66. This shared
receptor is a heterodimer that includes a first subunit of
approximately 140 kDa termed p410, and a second subunit of
approximately 52 kDa termed .alpha.' or IL13R.alpha.1. Idzerda et
al. (1990) J. Exp. Med., 173:861-873; Obiri et al. (1995) J. Biol.
Chem., 270:8797-8804; Hilton et al. (1996) Proc. Natl. Acad. Sci.
USA, 93:497-501; and Miloux et al. (1997) FEBS Letters,
401:163-166. Unlike hIL4, hIL13 does not bind p140 in the absence
of .alpha.'. Vita et al. (1995) J. Biol. Chem., 270:3512-3517. In
addition to the shared receptor, another hIL13 receptor termed the
restricted (IL4 independent) receptor exists. In contrast to the
shared receptor, the latter receptor binds hIL13 but not hIL4. The
restricted receptor is also sometimes called the glioma-associated
receptor because it is preferentially expressed at high levels in
certain malignant cells, including high grade human gliomas.
Debinski et al. (1995) Clin. Cancer Res., 1:1253-1258; and Debinski
et al. (1996) J. Biol. Chem., 271, 22428-22433. In addition to
being associated with malignancies, hIL13 has also been associated
with other pathological conditions. Notably, IL13 has been shown to
be involved in pathways that regulate airway inflammation,
suggesting that this cytokine might play an important role in
asthma and perhaps other allergic pathologies. Webb et al., (2000)
J. Immunol.165:108-113; and Djukanovic, R. (2000) Clin. Exp.
Allergy 30 Suppl 1:46-50.
SUMMARY OF THE INVENTION
[0006] The invention relates to the development and
characterization of several mutants of hIL13. Using these mutants,
three regions of native hIL13 were identified as being required for
signaling through the shared receptor. These regions were localized
to alpha-helices A, C and D and were generally separated from the
regions involved in binding to the restricted receptor. Glutamic
acids at positions 13 and 16 in hIL13 alpha-helix A, arginine and
serine at positions 66 and 69 in helix C, and arginine at position
109 in helix D were found to be important in inducing biological
signaling because these mutations resulted in the loss and/or gain
of functional phenomena.
[0007] Mutants within the invention include those having one or
more of the native amino acids of hIL13 at positions 13, 16, 17,
66, 69, 99, 102, 104, 105, 106, 107, 108, 109, 112, 113, and 114
replaced with a different amino acid. These mutants are expressed
herein as hIL13X.sub.1PX.sub.2, where P is a number corresponding
to the position of the mutated amino acid in hIL13, X.sub.1 is the
letter abbreviation of the amino acid that was replaced, and
X.sub.2 is the letter abbreviation of the replacement amino acid.
For example, hIL13.E13K represents a mutant form of hIL13 that has
the glutamic acid residue that naturally occurs at position 13 in
native hIL13 replaced with a lysine residue. Representative mutants
within the invention include hIL13.E13K, hIL13.E13I, hIL13.E13C,
hIL13.E13S, hIL13.E13R, hIL13.E13Y, hIL13.E13D, hIL13.E16K,
hIL13.E17k, hIL13.R66D, hIL13.S69D, hIL13.D99K, hIL13.L102A,
hIL13.L104A, hIL13.K105D, hIL13.K106D, hIL13.L107A, hIL13.F108Y,
hIL13.R109D, hIL13.R112D, hIL13.F113D, and hIL13.N114D.
[0008] Also within the invention are compositions including a
mutant hIL13 having an amino acid sequence having at least 90%
sequence identity to native hIL13 (SEQ ID NO:1). Such mutants can
have a mutation in a domain corresponding to the A, C, or D
alpha-helices of native hIL13. Exemplary mutants include those with
a polypeptide having an amino acid sequence of one of SEQ ID NOs:
2-23.
[0009] Mutants of hIL13 within the invention can be those that
specifically bind the shared IL4/IL13 receptor but not the
restricted (IL4-independent) receptor; those that specifically bind
the restricted (IL4-independent) receptor but not the shared
IL4/IL13 receptor; or those that bind both receptors.
[0010] Some hIL13 mutants of the invention specifically bind to an
hIL13 receptor associated with a cell in a manner that induces a
measurable change in the cell's physiology. This change can be of
greater or less magnitude than a change in the cell's physiology
that would be induced by specifically binding the IL13 receptor
with native hIL13.
[0011] Compositions within the invention can include both an hIL13
mutant and a pharmaceutically acceptable carrier.
[0012] Mutants of hIL13 within the invention can be conjugated to
an effector molecule such as a cytotoxin (e.g., Pseudomonas
exotoxin, PE38QQR, PE1E, PE4E, Diptheria toxin, ricin, abrin,
saporin, and pokeweed viral protein), a detectable label (e.g.,
radionuclide), an antibody, a liposome, or a lipid.
[0013] In another aspect the invention includes a purified nucleic
acid encoding a mutant hIL13. Also within the invention is an
antibody that specifically binds a mutant hIL13 molecule, but not a
native hIL13 molecule. And in another aspect, the invention
features a method of delivering a mutant hIL13 to a cell. The
method can include the steps of: providing a mutant hIL13 and a
cell; and contacting the cell with the mutant hIL13.
[0014] Unless otherwise defined, all technical terms used herein
have the same meaning as commonly understood by one of ordinary
skill in the art to which this invention belongs. Commonly
understood definitions of molecular biology terms can be found in
Rieger et al., Glossary of Genetics: Classical and Molecular, 5th
edition, Springer-Verlag: New York, 1991; and Lewin, Genes V,
Oxford University Press: New York, 1994.
[0015] As used herein, the phrase "native hIL13" means the mature
form of human interleukin 13, the amino acid sequence of which is
shown herein as SEQ ID NO:1.
[0016] The phrase "hIL13 mutant" or a "mutant hIL13 molecule" means
an hIL13 in which one or more of the amino acids differ from the
corresponding amino acids in the native hIL13. Thus, for example,
where a native hIL13 has a glutamic acid at position 13, a mutant
hIL13 can have an amino acid other than glutamic acid at position
13 (e.g., glutamic acid is substituted with lysine). It will
appreciated that mutant IL13 molecules of this invention include
mutant IL 13 molecules of other mammalian species (e.g., rat,
murine, porcine, ovine, goats, non-human primates, bovine, canus,
and the like) and this invention contemplates the use of mutant
IL13 in veterinary as well as human medical conditions.
[0017] As used herein, the terms "protein" and "polypeptide" are
used synonymously to mean any peptide-linked chain of amino acids,
regardless of length or post-translational modification, e.g.,
glycosylation or phosphorylation. An "purified" polypeptide is one
that has been substantially separated or isolated away from other
polypeptides in a cell, organism, or mixture in which the
polypeptide occurs (e.g., 30, 40, 50, 60, 70, 80, 90, 95, 96, 97,
98, 99, 100% free of contaminants).
[0018] As used herein, a "nucleic acid" or a "nucleic acid
molecule" means a chain of two or more nucleotides such as RNA
(ribonucleic acid) and DNA (deoxyribonucleic acid). A "purified"
nucleic acid molecule is one that has been substantially separated
or isolated away from other nucleic acid sequences in a cell or
organism in which the nucleic acid naturally occurs (e.g., 30, 40,
50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 100% free of contaminants).
The term includes, e.g., a recombinant nucleic acid molecule
incorporated into a vector, a plasmid, a virus, or a genome of a
prokaryote or eukaryote. Examples of purified nucleic acids include
cDNAs, fragments of genomic nucleic acids, nucleic acids produced
polymerase chain reaction (PCR), nucleic acids formed by
restriction enzyme treatment of genomic nucleic acids, recombinant
nucleic acids, and chemically synthesized nucleic acid molecules. A
"recombinant" nucleic acid molecule is one made by an artificial
combination of two otherwise separated segments of sequence, e.g.,
by chemical synthesis or by the manipulation of isolated segments
of nucleic acids by genetic engineering techniques.
[0019] As used herein, "sequence identity" means the percentage of
identical subunits at corresponding positions in two sequences when
the two sequences are aligned to maximize subunit matching, i.e.,
taking into account gaps and insertions. When a subunit position in
both of the two sequences is occupied by the same monomeric
subunit, e.g., if a given position is occupied by an alanine in
each of two polypeptide molecules, then the molecules are identical
at that position. For example, if 7 positions in a sequence 10
amino acids in length are identical to the corresponding positions
in a second 10 amino acid sequence, then the two sequences have 70%
sequence identity. Sequence identity is typically measured using
sequence analysis software (e.g., Sequence Analysis Software
Package of the Genetics Computer Group, University of Wisconsin
Biotechnology Center, 1710 University Avenue, Madison, Wis.
53705).
[0020] By the term "antibody" is meant an immunoglobulin as well as
any portion or fragment of an immunoglobulin whether made by
enzymatic digestion of intact immunoglobulin or by techniques in
molecular biology. The term also refers to a mixture containing an
immunoglobulin (or portion or fragment thereof) such as an
antiserum.
[0021] The term "specifically binds", as used herein, when
referring to a polypeptide (including antibodies) or receptor,
refers to a binding reaction which is determinative of the presence
of the protein or polypeptide or receptor in a heterogeneous
population of proteins and other biologics. Thus, under designated
conditions (e.g. immunoassay conditions in the case of an
antibody), the specified ligand or antibody binds to its particular
"target" (e.g. an IL13 specifically binds to an IL13 receptor) and
does not bind in a significant amount to other proteins present in
the sample or to other proteins to which the ligand or antibody may
come in contact in an organism. Generally, a first molecule that
"specifically binds" a second molecule has a binding affinity
greater than about 10.sup.5 (e.g., 10.sup.6, 10.sup.7, 10.sup.8,
10.sup.9, 10.sup.10, 10.sup.11, and 10.sup.12 or more) moles/liter
for that second molecule.
[0022] A "mutation" in a polypeptide refers to the substitution of
an amino acid at a particular position in a polypeptide with a
different amino acid at that position. Thus, for example, the
mutation hIL13.E13K indicates that the native amino acid at
position 13 in IL13 (glutamic acid, E) is replaced with lysine (K).
In some cases, a mutation can be the deletion, addition, or
substitution of more than one amino acid in a polypeptide. The
mutation does not require an actual removal and substitution of the
amino acid(s) in question. The protein can be created de novo with
the replacement amino acid in the position(s) of the desired
mutation(s) so the net result is equivalent to the replacement of
the amino acid in question.
[0023] Although methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the present invention, suitable methods and materials are described
below. All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety. In the case of conflict, the present specification,
including definitions will control. In addition, the particular
embodiments discussed below are illustrative only and not intended
to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The invention is pointed out with particularity in the
appended claims. The above and further advantages of this invention
may be better understood by referring to the following description
taken in conjunction with the accompanying drawings, in which:
[0025] FIG. 1 is a photograph of a SDS-PAGE (A) and Western blot
(B) analysis of purified hIL13 and various hIL13 mutants. Five
hundred nanograms of each purified cytokine was loaded per sample.
Proteins were detected using a Coomassie Blue stain, panel A.
Separated proteins from a duplicate gel were electroblotted to a
PVDF membrane and detected with an anti-hIL13 antibody in a Western
blot protocol using an enhanced chemiluminescence detection system,
panel B.
[0026] FIG. 2 is circular dichroism (CD) spectra obtained from
purified hIL13 and various hIL13 mutants. Each protein was diluted
in PBS (0.1 mg/ml), thermally equilibrated to 37.degree. C., and
its CD spectrum recorded over the wavelength range of 185 nm to 260
nm. The CD spectrum of unfolded hIL13 (panel D) was obtained by
diluting the protein in 8 M urea containing 40 mM dithiothreitol
prior to analysis. The reported spectra were the average of three
consecutive measurements. The mutants in each panel, listed from
top to bottom, represent the order of the spectra in each panel,
from top to bottom.
[0027] FIG. 3 is graphical representations of data obtained from
proliferation assays using TF-1 cells induced with hIL13 and
various hIL13 mutants. TF-1 cells were cultured in the presence of
increasing concentrations of the indicated protein for 72 h. The
amount of TF-1 cell proliferation, compared to control experiments
induced with buffer alone, was determined calorimetrically. The
reported data is the average of triplicate samples with the error
bars representing the standard deviation within a data set.
Experiments were repeated several times. Panels represents hIL13
alpha-helix A mutants that increased TF-1 cell proliferation (A),
hIL13 alpha-helix A mutants that failed to increase TF-1 cell
proliferation (B), and hIL13 alpha-helix C mutants that failed to
increase TF-1 cell proliferation (C).
[0028] FIG. 4 is a series of photomicrographs of indirect
immunofluorescence analyses of HUVEC for VCAM-1 expression induced
by hIL13 and various hIL13 mutants. Panels A-F and G-J are from two
separate experiments, each with its own set of controls. HUVEC
cells were cultured overnight in media containing buffer alone
(panels A and G) or 1 mg/ml of either wild-type hIL13 (panels B and
H) or various mutants (panels C-F, I and J). Induced expression of
the protein was detected through a rhodamine filter using goat
anti-VCAM-1 IgG primary antibody and rabbit anti-goat IgG
CY3-conjugated secondary antibody. The sensitivity of the imaging
camera was set to detect the level of fluorescence in the control
field, panels A and G. No further adjustments were made to the
sensitivity, allowing for the amount of increased or decreased
fluorescence in the experimental fields to be directly related to
the amount of interleukin-induced VCAM-1 expression.
Photomicrographs are shown at 20.times.magnification
(20.times.).
[0029] FIG. 5 is graphical representations of data obtained from
cytotoxicity assays performed to assess the ability of hIL13 and
hIL13 mutants to block the killing of U-251MG (panel A) and SNB-19
(panel B) cells by hIL13-PE1E. Cultured cells were incubated with
buffer alone, shown in all panels by closed diamonds, or 1 mg/ml of
hIL13 or the indicated mutant for 1 hour at 37.degree. C., prior to
the addition of increasing concentrations of hIL13-PE1E. The
reported data is the average of triplicate samples with the error
bars representing the standard deviation within a data set.
Experiments were repeated several times.
DETAILED DESCRIPTION
[0030] This invention encompasses compositions and methods relating
to hIL13 mutants. The below described preferred embodiments
illustrate adaptations of these compositions and methods.
Nonetheless, from the description of these embodiments, other
aspects of the invention can be made and/or practiced based on the
description provided below.
[0031] Biological Methods
[0032] Methods involving conventional molecular biology techniques
are described herein. Such techniques are generally known in the
art and are described in detail in methodology treatises such as
Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed.
Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989; and Current Protocols in Molecular Biology, ed.
Ausubel et al., Greene Publishing and Wiley-Interscience, New York,
1992 (with periodic updates). Various techniques using polymerase
chain reaction (PCR) are described, e.g., in Innis et al., PCR
Protocols: A Guide to Methods and Applications, Academic Press: San
Diego, 1990. PCR-primer pairs can be derived from known sequences
by known techniques such as using computer programs intended for
that purpose (e.g., Primer, Version 0.5, .COPYRGT.1991, Whitehead
Institute for Biomedical Research, Cambridge, Mass.). The Reverse
Transcriptase Polymerase Chain Reaction (RT-PCR) method used to
identify and amplify certain polynuleotide sequences within the
invention was performed as described in Elek et al., In Vivo,
14:172-182, 2000). Methods for chemical synthesis of nucleic acids
are discussed, for example, in Beaucage and Carruthers, Tetra.
Letts. 22:1859-1862, 1981, and Matteucci et al., J. Am. Chem. Soc.
103:3185, 1981. Chemical synthesis of nucleic acids can be
performed, for example, on commercial automated oligonucleotide
synthesizers. Immunological methods (e.g., preparation of
antigen-specific antibodies, immunoprecipitation, and
immunoblotting) are described, e.g., in Current Protocols in
Immunology, ed. Coligan et al., John Wiley & Sons, New York,
1991; and Methods of Immunological Analysis, ed. Masseyeff et al.,
John Wiley & Sons, New York, 1992.
[0033] Mutant hIL13 Molecules
[0034] The mutant hIL13 molecules of the invention are based on the
amino acid sequence of native hIL13 (SEQ ID NO:1). The hIL13
mutants within the invention differ by one or more amino acids from
native hIL13. For example, hIL13 mutants within the invention can
have 90% or more (e.g., 91, 92, 93, 94, 95, 96, 97, 98, and 99%)
sequence identity with native hIL13. Examples of hIL13 mutants
within the invention are those having the amino acid sequences of
SEQ ID NOs:2-23. These mutants each have a mutation in a domain
corresponding to either the A (residues 9-25 of SEQ ID NO:1), C
(residues 59-71 of SEQ ID NO:1), or D (residues 97-113 of SEQ ID
NO:1) alpha-helices of native hIL13. Each of these features a
substitution of one of the amino acid residues that occurs in
native hIL13. Other hIL13 mutants within the invention are those
with two or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more) such amino
acid substitutions, as well as deletion (e.g., truncation) and
addition (i.e., those with additional amino acids added to the
native hIL13 sequence) mutations.
[0035] Mutants of hIL13 can be made in a number of ways by adapting
techniques well known in the art. See, e.g., Sambrook et al.,
supra; and Ausubel et al., supra. For example, starting with the
known amino acid sequence of hIL13 (i.e., SEQ ID NO:1), the skilled
artisan can chemically synthesize various mutant hIL13 molecules
using, e.g, automated commercial polypeptide synthesizers.
Techniques for solid phase synthesis of polypeptides are well
known. See, e.g., Barany and Merrifield, Solid-Phase Peptide
Synthesis; pp. 3-284 in The Peptides: Analysis, Synthesis, Biology.
Vol. 2: Special Methods in Peptide Synthesis, Part A., Merrifield,
et al., J. Am. Chem. Soc., 85: 2149-2156 (1963), and Stewart et
al., Solid Phase Peptide Synthesis, 2nd ed. Pierce Chem. Co.,
Rockford, Ill. (1984). Using this technique, hIL13 mutants can be
synthesized as a single polypeptide. Alternatively, shorter
oligopeptide portions of the mutant hIL13 molecule can first be
synthesized and then fused together to form the full length mutant
by condensation of the amino terminus of one oligopeptide portion
with the carboxyl terminus of the another oligopeptide portion to
forming a peptide bond. The fusions can then be purified by
standard protein chemistry techniques.
[0036] Mutants of hIL13 can also be produced through recombinant
expression of hIL13-encoding nucleic acids (see below) in which the
nucleic acid is modified, randomly or in a site-specific manner, to
change (substitute), add to, or delete, some or all of the amino
acids in the encoded polypeptide. Site-specific mutations can be
introduced into the IL13-encoding nucleic acid by a variety of
conventional techniques well described in the scientific and patent
literature. Illustrative examples include: site-directed
mutagenesis by overlap extension polymerase chain reaction
(OE-PCR), as in Urban (1997) Nucleic Acids Res. 25: 2227-2228; Ke
(1997) Nucleic Acids Res., 25: 3371-3372, and Chattopadhyay (1997)
Biotechniques 22: 1054-1056, describing PCR-based site-directed
mutagenesis "megaprimer" method; Bohnsack (1997) Mol. Biotechnol.
7: 181-188; Ailenberg (1997) Biotechniques 22: 624-626, describing
site-directed mutagenesis using a PCR-based staggered re-annealing
method without restriction enzymes; Nicolas (1997) Biotechniques
22: 430-434, site-directed mutagenesis using long primer-unique
site elimination and exonuclease III. Unique-site elimination
mutagenesis can also be used (see, e.g., Dang et al. (1992) Anal.
Biochem., 200: 81). The production of mutants of biologically
active proteins such as IFN-beta and IL-2 is described in detail in
U.S. Pat. No. 4,853,332 and the mutation of hIL13 is described in
Example 1 below.
[0037] Other hIL13 mutants can be prepared by chemically modifying
native hIL13 according to known chemical modification methods. See,
e.g., Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel
(1995) Free Radic. Biol. Med. 19: 373-380; Blommers (1994)
Biochemistry 33: 7886-7896. Likewise, hIL13 mutants made by
chemical synthesis or by expression of nucleic acids as described
above can be chemically modified to make additional hIL13
mutants.
[0038] Characterizing hIL13 Mutants
[0039] Mutants of hIL13 can have characteristics that differ from
those native hIL13. For example, native hIL13 has the functional
characteristics of binding both shared receptor and the restrictive
receptor. Native hIL13 also has the characteristic of inducing
transmembrane signals through binding shared receptors expressed on
a cell surface. Such signaling can result in a measurable change in
the cell's physiology. Changes can be the production of second
messengers--e.g, an increase in intracellular [Ca.sup.2+],
activation of protein kinases and/or phosphorylases, changes in
phosphorylation of a substrate, changes in signal transducers and
activators of transcription, etc. They can also be changes in the
cell proteome, e.g., from increased or decreased transcription or
translation. Or they can be changes in a functional or phenotypic
characteristic of the cell. For instance, adding native hIL13 to
TF-1 cells can increase their rate of proliferation. As another
example, adding native hIL13 can cause HUVEC to increase their
expression of VCAM-1.
[0040] Characteristics of a given mutant hIL13 molecule can
therefore be assessed by examining the ability of the molecule to
bind the shared receptor and/or the restrictive receptor.
Similarly, the ability of the mutant molecule to induce
transmembrane signaling can be assessed by examining whether
contacting a cell expressing an IL13 receptor with the mutant
molecule results in a change in the cell's physiology. By these
methods, hIL13 mutants can be characterized as those that bind both
the shared receptor and/or the restrictive receptor, those that
bind only one of the receptors, and those that do not bind either
receptor. By quantifying the affinity of a mutant hIL13 molecule,
it can also be characterized as one that binds with less, about
equal, or more affinity than native hIL13. Mutants of hIL13 can
also be characterized as having or lacking the ability to cause a
transmembrane signal and/or a change in a cell's function or
phenotype. The changes caused by a mutant hIL3 molecule can also be
quantified to further characterize the molecule as one that causes
such changes less than (of less magnitude), about equal to, or more
than (of greater magnitude) those caused by native hIL13. For
instance mutants of hIL13 that specifically bind to an hIL13
receptor associated with a cell in a manner that induces a
measurable change in the cell's physiology can be those that
modulate the proliferation rate of a cell line that expresses an
IL13 receptor such as TF-1 cells. Antagonistic hIL13 mutants are
those that reduce the proliferation rate of the cell line compared
to that induced by native hIL13; agonistic hIL13 mutants are those
that induce about same (e.g., 50-150% or 75-125% of) proliferation
rate of the cell line as that induced by native hIL13; and
superagonistic hIL13 mutants are those that increase the
proliferation rate of the cell line compared to that induced by
native hIL13. See Examples, below.
[0041] Chimeric Molecules of Mutant hIL13 and Effector
Molecules
[0042] The invention also provides a chimeric molecule including a
mutant hIL13 molecule conjugated to an effector molecule. The
effector molecule can be any molecule that can be conjugated to an
hIL13 mutant and exert a particular function. Examples of effector
molecules include cytotoxins, drugs, detectable labels, targeting
ligands, and delivery vehicles.
[0043] A mutant hIL13 molecule conjugated with a one or more
cytoxins can be used to kill cells expressing a receptor to which
the mutant binds. Cytotoxins for use in the invention can be any
cytotoxic agent (i.e., molecule that can kill a cell after
contacting the cell) that can be conjugated to hIL13 or an hIL13
mutant. Examples of cytotoxins include, without limitation,
radionuclides (e.g., .sup.35S, .sup.14C, .sup.32P, .sup.125I,
.sup.131I, .sup.90Y, .sup.89Zr, .sup.201Tl, .sup.186Re, .sup.188Re,
.sup.57Cu, .sup.213Bi, .sup.211At, etc, conjugated radionuclides,
and chemotherapeutic agents. Further examples of cytotoxins
include, but are not limited to, antimetabolites (e.g.,
5-flourouricil (5-FU), methotrexate (MTX), fludarabine, etc.),
anti-microtubule agents (e.g., vincristine, vinblastine,
colchicine, taxanes (such as paclitaxel and docetaxel), etc.),
alkylating agents (e.g., cyclophasphamide, melphalan,
bischloroethylnitrosurea (BCNU), etc.), platinum agents (e.g.,
cisplatin (also termed cDDP), carboplatin, oxaliplatin, JM-216,
CI-973, etc.), anthracyclines (e.g., doxorubicin, daunorubicin,
etc.), antibiotic agents (e.g., mitomycin-C), topoisomerase
inhibitors (e.g., etoposide, tenoposide, and camptothecins), or
other cytotoxic agents such as ricin, diptheria toxin (DT),
Pseudomonas exotoxin (PE) A, PE40, abrin, saporin, pokeweed viral
protein, ethidium bromide, glucocorticoid, and others. See, e.g.
U.S. Pat. No. 5,932,188. Useful variations of PE and DT include
PE38QQR (see, U.S. Pat. No. 5,614,191), PE1E and PE4E (see, e.g.,
Chaudhary et al (1995) J. Biol. Chem., 265:16306), and DT388 and
DT398 (Chaudhary, et al. (1991) Bioch. Biophys. Res. Comm., 180:
545-551) can also be used.
[0044] Mutant hIL13 molecules conjugated with one or more
detectable labels can be used to detect the presence of a receptor
to which the mutant binds, e.g., in diagnostic assays (e.g., in the
detection of shed tumor cells overexpression the IL13 receptor)
and/or in the in vivo localization of tumor cells. Detectable
labels for use in the invention can be any substance that can be
conjugated to hIL13 or an hIL13 mutant and detected. Suitable
detectable labels are those that can be detected, for example, by
spectroscopic, photochemical, biochemical, immunochemical,
electrical, optical or chemical means. Useful detectable labels in
the present invention include biotin or streptavidin, magnetic
beads (e.g., Dynabeads.TM.), fluorescent dyes (e.g., fluorescein
isothiocyanate, texas red, rhodamine, green fluorescent protein,
and the like), radiolabels (e.g., .sup.3H, .sup.125I, .sup.35S,
.sup.14C, .sup.32P, .sup.111In, .sup.97Ru, .sup.67Ga, .sup.68Ga, or
.sup.72As,), radioopaque substances such as metals for
radioimaging, paramagnetic agents for magnetic resonance imaging,
enzymes (e.g., horseradish peroxidase, alkaline phosphatase and
others commonly used in an ELISA), and colorimetric labels such as
colloidal gold or colored glass or plastic (e.g. polystyrene,
polypropylene, latex, etc.) beads.
[0045] Means of detecting such labels are well known to those of
skill in the art. Thus, for example, radiolabels may be detected
using photographic film or scintillation counters, fluorescent
markers may be detected using a photo detector to detect emitted
illumination. Enzymatic labels are typically detected by providing
the enzyme with a substrate and detecting the reaction product
produced by the action of the enzyme on the substrate, and
colorimetric labels are detected by simply visualizing the colored
label, and so forth.
[0046] Mutant hIL13 molecules conjugated with one or more targeting
ligands (i.e., molecules that can bind a particular receptor) can
be used to mediate binding of the mutants to a particular receptor
or cell expressing the receptor. Any targeting ligand that can be
conjugated to hIL13 or an hIL13 mutant can be used. Examples of
such targeting ligands includes antibodies (or the antigen-binding
portion of antibodies); and chemokines, growth factors, soluble
cytokine receptors (e.g., those lacking a transmembrane domain),
superantigens, or other molecules that bind a particular receptor.
A large number of these molecules are known, e.g., IL-2, IL-4,
IL-6, IL-7, tumor necrosis factor (TNF), anti-Tac, TGF-alpha., SEA,
SEB, and the like. As a representative example, an hIL13 mutant can
be conjugated with a soluble form of a hIL13 receptor. This
conjugate, for example, could be used to both antagonize an
endogenous hIL13 receptor on a cell and neutralize any hIL13
present in the vicinity of the cell.
[0047] Mutant hIL13 molecules conjugated with one or more nucleic
acids can be used to specifically target delivery of the nucleic
acid(s) to a target cell (e.g., one expressing an receptor to which
the mutant binds). Any nucleic acid that can be conjugated to hIL13
or an hIL13 mutant can be used. The nucleic acids can be attached
directly to the mutant hIL13, attached via a linker, or complexed
with or encapsulated in another moiety (e.g., a lipid, a liposome,
a viral coat, or the like) that is attached to the mutant IL13
molecule. The nucleic acid can provide any of number of effector
functions. For example, a nucleic acid encoding one or more
proteins can be used to deliver a particular enzymatic activity,
substrate, and/or epitope to a target cell. For these applications
or others where expression (e.g. transcription or translation) of
the nucleic acid is desired, the nucleic acid is preferably a
component of an expression cassette that includes all the
regulatory sequences necessary to express the nucleic acid in the
cell. Suitable expression cassettes typically include promoter
initiation and termination codons, and are selected to optimize
expression in the target cell. Methods of constructing suitable
expression cassettes are well known to those of skill in the art.
See, e.g., Sambrook et al., supra.
[0048] A mutant hIL13 molecule conjugated with a one or more drugs
can be used to deliver such drug(s) to cells expressing a receptor
to which the mutant binds. Any drug which can be conjugated to
hIL13 or an hIL13 mutant can be used. Examples of such drugs
include sensitizing agents that render a target (e.g., tumor) cell
susceptible to various cancer therapeutics. The sensitizing agent
can be a small molecule drug or a gene (under the control of a
promoter in an appropriate expression cassette to induce expression
in the target cell). For example, it has been proposed that
expression of the herpes simplex virus (HSV) thymidine kinase (TK)
gene in proliferating cells, renders the cells sensitive to the
deoxynucleoside analog, ganciclovir. Moolten et at. (1986) Cancer
Res. 46:5276-5281; Moolten et al. (1990) Hum. Gene Ther. 1:
125-134; Moolten et al. (1990) J. Natl. Cancer Inst. 82: 297-300;
Short et al. (1990) J. Neurosci. Res. 27:427-433; Ezzedine et al.
(1991) New Biol. 3: 608-614, Boviatsis et al. (1994) Hum. Gene
Ther. 5: 183-191. HSV-TK mediates the phosphorylation of
ganciclovir, which is incorporated into DNA strands during DNA
replication (S-phase) in the cell cycle, leading to chain
termination and cell death. Elion (1983) Antimicr. Chemother. 12,
sup. B:9-17. A second example of a gene with a drug-conditional
"killing" function is the bacterial cytosine deaminase gene, which
confers chemosensitivity to the relatively non-toxic 5-fluorouracil
precursor 5-fluorocytosine. Mullen et al (1992) Proc. Natl. Acad.
Sci. USA 89: 33-37; Huber et al. (1993) Cancer Res. 53: 4619-4626;
Mullen et al. (1994) Cancer Res. 54: 1503-1506. Still another
example of a gene with a drug-conditional "killing" function is a
cytochrome P450 gene. Expression, of the gene product renders tumor
cells sensitive to a chemotherapeutic agent, in particular,
cyclophosphamide or ifosphamide. See, U.S. Pat. No. 5,688,773. The
drug employed need not be a gene. For example, it can be one of the
compounds that can treat multiple drug resistance of susceptible
tumor cells described in U.S. Pat. No. 4,282,233. Other drugs can
also be used. For example, chemotherapy drugs such as doxorubicin,
vinblastine, genistein, and other described above can be conjugated
to the mutant hIL13 molecule.
[0049] A mutant hIL13 molecule conjugated to a one or more delivery
vehicles is also within the invention. Such conjugates can be used
to deliver other substances such as a drug to cells expressing a
receptor to which the mutant binds. Any delivery vehicle that can
be conjugated to hIL13 or an hIL13 mutant can be used. Examples of
such delivery vehicles include liposomes and lipids (e.g.,
micelles). Liposomes encapsulating drugs or micelles including
drugs may also be used. Methods for preparing liposomes attached to
proteins are well known to those of skill in the art. See, for
example, U.S. Pat. No. 4,957,735; and Connor et al., Pharm. Ther.,
28: 341-365 (1985).
[0050] Effector molecules can be conjugated (e.g., covalently
bonded) to a mutant hIL13 by any method known in the art for
conjugating two such molecules together. For example, the mutant
hIL13 can be chemically derivatized with an effector molecule
either directly or using a linker (spacer). Several methods and
reagents (e.g., cross-linkers) for mediating this conjugation are
known. See, e.g., catalog of Pierce Chemical Company; and Means and
Feeney, Chemical Modification of Proteins, Holden-Day Inc., San
Francisco, Calif. 1971. Various procedures and linker molecules for
attaching various compounds including radionuclide metal chelates,
toxins, and drugs to proteins (e.g., to antibodies) are described,
for example, in European Patent Application No. 188,256; U.S. Pat.
Nos. 4,671,958; 4,659,839; 4,414,148; 4,699,784; 4,680,338;
4,569,789; and 4,589,071; and Borlinghaus et al. Cancer Res. 47:
4071-4075 (1987). In particular, production of various immunotoxins
is well-known within the art and can be found, for example in
"Monoclonal Antibody-Toxin Conjugates: Aiming the Magic Bullet,"
Thorpe et al., Monoclonal Antibodies in Clinical Medicine, Academic
Press, pp. 168-190 (1982); Waldmann (1991) Science, 252: 1657; and
U.S. Pat. Nos. 4,545,985 and 4,894,443.
[0051] Where the effector molecule is a polypeptide, the chimeric
molecule including the hIL13 mutant and the effector can be a
fusion protein. Fusion proteins can be prepared using conventional
techniques in molecular biology to join the two genes in frame into
a single nucleic acid, and then expressing the nucleic acid in an
appropriate host cell under conditions in which the fusion protein
is produced.
[0052] A mutant hIL13 may be conjugated to one or more effector
molecule(s) in various orientations. For example, the effector
molecule may be joined to either the amino or carboxy termini of
the mutant hIL13. The mutant IL13 molecule may also be joined to an
internal region of the effector molecule, or conversely, the
effector molecule may be joined to an internal location of the
mutant IL13 molecule.
[0053] In some circumstances, it is desirable to free the effector
molecule from the mutant hIL13 molecule when the chimeric molecule
has reached its target site. Therefore, chimeric conjugates
comprising linkages that are cleavable in the vicinity of the
target site may be used when the effector is to be released at the
target site. Cleaving of the linkage to release the effector
molecule from the mutant IL13 molecule may be prompted by enzymatic
activity or conditions to which the conjugate is subjected either
inside the target cell or in the vicinity of the target site. When
the target site is a tumor, a linker which is cleavable under
conditions present at the tumor site (e.g. when exposed to
tumor-associated enzymes or acidic pH) may be used. A number of
different cleavable linkers are known to those of skill in the art.
See, e.g., U.S. Pat. Nos. 4,618,492; 4,542,225; and 4,625,014. The
mechanisms for release of an agent from these linker groups
include, for example, irradiation of a photolabile bond and
acid-catalyzed hydrolysis. U.S. Pat. No. 4,671,958, for example,
includes a description of immunoconjugates comprising linkers which
are cleaved at the target site in vivo by the proteolytic enzymes
of the patient's complement system. In view of the large number of
methods that have been reported for attaching a variety of
radiodiagnostic compounds, radiotherapeutic compounds, drugs,
toxins, and other agents to antibodies one skilled in the art will
be able to determine a suitable method for attaching a given
effector molecule to a mutant hIL13 molecule.
[0054] Nucleic Acids Encoding Mutant hIL13 Molecules and Methods of
Making Mutant hIL13 Molecules Using Nucleic Acids
[0055] The invention also provides purified nucleic acids encoding
the mutant hIL13 molecules and the fusion proteins described above.
Starting with a known protein sequence, DNA encoding the mutant
hIL13 molecules or the fusion proteins may be prepared by any
suitable method, including, for example, cloning and restriction of
appropriate sequences or direct chemical synthesis by methods such
as the phosphotriester method of Narang et al. (1979) Meth.
Enzymol. 68: 90-99; the phosphodiester method of Brown et al.
(1979) Meth. Enzymol. 68: 109-151; the diethylphosphoramidite
method of Beaucage et al. (1981) Tetra. Lett., 22: 1859-1862; and
the solid support method of U.S. Pat. No. 4,458,066. Because of the
degeneracy of the genetic code, a large number of different nucleic
acids will encode the mutant hIL13 molecules and the fusion
proteins. Each of these is included within the invention.
[0056] Chemical synthesis produces a single stranded
oligonucleotide. This may be converted into double stranded DNA by
hybridization with a complementary sequence, or by polymerization
with a DNA polymerase using the single strand as a template. Longer
DNA sequences may be obtained by the ligation of shorter sequences.
Alternatively, subsequences may be cloned and the appropriate
subsequences cleaved using appropriate restriction enzymes. The
fragments may then be ligated to produce the desired DNA
sequence.
[0057] DNA encoding the mutant hIL13 molecules or the fusion
proteins may be cloned using DNA amplification methods such as
polymerase chain reaction (PCR). Thus, in a preferred embodiment,
the gene for hIL13 is PCR amplified, using primers that introduce
one or more mutations. The primers preferably include restrictions
sites, e.g., a sense primer containing the restriction site for
NdeI and an antisense primer containing the restriction site for
HindIII. In one embodiment, the primers are selected to amplify the
nucleic acid starting at position 19, as described by McKenzie et
al. (1987), supra. This produces a nucleic acid encoding the mature
IL13 sequence (or mutant hIL13 molecules) and having terminal
restriction sites.
[0058] For making DNA encoding the fusion proteins, the DNA
encoding the effector molecule can be obtained from available
sources. For example, the PE38QQR fragment may be excised from the
plasmid pWDMH4-38QQR or plasmid pSGC242FdNl as described by
Debinski et al. Int. J. Cancer, 58: 744-748 (1994), and by Debinski
et al. ( 1994) Clin. Cancer Res. 1:1015-1022 respectively. Ligation
of the mutant IL13 molecule and a Pseudomonas exotoxin (e.g.,
PE38QQR) sequences and insertion into a vector produces a vector
encoding the mutant IL13 joined to the terminus of the Pseudomonas
exotoxin (e.g., joined to the amino terminus of PE38QQR, PE1E, or
PE4E (position 253)). In a preferred embodiment, the two molecules
are joined directly. Alternatively there can be an intervening
peptide linker (e.g., a three amino acid junction consisting of
glutamic acid, alanine, and phenylalanine introduced by the
restriction site).
[0059] While the two molecules are preferably essentially directly
joined together, one of skill will appreciate that the molecules
may be separated by a peptide spacer consisting of one or more
amino acids. Generally the spacer will have no specific biological
activity other than to join the proteins or to preserve some
minimum distance or other spatial relationship between them.
However, the constituent amino acids of the spacer may be selected
to influence some property of the molecule such as the solubility,
folding, net charge, or hydrophobicity.
[0060] The nucleic acid sequences encoding the mutant hIL13
molecules or the fusion proteins may be expressed in a variety of
host cells, including E. coli, other bacterial hosts, yeast, and
various higher eukaryotic cells such as the COS, CHO and HeLa cells
lines and myeloma cell lines. The recombinant protein gene will be
operably linked to appropriate expression control sequences for
each host. F or E. coli this includes a promoter such as the T7,
trp, or lambda promoters, a ribosome binding site and preferably a
transcription termination signal. For eukaryotic cells, the control
sequences will include a promoter and preferably an enhancer
derived from immunoglobulin genes, SV 40, cytomegalovirus, etc.,
and a polyadenylation sequence, and may include splice donor and
acceptor sequences.
[0061] Plasmid vectors of the invention made as described above can
be transferred into the chosen host cell by well-known methods such
as calcium chloride, or heat shock, transformation for E. coli and
calcium phosphate treatment or electroporation for mammalian cells.
Cells transformed by the plasmids can be selected by resistance to
antibiotics conferred by genes contained on the plasmids, such as
the amp, gpt, neo and hyg genes.
[0062] Once expressed, the recombinant mutant hIL13 molecules or
fusion proteins can be purified according to standard procedures of
the art, including ammonium sulfate precipitation, affinity
columns, column chromatography, gel electrophoresis and the like.
See, generally, R. Scopes, Protein Purification, Springer-Verlag,
N.Y. (1982); and Deutscher, Methods in Enzymology Vol. 182: Guide
to Protein Purification, Academic Press, Inc. N.Y. (1990).
Substantially pure compositions of at least about 90 to 95%
homogeneity are preferred, and 98 to 99% or more homogeneity are
most preferred for pharmaceutical uses. Once purified, partially or
to homogeneity as desired, the polypeptides may then be used
therapeutically.
[0063] After chemical synthesis, biological expression, or
purification, the mutant hIL13 molecules or the fusion proteins may
possess a conformation substantially different than the native
conformations of the constituent polypeptides. In this case, it may
be necessary to denature and reduce the polypeptide and then to
cause the polypeptide to re-fold into the preferred conformation.
Methods of reducing and denaturing proteins and inducing re-folding
are well known to those of skill in the art. See, Debinski et al.
(1993) J. Biol. Chem., 268: 14065-14070; Kreitman and Pastan (1993)
Bioconjug. Chem., 4: 581-585; and Buchner, et al. (1992) Anal.
Biochem., 205: 263-270.
[0064] Modifications can be made to the IL13 receptor targeted
fusion proteins without diminishing their biological activity. Some
modifications may be made to facilitate the cloning, expression, or
incorporation of the targeting molecule into a fusion protein. Such
modifications are well known to those of skill in the art and
include, for example, a methionine added at the amino terminus to
provide an initiation site, or additional amino acids placed on
either terminus to create conveniently located restriction sites or
termination codons.
[0065] Antibodies
[0066] Mutants of hIL13 (or immunogenic fragments or analogs
thereof) can be used to raise antibodies useful in the invention.
Such polypeptides can be produced by recombinant techniques or
synthesized as described above. In general, hIL13 mutants can be
coupled to a carrier protein, such as KLH, as described in Ausubel
et al., supra, mixed with an adjuvant, and injected into a host
mammal. Antibodies produced in that animal can then be purified by
peptide antigen affinity chromatography. In particular, various
host animals can be immunized by injection with an hIL13 mutant or
an antigenic fragment thereof. Commonly employed host animals
include rabbits, mice, guinea pigs, and rats. Various adjuvants
that can be used to increase the immunological response depend on
the host species and include Freund's adjuvant (complete and
incomplete), mineral gels such as aluminum hydroxide, surface
active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and
dinitrophenol. Other potentially useful adjuvants include BCG
(bacille Calmette-Guerin) and Corynebacterium parvum.
[0067] Polyclonal antibodies are heterogeneous populations of
antibody molecules that are contained in the sera of the immunized
animals. Antibodies within the invention therefore include
polyclonal antibodies and, in addition, monoclonal antibodies,
single chain antibodies, Fab fragments, F(ab').sub.2 fragments, and
molecules produced using a Fab expression library. Monoclonal
antibodies, which are homogeneous populations of antibodies to a
particular antigen, can be prepared using the mutants of hIL13
described above and standard hybridoma technology (see, for
example, Kohler et al., Nature 256:495, 1975; Kohler et al., Eur.
J. Immunol. 6:511, 1976; Kohler et al., Eur. J. Immunol. 6:292,
1976; Hammerling et al., "Monoclonal Antibodies and T Cell
Hybridomas, " Elsevier, N.Y., 1981; Ausubel et al., supra). In
particular, monoclonal antibodies can be obtained by any technique
that provides for the production of antibody molecules by
continuous cell lines in culture such as described in Kohler et
al., Nature 256:495, 1975, and U.S. Pat. No. 4,376,110; the human
B-cell hybridoma technique (Kosbor et al., Immunology Today 4:72,
1983; Cole et al., Proc. Natl. Acad. Sci. USA 80:2026, 1983), and
the EBV-hybridoma technique (Cole et al., "Monoclonal Antibodies
and Cancer Therapy," Alan R. Liss, Inc., pp. 77-96, 1983). Such
antibodies can be of any immunoglobulin class including IgG, IgM,
IgE, IgA, IgD and any subclass thereof. A hybridoma producing a mAb
of the invention may be cultivated in vitro or in vivo. The ability
to produce high titers of mabs in vivo makes this a particularly
useful method of production.
[0068] Once produced, polyclonal or monoclonal antibodies can be
tested for specific recognition of the mutants by Western blot or
immunoprecipitation analysis by standard methods, for example, as
described in Ausubel et al., supra. Antibodies that specifically
recognize and bind to hIL13 mutants are useful in the invention.
For example, such antibodies can be used to monitor the amount of
an hIL13 mutant associated with a cell or to block binding of a
particular mutant a receptor.
[0069] Antibodies of the invention can be produced using fragments
of the hIL13 mutants that lie outside highly conserved regions and
appear likely to be antigenic, by criteria such as high frequency
of charged residues. Cross-reactive anti-hIL13 mutant antibodies
are produced using a fragment of a hIL13 mutant that is conserved
amongst members of this family of proteins. In one specific
example, such fragments are generated by standard techniques of
PCR, and are then cloned into the pGEX expression vector (Ausubel
et al., supra). Fusion proteins are expressed in E.coli and
purified using a glutathione agarose affinity matrix as described
in Ausubel, et al., supra. Non-cross reactive antibodies can be
prepared by adsorbing the antibody with the antigen(s) that the
antibody is desired not to react with. For example, antisera
prepared against a particular hIL13 mutant can be adsorbed with
other hIL13 mutants and/or native hIL13 to reduce or eliminate
cross-reactivity.
[0070] In some cases it may be desirable to minimize the potential
problems of low affinity or specificity of antisera. In such
circumstances, two or three fusions can be generated for each
protein, and each fusion can be injected into at least two rabbits.
Antisera can be raised by injections in a series, preferably
including at least three booster injections. Antiserum is also
checked for its ability to immunoprecipitate recombinant mutants of
hIL13 or control proteins, such as glucocorticoid receptor, CAT, or
luciferase.
[0071] Techniques described for the production of single chain
antibodies (U.S. Pat. Nos. 4,946,778, 4,946,778, and 4,704,692) can
be adapted to produce single chain antibodies against an hIL13
mutant, or a fragment thereof. Single chain antibodies are formed
by linking the heavy and light chain fragments of the Fv region via
an amino acid bridge, resulting in a single chain polypeptide.
[0072] Antibody fragments that recognize and bind to specific
epitopes can be generated by known techniques. For example, such
fragments include but are not limited to F(ab').sub.2 fragments
that can be produced by pepsin digestion of the antibody molecule,
and Fab fragments that can be generated by reducing the disulfide
bridges of F(ab').sub.2 fragments. Alter-natively, Fab expression
libraries can be constructed (Huse et al., Science 246:1275, 1989)
to allow rapid and easy identification of monoclonal Fab fragments
with the desired specificity.
[0073] The antibodies of the invention can be used, for example, in
the detection of a hIL13 mutant in a biological sample. Antibodies
can also be used to interfere with the interaction of an hIL13
mutant and other molecules that bind the mutant (e.g., an hIL13
receptor).
[0074] Methods of Delivering a Mutant hIL13 Molecule to a Cell
[0075] The invention also provides a method of delivering an IL13
mutant to a cell. This method is useful, among other things, for
directing a chimeric molecule including the hIL13 mutant and an
effector molecule to a cell so that the effector molecule can exert
its function. For example, an hIL13 mutant conjugated to a
cytotoxin can be delivered to a target cell to be killed by mixing
a composition containing the chimeric molecule with the target cell
expressing a receptor that binds the mutant. As another example, an
hIL13 mutant conjugated to a detectable label can be directed to a
target cell to be labeled by mixing a composition containing the
chimeric molecule with the target cell expressing a receptor that
binds the mutant.
[0076] Mutant hIL13 molecules can be delivered to a cell by any
known method. For example, a composition containing the hIL13
mutant can be added to cells suspended in medium. Alternatively, a
mutant hIL13 can be administered to an animal (e.g., by a
parenteral route) having a cell expressing a receptor that binds
the mutant so that the mutant binds to the cell in situ. The mutant
ILI3 molecules of this invention are particularly well suited as
targeting moieties for binding tumor cells because tumor cells
overexpress ILI3 receptors. In particular, carcinoma tumor cells
(e.g. renal carcinoma cells) overexpress ILI3 receptors at levels
ranging from about 2100 sites/cell to greater than 150,000 sites
per cell. Similarly, gliomas and other transformed cells also
overexpress ILI3 receptors (ILI3R). Thus, the methods of this
invention can be used to target an effector molecule to a variety
of cancers. Such cancers are well known to those of skill in the
art and include, but are not limited to, cancers of the skin (e.g.,
basal or squamous cell carcinoma, melanoma, Kaposi's sarcoma,
etc.), cancers of the reproductive system (e.g., testicular,
ovarian, cervical), cancers of the gastrointestinal tract (e.g.,
stomach, small intestine, large intestine, colorectal, etc.),
cancers of the mouth and throat (e.g. esophageal, larynx,
oropharynx, nasopharynx, oral, etc.), cancers of the head and neck,
bone cancers, breast cancers, liver cancers, prostate cancers
(e.g., prostate carcinoma), thyroid cancers, heart cancers, retinal
cancers (e.g., melanoma), kidney cancers, lung cancers (e.g.,
mesothelioma), pancreatic cancers, brain cancers (e.g. gliomas,
medulloblastomas, meningiomas, etc) and cancers of the lymph system
(e.g. lymphoma). In a particularly preferred embodiment, the
methods of this invention are used to target effector molecules to
brain cancers (especially gliomas).
[0077] One of skill in the art will appreciate that identification
and confirmation of ILI3 overexpression by other cells requires
only routine screening using well-known methods. Typically this
involves providing a labeled molecule that specifically binds to
the ILI3 receptor (e.g., a native or mutant ILI3). The cells in
question are then contacted with this molecule and washed.
Quantifying the amount of label remaining associated with the test
cell provides a measure of the amount of ILI3 receptor (ILI3R)
present on the surface of that cell. In a preferred embodiment,
ILI3 receptor may be quantified by measuring the binding of
.sup.125I-labeled IL13 (.sup.125I-ILI3) to the cell in question.
Details of such a binding assay are provided in U.S. Pat. No.
5,614,191.
[0078] As IL13 has been implicated in playing an important
regulatory role in allergic hyperactivity reactions such as asthma
(Webb et al. (2000) J. Immunol. 165:108-113), the invention also
provides a method of modulating an allergic response by contacting
a cell important in the response (e.g., a lymphocyte such as a B
cell, an eosinophil, a mast cell, and/or any other cells involved
in Th.sub.2-dominated inflammatory responses) with one or more
hIL13 mutants. Thus, for example, where interaction of native hIL13
with an hIL13 receptor expressed on a cell causes transmembrane
signals that contribute to the cell's role in an allergic reaction
(e.g., inducing inflammation), a mutant hIL13 can be used to block
this interaction and inhibit the allergic reaction. The interaction
between native hIL13 and the IL13 receptor can be blocked, for
example, by contacting the cell 1 can with an hIL13 mutant that
binds to the IL13 receptor (in some cases with more affinity than
native hIL13) but does not cause the transmembrane signaling
through the receptor. For asthma, such an hIL13 mutant could be
administered by inhalation of a pharmaceutical composition
containing the mutant.
[0079] Pharmaceutical Compositions
[0080] The mutant hIL13 molecules (including those conjugated with
an effector molcule) of this invention can be prepared for
parenteral, topical, oral, or local administration, such as by
aerosol or transdermally, for prophylactic and/or therapeutic
treatment. The pharmaceutical compositions can be administered in a
variety of unit dosage forms depending upon the method of
administration. For example, unit dosage forms suitable for oral
administration include powder, tablets, pills, capsules and
lozenges. It some cases it may be desirable to protect the fusion
proteins and pharmaceutical compositions of this invention, from
being digested (e.g., when administered orally). This can be
accomplished either by complexing the protein with a composition
that renders it resistant to acidic and enzymatic hydrolysis, or by
packaging the protein in an appropriately resistant carrier such as
a liposome. Means of protecting compounds from digestion are well
known in the art (see, e.g., U.S. Pat. No. 5,391,377 describing
lipid compositions for oral delivery of therapeutic agents).
[0081] The pharmaceutical compositions can also be delivered to an
animal by inhalation by any presently known suitable technique. For
example, the hIL13 mutants of the invention can be a delivered in
the form of an aerosol spray produced from pressurized packs or a
nebulizer, with the use of a suitable propellant such as
dichlorodifluromethane, trichlorotri-fluoromethane,
dichlorotetraflurorethane, carbon dioxide, or any other suitable
gas. In the case of a pressurized aerosol, the dosage unit may be
controlled using a valve to deliver a metered amount. Capsules and
cartridges (e.g., of gelatin) containing a powder mix of the hIL13
mutant and a suitable base (e.g., lactose or starch) can be used in
an inhaler or insufflator to deliver the mutant to the respiratory
tract of an animal.
[0082] The pharmaceutical compositions of this invention are
particularly useful for parenteral administration, such as
intravenous administration or administration into a body cavity or
lumen of an organ. The compositions for administration will
commonly comprise a solution of the mutant hIL13 molecule dissolved
in a pharmaceutically acceptable carrier, preferably an aqueous
carrier. A variety of aqueous carriers can be used, e.g., buffered
saline and the like. These solutions are sterile and generally free
of undesirable matter (e.g., pyrogens). These compositions may be
sterilized by conventional, well known sterilization techniques.
The compositions may contain pharmaceutically acceptable auxiliary
substances as required to approximate physiological conditions such
as pH adjusting and buffering agents, toxicity adjusting agents and
the like, for example, sodium acetate, sodium chloride, potassium
chloride, calcium chloride, sodium lactate and the like. The
concentration of the mutant hIL13 in these formulations can vary
widely, and will be selected primarily based on fluid volumes,
viscosities, body weight and the like in accordance with the
particular mode of administration selected and the patient's needs.
Actual methods for preparing parenterally administrable
compositions will be known or apparent to those skilled in the art
and are described in more detail in such publications as
Remington's Pharmaceutical Science, 15th ed., Mack Publishing
Company, Easton, Pa. (1980).
[0083] Toxicity and therapeutic efficacy of the pharmaceutical
compositions utilized in the invention can be determined by
standard pharmaceutical procedures, using either cells in culture
or experimental animals to determine the LD.sub.50 (the dose lethal
to 50% of the population) and the ED.sub.50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD.sub.50/ED.sub.50. Doses that
exhibit large therapeutic indices are preferred. While those that
exhibit toxic side effects may be used, care should be taken to
design a delivery system that targets the pharmaceutical
composition to the site of affected tissue in order to minimize
potential damage to uninfected cells and, thereby, reduce side
effects.
[0084] The data obtained from cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such pharmaceutical compositions lies
preferably within a range of circulating concentrations that
include an ED.sub.50 with little or no toxicity. The dosage may
vary within this range depending upon the dosage form employed and
the route of administration utilized. For any pharmaceutical
composition used in a method of the invention, the therapeutically
effective dose can be estimated initially from cell culture assays.
A dose can be formulated in animal models to achieve an lC.sub.50
(that is, the concentration of the test compound which achieves a
half-maximal inhibition of symptoms) as determined in cell culture.
Such information can be used to more accurately determine useful
doses in humans. Levels in plasma can be measured, for example, by
high performance liquid chromatography. Although dosage should be
determined for each particular application, it is expected that a
dose of a typical pharmaceutical composition for intravenous
administration would be about 0.1 to 10 mg per patient per day.
Dosages from 0.1 up to about 100 mg per patient per day may be
used, particularly when the pharmaceutical compositions is
administered to a secluded site and not into the blood stream, such
as into a body cavity or into a lumen of an organ.
[0085] The compositions containing the present hIL13 mutants, or a
cocktail thereof (i.e., with other proteins), can be administered
for therapeutic treatments. In therapeutic applications,
compositions are administered to a patient suffering from a
disease, in an amount sufficient to cure or at least partially
arrest the disease and its complications. An amount adequate to
accomplish this is defined as a "therapeutically effective dose."
Amounts effective for this use will depend upon the severity of the
disease and the general state of the patient's health. Single or
multiple administrations of the compositions may be administered
depending on the dosage and frequency as required and tolerated by
the patient. In any event, the composition should provide a
sufficient quantity of the proteins of this invention to
effectively treat the patient.
[0086] Among various uses of the cytotoxic fusion proteins of the
present invention are included a variety of disease conditions
caused by specific human cells that may be eliminated by the toxic
action of the protein. One preferred application is the treatment
of cancer (e.g., a glioma), such as by the use of an mutant IL13
ligand attached to a cytotoxin (e.g., PE or a PE derivative).
[0087] It will be appreciated by one of skill in the art that there
are some regions that are not heavily vascularized or that are
protected by cells joined by tight junctions and/or active
transport mechanisms which reduce or prevent the entry of
macromolecules present in the blood stream. For example, systemic
administration of therapeutics to treat gliomas, or other brain
cancers, is constrained by the blood-brain barrier which resists
the entry of macro-molecules into the subarachnoid space. Thus, the
therapeutic compositions of this invention can be administered
directly to the tumor site. For instance, brain tumors (e.g.,
gliomas) can be treated by administering the therapeutic
composition directly to the tumor site (e.g., through a surgically
implanted catheter). Where the fluid delivery through the catheter
is pressurized, small molecules ( e.g. the therapeutic molecules of
this invention) will typically infiltrate as much as two to three
centimeters beyond the tumor margin.
[0088] Alternatively, the therapeutic composition can be placed at
the target site in a slow release formulation (e.g., a
thrombin-fibrinogen mixture). Such formulations can include, for
example, a biocompatible sponge or other inert or resorbable matrix
material impregnated with the therapeutic composition, slow
dissolving time release capsules or microcapsules, and the
like.
[0089] Typically the catheter, or catheters, or time release
formulation will be placed at the tumor site as part of a surgical
procedure. Thus, for example, where major tumor mass is surgically
debulked, the perfusing catheter or time release formulation can be
emplaced at the tumor site as an adjunct therapy. Of course,
surgical removal of the tumor mass may be undesired, not required,
or impossible, in which case, the delivery of the therapeutic
compositions of this invention may comprise the primary therapeutic
modality.
[0090] Imaging
[0091] The invention also provides a method of imaging a cell
expressing a receptor that binds an hIL13 mutant in vivo. In an
exemplary method, an hIL13 mutant conjugated to a label detectable
by the chosen imaging technique is administered to an animal having
the cell expressing a receptor that binds the particular hIL13
mutant. The animal is then imaged using the chosen imaging
technique. Examples of labels useful for diagnostic imaging include
radiolabels such as .sup.131I, .sup.111In, 123I, .sup.99mTc,
.sup.32P, .sup.125I, .sup.3H, .sup.14C, and .sup.188Rh; fluorescent
labels such as fluorescein and rhodamine; nuclear magnetic
resonance active labels; positron emitting isotopes detectable by a
positron emission tomography ("PET") scanner; chemiluminescent
labels such as luciferin; and enzymatic markers such as peroxidase
or phosphatase. Mutants of hIL13 can be labeled with such reagents
as described above or using techniques known in the art.
[0092] Any imaging technique compatible with the labeled-hIL13
mutant can be used. Examples of such techniques include
immunoscintigraphy where a gamma camera is used to detect the
location and distribution of gamma-emitting radioisotopes; MRI
where a paramagnetic labeled-hIL13 mutant is used; PET where an
hIL13 mutant is conjugated with a positron emitting label; and
X-ray imaging where an hIL13 mutant is conjugated with a
radioopaque label (e.g., a metal particle). A more detailed
description of such techniques is provided in Handbook of Targeted
Delivery of Imaging Agents (Handbook of Pharmacology and
Toxicology), ed. V. Torchilin, CRC Press, 1995; Armstrong et al.,
Diagnostic Imaging, Blackwell Science Inc., 1998; and Diagnostic
Nuclear Medicine, ed. C. Schiepers, Springer Verlag, 2000.
[0093] As an illustrative example, the location of glioma tumor
cells in an animal can be determined by injecting (e.g.,
parenterally or in situ) an animal with a composition including
native hIL13 or an hIL13 mutant conjugated to a detectable label
(e.g., a gamma emitting radioisotope). The composition is then
allowed to equilibrate in the animal, and to bind to the glioma
cells. The animal is then subjected to imaging (e.g., using a gamma
camera) to image where the glioma cells are.
[0094] Diagnostic Kits
[0095] In another embodiment, this invention provides for kits for
the treatment of tumors or for the detection of cells
overexpressing IL 13 receptors. Kits will typically comprise a
chimeric molecule of the present invention (e.g., a mutant hIL13
conjugated to a detectable label, a mutant hIL13 conjugated to
cytotoxin, a mutant IL13 conjugated to a targeting ligand, etc.).
In addition the kits will typically include instructional materials
disclosing means of use of chimeric molecule ( e.g., as a
cytotoxin, for detection of tumor cells, to augment an immune
response, etc.). The kits may also include additional components to
facilitate the particular application for which the kit is
designed. Thus, for example, where a kit contains a chimeric
molecule in which the effector molecule is a detectable label, the
kit may additionally contain means of detecting the label (e.g.
enzyme substrates for enzymatic labels, filter sets to detect
fluorescent labels, appropriate secondary labels such as a sheep
anti-mouse-HRP, or the like). The kits may additionally include
buffers and other reagents routinely used for the practice of a
particular method. Such kits and appropriate contents are well
known to those of skill in the art.
EXAMPLES
[0096] The present invention is further illustrated by the
following specific examples. The examples are provided for
illustration only and are not to be construed as limiting the scope
or content of the invention in any way.
Example 1
Materials and Methods
[0097] Restriction endonucleases and DNA ligase were obtained from
New England Biolabs (Beverly, Mass.), Bethesda Research
Laboratories (BRL, Gaithersburg, Md.) and Boehringer Mannheim
(Indianapolis, Ind.). U.S.E. mutagenesis kit, fast protein liquid
chromatographic (FPLC) system, columns and media were obtained from
Pharmacia (Piscataway, N.J.). Oligonucleotide primers were
synthesized at the Macromolecular Core Laboratory, Penn State
College of Medicine. Polymerase chain reaction (PCR) kit was from
Perkin-Elmer Cetus (Norwalk, Conn.). Tissue culture ware was from
Corning (Corning, N.Y.). 3-(4,5-dimethylthiazol-2-yl)-5-(3--
carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (inner
salt)/phenazine methasulfate (MTS/PMS) non-radioactive cell
proliferation assay was purchased from Promega (Madison, Wis.).
SDS-PAGE supplies were from BioRad (Hercules, Calif.). Antibodies
were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.).
SuperSignal Substrate for chemiluminescent detection was purchased
from Pierce (Rockford, Ill.). Cell lines were obtained from the
American Type Culture Collection (Rockville, Md.). MTS/PMS for cell
titer 96 aqueous non-radioactive cell proliferation assay was
purchased from Promega (Madison, Wis.).
[0098] For recombinant protein expression in a prokaryotic system,
all plasmids carrying the genes encoding proteins of interest were
under a T7 promoter-based expression system. The plasmids were
constructed as described in Debinski et al., (1998) Nature
Biotech., 16:449-453. BL21(1DE3) E. coli, which carry the T7 RNA
polymerase gene in an isopropyl-1-thio-b-galactopyranoside (IPTG)
inducible form, were used as the host for recombinant protein
expression. Production of recombinant proteins driven by T7 RNA
polymerase allowed production of milligram quantities of
recombinant protein from a 1.0 liter culture induced at A.sub.600
of 2.0.
[0099] For expression of proteins, competent BL21 cells were
transformed with the appropriate plasmids and grown in Terrific
Broth (DIFCO Laboratories, Detroit Mich.) to A.sub.600 equal to
2.0, at which point IPTG was added to a final concentration of 250
mM. Cells were harvested 90 min. later. The inclusion body fraction
of the cells was isolated and denatured in 7M guanidine HCl, then
renatured by rapid dilution into buffer, using the
disulfide-shuffling method as was previously described in Debinski
et al. (1993) J. Biol. Chem., 268:14065-14070. After dialysis, the
renatured proteins were purified using a Pharmacia fast protein
liquid chromatography (FPLC) system.
[0100] For mutagenesis, mutations of the hIL13 gene were made by
standard PCR protocols (using the mutated oligonucleotides as sense
or anti-sense primers in PCR) or by using a unique site elimination
(U.S.E.) mutagenesis kit, based on the procedure developed by Deng
and Nickoloff in Anal. Biochem., 200:81-88, 1992. Examples of
primers used for the mutagenesis are shown below in table 1. All
mutated plasmids were isolated and sequenced to verify the correct
mutation prior to use.
1TABLE 1 hIL13.E13D: TTTGTGTGTCATATGTCCCCAGGCCCTGTG-
CCTCCCTCTACAGCCCTCAGGGACCTCATTGAGGAG hIL13.E13I:
TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGATCCTCATTGAGGAG
hIL13.E13K: AGGAGATATACATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGG-
AAGCTCATTGAGGA hIL13.E13R: TTTGTGTGTCATATGTCCCCAGGCCCTGTGC-
CTCCCTCTACAGCCCTCAGGCGCCTCATTGAGGAG hIL13.E13S:
TTTGTGTGTCATATGTCCCGAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGTCTCTCATTGAGGAG
WP070776;1 hIL13.E13Y: TTTGTGTGTCATATGTCCCCAGGCC-
CTGTGCCTCCCTCTACAGCCCTCAGGTACCTCATTGAGGAG hIL13.E16K:
TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGGAGCTCATTAAGGAGCTGGT
hIL13.E17K: TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCTCTACAGCCCTC-
AGGGAGCTCATTGAGAAGCTGGTCA hIL13.R66D:
ATGGAGAAGACCCAGGACATGCTGAGCGGATTC hIL13.D69D:
ACCCAGAGGATGCTGGACGGATTCTGCCCGCAC
[0101] For polyacrylamide gel electrophoresis and immunoblotting,
the purity of the isolated recombinant proteins was determined by
sodium dodecyl sulfate polyacrylamide gel electrophoresis, under
nonreducing conditions. The separated proteins in the gel were
stained either with Coomassie Blue for visual inspection or
transferred to polyvinylidene difluoride (PVDF) membrane for
Western blot analysis. For Western blot analysis, the PVDF with the
transferred proteins was incubated in 5% nonfat milk in phosphate
buffered saline (PBS) for one hour at room temperature. The
membrane was incubated for one hour in 5% milk/PBS containing goat
anti-human IL13 antibody (1:1,000 dilution). The antibody was
raised against a hIL13 specific peptide located at the carboxy
terminus of hIL13. After incubation with the primary antibody, the
membrane was washed three times, five min. each, with 0.05% Tween
20/PBS. The membrane was then incubated for one hour in 5% milk/PBS
containing donkey anti-goat IgG conjugated with horseradish
peroxidase (1:20,000 dilution). The membrane was washed three
times, five min. each, with 0.05% Tween 20/PBS. The immuno-reactive
proteins were identified on film, using enhanced chemiluminescence
detection. Images were digitized using a Hewlett Packard Scan-Jet
6100C scanner and composited using Microsoft Powerpoint
software.
[0102] For circular dichroism (CD), CD spectra for the proteins
were obtained over the wavelength range of 185-260 nm using a Jasco
J-710 spectropolarimeter. All measurements were carried at
37.degree. C., using the same cuvette, the same orientation of the
cuvette to the light source, and a 2 mm light path. Proteins (0.1
mg/ml) were resuspended in phosphate buffered saline (PBS) and then
analyzed. For unfolded samples, protein was resuspended in 8M urea
containing 40 mM DTT (denaturation buffer). Reported spectra were
the average of three consecutive runs for each sample. Spectra from
appropriate blanks, PBS alone or denaturation buffer, were
subtracted from each sample so that the resulting spectra reflected
only the CD contribution of the proteins.
[0103] For cell proliferation assays, cell killing by cytotoxins
was tested as follows. 5.times.10.sup.3 cells per well were plated
in a 96-well tissue culture plate in 150 ml of media. Various
concentrations of cytotoxins were diluted in 0.1% BSA/PBS and 25 ml
of each dilution was added to cells 18-24 h following cell plating.
Cells were incubated at 37 .degree. C. for another 48 h. Then, the
cytotoxicity was determined using a colorimetric MTS
[3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxypheny-
l)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt]/PMS (phenazine
methasulfate) cell proliferation assay. MTS/PMS was added at a half
final concentration as recommended by the manufacturer. The cells
were incubated with the dye for 4 hr and then the absorbance was
measured at 490 nm for each well using a micro-plate reader
(Cambridge Technology, Inc., Watertown, Mass.). The wells
containing cells treated with cycloheximide (10 mM) or wells with
no viable cells left served as a background for the assay. For
blocking studies, interleukins at a concetration of 1.0 ug/ml were
added to cells for 60 min before the cytotoxins addition.
[0104] Cell proliferation studies using TF-1 cells (pre-leukemic
human B cells, which express the shared IL13/4 receptor) were
performed by growing the cells in the presence of different
concentrations of wild-type interleukins or their mutants in 96
well culture plates. After 72 h of incubation at 37.degree. C., the
rate of proliferation of the TF-1 cells was determined by a
colorimetric MTS [3-(4,5-dimethylthiazol-2-
-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium,
inner salt]/PMS (phenazine methasulfate) cell proliferation assay.
The cell samples were incubated with the dye for four h then their
absorbance at 490 nm was recorded for each well using a microplate
reader. The wells with cells treated with high concentrations of
cycloheximide served as background for the assay.
[0105] For indirect immunofluorescence analyses, HUVEC were seeded
onto an eight chambered slide, 50,000 cells per chamber, and
incubated overnight at 37.degree. C. to allow cells to attach. The
media was removed and replaced with media containing hIL13 or its
mutants (1 mg/ml final concentration). The cells were incubated
again overnight at 37.degree. C. The next day, the media was
removed, the cells were fixed in ethanol and incubated with
blocking media (10% normal rabbit serum in PBS) at room temperature
for 20 min. The blocking media was removed and goat anti-VCAM-1
antibody (1 ug/ml) in 1.5% normal rabbit serum/PBS was added. Cells
were incubated at room temperature for one hour, then primary
antibody was removed and cells rinsed three times, five min. each,
with PBS. Cells were incubated with rabbit anti-goat IgG-Cy3
conjugate (1:150 dilution) in 1.5% normal rabbit serum/PBS for 45
min. at room temperature, in the dark. After 45 min., the cells
were rinsed three times, five min. each, with PBS, a coverslip was
mounted using aqueous mounting medium, and the fluorescent staining
determined using a rhodamine filter set. Images were obtained from
the same experiment without adjusting the microscope between
samples on a Zeiss Axioplan microscope and captured digitally using
Snappy by Play Inc.
[0106] For cytotoxicity-blocking assays, glioblastoma cells (U-251
MG and SNB-19) were plated into 96-well culture plates and
incubated for 24 h. After 24 h, hIL13 or its mutants were added to
cells and incubated for one hour at 37.degree. C. An equal volume
of 0.1% BSA in PBS was added to cells for assays without blocking
ligand. After the hour incubation, increasing concentration of the
hIL13 chimeric toxin (hIL13-PE1E; see Debinski, et al. (1996) J.
Biol. Chem., 271, 22428-22433)) was added (0.001-10 ng/ml final
concentration) and the cells were incubated for three days. After
three days, the number of proliferating cells in each well was
determined using the calorimetric MTS/PMS method described above.
The wells with cells treated with high concentrations of
cycloheximide served as background for the assay.
[0107] For autoradiography, recombinant hIL13.E13Y was iodo-labeled
with .sup.125I by using the IODO-GEN reagent (Pierce) according to
the manufacturer's instructions. The specific activity of
.sup.125I-hIL13.E13Y was .about.300 mCi/mg of protein. All studies
involving human specimens were approved by the respective Human
Subjects Protection Offices at the Penn State College of Medicine
(Protocol No. IRB 96-123EP). Serial tissue sections were cut (10
mm) on a cryostat, thaw-mounchrome alumme-alum coated slides, and
stored at 4.degree. C. until analyzed. To observe binding
distribution of .sup.125I-hIL13.E13Y, sections were incubated (1
hr, 22.degree. C.) with 1.0 nM .sup.125I-hIL13 in binding buffer
(200 mM sucrose, 50 mM HEPES, 1% BSA, 10 mM EDTA). Adjacent serial
sections were incubated with the radiolabeled recombinant
hIL13.E13Y after a 30 min pre-incubation at 22.degree. C. in the
presence of binding buffer alone or of a 100- to 500-fold molar
excess of unlabeled hIL13, hIL13.E13Y or hIL4, or a monoclonal
antibody against human transferrin receptor (TfR). To dissociate
non-specifically bound radioligand, sections were rinsed in four
consecutive changes (5 minutes each) of ice-cold 0.1 M PBS. At
least two sections of each of the tissue specimens were assayed for
the evaluation of .sup.125I-hIL13.E13Y binding specificity. After
drying, labeled sections were apposed to Kodak autoradiography film
at -65.degree. C. for 8 hr to 11 days.
Example 2
Radioimmunodetection and Radioimmunotherapy of Human High Grade
Gliomas
[0108] The IL13 mutein, hIL13.E13Y, was prepared as described above
and tested for its ability to modulate the interleukin-induced
proliferative responses of TF-1 cells. TF-1 cells were treated with
hIL13, hIL13.E13Y, or hIL13.E13K. While hIL13 was very potent in
stimulating the growth of TF-1 cells, hIL13.E13K showed no activity
and hIL13.E13Y exhibited only very weak activity, if any at
all.
[0109] The ability of hIL13.E13Y to compete for the hIL13 binding
sites in clinical specimens of glioblastoma (GBM) in situ was
investigated in autoradiographic studies. The two GBM tissues
studied labeled densely with .sup.125I-hIL13.E13Y binding sites, as
well as with labeled wild type hIL13. The binding was specific
since both hIL13.E13Y and the wild type IL13 blocked the binding of
.sup.125I-hIL13.E13Y. In contrast, an excess of recombinant hIL4
was largely without influence on the .sup.125I-hIL13.E13Y binding
to GBM specimens.
[0110] In another test of specificity of the hIL13.E13Y binding to
GBM, the ability of a monoclonal antibody against the transferrin
receptor (TfR) to displace the binding of radiolabeled interleukin
was examined. No cross-competition for the hIL13 binding sites in
the GBMs examined was observed. The binding of hIL13.E13Y to GBM
appears to be very specific as others studies have shown that
.sup.125-hIL13 fails to interact with normal brain or normal human
cells and that .sup.125I-hIL13.E13Y does not interact with normal
human cells, such as HUVEC.
[0111] In other tests, the ability of hIL13.E13Y to block the
action of hIL13-PE1E (an hIL13-based cytotoxin) was investigated
using two different human malignant glioma cell lines. Glioma cells
in culture were pretreated with either hIL13, hIL13.E13Y or
hIL13.E13K before hIL13-PE1E was added. The cytotoxicity of
hIL13-PE1E was neutralized in these cultures using hIL13,
hIL13.E13Y, or hIL13.E13K.
Example 3
Mutants of Interleukin 13 with Altered Reactivity Towards
Interleukin 13 Receptors
[0112] Recombinant IL-13 and IL-13 mutants were prepared, isolated,
and purified as described in Example 1. The prokaryotic production
of the cytokines or their mutants under control of the T7 promoter
was very efficient. After purification, between 0.5 mg and 1.5 mg
of each cytokine or mutant was obtained from a 1 liter culture.
When each purified protein was analyzed using SDS-PAGE and stained
with Coomassie Blue, a single protein band was observed migrating
at approximately 13 kDa (FIG. 1, panel A). Visual inspection
suggested that all preparations were greater than 95% pure. A
corresponding Western blot of the samples using a goat polyclonal
anti-hIL13 antibody (that was not cross-reactivity with any other
cytokine) indicated that the isolated proteins were immuno-reactive
with hIL13 (FIG. 1, panel B). The alpha-helix D mutants,
hIL13.R109D and hIL13.F113D, also reacted with this antibody
indicating that they too were immuno-reactive with hIL13 (data not
shown). Traces of a dimeric form (.about.26 kDa) of some of the
mutated cytokines were also detected.
[0113] To determine whether the recombinant interleukins had
refolded correctly and that their mutation had not destroyed their
general pattern of conformation, circular dichroism (CD) was used
to determine the proteins'folded structure. The secondary structure
data from the spectropolarimeter indicated that each protein sample
produced a spectrum consistent with an alpha-helical enriched
protein, having two spectral minima at approximately 208 nm and 222
nm (FIG. 2). Furthermore, the CD spectrum of each mutant could be
super-imposed on the CD spectrum of the wild-type hIL13, although
slight variations in spectra intensity were observed between
samples (FIG. 2, panels A, B, C). hIL13.R109D and hIL13.F113D both
produced CD spectra similar to the other mutants (not shown). For
comparison, the CD spectrum of unfolded hIL13 was also obtained
(FIG. 2, panel D). The panel illustrates the collapse of the
characteristic alpha-helical pattern when the protein is
unfolded.
[0114] Functional assays were employed to examine whether the IL13
mutants exhibited an altered association with the shared signaling
IL13/4 receptor by measuring their effect on induced TF-1 cell
proliferation. TF-1 cells express the shared IL13/4 receptor (but
not the restricted receptor) and proliferate in a dose-dependent
manner in the presence of hIL13 or hIL4. Under the conditions used
in this assay, a concentration of 100 ng/ml of wild-type hIL13
consistently produced a maximal proliferative response in TF-1
cells of .about.300% that of the baseline value (FIG. 3, panel A).
Differences were observed in TF-1 cell proliferation depending on
whether the mutants were in the predicted alpha-helices A, C, or D.
Of the alpha-helix A mutants, hIL13.E13K induced only a minimal
proliferative response over the range tested (FIG. 3, panel B), and
hIL13.E13I, hIL13.E13S, and hIL13.E13Y failed to induce any
proliferative response (FIG. 3, panel B). Mutants hIL13.E13D and,
unexpectedly, hIL13.E13R both induced a dose-dependent dependent
increase in proliferation of the TF-1 cells. Their induction of
TF-1 cell proliferation followed the same pattern as wild-type
hIL13, although hIL13.E13D had a lesser effect on proliferation
than did hIL13.E13R (FIG. 3, panel A). Both hIL13.E16K and
hIL13.E17K (with mutated sites one turn of the alpha-helix up from
position 13) induced a dose-dependent increase in the proliferative
response of the TF-1 cells (FIG. 3, panel A). While the
hIL13.E17K-induced effect was comparable to wild-type hIL13, the
hIL13.E16K-induced effect was significantly greater than that
caused by wild-type hIL13.
[0115] The alpha-helix C mutants, hIL13.R66D and hIL13.S69D, both
showed a significantly impaired ability to stimulate TF-1 cells,
compared to wild-type hIL13 (FIG. 3, panel C) Their action on TF-1
cells, however, can be classified between that caused by mutants
shown in FIG. 3, panels A and B. The alpha-helix D mutants also
exhibited contrasting patterns of action on TF-1 cells. The
hIL13.F113D mutant was equivalent to wild-type hIL13 in inducing
TF-1 cell proliferation, while the hIL13.R109D mutant was inactive
on these cells (not shown).
[0116] The ability of the hIL13 mutants to interact with the shared
hIL13/4 receptor on normal cells was assessed by examining their
effect on VCAM-1 expression on the surface of HUVEC. Cytokine
binding of the shared IL13/4 receptor on the HUVEC cell surface
results in transmembrane signaling events that induce VCAM-1
expression on these cells. Results from two separate experiments
are shown in FIG. 4. Cells incubated in the absence of hIL13 showed
minimal, nonspecific VCAM-1 staining (FIG. 4, panels A and G). In
contrast, cells incubated overnight in media containing wild-type
hIL13 exhibited a marked increase in VCAM-1 (FIG. 4, panels B and
H). The pattern of the staining appeared to be specific for certain
areas of the cell surface, compared to the minimal, homogeneous
staining of cells that had not been incubated with cytokine (FIG.
4, panels A and G). Cells incubated with mutants hIL13.E13I,
hIL13.E13K, and hIL13.E13Y, which are unable to induce TF-1 cell
proliferation (FIG. 3), showed less VCAM-1 expression than those
treated with wild-type hIL13 (FIG. 4, panels C, D, F, and B,
respectively). Although mutant hIL13.F113D was not tested, the
hIL13.R109D-induced VCAM-1 staining was negligible (not shown),
suggesting again the involvement of alpha-helix D of the cytokine
in effective signaling through the shared receptor. Cells treated
with mutants hIL13.E13R and hIL13.E17K showed an increase in VCAM-1
staining similar to that induced by wild-type hIL13, when compared
to their respective controls (FIG. 4, panels E and J). Mutant
hIL13.E16K appeared to have a superagonistic effect on VCAM-1
expression compared to its wild-type IL13 control (FIG. 4, panels I
and H, respectively).
[0117] The ability of hIL13 and its mutants to block the
cancer-restrictive hIL13 receptor on two different human
glioblastoma cell lines was examined in cytotoxicity assays using
hIL13-PE1E, an extremely potent anti-tumor agent on glioma cells
(see Debinski et al. (1996) J. Biol. Chem., 271: 22428-22433). The
cytotoxin caused a high level of cytotoxicty in cultured U-251-MG
cells (FIG. 5, panel A) and SNB-19 cells (FIG. 5, panel B) when the
cells were cultured in the absence of a competing ligand for the
receptor. When cultured in the presence of hIL13 or any of its A or
C helix mutants, the level of cytotoxicity was reduced even at the
highest concentration of cytotoxin used (FIG. 5, panels A and B).
IC.sub.50s for tests without blocking ligand were 0.1 ng/ml (1.25
pM) for U-251-MG cells and 0.07 ng/ml (0.875 pM) for SNB-19 cells.
In contrast, the blocking assay using hIL13 mutants showed their
ability to increase the IC.sub.50 by at least 100 times. For
concentrations of hIL13 or its mutants up to 1000.times.(by weight)
over hIL13-PE1E, no discernable differences were detected between
these various mutants and wild-type hIL13 in blocking the
cytotoxin's activity on the glioma cells (FIG. 5, panels A and B).
hIL13.F113D, an alpha-helix D mutant, behaved as the wild-type
cytokine. In contrast, addition of hIL13.R109D to the cell cultures
did not reduce the cytotoxin-induced cytotoxicity. hIL4 did not
display any neutralizing activity in these assays.
[0118] Other Embodiments
[0119] This description has been by way of example of how the
compositions and methods of invention can be made and carried out.
Those of ordinary skill in the art will recognize that various
details may be modified in arriving at the other detailed
embodiments, and that many of these embodiments will come within
the scope of the invention.
[0120] Therefore, to apprise the public of the scope of the
invention and the embodiments covered by the invention, the
following claims are made.
Sequence CWU 1
1
23 1 114 PRT Homo sapiens 1 Ser Pro Gly Pro Val Pro Pro Ser Thr Ala
Leu Arg Glu Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln Asn
Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser Ile
Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser Leu
Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln Arg
Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70 75 80
Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85
90 95 Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly
Arg 100 105 110 Phe Asn 2 114 PRT ARTIFICIAL SEQUENCE misc_feature
hIL13 mutant having a Glu to Lys substitution at residue 13 2 Ser
Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Lys Leu Ile Glu 1 5 10
15 Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly
20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys
Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala
Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser Gly Phe Cys Pro His
Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser Leu His Val Arg Asp
Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu
His Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105 110 Phe Asn 3 114
PRT ARTIFICIAL SEQUENCE misc_feature hIL13 mutant having a Glu to
Ile substitution at residue 13 3 Ser Pro Gly Pro Val Pro Pro Ser
Thr Ala Leu Arg Ile Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr
Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp
Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu
Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60
Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65
70 75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala
Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe
Arg Glu Gly Arg 100 105 110 Phe Asn 4 114 PRT ARTIFICIAL SEQUENCE
misc_feature hIL13 mutant having a Glu to Cys substitution at
residue 13 4 Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Cys
Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala
Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val
Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val
Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105
110 Phe Asn 5 114 PRT ARTIFICIAL SEQUENCE misc_feature hIL13 mutant
having a Glu to Ser substitution at residue 13 5 Ser Pro Gly Pro
Val Pro Pro Ser Thr Ala Leu Arg Ser Leu Ile Glu 1 5 10 15 Glu Leu
Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30
Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35
40 45 Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys
Thr 50 55 60 Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser
Ala Gly Gln 65 70 75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile
Glu Val Ala Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu His Leu Lys
Lys Leu Phe Arg Glu Gly Arg 100 105 110 Phe Asn 6 114 PRT
ARTIFICIAL SEQUENCE misc_feature hIL13 mutant having a Glu to Arg
substitution at residue 13 6 Ser Pro Gly Pro Val Pro Pro Ser Thr
Ala Leu Arg Arg Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln
Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser
Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser
Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln
Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70
75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln
Phe 85 90 95 Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg
Glu Gly Arg 100 105 110 Phe Asn 7 114 PRT ARTIFICIAL SEQUENCE
misc_feature hIL13 mutant having a Glu to Tyr substitution at
residue 13 7 Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr
Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala
Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val
Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val
Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105
110 Phe Asn 8 114 PRT ARTIFICIAL SEQUENCE misc_feature hIL13 mutant
having a Glu to Asp substitution at residue 13 8 Ser Pro Gly Pro
Val Pro Pro Ser Thr Ala Leu Arg Asp Leu Ile Glu 1 5 10 15 Glu Leu
Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30
Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35
40 45 Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys
Thr 50 55 60 Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser
Ala Gly Gln 65 70 75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile
Glu Val Ala Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu His Leu Lys
Lys Leu Phe Arg Glu Gly Arg 100 105 110 Phe Asn 9 114 PRT
ARTIFICIAL SEQUENCE misc_feature hIL13 mutant having a Glu to Lys
substitution at residue 16 9 Ser Pro Gly Pro Val Pro Pro Ser Thr
Ala Leu Arg Glu Leu Ile Lys 1 5 10 15 Glu Leu Val Asn Ile Thr Gln
Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser
Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser
Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln
Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70
75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln
Phe 85 90 95 Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg
Glu Gly Arg 100 105 110 Phe Asn 10 114 PRT ARTIFICIAL SEQUENCE
misc_feature hIL13 mutant having a Glu to Lys substitution at
residue 17 10 Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu
Leu Ile Glu 1 5 10 15 Lys Leu Val Asn Ile Thr Gln Asn Gln Lys Ala
Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val
Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val
Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105
110 Phe Asn 11 114 PRT ARTIFICIAL SEQUENCE misc_feature hIL13
mutant having a Arg to Asp substitution at residue 66 11 Ser Pro
Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu 1 5 10 15
Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly 20
25 30 Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala
Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile
Glu Lys Thr 50 55 60 Gln Asp Met Leu Ser Gly Phe Cys Pro His Lys
Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser Leu His Val Arg Asp Thr
Lys Ile Glu Val Ala Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu His
Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105 110 Phe Asn 12 114 PRT
ARTIFICIAL SEQUENCE misc_feature hIL13 mutant having a Ser to Asp
substitution at residue 69 12 Ser Pro Gly Pro Val Pro Pro Ser Thr
Ala Leu Arg Glu Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln
Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser
Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser
Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln
Arg Met Leu Asp Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70
75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln
Phe 85 90 95 Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg
Glu Gly Arg 100 105 110 Phe Asn 13 114 PRT ARTIFICIAL SEQUENCE
misc_feature hIL13 mutant having a Asp to Lys substitution at
residue 99 13 Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu
Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala
Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val
Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val
Lys Lys Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105
110 Phe Asn 14 114 PRT ARTIFICIAL SEQUENCE misc_feature hIL13
mutant having a Leu to Ala substitution at residue 102 14 Ser Pro
Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu 1 5 10 15
Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly 20
25 30 Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala
Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile
Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys
Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser Leu His Val Arg Asp Thr
Lys Ile Glu Val Ala Gln Phe 85 90 95 Val Lys Asp Leu Leu Ala His
Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105 110 Phe Asn 15 114 PRT
ARTIFICIAL SEQUENCE misc_feature hIL13 mutant having a Leu to Ala
substitution at residue 104 15 Ser Pro Gly Pro Val Pro Pro Ser Thr
Ala Leu Arg Glu Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln
Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser
Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser
Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln
Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70
75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln
Phe 85 90 95 Val Lys Asp Leu Leu Leu His Ala Lys Lys Leu Phe Arg
Glu Gly Arg 100 105 110 Phe Asn 16 114 PRT ARTIFICIAL SEQUENCE
misc_feature hIL13 mutant having a Lys to Asp substitution at
residue 105 16 Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu
Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala
Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val
Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val
Lys Asp Leu Leu Leu His Leu Asp Lys Leu Phe Arg Glu Gly Arg 100 105
110 Phe Asn 17 114 PRT ARTIFICIAL SEQUENCE misc_feature hIL13
mutant having a Lys to Asp substitution at residue 106 17 Ser Pro
Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu 1 5 10 15
Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly 20
25 30 Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala
Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile
Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys
Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser Leu His Val Arg Asp Thr
Lys Ile Glu Val Ala Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu His
Leu Lys Asp Leu Phe Arg Glu Gly Arg 100 105 110 Phe Asn 18 114 PRT
ARTIFICIAL SEQUENCE misc_feature hIL13 mutant having a Leu to Ala
substitution at residue 107 18 Ser Pro Gly Pro Val Pro Pro Ser Thr
Ala Leu Arg Glu Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln
Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser
Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser
Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln
Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70
75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln
Phe 85 90 95 Val Lys Asp Leu Leu Leu His Leu Lys Lys Ala Phe Arg
Glu Gly Arg 100 105 110 Phe Asn 19 114 PRT ARTIFICIAL SEQUENCE
misc_feature hIL13 mutant having a Phe to Tyr substitution at
residue 108 19 Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu
Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala
Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val
Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val
Lys Asp Leu Leu Leu His Leu Lys Lys Leu Tyr Arg Glu Gly Arg 100 105
110 Phe Asn 20 114 PRT ARTIFICIAL SEQUENCE misc_feature
hIL13 mutant having a Arg to Asp substitution at residue 109 20 Ser
Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu 1 5 10
15 Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly
20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys
Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala
Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser Gly Phe Cys Pro His
Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser Leu His Val Arg Asp
Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu
His Leu Lys Lys Leu Phe Asp Glu Gly Arg 100 105 110 Phe Asn 21 114
PRT ARTIFICIAL SEQUENCE misc_feature hIL13 mutant having a Arg to
Asp substitution at residue 112 21 Ser Pro Gly Pro Val Pro Pro Ser
Thr Ala Leu Arg Glu Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr
Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp
Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu
Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60
Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65
70 75 80 Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala
Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe
Arg Glu Gly Asp 100 105 110 Phe Asn 22 114 PRT ARTIFICIAL SEQUENCE
misc_feature hIL13 mutant having a Phe to Asp substitution at
residue 113 22 Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu
Leu Ile Glu 1 5 10 15 Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala
Pro Leu Cys Asn Gly 20 25 30 Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met Tyr Cys Ala Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val
Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95 Val
Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105
110 Asp Asn 23 114 PRT ARTIFICIAL SEQUENCE misc_feature hIL13
mutant having an Asn to Asp substitution at residue 113 23 Ser Pro
Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu 1 5 10 15
Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly 20
25 30 Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala
Ala 35 40 45 Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile
Glu Lys Thr 50 55 60 Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys
Val Ser Ala Gly Gln 65 70 75 80 Phe Ser Ser Leu His Val Arg Asp Thr
Lys Ile Glu Val Ala Gln Phe 85 90 95 Val Lys Asp Leu Leu Leu His
Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105 110 Phe Asp
* * * * *