U.S. patent application number 10/023839 was filed with the patent office on 2003-02-06 for isolated dna sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants.
Invention is credited to Chaubet, Nicole, Derose, Richard, Gigot, Claude.
Application Number | 20030027312 10/023839 |
Document ID | / |
Family ID | 9481325 |
Filed Date | 2003-02-06 |
United States Patent
Application |
20030027312 |
Kind Code |
A1 |
Derose, Richard ; et
al. |
February 6, 2003 |
Isolated DNA sequence capable of serving as regulatory element in a
chimeric gene which can be used for the transformation of
plants
Abstract
An isolated DNA sequence capable of serving as regulatory
element in a chimeric gene which can be used for the transformation
of plants is disclosed. A chimeric gene for the transformation of
plants is also disclosed. The gene comprises at least, in the
direction of transcription, a promoter sequence, a transgene and a
regulatory element, characterized in that the regulatory element
consists of at least one intron 1 in the noncoding 5' region of a
plant histone gene allowing the expression of the protein in the
zones undergoing rapid growth. The production of transgenic plants
is also disclosed.
Inventors: |
Derose, Richard; (Lyon,
FR) ; Chaubet, Nicole; (Strasbourg, FR) ;
Gigot, Claude; (US) ; Chaubet, Nicole;
(Strasbourg, FR) |
Correspondence
Address: |
Norman H. Stepno
BURNS, DOANE, SWECKER & MATHIS, L.L.P.
P.O. Box 1404
Alexandria
VA
22313-1404
US
|
Family ID: |
9481325 |
Appl. No.: |
10/023839 |
Filed: |
December 21, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10023839 |
Dec 21, 2001 |
|
|
|
09000062 |
May 29, 1998 |
|
|
|
6338961 |
|
|
|
|
09000062 |
May 29, 1998 |
|
|
|
PCT/FR96/01109 |
Jul 17, 1996 |
|
|
|
Current U.S.
Class: |
435/199 ;
435/320.1; 435/410; 435/69.1; 536/23.2; 800/288 |
Current CPC
Class: |
C12N 15/8229 20130101;
C12N 15/8222 20130101; C12N 9/1092 20130101; C12N 15/8233 20130101;
C12N 15/8275 20130101; C12N 15/8223 20130101; C12N 15/8216
20130101; C12N 15/8231 20130101; A01K 2217/05 20130101; C07K 14/415
20130101 |
Class at
Publication: |
435/199 ;
800/288; 536/23.2; 435/410; 435/69.1; 435/320.1 |
International
Class: |
C12N 009/22; A01H
001/00; C07H 021/04; C12P 021/02; C12N 005/04 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 19, 1995 |
FR |
95/08980 |
Claims
1. An isolated DNA sequence capable of serving as a regulatory
element in a chimeric gene which can be used for the transformation
of plants and allowing the expression of the product of translation
of the chimeric gene in particular in the regions of the plant
undergoing rapid growth, characterized in that it comprises at
least one intron such as the first intron (intron 1) of the
noncoding 5' region of a plant histone gene.
2. DNA sequence according to claim 1, characterized in that histone
intron comes from a plant histone gene of the "H3.3-like" type.
3. DNA sequence according to either of claims 1 and 2,
characterized in that histone intron 1 comes from a dicotyledonous
plant.
4. DNA sequence according to claim 3, characterized in that histone
intron 1 comes from Arabidopsis thaliana.
5. DNA sequence according to either of claims 1 and 2,
characterized in that histone intron 1 comes from a
monocotyledonous plant.
6. DNA sequence according to claim 5, characterized in that histone
intron 1 comes from Zea mays.
7. DNA sequence according to any one of claims 1 to 6,
characterized in that intron 1 is oriented, in the direction of
transcription of the chimeric gene, in a direct or reversed manner
relative to its initial orientation in the direction of
transcription of the gene from which it is derived.
8. DNA sequence according to any one of claims 1 to 7,
characterized in that the regulatory element comprises two introns
1, identical or different, which are combined.
9. Chimeric gene for the transformation of plants comprising at
least, in the direction of transcription, one regulatory element
comprising a promoter sequence, a sequence of a herbicide tolerance
gene and a regulatory element, characterized in that the regulatory
element comprises, in addition, an intron 1 according to any one of
claims 1 to 8.
10. Chimeric gene according to claim 9, characterized in that the
promoter sequence comes from a promoter of a plant histone
gene.
11. Chimeric gene according to either of claims 9 and 10,
characterized in that the promoter zone comes from the same plant
histone gene as intron 1.
12. Chimeric gene according to any one of claims 9 to 11,
characterized in that the promoter sequence comprises a promoter
for a duplicated plant histone.
13. Chimeric gene according to any one of claims 9 to 12,
characterized in that the promoter sequence contains at least one
promoter of a plant histone gene combined with a different promoter
derived from a gene which can be naturally expressed in plants.
14. Chimeric gene according to one of claims 9 to 13, characterized
in that the coding gene makes it possible to confer on plants an
enhanced tolerance to a herbicide.
15. Chimeric gene according to claim 14, characterized in that the
herbicide tolerance gene is fused with a DNA sequence encoding a
signal peptide allowing the accumulation of the product of
translation of the herbicide tolerance gene in a subcellular
compartment.
16. Chimeric gene according to claim 15, characterized in that the
signal peptide zone allows the accumulation of the product of
translation of the herbicide tolerance gene in the plastid
compartment.
17. Chimeric gene according to claim 16, characterized in that the
signal peptide sequence comprises, in the direction of
transcription, at least one signal peptide sequence of a plant gene
encoding a signal peptide directing transport of a polypeptide to a
plastid, optionally a portion of the sequence of the mature
N-terminal part of a plant gene produced when the first signal
peptide is cleaved by proteolytic enzymes, and then optionally a
second signal peptide of a plant gene encoding a signal peptide
directing transport of the polypeptide to a sub-compartment of the
plastid.
18. Chimeric gene according to any one of claims 9 to 17,
characterized in that the herbicide tolerance gene encodes an
enzyme which is active towards herbicides whose target is
EPSPS.
19. Chimeric gene according to claim 18, characterized in that the
herbicide tolerance gene encodes an enzyme which is active towards
glyphosate.
20. Vector for the transformation of plants, characterized in that
it comprises a chimeric gene according to any one of claims 9 to
19.
21. Strain of Agrobacterium sp., characterized in that it contains
a vector according to claim 20.
22. Transformed plant cells, characterized in that it contains a
chimeric gene according to any one of claims 9 to 19.
23. Transformed plant or plant portion obtained from a cell
according to claim 22.
24. Process for the construction of a chimeric gene according to
any one of claims 9 to 23, which comprises isolating an intron 1
from a plant histons gene as defined in any one of claims 1 to 8, a
promoter sequence, a signal peptide, and at least one transgene,
and assembling them, in that order in the direction of
transcription of the transgene.
Description
[0001] The present invention relates to the use of a regulatory
element isolated from transcribed plant genes, of new chimeric
genes containing then and to their use for the transformation of
plants.
[0002] Numerous phenotypic characters associated with the
expression of one or more gene elements can be integrated into the
genome of plants and thus confer on those transgenic plants
advantageous agronomic properties. In a nonexhaustive manner, there
may be mentioned: the resistances to pathogenic agents for crops,
the resistance to phytotoxic plant-protection products, the
production of substances of dietary or pharmacological interest. In
addition to the isolation and characterization of the gene elements
encoding these various characters, an appropriate expression should
be ensured. This appropriate expression may be situated both at the
qualitative and quantitative levels. At the qualitative level, for
example the spatial level: preferential expression in a specific
tissue, or temporal level: inducible expression; at the
quantitative level, by the accumulated quantity of the product of
expression of the gene introduced. This appropriate expression
depends, for a large part, an the presence of regulatory gene
elements associated with the transgenes, in particular as regards
the quantitative and qualitative elements. Among the key elements
ensuring this appropriate regulation, the use of single or combined
homologous or heterologous promoter elements has been widely
described in the scientific literature. The use of a regulatory
element downstream of the transgene was used for the sole purpose
of putting a boundary which makes it possible to stop the process
of transcription of the transgene, without presupposition as to
their role as regards the quality or the quantity of the expression
of the transgene.
[0003] The present invention relates to the use of an intron 1
isolated from plant genes as a regulatory element, of now chimeric
genes containing them and to their use for the transformation of
plants. It relates to an isolated DNA sequence capable of serving
as a regulatory element in a chimeric gene which can be used for
the transformation of plants and allowing the expression of the
product of translation of the chimeric gene in particular in the
regions of the plant undergoing rapid growth, which comprises, in
the direction of transcription of the chimeric gene, at least one
intron such as the first intron (intron 1) of the noncoding 5'
region of a plant histone gene. It relates more particularly to the
simultaneous use of the intron 1 as a regulatory element and of
promoters isolated from the same plant gene. it allows the
appropriate expression, both quantitative and qualitative, of the
transgenes under the control of these elements for gene regulation.
This appropriate expression, obtained by the use of the present
invention, may relate to characters such as; the resistance to
pathogenic agents for crops, the resistance to phytotoxic
plant-protection products, the production of substances of dietary
or pharmacological interest. in particular, it makes it possible to
confer on the transgenic plants an enhanced tolerance to herbicides
by a qualitative and quantitative preferential expression of the
product of expression of the chimeric genes in the regions of the
plant undergoing rapid growth. This specific appropriate expression
of the gene for herbicide resistance is obtained by the
simultaneous use of the promoter regulatory elements and of at
least one intron 1 of the histone gene of the "H3.3- like" type as
regulatory element. Such a pattern of expression can be obtained
for all the characters which are of interest, as described above,
with the regulatory elements used to confer an enhanced herbicide
tolerance. The present invention also relates to the plant cells
transformed with the aid of these genes and the transformed plants
regenerated from these cells as well as the plants derived from
crossings using these transformed plants.
[0004] Among the plant-protection products used for the protection
of crops, the systemic products are characterized in that they are
transported in the plant after application and, for some of them,
accumulate in the parts undergoing rapid growth, especially the
caulinary and root apices, causing, in the case of herbicides,
deterioration, up to the destruction, of the sensitive plants. For
some of the herbicides exhibiting this type of behaviour, the
primary mode of action is known and results from inactivation of
characterized enzymes involved in the biosynthesis pathways of
compounds required for proper development of the target plants. The
target enzymes of those products may be located in various
subcellular compartments and observation of the mode of action of
known products most often shows a location in the plastid
compartment.
[0005] Tolerance of plants sensitive to a product belonging to this
group of herbicides, and whose primary target is known, may be
obtained by stable introduction, into their genome, of a gene
encoding the target enzyme, of any phylogenetic origin, mutated or
otherwise with respect to the characteristics of inhibition, by the
herbicide, of the product of expression of this gene. Another
approach comprises introducing, in a stable manner, into the genome
of sensitive plants a gene of any phylogenetic origin encoding an
enzyme capable of metabolizing the herbicide into a compound which
is inactive and nontoxic for the development of the plant. In the
latter came, it is not necessary to have characterized the target
of the herbicide.
[0006] Given the mode of distribution and accumulation of products
of this type in the treated plants, it is advantageous to be able
to express the product of translation of these genes so as to allow
their preferential expression and their accumulation in the regions
of the plant undergoing rapid growth where these products
accumulate. Furthermore, and in the case where the target of these
products is located in a cellular compartment other than the
cytoplasm, it is advantageous to be able to express the product of
translation of these genes in the form of a precursor containing a
polypeptide sequence allowing directing of the protein conferring
the tolerance into the appropriate compartment, and in particular
in the plastid compartment.
[0007] By way of example illustrating this approach, there may be
mentioned glyphosate, sulfosate or fosametine which are
broad-spectrum systemic herbicides of the phosphonomethylglycine
family. They act essentially as competitive inhibitors, in relation
to PEP (phosphoenolpyruvate), of 5-enolpyruvylshikimate-3-phosphate
synthase (EPSPS, EC 2.5.1.19). After their application to the
plant, they are transported into the plant where they accumulate in
the parts undergoing rapid growth, especially the caulinary and
root apices, causing the deterioration, up to the destruction, of
the sensitive plants.
[0008] EPSPS, the principal target of these products, is an enzyme
of the pathway of biosynthesis of aromatic amino acids which is
located in the plastid compartment. This enzyme is encoded by one
or more nuclear genes and is synthesized in the form of a
cytoplasmic precursor and then imported into the plastids where it
accumulates in its mature form.
[0009] The tolerance of plants to glyphosate and to products of the
family is obtained by the stable introduction, into their genome,
of an EPSPS gene of plant or bacterial origin, mutated or otherwise
with respect to the characteristics of inhibition, by glyphosate,
of the product of this gene. Given the mode of action of
glyphosate, it is advantageous to be able to express the product of
translation of this gene so as to allow its high accumulation in
the plastids and, furthermore, in the regions of the plant
undergoing rapid growth where the products accumulate.
[0010] It is known, for example, from American patent 4,535,060 to
confer on a plant a tolerance to a herbicide of the above type, in
particular N-phosphonomethylglycine or glyphosate, by introduction,
into the genome of the plants, of a gene encoding an EPSPS carrying
at least one mutation making this enzyme more resistant to its
competitive inhibitor (glyphosate), after location of the enzyme in
the plastid compartment. These techniques require, however, to be
improved for greater reliability in the use of these plants during
a treatment with these products under agronomic conditions.
[0011] In the present description, "plant" is understood to mean
any differentiated multicellular organism capable of photosynthesis
and "plant cell" any cell derived from a plant and capable of
constituting undifferentiated tissues such as calli, or
differentiated tissues such as embryos or plant portions or plants
or seeds. "Intron 1 of Arabidopsis as a regulatory element" is
understood to mean an isolated DNA sequence of variable length,
situated upstream of the coding part or corresponding to the
structural part of a transcribed gene. Gene for tolerance to a
herbicide is understood to mean any gene, of any phylogenetic
origin, encoding either the target enzyme for the herbicide,
optionally having one or more mutations with respect to the
characteristics of inhibition by the herbicide, or an enzyme
capable of metabolizing the herbicide into a compound which is
inactive and nontoxic for the plant. Zones of the plants undergoing
rapid growth are understood to mean the regions which are the seat
of substantial cell multiplications, in particular the apical
regions.
[0012] The present invention relates to the production of
transformed plants having an enhanced tolerance to herbicides
accumulating in the zones of the treated plants undergoing rapid
growth, by regeneration of cells transformed with the aid of new
chimeric genes comprising a gene for tolerance to these products.
The subject of the invention is also the production of transformed
plants having an enhanced tolerance to herbicides of the
phosphonomethylglycine family by regeneration of cells transformed
with the aid of new chimeric genes comprising a gene for tolerance
to these herbicides. The invention also relates to these new
chimeric genes, as well as to transformed plants which are more
tolerant because of a better tolerance in the parts of these plants
undergoing rapid growth, as well as to the plants derived from
crossings using these transformed plants. Its subject is also new
intron 1 of a plant histone and its use as regulatory zone for the
construction of the above chimeric genes.
[0013] More particularly, the subject of the invention is a
chimeric gene for conferring on plants especially an enhanced
tolerance to a herbicide having EPSPS as target, comprising, in the
direction of transcription, a promoter element, a signal peptide
sequence, a sequence encoding an enzyme for tolerance to the
products of the phosphonomethylglycine family and a regulatory
element, characterized in that the regulatory element comprises a
fragment of an intron 1 of a plant histone gene in any orientation
relative to its initial orientation in the gene from which it is
derived, allowing the preferential expression and the accumulation
of the protein for tolerance to the herbicide in the zones for
accumulation of the said herbicide.
[0014] The histone gene, from which intron 1 according to the
invention is derived, comes from a monocotyledonous plant such an
for example wheat, maize or rice, or preferably from a
dicotyledonous plant such as for example lucerne, sunflower, soya
bean, rapeseed or preferably Arabidopsis thaliana. Preferably, a
histone gene of the "H3.3-like" type is used.
[0015] The signal peptide sequence comprises, in the direction of
transcription, at least one signal peptide sequence of a plant gene
encoding a signal peptide directing transport of a polypeptide to a
plastid, a portion of the sequence of the mature N-terminal part of
a plant gene produced when the first signal peptide is cleaved by
proteolytic enzymes, and then a second signal peptide of a plant
gene encoding a signal peptide directing transport of the
polypeptide to a sub-compartment of the plastid. The signal peptide
sequence is preferably derived from a gene for the small subunit of
ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisco) according
to European patent application PCT 508 909. The role of this
characteristic sequence is to allow the release, into the plastid
compartment, of a mature polypeptide with a maximum efficiency,
preferably in a native form.
[0016] The coding sequence which can be used in the chimeric gene
according to the invention comes from a herbicide tolerance gene of
any phylogenetic origin. This sequence may be especially that of
the mutated EPSPS having a degree of tolerance to glyphosate.
[0017] The promoter element according to European patent
application PCT 507 698 may be of any origin, in a single or
duplicated or combined form of a gene naturally expressed in
plants, that is to say, for example of bacterial origin such as
that of the nopaline synthase gene, or of viral origin such as that
of the 35S transcript of the cauliflower mosaic virus, or
preferably of plant origin such as that of the small subunit of the
ribulose-1,5-bisphosphate carboxylase/oxygenase or preferably such
as that of a plant histone gene and preferably from Arabidopsis
thaliana. A histone gene of the "H4" type is preferably used.
[0018] The chimeric gene according to the invention may comprise,
in addition to the above essential parts, an untranslated
intermediate zone (linker) between the promoter zone and the coding
zone as well as between the coding zone and intron 1 and which may
be of any phylogenetic origin.
[0019] The following examples show by way of illustration, but with
no limitation being implied, several aspects of the invention:
isolation of the introns according to the invention and their use
for the genetic transformation of plants as well as the improved
qualities of expression of the heterologous genes of plants
transformed with the aid of these introns. References to "Current
Protocols in Molecular Biology" are to Volumes 1 and 2, Ausubel F.
M. et al., published by Greene Publishing associates and Wiley
Interscience (1989) (CPMB).
EXAMPLE 1
[0020] 1. Production of an EPSPS fragment from Arabidopsis
thaliana
[0021] a) two 20-mer oligonucleotides of respective sequences:
1 5'-GCTCTGCTCATGTCTGCTCC-3' 5'-GCCCGCCCTTGACAAAGAAA-3'
[0022] were synthesized from the sequence of an EPSPS gene from
Arabidopsis thaliana (Klee H. J. et al., (1987) Mol. Gen. Genet.,
210, 437-442). These two oligonucleotides correspond to positions
1523 to 1543 and 1737 to 1717, respectively, of the published
sequence and in convergent orientation.
[0023] b) The total DNA from Arabidopsis thaliana (var. columbia)
was obtained from Clontech (catalogue reference: 6970-1)
[0024] c) 50 nanograms (ng) of DNA are mixed with 300 ng of each of
the oligonucleotides and subjected to 35 amplification cycles with
a Perkin-Elmer 9400 apparatus under the standard medium conditions
for amplification recommended by the supplier. The resulting 204 bp
fragment constitutes the EPSPS fragment from Arabidopsis
thaliana.
[0025] 2. Construction of a library of a cDNA from a BMS maize cell
line.
[0026] a) 5 g of filtered cells are ground in liquid nitrogen and
the total nucleic acids extracted according to the method described
by Shure et al. with the following modifications:
[0027] the pH of the lysis buffer is adjusted to pH=9.0
[0028] after precipitation with isopropanol, the pellet is taken up
in water and after dissolution, adjusted to 2.5 M LiCl. After
incubation for 12 h at 0.degree. C., the pellet from the 15 min
centrifugation at 30,000 g at 4.degree. C. is resolubilized. The
LiCl precipitation stage is then repeated. The resolubilized pellet
constitutes the RNA fraction of the total nucleic acids.
[0029] b) the RNA-poly A+ fraction of the RNA fraction is obtained
by chromatography on an oligo-dT cellulose column as described in
"Current Protocols in Molecular Biology".
[0030] c) Synthesis of double-stranded cDNA with an EcoRI synthetic
end; it is carried out by following the procedure of the supplier
of the various reagents necessary for this synthesis in the form of
a kit: the "copy kit" from the company Invitrogen.
[0031] Two single-stranded and partially complementary
oligonucleotides of respective sequences:
2 5'-AATTCCCGGG-3' 5'-CCCGGG-3'
[0032] (the latter being phosphorylated) are ligated to
double-stranded cDNAs with blunt ends.
[0033] This ligation of the adaptors results in the creation of
SmaI sites attached to the double-stranded cDNAs and of EcoRI sites
in cohesive form at each and of the double-stranded cDNAs.
[0034] d) Creation of the library:
[0035] The cDNAs having at their ends the cohesive artificial EcoRI
sites are ligated to the .lambda.gt10 bacteriophage cDNA cut with
EcoRI and dephosphorylated according to the procedure of the
supplier New England Biolabs.
[0036] An aliquot from the ligation reaction was encapsidated in
vitro with encapsidation extracts: Gigapack Gold according to the
supplier's instructions, this library was titrated using the
bactertium E. coli C600 hfl. The library thus obtained is amplified
and stored according to the instructions of the same supplier and
constitutes the cDNA library from BMS maize cell suspension.
[0037] 3. screening of the cDNA library from BMS maize cell
suspension with the EPSPS probe from Arabidopsis thaliana:
[0038] The procedure followed is that of "Current Protocols in
Molecular Biology". Briefly, about 10.sup.6 recombinant phages are
plated on an LB plate at a mean density of 100 phages/cm.sup.2. The
lysis plaques are replicated in duplicate on a Hybond N membrane
from Amersham.
[0039] The DNA was fixed onto the filters by a 1600 kJ UV treatment
(Stratalinker from Stratagene). The filters were prehybridized in:
6.times.SSC/0.1% SDS/0.25[lacuna] skimmed milk for 2 h at
65.degree. C. The EPSPS probe from Arabidopsis thaliana was
labelled with .sup.32P-dCTP by random priming according to the
instructions of the supplier (Kit Ready to Go from Pharmacia). The
specific activity obtained is of the order of 10.sup.3 cpm per
.mu.g of fragment. After denaturation for 5 min at 100.degree. C.,
the probe is added to the prehybridization medium and the
hybridization is continued for 14 hours at 55.degree. C. The
filters are fluorographed for 48 h at -80.degree. C. with a Kodak
XAR5 film and intensifying screens Hyperscreen RPN from Amersham.
The alignment of the positive spots on the filter with the plates
from which they are derived make it possible to collect, from the
plate, the zones corresponding to the phages exhibiting a positive
hybridization response with the EPSPS probe from Arabidopsis
thaliana. This step of plating, transfer, hybridization and
recovery is repeated until all the spots of the plate of phages
successively purified prove 100% positive in hybridization. A lysis
plaque per independent phage in then collected in the diluent
.lambda. medium (Tris-Cl pH=7.5; 10 mM MgSO4; 0.1 M NaCl; 0.1%
gelatine), these phages in solution constituting the positive EPSPS
clones from the BMS maize cell suspension.
[0040] 4. Preparation and analysis of the DNA of the EPSPS clones
from the BMS maize cell suspension.
[0041] About 5.times.10.sup.3 phages are added to 20 ml of 600hfl
bacteria at OD 2 (600 nm/ml) and incubated for 15 minutes at
37.degree. C. This suspension is then diluted in 200 ml of growth
medium for the bacteria in a 1l Erlenmeyer flask and shaken in a
rotary shaker at 250 rpm. Lysis is observed by clarification of the
medium, corresponding to lysis of the turbid bacteria and occurs
after about 4 h of shaking. This supernatant is then treated as
described in "Current Protocols in Molecular Biology". The DNA
obtained corresponds to the EPSPS clones from the BMS maize cell
suspension.
[0042] One to two .mu.g of this DNA are cut with EcoRI and
separated on a 0.8% LGTA/TBE agarose gel (ref. CPMB). A final
verification consists in ensuring that the purified DNA indeed
exhibits a hybridization signal with the EPSPS probe from
Arabidopsis thaliana. After electrophoresis, the DNA fragments are
transferred onto Hybond N membrane from Amersham according to the
Southern procedure described in "Current Protocols in Molecular
Biology". The filter is hybridized with the EPSPS probe from
Arabidopsis thaliana according to the conditions described in
paragraph 3 above. The clone exhibiting a hybridization signal with
the EPSPS probe from Arabidopsis thaliana and containing the
longest EcoRI fragment has a gel-estimated size of about 1.7
kbp.
[0043] 5. Production of the pRPA-ML-711clone:
[0044] Ten .mu.g of DNA from the phage clone containing the 1.7 kbp
insert are digested with EcoRI and separated on a 0.8% LGTA/TBE
agarose gel (ref. CPMB). The gel fragment containing the 1.7 kbp
insert is excised from the gel by BET staining and the fragment is
treated with .beta.-agarase according to the procedure of the
supplier New England Biolabs. The DNA purified from the 1.7 kbp
fragment is ligated at 12.degree. C. for 14 h with DNA from the
plasmid pUC 19 (New England Biolabs) cut with EcoRI according to
the ligation procedure described in "Current Protocols in Molecular
Biology". Two .mu.l of the above ligation mixture are used for the
transformation of one aliquot of electrocompetent E. coli DH10B;
the transformation occurs by electroporation using the following
conditions: the mixture of competent bacteria and ligation medium
is introduced into an electroporation cuvette 0.2 cm thick (Biorad)
previously cooled to 0.degree. C. The physical electroporation
conditions using an electroporator of Biorad trade mark are 2500
volts, 25 .mu.Farad and 200 .OMEGA.. Under these conditions, the
mean condenser discharge time is of the order of 4.2 milliseconds.
The bacteria are then taken up in 1 ml of SOC medium (ref. CPMB)
and shaken for 1 hour at 200 rpm on a rotary shaker in 15 ml
Corning tubes. After plating on LB/agar medium supplemented with
100 .mu.g/ml of carbenicillin, the mini-preparations of the
bacteria clones having grown overnight at 37.degree. C. are carried
out according to the procedure described in "Current Protocols in
Molecular Biology". After digestion of the DNA with EcoRI and
separation by electrophoresis on a 0.8% LGTA/TBE agarose gel (ref.
CPMB), the clones having a 1.7 kbp insert are conserved. A final
verification consists in ensuring that the purified DNA indeed
exhibits a hybridization signal with the EPSPS probe from
Arabidopsis thaliana. After electrophoresis, the DNA fragments are
transferred onto a Hybond N membrane from Amersham according to the
Southern procedure described in "Current Protocols in Molecular
Biology". The filter is hybridized with the EPSPS probe from
Arabidopsis thaliana according to the conditions described in
paragraph 3 above. The plasmid alone having a 1.7 kbp insert and
hybridizing with the EPSPS probe from Arabidopsis thaliana was
prepared on a larger scale and the DNA resulting from the lysis of
the bacteria purified on a CsCl gradient as described in "Current
Protocols in Molecular Biology". The purified DNA was partially
sequenced with a Pharmacia kit, following the supplier's
instructions and using, as primers, the direct and reverse M13
universal primers ordered from the same supplier. The partial
sequence produced covers about 0.5 kbp. The derived amino acid
sequence in the region of the mature protein (about 50 amino acid
residues) exhibits 100% identity with the corresponding amino
sequence of the mature maize EPSPS described in American patent
U.S. Pat. No. 4,971,908. This clone, corresponding to a 1.7 kbp
EcoRI fragment of the DNA for the EPSP from the BMS maize cell
suspension, was called pRPA-ML-711. The complete sequence of this
clone was obtained on both strands by using the Pharmacia kit
procedure and by synthesizing oligonucleotides which are
complementary and of opposite direction every 250 bp approximately.
The complete sequence of this 1713 bp clone obtained is presented
by SEQ ID No. 1.
[0045] 6. Production of the clone pRPA-ML-715:
[0046] Analysis of the sequence of the clone pRPA-ML-711 and in
particular comparison of the derived amino acid sequence with that
from maize shows a sequence extension of 92 bp upstream of the GCG
codon encoding the NH.sub.2-terminal alanine of the mature part of
the maize EPSPS (American patent U.S. Pat. No. 4,971,908).
Likewise, a 288 bp extension downstream of the AAT codon encoding
the COOH-terminal asparagine of the mature part of the maize EPSPS
(American patent U.S. Pat. No. 4,971,908) is observed. These two
parts might correspond, for the NH.sub.2-terminal extension, to a
portion of the sequence of a signal peptide before plastid location
and, for the COOH-terminal extension, to the untranslated 3' region
of the cDNA.
[0047] In order to obtain a cDNA encoding the mature part of the
cDNA for the maize EPSPS, as described in U.S. Pat. No. 4,971,908,
the following operations were carried out:
[0048] a) Elimination of the untranslated 3' region: construction
of pRPA-ML-712:
[0049] The clone pRPA-ML-711 was cut with the restriction enzyme
AseI and the resulting ends of this cut made blunt by treating with
the Klenow fragment of DNA polymerase I according to the procedure
described in CPMB. A cut with the restriction enzyme SacII was then
performed. The DNA resulting from these operations was separated by
electrophoresis on a 1% LGTA/TBE agarose gel (ref. CPMD)
[0050] The gel fragment containing the insert "AseI-blunt
ends/SacII" of 0.4 kbp was excised from the gel and purified
according to the procedure described in paragraph 5 above. The DNA
of the clone pRPA-ML-711 was cut with the restriction enzyme
HindIII situated in the polylinker of the cloning vector pUC19 and
the ends resulting from this cut were made blunt by treating with
the Klenow fragment of DNA polymerase I. A cut with the restriction
enzyme SacII was then performed. The DNA resulting from these
manipulations was separated by electrophoresis on a 0.7% LGTA/TBE
agarose gel (ref. CPMB).
[0051] The gel fragment containing the insert HindIII-blunt
ends/SacII of about 3.7 kbp was excised from the gel and purified
according to the procedure described in paragraph 5 above.
[0052] The two inserts were ligated, and 2 .mu.l of the ligation
mixture served to transform E. coli DH10B as described above in
paragraph 5.
[0053] The plasmid DNA content of the various clones was analysed
according to the procedure described for pRPA-ML-711. One of the
plasmid clones retained contains an EcoRI-HindIII insert of about
1.45 kbp. The sequence of the terminal ends of this clones shows
that the 5' end of the insert corresponds exactly to the
corresponding end of pRPA-ML-711 and that the 3' terminal end has
the following sequence:
[0054] "5'. . . AATTAAGCTCTAGAGTCGACCTGCAGGCATGCAAGCTT-3'".
[0055] The sequence underlined corresponds to the codon for the
COOH-terminal amino acid asparagine, the next codon corresponding
to the stop codon for translation. The nucleotides downstream
correspond to sequence components of the polylinker of pUC19. This
clone, comprising the sequence of pRPAML-711 up to the site for
termination of translation of the mature maize EPSPS and followed
by sequences of the polylinker of pUC19 up to the HindIII site, was
called pRPA-ML-712.
[0056] b) Modification of the 5' end of pRPA-ML-712: construction
of pRPA-ML-715
[0057] The clone pRPA-NL-712 was cut with the restriction enzymes
PstI and HindIII. The DNA resulting from these manipulations was
separated by electrophoresis on a 0.8% LGTA/TBE agarose gel (ref.
CPMB). The gel fragment containing the PstI/EcoRI insert of 1.3 kbp
was excised from the gel and purified according to the procedure
described in paragraph 5 above. This insert was ligated in the
presence of an equimolar quantity of each of the two partially
complementary oligonucleotides of sequence:
3 Oligo 1: 5'-GAGCCGAGCTCCATGGCCGGCGCCGAGGAGATCGTGCTGCA-3- ' Oligo
2: 5'-GCACGATCTCCTCGGCGCCGGCCATGGAGCTCGG- CTC-3'
[0058] as well as in the presence of DNA from the plasmid pUC19
digested with the restriction enzymes BamHI and HindIII.
[0059] Two .mu.l of the ligation mixture served to transform E.
coli DH10B as described above in paragraph 5. After analysis of the
plasmid DNA content of various clones according to the procedure
described above in paragraph 5, one of the clones having an insert
of about 1.3 kbp was conserved for subsequent analyses. The
sequence of the terminal 5' end of the clone retained shows that
the DNA sequence in this region is the following: sequence of the
polylinker of pUC19 of the EcoRI to BamHI sites, followed by the
sequence of the oligonucleotides used during the cloning, followed
by the rest of the sequence present in pRPAML-712. This clone was
called pRPA-ML-713. This clone has a methionine codon ATG included
in an NcoI site upstream of the N-terminal alanine codon of the
mature EPSPSynthase. Furthermore, the alanine and glycine codons of
the N-terminal and were conserved, but modified on the third
variable base: initial GCGGGT gives modified GCCGGC.
[0060] The clone pRPA-ML-713 was cut with the restriction enzyme
HindIII and the ends of this cut made blunt by treating with the
Klenow fragment of DNA polymerase I. A cut with the restriction
enzyme SacI was then performed. The DNA resulting from these
manipulations was separated by electrophoresis on a 0.8% LGTA/TBE
agarose gel (ref. CPMB) The gel fragment containing the insert
"HindIII-blunt ends/SacI" of 1.3 kbp was excised from the gel and
purified according to the procedure described in paragraph 5 above.
This insert was ligated in the presence of DNA from the plasmid
pUC19 digested with the restriction enzyme XbaI and the ends of
this cut made blunt by treating with the Klenow fragment of DNA
polymerase I. A cut with the restriction enzyme SacI was then
performed. Two .mu.l of the ligation mixture served to transform E.
coli DH10B as described above in paragraph 5. After analysis of the
plasmid DNA content of various clones according to the procedure
described above in paragraph 5, one of the clones having an insert
of about 1.3 kbp was conserved for subsequent analyses. The
sequence of the terminal ends of the clone retained shows that the
DNA sequence is the following: sequence of the polylinker of pUC19
of the EcoRI to SacI sites, followed by the sequence of the
oligonucleotides used during the cloning, from which the 4 bp GATCC
of oligonucleotide 1 described above have been deleted, followed by
the rest of the sequence present in pRPA-ML-712 up to the HindIII
site and sequence of the polylinker of pUC19 from XbaI to HindIII.
This clone was called pRPA-NL-715.
[0061] 7) Production of a cDNA encoding a mature
[0062] All the mutagenesis steps were carried out with the U.S.E.
mutagenesis kit from Pharmacia, following the instructions of the
supplier. The principle of this mutagenesis system is as follows:
the plasmid DNA is heat-denatured and recombined in the presence of
a molar excess, on the one hand, of the mutagenesis oligonucleotide
and, on the other hand, of an oligonuclootide which makes it
possible to eliminate a unique restriction enzyme site present in
the polylinker. After the reassociation step, the synthesis of the
complementary strand is performed by the action of T4 DNA
polymerase in the presence of T4 DNA ligase and protein of gene 32
in an appropriate buffer provided. The synthesis product is
incubated in the presence of the restriction enzyme, whose site is
supposed to have disappeared by mutagenesis. The E. coli strain
exhibiting, in particular, the mutS mutation is used as host for
the transformation of this DNA. After growth in liquid medium, the
total plasmid DNA is prepared and incubated in the presence of the
restriction enzyme used above. After these treatments, the E. coli
DH10B strain is used as host for the transformation. The plasmid
DNA of the isolated clones is prepared and the presence of the
mutation introduced is checked by sequencing.
[0063] A) Site or sequence modifications with no effect a priori on
the resistance character of maize EPSPS to the products which are
competitive inhibitors of the activity of EPSP synthase:
elimination of an internal NcoI site from pRPA-ML-715.
[0064] The sequence of pRPA-ML-715 is arbitrarily numbered by
placing the first base of the N-terminal alanine codon GCC in
position 1. This sequence has an NcoI site in position 1217. The
site-modifying oligonucleotide has the sequence;
[0065] 5'-CCACAGGATGGCGATGGCCTTCTCC-3'.
[0066] After sequencing according to the references given above,
the sequence read after mutagenesis corresponds to that of the
oligonucleotide used. The NcoI site was indeed eliminated and
translation into amino acids in this region conserves the initial
sequence present in pRPA-ML-715.
[0067] This clone was called pRPA-ML-716.
[0068] The 1340 bp sequence of this clone is represented as SEQ ID
No. 2 and SEQ ID No. 3.
[0069] B) Sequence modifications allowing an increase in the
resistance character of maize EPSPS to products which are
competitive inhibitors of the activity of EPSP synthase.
[0070] The following oligonucleotides were used:
4 a) Thr 102 .fwdarw. Ile mutation.
5'-GAATGCTGGAATCGCAATGCGGCCATTGACAGC-3' b) Pro 106 .fwdarw. Ser
mutation. 5'-GAATGCTGGAACTGCAATGCGGTCCTTGACAGC-3' c) Gly 101
.fwdarw. Ala and Thr 102 .fwdarw. Ile mutations.
5'-CTTGGGGAATGCTGCCATCGCAATGCGGCCATTG-3' d) Thr 102 .fwdarw. Ile
and Pro 106 .fwdarw. Ser mutations.
5'-GGGGAATGCTGGAATCGCAATGCGGTCCTTGACAGC-3'
[0071] After sequencing, the sequence read after mutagenesis on the
three mutated fragments is identical to the sequence of the
parental DNA pRPA-ML-716 with the exception of the mutagenesis
region which corresponds to that of the mutagenesis
oligonucleotides used. These clones were called: pRPA-ML-717 for
the Thr 102.fwdarw.Ile mutation, pRPA-ML-718 for the Pro
106.fwdarw.Ser mutation, pRPA-ML-719 for the Gly 101.fwdarw.Ala and
Thr 102.fwdarw.Ile mutations and pRPA-ML-720 for the Thr
102.fwdarw.Ile and Pro 106.fwdarw.Ser mutations.
[0072] The 1340 bp sequence of pRPA-ML-720 is represented as SEQ ID
No. 4 and SEQ ID No. 5.
[0073] The NcoI-HindIII insert of 1395 bp will be called in the
rest of the descriptions "the double mutant of maize EPSPS".
EXAMPLE 2
Construction of chimeric genes
[0074] The construction of chimeric genes according to the
invention is carried out using the following elements:
[0075] 1). The genomic clone (cosmid clone c22) from Arabidopsis
thaliana, containing two genes of the "H3.3-like" type was isolated
as described in Chaubet et al. (J. Mol. Biol. 1992, 225
569-574).
[0076] 2). Intron No. 1:
[0077] A DNA fragment of 414 base pairs is purified from digestion
of the cosmid clone c22 with the restriction enzyme DdeI followed
by treatment with a Klenow fragment of DNA polymerase from E. coli,
according to the manufacturer's instructions for creating a
blunt-ended DNA fragment and then cut with MseI. The purified DNA
fragment is ligated to a synthetic oligonucleotide adapter having
the following sequence:
5 Adaptor 1: 5' TAATTTGTTGAACAGATCCC 3' TAAACAACTTGTCTAGGG
[0078] The ligation product is cloned into pGEM7Zf (+) (Stratagene
catalogue No. P2251) which was digested with SmaI. This clone,
called "intron No. 1", is checked by sequencing (SEQ ID No. 6).
[0079] 3). Intron No. 2:
[0080] A DNA fragment of 494 base pairs is purified from the
digestion of the cosmid clone c22 with the restriction enzymes AluI
and CfoI. The purified DNA fragment is listed to a synthetic
oligonucleotide adaptor having the following sequence:
6 Adaptor 2: 5' CAGATCCCGGGATCTGCG 3' GCGTCTAGGGCCCTAGACGC
[0081] The ligation product is cloned into pGEM7Zf (+) (Stratagene
catalogue No. P2251) which was digested with SmaI. This clone,
called "intron No. 2", is checked by sequencing (SEQ ID No. 7).
[0082] 4). pRA-1
[0083] The construction of this plasmid is described in French
patent 9,308,029. This plasmid is a derivative of pBI 101.1
(Clonetech catalogue No. 6017-1) which contains the histone
promoter from Arabidopsis H4A748 regulating the synthesis of the E.
coli .beta.-glucoronidase gene and of the nopaline synthase ("NOS")
polyadenylation site. Thus, a chimeric gene is obtained having the
structure:
[0084] "H4A748 promoter-GUS gene-NOS"
[0085] 5). pCG-1
[0086] This plasmid contains the above intron No. 1 placed between
the H4A748 promoter and the GUS coding region of pRA-1. This plamid
is obtained by digestion of cosmid clone c22 with BamHI and SmaI.
The intron No. 1 of 418 base pairs is directly ligated into pRA-1
which was digested with BamHI and SmaI.
[0087] Thus, a chimeric gene in obtained having the structure:
[0088] "H4A748 promoter-intron NO. 1-GUS gene-NOS"
[0089] 6). pCG-13
[0090] This plasmid contains the above intron No. 2 placed between
the H4A748 promoter and the GUS coding region of pRA-1. This
plasmid is obtained by digestion of cosmid clone c22 with BamHI and
SmaI. The intron No. 2 of 494 base pairs is directly ligated into
pRA-1 which was digested with BamHI and SmaI.
[0091] Thus, a chimeric gene is obtained having the structure:
[0092] "H4A748 promoter-intron No. 2-GUS gene-NOS"
[0093] 7). pCG-15
[0094] This plasmid contains only intron No. 1 before the above GUS
coding sequence placed between the H4A748 promoter and the GUS
coding region of pCG-1. This plasmid is obtained by digestion of
pCG-1 with BamHI and HindIII followed by treatment with a Klenow
fragment of DNA polymerase from E. coli, according to the
manufacturer's instructions for creating a blunt-ended DNA
fragment.
[0095] This vector is then religated to give a chimeric gene having
the structure:
[0096] "intron No. 1-GUS-NOS"
[0097] 8). pCG-18
[0098] This plasmid contains only the above intron No. 2 in front
of the GUS coding sequence of pCG-13. This plasmid is obtained by
partial digestion of pCG-13 with BamHI and SphI, followed by
treatment with a fragment of T4 phage DNA polymerase, according to
the manufacturer's instructions in order to create a blunt-ended
DNA fragment.
[0099] This vector is then religated and checked by enzymatic
digestion in order to give a chimeric gene having the
structure:
[0100] "intron No. 2-GUS-NOS"
[0101] 9). pRPA-RD-124
[0102] Addition of a "nos" polyadenylation signal to pRPA-ML-720
with creation of a cloning cassette containing the maize double
mutant EPSPS gene (Thr 102.fwdarw.Ile and Pro 106.fwdarw.ser).
pRPA-ML-720 is digested with HindIII and treated with the Klenow
fragment of DNA polymerase from E. coli in order to produce a blunt
end. A second digestion is carried out with NcoI and the EPSPS
fragment is purified. The EPSPS gene is then ligated with purified
pRPA-RD-12 (a cloning cassette containing the nopaline synthase
polyadenylation signal) to give pRPA-RD-124. To obtain the purifed
useful vector pRPA-RD-12, it was necessary for the latter to be
previously digested with SalI, treated with Klenow DNA polymerase,
and then digested a second time with NcoI.
[0103] 10). pRPA-RD-125
[0104] Addition of an optimized signal peptide (OSP) from
pRPA-RD-124 with creation of a cloning cassette containing the
EPSPS gene targeted on the plasmids. pRPA-RD-7 (European Patent
Application EP 652 286) is digested with SphI, treated with T4 DNA
polymerase and then digested with SpeI and the OSP fragment is
purified. This OSP fragment is cloned into pRPA-RD-124 which was
previously digested with NcoI, treated with Klenow DNA polymerase
in order to remove the 3' protruding part, and then digested with
SpeI. This clone is then sequenced in order to ensure the correct
translational fusion between the OSP and the EPSPS gene.
pRPA-RD-125 is then obtained.
[0105] 11). pRPA-RD-196
[0106] In this plasmid, the "intron No. 1+.beta.-glucoronidase gene
from E. coli" portion of pCG-1 is replaced by a chimeric gene of 2
kilobases containing an optimized signal peptide, a double mutant
EPSPS gene (Ile.sub.102+Ser.sub.106) and a nopaline synthase
polyadenylation site ("NOS") isolated from pRPA-RD-125. To obtain
pRPA-RD-196, the digestion of pCG-1 is performed with EcoRI and
BamHI, followed by treatment with a Klenow fragment of DNA
polymerase from E. coli, according to the manufacturer's
instructions in order to create a blunt-ended DNA fragment. The
2-kilobase DNA fragment containing an optimized signal peptide of a
double mutant EPSPS gene (Ile.sub.102+Ser.sub.106) and a nopaline
synthase polyadenylation site ("NOS") is obtained from pRPA-RD-125
by digestion with NcoI and NotI, followed by treatment with DNA
polymerase from E. coli, according to the manufacturer's
instructions in order to create a blunt-ended DNA fragment. This
blunt-ended fragment is then ligated into pCG-1 prepared above.
[0107] A chimeric gene is thus obtained having the structure:
[0108] "H4A748 promoter-OSP-maize EPSPS gene-NOS"
[0109] 12). pRPA-RD-197
[0110] In this plasmid, the ".beta.-glucoronidase gene from E. coli
portion of pCG-1 is replaced by a chimeric gene of 2 kilobases
containing an optimized signal peptide, a double mutant EPSPS gene
(Ile.sub.102+Ser.sub.106) and a nopaline synthase polyadenylation
site ("NOS") isolated from pRPA-RD-125. To obtain pRPA-RD-197, the
digestion of pCG-1 is performed with EcoRI, followed by treatment
with a Klenow fragment of DNA polymerase from E. coli, according to
the manufacturer's instructions in order to create a blunt-ended
DNA fragment, then cut with SmaI. The 2-kilobase DNA fragment
containing an optimized signal peptide, a double mutant EPSPS gene
(Ile.sub.102+Ser.sub.106") and a nopaline synthase polyadenylation
site ("NOS") is obtained from pRPA-RD-125 by digestion with NcoI
and NotI, followed by a treatment with DNA polymerase from E. coli,
according to the manufacturer's instructions in order to create a
blunt-ended DNA fragment. This blunt-ended fragment is then ligated
into pCG-1 prepared above.
[0111] A chimeric gene is thus obtained having the structure:
[0112] "H4A74B promoter-intron No. 1-maize EPSPS gene-NOS"
[0113] 13). pRPA-RD-198
[0114] In this plasmid, the ".beta.-glucoronidase gene from E.
coli" portion of pCG-13 is replaced by a chimeric gene of 2
kilobases containing an optimized signal peptide, a double mutant
EPSPS gene (Ile.sub.102+Ser.sub.106) and a nopaline synthase
polyadenylation site ("NOS") isolated from pRPA-RD-125. To obtain
pRPA-RD-198, the digestion of pCG-13 is performed with EcoRI,
followed by treatment with a Klenow fragment of DNA polymerase from
E. coli, according to the manufacturer's instructions in order to
create a blunt-ended DNA fragment, then cut with SmaI. The
2-kilobase DNA fragment containing an optimized signal peptide, a
double mutant EPSPS gene (Ile.sub.102+Ser.sub.106) and a nopaline
synthase polyadenylation site ("NOS") is obtained from pRPA-RD-123
by digestion with NcoI and NotI, followed by a treatment with DNA
polymerase from E. coli, according to the manufacturer's
instructions in order to create a blunt-ended DNA fragment. This
blunt-ended fragment is then ligated into pCG-13 prepared
above.
[0115] A chimeric gene is thus obtained having the structure:
[0116] H4A74B promoter-intron No. 2-OSP-maize EPSPS gene-"NOS"
EXAMPLE 3
Expression of the activity of a reporter gene
[0117] 1) Transformation and regeneration
[0118] The vector is introduced into the nononcogenic strain of
Agrobacterium tumefaciens LBA 4404 available from a catalogue
(Clontech #6027-1) by triparental crossing using the "helper"
plasmid pRK 2013 in Escherichia coil HB101 according to the
procedure described by Bevan M. (1984) Nucl. Acids Res., 12,
8711-8721.
[0119] The transformation technique using root explants of
Arabidopsis thaliana L.-ecotype C24 was carried out according to
the procedure described by Valvekens D. et al. (1988) Proc. Natl.
Acad. Sci USA, 85, 5536-5540. Briefly, 3 steps are necessary:
induction of the formation of calli on Gamborg B5 medium
supplemented with 2,4-D and kinetin; formation of buds on Gamborg
B5 medium supplemented with 2iP and IAA; rooting and formation of
seeds on hormone-free M5.
[0120] 2) Measurement of the GUS activity in plants
[0121] a--histochemical observations
[0122] Visualization of the GUS activity by histochemical spots
(Jefferson R. A. et al. (1987) EMBO J. 6, 3901-3907) on 10-day
transgenic plants shows an increase in the intensity of the
histochemical pattern which is tissue-specific for the plasmids
containing the intron sequences (pCG-1 and pCG-13) compared with
those without these introns (pRA-1). In particular, the pattern of
spots for pCG-1 and pCG-13 is identical, showing an increase in
intensity of the spots for the vascular and meristematic tissues,
leaves and roots compared with that of the construct pRA-1. The
constructs containing only the sequences of intron No. 1 (pCG-15
and pCG-18) show an extremely clear histochemical spot only in the
apical meristem region.
[0123] b--fluoromeatric measurements
[0124] The GUS activity measured by fluorometry on extracts of
floral and leaf buds of the rosette (Jefferson R. A. et al. (1987)
EMBO J., 6, 3901-3907) from 12 plants, shows that the activity of
the H4A74B promoter is increased under the influence of intron Nos.
1 and 2.Compared with the construct pRA-1, the GUS activity of
pCG-1 and pCG-13 are at least six times greater in the floral buds,
twenty times greater in the leaves of the rosette and twenty-six
times greater in the roots.
[0125] These measurements clearly show that introns Nos. 1 and 2 of
Arabidopsis histone genes of the "H3.3-like" type used as a
regulatory element induces an increase in the activity of
expression of the chimeric gene.
EXAMPLE 4
Tolerance of transgenic plants to a herbicide
[0126] 1) Transformation and regeneration
[0127] The vector is introduced into the nononcogenic strain of
Agrobacterium tumefaciens LBA 4404 available from a catalogue
(Clontech #6027-1) by triparental crossing using the "helper"
plasmid pRK 2013 in Escherichia coli HB101 according to the
procedure described by Bevan M. (1984) Nucl. Acids Res., 12,
8711-8721.
[0128] The transformation technique using foliar explants of
tobacco is based on the procedure described by Horsh R. et al.
(1985) Science, 227, 1229-1231. The regeneration of the PBD6
tobacco (origin SEITA-France) from foliar explants is carried out
on a Murashige and Skoog (MS) basal medium comprising 30 g/l of
sucrose as well as 200 .mu.g/ml of kanamycin in three successive
steps: the first comprises the induction of shoots on an MS medium
supplemented with 30 g of sucrose containing 0.05 mg of
naphthylacetic acid (NAA) and 2 mg/l of benzylaminopurine (BAP) for
15 days. The shoots formed during this step are then developed by
culturing on an MS medium supplemented with 30 g/l of sucrose but
not containing any hormone, for 10 days. The developed shoots are
then removed and they are cultured on an MS rooting medium diluted
one half, with half the content of salts, vitamins and sugars and
not containing any hormone. After about 15 days, the rooted shoots
are planted in the soil.
[0129] 2) Measurement of the tolerance to glyphosate:
[0130] Twenty transformed plants were regenerated and transferred
to a greenhouse for each of the constructs pRPA-RD-196, pRPA-RD-197
and pRPA-RD-198. These plants were treated in a greenhouse at the
5-leaf stage with an aqueous suspension of herbicide, sold under
the trademark RoundUp, corresponding to 0.8 kg of active substance
glyphosate per hectare.
[0131] The results correspond to the observation of phytotoxicity
values noted 3 weeks after treatment. Under these conditions, it is
observed that the plants transformed with the constructs have on
average an acceptable tolerance (pRPA-RD-196) or even a good
tolerance (pRPA-RD-197 and pRPA-RD-196) whereas the untransformed
control plants are completely destroyed.
[0132] These results show clearly the improvement offered by the
use of a chimeric gene according to the invention for the same gene
encoding tolerance to glyphlosate.
[0133] The transformed plants according to the invention may be
used as parents for producing lines and hybrids having the
phenotypic character corresponding to the expression of the
chimeric gene introduced.
Sequence CWU 1
1
22 1 1713 DNA Zea mays 1 aatcaatttc acacaggaaa cagctatgac
catgattacg aattcgggcc cgggcgcgtg 60 atccggcggc ggcagcggcg
gcggcggtgc aggcgggtgc cgaggagatc gtgctgcagc 120 ccatcaagga
gatctggggc agcgtcaagc tgccggggtc caagtcgctt tccaaccgga 180
tcctcctact cgccgccctg tccgagggga caacagtggt tgataacctg ctgaacagtg
240 aggatgtcca ctacatgctc ggggccttga ggactcttgg tctctctgtc
gaagcggaca 300 aaggtcccaa aagagctgta cttgttggct ctggtggaaa
gttcccagtt gaggatgcta 360 aagaggaagt gcagctcttc ttggggaatg
ctggaactgc aatgcggcca ttgacagcag 420 ctgttactgc tgctggtgga
aatgcaactt acgtgcttga tggagtacca agaatgaggg 480 agagacccat
tggcgacttg gttgtcggat tgaagcagct tggtgcagat gttgattgtt 540
tccttggcac tgactgccca cgtgttcgtg tcaatggaat cggagggcta cctggtggca
600 aggtcaagct gtctggctcc atcagcagtc agtacttgag tgccttgctg
atggctgctc 660 ctttggctct tggggatgtg gagattgaaa tcattgataa
attaatctcc attccgtacg 720 tcgaaatgac attgagattg atggaccgtt
ttggtgtgaa agcagagcat tctgatagct 780 gggacagatt ctacattaag
ggaggtcaaa aatacaagtc ccctaaaaat gcctatgttg 840 aaggtgatgc
ctcaagcgca agctatttct tggctggtgc tgcaattact ggagggactg 900
tgactgtgga aggttgtggc accaccagtt tgcagggtga tgtgaagttt gctgaggtac
960 tggagatgat gggagcgaag gttacatgga ccgagactag cgtaactgtt
actcccccac 1020 cgcgggagcc atttgggagg aaacacctca aggcgattga
tgtcaacatc aacaagatgc 1080 ctgatgtcgc catgactctt gctgtggttg
ccctctttgc cgatggcccg acagccatca 1140 gagacgtggc ttcctggaga
gtaaaggaga ccgagaggat ggttgcgatc cggacggagc 1200 taaccaagct
gggagcatct gttgaggaag ggccggacta ctgcatcatc acgccgccgg 1260
agaagctgaa cgtgacggcg atcgacacgt acgacgacca caggatggcc atggccttct
1320 cccttgccgc ctgtgccgag gtccccgtca ccatccggga ccctgggtgc
acccggaaga 1380 ccttccccga ctacttcgat gtgctgagca ctttcgtcaa
gaattaataa agcgtgcgat 1440 actaccacgc agcttgattg aagtgatagg
cttgtgctga ggaaatacat ttcttttgtt 1500 ctgtttttct ctttcacggg
attaagtttt gagtctgtaa cgttagttgt ttgtagcaag 1560 tttctatttc
ggatcttaag tttgtgcact gtaagccaaa tttcatttca agagtggttc 1620
gttggaataa taagaataat aaattacgtt tcagtgaaaa aaaaaaaaaa aaaaaaaaaa
1680 aaaaaaaaaa aaaaaaaaaa aacccgggaa ttc 1713 2 1340 DNA Zea mays
CDS (6)..(1337) 2 ccatg gcc ggc gcc gag gag atc gtg ctg cag ccc atc
aag gag atc tcc 50 Ala Gly Ala Glu Glu Ile Val Leu Gln Pro Ile Lys
Glu Ile Ser 1 5 10 15 ggc acc gtc aag ctg ccg ggg tcc aag tcg ctt
tcc aac cgg atc ctc 98 Gly Thr Val Lys Leu Pro Gly Ser Lys Ser Leu
Ser Asn Arg Ile Leu 20 25 30 cta ctc gcc gcc ctg tcc gag ggg aca
aca gtg gtt gat aac ctg ctg 146 Leu Leu Ala Ala Leu Ser Glu Gly Thr
Thr Val Val Asp Asn Leu Leu 35 40 45 aac agt gag gat gtc cac tac
atg ctc ggg gcc ttg agg act ctt ggt 194 Asn Ser Glu Asp Val His Tyr
Met Leu Gly Ala Leu Arg Thr Leu Gly 50 55 60 ctc tct gtc gaa gcg
gac aaa gct gcc aaa aga gct gta gtt gtt ggc 242 Leu Ser Val Glu Ala
Asp Lys Ala Ala Lys Arg Ala Val Val Val Gly 65 70 75 tgt ggt gga
aag ttc cca gtt gag gat gct aaa gag gaa gtg cag ctc 290 Cys Gly Gly
Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gln Leu 80 85 90 95 ttc
ttg ggg aat gct gga act gca atg cgg cca ttg aca gca gct gtt 338 Phe
Leu Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala Val 100 105
110 act gct gct ggt gga aat gca act tac gtg ctt gat gga gta cca aga
386 Thr Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg
115 120 125 atg agg gag aga ccc att ggc gac ttg gtt gtc gga ttg aag
cag ctt 434 Met Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys
Gln Leu 130 135 140 ggt gca gat gtt gat tgt ttc ctt ggc act gac tgc
cca cct gtt cgt 482 Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys
Pro Pro Val Arg 145 150 155 gtc aat gga atc gga ggg cta cct ggt ggc
aag gtc aag ctg tct ggc 530 Val Asn Gly Ile Gly Gly Leu Pro Gly Gly
Lys Val Lys Leu Ser Gly 160 165 170 175 tcc atc agc agt cag tac ttg
agt gcc ttg ctg atg gct gct cct ttg 578 Ser Ile Ser Ser Gln Tyr Leu
Ser Ala Leu Leu Met Ala Ala Pro Leu 180 185 190 gct ctt ggg gat gtg
gag att gaa atc att gat aaa tta atc tcc att 626 Ala Leu Gly Asp Val
Glu Ile Glu Ile Ile Asp Lys Leu Ile Ser Ile 195 200 205 ccg tac gtc
gaa atg aca ttg aga ttg atg gag cgt ttt ggt gtg aaa 674 Pro Tyr Val
Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys 210 215 220 gca
gag cat tct gat agc tgg gac aga ttc tac att aag gga ggt caa 722 Ala
Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gln 225 230
235 aaa tac aag tcc cct aaa aat gcc tat gtt gaa ggt gat gcc tca agc
770 Lys Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser
240 245 250 255 gca agc tat ttc ttg gct ggt gct gca att act gga ggg
act gtg act 818 Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly
Thr Val Thr 260 265 270 gtg gaa ggt tgt ggc acc acc agt ttg cag ggt
gat gtg aag ttt gct 866 Val Glu Gly Cys Gly Thr Thr Ser Leu Gln Gly
Asp Val Lys Phe Ala 275 280 285 gag gta ctg gag atg atg gga gcg aag
gtt aca tgg acc gag act agc 914 Glu Val Leu Glu Met Met Gly Ala Lys
Val Thr Trp Thr Glu Thr Ser 290 295 300 gta act gtt act ggc cca ccg
cgg gag cca ttt ggg agg aaa cac ctc 962 Val Thr Val Thr Gly Pro Pro
Arg Glu Pro Phe Gly Arg Lys His Leu 305 310 315 aag gcg att gat gtc
aac atg aac aag atg cct gat gtc gcc atg act 1010 Lys Ala Ile Asp
Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr 320 325 330 335 ctt
gct gtg gtt gcc ctc ttt gcc gat ggc ccg aca gcc atc aga gac 1058
Leu Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp 340
345 350 gtg gct tcc tgg aga gta aag gag acc gag agg atg gtt gcg atc
cgg 1106 Val Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala
Ile Arg 355 360 365 acg gag cta acc aag ctg gga gca tct gtt gag gaa
ggg ccg gac tac 1154 Thr Glu Leu Thr Lys Leu Gly Ala Ser Val Glu
Glu Gly Pro Asp Tyr 370 375 380 tgc atc atc acg ccg ccg gag aag ctg
aac gtg acg gcg atc gac acg 1202 Cys Ile Ile Thr Pro Pro Glu Lys
Leu Asn Val Thr Ala Ile Asp Thr 385 390 395 tac gac gac cac agg atg
gcc atg gcc ttc tcc ctt gcc gcc tgt gcc 1250 Tyr Asp Asp His Arg
Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala 400 405 410 415 gag gtc
ccc gtc acc atc cgg gac cct ggg tgc acc cgg aag acc ttc 1298 Glu
Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe 420 425
430 ccc gac tac ttc gat gtg ctg agc act ttc gtc aag aat taa 1340
Pro Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440 3 444
PRT Zea mays 3 Ala Gly Ala Glu Glu Ile Val Leu Gln Pro Ile Lys Glu
Ile Ser Gly 1 5 10 15 Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser
Asn Arg Ile Leu Leu 20 25 30 Leu Ala Ala Leu Ser Glu Gly Thr Thr
Val Val Asp Asn Leu Leu Asn 35 40 45 Ser Glu Asp Val His Tyr Met
Leu Gly Ala Leu Arg Thr Leu Gly Leu 50 55 60 Ser Val Glu Ala Asp
Lys Ala Ala Lys Arg Ala Val Val Val Gly Cys 65 70 75 80 Gly Gly Lys
Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gln Leu Phe 85 90 95 Leu
Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala Val Thr 100 105
110 Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met
115 120 125 Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gln
Leu Gly 130 135 140 Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro
Pro Val Arg Val 145 150 155 160 Asn Gly Ile Gly Gly Leu Pro Gly Gly
Lys Val Lys Leu Ser Gly Ser 165 170 175 Ile Ser Ser Gln Tyr Leu Ser
Ala Leu Leu Met Ala Ala Pro Leu Ala 180 185 190 Leu Gly Asp Val Glu
Ile Glu Ile Ile Asp Lys Leu Ile Ser Ile Pro 195 200 205 Tyr Val Glu
Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys Ala 210 215 220 Glu
His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gln Lys 225 230
235 240 Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser
Ala 245 250 255 Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr
Val Thr Val 260 265 270 Glu Gly Cys Gly Thr Thr Ser Leu Gln Gly Asp
Val Lys Phe Ala Glu 275 280 285 Val Leu Glu Met Met Gly Ala Lys Val
Thr Trp Thr Glu Thr Ser Val 290 295 300 Thr Val Thr Gly Pro Pro Arg
Glu Pro Phe Gly Arg Lys His Leu Lys 305 310 315 320 Ala Ile Asp Val
Asn Met Asn Lys Met Pro Asp Val Ala Met Thr Leu 325 330 335 Ala Val
Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val 340 345 350
Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg Thr 355
360 365 Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tyr
Cys 370 375 380 Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile
Asp Thr Tyr 385 390 395 400 Asp Asp His Arg Met Ala Met Ala Phe Ser
Leu Ala Ala Cys Ala Glu 405 410 415 Val Pro Val Thr Ile Arg Asp Pro
Gly Cys Thr Arg Lys Thr Phe Pro 420 425 430 Asp Tyr Phe Asp Val Leu
Ser Thr Phe Val Lys Asn 435 440 4 1340 DNA Zea mays CDS (6)..(1337)
4 ccatg gcc ggc gcc gag gag atc gtg ctg cag ccc atc aag gag atc tcc
50 Ala Gly Ala Glu Glu Ile Val Leu Gln Pro Ile Lys Glu Ile Ser 1 5
10 15 ggc acc gtc aag ctg ccg ggg tcc aag tcg ctt tcc aac cgg atc
ctc 98 Gly Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile
Leu 20 25 30 cta ctc gcc gcc ctg tcc gag ggg aca aca gtg gtt gat
aac ctg ctg 146 Leu Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp
Asn Leu Leu 35 40 45 aac agt gag gat gtc cac tac atg ctc ggg gcc
ttg agg act ctt ggt 194 Asn Ser Glu Asp Val His Tyr Met Leu Gly Ala
Leu Arg Thr Leu Gly 50 55 60 ctc tct gtc gaa gcg gac aaa gct gcc
aaa aga gct gta gtt gtt ggc 242 Leu Ser Val Glu Ala Asp Lys Ala Ala
Lys Arg Ala Val Val Val Gly 65 70 75 tgt ggt gga aag ttc cca gtt
gag gat gct aaa gag gaa gtg cag ctc 290 Cys Gly Gly Lys Phe Pro Val
Glu Asp Ala Lys Glu Glu Val Gln Leu 80 85 90 95 ttc ttg ggg aat gct
gga atc gca atg cgg tcc ttg aca gca gct gtt 338 Phe Leu Gly Asn Ala
Gly Ile Ala Met Arg Ser Leu Thr Ala Ala Val 100 105 110 act gct gct
ggt gga aat gca act tac gtg ctt gat gga gta cca aga 386 Thr Ala Ala
Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg 115 120 125 atg
agg gag aga ccc att ggc gac ttg gtt gtc gga ttg aag cag ctt 434 Met
Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gln Leu 130 135
140 ggt gca gat gtt gat tgt ttc ctt ggc act gac tgc cca cct gtt cgt
482 Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg
145 150 155 gtc aat gga atc gga ggg cta cct ggt ggc aag gtc aag ctg
tct ggc 530 Val Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu
Ser Gly 160 165 170 175 tcc atc agc agt cag tac ttg agt gcc ttg ctg
atg gct gct cct ttg 578 Ser Ile Ser Ser Gln Tyr Leu Ser Ala Leu Leu
Met Ala Ala Pro Leu 180 185 190 gct ctt ggg gat gtg gag att gaa atc
att gat aaa tta atc tcc att 626 Ala Leu Gly Asp Val Glu Ile Glu Ile
Ile Asp Lys Leu Ile Ser Ile 195 200 205 ccg tac gtc gaa atg aca ttg
aga ttg atg gag cgt ttt ggt gtg aaa 674 Pro Tyr Val Glu Met Thr Leu
Arg Leu Met Glu Arg Phe Gly Val Lys 210 215 220 gca gag cat tct gat
agc tgg gac aga ttc tac att aag gga ggt caa 722 Ala Glu His Ser Asp
Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gln 225 230 235 aaa tac aag
tcc cct aaa aat gcc tat gtt gaa ggt gat gcc tca agc 770 Lys Tyr Lys
Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser 240 245 250 255
gca agc tat ttc ttg gct ggt gct gca att act gga ggg act gtg act 818
Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr 260
265 270 gtg gaa ggt tgt ggc acc acc agt ttg cag ggt gat gtg aag ttt
gct 866 Val Glu Gly Cys Gly Thr Thr Ser Leu Gln Gly Asp Val Lys Phe
Ala 275 280 285 gag gta ctg gag atg atg gga gcg aag gtt aca tgg acc
gag act agc 914 Glu Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr
Glu Thr Ser 290 295 300 gta act gtt act ggc cca ccg cgg gag cca ttt
ggg agg aaa cac ctc 962 Val Thr Val Thr Gly Pro Pro Arg Glu Pro Phe
Gly Arg Lys His Leu 305 310 315 aag gcg att gat gtc aac atg aac aag
atg cct gat gtc gcc atg act 1010 Lys Ala Ile Asp Val Asn Met Asn
Lys Met Pro Asp Val Ala Met Thr 320 325 330 335 ctt gct gtg gtt gcc
ctc ttt gcc gat ggc ccg aca gcc atc aga gac 1058 Leu Ala Val Val
Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp 340 345 350 gtg gct
tcc tgg aga gta aag gag acc gag agg atg gtt gcg atc cgg 1106 Val
Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg 355 360
365 acg gag cta acc aag ctg gga gca tct gtt gag gaa ggg ccg gac tac
1154 Thr Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp
Tyr 370 375 380 tgc atc atc acg ccg ccg gag aag ctg aac gtg acg gcg
atc gac acg 1202 Cys Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr
Ala Ile Asp Thr 385 390 395 tac gac gac cac agg atg gcg atg gcc ttc
tcc ctt gcc gcc tgt gcc 1250 Tyr Asp Asp His Arg Met Ala Met Ala
Phe Ser Leu Ala Ala Cys Ala 400 405 410 415 gag gtc ccc gtc acc atc
cgg gac cct ggg tgc acc cgg aag acc ttc 1298 Glu Val Pro Val Thr
Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe 420 425 430 ccc gac tac
ttc gat gtg ctg agc act ttc gtc aag aat taa 1340 Pro Asp Tyr Phe
Asp Val Leu Ser Thr Phe Val Lys Asn 435 440 5 444 PRT Zea mays 5
Ala Gly Ala Glu Glu Ile Val Leu Gln Pro Ile Lys Glu Ile Ser Gly 1 5
10 15 Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu
Leu 20 25 30 Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn
Leu Leu Asn 35 40 45 Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu
Arg Thr Leu Gly Leu 50 55 60 Ser Val Glu Ala Asp Lys Ala Ala Lys
Arg Ala Val Val Val Gly Cys 65 70 75 80 Gly Gly Lys Phe Pro Val Glu
Asp Ala Lys Glu Glu Val Gln Leu Phe 85 90 95 Leu Gly Asn Ala Gly
Ile Ala Met Arg Ser Leu Thr Ala Ala Val Thr 100 105 110 Ala Ala Gly
Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met 115 120 125 Arg
Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gln Leu Gly 130 135
140 Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Val
145 150 155 160 Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu
Ser Gly Ser 165 170 175 Ile Ser Ser Gln Tyr Leu Ser Ala Leu Leu Met
Ala Ala Pro Leu Ala 180 185 190 Leu Gly Asp Val Glu Ile Glu Ile Ile
Asp Lys Leu Ile Ser Ile Pro 195 200 205 Tyr Val Glu Met Thr Leu Arg
Leu Met Glu Arg Phe Gly Val Lys Ala 210 215 220 Glu His Ser Asp Ser
Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gln Lys 225 230 235 240 Tyr Lys
Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala 245 250 255
Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val
260 265 270 Glu Gly Cys Gly Thr Thr Ser Leu Gln Gly Asp Val Lys Phe
Ala Glu 275 280 285 Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr
Glu Thr Ser Val 290 295 300 Thr Val Thr Gly Pro Pro Arg Glu Pro Phe
Gly Arg Lys His Leu Lys 305 310 315 320 Ala Ile Asp Val Asn Met Asn
Lys Met Pro Asp Val Ala Met Thr Leu 325 330 335 Ala Val Val Ala Leu
Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val 340 345 350 Ala Ser Trp
Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg Thr 355 360 365 Glu
Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tyr Cys 370 375
380 Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr Tyr
385 390 395 400 Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala
Cys Ala Glu 405 410 415 Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr
Arg Lys Thr Phe Pro 420 425 430 Asp Tyr Phe Asp Val Leu Ser Thr Phe
Val Lys Asn 435 440 6 418 DNA Zea mays 6 tgaggtacga ttcttcgatc
ctctttgatt ttcctggaaa tattttttcg gtgatcgtga 60 aactactgga
atcgctcgat aggtggtacg aaattaggcg agattagttt ctattcttgg 120
ccattatctt gtttcttcgc cgaatgatct tccgtataaa gattttaggt tagagatgaa
180 tcgtatagct agatttcatc accagatagt ttctttgtct agaatctctg
aaattctcga 240 tagttttcac atgtgtaaat agattgttct tattcggcga
ttgttgatta gggttttgat 300 tttcttgatt atgcgattgc aattagggat
tttctttggt tttgtgttga tcttacgata 360 cattcctgca attgaatacg
tatggatcta aatcttgtta atttgttgaa cagatccc 418 7 494 DNA Zea mays 7
ctcaggcgaa gaacaggtat gatttgtttg taattagatc aggggtttag gtctttccat
60 tactttttaa tgttttttct gttactgtct ccgcgatctg attttacgac
aatagagttt 120 cgggttttgt cccattccag tttgaaaata aacgtccgtc
ttttaagttt gctggatcga 180 taaacctgtg aagattgagt ctagtcgatt
tattggatga tccattcttc atcgtttttt 240 tcttgcttcg aagttctgta
taaccagatt tgtctgtgtg cgattgtcat tacctagccg 300 tgtatcgaga
actagggttt tcgagtcaat tttgcccctt ttggttatat ctggttcgat 360
aacgattcat ctggattagg gttttaagtg gtgacgttta gtattccaat ttcttcaaaa
420 tttagttatg gataatgaaa atcccgaatt gactgttcaa tttcttgtta
aatgcgcaga 480 tcccgggatc tgcg 494 8 20 DNA Zea mays 8 gctctgctca
tgtctgctcc 20 9 20 DNA Zea mays 9 gcccgccctt gacaaagaaa 20 10 10
DNA Zea mays 10 aattcccggg 10 11 38 DNA Zea mays 11 aattaagctc
tagagtcgac ctgcaggcat gcaagctt 38 12 41 DNA Zea mays 12 gagccgagct
ccatggccgg cgccgaggag atcgtgctgc a 41 13 37 DNA Zea mays 13
gcacgatctc ctcggcgccg gccatggagc tcggctc 37 14 25 DNA Zea mays 14
ccacaggatg gcgatggcct tctcc 25 15 33 DNA Zea mays 15 gaatgctgga
atcgcaatgc ggccattgac agc 33 16 33 DNA Zea mays 16 gaatgctgga
actgcaatgc ggtccttgac agc 33 17 34 DNA Zea mays 17 cttggggaat
gctgccatcg caatgcggcc attg 34 18 36 DNA Zea mays 18 ggggaatgct
ggaatcgcaa tgcggtcctt gacagc 36 19 20 DNA Zea mays 19 taatttgttg
aacagatccc 20 20 18 DNA Zea mays 20 taaacaactt gtctaggg 18 21 18
DNA Zea mays 21 cagatcccgg gatctgcg 18 22 20 DNA Zea mays 22
gcgtctaggg ccctagacgc 20
* * * * *