U.S. patent application number 10/259520 was filed with the patent office on 2003-02-06 for mammary transforming protein.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Gentz, Reiner L., Ni, Jian, Yu, Guo-Liang.
Application Number | 20030027989 10/259520 |
Document ID | / |
Family ID | 21719713 |
Filed Date | 2003-02-06 |
United States Patent
Application |
20030027989 |
Kind Code |
A1 |
Ni, Jian ; et al. |
February 6, 2003 |
Mammary transforming protein
Abstract
A human mammary transforming protein and DNA (RNA) encoding such
polypeptide and a procedure for producing such polypeptide by
recombinant techniques is disclosed. Also disclosed are methods for
inhibiting such polypeptide for preventing and/or treating
neoplasia. Diagnostic assays for identifying mutations in nucleic
acid sequence encoding a polypeptide of the present invention and
for detecting altered levels of the polypeptide of the present
invention for detecting diseases, for example, cancer, are also
disclosed.
Inventors: |
Ni, Jian; (Germantown,
MD) ; Yu, Guo-Liang; (Berkeley, CA) ; Gentz,
Reiner L.; (Belo Horizonte-Mg, BR) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
9410 KEY WEST AVENUE
ROCKVILLE
MD
20850
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
21719713 |
Appl. No.: |
10/259520 |
Filed: |
September 30, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10259520 |
Sep 30, 2002 |
|
|
|
09263811 |
Mar 8, 1999 |
|
|
|
6482922 |
|
|
|
|
09263811 |
Mar 8, 1999 |
|
|
|
08743975 |
Nov 1, 1996 |
|
|
|
6057434 |
|
|
|
|
60006187 |
Nov 2, 1995 |
|
|
|
Current U.S.
Class: |
530/350 ;
435/183; 435/320.1; 435/325; 435/69.1; 536/23.5 |
Current CPC
Class: |
A61K 38/00 20130101;
C12Q 1/6886 20130101; A61K 48/00 20130101; C07K 14/82 20130101;
C12Q 2600/136 20130101; C12N 2799/026 20130101 |
Class at
Publication: |
530/350 ;
435/69.1; 435/183; 435/320.1; 435/325; 536/23.5 |
International
Class: |
C12P 021/02; C12N
005/06; C07K 014/435; C07H 021/04 |
Claims
What is claimed is:
1. An isolated polynucleotide comprising a polynucleotide having at
least 95% identity to a member selected from the group consisting
of: (a) a polynucleotide encoding a polypeptide comprising amino
acid 2 to 74 of SEQ ID NO:2; and (b) the complement of (a).
2. The isolated polynucleotide of claim 1 wherein said member is
(a).
3. The isolated polynucleotide of claim 1 wherein said member is
(a) and the polypeptide comprises amino acids 1 to 74 of SEQ ID
NO:2.
4. The isolated polynucleotide of claim 1 comprising a
polynucleotide encoding a polypeptide comprising the amino acid
sequence identical to amino acids 2 to 74 of SEQ ID NO:2.
5. The isolated polynucleotide of claim 1, wherein the
polynucleotide is DNA.
6. The isolated polynucleotide of claim 1 comprising a
polynucleotide encoding a polypeptide comprising the amino sequence
identical to amino acids 1 to 74 of SEQ ID NO:2.
7. The isolated polynucleotide of claim 1, wherein said
polynucleotide is RNA.
8. A method of making a recombinant vector comprising inserting the
isolated polynucleotide of claim 2 into a vector, wherein said
polynucleotide is DNA.
9. A recombinant vector comprising the polynucleotide of claim 2,
wherein said polynucleotide is DNA.
10. A recombinant host cell comprising the polynucleotide of claim
2, wherein said polynucleotide is DNA.
11. A method for producing a polypeptide comprising expressing from
the recombinant cell of claim 10 the polypeptide encoded by said
polynucleotide.
12. A process for producing a polypeptide comprising: expressing
from a recombinant cell containing the polynucleotide of claim 4
the polypeptide encoded by said polynucleotide.
13. A process for producing a polypeptide comprising: expressing
from a recombinant cell containing the polynucleotide of claim 6
the polypeptide encoded by said polynucleotide.
14. The isolated polynucleotide of claim 1 comprising nucleotides
169 to 387 of SEQ ID NO:1.
15. The isolated polynucleotide of claim 1 comprising nucleotides
166 to 357 of SEQ ID NO:1.
16. The isolated polynucleotide of claim 1 comprising the
nucleotides of the sequence of SEQ ID NO:1.
17. An isolated polynucleotide comprising a polynucleotide having
at least a 95% identity to a member selected from the group
consisting of: (a) a polynucleotide encoding the same mature
polypeptide encoded by the human cDNA in ATCC Deposit No. 97300;
and (b) the complement of (a).
18. The isolated polynucleotide of claim 17, wherein the member is
(a).
19. The isolated polynucleotide of claim 17, wherein said
polynucleotide comprises DNA identical to the coding portion of the
human cDNA in ATCC Deposit No. 97300 which encodes a mature
polypeptide.
20. An isolated polypeptide comprising: a mature polypeptide having
an amino acid sequence encoded by a polynucleotide which is at
least 95% identical to the polynucleotide of claim 4.
21. The isolated polypeptide of claim 20, comprising amino acids 2
to 74 of sequence of SEQ ID NO:2.
22. The isolated polypeptide of claim 20, comprising amino acids 1
to 74 of sequence of SEQ ID NO:2.
23. The isolated polypeptide of claim 20 comprising amino acids 1
to 74 of SEQ ID NO:2.
24. An isolated polypeptide comprising: a mature polypeptide
encoded by a polynucleotide which is at least 95% identical to the
human cDNA contained in ATCC Deposit No. 97300.
25. The isolated polypeptide of claim 24 comprising the mature
polypeptide encoded by the human cDNA in ATCC Deposit No.
97300.
26. An antibody against the polypeptide of claim 20.
27. An antagonist against the polypeptide of claim 20.
28. A method for the treatment of a patient having need of mammary
transforming protein comprising: administering to the patient a
therapeutically effective amount of the polypeptide of claim
20.
29. The method of claim 25 wherein said therapeutically effective
amount of the polypeptide is administered by providing to the
patient DNA encoding said polypeptide and expressing said
polypeptide in vivo.
30. A method for the treatment of a patient having need to inhibit
a mammary transforming protein polypeptide comprising:
administering to the patient a therapeutically effective amount of
the compound of claim 24.
31. A process for diagnosing a disease or a susceptibility to a
disease related to an under-expression of the polypeptide of claim
25 comprising: determining a mutation in a nucleic acid sequence
encoding said polypeptide.
32. A diagnostic process comprising: analyzing for the presence of
the polypeptide of claim 25 in a sample derived from a host.
33. The diagnostic process of claim 32 wherein said sample is
selected from the group consisting of histological sections of
mammary sections and blood, and the diagnostic process detects the
presence or absence of cancer.
34. A method for identifying compounds which bind to and inhibit
activation of the polypeptide of claim 25 comprising: contacting a
cell expressing on the surface thereof a receptor for the
polypeptide, said receptor being associated with a second component
capable of providing a detectable signal in response to the binding
of a compound to said receptor, with an analytically detectable
mammary transforming protein and a compound under conditions to
permit binding to the receptor; and determining whether the
compound binds to and inhibits the receptor by detecting the
absence of a signal generated from the interaction of the mammary
transforming protein with the receptor.
Description
[0001] This application is entitled to the benefits of 35 U.S.C.
.sctn. 120 based on U.S. Provisional Application 60/006,187, filed
Nov. 2, 1995, pending.
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention has been putatively identified
as mammary transforming protein. The invention also relates to
inhibiting the action of such polypeptides.
[0003] Hormones from ovaries and pituitary glands are absolutely
essential for the proliferation and differentiation of mammary
epithelial cells (MECs), which are the predominant
carcinogen-susceptible cell type in the mammary gland (Imagawa, W.,
Bandyopadhyay, G. K. & Nandi, S. (1990) Endocr. Rev. 11,
494-523). Studies from several laboratories have indicated that
hormones play a crucial role in chemical carcinogen-induced mammary
tumorigenesis in both mouse and rat model systems (Medina, D.
(1974) J. Natl. Cancer Inst. 53, 223-226; Medina, D. (1976) J. Nat.
Cancer Inst. 57, 1185-1189; Medina, D. (1981) Cancer Res. 41,
3819-3820; Welsch, C. W. (1987) in Cellular and Molecular Biology
of Mammary Cancer, eds. Medina, D., Kidwell, W. Heppner, G. &
Anderson, E. (Plenum, New York), pp. 163-179). Earlier studies from
different laboratories have demonstrated that the nature of the
carcinogen and of the tissue types determine the genotype of the
lesions induced using various animal model systems. For example, in
the two-stage skin carcinogenesis system, papillomas induced with
the methylating agent N-methyl-N'-nitro-N-nitrosoguanidine or
N-methyl-N-nitrosourea (MNU) have predominantly G.fwdarw.A
transition mutations at codon 12 of the H-ras protooncogene
(Balmain, A. & Brown, K. (1988) adv. Cancer Res. 51, 147-182;
Brown, K., Buchmann, A. & Balmain, A. (1990) Proc. Natl. Acad.
Sci. USA 87, 538-542) Similar findings have been reported in the
rat mammary tumorigenesis system using MNU as a carcinogen
(Sukumar, S. Notario, V., Martin-Zanca, D. & Barbacid, M.
(1983) Nature (London) 306, 658-661; Zarbl, H., Sukumar, S.,
Arthur, A. V., Martin-Sanca, D. & Barbacid, M. (1985) Nature
(London) 315, 382-385). However, skin tumors in mice and mammary
tumors in mice and rats, induced with the polycyclic hydrocarbon
dimethylbenz [a] anthracene, contain predominantly A.fwdarw.T
transversion mutations at the 61st codon of the H-ras protooncogene
(Zarbl, H., Sukumar, S., Arthur, A. V., Martin-Sanca, D. &
Barbacid, M. (1985) Nature (London) 315, 382-385; Kumar, R.,
MEdina, D. & Sukumar, S. (1990) Oncogene 5, 1271-1277;
Dandekar, S., Sukumar, S., Zarbl, H., Young, L. J. T. &
Cardiff, R. D. (1986) Mol. Cell. Biol. 6,4104-4108; Quintanilla,
M., Brown, K., Ramsden, M. & Balmain, A. (1986) Nature (London)
322, 78-80). A majority of thymic lymphomas induced with MNU, on
the other hand, contain a G35.fwdarw.A35 mutation in the N-ras
protooncogene (Guerrero, I., Calzada, P., Mayer, A. & Pellicer,
A. (1984) Proc. Natl. Acad. Sci. USA 81, 202-205; Guerrero, I.,
Villasante, A., Corces, V. & Pellicer, A. (1985) Proc. Natl.
Acad. Sci. USA 82, 7810-7814).
[0004] A defined serum-free cell culture system has been developed
in which mouse MECs embedded in a three-dimensional collagen gel
matrix can be grown, induced to differentiate, and be
neoplastically transformed with chemical carcinogens (Guzman, R.
C., Osborn, R. C., Bartley, J. C., Imagawa, W., Asch, B. B. &
Nandi, S. (1987) Cancer Res. 47, 275-280). Using this system it has
been observed that the types of mammary lesions induced by
carcinogens are greatly influenced by the mitogens present around
the time of carcinogen treatment. It has been reported on an in
vitro system, the induction of preneoplastic hyperplastic alveolar
nodules (HANs) and carcinomas from MECs exposed to the
direct-acting chemical carcinogen MNU in the presence of different
mitogens (Miyamoto, S., Guzman, R. C., Osborn, R. C. & Nandi,
S. (1988) Proc. Natl. Acad. Sci. USA 85, 477-481) . When mouse MECs
were grown in the presence of the mammogenic hormones progestone
and prolactin (PPRL) during MNU administration, the predominant
types of lesions induced were a high incidence of HANs and
carcinomas with squamous metaplasia. In contrast, when epidermal
growth factor was used as a mitogen during the carcinogen
treatment, only a low incidence of ductal hyperplasia was detected,
although the extent of MEC proliferation between the two groups was
equivalent. The genetic analysis of these lesions indicated that
the activation of the protooncogene was also dependent on the
mitogen used around the time of carcinogen treatment. The majority
(80%) of the HANs and carcinomas induced with MNU in the presence
of PPRL had an activation of the protooncogene c-Ki-ras by a
specific G35.fwdarw.A35 point mutation at codon 12. The activation
of the protooncogene was determined to be an early event in this
carcinogenesis process because the activation was detected in
preneoplastic lesions (Miyamoto, S., Sukumar, S., Guzman, R. C.,
Osborn, R. C. & Nandi, S. (1990) Mol. Cell. Biol. 10,
1593-1599). In contrast, activation of C-Ki-ras was absent in all
the ductal hyperplasias induced by MNU in the presence of the
mitogen epidermal growth factor. Involvement of the same type of
c-Ki-ras 3mutation has, however, been observed in the in vivo mouse
model system where pituitary-isografted mice were injected with a
single dose of MNU (Guzman, R. C., Osborn, R. C., Swanson, S. M.,
Sakthivel, R., Hwang, S.-i., Miyamoto, S. & Nandi, S. (1992)
Cancer Res. 52, 5732-5737) . Pituitary isografts in mice raise
blood levels of PPRL (Christov, K., Swanson, S. M., Guzman, R. C.,
Thordarson, G., Jin, E., Talamantes, F. & Nandi, S. (1993)
Carcinogenesis, 14, 2019-2025) and thereby partially mimic the in
vitro PPRL culture condition. Results from another set of in vivo
experiments with virgin rats also showed that a difference in
experiments with virgin rats also showed that a difference in
frequency of G35.fwdarw.A35 mutated H-ras protooncogene correlated
with different stages of the estrous cycle at the time of MNU
administration (Pascual, R. V., Hwang, S. -I., Swanson, S. M.,
Bauzon, M. K., Guzman, R. C. & Nandi, S. (1994) Proc. Am.
Assoc. Cancer Res. 35, 262).
[0005] The induction of preneoplastic and neoplastic lesions of
different phenotypes by using LiCl as a mitogen during carcinogen
treatment and the involvement of a transforming gene, designated
MAT1, in this process, LiCl, a potent mitogen for mammary
epithelial cells, has been reported, (Hori, C. & Oka, T. (1979)
Proc. Natl. Acad. Sci. USA 76, 2823-2827; Tomooka, Y., Imagawa, W.,
Nandi, S. & Bern, H. A. (1983) J. Cell. Physiol. 117, 290-296)
. LiCl has been found to alter the phosphatidylinositol hydrolysis
in MECs. Although LiCl also modules the cAMP synthesis, K.sup.+ and
Ca.sup.2+ transport, and guanine nucleotide-binding protein
synthesis in other cell types, the exact mechanism of its mitogenic
effect is still unclear (Imagawa, W., Bandyopadhyay, G. K. &
Nandi, S. Endocr. Rev. 11:494-523 (1990)). This gene has been
cloned and sequenced
[0006] The polypeptide of the present invention has been putatively
identified as a mammary transforming protein as a result of amino
acid sequence homology to mammary transforming gene (MAT1) as
disclosed in Bera, T., et al., PNAS, USA, 91:9789-9793 (1994).
[0007] In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide, as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof. The polypeptide of the
present invention is of human origin.
[0008] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding a
polypeptide of the present invention including mRNAs, cDNAs,
genomic DNAs as well as analogs and biologically active and
diagnostically or therapeutically useful fragments thereof.
[0009] In accordance with another aspect of the present invention
there is provided an isolated nucleic acid molecule encoding a
mature polypeptide expressed by the DNA contained in ATCC Deposit
No. 97300.
[0010] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
nucleic acid sequence encoding a polypeptide of the present
invention, under conditions promoting expression of said protein
and subsequent recovery of said protein.
[0011] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptide, or polynucleotide encoding such polypeptide for
therapeutic purposes, for example, to regulate development and
normal physiology of cells.
[0012] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0013] In accordance with yet another aspect of the present
invention, there are provided antagonists to, such polypeptides,
which may be used to inhibit the action of such polypeptides, for
example, to prevent the transformation of cells which lead to
neoplasia.
[0014] In accordance with yet a further aspect of the present
invention, there is also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to a nucleic acid sequence of the present invention.
[0015] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases or susceptibility to diseases related to an overexpression
of a polypeptide of the present invention.
[0016] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, for example,
synthesis of DNA and manufacture of DNA vectors.
[0017] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
[0018] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0019] FIG. 1 is an illustration of the cDNA and corresponding
deduced amino acid sequence of the polypeptide of the present
invention. Sequencing was performed using a 373 automated DNA
sequencer (Applied Biosystems, Inc.).
[0020] FIG. 2 is an amino acid sequence comparison between the
polypeptide of the present invention (top line) and mouse mammary
transforming protein as disclosed in Bera, et al., supra, (bottom
line) (SEQ ID NO:9).
[0021] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIG. 1 (SEQ ID NO:2).
[0022] A polynucleotide encoding a polypeptide of the present
invention may be obtained from a cDNA library derived from a human
hypothalamus. It is most closely related to the mammary
transforming gene MAT1. It contains an open reading frame encoding
a protein of 74 amino acid residues. The protein exhibits the
highest degree of homology at the amino acid level to the mouse
mammary transforming gene MAT1 with 63.934% identity and 73.770%
similarity over the entire amino acid stretch, and at the amino
acid level the polynucleotide of the present invention exhibits 98%
identity and 98% similarity to the human homolog of mouse MAT1 gene
over a 120 nucleotide stretch. The polypeptide of the present
invention has a molecular weight of 8445.10 daltons, has a length
of 74 amino acids, a molar extinction coefficient of 849 and an
isoelectric point of 10.02.
[0023] In accordance with another aspect of the present invention
there are provided isolated polynucleotides encoding a mature
polypeptide expressed by the DNA contained in ATCC Deposit No.
97300, deposited with the American Type Culture Collection, 12301
Park Lawn Drive, Rockville, Md. 20852, USA, on Sep. 25, 1995. The
deposited material is a plasmid that contains the full-length MTP
cDNA inserted into a pBluescript SK(-) vector (Stratagene, La
Jolla, Calif.).
[0024] The deposit has been made under the terms of the Budapest
Treaty on the International Recognition of the Deposit of
Micro-organisms for purposes of Patent Procedure. The strain will
be irrevocably and without restriction or condition released to the
public upon the issuance of a patent. The deposit is provided
merely as convenience to those of skill in the art and are not an
admission that a deposit is required under 35 U.S.C. .sctn.112. The
sequence of the polynucleotide contained in the deposited material,
as well as the amino acid sequence of the polypeptides encoded
thereby, are controlling in the event of any conflict with any
description of sequences herein. A license may be required to make,
use or sell the deposited material, and no such license is hereby
granted.
[0025] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIG. 1 (SEQ ID NO:1) , as a result of the redundancy or
degeneracy of the genetic code, encodes the same mature polypeptide
as the DNA of FIG. 1 (SEQ ID NO:1).
[0026] The polynucleotide which encodes for the mature polypeptide
of FIG. 1 (SEQ ID NO:2) may include, but is not limited to: only
the coding sequence for the mature polypeptide; the coding sequence
for the mature polypeptide and additional coding sequence such as a
leader or secretory sequence or a proprotein sequence; the coding
sequence for the mature polypeptide (and optionally additional
coding sequence) and non-coding sequence, such as introns or
non-coding sequence 5' and/or 3' of the coding sequence for the
mature polypeptide.
[0027] Thus, the term "polynucleotide" encompasses a polynucleotide
which includes only coding sequence for the polypeptide as well as
a polynucleotide which includes additional coding and/or non-coding
sequence.
[0028] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 (SEQ ID NO:2). The variant of the
polynucleotide may be a naturally occurring allelic variant of the
polynucleotide or a non-naturally occurring variant of the
polynucleotide.
[0029] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIG. 1 (SEQ ID
NO:2) as well as variants of such polynucleotides which variants
encode for a fragment, derivative or analog of the polypeptide of
FIG. 1 (SEQ ID NO:2). Such nucleotide variants include deletion
variants, substitution variants and addition or insertion
variants.
[0030] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIG. 1 (SEQ ID NO:1). As known in the
art, an allelic variant is an alternate form of a polynucleotide
sequence which may have a substitution, deletion or addition of one
or more nucleotides, which does not substantially alter the
function of the encoded polypeptide.
[0031] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains.
[0032] Thus, for example, the polynucleotide of the present
invention may encode for a mature protein, or for a protein having
a prosequence or for a protein having both a prosequence and a
presequence (leader sequence).
[0033] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0034] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0035] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which-have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0036] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIG. 1 (SEQ ID
NO:1).
[0037] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0038] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 and polynucleotides
complementary thereto as well as portions thereof, which portions
have at least 30 consecutive bases and preferably at least 50
consecutive bases and to polypeptides encoded by such
polynucleotides.
[0039] The present invention further relates to a polypeptide which
has the deduced amino acid sequence of FIG. 1 (SEQ ID NO:2), as
well as fragments, analogs and derivatives of such polypeptide.
[0040] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIG. 1 (SEQ ID NO:2), means a
polypeptide which retains essentially the same biological function
or activity as such polypeptide. Thus, an analog includes a
proprotein which can be activated by cleavage of the proprotein
portion to produce an active mature polypeptide.
[0041] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0042] The fragment, derivative or analog of the polypeptide of
FIG. 1 (SEQ ID NO:2) may be (i) one in which one or more of the
amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may not be
one encoded by the genetic code, or (ii) one in which one or more
of the amino acid residues includes a substituent group, or (iii)
one in which the mature polypeptide is fused with another compound,
such as a compound to increase the half-life of the polypeptide
(for example, polyethylene glycol), or (iv) one in which the
additional amino acids are fused to the mature polypeptide, such as
a leader or secretory sequence or a sequence which is employed for
purification of the mature polypeptide or a proprotein sequence.
Such fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0043] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0044] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part, of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0045] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 80% similarity
(preferably at least 80% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0046] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0047] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0048] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0049] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
genes of the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0050] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0051] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0052] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0053] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0054] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0055] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0056] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pBluescript SK, pBSKS, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0057] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0058] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0059] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0060] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0061] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples include the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0062] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product.
[0063] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0064] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA)
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0065] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0066] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0067] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well known to those skilled in the art.
[0068] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0069] The polypeptide can be recovered and purified from
recombinant cell cultures by methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0070] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0071] The polypeptide of the present invention plays a role in
normal development and in normal physiological functions and may be
employed in such a manner to induce the appropriate biological
effect in a host.
[0072] The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials for
discovery of treatments and diagnostics to human disease.
[0073] This invention provides a method for identification of the
receptor for the mammary transforming protein. The gene encoding
the receptor can be identified by numerous methods known to those
of skill in the art, for example, ligand panning and FACS sorting
(Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5,
(1991)). Preferably, expression cloning is employed wherein
polyadenylated RNA is prepared from a cell responsive to the
mammary transforming protein, and a cDNA library created from this
RNA is divided into pools and used to transfect COS cells or other
cells that are not responsive to the mammary transforming protein.
Transfected cells which are grown on glass slides are exposed to
labeled mammary transforming protein. The mammary transforming
protein can be labeled by a variety of means including iodination
or inclusion of a recognition site for a site-specific protein
kinase. Following fixation and incubation, the slides are subjected
to auto-radiographic analysis. Positive pools are identified and
sub-pools are prepared and re-transfected using an iterative
sub-pooling and re-screening process, eventually yielding a single
clone that encodes the putative receptor. As an alternative
approach for receptor identification, labeled ligand can be
photoaffinity linked with cell membrane or extract preparations
that express the receptor molecule. Cross-linked material is
resolved by PAGE and exposed to X-ray film. The labeled complex
containing the ligand-receptor can be excised, resolved into
peptide fragments, and subjected to protein microsequencing. The
amino acid sequence obtained from microsequencing would be used to
design a set of degenerate oligonucleotide probes to screen a cDNA
library to identify the gene encoding the putative receptor.
[0074] The present invention also provides an assay to determine
the activity of the protein of the present invention. The assay
will determine the growth promoting activity of mammary
transforming protein in vitro by a serum-free cell culture system
in which mouse primary mammary epithelial cells can grow and
differentiate in response to specific mammogenic hormones and
related growth factors. This serum-free culture system may also be
employed to test the growth-promoting activity of mammary
transforming protein singly and in combination with other growth
factors on mammary epithelial cells. The mutant mammary
transforming protein may be used in this assay to determine the
effect of wild-type mammary transforming protein onthe growth of
mammary epithelial cells.
[0075] An in vivo assay to test the effect of the mammary
transforming protein of the present invention on the growth and
morphogenesis of mammary epithelial cells may be tested both in
in-tact and ovariectomized mice. The protein is administered into
the in-tact and ovariectomized mice and the growth-promoting
activity will be determined by Brd Uptake as well as by whole mount
preparation. The mammary transforming protein is administered into
the animal by several ways: (1) direct injection into the target
tissue; (2) mammary transforming protein pellet is made and
implanted into the animal and the mammary transforming protein is
administered by osmotic pump. The mammary transforming protein
growth-promoting activity on human cells in vivo may also be tested
by transplanting the collagen embedded human cells into the athymic
nude mice. For a review, see Bera, T., et al. PNAS, USA,
91:9789-9798 (1994).
[0076] This invention provides a method of screening compounds to
identify those which block interaction of mammary transforming
protein with its receptor. As an example, a mammalian cell or
membrane preparation expressing the mammary transforming protein
receptor would be incubated with labeled ligand in the presence of
the drug. The ability of the drug to block this interaction could
then be measured. Alternatively, the response of a known second
messenger system following interaction of ligand and receptor would
be measured and compared in the presence or absence of the drug.
Such second messenger systems include but are not limited to, cAMP
guanylate cyclase, ion channels or phosphoinositide hydrolysis.
Another example of an assay combines mammary transforming protein
and a potential antagonist with membrane-bound receptors or
recombinant receptors under appropriate conditions for a
competitive inhibition assay. Mammary transforming protein can be
labeled, such as by radioactivity, such that the number of
molecules bound to the receptor can determine the effectiveness of
the potential antagonist.
[0077] Potential antagonists include an antibody, or in some cases,
an oligopeptide, which binds to the polypeptide. Alternatively, a
potential antagonist may be a closely related protein which binds
to the receptor sites, however, they are inactive forms of the
polypeptide and thereby prevent the action of mammary transforming
protein since receptor sites are occupied.
[0078] Another potential antagonist is an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix--see Lee
et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of mammary
transforming protein. The antisense RNA oligonucleotide hybridizes
to the mRNA in vivo and blocks translation of the mRNA molecule
into mammary transforming protein polypeptide (Antisense--Okano, J.
Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense
Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)).
The oligonucleotides described above can also be delivered to cells
such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of mammary transforming protein.
[0079] Potential antagonists include a small molecule which binds
to and occupies the catalytic site of the polypeptide thereby
making the catalytic site inaccessible to substrate such that
normal biological activity is prevented. Examples of small
molecules include but are not limited to small peptides or
peptide-like molecules.
[0080] The antagonists may be employed to prevent the mammary
transforming protein of the present invention from neoplastically
transforming cells. The antagonists may be employed in a
composition with a pharmaceutically acceptable carrier, e.g., as
hereinafter described.
[0081] The polypeptides of the present invention may be employed in
combination with a suitable pharmaceutical carrier. Such
compositions comprise a therapeutically effective amount of the
polypeptide, and a pharmaceutically acceptable carrier or
excipient. Such a carrier includes but is not limited to saline,
buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The formulation should suit the mode of
administration.
[0082] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides of the present
invention may be employed in conjunction with other therapeutic
compounds.
[0083] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, parenterally,
intravenous, intraperitoneal, intramuscular, subcutaneous,
intranasal or intradermal routes. The pharmaceutical compositions
are administered in an amount which is effective for treating
and/or prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc.
[0084] The mammary transforming protein polypeptides and agonists
and antagonists which are polypeptides may also be employed in
accordance with the present invention by expression of such
polypeptides in vivo, which is often referred to as "gene
therapy."
[0085] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art and are apparent from the teachings herein. For example, cells
may be engineered by the use of a retroviral plasmid vector
containing RNA encoding a polypeptide of the present invention.
[0086] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
For example, a packaging cell is transduced with a retroviral
plasmid vector containing RNA encoding a polypeptide of the present
invention such that the packaging cell now produces infectious
viral particles containing the gene of interest. These producer
cells may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention.
[0087] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0088] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0089] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or hetorologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0090] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .psi.-2, .psi.-AM, PA12, T19-14X,
VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0091] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0092] This invention is also related to the use of the gene of the
present invention as a diagnostic. Detection of a mutated form of
the gene will allow a diagnosis of a disease or a susceptibility to
a disease which results from underexpression of mammary
transforming protein.
[0093] Individuals carrying mutations in the gene of the present
invention may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, including but not limited to blood, urine, saliva,
tissue biopsy and autopsy material. The genomic DNA may be used
directly for detection or may be amplified enzymatically by using
PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.
RNA or cDNA may also be used for the same purpose. As an example,
PCR primers complementary to the nucleic acid encoding mammary
transforming protein can be used to identify and analyze mutations.
For example, deletions and insertions can be detected by a change
in size of the amplified product in comparison to the normal
genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled RNA or alternatively, radiolabeled
antisense DNA sequences. Perfectly matched sequences can be
distinguished from mismatched duplexes by RNase A digestion or by
differences in melting temperatures
[0094] Sequence differences between the reference gene and genes
having mutations may be revealed by the direct DNA sequencing
method. In addition, cloned DNA segments may be employed as probes
to detect specific DNA segments. The sensitivity of this method is
greatly enhanced when combined with PCR. For example, a sequencing
primer is used with double-stranded PCR product or a
single-stranded template molecule generated by a modified PCR. The
sequence determination is performed by conventional procedures with
radiolabeled nucleotide or by automatic sequencing procedures with
fluorescent-tags.
[0095] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0096] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., PNAS, USA,
85:4397-4401 (1985)).
[0097] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0098] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0099] The present invention also relates to diagnostic assays for
detecting the presence or over-expression of the polypeptide of the
present invention in host tissues, for example histological
sections of mammary sections or in blood, since an over-expression
of the proteins compared to normal control tissue samples can
detect the presence of neoplasia, for example, cancer. Assays used
to detect levels of the polypeptide of the present invention in a
sample derived from a host are well-known to those of skill in the
art and include radioimmunoassays, competitive-binding assays,
Western Blot analysis and preferably an ELISA assay. An ELISA assay
initially comprises preparing an antibody specific to a mammary
transforming protein antigen, preferably a monoclonal antibody. In
addition a reporter antibody is prepared against the monoclonal
antibody. To the reporter antibody is attached a detectable reagent
such as radioactivity, fluorescence or in this example a
horseradish peroxidase enzyme. A sample is now removed from a host
and incubated on a solid support, e.g. a polystyrene dish, that
binds the proteins in the sample. Any free protein binding sites on
the dish are then covered by incubating with a non-specific protein
such as bovine serum albumin. Next, the monoclonal antibody is
incubated in the dish during which time the monoclonal antibodies
attached to any of the polypeptide of the present invention
attached to the polystyrene dish. All unbound monoclonal antibody
is washed out with buffer. The reporter antibody linked to
horseradish peroxidase is now placed in the dish resulting in
binding of the reporter antibody to any monoclonal antibody bound
to the polypeptide of the present invention. Unattached reporter
antibody is then washed out. Peroxidase substrates are then added
to the dish and the amount of color developed in a given time
period is a measurement of the amount of the polypeptide of the
present invention present in a given volume of patient sample when
compared against a standard curve.
[0100] A competition assay may be employed wherein antibodies
specific to the polypeptide of the present invention are attached
to a solid support and labeled mammary transforming protein and a
sample derived from the host are passed over the solid support and
the amount of label detected attached to the solid support can be
correlated to a quantity of the polypeptide of the present
invention in the sample. These assays may also be used to monitor
cancer progression, remission and recurrence.
[0101] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0102] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region of the gene is used to rapidly select
primers that do not span more than one exon in the genomic DNA,
thus complicating the amplification process. These primers are then
used for PCR screening of somatic cell hybrids containing
individual human chromosomes. Only those hybrids containing the
human gene corresponding to the primer will yield an amplified
fragment.
[0103] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0104] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA having at least 50 or 60 bases. For a review of this
technique, see Verma et al., Human Chromosomes: a Manual of Basic
Techniques, Pergamon Press, New York (1988).
[0105] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0106] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0107] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0108] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0109] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0110] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0111] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0112] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0113] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0114] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0115] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0116] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0117] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0118] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0119] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
Bacterial Expression and Purification of Mammary Transforming
Protein
[0120] The DNA sequence encoding mammary transforming protein, ATCC
# 97300, is initially amplified using PCR oligonucleotide primers
corresponding to the 5' sequences of the processed mammary
transforming protein (minus the signal peptide sequence) and the
vector sequences 3' to the mammary transforming protein gene.
Additional nucleotides corresponding to mammary transforming
protein were added to the 5' and 3' sequences respectively. The 5'
oligonucleotide primer has the sequence 5'
CGCGGATCCGCCATCATGTATATTAAAACTGCA 3' (SEQ ID NO:3) contains a BamHI
restriction enzyme site followed by 18 nucleotides of the mammary
transforming protein coding sequence. The 3' sequence 5' CGCGGATCC
CTAAAAGCTCCTAACTTG 3' (SEQ ID NO:4) contains complementary
sequences to a BamHI site and is followed by 18 nucleotides of
mammary transforming protein including the stop codon. The
restriction enzyme sites correspond to the restriction enzyme sites
on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
Calif., 91311). pQE-9 encodes antibiotic resistance (Amp.sup.r), a
bacterial origin of replication (ori), an IPTG-regulatable promoter
operator (P/O), a ribosome binding site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 was then digested with BamHI. The
amplified sequences were ligated into pQE-9 and were inserted in
frame with the sequence encoding for the histidine tag and the RBS.
The ligation mixture was then used to transform E. coli strain
M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
et al., Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989). M15/rep4 contains multiple copies of the
plasmid pREP4, which expresses the lacI repressor and also confers
kanamycin resistance (Kan.sup.r). Transformants are identified by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies were selected. Plasmid DNA was isolated and
confirmed by restriction analysis. Clones containing the desired
constructs were grown overnight (O/N) in liquid culture in LB media
supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N
culture is used to inoculate a large culture at a ratio of 1:100 to
1:250. The cells were grown to an optical density 600
(O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells were grown an extra 3 to 4 hours. Cells were then harvested
by centrifugation. The cell pellet was solubilized in the
chaotropic agent 6 Molar Guanidine HCl. After clarification,
solubilized mammary transforming protein was purified from this
solution by chromatography on a Nickel-Chelate column under
conditions that allow for tight binding by proteins containing the
6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184
(1984)). Mammary transforming protein ( 90% pure) was eluted from
the column in 6 molar guanidine HCl pH 5.0 and for the purpose of
renaturation adjusted to 3 molar guanidine HCl, 100 mM sodium
phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione
(oxidized). After incubation in this solution for 12 hours the
protein was dialyzed to 10 mmolar sodium phosphate.
EXAMPLE 2
Cloning and Expression of Mammary Transforming Protein Using the
Baculovirus Expression System
[0121] The DNA sequence encoding the full length mammary
transforming protein, ATCC # 97300, was amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene:
[0122] The 5' primer has the sequence 5' CGCGGATCCGCCATCATGTAT
ATTAAAACTGCA 3' (SEQ ID NO:5) and contains a BamHI restriction
enzyme site (in bold) followed by 6 nucleotides resembling an
efficient signal for the initiation of translation in eukaryotic
cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is just
behind the first 18 nucleotides of the mammary transforming protein
gene (the initiation codon for translation "ATG" is
underlined).
[0123] The 3' primer has the sequence 3' CGCGGATCCCTAAAAGCTCCT
AACTTG 5' (SEQ ID NO:6) and contains the cleavage site for the
restriction endonuclease BamHI and 18 nucleotides complementary to
the 3' translated sequence of the mammary transforming protein gene
and stop codon. The amplified sequences were isolated from a 1%
agarose gel using a commercially available kit ("Geneclean," BIO
101 Inc., La Jolla, Calif.). The fragment was then digested with
the endonuclease BamHI and then purified again on a 1% agarose gel.
This fragment is designated F2.
[0124] The vector pA2-Gp (modification of pVL941 vector, discussed
below) is used for the expression of the mammary transforming
protein using the baculovirus expression system (for review see:
Summers, M. D. and Smith, G. E. 1987, A manual of methods for
baculovirus vectors and insect cell culture procedures, Texas
Agricultural Experimental Station Bulletin No. 1555). This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by the recognition sites for the restriction endonuclease BamHI.
The polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of recombinant
virus the beta-galactosidase gene from E. coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of co-transfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V. A. and Summers,
M. D., Virology, 170:31-39).
[0125] The plasmid was digested with the restriction enzymes BamHI,
then dephosphorylated using calf intestinal phosphatase by
procedures known in the art. The DNA was then isolated from a 1%
agarose gel using the commercially available kit ("Geneclean" BIO
101 Inc., La Jolla, Calif.). This vector DNA is designated V2.
[0126] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells were then transformed and
bacteria identified that contained the plasmid (pBac mammary
transforming protein) with the mammary transforming protein gene
using the enzymes BamHI. The sequence of the cloned fragment was
confirmed by DNA sequencing.
[0127] 5 .mu.g of the plasmid pBac mammary transforming protein was
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus ("BaculoGold.TM. baculovirus DNA",
Pharmingen, San Diego, Calif.) using the lipofection method
(Felgner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417
(1987)).
[0128] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBac mammary transforming protein were mixed in a sterile
well of a microtiter plate containing 50 .mu.l of serum free
Grace's medium (Life Technologies Inc., Gaithersburg, Md.).
Afterwards 10 .mu.l Lipofectin plus 90 .mu.l Grace's medium were
added, mixed and incubated for 15 minutes at room temperature. Then
the transfection mixture was added drop-wise to the Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1
ml Grace's medium without serum. The plate was rocked back and
forth to mix the newly added solution. The plate was then incubated
for 5 hours at 27.degree. C. After 5 hours the transfection
solution was removed from the plate and 1 ml of Grace's insect
medium supplemented with 10% fetal calf serum was added. The plate
was put back into an incubator and cultivation continued at
27.degree. C. for four days.
[0129] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal", (Life
Technologies Inc., Gaithersburg) was used which allows an easy
isolation of blue stained plaques. (A detailed description of a
"plaque assay" can also be found in the user's guide for insect
cell culture and baculovirology distributed by Life Technologies
Inc., Gaithersburg, page 9-10).
[0130] Four days after the serial dilution, the virus was added to
the cells and blue stained plaques were picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses was
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus was used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0131] Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-mammary transforming protein at a multiplicity of
infection (MOI) of 2. Six hours later the medium was removed and
replaced with SF900 II medium minus methionine and cysteine (Life
Technologies Inc., Gaithersburg). 42 hours later 5 .mu.Ci of
.sup.35S-methionine and 5 .mu.Ci .sup.35S cysteine (Amersham) were
added. The cells were further incubated for 16 hours before they
were harvested by dialysis agains PBS and centrifugation and the
labelled proteins visualized by SDS-PAGE and autoradiography.
EXAMPLE 3
Expression of Recombinant Mammary Transforming Protein in COS
Cells
[0132] The expression of plasmid, mammary transforming protein HA
is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1)
SV40 origin of replication, 2) ampicillin resistance gene, 3) E.
coli replication origin, 4) CMV promoter followed by a polylinker
region, an SV40 intron and polyadenylation site. A DNA fragment
encoding the entire mammary transforming protein precursor and a HA
tag fused in frame to its 3' end is cloned into the polylinker
region of the vector, therefore, the recombinant protein expression
is directed under the CMV promoter. The HA tag corresponds to an
epitope derived from the influenza hemagglutinin protein as
previously described (I. Wilson, H. Niman, R. Heighten, A
Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37:767, (1984)).
The infusion of HA tag to the target protein allows easy detection
of the recombinant protein with an antibody that recognizes the HA
epitope.
[0133] The plasmid construction strategy is described as
follows:
[0134] The DNA sequence encoding mammary transforming protein, ATCC
# 97300, is constructed by PCR using two primers: the 5' primer 5'
GCGCGGATCCACCATGTATATTAAACTGCA 3' (SEQ ID NO:7) contains a BamHI
site followed by 18 nucleotides of mammary transforming protein
coding sequence starting from the initiation codon; the 3' sequence
5' GCGCTCTAGATCAAGCGTA GTCTGGGACGTCGTATGGGTAAAAGCTCCTAACTTG (SEQ ID
NO:8) contains complementary sequences to an XbaI site, translation
stop codon, HA tag and the last 15 nucleotides of mammary
transforming protein coding sequence (not including the stop
codon). Therefore, the PCR product contains a BamHI site, mammary
transforming protein coding sequence followed by HA tag fused in
frame, a translation termination stop codon next to the HA tag, and
an XbaI site. The PCR amplified DNA fragment and the vector,
pcDNAI/Amp, are digested with BamHI and XbaI restriction enzyme and
ligated. The ligation mixture is transformed into E. coli strain
SURE (Stratagene Cloning Systems, La Jolla, Calif.) the transformed
culture is plated on ampicillin media plates and resistant colonies
are selected. Plasmid DNA is isolated from transformants and
examined by restriction analysis for the presence of the correct
fragment. For expression of the recombinant mammary transforming
protein, COS cells are transfected with the expression vector by
DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory
Press, (1989)). The expression of the mammary transforming protein
HA protein is detected by radiolabelling and immunoprecipitation
method (Harlow, E. and Lane, D., Antibodies: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled
for 8 hours with .sup.35S-cysteine two days post transfection.
Culture media is then collected and cells are lysed with detergent
(RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC,
50 mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both
cell lysate and culture media are precipitated with an HA specific
monoclonal antibody. Proteins precipitated are analyzed on 15%
SDS-PAGE gels.
EXAMPLE 4
Expression via Gene Therapy
[0135] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0136] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0137] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0138] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0139] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0140] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0141] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
* * * * *