U.S. patent application number 09/967719 was filed with the patent office on 2003-02-06 for monoclonal antibodies, antigens and diagnosis and therapy of malignant diseases.
Invention is credited to Hardy, Britta, Novogrodsky, Abraham.
Application Number | 20030026800 09/967719 |
Document ID | / |
Family ID | 11072675 |
Filed Date | 2003-02-06 |
United States Patent
Application |
20030026800 |
Kind Code |
A1 |
Hardy, Britta ; et
al. |
February 6, 2003 |
Monoclonal antibodies, antigens and diagnosis and therapy of
malignant diseases
Abstract
The invention concerns novel DNA and amino acid sequences of
monoclonal antibodies (mAbs) raised against lymphoblastoid cells
and peptides to which the mAbs bind to. The invention also concerns
diagnostic assays using said antibodies or peptides for detecting
individuals with a high probability of having a malignant disease
and, at times, for detecting an individual having a specific
malignant disease. The invention further concerns pharmaceutical
compositions comprising the mAbs or peptides of the invention for
use in the treatment of various malignant diseases as well as
methods for the treatment of malignant diseases using the mAbs or
peptides of the invention.
Inventors: |
Hardy, Britta; (Tel Aviv,
IL) ; Novogrodsky, Abraham; (Rehovot, IL) |
Correspondence
Address: |
WINSTON & STRAWN
PATENT DEPARTMENT
1400 L STREET, N.W.
WASHINGTON
DC
20005-3502
US
|
Family ID: |
11072675 |
Appl. No.: |
09/967719 |
Filed: |
September 28, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09967719 |
Sep 28, 2001 |
|
|
|
PCT/IL99/00518 |
Sep 30, 1999 |
|
|
|
Current U.S.
Class: |
424/132.1 ;
435/320.1; 435/326; 530/387.3; 536/23.53 |
Current CPC
Class: |
A61K 2039/505 20130101;
G01N 33/56972 20130101; G01N 33/57419 20130101; C07K 7/08 20130101;
C07K 16/28 20130101; G01N 33/57415 20130101; C07K 2319/00 20130101;
C07K 2317/24 20130101; A61P 35/00 20180101; A61K 38/00 20130101;
C07K 2317/34 20130101; C07K 7/06 20130101; G01N 33/57434
20130101 |
Class at
Publication: |
424/132.1 ;
530/387.3; 435/326; 536/23.53; 435/320.1 |
International
Class: |
A61K 039/395; C07H
021/04; C12N 005/06; C07K 016/44 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 31, 1999 |
IL |
129299 |
Claims
1. A monoclonal antibody comprising a heavy chain variable region
having at least 70% identity to the amino acid sequence of FIG. 1;
a light chain variable region having at least 70% identity to the
amino acid sequence of FIG. 2; or both said heavy chain variable
region and said light chain variable region.
2. The monoclonal antibody according to claim 1, wherein said heavy
chain variable region comprises of the amino acid sequence of FIG.
1; said light chain variable region comprises of the amino acid
sequence of FIG. 2; or both said heavy chain variable region and
said light chain variable region comprising FIG. 1 and FIG. 2
correspondingly.
3. A monoclonal antibody, wherein said antibody binds to an antigen
to which any one of the monoclonal antibodies of claim 1
specifically bind.
4. The antibody according to claim 1, wherein the antibody is a
chimeric human-mouse antibody.
5. A nucleic acid molecule encoding the amino acid sequence of the
monoclonal antibody of claim 1.
6. An expression vector having the nucleic acid sequence of claim
5.
7. An expression vector according to claim 6, comprising of plasmid
pKN110 or plasmid pG1D110.
8. A cell transfected with the expression vector of claim 6.
9. A hybridoma cell line producing at least one of the monoclonal
antibodies of claim 1.
10. A peptide having an amino acid sequence at least 85% identical
to the amino acid sequence of the peptides in FIG. 10, FIG. 11, or
FIG. 12.
11. The peptide of claim 10, wherein the peptide comprises of the
amino acid sequence of the peptide in FIG. 10, FIG. 11, or FIG.
12.
12. A protein or peptide comprising one or more of the peptides of
claim 10.
13. A peptide analog of any of the peptides of claim 10, wherein
said peptide analog has substantially the same level of binding to
a monoclonal antibody comprising a heavy chain variable region
having at least 70% identity to the amino acid sequence of FIG. 1,
a light chain variable region having at least 70% identity to the
amino acid sequence of FIG. 2, or both said heavy chain variable
region and said light chain variable region.
14. A method for identifying a tested individual with a high
probability of having a malignant disease comprising: (a) obtaining
a body fluid sample from said individual; (b) contacting said
sample with at least one of the monoclonal antibodies of claim 1,
or a monoclonal antibody, wherein said antibody binds to an antigen
to which any one of the monoclonal antibodies of claim 1
specifically bind; (c) determining the extent of binding of said
monoclonal antibody to T-cells within said sample; and (d)
comparing the extent of (c) to the extent of binding of the
monoclonal to T-cells in a sample obtained from a healthy
individual, wherein a significant difference between said extents
of binding indicate that said tested individual has a high
probability of having a malignant disease.
15. The method according to claim 14, wherein before step (b) the
peripheral blood mononuclear cells are separated, said separated
the peripheral blood mononuclear cells are then contacted in step
(c) with said monoclonal antibody.
16. The method according to claim 14, wherein said body fluid is
blood.
17. The method according to claim 14, wherein the extent of binding
of the monoclonal antibodies obtained from said tested individual
is higher than the extent of binding of the same monoclonal
antibody to T-cells of healthy individuals.
18. The method according to claim 17, wherein said specific
malignant disease is prostate carcinoma.
19. The method according to claim 14, wherein the extent of binding
of the monoclonal antibody to T-cells obtained from said tested
individual is lower than the extent of binding of the same
monoclonal antibody to T-cells of healthy individuals.
20. The method according to claim 19, wherein said specific
malignant disease is breast carcinoma or colon carcinoma.
21. A composition comprising at least one monoclonal antibody of
claim 1 together with a carrier.
22. A kit comprising at least one monoclonal antibody of claim 1
together with a conjugate of a specific binding partner for said
monoclonal antibody, and a label capable of producing a detectable
signal.
23. A method for the treatment of a malignant disease comprising
administering to an individual in need a therapeutically effect
amount of the composition of claim 21.
24. The method according to claim 23, wherein said malignant
disease is a solid tumor, prostate carcinoma, breast carcinoma, or
colon carcinoma.
25. A composition comprising of a therapeutically effective amount
of one or more of the peptides of claim 10, together with a
carrier.
26. A method for the treatment of a malignant disease comprising
administering to an individual in need a therapeutically effect
amount of the composition of claim 25.
27. The method according to claim 26, wherein said malignant
disease is a solid tumor, prostate carcinoma, breast carcinoma, or
colon carcinoma.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of the U.S. National
Stage designation of International Application PCT/IL99/00518 filed
Sep. 30, 1999, the content of which is expressly incorporated
herein by reference thereto.
FIELD OF THE INVENTION
[0002] The present invention concerns novel sequences of monoclonal
antibodies, peptidic sequences of antigens to which the monoclonal
antibodies bind, as well as diagnostic and therapeutic assays using
the monoclonal antibody and peptides.
BACKGROUND OF THE INVENTION
[0003] Co-owned PCT Application, Publication No. WO 95/20605,
discloses immuno-stimulatory monoclonal antibodies. The antibodies
subject of this PCT application were raised against B
lymphoblastoid cells and were shown to have an immuno-stimulatory
effect. When injected into tumor-bearing animals, these antibodies
were also found to elicit an anti-tumor effect.
[0004] Cancer diagnosis, under current medical procedures, is
typically a multi-step process involving physical examination, use
of a variety of imaging techniques, employment of a variety of
cancer markers, etc. There is a longfelt need in the art for cancer
diagnostic techniques which allow detection of cancer and also
determination of the type of cancer which the tested individual is
suffering from.
GENERAL DESCRIPTION OF THE INVENTION
[0005] The present invention is based on the finding of sequences
of monoclonal antibodies against lymphoblastoid cells. The present
invention is further based on the finding that the level of binding
of these antibodies to T-cells of patients having cancer is
different (higher or lower) than the level of binding of these
antibodies to T-cells of healthy individuals.
[0006] In accordance with one aspect of the invention there is
provided a monoclonal antibody having a variable region selected
from the group consisting of:
[0007] (a) a monoclonal antibody having a heavy chain variable
region comprising the amino acid sequence of FIG. 1;
[0008] (b) a monoclonal antibody having a Kappa light chain
variable region comprising the amino acid sequence of FIG. 2;
[0009] (c) a monoclonal antibody having a heavy chain variable
region comprising the amino acid sequence of FIG. 1 and the Kappa
light chain variable region comprising the amino acid sequence of
FIG. 2;
[0010] (d) a monoclonal antibody having a heavy chain variable
region having at least 70% identity to the amino acid sequence of
FIG. 1;
[0011] (e) a monoclonal antibody having a light chain variable
region having at least 70% identity to the sequence of FIG. 2.
[0012] In accordance with the invention, the term "antibody" refers
to monoclonal antibodies of any of the classes IgG, IgM, IgD, IgA
and IgE. The term refers to whole antibodies or fragments of the
antibodies comprising the antigen-binding domain of the antibodies,
e.g. antibodies lacking the Fc portion, single chain antibodies,
fragments of articles consisting essentially of only the variable
antigen-binding domain of the antibody, etc.
[0013] In addition the invention also concerns antibodies which
bind to an antigen to which any one of the above mAbs specifically
binds to i.e. antibodies which have cross reactivity with the above
antibodies.
[0014] In accordance with one embodiment of the invention, the
monoclonal antibody is a chimeric human-mouse antibody, namely a
mAb with a constant region derived from a human origin and a
variable region derived from mouse. For this purpose, the Kappa
light and heavy chain variable regions of the mAb of the invention
were PCR cloned and their DNA sequenced. In accordance with yet
another embodiment of the invention the antibody is a fully
humanized antibody, i.e. both its variable and constant region are
derived from a human source.
[0015] The term "having at least X percent identity" refers to the
percent of amino acid residues that are identical in the two
compared sequences when the sequences are optimally aligned. Thus,
70% amino acid sequence identity means that 70% of the amino acids
in two or more optimally aligned polypeptide sequences are
identical. Preferably, the identity is at least 80%, most
preferably at least 90%.
[0016] In accordance with an additional aspect of the invention,
there are provided mouse hybridoma cell lines which produce any of
the mAbs of the invention. The hybridomas may be prepared by any of
the methods known in the art (for example, Kohler, G. and Milstein,
C., Nature, 256:495-497, (1975)). The supernatant of the hybridoma
cell lines are typically screened for antibody binding activity by
any one of the methods known in the art such as by enzyme linked
immuno sorbent assay (ELISA) or radio immuno assay (RIA). The
supernatants are screened for production of mAbs which bind to any
of the peptides of the invention (as explained below) or which bind
to cells to which they bind, e.g. Daudi cells or T lymphocytes.
[0017] DNA sequences which encode any of the amino acid sequences
of the heavy chain or light chain of the above mAbs are also
encompassed within the scope of the invention. As will no doubt be
clear to any man versed in the art, due to the degenerative nature
of the genetic code a plurality of nucleic acid sequences may code
for the mAb of the invention beyond those shown in FIGS. 1 or
2.
[0018] The invention also provides expression vectors such as
plasmids having said DNA sequences as well as host cells containing
one or more of these expression vectors.
[0019] In accordance with another aspect of the invention, there
are provided peptidic sequences of a B-cell antigens to which the
mAbs of the invention can bind. Searches performed against the
non-redundant gene bank database and the EST division determined
that these peptidic sequences are novel.
[0020] In accordance with this additional aspect of the invention
there is provided a peptide selected from the group consisting
of:
[0021] (a) a peptide having an amino acid sequence as depicted in
FIG. 10;
[0022] (b) a peptide having an amino acid sequence as depicted in
FIG. 11;
[0023] (c) a peptide having an amino acid sequence as depicted in
FIG. 12;
[0024] (d) a peptide having at least 85% identity to any one of the
amino acid sequences of the peptides of (a), (b) and (c) above;
and
[0025] (e) a protein or a peptide comprising one or more of the
peptides of (a)-(d) above.
[0026] The peptides of the invention may be used for a variety of
diagnostic assays, such as, for example, competitive immuno-assays
wherein the level of binding of the mAb of the invention to its
native antigen, which exists on T-cells is determined. In addition,
the peptides may be used for the production of antibodies in
immunized animals which antibodies may then be used for any one of
the utilities described above and below.
[0027] Analogs of all the above peptides also form an additional
aspect of the present invention. As will be appreciated by an
person versed in the art, the amino acid sequence of the peptides
of the invention may be altered, for example, by addition, deletion
or conservative or non-conservative substitution of one or more
amino acids without substantially altering the antibody binding
properties of the peptide
[0028] The term "conservative substitution" refers to the
substitution of an amino acid in one class by an amino acid of the
same class, where a class if defined by common physiochemical amino
acid side chain properties and high substitution frequencies in
homologous proteins found in nature, as determined, for example, by
a standard Dayhoff frequency exchange matrix or BLOSUM matrix. [Six
general classes of amino acid side chains have been characterized
and include: Class I (Cys); Class II (Ser, Thr, Pro, Ala, Gly);
Class III (Asn, Asp, Gln, Glu); Class IV (His, Arg, Lys); Class V
(Ile, Leu, Val, Met); and Class VI (Phe, Tyr, Trp). For example,
substitution of an Asp for another Class III residue such as Asn,
Gln, or Glu, is a conservative substitution. The term
"non-conservative substitution" refers to the substitution of an
amino acid in one class with an amino acid from another class; for
example, substitution of an Ala, a Class II residue, with a Class
III residue such as Asp, Asn, Glu, or Gln.
[0029] The letters used above (and hereinafter) to denote specific
amino acids (aa) are in accordance with the 1-letter amino acid
symbols recommend by the IUPAC-IUB Biochemical Nomenclature
Commission.
[0030] Analogs of the above peptides which fall under the scope of
the present invention are such which have substantially the same
level of binding to the mAbs of the invention as the peptides
depicted in FIGS. 10-12. The level of binding can be determined by
any manner known in the art.
[0031] The peptides and analogs of the invention may also be
chemically modified and such chemically modified peptides and
analogues also form a part of the invention. The term "chemically
modified" refers to a protein where at least one of its amino acid
residues is modified either by natural processes, such as
processing or other post-translational modifications, or by
chemical modification techniques which are well known in the art.
Among the numerous known modifications typical, but not exclusive
examples include: acetylation, acylation, amidation,
ADP-ribosylation, glycosylation, GPI anchor formation, covalent
attachment of a liquid or lipid derivative, methylation,
myristylation, pegylation, prenylation, phosphorylation,
ubiqutination, or any similar process.
[0032] The second finding on which the invention is based is that
the mAbs of the invention can bind to a different extent to T-cells
obtained from individuals having a malignant disease as compared to
the extent of binding of the same mAbs to T-cells of a healthy
individual.
[0033] Thus, by a further aspect of the present invention an assay
is provided for identifying a tested individual with a high
probability of having a malignant disease comprising:
[0034] (a) obtaining a body fluid sample from said individual;
[0035] (b) contacting said sample with at least one mAb of the
invention;
[0036] (c) determining the extent of binding of said mAbs to
T-cells within said sample; and
[0037] (d) comparing the extent of (c) to the extent of binding of
the mAbs of the invention to T-cells in a sample obtained from a
healthy individual; a significant difference between the above two
extents of binding indicating that said tested individual has a
high probability of having a malignant disease.
[0038] In accordance with the invention, the sample obtained from
the individual to be tested may be any body fluid which contains a
detectable amount of T-cells. Typically, the body fluid sample is a
blood or lymph fluid sample. Preferably, before contacting the mAbs
of the invention with the obtained sample, the peripheral blood
monoclear cells (PBMC) in the sample are separated by any one of
the methods known in the art such as by Ficoll Hypaque density
centrifugation and the separated cells are then contacted with the
tested antibodies.
[0039] The term "malignant disease" in accordance with the
invention is to be understood as any kind of malignant disease
known in the art at any of its stages.
[0040] This term also encompasses malignant diseases which are at
their early stages and have not yet elicited clinical symptoms.
Preferably this term refers to solid tumors.
[0041] The term "healthy individual" relates to an individual who
does not have a malignant disease, and may also refer to an average
level of several individuals or to a level obtained by pooling
together body fluids from several individuals. It should be noted
that once a standard extent of binding of healthy individuals is
established, there is no need to re-establish this standard for
every test and the figure established may be used continuously. In
accordance with the invention it has been found that in healthy
individuals about 25% of CD3.sup.+ T-cells bind to antibodies of
the invention.
[0042] The term "high probability" means that the assay of the
invention is an initial screening assay capable of identifying
individuals suspected of having a malignant disease. The fact that
the individual detected by the method of the invention has indeed a
malignant disease will have to be verified later by utilizing
additional techniques known in the art.
[0043] The term "extent of binding" relates to the level of binding
of the antibody to an antigen present on the T-cell of the tested
individual which extent can be determined by any of the methods
known in the art for determining binding levels of antibodies such
as ELISA or Western Blotting. The extent of binding may be
determined using any detection system such as anti-mouse
immunoglobulin or fragments thereof linked to a detectable marker.
Examples of such detectable markers are a radioactive group, a
fluorescent group, an enzyme capable of catalyzing a reaction
yielding a detectable product (such as a color reaction), a biotin
group capable of being detected by avidin, etc. By a preferred
embodiment, the extent of binding of the mAbs of the invention to
the T-cells is carried out by double labeling in which the anti
T-cell antibody (e.g. anti-CD3.sup.+ antibody) is attached to one
kind of fluorescent marker and the mAb of the invention is attached
to a second type of fluorescent marker. The extent of binding is
then determined using fluorecein activated cell sorter (FACS). The
quantitation of the extent of binding is achieved by determining
the percent of CD3.sup.+ T-cells (determined by their binding of
anti-CD3.sup.+ antibodies) which also bind the mAb of the
invention.
[0044] In accordance with the invention, it was found that the
total number of CD3.sup.+ cells in blood samples of individuals
having a malignant disease is similar to the number of CD3.sup.+
cells in blood samples obtained from healthy individuals so that
the normalization of the extent of binding of both mAb and
CD3.sup.+ T-cells by using total CD3.sup.+ binding T-cells both in
malignant patients and healthy individuals is valid. However, the
percent of the CD3.sup.+ binding T-cells which also bind the mAb of
the invention (hereinafter: "CD3.sup.+ mAb cells") in individuals
having a malignant disease differs significantly from the percent
of CD3.sup.+ mAb.sup.+ cells in blood of healthy individuals. The
percent of the CD3.sup.+ mAb.sup.+ cells in an individual having a
malignant disease may either be significantly higher or
significantly lower than the percent of CD3.sup.+ mAb.sup.+ cells
in healthy individuals, depending on the type of the malignant
disease.
[0045] The extent of binding of a mAb of the invention to a T-cell
obtained from a tested individual will be considered to be
"significantly different" than the extent of binding to T-cells
obtained from a healthy individual when the difference in binding
of the mAb is statistically different in a significant degree as
determined by any of the statistical methods known in the art (e.g.
Students t-Test) which are used in connection with results obtained
by the experimental methods mentioned herewith.
[0046] The invention not only enables to identify individuals
having a high probability of having any type of malignant diseases
(where the diseased individual has a different extent of binding of
T-cells to mAbs of the invention as compared to a healthy
individual) but can also help identify individuals having specific
types of cancer by determining whether said extent is higher or
lower than the corresponding extent in the healthy individual.
[0047] Typically, the percent of binding of the mAbs of the
invention to T-cells obtained from healthy individuals is in the
range of about 25%, i.e. 25% of the cells expressing the CD3.sup.+
T-cell marker (determined by binding of anti-CD3.sup.+ antibody to
the cells) also bind the mAbs of the invention.
[0048] In accordance with the invention, it has been shown that in
samples obtained from prostate cancer patients, the percent of
CD3.sup.+ T-cells to which the mAbs of the invention bind are in
the range of about 50%.
[0049] It was further shown that where the CD3.sup.+ T-cells
originate from samples obtained from colon or breast carcinoma
patients, the percent of the cells which also bind to the mAbs of
the invention is about 7% and 10%, respectively.
[0050] Thus, in accordance with the present invention it has become
possible to determine that there is a high probability that there
exists a specific type of cancer in a body fluid sample taken from
a tested individual using a simple and single assay based on the
extent of binding of the mAbs of the invention to CD3.sup.+ cells
present in the body fluid sample. The simplicity of the diagnostic
assay of the invention which necessitates use of only one kind of
mAb to identify an individual having a certain type of cancer is
very useful for wide screening of a population.
[0051] Thus, the present invention by another of its aspects
provides an assay for identifying a tested individual with a high
probability of having a specific malignant disease comprising:
[0052] (a) obtaining a body fluid sample from said individual;
[0053] (b) contacting said sample with the mAbs of the
invention;
[0054] (c) determining the extent of binding of said mAbs to
T-cells in said sample; and
[0055] (d) comparing the extent of binding (c) cells obtained to
the extent of binding of the mAbs to T-cells obtained from a
healthy individual, the existence of a significant difference in
the extents of binding indicating with a high probability that the
tested individual has a malignant disease wherein whether the
extent of binding to the T-cells from said individual is above or
below the extent of the binding of the mAbs in T-cells of healthy
individuals, indicates a specific type of malignant disease which
the tested individual has with high probability.
[0056] In particular, where the extent of binding to the mAb of the
invention is significantly higher than in healthy individuals the
tested individual has a high probability of having prostate
cancer.
[0057] Where the extent of binding is significantly lower than the
healthy individual, the tested individual has a high probability of
having colon or breast cancer.
[0058] In accordance with the diagnostic aspect of the invention,
compositions comprising the mAbs of the invention may be used for
diagnosis to identify individuals with the high probability of
having a malignant disease (in general) or for identifying a
specific malignant disease the individual is likely to have. The
invention therefore provides by another of its aspects, a
diagnostic composition comprising mAbs belonging to at least one of
the abovementioned antibodies together with a suitable carrier. The
carrier may either be a soluble carrier such as any one of the
physiological acceptable buffers known in the art (e.g. PBS) or a
solid state carrier such as, for example, latex beads.
[0059] The present invention also provides kits, e.g. diagnostic
assay kits, for utilizing the mAbs of the invention and carrying
out the diagnostic assays disclosed above. In one embodiment, the
diagnostic kit would conventionally include at least one of the
above mAbs in one or more containers, a conjugate of a specific
binding partner for the mAb (for example the antigen or analog of
the invention), a label capable of producing a detectable signal
and directions for its use. The label may be, a priori, bound to
the monoclonal antibody or, alternatively, the label may be bound
to a carrier molecule which then specifically binds to the mAb. The
incubation of the tested sample with the diagnostic reagent
composition is for a time sufficient to allow binding of the
monoclonal antibodies to the cells.
[0060] By a further aspect of the invention, there are provided
pharmaceutical compositions comprising, as an active ingredient,
one or more of the mAbs of the invention together. Use of said mAbs
for the preparation of pharmaceutical preparations for the
treatment of various malignant diseases in an individual is also
within the scope of the invention.
[0061] By yet another aspect the present invention concerns a
method of treatment of malignant diseases by administering to an
individual in need a therapeutically effective amount of said mAbs.
A therapeutically effective amount being an amount capable of
alleviating the symptoms of the malignant disease, reducing the
symptoms or completely eliminating them.
[0062] Pharmaceutical compositions comprising the peptides of the
invention also constitute an aspect of the invention. Such
compositions may be used, for example, for active immunization of
an individual to obtain antibodies which may then bind to the
T-cells of the individual and elicit an immune response in the
individual.
DETAILED DESCRIPTION OF THE ASPECTS OF THE INVENTION
[0063] The main aspects of the invention will now be described with
occasional reference to the attached figures. In the following
description and figures, the term "BAT antibody" will be used
interchangeably with the term "mAbs of the invention".
BRIEF DESCRIPTION OF THE FIGURES
[0064] FIG. 1 shows the DNA (SEQ ID NO.: 1) and peptide sequences
(SEQ ID NO.: 2) of the heavy chain variable region of the mAb of
the invention;.
[0065] FIG. 2 shows DNA (SEQ ID NO.: 3) and peptide sequences (SEQ
ID NO.: 4) of the Kappa light chain variable region of the mAb of
the invention;
[0066] FIG. 3 shows an analysis of the amino acid sequence of the
heavy chain variable region of the antibody of the invention
(designated "BAT "BAT" defines the amino acid sequence of the BAT
antibody V.sub.H region, while "VMS2" defines the amino acid
sequence of the germline VMS2/VGK4 germline gene. Where the BAT
sequence and the germline sequence are identical the germline
sequence is represented by a dot (.); where mismatches occur the
different germline residue is shown. The tables below, the sequence
on the following pages describe the frequency with which certain
amino acids have been seen at a particular residue position both
within the Kabat et al., Sequences of proteins of immunological
interest, (1991) mouse heavy chain subgroup miscellaneous (Mouse
V.sub.H Misc.) and across a larger database of all known mouse
V.sub.H sequences (All Mouse V.sub.H);.
[0067] FIG. 4 shows an analysis of the amino acid sequence of the
kappa light chain variable region of the antibody of the invention
(designated in the FIG. As "BAT"). "Mouse" defines the amino acid
sequence of the BAT antibody K.sub.K region, while "Germ" defines
the amino acid sequence of the germline H4 germline gene. Where the
BAT sequence and the germline sequence are identical the germline
sequence is represented by a dot (.); where mismatches occur the
different germline residue is shown. The tables below and on the
following pages describe the frequency with which certain amino
acids have been seen at a particular residue position both within
the Kabat mouse heavy chain subgroup VI (Mouse V.sub.K VI) and
across a larger database of all known mouse V.sub.K sequences (All
Mouse V.sub.K);
[0068] FIG. 5 shows the DNA (SEQ ID NO.: 5) and peptide sequences
(SEQ ID NO.: 6) of the Kappa light chain variable regions of the
chimeric antibody of the invention;
[0069] FIG. 6 shows the DNA (SEQ ID NO.: 7) and peptide sequences
(SEQ ID NO.: 8) of the heavy chain variable region of the chimeric
antibody of the invention;
[0070] FIG. 7 shows a schematic representation of the pKN 110
mammalian expression vector used for the expression of the Kappa
light chain of the chimeric antibody of the invention;
[0071] FIG. 8 shows a schema tic representation of the pG1D 110
mammalian expression vector used for the expression of the heavy
chain of the chimeric antibody of the invention.
[0072] FIG. 9 shows a graphic representation featuring an example
of results of an ELISA assay measuring the binding characteristics
of the mouse and the .gamma.1/Kappa chimeric antibody of the
invention to Daudi cells;.
[0073] FIG. 10 shows the amino acid sequence of peptide 1 (SEQ ID
NO.: 9) of the invention;
[0074] FIG. 11 shows the amino acid sequence of peptide 2 (SEQ ID
NO.: 10) of the invention;
[0075] FIG. 12 shows the amino acid sequence of peptide 3 (SEQ ID
NO.: 11) of the invention;
[0076] FIG. 13 is a schematical representation showing the percent
of CD3.sup.+ cells which also bind the mAb of the invention
(indicated as "BAT") as compared to the total number of CD3.sup.+
cells in blood samples of healthy individuals as determined by FACS
analysis;
[0077] FIG. 14 shows the percent of CD3.sup.+ cells which also bind
the mAb of the invention (indicated as BAT) as compared to the
total number of CD3.sup.+ cells in blood samples taken from
patients having colon carcinoma as determined by FACS analysis;
[0078] FIG. 15 shows the percent of CD3.sup.+ cells which also bind
the mAb of the invention (indicated as BAT) as compared to the
total number of CD3.sup.+ cells in blood samples obtained from
patients having breast carcinoma;
[0079] FIG. 16 shows the percent of CD3.sup.+ cells which also bind
the mAb of the invention (indicated as BAT) as compared to the
total number of CD3.sup.+ cells in blood samples obtained from
patients having prostate carcinoma;
[0080] FIG. 17 is a schematic representation showing the mean
percent of CD3.sup.+ cells which bind the mAb of the invention
(indicated as BAT) in healthy individuals as compared to patients
having breast carcinoma, colon carcinoma or prostate carcinoma;
[0081] FIG. 18 is a photograph of a Western Blot of peptides
obtained from T-cells of individuals having prostate cancer, ear,
nose and throat (ENT) carcinoma, breast carcinoma or from membranes
of Daudi cells. The Blot was incubated with the mAb of the
invention and shows an increased amount of antigen in T-cells
obtained from patients having prostate carcinoma as compared to an
undetectable level of antigen in T-cells obtained from patients
having breast carcinoma;
I. SEQUENCING OF THE MAB
[0082] (A) Abbreviations
[0083] Fetal Calf Serum (FCS); ribonucleic acid (RNA); messenger
RNA (mRNA); deoxyribonucleic acid (DNA); copy DNA (cDNA) ;
polymerase chain reaction (PCR); minute (min); second (sec);
Tris-borate buffer (TBE).
[0084] (B) Materials
[0085] Media components and all other tissue culture materials were
obtained from Life Technologies (UK). The RNA isolation kit was
obtained from Stratagene (USA) while the 1.sup.st strand cDNA
synthesis kit was purchased from Pharmacia (UK). All the
constituents and equipment for the PCR-reactions, including
AmpliTaq.RTM. DNA polymerase, were purchased from Perkin Elmer
(USA). The TA Cloning.RTM. kit was obtained from Invitrogen (USA).
Agarose (UltraPure.TM.) was obtained from Life Technologies (UK).
The Thermo Sequences.TM. pre-mixed cycle sequencing kit and the
Vistra 725 DNA sequencing machine were both purchased from Amersham
(UK). All other molecular biological products were obtained from
New England Biolabs (USA).
[0086] (C) Experimental Techniques:PCR Cloning and Sequencing of
the Mouse BAT Antibody Variable Region Genes
[0087] The mouse BAT hybridoma cell line and the Daudi cell line
were successfully transferred to the MRC-CC and both cell lines
were grown, in suspension, using RPMI (without glutamine)
supplemented with 10% (v/v) FCS, 100 units/ml penicillin, 100
.mu.g/ml streptomycin and 2 mM L-glutamine, 1 mM sodium pyruvate
and 12.5 units/ml Nystatin.
[0088] Approximately 10.sup.8 of viable cells of the BAT hybridoma
cell line were harvested and, from the 10.sup.8 cells, total RNA
was isolated using an RNA Isolation kit according to the
manufacturers instructions. The kit used a guanidinium thiocyanate
phenol-chloroform single step extraction procedure as described by
Chromczynski and Sacchi, Anal. Biochem., 162:156, 1987. Also
following the manufacturers instructions a 1.sup.st Strand cDNA
synthesis kit was employed to produce a single-stranded DNA copy of
the BAT hybridoma mRNA using the NotI-(dT).sub.18 primer supplied
in the kit. Approximately 5 .mu.g of total RNA was used in each 33
.mu.l final reaction volume. The completed reaction mix was then
heated to 90.degree. C. for 5 min. to denature the RNA-cDNA duplex
and inactivate the reverse transcriptase, before being chilled on
ice.
[0089] To PCR-amplify the mouse heavy chain variable region gene
(V.sub.H gene) and the mouse kappa light chain variable region gene
(V.sub.K gene) from the hybridoma cell line the method described by
Jones and Bendig, Bio/Technology, 9:8, 1987 was followed.
Essentially, two series of degenerate primers, one designed to
anneal to the leader sequences of the mouse heavy chain genes (i.e.
MHV1-12; Table 1) and one designed to anneal to the leader
sequences of mouse kappa light chain genes (i.e. MKV1-11; Table 2)
were used, in conjunction with primers designed to anneal to the
5'-end of the appropriate constant region gene, to PCR-clone the
murine variable region genes.
[0090] Separate PCR-reactions were prepared for each of the
degenerate primers with their appropriate constant region primer,
in a special PCR-room using specific protocols designed to minimize
the possibility of cross-contamination. Amplitaq.RTM. DNA
polymerase was used to amplify the template cDNA in all cases. The
PCR-reaction tubes were than loaded into a Perkin Elmer 480 DNA
thermal cycler and cycled (after an initial melt at 94.degree. C.
for 1.5 min) at 94.degree. C. for 1 min and 72.degree. C. for 1 min
over 25 cycles. At the completion of the last cycle a final
extension step at 72.degree. C. for 10 min was carried out before
the reactions were cooled to 4.degree. C. Except for between the
annealing (50.degree. C.) and extension (72.degree. C.) steps, when
an extended ramp time of 2.5 min was used, a 30 sec ramp time
between each step of the cycle was employed.
[0091] 10 .mu.l aliquots from each PCR-reaction were run on a 1%
agarose/TBE (pH 8.8) gel to determine which had produced a
PCR-product of the correct size. Those PCR-reactions that did
appear to amplify full-length variable region genes were repeated
to produce independent PCR-clones and thereby minimize the effect
of PCR-errors. 1-6 .mu.1 aliquots of those PCR-products of the
correct size were directly cloned into the pCRII.TM. vector,
provided by the TA Cloning.RTM. kit, and transformed into INA
.alpha.F' competent cells as described in the manufacturers
instructions. Colonies containing the plasmid, with a correctly
sized insert, were identified by PCR-screening the colonies using
the pCRII Forward and pCRII Reverse oliognucleotide primers
described in Table 3 below according to the method of Gussow and
Clackson, Nucleic Acids Res., 17:4000, 1989
[0092] Those putative positive clones identified were
double-stranded plasmid DNA sequenced using the Vistra DNA
sequencing machine and the Thermo Sequenase.TM. pre-mixed cycle
sequencing kit as described in the manufacturers instructions.
EXAMPLE 1
Cloning and Sequencing of the Heavy Chain Variable Region of the
BAT Antibody
[0093] As with all humanization projects, a strict PCT-cloning and
sequencing protocol was followed. This was done to minimize the
possibility of introducing errors into the wild-type sequences of
the mouse VH variable region genes from the BAT hybridoma cell
line. Only if all the DNA sequence data from at least two different
V.sub.H gene clones, from the hybridoma cell line expressing the
murine BAT antibody, matched perfectly were the gene sequences
accepted as correct.
[0094] Three separate PCR-products, each from a different total RNA
preparation and subsequent first strand cDNA synthesis reaction,
were PCR-cloned and completely DNA sequenced on both strands.
Although all twelve heavy chain primers were tested (Table 1), only
the MHV9 primer (in conjunction with MHCG3--designed to anneal to
the CH.sub.1 domain of the mouse .gamma.3 heavy chain gene) was
PCR-amplified an approximately 460 bp product which was then
TA-cloned into the pCRII.TM. cloning vector (data not shown).
[0095] DNA sequence analysis of several individual clones from each
of the three PCR-products (each from different 1.sup.st strand
synthesis reactions and subsequent PCR-reactions) resulted in the
determination of the BAT antibody heavy chain variable region
sequence as described in FIG. 1. This sequence was confirmed on
both DNA strands for all three PCR-clones studied.
EXAMPLE 2
Cloning and Sequencing of the Kappa Light Chain Variable Region of
the BAT Antibody
[0096] The single stranded cDNA template, produced via 1.sup.st
strand synthesis, was PCR-amplified using a series of kappa light
chain degenerate primers (Table 2 below). However, this resulted in
the amplification of a number of PCR-products from more than one
degenerate primer, suggesting that more than one variable region
gene was being transcribed, at least, by the BAT hybridoma cell
line.
[0097] First, a PCR-product was seen when the MKV2 primer (which,
like all of the MKV series of primers, anneals to the 5' end of the
DNA sequence of the kappa light chain signal peptide) and MKC
(which is designed to anneal to the 5' end of the mouse kappa
constant region gene) were used together. Previous in-house
experience had shown us that the MKV2 primer would PCT-amplify an
aberrant mRNA transcript. This aberrant pseudogene was present in
all standard fusion partners derived from the original MOPC-21
plasmacytoma cell line and was known as MOPC-21n Deyev, S. M., et
al., Genetica, 85:45, 1991. NO-0 was a cell line which was derived
from MOPC-21 line, and it was this line which was used as the
fusion partner to produce the BAT hybridoma. Consequently, it was
not surprising that a PCR-product was seen when using the MKV2
primer. This product was analyzed and shown to be the
non-functional pseudogene (data not shown).
[0098] Unusually, another pseudogene, previously identified as
being secreted by the related cell line NS-1 Hamlyn, P. H., et al.,
Nucl. Acis Res., 9:4485, 1981 and normally PCR-cloned when using
the MKV7 primer in conjunction with MKC primer, was not seen in any
of the PCR-products so far analyzed. Since the NS-1 and NS-0 cell
lines were very closely related, this was a little surprising.
However, it also highlighted the confusing nature of kappa light
chain transcription that was present in the BAT hybridoma cell
line.
[0099] Another PCR-clone, which ultimately turned out to be the
V.sub.K gene of the BAT antibody, was also successfully
PCR-amplified from the BAT hybridoma cell line with the primers
MKV5 and MKC. Following transformation of the approximately 450 bp
product into INV.alpha.F' competent cells, putative positive
transformants were identified using the PCR-screening assay and
then DNA sequenced.
[0100] From sequence analysis of two individual clones of the MKV5
product (each from different .sub.1.sup.st strand synthesis
reactions and subsequent PCR-reactions) the DNA sequence of the BAT
antibody kappa light chain variable region gene was determined
(FIG. 2). This sequence was again confirmed on both DNA strands for
each clone.
EXAMPLE 3
Sequence Analysis of the Mouse BAT Antibody Variable Regions
[0101] The amino acid sequence of the BAT V.sub..kappa. and V.sub.H
regions were compared to the consensus sequences of murine variable
region subgroups that were defined in the Kabat (Supra) database
From this analysis the BAT V.sub.H region was found to most closely
match the consensus sequence of mouse kappa subgroup VI. Similar
comparisons of the BAT V.sub.H region to the Kabat databasefound
that it exhibited the closest match to the consensus sequence of
mouse heavy chain subgroup "miscellaneous".
[0102] A comparison of the above BAT antibody variable region
sequences to a database of murine germlines, found that the closest
germline gene to the BAT V.sub.H gene was VMS/VGK4 (FIG. 3), whilst
the closest germline gene to the BAT V.sub..kappa. gene was H4
(FIG. 4). As can be seen in FIG. 3, those mismatches that did occur
between the BAT V.sub.H gene and its closest germline gene were,
unsurprisingly, predominantly located in the CDR2 and CDR3. There
were only three framework changes, and all these were located in
FR3. With respect to the BAT V.sub..kappa. gene (FIG. 4), it was
again not all together surprising that the majority of mismatches
were positioned in the CDRs. The four differences that were located
in the FRs were all highly conservative changes, except for the
cysteine at position 72 (Kabat numbering) in FR3. Its location
immediately adjacent to an important canonical residue (position
71) suggested that the cysteine may have been playing a key role in
antigen binding. However, only through modeling the Fv domain could
such a supposition be clarified.
[0103] Nevertheless, these analyses confirmed that both the V.sub.H
regions and the V.sub..kappa. regions of the mouse BAT variable
regions appeared to be typical of mouse variable regions.
1TABLE 1 PCR-primers used in the cloning of the BAT heavy chain
variable region gene Name Sequence (5'.fwdarw.3') MHV5.sup.a (30
mer; SEQ ID NO:12) ATGGACTCCAGGCTCAATTTAGTTTTCCTT MHV9.sup.a (30
mer; SEQ ID NO:13) ATGGATTGGGTGTGGACCTTGCTATTCCTG C A MHCG3.sup.b
(21 mer; SEQ ID NO:14) CAAGGGATAGACAGATGGGGC .sup.a MHV indicates a
primer that hybridizes to leader sequences of mouse heavy chain
variable region genes. .sup.b MHCG indicates primers that hybridize
to mouse constant region genes.
[0104]
2TABLE 2 PCR-primers used in the cloning of the BAT kappa light
chain variable region gene Name Sequence (5'.fwdarw.3') MKV2.sup.a
(30 mer; SEQ ID NO:15) ATGGAGACAGACACACTCCTGCTATGGGTG T T
MKV5.sup.a (30 mer; SEQ ID NO:16) ATGGATTTTCAGGTGCAGATTATCAGCTTC A
T MKV6.sup.a (30 mer; SEQ ID NO:17) ATGAGGTGCCCTGTTCAGTTCCTGGGG T
TT C G C T A MKV11.sup.a (30 mer; SEQ ID NO:18)
ATGGAAGCCCCAGCTCAGCTTCTCTTCC MKC.sup.b (20 mer; SEQ ID NO:19)
ACTGGATGGTGGGAAGATGG .sup.a MKV indicates primers that hybridize to
leader sequences of mouse kappa light chain cariable region genes
.sup.b MKC indicates the primer that hybridizes to the mouse kappa
constant region gene
[0105]
3TABLE 3 Primers for PCR screening transformed colonies Name
Sequence (5'-43 3') pCRII Forward Primer (18 mer; SEQ ID:20)
CTAGATGCATGCTCGAGC pCRII Reverse Primer (21 mer; SEQ ID:21)
TACCGAGCTCGGATCCACTAG
II. CONSTRUCTION AND EXPRESSION OF THE CHIMERIC ANTIBODY OF THE
INVENTION
[0106] (A) Abbreviations
[0107] The following non-SI unit and other abbreviations were
used:
[0108] Polymerase chain reaction (PCR); deoxyribonucleic acid
(DNA); copy DNA (cDNA); kappa light chain variable region
(V.sub..kappa.); heavy chain variable region (V.sub.H); minute
(min); Tris-borate buffer (TBE); phosphate buffered saline (PBS);
room temperature (RT), bovine serum albumin (BSA); hydrochloric
acid (HCl); horseradish peroxidase (HRP); low fat milk LFM); hour
(hr); percent (%); O-phenylenediamine dihydrochloride (OPD);
multiple cloning site (MCS).
[0109] (B) Materials
[0110] Media components and all other tissue culture materials were
obtained from Life Technologies (UK). The constituents for the
PCR-reactions, including AmpliTaq.RTM. DNA polymerase, were
purchased from Perkin Elmer (USA). However, the TA Cloning.RTM. kit
and INV.alpha.F' competent cells were obtained from Invitrogen
(USA). DH5.alpha. competent cells and agarose (UltraPure.TM.) were
obtained from Life Technologies (UK). The Thermo Sequenase.TM.
pre-mixed cycle sequencing kit and the Vistra 725 DNA sequencing
machine were both purchased from Amersham (UK). The Big Dye.TM.
Terminator Cycle Sequencing Ready Reaction Kit used with the ABI
Prism 310 Genetic Analyzer were purchased from PE Applied
Biosystems (UK). All other molecular biological products described
were obtained either from New England biolabs (USA) or Promega
(USA). Nunc-Immuno Plate MaxiSorp.TM. immunoplates were purchased
from Life Technoloiges (UK) while the Coming easy wash ELISA plates
were obtained from Coming Laboratory Sciences Company (UK). The
goat anti-human IgG (Fc.sub..gamma. fragment specific) antibody,
the goat anti-human kappa light chain/HRP conjugate and the
AffinPure goat anti-human IgG (Fc.sub..gamma. fragment
specific)/HRP conjugate were obtained from Jackson ImmunoResearch
Laboratories Inc. (USA). K-Blue TMB substrate and Red Stop solution
were purchased from Neogen Inc. (USA). All other products for the
ELISA were obtained from Sigma (UK). Microplate Manager.RTM. data
analysis software package was purchased from Bio-Rad (UK). The
micro-volume stirred ultrafiltration cell and PM30 filter membrane
were obtained from Amicon PLC (UK), while the Immunopure.RTM. (G)
IgG purification kit was purchased from Pierce PLC (UK).
[0111] (C) Experimental Techniques
[0112] C1 Construction of chimeric .gamma.1/.sub..kappa. BAT
antibody
[0113] The previously isolated mouse kappa light chain variable
region (V.sub..kappa.) gene (FIG. 1) and heavy chain variable
region (V.sub.H) gene (FIG. 2) were modified at the 5'- and
3'-ends, using specifically designed PCR-primers (Table 1), to
enable expression of the BAT variable region genes in mammalian
cells as part of a chimeric mouse-human antibody. To achieve this
separation PCR-reactions were prepared for each variable region
gene in a specific PCR-room using specific protocols designed to
minimize the possibility of cross-contamination. The plasmids
BATV.sub.H-pCR2. 1 and BATV.sub..kappa.-pCR2. 1 were used as
templates and AmpliTaq.RTM. DNA polymerase was used t amplify these
templates. Primers B8814 and B8815 (Table 4) were used to
PCR-modify the BAT V.sub.H gene while primers C0224 and C0225
(Table 4) were used to PCR-mutate the BAT V.sub..kappa. gene.
[0114] The PCR-reaction tubes were cycled (after an initial melt at
94.degree. C. for 3 min) at 94.degree. C. for 50 s, 72.degree. C.
for 1 min 30 s over 30 cycles. At the completion of the last cycle
a final extension step at 72.degree. C. for 10 min was carried out
before the reactions were cooled on ice. 5 .mu.l aliquots from each
PCR-reaction were then run on a 1.2% agarose/TBE (pH 8.8) gel to
determine which had produced a PCR-product of the correct size.
[0115] 1-2 .mu.l aliquots of those PCR-products of the correct size
were directly cloned into the pCR2.1.TM. vector, provided by the TA
Cloning.RTM. kit, and transformed into INV.alpha.F' competent cells
as described in the manufacturers instructions. Colonies containing
the plasmid, with a correctly sized insert, were identified by
PCR-screening the colonies using the 1212 and 1233 oligonucleotide
primers (Table 5) according to the method of Guissow and Clackson
(Supra) Those putative positive clones identified were
double-stranded plasmid DNA sequenced using both the Vistra DNA
sequencing machine and ABI Prism 310 Genetic Analyzer. The Thermo
Sequenase.TM. pre-mixed cycle sequencing kit and the Big Dye.TM.
Terminator Cycle Sequencing Ready Reaction Kit were used as
described in the manufacturers instructions with the primers 1212
and 1233 (Table 5).
[0116] Those clones containing the correctly adapted BAT
V.sub..kappa. and V.sub.H genes (FIGS. 5 and 6, respectively) were
subcloned, as a HindIII-BamHi fragments, into the expression
vectors pKN110 (FIG. 7) and pG1D110 (FIG. 8), respectively, to
express chimeric light and heavy chains in mammalian cells. The
ligated expression vectors (i.e. pKN 110-BATV.sub..kappa. and
pG1D110-BATV.sub.H) were then transformed into DH5.sub..alpha.
competent cells. Positive clones, containing the correctly
constructed expression vectors, were finally identified by
restriction digest analysis.
[0117] C2 Co-transfection of chimeric .gamma.1/.sub..kappa. BAT
antibody vector DNA into COS cells
[0118] The method of Kettleborough et al. was followed to transfect
the mammalian expression vectors into COS cells. Briefly, the DNA
(10 .mu.g each of the kappa light chain expression vector
pKN110-BATV.sub..kappa. and heavy chain expression vector
pG1D110-BATV.sub.H) was added to a 0.70 ml aliquot of
1.times.10.sup.7 cells/ml in PBS and pulsed at 1900 V, 25 .mu.F
capacitance using a Bio-Rad Cene Pulser apparatus. Following a 10
min recovery at RT the electroporated cells were added to 8 ml of
DMEM containing 5% FCS and incubated for 72 hr in 5% CO.sub.2 at
37.degree. C. After 72 hr incubation, the medium was collected,
spun to remove cell debris and analyzed by ELISA for chimeric BAT
antibody production.
[0119] C3 Quantification of chimeric .gamma.1/.sub..kappa. antibody
via ELISA
[0120] Each well of a 96-well Nunc-Immuno Plate MaxiSorp.TM.
immunoplate as first coated with 100 .mu.l aliquots of 0.4 ng/.mu.l
goat anti-human IgG (Fc.sub..gamma. fragment specific) antibody,
diluted in PBS and incubated overnight at 4.degree. C. and removed
prior to use. 100 .mu.l/well aliquots f the experimental samples
(i.e. harvested COS cell supernatants--spun to remove cell debris)
and 1:2 sample dilutions, diluted in sample-enzyme conjugate buffer
(0.1 M Tris-HCl (pH 7.0), 0.1 M NaCl, 0.02% (v/v) TWEEN-20 and 0.2%
(w/v) BSA), were then dispensed onto the immunoplate. In addition,
a purified human .gamma.1/.sub..kappa. antibody (1000 ng/.mu.l),
which was used as a standard and serially diluted 1:2, and also
loaded onto the immunoplate. The immunoplate was incubated at
37.degree. C. for 1 hr before being washed with 200 .mu.l/well of
wash buffer (PBS/0.1% (v/v) TWEEN-20) three times. 100 .mu.l of
goat anti-human kappa light chain/horseradish peroxidase conjugate,
diluted 5000-fold in sample-enzyme conjugate buffer, was added to
each well, following which the immunoplate was incubated at
37.degree. C. for 1 hr before it was washed as before. 150 .mu.l
aliquots of K-Blue substrate were then added to each well,
following which the immunoplate was incubated for 10 min at RT in
the dark. The reaction was finally halted by dispensing 50 .mu.l of
Red Stop into each well. The optical density at 655 nm was then
determined using a Bio-Rad 3550 microplate reader in conjunction
with the Microplate Manager.RTM. software package.
[0121] C4 Purification of the Chimeric BAT Antibody
[0122] The chimeric BAT .gamma.1/.sub..kappa. antibody was purified
from COS cell supernatants in two stages. First, a micro-volume
stirred ultrafiltration cell with a PM30 filter membrane was used,
according to the manufacturers instructions, to reduce the volume
of the raw, non-purified supernatant. Then an Immunopure.RTM. (G)
IgG purification kit was used to affinity purify the chimeric BAT
antibody from the concentrated supernatant, also according to the
manufacturers instructions.
[0123] C5 Daudi cell ELISA
[0124] The cell ELISA assay was carried out using the Daudi cell
cultured from an original stock also by Dr. Hardy (Felsenstein
Medical Research Center, Rabin Medical Center, Beilinson Campus,
Petach Tikva,49100, Israel). Minor modifications were made to the
assay depending upon whether the mouse or the mouse-human chimeric
BAT antibody was being analyzed. When assaying the binding affinity
of the mouse BAT antibody a goat anti-mouse IgG (Fab specific)/HRP
conjugate (diluted 1:15000) was used as the secondary antibody.
Conversely, when measuring the affinity of the chimeric BAT
antibody AffiniPure goat anti-human IgG (Fc.sub..gamma. fragment
specific)/HRP conjugate (diluted 1000-fold) was used.
[0125] The Daudi cells (2 days after being passaged) were first
plated at 10.sup.5 cells/well in a 96 well Coming easy wash ELISA
plate and then incubated overnight at 37.degree. C. in a dry
incubator. The next day, 200 .mu.l of rehydration buffer (PBS
containing 10% FCS and 0.05% azide) was added to each well which
was then left for a minimum of 1 hr. The rehydration buffer was
then decanted off before 50 .mu.l aliquots of various 1:2 serial
dilutions of the purified BAT antibody was added to the wells of
the plate. The plate was again incubated overnight (at 4.degree.
C.), washed twice with 200 .mu.l/well of PBS containing 5% LFM and
allowed to dry. 50 .mu.l/well of the HRP conjugated secondary
antibody was then added before a series of six different washes
(i.e. one wash with PBS containing 5% LFM, three washed with the
same buffer supplemented with 0.05% TWEEN-20, followed by a further
two washes with the PBS/LFM buffer) were carried out. 200
.mu.l/well of 0.4 mg/ml OPD substrate in 0.05 M citrate buffer (pH
5.0) and 60 mg/ml hydrogen peroxide was then added before the ELISA
plate was incubated in the dark and at RT until the color had
developed (usually about 30 min). Finally, the reaction was stopped
by the addition of 50 .mu.l/well of 2.5 M sulfuric acid and the
optical density at 490 nm was then measured using a Bio-Rad 3550
microplate reader in conjunction with the Microplate Manager.RTM.
software package.
[0126] Results
EXAMPLE 4
Construction of the Chimeric .gamma.1/.sub..kappa. BAT antibody
[0127] As with all projects, a strict PCR-cloning and sequencing
protocol was followed. This was done to minimize the possibility of
introducing errors into the wild-type sequences of the mouse
variable region genes during the PCR-modification step. Using the
primers C0224 and C0225 (Table 1) the mouse BAT V.sub..kappa. gene
(FIG. 2) was modified via PCR to produce a 418 bp band (data not
shown). This PCR-product was ligated into the pCR2.1 plasmid and
transformed into INV.alpha.F' competent cells. Similarly, the mouse
BAT V.sub.H gene (FIG. 1 was PCR-mutated using primers B8814 and
B8815 (Table 1) to produce a 436 bp band (data not shown). This
PCR-product was also ligated into the pCR2.1 plasmid and
transformed into INV.alpha.F' competent cells.
[0128] Putative positive transformants were then detected using the
PCR-screening assay (data not shown) before finally being ds-DNA
sequenced on the ABI Prism 310 Genetic Analyzer. FIGS. 3 and 4 show
the results of this DNA sequence analysis of the chimeric BAT
V.sub..kappa. gene and BAT V.sub.H gene, respectively. The analysis
was carried out both to confirm their successful mutagenesis and
also show the presence of any PCR-errors that may have been
introduced into the genes. Only one PCR-reaction was actually
carried out for each variable region gene and only two clones from
each of these PCR-reactions were eventually DNA sequences to
completed.
[0129] Nevertheless, this proved sufficient to isolate at least one
clone for each modified variable region gene which contained the
correct modified DNA sequence.
[0130] The mutated V.sub.H and V.sub..kappa. genes were then
subcloned into the appropriate expression vectors, as hindIII/BamHI
fragments, to create pKN110-BATV.sub..kappa. (7.88kb) and
pG1D110-BATV.sub.H (7.55 kb), respectively. The fidelity of the
expression vectors constructed was then confirmed via restriction
enzyme analysis (data not shown). Once co-transfected into COS
cells, these vectors wold allow the transient expression of a
.gamma.1/.sub..kappa. version of the chimeric BAT antibody.
[0131] In addition, as an extra component to the BAT antibody
humanization project, the BAT V.sub.H gene was also subcloned, as a
HindIII/BamHI fragment, into both the pG3D110 and the pG4D1100
heavy chain expression vectors. These vectors were identical to
pG1D110, save for the replacement of the cDNA copy .gamma.1 human
constant region genes with either a cDNA copy of the .sup.3.gamma.
constant region genes (in the case of pG3D110) or the cDNA of the
.gamma.3 constant region genes (in the case of pG3D110) or the cDNA
of the .gamma.4 constant region genes (in the case of pG3D110). The
construction of these vectors (i.e. pG3D110-BATV.sub..kappa., of
both .gamma.3/.sub..kappa. and .gamma.4.sub..kappa. versions of the
chimeric BAT antibody in COS cells.
EXAMPLE 5
Transient Expression of the Chimeric .gamma.1/.sub..kappa. BAT
Antibody
[0132] The two vectors pKN110-BATV.sub..kappa. and
pG1D110-BATV.sub.H were co-transfected into COS cells in a series
of repeated transient expression experiments. After being expressed
for 72 hr the mouse-human .gamma.1/.sub..kappa. chimeric BAT
antibody was detected in the supernatant of the COS cell
co-transfections via the .gamma.1/.sub..kappa. ELISA. From these
assays the mean concentration of .gamma.1/.sub..kappa. chimeric BAT
antibody detected in the media was calculated to be 509.+-.272
ng/ml.
[0133] Interestingly, the .gamma.3/.sub..kappa. and
.gamma.4/.sub..kappa. versions of the chimeric BAT antibody
appeared to produce significantly greater quantities of antibody
following their expression COS cells. Specifically, when
pG3D110-BATV.sub.H and pKN110BATV.sub..kappa. were co-transfected
into COS cells, initial analysis of the supernatant (using the
ELISA method described in Section 4.3 and human IgG3/kappa antibody
as a standard) measured the expression levels of the chimeric
.gamma.3/.sub..kappa. BAT antibody to be 6.7 .mu.g/ml. Moreover,
when pG4D110-BATV.sub.H pKN110-BATV.sub..kappa. were expressed in
COS cells, the same ELISA (using human IgG4/kappa antibody as a
standard) measured the expression levels of the chimeric
.gamma.4/.sub..kappa. BAT antibody to be 8.2 .mu.g/ml.
EXAMPLE 6
Purification of the Chimeric .gamma.1/.sub..kappa. BAT antibody
[0134] Harvesting approximately 8 ml per co-transfection, a series
of transfections were carried out until 200 ml of COS supernatant
had been collected. The volume of this supernatant was then reduced
to 15 ml by passing the supernatant through a micro-volume stirred
ultrafiltration cell with a PM30 filter membrane--which had a
molecular weight cut-off of 30 kDa.
[0135] The Immunopure.RTM. (G) IgG purification kit essentially
comprised of a 2 ml column of immobilized Protein G column. The
antibody was eluted from the column with 6 ml of elution buffer,
the eluate of which was collected in 1 ml fractions. The
concentration of chimeric .gamma.1/.sub..kappa. BAT antibody in
each fraction was then assayed using the ELISA method described in
Section C3. This analysis found that the chimeric antibody was
present in Fraction 3 (42.05 .mu.g/ml) and Fraction 4 (20.05
.mu.g/ml), which correspond to a total recovery of 62.1 .mu.g of
chimeric .gamma.1/.sub..kappa. BAT antibody. This was stored at
-20.degree. C., until its subsequent transfer to Curetech for
further analysis.
EXAMPLE 7
Analysis of Daudi Cell Binding by the Chimeric
.gamma.1/.sub..kappa. Bat antibody
[0136] Using the Daudi cell ELISA it was clearly shown that the
purified chimeric .gamma.1/.sub..kappa. BAT antibody bound to Daudi
cells. FIG. 9 shows a typical example of one experiment. However,
what was less conclusive was the binding of similar concentrations
of mouse BAT antibody, in the same ELISA, which appeared to be
lower than the chimeric antibody. Nevertheless, since the
conjugated secondary antibody used to detect antibody binding to
the Daudi cells was different for each antibody construct, no
direct comparison of the binding of the two versions can
legitimately be made.
4TABLE 4 Primers used to PCR-modify the mouse BAT antibody kappa
light chain and heavy chain variable region genes to allow their
expression as part of a chimeric .gamma.1/.sub.78 BAT antibody in
mammalian cells Name Sequence (5'.fwdarw.3') C0225 (42 mer; SEQ
ID:22) C C C A A G C T T G C C G C C A C C A T G G A T T T T C A G
G T G C A G A T T A T C C0224 (39 mer; SEQ ID NO:23) C G C G G A T
C C A C T C A C G T T T T A T T T C C A A C T T T G T C C C C G
B8815 (40 mer; SEQ ID NO:24) G G A T C C A C T C A C C T G A G G A
G A C G G T G A C T G A G G T T C C T T G B8814 (42 mer; SEQ ID
NO:25) A A G C T T G C C G C C A C C A T G G C T T G G G T G T G G
A C C T T G C T A T T C
[0137]
5TABLE 5 Primers used to PCR screen the transformed colonies and
DNA sequence the PCR-modified variable region genes of the BAT
antibody Name Sequence (5'.fwdarw.3') Hu.gamma.1 (17 mer; SEQ ID
NO:26) T T G G A G G A G G G T G C C A G HCMVi.3s (28 mer; SEQ ID
NO:27) G T C A C C G T C C T T G A C A C G C G T C T C G G G A FOR
(18 me; SEQ ID NO:28) T G T A A A A C G A C G G C C A G T REV (18
mer; SEQ ID NO:29) G A A A C A G C T A T G A C C A T G B6990 (27
mer; SEQ ID NO:30) C A G C A T A T G T T G A C T C T C C A C T G T
C G G B6991 (27 mer; SEQ ID NO:31) G T C A A C A T A T G C T G A A
G A G T T C A A G G G B8809 (18 mer; SEQ ID NO:32) T G C C A G G T
C A A G T G T A A G B8810 (18 mer; SEQ ID NO:33) A A G C C A G G T
T G G A T G T C C
IV AMINO ACID SEQUENCES OF 3 PEPTIDES TAKEN FROM THE DAUDI B-CELL
LYMPHOBLASTOID CELL LINE ANTIGEN TO WHICH THE MABS OF THE INVENTION
BIND
[0138] Three peptides comprised in the antigenic epitope of the
Daudi B lymphoblastoid cells to which the mAbs of the invention
bind were sequenced. Their sequence depicted in FIGS. 10, 11 and
12.
[0139] Searches performed against the non-redundant gene bank
database and the EST Division yielded no hits when the three
peptides were ran as queries using the TBLASTN algorithm (Version
2) with an EXPECT value of 10 and the matrix BLOSUM 62.
[0140] However, since the peptides are small peptides, they were
submitted again at a higher EXPECT value to make the search less
stringent. The filter was also unmasked for low complexity which
can eliminate potentially confounding matches (e.g. hits against
proline-rich regions or proly-A tails) from the blast reports,
leaving regions whose blast statistics reflect the specificity of
their pairwise alignment. The three peptides of the invention did
not yield any hit with the gene bank and the EST division database
even at a very low stringency.
[0141] Thus, in accordance with the above results, the three above
peptides seem to be novel peptides.
IV DIAGNOSIS OF MALIGNANT DISEASES IN PATIENTS USING THE MAB OF THE
INVENTION
[0142] Peripheral blood lymphocytes from tested individuals were
double-labeled using the anti-CD3 antibody and one of the mAbs of
the invention. The percent of CD3.sup.+ cells which bind the mAbs
of the invention were determined. In accordance with the invention,
it has been shown that the number of the CD3.sup.+mAb.sup.+ cells
in individuals having a malignant disease differs from the percent
of these cells in blood samples obtained from healthy individuals.
The fact that there exists a significant difference of the percent
of the CD3.sup.+ cells in the individuals having a malignant
disease and whether the difference is above or below the percent of
CD3.sup.+mAb.sup.+ cells obtained from healthy individuals enables
to determine at high probability whether the individual has a
malignant disease as well as the specific kind of malignant disease
which the tested individual may have.
[0143] Typically, human peripheral blood lymphocytes were obtained
from 20 ml blood of either a healthy individual or from cancer
patients by Ficoll Hypaque density centrifugation. The cells were
washed and suspended in PBS containing 0.5% BSA and 0.05% as acid.
The samples containing 0.5.times.10.sup.6 cells were used for FACS
analysis. First, the cells were incubated with a saturated amount
of the mAb of the invention for 45 mins. at 0.degree. C. followed
by their incubation with an anti-mouse mAb conjugated to FITC for
30 mins. on ice. After two washes and centrifugation at 1200 rpm
cells were incubated with an anti-human CD3 conjugated to PE
antibodies for 30 mins. on ice. Following this incubation, the
cells were washed twice and the sample is analyzed by a FACS scan
(Bectan Dickinson). The results are shown in FIGS. 13 to 17.
[0144] As can be seen in FIG. 13, as well as in FIG. 17, the
percent of CD3.sup.+ BAT.sup.+cells (as compared to total CD3.sup.+
cells) in blood samples obtained from healthy individuals is in the
range of about 25%. As seen in FIG. 14, the percent of the
CD3.sup.+ BAT.sup.+ cells in blood samples obtained from patients
having colon carcinoma is substantively lower, as compared to
healthy individuals, in the range of about 7%. Similarly, the
percent of CD3.sup.+ BAT.sup.+ cells in blood samples obtained from
patients having breast carcinoma was in the range of about 10%
(FIG. 15). These results clearly indicate that colon and breast
carcinoma can be identified by the fact that the percent of
CD3.sup.+ BAT.sup.+ cells is lower as compared to healthy
individuals.
[0145] The percent of CD3.sup.+ BAT.sup.+ cells in blood samples
obtained from prostate carcinoma patients is significantly higher
than the percentagein blood samples of healthy individuals as seen
in FIG. 16 and is in the range of about 50%. These results clearly
indicate that prostate carcinoma can be identified by the fact that
the percent of CD3.sup.+ BAT.sup.+ cells is higher a compared to
healthy individuals. As seen in FIG. 18, the amount of the antigen
to, which the mAb of the invention bind found on T-cells, obtained
from prostate carcinoma patients is very high while the antigen is
undetectable in T-cells obtained from patients of breast
carcinoma.
[0146] The above results show that the mAbs of the invention may be
used in order to identify an individual suffering from a certain
kind of malignant disease. Thus, if a blood sample is obtained from
a tested individual and the extent of binding of the mAbs of the
invention to CD3.sup.+ cells in the sample is significantly high
(in the range of about 50%), there is a very high probability that
the tested individual is suffering from prostate cancer. Against
this, if the percent of the CD3.sup.+ cells in the sample is
significantly low as compared to healthy individuals (in the range
of about 7% or 10%), there is a high probability that the tested
individual is suffering from breast or colon carcinoma. Obviously,
if the tested individual is a male individual, there is a high
probability of his suffering from colon carcinoma.
[0147] The above examples are not to be construed as limiting and
additional correlations between the percent of CD3.sup.+ cells
which bind the mAbs of the invention and other malignant diseases
are also within the scope of the invention.
Sequence CWU 1
1
33 1 462 DNA Humanus 1 tactagtcga catggcttgg gtgtggacct tgctattcct
gatggcagct gcccaaagta 60 tccaagcaca gatccagttg gtgcagtctg
gacctgagtt gaagaagcct ggagagacag 120 tcaagatctc ctgcaaggct
tctggatata ctttcacaaa ctatggaatg aactgggtga 180 agcaggctcc
aggaaagggt ttaaagtgga tgggctggat aaacaccgac agtggagagt 240
caacatatgc tgaagagttc aagggacggt ttgccttctc tttggaaacc tctgccaaca
300 ctgcctattt gcagatcaac aacctcaaca atgaggacac gcctacatat
ttctgtgtga 360 gagtcggcta cgatgctttg gactactggg gtcaaggaac
ctcagtcacc gtctcctcaa 420 ctacaacaac agccccatct gtctatccct
tcccgggttc ca 462 2 136 PRT Humanus 2 Met Ala Trp Val Trp Thr Leu
Leu Phe Leu Met Ala Ala Ala Gln Ser 1 5 10 15 Ile Gln Ala Gln Ile
Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys 20 25 30 Pro Gly Glu
Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr
Asn Tyr Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu 50 55
60 Lys Trp Met Gly Trp Ile Asn Thr Asp Ser Gly Glu Ser Thr Tyr Ala
65 70 75 80 Glu Glu Phe Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser
Ala Asn 85 90 95 Thr Ala Tyr Leu Gln Ile Asn Asn Leu Asn Asn Glu
Asp Thr Ala Thr 100 105 110 Tyr Phe Cys Val Arg Val Gly Tyr Asp Ala
Leu Asp Tyr Trp Gly Gln 115 120 125 Gly Thr Ser Val Thr Val Ser Ser
130 135 3 443 DNA Humanus 3 actagtcgac atggatttac aggtgcagat
tatcagcttc ctgctaatca gtgcctcagt 60 cataatgtcc agaggacaaa
ttgttctcac ccagtctcca gcaatcatgt ctgcatctcc 120 aggggagaag
gtcaccataa cctgcagtgc caggtcaagt gtaagttaca tgcactggtt 180
ccagcagaag ccaggcactt ctcccaaact ctggatttat aggacatcca acctggcttc
240 tggagtccct gctcgcttca gtggcagtgg atctgggacc tcttactgtc
tcacaatcag 300 ccgaatggag gctgaagatg ctgccactta ttactgccag
caaaggagta gtttcccact 360 cacgttcggc tcggggacaa agttggaaat
aaaacgggct gatgctgcac caactgtatc 420 catcttccca ccatccaaga tct 443
4 128 PRT Humanus 4 Met Asp Leu Gln Val Gln Ile Ile Ser Phe Leu Leu
Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Gln Ile Val Leu
Thr Gln Ser Pro Ala Ile 20 25 30 Met Ser Ala Ser Pro Gly Glu Lys
Val Thr Ile Thr Cys Ser Ala Arg 35 40 45 Ser Ser Val Ser Tyr Met
His Trp Phe Gln Gln Lys Pro Gly Thr Ser 50 55 60 Pro Lys Leu Trp
Ile Tyr Arg Thr Ser Asn Leu Ala Ser Gly Val Pro 65 70 75 80 Ala Arg
Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Cys Leu Thr Ile 85 90 95
Ser Arg Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg 100
105 110 Ser Ser Phe Pro Leu Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile
Lys 115 120 125 5 412 DNA Humanus 5 aagcttgccg ccaccatgga
tttacaggtg cagattatca gcttcctgct aatcagtgcc 60 tcagtcataa
tgtccagagg acaaattgtt ctcacccagt ctccagcaat catgtctgca 120
tctccagggg agaaggtcac cataacctgc agtgccaggt caagtgtaag ttacatgcac
180 tggttccagc agaagccagg cacttctccc aaactctgga tttataggac
atccaacctg 240 gcttctggag tccctgctcg cttcagtggc agtggatctg
ggacctctta ctgtctcaca 300 atcagccgaa tggaggctga agatgctgcc
acttattact gccagcaaag gagtagtttc 360 ccactcacgt tcggctcggg
gacaaagttg gaaataaaac gtgagtggat cc 412 6 128 PRT Humanus 6 Met Asp
Leu Gln Val Gln Ile Ile Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15
Val Ile Met Ser Arg Gly Gln Ile Val Leu Thr Gln Ser Pro Ala Ile 20
25 30 Met Ser Ala Ser Pro Gly Glu Lys Val Thr Ile Thr Cys Ser Ala
Arg 35 40 45 Ser Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro
Gly Thr Ser 50 55 60 Pro Lys Leu Trp Ile Tyr Arg Thr Ser Asn Leu
Ala Ser Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Gly Ser Gly
Thr Ser Tyr Cys Leu Thr Ile 85 90 95 Ser Arg Met Glu Ala Glu Asp
Ala Ala Thr Tyr Tyr Cys Gln Gln Arg 100 105 110 Ser Ser Phe Pro Leu
Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 115 120 125 7 436 DNA
Humanus 7 aagcttgccg ccaccatggc ttgggtgtgg accttgctat tcctgatggc
agctgcccaa 60 agtatccaag cacagatcca gttggtgcag tctggacctg
agttgaagaa gcctggagag 120 acagtcaaga tctcctgcaa ggcttctgga
tatactttca caaactatgg aatgaactgg 180 gtgaagcagg ctccaggaaa
gggtttaaag tggatgggct ggataaacac cgacagtgga 240 gagtcaacat
atgctgaaga gttcaaggga cggtttgcct tctctttgga aacctctgcc 300
aacactgcct atttgcagat caacaacctc aacaatgagg acacggctac atatttctgt
360 gtgagagtcg gctacgatgc tttggactac tggggtcaag gaacctcagt
caccgtctcc 420 tcaggtgagt ggatcc 436 8 135 PRT Humanus 8 Met Ala
Trp Val Trp Thr Leu Leu Phe Leu Met Ala Ala Ala Gln Ser 1 5 10 15
Ile Gln Ala Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys 20
25 30 Pro Gly Glu Thr Val Glu Ile Ser Cys Lys Ala Ser Gly Tyr Thr
Phe 35 40 45 Thr Asn Tyr Gly Met Asn Trp Val Lys Gln Ala Pro Gly
Lys Gly Leu 50 55 60 Lys Trp Met Gly Trp Ile Asn Thr Asp Ser Gly
Glu Ser Thr Tyr Ala 65 70 75 80 Glu Glu Phe Lys Gly Arg Phe Ala Phe
Ser Leu Glu Thr Ser Ala Asn 85 90 95 Thr Ala Tyr Leu Gln Ile Asn
Asn Leu Asn Asn Glu Asp Thr Ala Thr 100 105 110 Tyr Phe Cys Val Arg
Val Gly Tyr Asp Ala Leu Asp Tyr Trp Gly Gln 115 120 125 Gly Thr Ser
Val Thr Val Ser 130 135 9 9 PRT Humanus 9 Thr Ile Asn Glu Glu Glu
Glu Lys Cys 1 5 10 14 PRT Humanus 10 Asn Ser Gly Pro Ser Met Arg
Lys Lys Asn Val Ser Ile Gly 1 5 10 11 5 PRT Humanus 11 Ile Pro Asp
His Gln 1 5 12 30 DNA artificial sequence PCR-primers used in the
cloning of the BAT heavy chain variable region gene 12 atggactcca
ggctcaattt agttttcctt 30 13 30 DNA artificial sequence PCR-primers
used in the cloning of the BAT heavy chain variable region gene 13
atggattggg tgtggacctt gctattcctg 30 14 21 DNA Artificial Sequence
PCR-primers used in the cloning of the BAT heavy chain variable
region gene 14 caagggatag acagatgggg c 21 15 30 DNA Artificial
Sequence PCR-primers used in the cloning of the BAT kappa light
chain variable region gene 15 atggagacag acacactcct gctatgggtg 30
16 30 DNA Artificial Sequence PCR-primers used in the cloning of
the BAT kappa light chain variable region gene 16 atggattttc
aggtgcagat tatcagcttc 30 17 27 DNA Artificial Sequence PCR-primers
used in the cloning of the BAT kappa light chain variable region
gene 17 atgaggtgcc ctgttcagtt cctgggg 27 18 28 DNA artificial
sequence PCR-primers used in the cloning of the BAT kappa light
chain variable region gene 18 atggaagccc cagctcagct tctcttcc 28 19
18 DNA Artificial Sequence PCR-primers used in the cloning of the
BAT kappa light chain variable region gene 19 ctagatgcat gctcgagc
18 20 20 DNA Artificial Sequence pCRII Forward Primer 20 actggatggt
gggaagatgg 20 21 21 DNA Artificial Sequence pCRII Reverse Primer 21
taccgagctc ggatccacta g 21 22 42 DNA artificial sequence C0225
primer 22 cccaagcttg ccgccaccat ggattttcag gtgcagatta tc 42 23 39
DNA artificial sequence C0224 Primer 23 cgcggatcca ctcacgtttt
atttccaact ttgtccccg 39 24 40 DNA artificial sequence B8815 Primer
24 ggatccactc acctgaggag acggtgactg aggttccttg 40 25 42 DNA
artificial sequence B8814 Primer 25 aagcttgccg ccaccatggc
ttgggtgtgg accttgctat tc 42 26 17 DNA artificial sequence Huy1
Primer 26 ttggaggagg gtgccag 17 27 28 DNA artificial sequence
HCMVi.3s primer 27 gtcaccgtcc ttgacacgcg tctcggga 28 28 18 DNA
artificial sequence FOR primer 28 tgtaaaacga cggccagt 18 29 18 DNA
artificial sequence REV primer 29 gaaacagcta tgaccatg 18 30 27 DNA
artificial sequence B6990 primer 30 cagcatatgt tgactctcca ctgtcgg
27 31 27 DNA artificial sequence B6991 primer 31 gtcaacatat
gctgaagagt tcaaggg 27 32 18 DNA artificial sequence B8809 primer 32
tgccaggtca agtgtaag 18 33 18 DNA artificial sequence B8810 primer
33 aagccaggtt ggatgtcc 18
* * * * *