U.S. patent application number 10/133934 was filed with the patent office on 2003-01-30 for method of increasing grain crop.
Invention is credited to Della-Cioppa, Guy R., Erwin, Robert L., Kumagai, Monto H., McGee, David R..
Application Number | 20030024008 10/133934 |
Document ID | / |
Family ID | 27358544 |
Filed Date | 2003-01-30 |
United States Patent
Application |
20030024008 |
Kind Code |
A1 |
Kumagai, Monto H. ; et
al. |
January 30, 2003 |
Method of increasing grain crop
Abstract
The present invention provides a method of compiling a plant
functional gene profile, a method of changing the phenotype or
biochemistry of a plant, a method of determining a change in
phenotype or biochemistry of a plant, a method of determining the
presence of a trait in plant, and a method of increasing grain
crop. The methods comprise expressing transiently a nucleic acid
sequence of a plant into a host plant to affect phenotypic or
biochemical changes in the host plant. A viral vector functional
genomic screen has been developed to identify nucleotide sequences
in transfected plants by systemically knocking out endogenous gene
expression in an antisense mechanism. Once the presence of a trait
in a plant is identified by phenotypic or biochemical changes in
the host plant, the nucleic acid insert in the cDNA clone or in the
vector that results in the changes is then sequenced. The present
invention exemplifies that genes encoding GTP binding proteins in
one plant can silence endogenous gene expression in a different
plant.
Inventors: |
Kumagai, Monto H.; (Davis,
CA) ; Della-Cioppa, Guy R.; (Vacaville, CA) ;
Erwin, Robert L.; (Vacaville, CA) ; McGee, David
R.; (Vacaville, CA) |
Correspondence
Address: |
HOWREY SIMON ARNOLD & WHITE, LLP
BOX 34
301 RAVENSWOOD AVE.
MENLO PARK
CA
94025
US
|
Family ID: |
27358544 |
Appl. No.: |
10/133934 |
Filed: |
April 24, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10133934 |
Apr 24, 2002 |
|
|
|
09359301 |
Jul 21, 1999 |
|
|
|
09359301 |
Jul 21, 1999 |
|
|
|
09232170 |
Jan 15, 1999 |
|
|
|
09232170 |
Jan 15, 1999 |
|
|
|
09008186 |
Jan 16, 1998 |
|
|
|
Current U.S.
Class: |
800/278 ;
800/320.2 |
Current CPC
Class: |
C12N 15/8261 20130101;
A01H 1/04 20130101; C12N 15/825 20130101; C07K 14/415 20130101;
C12N 15/8216 20130101; C12N 15/8242 20130101; Y10S 977/804
20130101; C12N 15/8243 20130101; C12N 15/1034 20130101; C12N
15/8203 20130101; C12Q 1/68 20130101; Y02A 40/146 20180101; C12N
15/8257 20130101 |
Class at
Publication: |
800/278 ;
800/320.2 |
International
Class: |
A01H 005/00 |
Claims
What is claimed is:
1. A method of increasing yield of a grain crop, said method
comprising the steps of: (a) preparing a library of cDNAs, genomic
DNAs, or a pool of RNAs of a donor plant; (b) constructing
recombinant viral nucleic acids obtained from a tobamo virus
comprising an unidentified nucleic acid insert obtained from said
library in an antisense orientation relative to said DNA or RNA
sequence of said donor plant; (c) infecting host grain crops with
said recombinant viral nucleic acids, and transiently expressing
said unidentified nucleic acids in the infected host grain crops;
and (d) selecting host grain crops that have stunted growth and
increased seed production.
2. The method according to claim 1, wherein said nucleic acid
insert comprises a GTP binding protein open reading frame.
3. The method according to claim 1, wherein said grain crop is
rice.
4. The method according to claim 1, wherein said tobamo virus is a
tobacco masaic virus.
Description
[0001] This application is a divisional application of U.S. patent
application 09/359,301, filed Jul. 21, 1999; which is a
Continuation-In-Part application of U.S. patent application No.
09/232,170, filed on Jan. 15, 1999, which is a Continuation-In-Part
application of U.S. patent application No. 09/008,186, filed on
Jan. 16, 1998. All the above applications are incorporated herein
by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to the field of
molecular biology and plant genetics. Specifically, the present
invention relates to a method for determining the presence of a
trait in a plant and a method of changing the phenotype or
biochemistry of a plant, by expressing transiently a nucleic acid
sequence in an antisense orientation in a host plant. This
invention is exemplified by a nucleic acid sequence comprising a
GTP binding protein open reading frame having an antisense
orientation.
BACKGROUND OF THE INVENTION
[0003] Great interest exists in launching genome projects in plants
comparable to the human genome project. Valuable and basic
agricultural plants, including by way of example but without
limitation, corn, soybeans and rice are targets for such projects
because the information obtained thereby may prove very beneficial
for increasing world food production and improving the quality and
value of agricultural products. The United States Congress is
considering launching a corn genome project. By helping to unravel
the genetics hidden in the corn genome, the project could aid in
understanding and combating common diseases of grain crops. It
could also provide a big boost for efforts to engineer plants to
improve grain yields and resist drought, pests, salt, and other
extreme environmental conditions. Such advances are critical for a
world population expected to double by 2050. Currently, there are
four species which provide 60% of all human food: wheat, rice,
corn, and potatoes, and the strategies for increasing the
productivity of these plants is dependent on rapid discovery of the
presence of a trait in these plants, and the function of unknown
gene sequences in these plants.
[0004] One strategy that has been proposed to assist in such
efforts is to create a database of expressed sequence tags (ESTs)
that can be used to identify expressed genes. Accumulation and
analysis of expressed sequence tags (ESTs) have become an important
component of genome research. EST data may be used to identify gene
products and thereby accelerate gene cloning. Various sequence
databases have been established in an effort to store and relate
the tremendous amount of sequence information being generated by
the ongoing sequencing efforts. Some have suggested sequencing
500,000 ESTs for corn and 100,000 ESTs each for rice, wheat, oats,
barley, and sorghum. Efforts at sequencing the genomes of plant
species will undoubtedly rely upon these computer databases to
share the sequence data as it is generated. Arabidopsis thaliana
may be an attractive target discovery of a trait and for gene
function discovery because a very large set of ESTs have already
been produced in this organism, and these sequences tag more than
50% of the expected Arabidopsis genes.
[0005] Potential use of the sequence information so generated is
enormous if gene function can be determined. It may become possible
to engineer commercial seeds for agricultural use to convey any
number of desirable traits to food and fiber crops and thereby
increase agricultural production and the world food supply.
Research and development of commercial seeds has so far focused
primarily on traditional plant breeding, however there has been
increased interest in biotechnology as it relates to plant
characteristics. Knowledge of the genomes involved and the function
of genes contained therein for both monocotyledonous and
dicotyledonous plants is essential to realize positive effects from
such technology.
[0006] The impact of genomic research in seeds is potentially far
reaching. For example, gene profiling in cotton can lead to an
understanding of the types of genes being expressed primarily in
fiber cells. The genes or promoters derived from these genes may be
important in genetic engineering of cotton fiber for increased
strength or for "built-in" fiber color. In plant breeding, gene
profiling coupled to physiological trait analysis can lead to the
identification of predictive markers that will be increasingly
important in marker assisted breeding programs. Mining the DNA
sequence of a particular crop for genes important for yield,
quality, health, appearance, color, taste, etc., are applications
of obvious importance for crop improvement.
[0007] Work has been conducted in the area of developing suitable
vectors for expressing foreign DNA and RNA in plant hosts.
Ahlquist, U.S. Pat. Nos. 4,885,248 and 5,173,410 describes
preliminary work done in devising transfer vectors which might be
useful in transferring foreign genetic material into a plant host
for the purpose of expression therein. All patent references cited
herein are hereby incorporated by reference. Additional aspects of
hybrid RNA viruses and RNA transformation vectors are described by
Ahlquist et al. in U.S. Pat. Nos. 5,466,788, 5,602,242, 5,627,060
and 5,500,360, all of which are incorporated herein by reference.
Donson et al., U.S. Pat. Nos. 5,316,931, 5,589,367 and 5,866,785,
incorporated herein by reference, demonstrate for the first time
plant viral vectors suitable for the systemic expression of foreign
genetic material in plants. Donson et al. describe plant viral
vectors having heterologous subgenomic promoters for the systemic
expression of foreign genes. Carrington et al., U.S. Pat. No.
5,491,076, describe particular potyvirus vectors also useful for
expressing foreign genes in plants. The expression vectors
described by Carrington et al. are characterized by utilizing the
unique ability of viral polyprotein proteases to cleave
heterologous proteins from viral polyproteins. These include
Potyviruses such as Tobacco Etch Virus. Additional suitable vectors
are described in U.S. Pat. No. 5,811,653 and U.S. patent
application Ser. No. 08/324,003, both of which are incorporated
herein by reference.
[0008] Construction of plant RNA viruses for the introduction and
expression of non-viral foreign genes in plants has also been
demonstrated by Brisson et al., Methods in Enzymology 118:659
(1986), Guzman et al., Communications in Molecular Biology: Viral
Vectors, Cold Spring Harbor Laboratory, pp. 172-189 (1988), Dawson
et al., Virology 172:285-292 (1989), Takamatsu et al., EMBO J.
6:307-311 (1987), French et al., Science 231:1294-1297 (1986), and
Takamatsu et al., FEBS Letters 269:73-76 (1990). However, these
viral vectors have not been shown capable of systemic spread in the
plant and expression of the non-viral foreign genes in the majority
of plant cells in the whole plant. Moreover, many of these viral
vectors have not proven stable for the maintenance of non-viral
foreign genes. However, the viral vectors described by Donson et
al., in U.S. Pat. Nos. 5,316,931, 5,589,367, and 5,866,785, Turpen
in U.S. Pat. No. 5,811,653, Carrington et al. in U.S. Pat. No.
5,491,076, and in co-pending U.S. patent application Ser. No.
08/324,003, have proven capable of infecting plant cells with
foreign genetic material and systemically spreading in the plant
and expressing the non-viral foreign genes contained therein in
plant cells locally or systemically. All patents, patent
applications, and references cited in the instant application are
hereby incorporated by reference.
[0009] With the recent advent of technology for cloning, genes can
be selectively turned off. One method is to create antisense RNA or
DNA molecules that bind specifically with a targeted gene's RNA
message, thereby interrupting the precise molecular mechanism that
expresses a gene as a protein. The antisense technology which
deactivates specific genes provides a different approach from a
classical genetics approach. Classical genetics usually studies the
random mutations of all genes in an organism and selects the
mutations responsible for specific characteristics. Antisense
approach starts with a cloned gene of interest and manipulates it
to elicit information about its function.
[0010] Post-transcriptional gene silencing (PTGS) in transgenic
plants is the manifestation of a mechanism that suppresses RNA
accumulation in a sequence-specific manner. There are three models
to account for the mechanism of PTGS: direct transcription of an
antisense RNA from the transgene, an antisense RNA produced in
response to over expression of the transgene, or an antisense RNA
produced in response to the production of an aberrant sense RNA
product of the transgene (Baulcombe, Plant Mol. Biol. 32:79-88
(1996)). The PTGS mechanism is typified by the highly specific
degradation of both the transgene mRNA and the target RNA, which
contains either the same or complementary nucleotide sequences
(Waterhouse et al Proc. Natl. Acad. Sci. USA 10: 13959-64 (1998)).
Antisense RNA has been used to down regulate gene expression in
transgenic and transfected plants. The effectiveness of antisense
on the inhibition of eukaryotic gene expression was first
demonstrated by Izant et al. (Cell 36(4):1007-1015 (1984)). Since
then, the down-regulation of different genes from transgenic plants
has been reported. Kumagai et al (Proc. Natl. Acad. Sci. USA
92:1679 (1995)) report that gene expression in transfected
Nicotiana benthamiana was cytoplasmic inhibited by viral delivery
of a RNA of a known sequence derived from cDNA encoding tomato
phytoene desaturase in a positive sense or an antisense
orientation. The host plant, Nicotiana benthamiana, and the donor
plant, tomato (Lycopersicon esculentum), belong to the same family.
There is also evidence that inhibition of endogenous genes occurs
in transgenic plants containing sense RNA (Van der Krol et al.,
Plant Cell 2(4):291-299 (1990), Napoli et al., Plant Cell 2:279-289
(1990) and Fray et al., Plant Mol. Biol. 22:589-602 (1993)).
[0011] The antisense technology can be used to develop a functional
genomic screening of a plant of interest. The antisense technology
is applied in this invention to provide a method of discovering the
presence of a trait in a plant and to determine the function and
sequence of a nucleic acid of a plant by expressing the nucleic
acid sequence that has not been identified in a different host
plant. GTP-binding proteins exemplify this invention. In eukaryotic
cells, GTP-binding proteins function in a variety of cellular
processes, including signal transduction, cytoskeletal
organization, and protein transport. The heterotrimeric and
monomeric GTP-binding proteins that may be involved in secretion
and intracellular transport are divided into two structural
classes: the rab and the ARF families. The ARFs are highly
conserved and found in all eukaryotic cells including human, yeast,
plants, and slime mold. The cDNAs encoding GTP binding proteins
have been isolated from a variety of plants including rice, barley,
corn, tobacco, and A. thaliana. For example, Verwoert et al. (Plant
Molecular Biol. 27:629-633 (1995)) report the isolation of a Zea
mays cDNA clone encoding a GTP-binding protein of the ARF family by
direct genetic selection in an E. coli fabD mutant with a maize
cDNA expression library. Regad et al. (FEBS 2:133-136 (1993))
isolated a cDNA clone encoding the ARF from a cDNA library of
Arabidopsis thaliana cultured cells by randomly selecting and
sequencing cDNA clones. Dallmann et al (Plant Molecular Biol.
19:847-857 (1992)) isolated two cDNAs encoding small GTP-binding
proteins from leaf cDNA libraries using a PCR approach. Dallmann et
al. prepared leaf cDNAs and use them as templates in PCR
amplifications with degenerated oligonucleotides corresponding to
the highly conserved motifs, found in members of the ras
superfamily, as primers. The present invention provides advantages
over the above isolation methods in that it only sequences clones
that have a function and does not randomly sequence clones. Haizel
et al., Plant J., 11:92-103 (1997)) isolated cDNA and genomic
clones encoding Ran-like small GTP binding proteins from
Arabidopsis cDNA and genomic libraries using a full-length tobacco
Nt Ran1 cDNA as a probe.
[0012] The present invention provides a method for discovering the
presence of a trait in a plant by expressing a nucleic acid
sequence in an antisense orientation in a host plant. Once the
presence of a trait is identified by phenotypic changes, the
nucleic acid insert in the cDNA clone or in the vector is then
sequenced. The present method provides a rapid method for
determining the presence of a trait and identifying a nucleic acid
sequence and its function in a plant by screening a transfected
host plant for its change of function.
SUMMARY OF THE INVENTION
[0013] The present invention is directed to a method of making a
functional gene profile in a host plant by transiently expressing a
nucleic acid sequence library in a host plant, determining the
phenotypic or biochemical changes in the host plant, identifying a
trait associated with the change, identifying the donor gene
associated with the trait, and identifying the homologous host
gene, if any. The invention is also directed to a method of
changing the phenotype or biochemistry of a plant, a method of
determining a change in phenotype or biochemistry in a plant, and a
method of determining the presence of a trait in a plant. The
method comprising the steps of expressing transiently an
unidentified RNA or DNA sequence of a donor plant in an antisense
orientation in a host plant, identifying changes in the host plant,
and correlating the expression with the phenotypic changes.
Alternatively, the method comprises the steps of expressing
transiently a nucleic acid sequence of a donor plant in an
antisense orientation in a host plant, identifying changes in the
host plant, and correlating the expression with the phenotypic
changes, wherein the donor plant and the host plant belong to
different genus, family, order, class, subdivision, or division.
The present invention is also directed to a method of determining
the function of a nucleic acid sequence, including a gene, in a
donor plant, by transfecting the nucleic acid sequence into a host
plant in a manner so as to affect phenotypic changes in the host
plant. In one embodiment, recombinant viral nucleic acids are
prepared to include the nucleic acid insert of a donor. The
recombinant viral nucleic acids infect a host plant and produce
antisense RNAs in the cytoplasm which result in reduced expression
of endogenous cellular genes in the host plant. Once the presence
of a trait is identified by phenotypic changes, the function of the
nucleic acid is determined. The nucleic acid insert in a cDNA clone
or in a vector is then sequenced. The nucleic acid sequence is
determined by a standard sequence analysis. This invention is
exemplified by a nucleic acid sequence comprising a GTP binding
protein open reading frame having an antisense orientation.
[0014] The present invention is also directed to a method of
increasing yield of a grain crop. The method comprises expressing
transiently a nucleic acid sequence of a donor plant in an
antisense orientation in a grain crop, wherein said expressing
results in stunted growth and increased seed production of the
grain crop. A preferred method comprises the steps of cloning the
nucleic acid sequence into a plant viral vector and infecting the
grain crop with a recombinant viral nucleic acid comprising said
nucleic acid sequence.
[0015] One aspect of the invention is a method of identifying and
determining a nucleic acid sequence in a plant of interest, whose
function is to silence endogenous genes in a host plant, by
introducing the nucleic acid into the host plant by way of a viral
nucleic acid such as a plant viral nucleic acid suitable to produce
expression of the nucleic acid in the transfected host. This method
utilizes the principle of post-transcription gene silencing of the
endogenous host gene homolog, for example, antisense RNAs.
Particularly, this silencing function is useful for silencing a
multigene family frequently found in plants.
[0016] Another aspect of the invention is to discover genes having
the same function in different plants. The method starts with a
library of cDNAs, genomic DNAs, or a pool of RNAs of a first plant.
Then, a recombinant viral nucleic acid comprising a nucleic acid
insert derived from the library is prepared and is used to infect a
different host plant. The infected host plant is inspected for
phenotypic changes. The recombinant viral nucleic acid that results
in phenotypic changes in the host plant is identified and the
sequence of the nucleic acid insert is determined by a standard
method. Such nucleic acid sequence in the first plant has
substantial sequence homology as that in the host plant: the
nucleic acid sequences are conserved between the two plants. This
invention provides a rapid means for elucidating the function and
sequence of nucleic acids of interest; such rapidly expanding
information can be subsequently utilized in the field of
genomics.
[0017] In one embodiment, a nucleic acid is introduced into a plant
host wherein the plant host may be a monocotyledonous or
dicotyledonous plant, plant tissue or plant cell. Preferably, the
nucleic acid is introduced by way of a recombinant plant viral
nucleic acid. Preferred recombinant plant viral nucleic acids
useful in the present invention comprise a native plant viral
subgenomic promoter, a plant viral coat protein coding sequence,
and at least one non-native nucleic acid sequence. Some viral
vectors used in accordance with the present invention may be
encapsidated by the coat proteins encoded by the recombinant plant
virus. Recombinant plant viral nucleic acids or recombinant plant
viruses are used to infect a plant host. The recombinant plant
viral nucleic acid is capable of replication in the host, localized
or systemic spread in the host, and transcription or expression of
the non-native nucleic acid in the host to produce a phenotypic or
biochemical change. Any suitable vector constructs useful to
produce localized or systemic expression of nucleic acids in host
plants are within the scope of the present invention.
BRIEF DESCRIPTION OF THE FIGURES
[0018] FIG. 1 depicts the vector TT01/PDS-.
[0019] FIG. 2 depicts the plasmid pBS #712.
[0020] FIG. 3 depicts the plasmid KS+TVCVK #23.
[0021] FIG. 4 depicts the plasmid pBS #735.
[0022] FIG. 5 depicts the plasmid pBS #740.
[0023] FIG. 6 depicts the plasmid pBS #740 AT #120 (ATCC No.:
PTA-325, deposited Jul. 12, 1999, American Type Culture Collection,
10801 University Blvd., Manassas, Va. 20110).
[0024] FIG. 7 shows the nucleotide sequence comparison of A.
thaliana 740 AT #120 and A. thaliana est AA042085
[0025] FIG. 8 shows the nucleotide sequence alignment of 740 AT
#120 to rice D17760 (Oryza sativa) ADP-ribosylation factor.
[0026] FIG. 9 shows the KS+Nb ARF #3 plasmid (ATCC No.: PTA-324,
deposited Jul. 12, 1999, American Type Culture Collection, 10801
University Blvd., Manassas, Va. 20110) map.
[0027] FIG. 10 shows the nucleotide sequence comparison of A.
thaliana 740 AT #120 and N. benthamiana KS+Nb ARF#3.
[0028] FIG. 11 shows the plasmid pBS #740 AT #88 (ATCC No.:
PTA-331, deposited Jul. 12, 1999, American Type Culture Collection,
10801 University Blvd., Manassas, Va. 20110).
[0029] FIG. 12 shows the plasmid pBS #377 (ATCC No.: PTA-334,
deposited Jul. 12, 1999, American Type Culture Collection, 10801
University Blvd., Manassas, Va. 20110).
[0030] FIG. 13 shows the nucleotide sequence of 740 AT #377.
[0031] FIG. 14 shows the plasmid pBS #2483 (ATCC No.: PTA-328,
deposited Jul. 12, 1999, American Type Culture Collection, 10801
University Blvd., Manassas, Va. 20110).
[0032] FIG. 15 shows the nucleotide sequence of 740 AT #2483.
DETAILED DESCRIPTION OF THE INVENTION
[0033] The present invention is directed to a method of changing
the phenotype or biochemistry of a plant, a method of determining a
change in phenotype or biochemistry in a plant, a method of
determining the presence of a trait in a plant, and a method of
determining the function of a nucleic acid sequence. The methods
comprise the steps of expressing transiently a nucleic acid
sequence in an antisense orientation in a host organism such as a
plant, a plant tissue or a plant cell, identifying changes in the
host organism and correlating the expression and the changes. The
presence of a trait is identified either in the infected host plant
or in an uninfected host plant. The nucleic acid sequence, which is
expressed in the host plant, does not need to be identified,
isolated, or characterized prior to the expression. The donor plant
and the host plant can belong to different genus, family, order,
class, subdivision, or division. In one preferred embodiment, the
method comprising the steps of (a) preparing a library of cDNAs,
genomic DNAs, or a pool of RNAs of a donor plant, (b) constructing
recombinant viral nucleic acids comprising a nucleic acid insert
derived from said library, (c) infecting each said host plant with
one of said recombinant viral nucleic acids, (d) growing said
infected host plant, and (e) determining changes in said host
plant.
[0034] The invention is directed to a method of compiling a plant
antisense functional gene profile. The method comprises (a)
preparing a vector library of DNA or RNA sequences from a donor
plant, each sequence being in an antisense orientation; (b)
infecting a plant host with a vector; (c) transiently expressing
the donor plant DNA or RNA sequence in the growing plant host; (d)
determining one or more phenotypic or biochemical changes in the
plant host, if any; (e) identifying an associated trait where a
phenotypic or biochemical change occurs; (f) identifying a donor
plant gene associated with the trait; (g) identifying a plant host
gene, if any, associated with the trait; and (h) repeating steps
(b)-(g) until an antisense functional gene profile of the plant
host and/or of the donor plant is compiled.
[0035] The invention is also directed to a method of compiling a
plant functional gene profile. The method comprises (a) preparing a
vector library of DNA or RNA sequences from a donor plant, each
sequence being in either an antisense or a positive orientation;
(b) infecting a plant host with a vector; (c) transiently
expressing the donor plant DNA or RNA sequence in the growing plant
host; (d) determining one or more phenotypic or biochemical changes
in the plant host, if any; (e) identifying an associated trait
where a phenotypic or biochemical change occurs; (f) identifying a
donor plant gene associated with the trait; (g) identifying a plant
host gene, if any, associated with the trait; and (h) repeating
steps (b)-(g) until a functional gene profile of the plant host
and/or of the donor plant is compiled. A detailed discussion of
positive sense expression of nucleic acids is presented in a
co-pending and co-owned U.S. patent application No. 09/359,305
(Kumagai et al., Attorney Docket No. 08010137US05, filed Jul. 1,
1999), the entire disclosure of which is incorporated herein by
reference.
[0036] The present method has the advantages that the nucleic acid
sequence does not need to be known, identified, isolated, or
characterized prior to infecting a host plant with a recombinant
viral nucleic acid comprising the nucleic acid sequence. Once
changes in the host plant is observed, the nucleic acid sequence
can be determined by further identifying the recombinant viral
nucleic acid that results in changes in the host, and analyzing the
sequence of the nucleic acid insert in the recombinant viral
nucleic acid that results in changes in the host.
[0037] The present invention provides a method of infecting a host
plant by a recombinant plant viral nucleic acid which contains one
or more non-native nucleic acid sequences, or by a recombinant
plant virus containing a recombinant plant viral nucleic acid. The
non-native nucleic acids are subsequently transcribed or expressed
in the infected host plant. The products of the non-native nucleic
acid sequences result in changing phenotypic traits in the host
plant, affecting biochemical pathways within the plant, or
affecting endogenous gene expression within the plant.
[0038] In one embodiment, a nucleic acid is introduced into a plant
host by way of a recombinant viral nucleic acid. Such recombinant
viral nucleic acids are stable for the maintenance and
transcription or expression of non-native nucleic acid sequences
and are capable of systemically transcribing or expressing such
non-native sequences in the plant host. Preferred recombinant plant
viral nucleic acids useful in the present invention comprise a
native plant viral subgenomic promoter, a plant viral coat protein
coding sequence, and at least one non-native nucleic acid
sequence.
[0039] In a second embodiment, plant viral nucleic acid sequences
are characterized by the deletion of a native coat protein coding
sequence. The plant viral nucleic acid sequence comprises a
non-native plant viral coat protein coding sequence and a
non-native promoter, preferably the subgenomic promoter of the
non-native coat protein coding sequence. Such plant viral nucleic
acid sequence is capable of expressing in a plant host, packaging
the recombinant plant viral nucleic acid, and ensuring a systemic
infection of the host by the recombinant plant viral nucleic acid.
The recombinant plant viral nucleic acid may contain one or more
additional native or non-native subgenomic promoters. Each
non-native subgenomic promoter is capable of transcribing or
expressing adjacent genes or nucleic acid sequences in the plant
host and incapable of recombination with each other and with native
subgenomic promoters. One or more non-native nucleic acids may be
inserted adjacent to the native plant viral subgenomic promoter or
the native and non-native plant viral subgenomic promoters if more
than one nucleic acid sequence is included. Moreover, two or more
heterologous non-native subgenomic promoters may be used. The
non-native nucleic acid sequences may be transcribed or expressed
in the host plant under the control of the subgenomic promoter to
produce the products of the nucleic acids of interest.
[0040] In a third embodiment, plant recombinant viral nucleic acids
comprise a native coat protein coding sequence instead of a
non-native coat protein coding sequence, placed adjacent one of the
non-native coat protein subgenomic promoters.
[0041] In a fourth embodiment, plant recombinant viral nucleic
acids comprise a native coat protein gene adjacent its native
subgenomic promoter, one or more non-native subgenomic promoters,
and at least one non-native nucleic acid sequence. The native plant
viral subgenomic promoter initiates transcription of the plant
viral coat protein sequence. The non-native subgenomic promoters
are capable of transcribing or expressing adjacent genes in a plant
host and are incapable of recombination with each other and with
native subgenomic promoters. Non-native nucleic acid sequences may
be inserted adjacent the non-native subgenomic plant viral
promoters such that the sequences are transcribed or expressed in
the host plant under control of the subgenomic promoters to produce
a product of the non-native nucleic acid. Alternatively, the native
coat protein coding sequence may be replaced by a non-native coat
protein coding sequence.
[0042] The viral vectors used in accordance with the present
invention may be encapsidated by the coat proteins encoded by the
recombinant plant virus. The recombinant plant viral nucleic acid
or recombinant plant virus is used to infect a host plant. The
recombinant plant viral nucleic acid is capable of replication in
the host, localized or systemic spread in the host, and
transcription or expression of the non-native nucleic acid in the
host to affect a phenotypic or biochemical change in the host.
[0043] In one embodiment, recombinant plant viruses are used which
encode for the expression of a fusion between a plant viral coat
protein and the amino acid product of the nucleic acid of interest.
Such a recombinant plant virus provides for high level expression
of a nucleic acid of interest. The location or locations where the
viral coat protein is joined to the amino acid product of the
nucleic acid of interest may be referred to as the fusion joint. A
given product of such a construct may have one or more fusion
joints. The fusion joint may be located at the carboxyl terminus of
the viral coat protein or the fusion joint may be located at the
amino terminus of the coat protein portion of the construct. In
instances where the nucleic acid of interest is located internal
with respect to the 5' and 3' residues of the nucleic acid sequence
encoding for the viral coat protein, there are two fusion joints.
That is, the nucleic acid of interest may be located 5', 3',
upstream, downstream or within the coat protein. In some
embodiments of such recombinant plant viruses, a "leaky" start or
stop codon may occur at a fusion joint which sometimes does not
result in translational termination. A more detailed description of
some recombinant plant viruses according to this embodiment of the
invention may be found in co-pending U.S. patent application Ser.
No. 08/324,003 the disclosure of which is incorporated herein by
reference.
[0044] The present invention is not intended to be limited to any
particular viral constructs, but rather to include all operable
constructs. Specifically, those skilled in the art may choose to
transfer DNA or RNA of any size up to and including an entire
genome in a plant into a host organism in order to determine the
presence of a trait in the plant. Those skilled in the art will
understand that the recited embodiments are representative only.
All operable constructs useful to produce localized or systemic
expression of nucleic acids in a plant are within the scope of the
present invention.
[0045] The chimeric genes and vectors and recombinant plant viral
nucleic acids used in this invention are constructed using
techniques well known in the art. Suitable techniques have been
described in Sambrook et al. (2nd ed.), Cold Spring Harbor
Laboratory, Cold Spring Harbor (1982, 1989); Methods in Enzymol.
(Vols. 68, 100, 101, 118, and 152-155) (1979, 1983, 1986 and 1987);
and DNA Cloning, D. M. Clover, Ed., IRL Press, Oxford (1985).
Medium compositions have been described by Miller, J., Experiments
in Molecular Genetics, Cold Spring Harbor Laboratory, New York
(1972), as well as the references previously identified, all of
which are incorporated herein by reference. DNA manipulations and
enzyme treatments are carried out in accordance with manufacturers'
recommended procedures in making such constructs.
[0046] The first step in producing recombinant plant viral nucleic
acids is to modify the nucleotide sequences of the plant viral
nucleotide sequence by known conventional techniques such that one
or more non-native subgenomic promoters are inserted into the plant
viral nucleic acid without destroying the biological function of
the plant viral nucleic acid. The subgenomic promoters are capable
of transcribing or expressing adjacent nucleic acid sequences in a
plant host infected by the recombination plant viral nucleic acid
or recombinant plant virus. The native coat protein coding sequence
may be deleted in some embodiments, placed under the control of a
non-native subgenomic promoter in other embodiments, or retained in
a further embodiment. If it is deleted or otherwise inactivated, a
non-native coat protein gene is inserted under control of one of
the non-native subgenomic promoters, or optionally under control of
the native coat protein gene subgenomic promoter. The non-native
coat protein is capable of encapsidating the recombinant plant
viral nucleic acid to produce a recombinant plant virus. Thus, the
recombinant plant viral nucleic acid contains a coat protein coding
sequence, which may be native or a nonnative coat protein coding
sequence, under control of one of the native or non-native
subgenomic promoters. The coat protein is involved in the systemic
infection of the plant host.
[0047] Viruses suitable for use according to the methods of the
present invention include viruses from the tobamovirus group such
as Tobacco Mosaic virus (TMV), Ribgrass Mosaic Virus (RGM), Cowpea
Mosaic virus (CMV), Alfalfa Mosaic virus (AMV), Cucumber Green
Mottle Mosaic virus watermelon strain (CGMMV-W) and Oat Mosaic
virus (OMV) and viruses from the brome mosaic virus group such as
Brome Mosaic virus (BMV), broad bean mottle virus and cowpea
chlorotic mottle virus. Additional suitable viruses include Rice
Necrosis virus (RNV), and geminiviruses such as Tomato Golden
Mosaic virus (TGMV), Cassava Latent virus (CLV) and Maize Streak
virus (MSV). Each of these groups of suitable viruses is
characterized below. However, the invention should not be construed
as limited to using these particular viruses, but rather the
present invention is contemplated to include all plant viruses at a
minimum.
TOBAMOVIRUS GROUP
[0048] The tobacco mosaic virus (TMV) is of particular interest to
the instant invention because of its ability to express genes at
high levels in plants. TMV is a member of the tobamovirus group.
The TMV virion is a tubular filament, and comprises coat protein
sub-units arranged in a single right-handed helix with the
single-stranded RNA intercalated between the turns of the helix.
TMV infects tobacco as well as other plants. TMV virions are 300
nm.times.18 nm tubes with a 4 nm-diameter hollow canal, and consist
of 2140 units of a single structural protein helically wound around
a single RNA molecule. The genome is a 6395 base plus-sense RNA.
The 5'-end is capped and the 3'-end contains a series of
pseudoknots and a tRNA-like structure that will specifically accept
histidine. The genomic RNA functions as mRNA for the production of
proteins involved in viral replication: a 126-kDa protein that
initiates 68 nucleotides from the 5'-terminus, and a 183-kDa
protein synthesized by readthrough of an amber termination codon
approximately 10% of the time. Only the 183-kDa and 126-kDa viral
proteins are required for the TMV replication in trans. (Ogawa et
al., Virology 185:580-584 (1991)). Additional proteins are
translated from subgenomic size mRNA produced during replication
(Dawson, Adv. Virus Res., 38:307-342 (1990)). The 30-kDa protein is
required for cell-to-cell movement; the 17.5-kDa capsid protein is
the single viral structural protein. The function of the predicted
54-kDa protein is unknown.
[0049] TMV assembly apparently occurs in plant cell cytoplasm,
although it has been suggested that some TMV assembly may occur in
chloroplasts since transcripts of ctDNA have been detected in
purified TMV virions. Initiation of TMV assembly occurs by
interaction between 10 ring-shaped aggregates ("discs") of coat
protein (each disc consisting of two layers of 17 subunits) and a
unique internal nucleation site in the RNA; a hairpin region about
900 nucleotides from the 3'-end in the common strain of TMV. Any
RNA, including subgenomic RNAs containing this site, may be
packaged into virions. The discs apparently assume a helical form
on interaction with the RNA, and assembly (elongation) then
proceeds in both directions (but much more rapidly in the 3'- to
5'- direction from the nucleation site).
[0050] Another member of the Tobamoviruses, the Cucumber Green
Mottle Mosaic virus watermelon strain (CGMMV-W) is related to the
cucumber virus. Nozu et al., Virology 45:577 (1971). The coat
protein of CGMMV-W interacts with RNA of both TMV and CGMMV to
assemble viral particles in vitro. Kurisu et al., Virology 70:214
(1976).
[0051] Several strains of the tobamovirus group are divided into
two subgroups, on the basis of the location of the assembly of
origin. Subgroup I, which includes the vulgare, OM, and tomato
strain, has an origin of assembly about 800-1000 nucleotides from
the 3'-end of the RNA genome, and outside the coat protein cistron.
Lebeurier et al., Proc. Natl. Acad. Sci. USA 74:149 (1977); and
Fukuda et al., Virology 101:493 (1980). Subgroup II, which includes
CGMMV-W and cornpea strain (Cc) has an origin of assembly about
300-500 nucleotides from the 3'-end of the RNA genome and within
the coat-protein cistron. The coat protein cistron of CGMMV-W is
located at nucleotides 176-661 from the 3'-end. The 3' noncoding
region is 175 nucleotides long. The origin of assembly is
positioned within the coat protein cistron. Meshi et al., Virology
127:54 (1983).
BROME MOSAIC VIRUS GROUP
[0052] Brome Mosaic virus (BMV) is a member of a group of
tripartite, single-stranded, RNA-containing plant viruses commonly
referred to as the bromoviruses. Each member of the bromoviruses
infects a narrow range of plants. Mechanical transmission of
bromoviruses occurs readily, and some members are transmitted by
beetles. In addition to BV, other bromoviruses include broad bean
mottle virus and cowpea chlorotic mottle virus.
[0053] Typically, a bromovirus virion is icosahedral, with a
diameter of about 26 .mu.m, containing a single species of coat
protein. The bromovirus genome has three molecules of linear,
positive-sense, single-stranded RNA, and the coat protein mRNA is
also encapsidating. The RNAs each have a capped 5'-end, and a
tRNA-like structure (which accepts tyrosine) at the 3'-end. Virus
assembly occurs in the cytoplasm. The complete nucleotide sequence
of BMV has been identified and characterized as described by
Ahlquist et al., J. Mol. Biol. 153:23 (1981).
RICE NECROSIS VIRUS
[0054] Rice Necrosis virus is a member of the Potato Virus Y Group
or Potyviruses. The Rice Necrosis virion is a flexuous filament
comprising one type of coat protein (molecular weight about 32,000
to about 36,000) and one molecule of linear positive-sense
single-stranded RNA.
[0055] The Rice Necrosis virus is transmitted by Polymyxa oraminis
(a eukaryotic intracellular parasite found in plants, algae and
fungi).
GEMINIVIRUSES
[0056] Geminiviruses are a group of small, single-stranded
DNA-containing plant viruses with virions of unique morphology.
Each virion consists of a pair of isometric particles (incomplete
icosahedral), composed of a single type of protein (with a
molecular weight of about 2.7-3.4.times.10.sup.4). Each geminivirus
virion contains one molecule of circular, positive-sense,
single-stranded DNA. In some geminiviruses (i.e., Cassava latent
virus and bean golden mosaic virus) the genome appears to be
bipartite, containing two single-stranded DNA molecules.
POTYVIRUSES
[0057] Potyviruses are a group of plant viruses which produce
polyprotein. A particularly preferred potyvirus is tobacco etch
virus (TEV). TEV is a well characterized potyvirus and contains a
positive-strand RNA genome of 9.5 kilobases encoding for a single,
large polyprotein that is processed by three virus-specific
proteinases. The nuclear inclusion protein "a" proteinase is
involved in the maturation of several replication-associated
proteins and capsid protein. The helper component-proteinase
(HC-Pro) and 35-kDa proteinase both catalyze cleavage only at their
respective C-termini. The proteolytic domain in each of these
proteins is located near the C-terminus. The 35-kDa proteinase and
HC-Pro derive from the N-terminal region of the TEV
polyprotein.
[0058] The nucleic acid of any suitable plant virus can be utilized
to prepare a recombinant plant viral nucleic acid for use in the
present invention, and the foregoing are only exemplary of such
suitable plant viruses. The nucleotide sequence of the plant virus
can be modified, using conventional techniques, by insertion of one
or more subgenomic promoters into the plant viral nucleic acid. The
subgenomic promoters are capable of functioning in a specific host
plant. For example, if the host is a tobacco plant, TMV, TEV, or
other viruses containing suitable subgenomic promoter may be
utilized. The inserted subgenomic promoters should be compatible
with the viral nucleic acid and capable of directing transcription
or expression of adjacent nucleic acid sequences in tobacco.
[0059] The native or non-native coat protein gene is included in
the recombinant plant viral nucleic acid. When non-native nucleic
acid is utilized, it may be positioned adjacent its natural
subgenomic promoter or adjacent one of the other available
subgenomic promoters. The non-native coat protein, as is the case
for the native coat protein, is capable of encapsidating the
recombinant plant viral nucleic acid and providing for systemic
spread of the recombinant plant viral nucleic acid in a host plant.
The coat protein is selected to provide a systemic infection in the
plant host of interest. For example, the TMV-O coat protein
provides systemic infection in N. benthamiana, whereas TMV-U1 coat
protein provides systemic infection in N. tabacum.
[0060] The recombinant plant viral nucleic acid is prepared by
cloning a viral nucleic acid. If the viral nucleic acid is DNA, it
can be cloned directly into a suitable vector using conventional
techniques. One technique is to attach an origin of replication to
the viral DNA which is compatible with the cell to be transfected.
If the viral nucleic acid is RNA, a full-length DNA copy of the
viral genome is first prepared by well-known procedures. For
example, the viral RNA is transcribed into DNA using reverse
transcriptase to produce subgenomic DNA pieces, and a
double-stranded DNA made using DNA polymerases. The cDNA is then
cloned into appropriate vectors and cloned into a cell to be
transfected. Alternatively, the cDNA is ligated into the vector and
is directly transcribed into infectious RNA in vitro, the
infectious RNA is then inoculated onto the plant host. The cDNA
pieces are mapped and combined in a proper sequence to produce a
full-length DNA copy of the viral RNA genome, if necessary. DNA
sequences for the subgenomic promoters, with or without a coat
protein gene, are then inserted into the nucleic acid at
non-essential sites, according to the particular embodiment of the
invention utilized. Non-essential sites are those that do not
affect the biological properties of the plant viral nucleic acids.
Since the RNA genome is the infective agent, the cDNA is positioned
adjacent a suitable promoter so that the RNA is produced in the
production cell. The RNA can be capped by the addition of a
nucleotide in a 5'-5' linkage using conventional techniques (Dawson
et al., Proc. Natl. Acad. Sci. USA, 83:1832 (1986). One or more
nucleotides may be added between the transcription start site of
the promoter and the start of the cDNA of a viral nucleic acid to
construct an infectious viral vector. In a preferred embodiment of
the present invention, the inserted nucleotide sequence contains a
G at the 5'-end. In one embodiment, the inserted nucleotide
sequence is GNN, GTN, or their multiples, (GNN).sub.x or
(GTN).sub.x. The capped RNA can be packaged in vitro with added
coat protein from TMV to make assembled virions.
[0061] These assembled virions can then be used to inoculate plants
or plant tissues.
[0062] Alternatively, an uncapped RNA may be employed in the
embodiments of the present invention. Contrary to the practiced art
in scientific literature and in an issued patent (Ahlquist et al.,
U.S. Pat. No. 5,466,788), uncapped transcripts for virus expression
vectors are infective on both plants and in plant cells. Capping is
not a prerequisite for establishing an infection of a virus
expression vector in plants, although capping increases the
efficiency of infection.
[0063] One feature of the recombinant plant viral nucleic acids
useful in the present invention is that they further comprise one
or more non-native nucleic acid sequences capable of being
transcribed in a host plant. These nucleic acid sequences may be
native nucleic acid sequences that occur in a host plant.
Preferably, these nucleic acid sequences are non-native nucleic
acid sequences that do not normally occur in a host plant. These
nucleic acid sequences are derived from a donor plant, which is
preferably genetically different from the host plant. The donor
plant and the host plant may be genetically remote or unrelated:
they may belong to different genus, family, order, class,
subdivision, or division. Donor plants and host plants include
plants of commercial interest, such as food crops, seed crops, oil
crops, ornamental crops and forestry crops. For example, wheat,
rice, corn, potatoes, barley, tobaccos, soybean canola, maize,
oilseed rape, Arabidopsis, Nicotiana can be selected as a donor
plant or a host plant. Host plants include those capable of being
infected by an infectious RNA or a virus containing a recombinant
viral nucleic acid. Preferred host plants include Nicotiana,
preferably, Nicotiana benthamiana, or Nicotiana cleavlandii. Plant
are grown from seed in a mixture of "Peat-Lite Mix.TM. (Speedling,
Inc. Sun City, Fla.) and Nutricote.TM. controlled release
fertilizer 14-14-14 (Chiss-Asahi Fertilizer Co., Tokyo, Japan).
Plants are grown in a controlled environment provided 16 hours of
light and 8 hours of darkness. Sylvania "Gro-Lux/Aquarium" wide
spectrum 40 watt flourescent grow lights. (Osram Sylvania Products,
Inc. Danvers, Mass.) are used. Temperatures are kept at around
80.degree. F. during light hours and 70.degree. F. during dark
hours. Humidity is between 60 and 85%.
[0064] To prepare a DNA insert comprising a nucleic acid sequence
of a donor plant, the first step is to construct a library of
cDNAs, genomic DNAs, or a pool of RNAs of the plant of interest.
Full-length cDNAs can be obtained from public or private
repositories, for example, cDNA library of Arabidopsis thaliana can
be obtained from the Arabidopsis Biological Resource Center.
Alternatively, cDNA library can be prepared from a field sample by
methods known to a person of ordinary skill, for example, isolating
mRNAs and transcribing mRNAs into cDNAs by reverse transcriptase
(see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual
(2nd ed.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989), or
Current Protocols in Molecular Biology, F. Ausubel et al., ed.
Greene Publishing and Wiley-Interscience, New York (1987)). Genomic
DNAs represented in BAC (bacterial artificial chromosome), YAC
(yeast artificial chromosome), or TAC (transformation-competent
artificial chromosome, Liu et al., Proc. Natl. Acad. Sci. USA,
96:6535-6540 (1999)) libraries can be obtained from public or
private repositories, for example, the Arabidopsis Biological
Resource Center. The BAC/YAC/TAC DNAs or cDNAs can be mechanically
size-fractionated or digested by an enzyme to smaller fragments.
The fragments are ligated to adapters with cohesive ends, and
shotgun-cloned into recombinant viral nucleic acid vectors.
Alternatively, the fragments can be blunt-end ligated into
recombinant viral nucleic acid vectors. Recombinant plant viral
nucleic acids containing a nucleic acid sequence derived from the
cDNA library or genomic DNA library is then constructed using
conventional techniques. The recombinant viral nucleic acid vectors
produced comprise the nucleic acid insert derived from the donor
plant. The nucleic acid sequence of the recombinant viral nucleic
acid is transcribed as RNA in a host plant; the RNA is capable of
regulating the expression of a phenotypic trait by an antisense
mechanism. The nucleic acid sequence may also code for the
expression of more than one phenotypic trait. Sequences from wheat,
rice, corn, potato, barley, tobacco, soybean, canola, maize,
oilseed rape, Arabidopsis, and other crop species may be used to
assemble the DNA libraries. This method may thus be used to search
for useful dominant gene phenotypes from DNA libraries through the
gene expression.
[0065] A further alternative when creating the recombinant plant
viral nucleic acid is to prepare more than one nucleic acid (i.e.,
to prepare the nucleic acids necessary for a multipartite viral
vector construct). In this case, each nucleic acid would require
its own origin of assembly. Each nucleic acid could be prepared to
contain a subgenomic promoter and a non-native nucleic acid.
[0066] In some embodiments of the instant invention, methods to
increase the representation of gene sequences in virus expression
libraries may also be achieved by bypassing the genetic bottleneck
of propagation in bacterial cells. For example, cell-free methods
may be used to assemble sequence libraries or individual arrayed
sequences into virus expression vectors and reconstruct an
infectious virus, such that the final ligation product can be
transcribed and the resulting RNA can be used for plant, plant
tissue or plant cell inoculation/infection. A more detailed
discussion is presented in a co-pending/co-owned U.S. patent
application No. 09/359,303 (Padgett et al., Attorney Docket No.
08010137US03, filed Jul. 21, 1999), incorporated herein by
reference.
[0067] The host can be infected with a recombinant viral nucleic
acid or a recombinant plant virus by conventional techniques.
Suitable techniques include, but are not limited to, leaf abrasion,
abrasion in solution, high velocity water spray, and other injury
of a host as well as imbibing host seeds with water containing the
recombinant viral RNA or recombinant plant virus. More
specifically, suitable techniques include:
[0068] (a) Hand Inoculations. Hand inoculations are performed using
a neutral pH, low molarity phosphate buffer, with the addition of
celite or carborundum (usually about 1%). One to four drops of the
preparation is put onto the upper surface of a leaf and gently
rubbed.
[0069] (b) Mechanized Inoculations of Plant Beds. Plant bed
inoculations are performed by spraying (gas-propelled) the vector
solution into a tractor-driven mower while cutting the leaves.
Alternatively, the plant bed is mowed and the vector solution
sprayed immediately onto the cut leaves.
[0070] (c) Vacuum Infiltration. Inoculations may be accomplished by
subjecting a host organism to a substantially vacuum pressure
environment in order to facilitate infection.
[0071] (d) High Speed Robotics Inoculation. Especially applicable
when the organism is a plant, individual organisms may be grown in
mass array such as in microtiter plates. Machinery such as robotics
may then be used to transfer the nucleic acid of interest.
[0072] (e) High Pressure Spray of Single Leaves. Single plant
inoculations can also be performed by spraying the leaves with a
narrow, directed spray (50 psi, 6-12 inches from the leaf)
containing approximately 1% carborundum in the buffered vector
solution.
[0073] (f) Ballistics (High Pressure Gun) Inoculation. Single plant
inoculations can also be performed by particle bombardment. A
ballistics particle delivery system (BioRad Laboratories, Hercules,
(A) can be used to transfect plants such as N. benthamiana as
described previously (Nagar et al., Plant Cell, 7:705-719
(1995)).
[0074] An alternative method for introducing a recombinant plant
viral nucleic acid into a plant host is a technique known as
agroinfection or Agrobacterium-mediated transformation (sometimes
called Agro-infection) as described by Grimsley et al., Nature
325:177 (1987). This technique makes use of a common feature of
Agrobacterium which colonizes plants by transferring a portion of
their DNA (the T-DNA) into a host cell, where it becomes integrated
into nuclear DNA. The T-DNA is defined by border sequences which
are 25 base pairs long, and any DNA between these border sequences
is transferred to the plant cells as well. The insertion of a
recombinant plant viral nucleic acid between the T-DNA border
sequences results in transfer of the recombinant plant viral
nucleic acid to the plant cells, where the recombinant plant viral
nucleic acid is replicated, and then spreads systemically through
the plant. Agro-infection has been accomplished with potato spindle
tuber viroid (PSTV) (Gardner et al., Plant Mol. Biol. 6:221 (1986);
CaV (Grimsley et al., Proc. Natl. Acad. Sci. USA 83:3282 (1986));
MSV (Grimsley et al., Nature 325:177 (1987)), and Lazarowitz, S.,
Nucl. Acids Res. 16:229 (1988)) digitaria streak virus (Donson et
al., Virology 162:248 (1988)), wheat dwarf virus (Hayes et al., J.
Gen. Virol. 69:891 (1988)) and tomato golden mosaic virus (TGMV)
(Elmer et al., Plant Mol. Biol. 10:225 (1988) and Gardiner et al.,
EMBO J. 7:899 (1988)). Therefore, agro-infection of a susceptible
plant could be accomplished with a virion containing a recombinant
plant viral nucleic acid based on the nucleotide sequence of any of
the above viruses. Particle bombardment or electrosporation or any
other methods known in the art may also be used.
[0075] Infection may also be attained by placing a selected nucleic
acid sequence into an organism such as E. coli, or yeast, either
integrated into the genome of such organism or not, and then
applying the organism to the surface of the host organism. Such a
mechanism may thereby produce secondary transfer of the selected
nucleic acid sequence into a host organism. This is a particularly
practical embodiment when the host organism is a plant. Likewise,
infection may be attained by first packaging a selected nucleic
acid sequence in a pseudovirus. Such a method is described in WO
4/10329, the teachings of which are incorporated herein by
reference. Though the teachings of this reference may be specific
for bacteria, those of skill in the art will readily appreciate
that the same procedures could easily be adapted to other
organisms.
[0076] After a host is infected with a recombinant viral nucleic
acid comprising a nucleic acid insert derived from a cDNA library
or a genomic library, one or more biochemical or phenotypic changes
in a host plant is determined. The biochemical or phenotypic
changes in the infected host plant is correlated to the
biochemistry or phenotype of a host plant that is uninfected.
Optionally, the biochemical or phenotypic changes in the infected
host plant is further correlated to a host plant that is infected
with a viral vector that contains a control nucleic acid of a known
sequence in an antisense orientation; the control nucleic acid has
similar size but is different in sequence from the nucleic acid
insert derived from the library. For example, if the nucleic acid
insert derived from the library is identified as encoding a GTP
binding protein in an antisense orientation, a nucleic acid derived
from a gene encoding green fluorescent protein can be used as a
control nucleic acid. Green fluorescent protein is known not be
have the same effect as the GTP binding protein when expressed in
plants.
[0077] Those of skill in the art will readily understand that there
are many methods to determine phenotypic or biochemical change in a
plant and to determine the function of a nucleic acid, once the
nucleic acid is localized or systemic expressed in a host plant. In
a preferred embodiment, the phenotypic or biochemical trait may be
determined by observing phenotypic changes in a host by methods
including visual, morphological, macroscopic or microscopic
analysis. For example, growth change such as stunting,
hyperbranching, and necrosis; structure change such as vein
banding, ring spot, etching; color change such as bleaching,
chlorosis, or other color; and other changes such as marginal,
mottled, patterening, punctate, and reticulate are easily detected.
In another embodiment, the phenotypic or biochemical trait may be
determined by complementation analysis, that is, by observing the
endogenous gene or genes whose function is replaced or augmented by
introducing the nucleic acid of interest. A discussion of such
phenomenon is provided by Napoli et al., The Plant Cell 2:279-289
(1990). In a third embodiment, the phenotypic or biochemical trait
may be determined by analyzing the biochemical alterations in the
accumulation of substrates or products from enzymatic reactions
according to any means known by those skilled in the art. In a
fourth embodiment, the phenotypic or biochemical trait may be
determined by observing any changes in biochemical pathways which
may be modified in a host organism as a result of expression of the
nucleic acid. In a fifth embodiment, the phenotypic or biochemical
trait may be determined utilizing techniques known by those skilled
in the art to observe inhibition of endogenous gene expression in
the cytoplasm of cells as a result of expression of the nucleic
acid. In a sixth embodiment, the phenotypic or biochemical trait
may be determined utilizing techniques known by those skilled in
the art to observe changes in the RNA or protein profile as a
result of expression of the nucleic acid. In a seventh embodiment,
the phenotypic or biochemical trait may be determined by selection
of organisms such as plants capable of growing or maintaining
viability in the presence of noxious or toxic substances, such as,
for example herbicides and pharmaceutical ingredients.
[0078] Phenotypic traits in plant cells, which may be observed
microscopically, macroscopically or by other methods, include
improved tolerance to herbicides, improved tolerance to extremes of
heat or cold, drought, salinity or osmotic stress; improved
resistance to pests (insects, nematodes or arachnids) or diseases
(fungal, bacterial or viral), production of enzymes or secondary
metabolites; male or female sterility; dwarfness; early maturity;
improved yield, vigor, heterosis, nutritional qualities, flavor or
processing properties, and the like. Other examples include the
production of important proteins or other products for commercial
use, such as lipase, melanin, pigments, alkaloids, antibodies,
hormones, pharmaceuticals, antibiotics and the like. Another useful
phenotypic trait is the production of degradative or inhibitory
enzymes, for example, enzymes preventing or inhibiting the root
development in malting barley, or enzymes determining response or
non-response to a systemically administered drug in a human. The
phenotypic trait may also be a secondary metabolite whose
production is desired in a bioreactor.
[0079] Biochemical changes can also be determined by analytical
methods, for example, in a high-throughput, fully automated fashion
using robotics. Suitable biochemical analysis may include
MALDI-TOF, LC/MS, GC/MS, two-dimensional IEF/SDS-PAGE, ELISA or
other methods of analyses. The clones in the plant viral vector
library may then be functionally classified based on metabolic
pathway affected or visual/selectable phenotype produced in the
plant. This process enables the rapid determination of gene
function for unknown nucleic acid sequences of a plant origin.
Furthermore, this process can be used to rapidly confirm function
of full-length DNA's of unknown gene function. Functional
identification of unknown nucleic acid sequences in a plant library
may then rapidly lead to identification of similar unknown
sequences in expression libraries for other crop species based on
sequence homology.
[0080] One useful means to determine the function of nucleic acids
transfected into a host is to observe the effects of gene
silencing. Traditionally, functional gene knockout has been
achieved following inactivation due to insertion of transposable
elements or random integration of T-DNA into the chromosome,
followed by characterization of conditional, homozygous-recessive
mutants obtained upon backcrossing. Some teachings in these regards
are provided by WO 97/42210 which is herein incorporated by
reference. As an alternative to traditional knockout analysis, an
EST/DNA library from an organism, for example Arabidopsis thaliana,
may be assembled into a plant viral transcription plasmid. The
nucleic acid sequences in the transcription plasmid library may
then be introduced into plant cells as part of a functional RNA
virus which post-transcriptionally silences the homologous target
gene. The EST/DNA sequences may be introduced into a plant viral
vector in either the plus or minus sense orientation, and the
orientation can be either directed or random based on the cloning
strategy. A high-throughput, automated cloning scheme based on
robotics may be used to assemble and characterize the library. In
addition, double stranded RNA may also be an effective stimulator
of gene silencing in transgenic plant. Gene silencing of plant
genes may be induced by delivering an RNA capable of base pairing
with itself to form double stranded regions. This approach could be
used with any plant gene to assist in the identification of the
function of a particular gene sequence.
[0081] The present invention provides a method to produce
transfected plants containing viral-derived antisense RNA in the
cytoplasm. Such method is much faster than the time required to
obtain genetically engineered antisense transgenic plants. Systemic
infection and expression of viral antisense RNA occurs as short as
four days post inoculation, whereas it takes several months or
longer to create a single transgenic plant. The invention provides
a method to identify genes involved in the regulation of plant
growth by inhibiting the expression of specific endogenous genes
using viral vectors, which replicate solely in the cytoplasm. This
invention provides a method to characterize specific genes and
biochemical pathways in donor plants or in host plants using an RNA
viral vector.
[0082] The invention is also directed to a method of determining a
nucleic acid sequence in a donor plant, which has the same function
as that in a genetically different host plant, by transfecting a
nucleic acid sequence derived from a donor plant into a plant host.
In one preferred embodiment, the method comprising the steps of (a)
preparing a library of cDNAs, genomic DNAs, or a pool of RNAs of
the donor plant, (b) constructing recombinant viral nucleic acids
comprising a nucleic acid insert derived from the library, (c)
infecting each host plant with the one of the recombinant viral
nucleic acids, (d) growing the infected host plant, (e) determining
one or more changes in the host plant, (f) identifying the
recombinant viral nucleic acid that results in changes in the host,
(g) determining the sequence of the nucleic acid insert in the
recombinant viral nucleic acid that results in changes in the host,
and (h) determining the sequence of an entire open reading frame of
the donor from which the nucleic acid insert is derived.
[0083] The invention is further directed to a method of determining
a nucleic acid sequence in a host plant, which has the same
function as that in a genetically different donor plant, by
transfecting a nucleic acid sequence derived from a donor plant
into a host plant. In one preferred embodiment, the method
comprising the steps of (a) preparing a library of cDNAs, genomic
DNAs, or a pool of RNAs of the donor plant, (b) constructing
recombinant viral nucleic acids comprising a nucleic acid insert
derived from the library, (c) infecting each host plant with one of
said recombinant viral nucleic acids, (d) growing the infected host
plant, (e) determining one or more changes in the host plant, (f)
identifying the recombinant viral nucleic acid that results in
changes in the host, (g) determining the sequence of the nucleic
acid insert in the recombinant viral nucleic acid that results in
changes in the host, and (h) determining the sequence of an entire
open reading frame of a gene in the host plant, the expression of
which is affected by the insert. The sequence of the nucleic acid
insert in the cDNA clone or in the viral vector can be determined
by a standard method, for example, by dideoxy termination using
double stranded templates (Sanger et al., Proc., Natl. Acad. Sci.
USA 74:5463-5467 (1977)). Once the sequence of the nucleic acid
insert is obtained, the sequence of an entire open reading frame of
a gene can be determined by probing filters containing full-length
cDNAs from the cDNA library with the nucleic acid insert labeled
with radioactive, fluorescent, or enzyme molecules. The sequence of
an entire open reading frame of a gene can also be determined by
RT-PCR (Methods Mol. Biol., 89:333-358 (1998)).
[0084] The present invention is also directed to a method of
changing the phenotype or biochemistry of a plant by expressing
transiently a nucleic acid sequence from a donor plant in an
antisense orientation in a host plant, which inhibits an endogenous
gene expression in the meristem of the host plant. The one or more
phenotypic or biochemical changes in the host plant are detected by
methods as describes previously. Transient expressing a nucleic
acid sequence in a host plant can affect the gene expression in
meristem. Meristems are of interest in plant development because
plant growth is driven by the formation and activity of meristems
throughout the entire life cycle. This invention is exemplified by
a nucleic acid sequence encoding ribosomal protein S18. The
activity of S18 promoter is restricted to meristems (Lijsebettesn
et al., EMBO J. 13:3378-3388). Transient expression of a nucleic
acid sequence in a host plant can trigger a signal transmitting to
meristems and affect the gene expression in meristem.
[0085] One problem with gene silencing in a plant host is that many
plant genes exist in multigene families. Therefore, effective
silencing of a gene function may be especially problematic.
According to the present invention, however, nucleic acids may be
inserted into the viral genome to effectively silence a particular
gene function or to silence the function of a multigene family. It
is presently believed that about 20% of plant genes exist in
multigene families.
[0086] A detailed discussion of some aspects of the "gene
silencing" effect is provided in the co-pending patent application,
U.S. patent application Ser. No. 08/260,546 (WO95/34668 published
Dec. 21, 1995) the disclosure of which is incorporated herein by
reference. RNA can reduce the expression of a target gene through
inhibitory RNA interactions with target mRNA that occur in the
cytoplasm and/or the nucleus of a cell.
[0087] An EST/cDNA library from a plant such as Arabidopsis
thaliana may be assembled into a plant viral transcription plasmid
background. The cDNA sequences in the transcription plasmid library
can then be introduced into plant cells as cytoplasmic RNA in order
to post-transcriptionally silence the endogenous genes. The
EST/cDNA sequences may be introduced into the plant viral
transcription plasmid in either the plus or anti-sense orientation
(or both), and the orientation can be either directed or random
based on the cloning strategy. A high-throughput, automated cloning
strategy using robotics can be used to assemble the library. The
EST clones can be inserted behind a duplicated subgenomic promoter
such that they are represented as subgenomic transcripts during
viral replication in plant cells. Alternatively, the EST/cDNA
sequences can be inserted into the genomic RNA of a plant viral
vector such that they are represented as genomic RNA during the
viral replication in plant cells. The library of EST clones is then
transcribed into infectious RNAs and inoculated onto a host plant
susceptible to viral infection. The viral RNAs containing the
EST/cDNA sequences contributed from the original library are now
present in a sufficiently high concentration in the cytoplasm of
host plant cells such that they cause post-transcriptional gene
silencing of the endogenous gene in a host plant. Since the
replication mechanism of the virus produces both sense and
antisense RNA sequences, the orientation of the EST/cDNA insert is
normally irrelevant in terms of producing the desired phenotype in
the host plant.
[0088] It is known that silencing of endogenous genes can be
achieved with homologous sequences from the same family. For
example, Kumagai et al., (Proc. Natl. Acad. Sci. USA 92:1679
(1995)) report that the Nicotiana benthamiana gene for phytoene
desaturase (PDS) was silenced by transfection with a viral RNA
derived from a clone containing a partial tomato (Lycopersicon
esculentum) cDNA encoding PDS being in an antisense orientation.
This paper is incorporated here by reference. Kumagai et al.
demonstrate that gene encoding PDS from one plant can be silenced
by transfection a host plant with a nucleic acid of a known
sequence, namely, a PDS gene, from a donor plant of the same
family. The present invention provides a method of silencing a gene
in a host plant by transfecting the host plant with a viral nucleic
acid comprising a nucleic acid insert derived from a cDNA library,
a genomic DNA library, or a pool of RNA. Different from Kumagai et
al, the sequence of the nucleic acid insert in the present
invention is not identified or isolated prior to the transfection.
Another feature of the present invention is that it provides a
method to silence a gene of a different family; the antisense
transcript of one plant results in reducing expression of the
endogenous gene or multigene family of a plant of a different
genus, family, order, class, subdivision, division, or subkingdom.
The invention is exemplified by GTP binding proteins. In eukaryotic
cells, GTP-binding proteins function in a variety of cellular
processes, including signal transduction, cytoskeletal
organization, and protein transport. Low molecular weight (20-25 K
Daltons) of GTP-binding proteins include ras and its close
relatives (for example, Ran), rho and its close close relatives,
the rab family, and the ADP-ribosylation factor (ARF) family. The
heterotrimeric and monomeric GTP-binding proteins that may be
involved in secretion and intracellular transport are divided into
two structural classes: the rab and the ARF families. The ARFs from
many organisms have been isolated and characterized. The ARFs share
structural features with both the ras and trimeric GTP-binding
protein families. The present invention demonstrates that genes of
one plant, such as Nicotiana, which encode GTP binding proteins,
can be silenced by transfection with infectious RNA from a clone
containing GTP binding protein open reading frame in an antisense
orientation, derived from a plant of a different family, such as
Arabidopsis.
[0089] The present invention also provides a method of isolating a
conserved gene such as a gene encoding a GTP binding protein, from
rice, barley, corn, soybean, maize, oilseed, and other plant of
commercial interest, using another gene having homology with gene
being isolated. Libraries containing full-length cDNAs from a donor
plant such as rice, barley, corn, soybean and other important crops
can be obtained from public and private sources or can be prepared
from plant mRNAs. The cDNAs are inserted in viral vectors or in
small subcloning vectors such as pBluescript (Strategene), pUC18,
M13, or pBR322. Transformed bacteria are then plated and individual
clones selected by a standard method. The bacteria transformants or
DNAs are rearrayed at high density onto membrane filters or glass
slides. Full-length cDNAs encoding GTP binding proteins can be
identified by probing filters or slides with labeled nucleic acid
inserts which result in changes in a host plant, or labeled probes
prepared from DNAs encoding GTP binding proteins from Arabidopsis.
Useful labels include radioactive, fluorescent, or chemiluminecent
molecules, enzymes, etc.
[0090] Alternatively, genomic libraries containing sequences from
rice, barley, corn, soybean and other important crops can be
obtained from public and private sources, or be prepared from plant
genomic DNAs. BAC clones containing entire plant genomes have been
constructed and organized in a minimal overlapping order.
Individual BACs are sheared to fragments and directly cloned into
viral vectors. Clones that completely cover an entire BAC form a
BAC viral vector sublibrary. Genomic clones can be identified by
probing filters containing BACs with labeled nucleic acid inserts
which result in changes in a host plant, or with labeled probes
prepared from DNAs encoding GTP binding proteins from Arabidopsis.
Useful labels include radioactive, fluorescent, or chemiluminecent
molecules, enzymes, etc. BACs that hybridize to the probe are
selected and their corresponding BAC viral vectors are used to
produce infectious RNAs. Plants that are transfected with the BAC
sublibrary are screened for change of function, for example, change
of growth rate or change of color. Once the change of function is
observed, the inserts from these clones or their corresponding
plasmid DNAs are characterized by dideoxy sequencing. This provides
a rapid method to obtain the genomic sequence for a plant protein,
for example, a GTP binding protein. Using this method, once the DNA
sequence in one plant such as Arabidopsis thaliana is identified,
it can be used to identify conserved sequences of similar function
that exist in other plant libraries.
[0091] Large amounts of DNA sequence information are being
generated in the public domain and may be entered into a relational
database. Links may be made between sequences from various species
predicted to carry out similar biochemical or regulatory functions.
Links may also be generated between predicted enzymatic activities
and visually displayed biochemical and regulatory pathways.
Likewise, links may be generated between predicted enzymatic or
regulatory activity and known small molecule inhibitors,
activators, substrates or substrate analogs. Phenotypic data from
expression libraries expressed in transfected hosts may be
automatically linked within such a relational database. Genes with
similar predicted roles of interest in other crop plants may be
rapidly discovered.
[0092] A functional genomics screen is set up using a tobacco
mosaic virus TMV-O coat protein capsid for infection of Nicotiana
benthamiana, a plant related to the common tobacco plant. For
Arabidopsis thaliana cDNA librariers are obtained from the
Arabidopsis Biological Resource Center, Bluescript.RTM. phagemid
vectors are recovered by Not 1 digestion. cDNA is transformed into
a plasmid. The plasmid is transcribed into viral vector RNA. The
inserts are in the antisense orientation as in Figure until all of
the cDNA from each cDNA library is represented on viral vectors.
Each viral vector is sprayed onto the leaf of a two-week old N.
benthamiana plant host with sufficient force to cause tissue injury
and localized viral infection. Each infected plant is grown side by
side with an uninfected plant and a plant infected with a null
insert vector as controls. All plants are grown in an artificial
environment having 16 hours of light and 8 hours of dark. Lumens
are approximately equal on each plant. At intervals of 2 days a
visual and photographic observation of phenotype is made and
recorded for each infected plant and each of its controls and a
comparison is made. Data is entered into a Laboratory Information
Management System database. At the end of the observation period
stunted plants are grouped for analysis. The nucleic acid insert
contained in the viral vector clone 740AT#120 is responsible for
severe stunting of one of the plants. Clone 740AT #120 is
sequenced. The homolog from the plant host is also sequenced. The
740AT #120 clone is found to have 80% hemology to plant host
nucleic acid sequence. The amino acid sequence of hemology is 96%.
The entire cDNA sequence of the insert is obtained by sequencing
and found to code for a GTP binding protein. The host plant homolog
is selected and sequenced. It also codes for a GTP binding protein.
We conclude that this GTP binding protein coding sequence is highly
conserved in nature. This information is useful in pharmaceutical
development as well as in toxicology studies.
[0093] A complete classification scheme of gene functionality for a
fully sequenced eukaryotic organism has been established for yeast.
This classification scheme may be modified for plants and divided
into the appropriate categories. Such organizational structure may
be utilized to rapidly identify herbicide target loci which may
confer dominant lethal phenotypes, and thereby is useful in helping
to design rational herbicide programs.
[0094] The present invention is also directed to a method of
increasing yield of a grain crop. In Rice Biotechnology Quarterly
(37:4, (1999)), it is reported that a transgenic rice plant
transformed with a rgpl gene, which encodes a small GTP binding
protein from rice, was shorter than a control plant, but it
produced more seeds than the control plant. To increase the yield
of a grain crop, the present method comprises expressing
transiently a nucleic acid sequence of a donor plant in an
antisense orientation in the grain crop, wherein said expressing
results in stunted growth and increased seed production of said
grain crop. A preferred method comprises the steps of cloning the
nucleic acid sequence into a plant viral vector and infecting the
grain crop with a recombinant viral nucleic acid comprising said
nucleic acid sequence. Preferred plant viral vector is derived from
a Brome Mosaic virus, a Rice Necrosis virus, or a geminivirus.
Preferred grain crops include rice, wheat, and barley. The nucleic
acid expressed in the host plant, for example, comprises a GTP
binding protein open reading frame having an antisense orientation.
The present method provides a transiently expression of a gene to
obtain a stunted plant. Because less energy is put into plant
growth, more energy is available for production of seed, which
results in increase yield of a grain crop. The present method has
an advantage over other method using a trangenic plant, because it
does not have an effect on the genome of a host plant.
[0095] In order to provide an even clearer and more consistent
understanding of the specification and the claims, including the
scope given herein to such terms, the following definitions are
provided:
[0096] Adjacent: A position in a nucleotide sequence proximate to
and 5' or 3' to a defined sequence. Generally, adjacent means
within 2 or 3 nucleotides of the site of reference.
[0097] Anti-Sense Inhibition: A type of gene regulation based on
cytoplasmic, nuclear or organelle inhibition of gene expression due
to the presence in a cell of an RNA molecule complementary to at
least a portion of the mRNA being translated. It is specifically
contemplated that RNA molecules may be from either an RNA virus or
mRNA from the host cells genome or from a DNA virus.
[0098] Cell Culture: A proliferating group of cells which may be in
either an undifferentiated or differentiated state, growing
contiguously or non-contiguously.
[0099] Chimeric Sequence or Gene: A nucleotide sequence derived
from at least two heterologous parts. The sequence may comprise DNA
or RNA.
[0100] Coding Sequence: A deoxyribonucleotide or ribonucleotide
sequence which, when either transcribed and translated or simply
translated, results in the formation of a cellular polypeptide or a
ribonucleotide sequence which, when translated, results in the
formation of a cellular polypeptide.
[0101] Compatible: The capability of operating with other
components of a system. A vector or plant or animal viral nucleic
acid which is compatible with a host is one which is capable of
replicating in that host. A coat protein which is compatible with a
viral nucleotide sequence is one capable of encapsidating that
viral sequence.
[0102] Complementation Analysis: As used herein, this term refers
to observing the changes produced in an organism when a nucleic
acid sequence is introduced into that organism after a selected
gene has been deleted or mutated so that it no longer functions
fully in its normal role. A complementary gene to the deleted or
mutated gene can restore the genetic phenotype of the selected
gene.
[0103] Dual Heterologous Subgenomic Promoter Expression System
(DHSPES): a plus stranded RNA vector having a dual heterologous
subgenomic promoter expression system to increase, decrease, or
change the expression of proteins, peptides or RNAs, preferably
those described in U.S. Pat. Nos. 5,316,931, 5,811,653, 5,589,367,
and 5,866,785, the disclosure of which is incorporated herein by
reference.
[0104] Expressed sequence tags (ESTs): Relatively short single-pass
DNA sequences obtained from one or more ends of cDNA clones and RNA
derived therefrom. They may be present in either the 5' or the 3'
orientation. ESTs have been shown useful for identifying particular
genes.
[0105] Expression: The term as used herein is meant to incorporate
one or more of transcription, reverse transcription and
translation.
[0106] A functional Gene Profile: The collection of genes of an
organism which code for a biochemical or phenotypic trait. The
functional gene profile of an organism is found by screening
nucleic acid sequences from a donor organism by over expression or
suppression of a gene in a host organism. A functional gene profile
requires a collection or library of nucleic acid sequences from a
donor organism. A functional gene profile will depend on the
ability of the collection or library of donor nucleic acids to
cause over-expression or suppression in the host organism.
Therefore, a functional gene profile will depend upon the quantity
of donor genes capable of causing over-expression or suppression of
host genes or of being expressed in the host organism in the
absence of a homologous host gene.
[0107] Gene: A discrete nucleic acid sequence responsible for
producing one or more cellular products and/or performing one or
more intercellular or intracellular functions.
[0108] Gene silencing: A reduction in gene expression. A viral
vector expressing gene sequences from a host may induce gene
silencing of homologous gene sequences.
[0109] Homology: A high degree of nucleic acid similarity in all or
some portions of a gene sequence sufficient to result in gene
suppression if the nucleic acid sequence is delivered in the
antisense orientation.
[0110] Host: A cell, tissue or organism capable of replicating a
nucleic acid such as a vector or plant viral nucleic acid and which
is capable of being infected by a virus containing the viral vector
or viral nucleic acid. This term is intended to include prokaryotic
and eukaryotic cells, organs, tissues or organisms, where
appropriate. Bacteria, fungi, yeast, animal (cell, tissues, or
organisms), and plant (cell, tissues, or organisms) are examples of
a host.
[0111] Infection: The ability of a virus to transfer its nucleic
acid to a host or introduce a viral nucleic acid into a host,
wherein the viral nucleic acid is replicated, viral proteins are
synthesized, and new viral particles assembled. In this context,
the terms "transmissible" and "infective" are used interchangeably
herein. The term is also meant to include the ability of a selected
nucleic acid sequence to integrate into a genome, chromosome or
gene of a target organism.
[0112] Multigene family: A set of genes descended by duplication
and variation from some ancestral gene. Such genes may be clustered
together on the same chromosome or dispersed on different
chromosomes. Examples of multigene families include those which
encode the histones, hemoglobins, immunoglobulins,
histocompatibility antigens, actins, tubulins, keratins, collagens,
heat shock proteins, salivary glue proteins, chorion proteins,
cuticle proteins, yolk proteins, and phaseolins.
[0113] Non-Native: Any RNA or DNA sequence that does not normally
occur in the cell or organism in which it is placed. Examples
include recombinant plant viral nucleic acids and genes or ESTs
contained therein. That is, an RNA or DNA sequence may be
non-native with respect to a viral nucleic acid. Such an RNA or DNA
sequence would not naturally occur in the viral nucleic acid. Also,
an RNA or DNA sequence may be non-native with respect to a host
organism. That is, such a RNA or DNA sequence would not naturally
occur in the host organism.
[0114] Nucleic acid: As used herein the term is meant to include
any DNA or RNA sequence from the size of one or more nucleotides up
to and including a complete gene sequence. The term is intended to
encompass all nucleic acids whether naturally occurring in a
particular cell or organism or non-naturally occurring in a
particular cell or organism.
[0115] Nucleic acid of interest: The term is intended to refer to
the nucleic acid sequence whose function is to be determined. The
sequence will normally be non-native to a viral vector but may be
native or non-native to a host organism.
[0116] Phenotypic Trait: An observable, measurable or detectable
property resulting from the expression or suppression of a gene or
genes.
[0117] Plant Cell: The structural and physiological unit of plants,
consisting of a protoplast and the cell wall.
[0118] Plant Organ: A distinct and visibly differentiated part of a
plant, such as root, stem, leaf or embryo.
[0119] Plant Tissue: Any tissue of a plant in planta or in culture.
This term is intended to include a whole plant, plant cell, plant
organ, protoplast, cell culture, or any group of plant cells
organized into a structural and functional unit.
[0120] Positive-sense inhibition: A type of gene regulation based
on cytoplasmic inhibition of gene expression due to the presence in
a cell of an RNA molecule substantially homologous to at least a
portion of the mRNA being translated.
[0121] Promoter: The 5'-flanking, non-coding sequence substantially
adjacent a coding sequence which is involved in the initiation of
transcription of the coding sequence.
[0122] Protoplast: An isolated plant or bacterial cell without some
or all of its cell wall.
[0123] Recombinant Plant Viral Nucleic Acid: Plant viral nucleic
acid which has been modified to contain non-native nucleic acid
sequences. These non-native nucleic acid sequences may be from any
organism or purely synthetic, however, they may also include
nucleic acid sequences naturally occurring in the organism into
which the recombinant plant viral nucleic acid is to be
introduced.
[0124] Recombinant Plant Virus: A plant virus containing the
recombinant plant viral nucleic acid.
[0125] Subgenomic Promoter: A promoter of a subgenomic mRNA of a
viral nucleic acid.
[0126] Substantial Sequence Homology: Denotes nucleotide sequences
that are substantially functionally equivalent to one another.
Nucleotide differences between such sequences having substantial
sequence homology are insignificant in affecting function of the
gene products or an RNA coded for by such sequence.
[0127] Systemic Infection: Denotes infection throughout a
substantial part of an organism including mechanisms of spread
other than mere direct cell inoculation but rather including
transport from one infected cell to additional cells either nearby
or distant.
[0128] Transposon: A nucleotide sequence such as a DNA or RNA
sequence which is capable of transferring location or moving within
a gene, a chromosome or a genome.
[0129] Transgenic plant: A plant which contains a foreign
nucleotide sequence inserted into either its nuclear genome or
organellar genome.
[0130] Transcription: Production of an RNA molecule by RNA
polymerase as a complementary copy of a DNA sequence or subgenomic
mRNA.
[0131] Transient Expression: expression of a nucleic acid sequence
in a host without insertion of the nucleic acid sequence into the
host genome, such as by way of a viral vector.
[0132] Vector: A self-replicating RNA or DNA molecule which
transfers an RNA or DNA segment between cells, such as bacteria,
yeast, plant, or animal cells.
[0133] Virus: An infectious agent composed of a nucleic acid which
may or may not be encapsidated in a protein. A virus may be a
mono-, di-, tri-, or multi-partite virus, as described above.
EXAMPLES
[0134] The following examples further illustrate the present
invention. These examples are intended merely to be illustrative of
the present invention and are not to be construed as being
limiting.
Example 1
[0135] Gene silencing/co-supression of genes induced by delivering
an RNA capable of base pairing with itself to form double stranded
regions.
[0136] Gene silencing has been used to down regulate gene
expression in transgenic plants. Recent experimental evidence
suggests that double stranded RNA may be an effective stimulator of
gene silencing/co-suppression phenomenon in transgenic plant. For
example, Waterhouse et al (Proc. Natl. Acad. Sci. USA
95:13959-13964 (1998), incorporated herein by reference) described
that virus resistance and gene silencing in plants could be induced
by simultaneous expression of sense and antisense RNA. Gene
silencing/co-suppression of plant genes may be induced by
delivering an RNA capable of base pairing with itself to form
double stranded regions.
[0137] This example shows: (1) a novel method for generating an RNA
virus vector capable of producing an RNA capable of forming double
stranded regions, and (2) a process to silence plant genes by using
such a viral vector.
[0138] Step 1: Construction of a DNA sequence which after it is
transcribed would generate an RNA molecule capable of base pairing
with itself. Two identical, or nearly identical, ds DNA sequences
are ligated together in an inverted orientation to each other
(i.e., in either a head to tail or tail to head orientation) with
or without a linking nucleotide sequence between the homologous
sequences. The resulting DNA sequence is then be cloned into a cDNA
copy of a plant viral vector genome.
[0139] Step 2: Cloning, screening, transcription of clones of
interest using known methods in the art.
[0140] Step 3: Infect plant cells with transcripts from clones.
[0141] As virus expresses foreign gene sequence, RNA from foreign
gene forms base pair upon itself, forming double-stranded RNA
regions. This approach is used with any plant or non-plant gene and
used to silence plant gene homologous to assist in identification
of the function of a particular gene sequence.
Example 2
[0142] Cytoplasmic inhibition of phytoene desaturase in transfected
plant confirms that the partial tomato PDS sequence encodes
phytoene desaturase.
[0143] Isolation of tomato mosaic virus cDNA. An 861 base pair
fragment (5524-6384) from the tomato mosaic virus (fruit necrosis
strain F; tom-F) containing the putative coat protein subgenomic
promoter, coat protein gene, and the 3'-end was isolated by PCR
using primers 5'-CTCGCAAAGTTTCGAACCAAATCCTC-3' (upstream) (SEQ ID
NO: 1) and 5'-CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream)
(SEQ ID NO: 2) and subcloned into the HincII site of pBluescript
KS-. A hybrid virus consisting of TMV-U1 and ToMV-F was constructed
by swapping an 874-bp BamHI-KpnI ToMV fragment into pBGC152,
creating plasmid TTO1. The inserted fragment was verified by
dideoxynucleotide sequencing. A unique AvrII site was inserted
downstream of the XhoI site in TTO1 by PCR mutagenesis, creating
plasmid TTO1A, using the following oligonucleotides:
5'-TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA-3' (upstream) (SEQ ID
NO: 3), 5'-CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream) (SEQ
ID NO: 4).
[0144] Isolation of a partial cDNA encoding tomato phytoene
desaturase. Partial cDNAs were isolated from ripening tomato fruit
RNA by polymerase chain reaction (PCR) using the following
oligonucleotides: PDS, 5'-TGCTCGAGTGTGTTCTTCAGTTTTCTGTCA-3' (SEQ ID
NO: 5) (upstream), 5'-AACTCGAGCGCTTTGATTTCTCCGAAGCTT-3'
(downstream) (SEQ ID NO: 6). Approximately 3.times.10.sup.4
colonies from a Lycopersicon esculentum cDNA library were screened
by colony hybridization using a .sup.32P labeled tomato phytoene
desaturase PCR product. Hybridization was carried out at 42.degree.
C. for 48 hours in 50% formamide, 5.times.SSC, 0.02 M phosphate
buffer, 5.times.Denhart's solution, and 0.1 mg/ml sheared calf
thymus DNA. Filters were washed at 65.degree. C. in 0.1.times.SSC,
0.1% SDS prior to autoradiography. PCR products and the phytoene
desaturase cDNA clones were verified by dideoxynucleotide
sequencing.
[0145] DNA sequencing and computer analysis. A PstI, BamHI fragment
containing the phytoene synthase cDNA and the partial phytoene
desaturase cDNA was subcloned into pBluescript.RTM. KS+(Stratagene,
La Jolla, Calif.). The nucleotide sequencing of KS+/PDS #38 was
carried out by dideoxy termination using single-stranded templates
(Maniatis, Molecular Cloning, 1.sup.st Ed.) Nucleotide sequence
analysis and amino acid sequence comparisons were performed using
PCGENE.RTM. and DNA Inspector.RTM. IIE programs.
[0146] Construction of a viral vector containing a partial tomato
phytoene desaturase cDNA. A XhoI fragment containing the partial
tomato phytoene desaturase cDNA was subcloned into TTO1. The vector
TTO1A/PDS+(FIG. 1) contains the phytoene desaturase cDNA in the
positive orientation under the control of the TMV-U1 coat protein
subgenomic promoter; while the vector TTO1A/PDS-contains the
phytoene desaturase cDNA in the antisense orientation.
[0147] Analysis of N. benthamiana transfected by TTO1/PDS+, and
TTO1/PDS-. Infectious RNAs from TTO1/PDS +, TTO1/PDS+were prepared
by in vitro transcription using SP6 DNA-dependent RNA polymerase as
described previously (Dawson et al., Proc. Natl. Acad. Sci. USA
83:1832 (1986)) and were used to mechanically inoculate N.
benthamiana. The hybrid viruses spread throughout all the
non-inoculated upper leaves as verified by transmission electron
microscopy, local lesion infectivity assay, and polymerase chain
reaction (PCR) amplification. The viral symptoms resulting from the
infection consisted of distortion of systemic leaves and plant
stunting with mild chlorosis. The leaves from plants transfected
with TTO1/PDS+ and TTO1/PDS- turned white. Agarose gel
eletrophoresis of PCR cDNA isolated from virion RNA and Northern
blot analysis of virion RNA indicate that the vectors are
maintained in an extrachromosomal state and have not undergone any
detectable intramolecular rearrangements.
[0148] Purification and analysis of carotenoids from transfected
plants. The carotenoids were isolated from systemically infected
tissue and analyzed by HPLC chromatography. Carotenoids were
extracted in ethanol and identified by their peak retention time
and absorption spectra on a 25-cm Spherisorb.RTM. ODS-15-m column
using acetonitrile/methanol/2-propa- nol (85:10:5) as a developing
solvent at a flow rate of 1 ml/min. They had identical retention
time to a synthetic phytoene standard and .beta.-carotene standards
from carrot and tomato. The expression of sense and antisense RNA
to a partial phytoene desaturase in transfected plants inhibited
the synthesis of colored carotenoids and caused the systemically
infected leaves to turn white. HPLC analysis of these plants
revealed that they also accumulated phytoene. The white leaf
phenotype was also observed in plants treated with the herbicide
norflurazon which specifically inhibits phytoene desaturase.
[0149] Our results that phytoene accumulated in plants transfected
with antisense phytoene desaturase suggests that viral vectors can
be used as a potent tool to manipulate pathways in the production
of secondary metabolites through cytoplasmic antisense inhibition.
Leaves from systemically infected TTO1A/PDS+plants also accumulated
phytoene and developed a bleaching white phenotype; the actual
mechanism of inhibition is not clear. These data are presented by
Kumagai et al., Proc. Natl. Acad. Sci. USA 92:1679-1683 (1995).
Example 3
[0150] Cytoplasmic inhibition of 5-enolpyruvylshikimate-3-phosphate
synthase (EPSPS) genes in plants blocks aromatic amino acid
biosynthesis.
[0151] Cytoplasmic inhibition of 5-enolpyruvylshikimate-3-phosphate
synthase (EPSPS) genes in plants blocks aromatic amino acid
biosynthesis and causes a systemic bleaching phenotype similar to
Roundup.RTM. herbicide. See also della-Cioppa, et al., "Genetic
Engineering of herbicide resistance in plants," Frontiers of
Chemistry: Biotechnology, Chemical Abstract Service, ACS, Columbus,
Ohio, pp. 665-70 (1989). A dual subgenomic promoter vector encoding
1097 base pairs of an antisense EPSPS gene from Nicotiana tabacum
(Class I EPSPS) is shown in plasmid pBS712. FIG. 2 shows plasmid
pBS712. Systemic expression of the Nicotiana tabacum Class I EPSPS
gene in the antisense orientation causes a systemic bleaching
phenotype similar to Roundup.RTM. herbicide.
Example 4
[0152] Exemplary complementation analysis.
[0153] A transgenic plant or naturally occurring plant mutant may
have a non-functional gene such as the one which produces EPSPS. A
plant deficient or lacking in the EPSPS gene could grow only in the
presence of added aromatic amino acids. Transfection of plants with
a viral vector containing a functional EPSPS gene or cDNA sequence
encoding the same would cause the plant to produce a functional
EPSPS gene product. A plant so transfected would then be able to
grow normally without added aromatic amino acids to its
environment. In this transfected plant, the EPSPS mutation in the
plant would be complemented in trans by the viral nucleic acid
sequence containing the native or foreign EPSPS cDNA sequence.
Example 5
[0154] Construction of a tobamoviral vector for expression of
heterologous genes in A. thaliana.
[0155] Virions that were prepared as a crude aqueous extract of
tissue from turnip infected with Ribgrass mosaic virus (RMV) were
used to inoculate N. benthamiana, N. tabacum, A. thaliana, and
oilseed rape (canola). Two to three weeks after transfection,
systemically infected plants were analyzed by immunoblotting, using
purified RMV as a standard. Total soluble plant protein
concentrations were determined using bovine serum albumin as a
standard. The proteins were analyzed on a 0.1% SDS/12.5%
polyacrylamide gel and transferred by electroblotting for 1 hr to a
nitrocellulose membrane. The blotted membrane was incubated for 1
hr with a 2000-fold dilution of anti-ribgrass mosaic virus coat
antiserum. Using standard protocols, the antisera was raised in
rabbits against purified RMV coat protein. The enhanced
chemiluminescence horseradish peroxidase-linked, goat anti-rabbit
IgG assay (Cappel Laboratories) was performed according to the
manufacturer's (Amersham) specifications. The blotted membrane was
subjected to film exposure times of up to 10 sec. No detectable
cross-reacting protein was observed in the noninfected N.
benthamiana control plant extracts. A 18 kDa protein cross-reacted
to the anti-RMV coat antibody from systemically infected N.
benthamiana, N. tabacum, A. thaliana, and oilseed rape (canola).
This result demonstrates that RMV can systemically infect N.
benthamiana, N. tabacum, A. thaliana, and oilseed rape
(canola).
[0156] Plasmid constructions.
[0157] Ribgrass mosaic virus (RMV) is a member of the tobamovirus
group that infects crucifers. A partial RMV cDNA containing the 30K
subgenomic promoter, 30K ORF, coat subgenomic promoter, coat ORF,
and 3'-end was isolated by RT-PCR using by using oligonucleotides
TVCV183X, 5'-TAC TCG AGG TTC ATA AGA CCG CGG TAG GCG G-3'
(upstream) (SEQ ID NO: 7) and TVCV KpnI, 5'-CGG GGT ACC TGG GCC CCT
ACC CGG GGT TTA GGG AGG-3' (downstream) (SEQ ID NO: 8), and
subcloned into the EcoRV site of KS+, creating plasmid KS+TVCV #23
(FIG. 3). The RMV cDNA was characterized by restriction mapping and
dideoxy nucleotide sequencing. The partial nucleotide sequence is
as follows:
1 5'-CTCGAGGTTCATAAGACCGCGGTAGGCGGAGCGTTTGTTTACTGTAGTATAATTA
AATATTTGTCAGATAAAAGGTTGTTTAAAGATTTGTTTTTTGTTTGACTGAGTCGATA
ATGTCTTACGAGCCTAAAGTTAGTGACTTCCTTGCTCTTACGAAAAAGGAGGAAATT
TTACCCAAGGCTTTGACGAGATTAAAGACTGTCTCTATTAGTACTAAGGATGTTATA
TCTGTTAAGGAGTCTGAGTCCCTGTGTGATATTGATTTGTTAGTGAATGTGCCATTAG
ATAAGTATAGGTATGTGGGTGTTTTGGGTGTTGTTTTCACCGGTGAATGGCTGGTAC
CGGATTTCGTTAAAGGTGGGGTAACAGTGAGCGTGATTGACAAACGGCTTGAAAAT
TCCAGAGAGTGCATAATTGGTACGTACCGAGCTGCTGTAAAGGACAGAAGGTTCCA
GTTCAAGCTGGTTCCAAATTACTTCGTATCCATTGCGGATGCCAAGCGAAAACCGTG
GCAGGTTCATGTGCGAATTCAAAATCTGAAGATCGAAGCTGGATGGCAACCTCTAG
CTCTAGAGGTGGTTTCTGTTGCCATGGTTACTAATAACGTGGTTGTTAAAGGTTTGAG
GGAAAAGGTCATCGCAGTGAATGATCCGAACGTCGAAGGTTTCGAAGGTGTGGTTG
ACGATTTCGTCGATTCGGTTGCTGCATTCAAGGCGATTGACAGTTTCCGAAAGAAAA
AGAAAAAGATTGGAGGAAGGGATGTAAATAATAATAAGTATAGATATAGACCGGA
GAGATACGCCGGTCCTGATTCGTTACAATATAAAGAAGAAAATGGTTTACAACATCA
CGAGCTCGAATCAGTACCAGTATTTCGCAGCGATGTGGGCAGAGCCCACAGCGATG
CTTAACCAGTGCGTGTCTGCGTTGTCGCAATCGTATCAAACTCAGGCGGCAAGAGAT
ACTGTTAGACAGCAGTTCTCTAACCTTCTGAGTGCGATTGTGACACCGAACCAGCGG
TTTCCAGAAACAGGATACCGGGTGTATATTAATTCAGCAGTTCTAAAACCGTTGTAC
GAGTCTCTCATGAAGTCCTTTGATACTAGAAATAGGATCATTGAAACTGAAGAAGAG
TCGCGTCCATCGGCTTCCGAAGTATCTAATGCAACACAACGTGTTGATGATGCGACC
GTGGCCATCAGGAGTCAAATTCAGCTTTTGCTGAACGAGCTCTCCAACGGACATGGT
CTGATGAACAGGGCAGAGTTCGAGGTTTTATTACCTTGGGCTACTGCGCCAGCTACA
TAGGCGTGGTGCACACGATAGTGCATAGTGTTTTTCTCTCCACTTAAATCGAAGAGA
TATACTTACGGTGTAATTCCGCAAGGGTGGCGTAAACCAAATTACGCAATGTTTTAG
GTTCCATTTAAATCGAAACCTGTTATTTCCTGGATCACCTGTTAACGTACGCGTGGCG
TATATTACAGTGGGAATAACTAAAAGTGAGAGGTTCGAATCCTCCCTAACCCCGGGT
AGGGGCCCA-3' (SEQ ID NO:9).
[0158] The 1543 base pair from the partial RMV cDNA was compared
(PCGENE) to oilseed rape mosaic virus (ORMV). The nucleotide
sequence identity was 97.8%. The RMV 30K and coat ORF were compared
to ORMV and the amino acid identity was 98.11% (30K) and 98.73%
(coat), respectively. A partial RMV cDNA containing the 5'-end and
part of the replicase was isolated by RT-PCR from RMV RNA using
oligonucleotides RGMV1 5'-GAT GGC GCC TTA ATA CGA CTC ACT ATA GTT
TTA TTT TTG TTG CAA CAA CAA CAA C-3' (upstream) (SEQ ID NO: 10) and
RGR 132 5'-CTT GTG CCC TTC ATG ACG AGC TAT ATC ACG-3' (downstream)
(SEQ ID NO: 11). The RMV cDNA was characterized by dideoxy
nucleotide sequencing. The partial nucleotide sequence containing
the T7 RNA polymerase promoter and part of the RMV cDNA is as
follows:
[0159]
5'-ccttaatacgactcactataGTTTTATTTTTGTTGCAACAACAACAACAAATTACAATAACAAC
AAAACAAATACAAACAACAACAACATGGCACAATTTCAACAAACAGTAAACATGCA
AACATTGCAGGCTGCCGCAGGGCGCAACAGCCTGGTGAATGATTTAGCCTCACGAC
GTGTTTATGACAATGCTGTCGAGGAGCTAAATGCACGCTCGAGACGCCCTAAGGTTC
ATTACTCCAAATCAGTGTCTACGGAACAGACGCTGTTAGCTTCAAACGCTTATCCGG
AGTTTGAGATTTCCTTTACTCATACCCAACATGCCGTACACTCCCTTGCGGGTGGCCT
AAGGACTCTTGAGTTAGAGTATCTCATGATGCAAGTTCCGTTCGGTTCTCTGACGTA
CGACATCGGTGGTAACTTTGCAGCGCACCTTTTCAAAGGACGCGACTACGTTCACTG
CTGTATGCCAAACTTGGATGTACGTGATATAGCT-3' (SEQ ID NO: 12). The
uppercase letters are nucleotide sequences from RMV cDNA. The lower
case letters are nucleotide sequences from T7 RNA polymerase
promoter. The nucleotide sequences from the 5' and 3'
oligonucleotides are underlined.
[0160] Full length infectious RMV cDNA clones were obtained by
RT-PCR from RMV RNA using oligonucleotides RGMV1, 5'-GAT GGC GCC
TTA ATA CGA CTC ACT ATA GTT TTA TTT TTG TTG CAA CAA CAA CAA C-3'
(upstream) (SEQ ID NO: 13) and RG1 APE, 5'-ATC GTT TAA ACT GGG CCC
CTA CCC GGG GTT AGG GAG G-3' (downstream) (SEQ ID NO: 14). The RMV
cDNA was characterized by dideoxy nucleotide sequencing. The
partial nucleotide sequence containing the T7 RNA polymerase
promoter and part of the RMV cDNA is as follows:
2 5'-CCTTAATACGACTCACTATAGTTTTATTTTTGTTGCAACAACAACAACAAATTACA
ATAACAACAAAACAAATACAAACAACAACAACATGGCACAATTTCAACAAACAGTA
AACATGCAAACATTCCAGGCTGCCGCAGGGCGCAACAGCCTGGTGAATGATTTAGC
CTCACGACGTGTTTATGACAATGCTGTCGAGGAGCTAAATGCACGCTCGAGACGCCC
TAAGGTTCATTACTCCAAATCAGTGTCTACGGAACAGACGCTGTTAGCTTCAAACGC
TTATCCGGAGTTTGAGATTTCCTTTACTCATACCCAAACATGCCGTACACTCCCTTGC
GGGTGGCCTAAGGACTCTTGAGTTAGAGTATCTCATGATGCAAGTTCCGTTCGGTTC
TCTGACGTACGACATCGGTGGTAACTTTGCAGCGCACCTTTTCAAAGGACGCGACTA
CGTTCACTGCTGTATGCCAAACTTGGATGTACGTGATATAGCT-3' (SEQ ID NO:15).
[0161] The uppercase letters are nucleotide sequences from RMV
cDNA. The nucleotide sequences from the 5' and 3' oligonucleotides
are underlined. Full length infectious RMV cDNA clones were
obtained by RT-PCR from RMV RNA using oligonucleotides RGMV1,
5'-gat ggc gcc tta ata cga ctc act ata gtt tta ttt ttg ttg caa caa
caa caa c-3' (upstream) (SEQ ID NO: 16) and RG1 APE, 5'-ATC GTT TAA
ACT GGG CCC CTA CCC GGG GTT AGG GAG G-3' (downstream) (SEQ ID NO:
17).
Example 6
[0162] Arabidopsis thaliana cDNA library construction in a dual
subgenomic promoter vector.
[0163] Arabidopsis thaliana cDNA libraries obtained from the
Arabidopsis Biological Resource Center (ABRC). The four libraries
from ABRC were size-fractionated with inserts of 0.5-1 kb (CD4-13),
1-2 kb (CD4-14), 2-3 kb (CD4-15), and 3-6 kb (CD4-16). All
libraries are of high quality and have been used by several dozen
groups to isolate genes. The pBluescript.RTM. phagemids from the
Lambda ZAP II vector were subjected to mass excision and the
libraries were recovered as plasmids according to standard
procedures.
[0164] Alternatively, the cDNA inserts in the CD4-13 (Lambda ZAP II
vector) were recovered by digestion with NotI. Digestion with NotI
in most cases liberated the entire Arabidopsis thaliana cDNA insert
because the original library was assembled with NotI adapters. NotI
is an 8-base cutter that infrequently cleaves plant DNA. In order
to insert the NotI fragments into a transcription plasmid, the
pBS735 transcription plasmid (FIG. 4) was digested with PacI/XhoI
and ligated to an adapter DNA sequence created from the
oligonucleotides 5'-TCGAGCGGCCGCAT-3' (SEQ ID NO: 18) and
5'-GCGGCCGC-3' (SEQ ID NO: 19). The resulting plasmid pBS740 (FIG.
5) contains a unique NotI restriction site for bidirectional
insertion of NotI fragments from the CD4-13 library. Recovered
colonies were prepared from these for plasmid minipreps with a
Qiagen BioRobot 9600.RTM.). The plasmid DNA preps performed on the
BioRobot 9600.RTM. are done in 96-well format and yield
transcription quality DNA. An Arabidopsis cDNA library was
transformed into the plasmid and analyzed by agarose gel
electrophoresis to identify clones with inserts. Clones with
inserts are transcribed in vitro and inoculated onto N. benthamiana
or Arabidopsis thaliana. Selected leaf disks from transfected
plants are then taken for biochemical analysis.
Example 7
[0165] High throughput robotics.
[0166] The efficiency of inoculation of subject organisms such as
plants is improved by using means of high throughput robotics. For
example, host plants such as Arabidopsis thaliana were grown in
microtiter plates such as the standard 96-well and 384-well
microtiter plates. A robotic handling arm then moved the plates
containing the organism to a colony picker or other robot that
delivered inoculations to each plant in the well. By this
procedure, inoculation was performed in a very high speed and high
throughput manner. It is preferable that the plant is a germinating
seed or at least in the development cycle to enable access to the
cells to be transfected. Equipment used for automated robotic
production line include, but not be limited to, robots of these
types: electronic multichannel pipetmen, Qiagen BioRobot 9600.RTM.,
Robbins Hydra liquid handler, Flexys Colony Picker, New Brunswick
automated plate pourer, GeneMachines HiGro shaker incubator, New
Brunswick floor shaker, three Qiagen BioRobots, MJ Research PCR
machines (PTC-200, Tetrad), ABI 377 sequencer and Tecan Genesis
RSP200 liquid handler.
Example 8
[0167] Genomic DNA library construction in a recombinant viral
nucleic acid vector.
[0168] Genomic DNAs represented in BAC (bacterial artificial
chromosome) or YAC (yeast artificial chromosome) libraries are
obtained from the Arabidopsis Biological Resource Center (ABRC).
The BAC/YAC DNAs are mechanically size-fractionated, ligated to
adapters with cohesive ends, and shotgun-cloned into recombinant
viral nucleic acid vectors. Alternatively, mechanically
size-fractionated genomic DNAs are blunt-end ligated into a
recombinant viral nucleic acid vector. Recovered colonies are
prepared for plasmid minipreps with a Qiagen BioRobot 9600.RTM..
The plasmid DNA preps done on the BioRobot 9600.RTM. are assembled
in 96-well format and yield transcription quality DNA. The
recombinant viral nucleic acid/Arabidopsis genomic DNA library is
analyzed by agarose gel electrophoresis (template quality control
step) to identify clones with inserts. Clones with inserts are then
transcribed in vitro and inoculated onto N. benthamiana and/or
Arabidopsis thaliana. Selected leaf disks from transfected plants
are then be taken for biochemical analysis.
[0169] Genomic DNA from Arabidopsis typically contains a gene every
2.5 kb (kilobases) on average. Genomic DNA fragments of 0.5 to 2.5
kb obtained by random shearing of DNA were shotgun assembled in a
recombinant viral nucleic acid expression/knockout vector library.
Given a genome size of Arabidopsis of approximately 120,000 kb, a
random recombinant viral nucleic acid genomic DNA library would
need to contain minimally 48,000 independent inserts of 2.5 kb in
size to achieve 1.times.coverage of the Arabidopsis genome.
Alternatively, a random recombinant viral nucleic acid genomic DNA
library would need to contain minimally 240,000 independent inserts
of 0.5 kb in size to achieve 1.times.coverage of the Arabidopsis
genome. Assembling recombinant viral nucleic acid
expression/knockout vector libraries from genomic DNA rather than
cDNA has the potential to overcome known difficulties encountered
when attempting to clone rare, low-abundance mRNA's in a cDNA
library. A recombinant viral nucleic acid expression/knockout
vector library made with genomic DNA would be especially useful as
a gene silencing knockout library. In addition, the Dual
Heterologous Subgenomic Promoter Expression System (DHSPES)
expression/knockout vector library made with genomic DNA would be
especially useful for expression of genes lacking introns.
Furthermore, other plant species with moderate to small genomes
(e.g. rose, approximately 80,000 kb) would be especially useful for
recombinant viral nucleic acid expression/knockout vector libraries
made with genomic DNA. A recombinant viral nucleic acid
expression/knockout vector library can be made from existing
BAC/YAC genomic DNA or from newly-prepared genomic DNAs for any
plant species.
Example 9
[0170] Genomic DNA or cDNA library construction in a DHSPES vector,
and transfection of individual clones from said vector library onto
T-DNA tagged or transposon tagged or mutated plants.
[0171] Genomic DNA or cDNA library construction in a recombinant
viral nucleic acid vector, and transfection of individual clones
from the vector library onto T-DNA tagged or transposon tagged or
mutated plants may be performed according to the procedure set
forth in Example 7. Such a protocol may be easily designed to
complement mutations introduced by random insertional mutagenesis
of T-DNA sequences or transposon sequences.
Example 10
[0172] Identification of nucleotide sequences involved in the
regulation of plant growth by cytoplasmic inhibition of gene
expression using viral derived RNA (GTP binding proteins).
[0173] In the following examples, we show: (1) a method for
producing antisense RNA using an RNA viral vector, (2) a method to
produce viral-derived antisense RNA in the cytoplasm, (3) a method
to inhibit the expression of endogenous plant proteins in the
cytoplasm by viral antisense RNA, and (4) a method to produce
transfected plants containing viral antisense RNA, such method is
much faster than the time required to obtain genetically engineered
antisense transgenic plants. Systemic infection and expression of
viral antisense RNA occurs as short as four days post inoculation,
whereas it takes several months or longer to create a single
transgenic plant. These examples demonstrates that novel positive
strand viral vectors, which replicate solely in the cytoplasm, can
be used to identify genes involved in the regulation of plant
growth by inhibiting the expression of specific endogenous genes.
These examples enable one to characterize specific genes and
biochemical pathways in transfected plants using an RNA viral
vector.
[0174] Tobamoviral vectors have been developed for the heterologous
expression of uncharacterized nucleotide sequences in transfected
plants. A partial Arabidopsis thaliana cDNA library was placed
under the transcriptional control of a tobamovirus subgenomic
promoter in a RNA viral vector. Colonies from transformed E. coli
were automatically picked using a Flexys robot and transferred to a
96 well flat bottom block containing terrific broth (TB) Amp 50
ug/ml. Approximately 2000 plasmid DNAs were isolated from overnight
cultures using a BioRobot and infectious RNAs from 430 independent
clones were directly applied to plants. One to two weeks after
inoculation, transfected Nicotiana benthamiana plants were visually
monitored for changes in growth rates, morphology, and color. One
set of plants transfected with 740 AT #120 were severely stunted.
DNA sequence analysis revealed that this clone contained an
Arabidopsis GTP binding protein open reading frame (ORF) in the
antisense orientation. This demonstrates that an episomal RNA viral
vector can be used to deliberately alter the metabolic pathway and
cause plant stunting. In addition, our results suggest that the
Arabidopsis antisense transcript can turn off the expression of the
N. benthamiana gene.
[0175] Construction of an Arabidopsis thaliana cDNA library in an
RNA viral vector.
[0176] An Arabidopsis thaliana CD4-13 cDNA library was digested
with NotI. DNA fragments between 500 and 1000 bp were isolated by
trough elution and subcloned into the NotI site of pBS740. E. coli
C600 competent cells were transformed with the pBS740 AT library
and colonies containing Arabidopsis cDNA sequences were selected on
LB Amp 50 ug/ml. Recombinant C600 cells were automatically picked
using a Flexys robot and then transferred to a 96 well flat bottom
block containing terrific broth (TB) Amp 50 ug/ml. Approximately
2000 plasmid DNAs were isolated from overnight cultures using a
BioRobot (Qiagen) and infectious RNAs from 430 independent clones
were directly applied to plants.
[0177] Isolation of a gene encoding a GTP binding protein.
[0178] One to two weeks after inoculation, transfected Nicotiana
benthamiana plants were visually monitored for changes in growth
rates, morphology, and color. Plants transfected with 740 AT #120
(FIG. 6) were severely stunted. Plasmid 740 AT #120 contains the
TMV-U1 126-, 183-, and 30-kDa ORFs, the TMV-U5 coat protein gene
(U5 cp), the T7 promoter, an Arabidopsis thaliana CD4-13 NotI
fragment, and part of the pUC19 plasmid. The TMV-U1 subgenomic
promoter located within the minus strand of the 30-kDa ORF controls
the synthesis of the CD4-13 antisense subgenomic RNA.
[0179] DNA sequencing and computer analysis.
[0180] A 782 bp NotI fragment of 740 AT #120 containing the
ADP-ribosylation factor (ARF) cDNA was characterized. DNA sequence
of NotI fragment of 740 AT #120 (774 base pairs) is as follows:
3 5'-CCGAAACATTCTTCGTAGTGAAGCAAAATGGGGTTGAGTTTCGCCAAGCTGTTTA
GCAGGCTTTTTGCCAAGAAGGAGATGCGAATTCTGATGGTTGGTCTTGATGCTGCTG
GTAAGACCACAATCTTGTACAAGCTCAAGCTCGGAGAGATTGTCACCACCATCCCTA
CTATTGGTTTCAATGTGGAAACTGTGGAATACAAGAACATTAGTTTCACCGTGTGGG
ATGTCGGGGGTCAGGACAAGATCCGTCCCTTGTGAGACACTACTTCCAGAACACTCA
AGGTCTAATCTTTGTTGTTGATAGCAATGACAGAGACAGAGTTGTTGAGGCTCGAGA
TGAACTCCACAGGATGCTGAATGAGGACGAGCTGCGTGATGCTGTGTTGCTTGTGTT
TGCCAACAAGCAAGATCTTCCAAATGCTATGAACGCTGCTGAAATCACAGATAAGC
TTGGCCTTCACTCCCTCCGTCAGCGTCATTGGTATATCCAGAGCACATGTGCCACTTC
AGGTGAAGGGCTTTATGAAGGTCTGGACTGGCTCTCCAACAACATCGCTGGCAAGG
CATGATGAGGGAGAAATTGCGTTGCATCGAGATGATTCTGTCTGCTGTGTTGGGATC
TCTCTCTGTCTTGATGCAAGAGAGATTATAAATATTATCTGAACCTTTTTGCTTTTTT
GGGTATGTGAATGTTTCTTATTGTGCAAGTAGATGGTCTTGTACCTAAAAATTTACTA
GAAGAACCCTTTTAAATAGCTTTCGTGTATTGT-3' (SEQ ID NO:20).
[0181] The nucleotide sequencing of 740 AT #120 was carried out by
dideoxy termination using double stranded templates (Sanger et al.
1977). Nucleotide sequence analysis and amino acid sequence
comparisons were performed using DNA Strider, PCGENE and NCBI Blast
programs. 740 AT #120 contained an open reading frame (ORF) in the
antisense orientation that encodes a protein of 181 amino acids
with an apparent molecular weight of 20,579 Daltons. FIG. 7 shows a
nucleotide sequence comparison of A. thalana 740 AT #120 and A.
thaliana est AA042085, SEQ ID NOs: 21 and 22. The nucleotide
sequence from 740 AT #120 is also compared with a rice (Oryza
sativa) ADP ribosylation factor AF012896, SEQ ID NOs: 23 and 24
(FIG. 8); which shows 82% (456/550) positives and identities. The
nucleotide sequence from 740 AT #120 exhibits a high degree of
homology (81-84% identity and positive) to rice, barley, carrot,
corn and A. thaliana DNA encoding ARFs (Table 1). The amino acid
sequence derived from 740 AT #120 exhibits an even higher degree of
homology (96-98% identity and 97-98% positive) to ARFs from rice,
carrot, corn and A. thaliana.(Table 2).
[0182] The protein encoded by 740 AT #120, 120P, contained three
conserved domains: the phosphate binding loop motif, GLDAAGKT, SEQ
ID NO:25 (consensus GXXXXGKS/T); the G' motif, DVGGQ, SEQ ID NO:25
(consensus DXXGQ), a sequence which interacts with the
gamma-phosphate of GTP; and the G motif NKQD, SEQ ID NO:26
(consensus NKXD), which is specific for guanidinyl binding. The
120P contains a putative glycine-myristoylation site at position 2,
a potential N-glycosylation site (NXS) at position 60, and several
putative serine/threonine phosphorylations sites.
4TABLE 1 740 AT #120 Nucleotide sequence comparison Score Expect
Identities Positives barley E10542 540.8 bits (1957) 1.4e-157
461/548 (84%) 461/548 (84%) A. thaliana M95166 538.5 bits (1949)
7.4e-157 461/550 (83%) 461/550 (83%) rice AF012896 537.7 bits
(1946) 1.3e-156 462/553 (83%) 462/553 (83%) carrot D45420 531.4
bits (1923) 9.8e-155 471/579 (81%) 471/579 (81%) corn X80042 512.3
bits (1854) 6.8e-149 450/549 (81%) 450/549 (81%)
[0183]
5TABLE 2 Amino acid sequence comparison of 740 AT #120 with ARFs
from other organisims. Score Expect Identities Positives A.
thaliana ARF1 g543841 365 bits (928) e-101 179/181 (98%) 179/181
(98%) rice g1703380 363 bits (921) e-100 177/181 (97%) 179/181
(98%) corn g1351974 356 bits (905) 3e-98 174/181 (96%) 179/181
(98%) carrot g1703375 362 bits (919) e-100 177/181 (97%) 178/181
(97%)
Example 11
[0184] Isolation of an Arabidopsis thaliana ARF genomic clone
[0185] A genomic clone encoding A. thaliana ARF can be isolated by
probing filters containing A. thaliana BAC clones using a 32P
labeled 740 AT #120 NotI insert. Other members of the A. thaliana
ARF multigene family have been identified using programs of the
University of Wisconsin Genetic Computer Group. The BAC clone
T08113 located on chromosome II has a high degree of homology to
740 AT #120 (78% to 86% identity).
Example 12
[0186] Construction of a Nicotiana benthamiana cDNA library.
[0187] Vegetative N. benthamiana plants were harvested 3.3 weeks
after sowing and sliced up into three groups of tissue: leaves,
stems and roots. Each group of tissue was flash frozen in liquid
nitrogen and total RNA was isolated from each group separately
using the following hot borate method (Larry Smart and Thea
Wilkins, 1995). Frozen tissue was ground to a fine powder with a
pre-chilled mortar and pestle, and then further homogenized in
pre-chilled glass tissue grinder. Immediately thereafter, 2.5 ml/g
tissue hot (.about.82.degree. C.) XT Buffer (0.2 M borate
decahydrate, 30 mM EGTA, 1% (w/v) SDS. Adjusted pH to 9.0 with 5 N
NaOH, treated with 0.1% DEPC and autoclaved. Before use, added 1%
deoxycholate (sodium salt), 10 mM dithiothreitol, 15 Nonidet P-40
(NP-40) and 2% (w/v) polyvinylpyrrilidone, MW 40,000 (PVP-40)) was
added to the ground tissue. The tissue was homogenized 1-2 minutes
and quickly decanted to a pre-chilled Oak Ridge centrifuge tube
containing 105 .mu.l of 20 mg/ml proteinase K in DEPC treated
water. The tissue grinder was rinsed with an additional 1 ml hot XT
Buffer per g tissue, which was then added to rest of the
homogenate. The homogenate was incubated at 42.degree. C. at 100
rpm for 1.5 h. 2 M KCl was added to the homogenate to a final
concentration of 160 mM, and the mixture was incubated on ice for 1
h to precipitate out proteins. The homogenate was centrifuged at
12,000.times.g for 20 min at 4.degree. C., and the supernatant was
filtered through sterile miracloth into a clean 50 ml Oak Ridge
centrifuge tube. 8 M LiCl was added to a final concentration of 2 M
LiCl and incubated on ice overnight. Precipitated RNA was collected
by centrifugation at 12,000.times.g for 20 min at 4.degree. C. The
pellet was washed three times in 3-5 ml 4.degree. C. 2 M LiCl. Each
time the pellet was resuspended with a glass rod and then spun at
12,000.times.g for 20 min at 4.degree. C. The RNA pellet was
suspended in 2 ml 10 mM Tris-HCl (pH 7.5), and purified from
insoluble cellular components by spinning at 12,000.times.g for 20
min at 4.degree. C. The RNA containing supernatant was transferred
to a 15 ml Corex tube and precipitated overnight at -20.degree. C.
with 2.5 volumes of 100% ethanol. The RNA was pelleted by
centrifugation at 9,800.times.g for 30 min at 4.degree. C. The RNA
pellet was washed in 1-2 ml cold 70.degree. C. ethanol and
centrifuged at 9,800.times.g for 5 min at 4.degree. C. Residual
ethanol was removed from the RNA pellet under vacuum, and the RNA
was resuspended in 200 .mu.l DEPC treated dd-water and transferred
to a 1.5 ml microfuge tube. The Corex tube was rinsed in 100 .mu.l
DEPC-treated dd-water, which was then added to the rest of the RNA.
The RNA was then precipitated with {fraction (1/10)} volume of 3 M
sodium acetate, pH 6.0 and 2.5 volumes of cold 100% ethanol at
-20.degree. C. for 1-2 h. The tube was centrifuged for 20 min at
16,000.times.g, and the RNA pellet washed with cold 70% ethanol,
and centrifuged for 5 min at 16,000.times.g. After drying the
pellet under vacuum, the RNA was resuspended in DEPC-treated water.
This is the total RNA.
[0188] Messenger RNA was purified from total RNA using an
Poly(A)Pure kit (Ambion, Austin Tex.), following the manufacturer's
instructions. A reverse transcription reaction was used to
synthesize cDNA from the mRNA template, using the Stratagene kit.
The cDNA was subcloned into the bacteriophage at EcoRI/XhoI by
ligating to arms using the Gigapack III Gold kit (Stratagene, La
Jolla, Calif.), following the manufacturer's instructions.
Example 13
[0189] Isolation and characterization of a cDNA encoding Nicotiana
benthamiana ADP-ribosylation factor.
[0190] A 488 bp cDNA from N. benthamiana stem cDNA library was
isolated by polymerase chain reaction (PCR) using the following
oligonucleotides: ATARFK15, 5' AAG AAG GAG ATG CGA ATT CTG ATG GT
3' (upstream)(SEQ ID NO:27), ATARFN176, 5' ATG TTG TTG GAG AGC CAG
TCC AGA CC 3' (downstream)(SEQ ID NO: 28). The vent polymerase in
the reaction was inactivated using phenol/chloroform, and the PCR
product was directly cloned into the HincII site in Bluescript
KS+(Strategene). The plasmid map of KS+Nb ARF #3, which contains
the N. benthamiaca ARF ORF in pBluescript KS+is shown in FIG. 9.
The nucleotide sequence of N. benthamiana KS+Nb ARF#3, which
contains partial ADP-ribosylation factor ORF, was determined by
dideoxynucleotide sequencing. The nucleotide sequence from KS+Nb
ARF#3, SEQ ID NO: 29, had a strong similarity to other plant
ADP-ribosylation factor sequences (82 to 87% identity at the
nucleotide level). The nucleotide sequence comparison of N.
benthamiana KS+Nb ARF#3 and A. thaliana 740 AT #120 is shown in
FIG. 10 (SEQ ID NOs: 26 and 27).
[0191] A full-length cDNA encoding ARF is isolated by screening the
N. benthamiana cDNA library by colony hybridization using a
.sup.32P-labeled N. benthamiana KS+/Nb ARF #3 probe. Hybridization
is carried out at 42.degree. C. for 48 hours in 50% formamide,
5.times.SSC, 0.02 M phosphate buffer, 5.times.Denhart's solution,
and 0.1 mg/ml sheared calf thymus DNA. Filters are washed at
65.degree. C. in 0.1.times.SSC, 0.1% SDS prior to
autoradiography.
Example 14
[0192] Rapid isolation of cDNAs encoding rice, barley corn,
soybean, and other ADP-ribosylation factor
[0193] Libraries containing full-length cDNAs from rice, barley,
corn, soybean and other important crops are obtained from public
and private sources or can be prepared from plant mRNAs. The cDNAs
are inserted in viral vectors or in small subcloning vectors such
as pBluescript (Strategene), pUC18, M13, or pBR322. Transformed
bacteria (E. coli) are then plated on large petri plates or
bioassay plates containing the appropriate media and antibiotic.
Individual clones are selected using a robotic colony picker and
arrayed into 96 well microtiter plates. The cultures are incubated
at 37.degree. C. until the transformed cells reach log phase.
Aliquots are removed to prepare glycerol stocks for long term
storage at -80.degree. C. The remainder of the culture is used to
inoculate an additional 96 well microtiter plate containing
selective media and grown overnight. DNAs are isolated from the
cultures and stored at -20.degree. C. Using a robotic unit such as
the Qbot (Genetix), the E. coli transformants or DNAs are rearrayed
at high density on nylon filters or glass slides. Full-length cDNAs
encoding ARFs from rice, barley, corn, soybean and other important
crops are isolated by screening the various filters of slides by
hybridization using a .sup.32P-labeled or fluorescent N.
benthamiana KS+/Nb ARF #3 probe, or .sup.32P-labeled Arabidopsis
740 AT #120 NotI insert.
Example 15
[0194] Rapid isolation of genomic clones encoding ADP ribosylation
factor from rice, barley, corn, soybean, and other plant
[0195] Genomic libraries containing sequences from rice, barley,
corn, soybean and other important crops are obtained from public
and private sources, or are prepared from plant genomic DNAs. BAC
clones containing entire plant genomes have been constructed and
organized in minimal overlapping order. Individual BACs are sheared
to 500-1000 bp fragments and directly cloned into viral vectors.
Approximate 200-500 clones that completely cover an entire BAC will
form a BAC viral vector sublibrary. These libraries can be stored
as bacterial glycerol stocks at -80.degree. C. and as DNA at
-20.degree. C. Genomic clones are identified by first probing
filters of BACs with a .sup.32P-labeled or fluorescent N.
benthamiana KS+/Nb ARF #3 probe, or .sup.32P-labeled Arabidopsis
740 AT #120 NotI insert. BACs that hybridize to the probe are
selected and their corresponding BAC viral vector sublibrary is
used to produce infectious RNA. Plants that are transfected with
the BAC sublibrary are screened for loss of function (for example,
stunted plants). The inserts from these clones or their
corresponding plasmid DNAs are characterized by dideoxy sequencing.
This provides a rapid method to obtain the genomic sequence for the
plant ARFs.
Example 16
[0196] Identification of nucleotide sequences involved in the
regulation of plant development by cytoplasmic inhibition of gene
expression using viral derived RNA (G-protein coupled
receptor).
[0197] This example again demonstrates that an episomal RNA viral
vector can be used to deliberately manipulate a signal transduction
pathway in plants. In addition, our results suggest that the
Arabidopsis antisense transcript can turn off the expression of the
N. benthamiana gene.
[0198] A partial Arabidopsis thaliana cDNA library was placed under
the transcriptional control of a tobamovirus subgenomic promoter in
a RNA viral vector. (see EXAMPLE 9). Colonies from transformed E.
coli were automatically picked using a Flexys robot and transferred
to a 96 well flat bottom block containing terrific broth (TB) Amp
50 ug/ml. Approximately 2000 plasmid DNAs were isolated from
overnight cultures using a BioRobot and infectious RNAs from 430
independent clones were directly applied to plants. One to two
weeks after inoculation, transfected Nicotiana benthamiana plants
were visually monitored for changes in growth rates, morphology,
and color. One set of plants transfected with 740 AT #88 (FIG. 11)
developed a white phenotype on the infected leaf tissue. DNA
sequence analysis revealed that this clone contained an Arabidopsis
G-protein coupled receptor open reading frame (ORF) in the
antisense orientation.
[0199] DNA sequencing and computer analysis.
[0200] A 750 bp NotI fragment of 740 AT #88 containing the
G-protein coupled receptor cDNA was characterized. DNA sequence of
NotI fragment of 740 AT #88 (750 bp) is as follows:
[0201] 5'-TTTCGATCTAAGGTTCGTGATCTCCTTCTTCTCTACGAAGTTTACACTTTTTCTTCA
AAGGAAACAATGAGCCAGTACAATCAACCTCCCGTTGGTGTTCCTCCTCCTCAAGGT
TATCCACCGGAGGGATATCCAAAAGATGCTTATCCACCACAAGGATATCCTCCTCAG
GGATATCCTCAGCAAGGCTATCCACCTCAGGGATATCCTCAACAAGGTTATCCTCAG
CAAGGATATCCTCCACCGTACGCGCCTCAATATCCTCCACCACCGCAAGCATCAGCA
ACAACAGAGCAAGTCCTGGCTTTCTAGAAGGATGTCTTGCTGCTCTGTGTTGTTGCT
GTCTCTTGGATGCTTGCTTCTGATTGGAGTCTCTCTCTCTCTGCATAAAGCTTCGGGA
TTTATTTGTAAGAGGGTTTTTGGGTTAAACAAAAACCTTAATTGATTTGTGGGGCATT
AAAAATGAATCTCTCGATGATTCTCTTCGTTTATGTGGTAATGTTCTTCGGTTATAAC
ATTTAACATTGCTATCGACGTTCTGCCTAGTTGGATTTGATTATTGGGAATGTAAATT
GGTTGGGAAGACACCGGGCCGTTAATGACAGAACCCGAACTGAGATGGAGTATGAT
CTGAAATATTTAAAACAATCCTCGCGACATAGCCTCCAATCTCATCGTAAATATTCT
TTTTAAACTATTCCCAATCTTAACTTTTATAGTCTGGTCGACTGACCACTACTCTTTTT CCTT-3'
(SEQ ID NO: 30) The nucleotide sequencing of 740 AT #88 was carried
out by dideoxy termination using double stranded templates (Sanger
et al., Proc. Natl. Acad. Sci. USA 74(12):5463-5467 (1977)).
Nucleotide sequence analysis and amino acid sequence comparisons
were performed using DNA Strider, PCGENE and NCBI Blast
programs.
Example 17
[0202] Identification of nucleotide sequences containing an
Arabidopsis S 18 ribosomal protein open reading frame.
[0203] One to two weeks after inoculation, transfected Nicotiana
benthamiana plants were visually monitored for changes in growth
rates, morphology, and color. one set of plants transfected with
740 AT #377 (FIG. 12) were severely stunted. DNA sequence analysis
(FIG. 13, SEQ ID NO: 31) revealed that this clone contained an
Arabidopsis S18 ribosomal protein open reading frame (ORF) in the
antisense orientation.
Example 18
[0204] Identification of L19 ribosomal protein gene involved in the
regulation of plant growth by cytoplasmic inhibition of gene
expression using viral derived RNA.
[0205] One to two weeks after inoculation, transfected Nicotiana
benthamiana plants were visually monitored for changes in growth
rates, morphology, and color. One set of plants transfected with
740 AT #2483 (FIG. 14) were severely stunted. DNA sequence analysis
(FIG. 15, SEQ ID NO: 32) revealed that this clone contained an
Arabidopsis L19 ribosomal protein open reading frame (ORF) in the
antisense orientation. The 740 AT #2483 nucelotide sequence
exhibited a high degree of homology (77-78% identities and
positives) to plant, L19 ribosomal proteins genes (Table 3).
6TABLE 3 740 AT #2483 Nucleotide sequence comparison Clone Score
pValue Identities Positives A. thaliana AF075597 389 (107.5 bits)
2.60E-38 101/130 (77%) 101/130 (77%) Rice mRNA for ribosomal 198
(54.7 bits) 2.20E-10 50/64 (78%) 50/64 (78%) protein L19 D21304 N.
tabacum L19 194 (53.6 bits) 3.50E-05 50/64 (78%) 50/64 (78%) mRNA
Z31720
Example 19
[0206] Novel requirements for production of infectious viral vector
in vitro derived RNA transcripts.
[0207] This example demonstrates the production of highly
infectious viral vector transcripts containing 5' nucleotides with
reference to the virus vector.
[0208] Construction of a library of subgenomic cDNA clones of TMV
and BMV has been described in Dawson et al., Proc. Natl. Acad. Sci.
USA 83:1832-1836 (1986) and Ahlquist et al., Proc. Natl. Acad. Sci.
USA 81:7066-7070 (1984). Nucleotides were added between the
transcriptional start site of the promoter for in vitro
transcription, in this case T7, and the start of the cDNA of TMV in
order to maximize transcription product yield and possibly obviate
the need to cap virus transcripts to insure infectivity. The
relevant sequence is the T7 promoter . . . TATAGATATTTT . . . (SEQ
ID NO: 33) where the A indicates the base preceding is the start
site for transcription and the bold letter is the first base of the
TMV cDNA. Three approaches were taken: 1) addition of G, GG or GGG
between the start site of transcription and the TMV cDNA . . .
TATAGGTATTT, (SEQ ID NO: 34), . . . and associated sequences); 2)
addition of G and a random base (GN or N2) or a G and two random
bases (GNN or N3) between the start site of transcription and the
TMV cDNA ( . . . TATAGNTATTT (SEQ ID NO: 35), . . . and associated
sequences), and the addition of a GT and a single random base
between the start site of transcription and the TMV cDNA ( . . .
TATAGTNGTATTT (SEQ ID NO: 36), . . . and associated sequences). The
use of random bases was based on the hypothesis that a particular
base may be best suited for an additional nucleotide attached to
the cDNA, since it will be complementary to the normal nontemplated
base incorporated at the 3'-end of the TMV (-) strand RNA. This
allows for more ready mis-initiation and restoration of wild type
sequence. The GTN would allow the mimicking of two potential sites
for initiation, the added and the native sequence, and facilitate
more ready mis-initiation of transcription in vivo to restore the
native TMV cDNA sequence. Approaches included cloning GFP
expressing TMV vector sequences into vectors containing extra G, GG
or GGG bases using standard molecular biology techniques. Likewise,
full length PCR of TMV expression clone 1056 was done to add N2, N3
and GTN bases between the T7 promoter and the TMV cDNA.
Subsequently, these PCR products were cloned into pUC based
vectors. Capped and uncapped transcripts were made in vitro and
inoculated to tobacco protoplasts or Nicotiana benthamiana plants,
wild type and 30k expressing transgenics. The results are that an
extra G, . . . TATAGGTATTTT (SEQ ID NO: 37), . . . , or a GTC, . .
. TATAGTCGTATTTT (SEQ ID NO: 38), . . . , were found to be well
tolerated as additional 5' nucleotides on the 5' of TMV vector RNA
transcripts and were quite infectious on both plant types and
protoplasts as capped or non-capped transcripts. Other sequences
may be screened to find other options. Clearly, infectious
transcripts may be derived with extra 5' nucleotides.
[0209] Other derivatives based on the putative mechanistic function
of the GTN strategy that yielded the GTC functional vector are to
use multiple GTN motifs preceeding the 5' most nt of the virus cDNA
or the duplication of larger regions of the 5'-end of the TMV
genome. For example: TATAAGTNGTNGTATT, (SEQ ID NO: 39), . . . or
TATAAGTNGTNGTNGTNGTATT (SEQ ID NO: 40), . . . or TATAAGTATTTGTATTT
(SEQ ID NO: 41), . . . . In this manner the replication mediated
repair mechanism may be potentiated by the use of multiple
recognition sequences at the 5'-end of transcribed RNA. The
replicated progeny may exhibit the results of reversion events that
would yield the wild type virus 5' virus sequence, but may include
portions or entire sets of introduced additional base sequences.
This strategy can be applied to a range of RNA viruses or RNA viral
vectors of various genetic arrangements derived from wild type
virus genome. This would require the use of sequences particular to
that of the virus used as a vector.
Example 20
[0210] Infectivity of uncapped transcripts.
[0211] Two TMV-based virus expression vectors were initially used
in these studies pBTI 1056 which contains the T7 promoter followed
directly by the virus cDNA sequence ( . . . TATAGTATT . . . ), and
pBTI SBS60-29 which contains the T7 promoter (underlined) followed
by an extra guanine residue then the virus cDNA sequence ( . . .
TATAGGTATTT . . . ). Both expression vectors express the cycle 3
shuffled green fluorescent protein (GFPc3) in localized infection
sites and systemically infected tissue of infected plants.
Transcriptions of each plasmid were carried out in the absence of
cap analogue (uncapped) or in the presence of 8-fold greater
concentration of RNA cap analogue than rGTP (capped).
Transcriptions were mixed with abrasive and inoculated on expanded
older leaves of a wild type Nicotiana benthamiana (Nb) plant and a
Nb plant expressing a TMV U1 30k movement protein transgene (Nb
30K). Four days post inoculation (dpi), long wave UV light was used
to judge the number of infection sites on the inoculated leaves of
the plants. Systemic, noninoculated tissues, were monitored from 4
dpi on for appearance of systemic infection indicating vascular
movement of the inoculated virus. Table 4 shows data from one
representative experiment.
7 TABLE 4 Local infection sites Systemic Infection Construct Nb Nb
30 K Nb Nb 30 K pBTI1056 Capped 5 6 yes yes Uncapped 0 5 no yes
PBTI SBS60-29 Capped 6 6 yes yes Uncapped 1 5 yes yes
[0212] Nicotiana tabacum protoplasts were infected with either
capped or uncapped transcriptions (as described above) of pBTI
SBS60 which contains the T7 promoter followed directly by the virus
cDNA sequence (TATAGTATT . . . ). This expression vector also
expresses the GFPc3 gene in infected cells and tissues. Nicotiana
tabacum protoplasts were transfected with 1 mcl of each
transcriptions. Approximately 36 hours post infection transfected
protoplasts were viewed under UV illumination and cells showing
GFPc3 expression. Approximately 80% cells transfected with the
capped PBTI SBS60 transcripts showed GFP expression while 5% of
cells transfected with uncapped transcripts showed GFP expression.
These experiments were repeated with higher amounts of uncapped
inoculum. In this case a higher proportion of cells, >30% were
found to be infected at this time with uncapped transcripts, where
>90% of cells infected with greater amounts of capped
transcripts were scored infected.
[0213] These results indicate that, contrary to the practiced art
in scientific literature and in issued patents (Ahlquist et al.,
U.S. Pat. No. 5,466,788), uncapped transcripts for virus expression
vectors are infective on both plants and in plant cells, however
with much lower specific infectivity. Therefore, capping is not a
prerequisite for establishing an infection of a virus expression
vector in plants; capping just increases the efficiency of
infection. This reduced efficiency can be overcome, to some extent,
by providing excess in vitro transcription product in an infection
reaction for plants or plant cells.
[0214] The expression of the 30K movement protein of TMV in
transgenic plants also has the unexpected effect of equalizing the
relative specific infectivity of uncapped verses capped
transcripts. The mechanism behind this effect is not fully
understood, but could arise from the RNA binding activity of the
movement protein stabilizing the uncapped transcript in infected
cells from prereplication cytosolic degradation.
[0215] Extra guanine residues located between the T7 promoter and
the first base of a virus cDNA lead to increased amount of RNA
transcript as predicted by previous work with phage polymerases.
These polymerases tend to initiate more efficiently at . . . TATAGG
or . . . TATAGGG than . . . TATAG. This has an indirect effect on
the relative infectivity of uncapped transcripts in that greater
amounts are synthesized per reaction resulting in enhanced
infectivity.
[0216] Data concerning cap dependent transcription of pBTI1056
GTN#28.
[0217] TMV-based virus expression vector pBTI 1056 GTN#28 which
contains the T7 promoter (underlined) followed GTC bases (bold)
then the virus cDNA sequence ( . . . TATAGTCGTATT SEQ ID NO: 42, .
. . ). This expression vector expresses the cycle 3 shuffled green
fluorescent protein (GFPc3) in localized infection sites and
systemically infected tissue of infected plants. This vector was
transcribed in vitro in the presence (capped) and absence
(uncapped) of cap analogue. Transcriptions were mixed with abrasive
and inoculated on expanded older leaves of a wild type Nicotiana
benthamiana (Nb) plant and a Nb plant expressing a TMV U1 30k
movement protein transgene (Nb 30K). Four days post inoculation
(dpi) long wave UV light was used to judge the number of infection
sites on the inoculated leaves of the plants. Systemic,
non-inoculated tissues, were monitored from 4 dpi on for appearance
of systemic infection indicating vascular movement of the
inoculated virus. Table 5 shows data from two representative
experiments at 11 dpi.
8 TABLE 5 Local infection sites Systemic Infection Construct Nb Nb
30 K Nb Nb 30 K Experiment 1 pBTI1056 GTN#28 Capped 18 25 yes yes
Uncapped 2 4 yes yes Experiment 2 pBTI1056 GTN#28 Capped 8 12 yes
yes Uncapped 3 7 yes yes
[0218] These data further support the claims concerning the utility
of uncapped transcripts to initiate infections by plant virus
expression vectors and further demonstrates that the introduction
of extra, non-viral nucleotides at the 5'-end of in vitro
transcripts does not preclude infectivity of uncapped
transcripts.
[0219] Although the invention has been described with reference to
the presently preferred embodiments, it should be understood that
various modifications can be made without departing from the spirit
of the invention.
Sequence CWU 1
1
42 1 26 DNA Tomato mosaic virus 1 ctcgcaaagt ttcgaaccaa atcctc 26 2
35 DNA Tomato mosaic virus 2 cggggtacct gggccccaac cgggggttcc ggggg
35 3 41 DNA Tomato mosaic virus 3 tcctcgagcc taggctcgca aagtttcgaa
ccaaatcctc a 41 4 35 DNA Tomato mosaic virus 4 cggggtacct
gggccccaac cgggggttcc ggggg 35 5 30 DNA Tomato mosaic virus 5
tgctcgagtg tgttcttcag ttttctgtca 30 6 30 DNA Tomato mosaic virus 6
aactcgagcg ctttgatttc tccgaagctt 30 7 31 DNA Ribgrass mosaic virus
7 tactcgaggt tcataagacc gcggtaggcg g 31 8 36 DNA Ribgrass mosaic
virus 8 cggggtacct gggcccctac ccggggttta gggagg 36 9 1543 DNA
Ribgrass mosaic virus 9 ctcgaggttc ataagaccgc ggtaggcgga gcgtttgttt
actgtagtat aattaaatat 60 ttgtcagata aaaggttgtt taaagatttg
ttttttgttt gactgagtcg ataatgtctt 120 acgagcctaa agttagtgac
ttccttgctc ttacgaaaaa ggaggaaatt ttacccaagg 180 ctttgacgag
attaaagact gtctctatta gtactaagga tgttatatct gttaaggagt 240
ctgagtccct gtgtgatatt gatttgttag tgaatgtgcc attagataag tataggtatg
300 tgggtgtttt gggtgttgtt ttcaccggtg aatggctggt accggatttc
gttaaaggtg 360 gggtaacagt gagcgtgatt gacaaacggc ttgaaaattc
cagagagtgc ataattggta 420 cgtaccgagc tgctgtaaag gacagaaggt
tccagttcaa gctggttcca aattacttcg 480 tatccattgc ggatgccaag
cgaaaaccgt ggcaggttca tgtgcgaatt caaaatctga 540 agatcgaagc
tggatggcaa cctctagctc tagaggtggt ttctgttgcc atggttacta 600
ataacgtggt tgttaaaggt ttgagggaaa aggtcatcgc agtgaatgat ccgaacgtcg
660 aaggtttcga aggtgtggtt gacgatttcg tcgattcggt tgctgcattc
aaggcgattg 720 acagtttccg aaagaaaaag aaaaagattg gaggaaggga
tgtaaataat aataagtata 780 gatatagacc ggagagatac gccggtcctg
attcgttaca atataaagaa gaaaatggtt 840 tacaacatca cgagctcgaa
tcagtaccag tatttcgcag cgatgtgggc agagcccaca 900 gcgatgctta
accagtgcgt gtctgcgttg tcgcaatcgt atcaaactca ggcggcaaga 960
gatactgtta gacagcagtt ctctaacctt ctgagtgcga ttgtgacacc gaaccagcgg
1020 tttccagaaa caggataccg ggtgtatatt aattcagcag ttctaaaacc
gttgtacgag 1080 tctctcatga agtcctttga tactagaaat aggatcattg
aaactgaaga agagtcgcgt 1140 ccatcggctt ccgaagtatc taatgcaaca
caacgtgttg atgatgcgac cgtggccatc 1200 aggagtcaaa ttcagctttt
gctgaacgag ctctccaacg gacatggtct gatgaacagg 1260 gcagagttcg
aggttttatt accttgggct actgcgccag ctacataggc gtggtgcaca 1320
cgatagtgca tagtgttttt ctctccactt aaatcgaaga gatatactta cggtgtaatt
1380 ccgcaagggt ggcgtaaacc aaattacgca atgttttagg ttccatttaa
atcgaaacct 1440 gttatttcct ggatcacctg ttaacgtacg cgtggcgtat
attacagtgg gaataactaa 1500 aagtgagagg ttcgaatcct ccctaacccc
gggtaggggc cca 1543 10 55 DNA Ribgrass mosaic virus 10 gatggcgcct
taatacgact cactatagtt ttatttttgt tgcaacaaca acaac 55 11 30 DNA
Ribgrass mosaic virus 11 cttgtgccct tcatgacgag ctatatcacg 30 12 496
DNA Ribgrass mosaic virus 12 ccttaatacg actcactata gttttatttt
tgttgcaaca acaacaacaa attacaataa 60 caacaaaaca aatacaaaca
acaacaacat ggcacaattt caacaaacag taaacatgca 120 aacattgcag
gctgccgcag ggcgcaacag cctggtgaat gatttagcct cacgacgtgt 180
ttatgacaat gctgtcgagg agctaaatgc acgctcgaga cgccctaagg ttcattactc
240 caaatcagtg tctacggaac agacgctgtt agcttcaaac gcttatccgg
agtttgagat 300 ttcctttact catacccaac atgccgtaca ctcccttgcg
ggtggcctaa ggactcttga 360 gttagagtat ctcatgatgc aagttccgtt
cggttctctg acgtacgaca tcggtggtaa 420 ctttgcagcg caccttttca
aaggacgcga ctacgttcac tgctgtatgc caaacttgga 480 tgtacgtgat atagct
496 13 55 DNA Ribgrass mosaic virus 13 gatggcgcct taatacgact
cactatagtt ttatttttgt tgcaacaaca acaac 55 14 37 DNA Ribgrass mosaic
virus 14 atcgtttaaa ctgggcccct acccggggtt agggagg 37 15 497 DNA
Ribgrass mosaic virus 15 ccttaatacg actcactata gttttatttt
tgttgcaaca acaacaacaa attacaataa 60 caacaaaaca aatacaaaca
acaacaacat ggcacaattt caacaaacag taaacatgca 120 aacattccag
gctgccgcag ggcgcaacag cctggtgaat gatttagcct cacgacgtgt 180
ttatgacaat gctgtcgagg agctaaatgc acgctcgaga cgccctaagg ttcattactc
240 caaatcagtg tctacggaac agacgctgtt agcttcaaac gcttatccgg
agtttgagat 300 ttcctttact catacccaaa catgccgtac actcccttgc
gggtggccta aggactcttg 360 agttagagta tctcatgatg caagttccgt
tcggttctct gacgtacgac atcggtggta 420 actttgcagc gcaccttttc
aaaggacgcg actacgttca ctgctgtatg ccaaacttgg 480 atgtacgtga tatagct
497 16 55 DNA Ribgrass mosaic virus 16 gatggcgcct taatacgact
cactatagtt ttatttttgt tgcaacaaca acaac 55 17 37 DNA Ribgrass mosaic
virus 17 atcgtttaaa ctgggcccct acccggggtt agggagg 37 18 14 DNA
Arabidopsis thaliana 18 tcgagcggcc gcat 14 19 8 DNA Arabidopsis
thaliana 19 gcggccgc 8 20 773 DNA Arabidopsis thaliana 20
ccgaaacatt cttcgtagtg aagcaaaatg gggttgagtt tcgccaagct gtttagcagg
60 ctttttgcca agaaggagat gcgaattctg atggttggtc ttgatgctgc
tggtaagacc 120 acaatcttgt acaagctcaa gctcggagag attgtcacca
ccatccctac tattggtttc 180 aatgtggaaa ctgtggaata caagaacatt
agtttcaccg tgtgggatgt cgggggtcag 240 gacaagatcc gtcccttgtg
agacactact tccagaacac tcaaggtcta atctttgttg 300 ttgatagcaa
tgacagagac agagttgttg aggctcgaga tgaactccac aggatgctga 360
atgaggacga gctgcgtgat gctgtgttgc ttgtgtttgc caacaagcaa gatcttccaa
420 atgctatgaa cgctgctgaa atcacagata agcttggcct tcactccctc
cgtcagcgtc 480 attggtatat ccagagcaca tgtgccactt caggtgaagg
gctttatgaa ggtctggact 540 ggctctccaa caacatcgct ggcaaggcat
gatgagggag aaattgcgtt gcatcgagat 600 gattctgtct gctgtgttgg
gatctctctc tgtcttgatg caagagagat tataaatatt 660 atctgaacct
ttttgctttt ttgggtatgt gaatgtttct tattgtgcaa gtagatggtc 720
ttgtacctaa aaatttacta gaagaaccct tttaaatagc tttcgtgtat tgt 773 21
404 DNA Arabidopsis thaliana 21 tccgaaacat tcttcgtact gaagcaaaat
ggggttgagt ttcgccaagc tgtttagcag 60 gctttttgcc aagaaggaga
tgcgaattct gatggttggt cttgatgctg ctggtaagac 120 cacaatcttg
tacaagctca agctcggaga gattgtcacc accatccctt actattggtt 180
tcaatgtgga aactgtggaa tacaagaaca ttagtttcac cgtgtggatg tcgggggtca
240 ggacaagatc cgtccgtccc ttgtggagac actacttcca gaacactcaa
ggtctaatct 300 ttgttgttga tagcaatgac agagacagag ttgttgaggc
tcgagatgaa ctccacagga 360 tgctgaatga ggacgagctg cgtgatgctg
tgttgcttgt gttt 404 22 400 DNA Arabidopsis thaliana misc_feature
(1)...(400) n= a, t, c or g 22 tccgaaacat tcttcgtagt gaagcaaaat
ggggttgagt ttcgccaagc tgtttagcag 60 gctttttgcc aagaaggaga
tgcgaattct gatggttggt cttgatgctg ctggtaagac 120 cacaatgttg
tacaagctca agctcggaga gattgtcacc accatcccta ctattggttt 180
caatgtggaa actgtggaat acaagaacat tagtttcacc gtgtgggatg tcgggggtca
240 ggacaagatc cgtcccttgt ggagacacta cttccagaac actcaaggtc
taatctttgt 300 tgttgatagc aatgacagag acagagttgt tgaggctcga
gatgaactcc acaggatgct 360 gnatgagnac gagctgcgtg atgctgtgtt
gcttgtgttt 400 23 550 DNA Arabidopsis thaliana 23 aaatggggtt
gagtttcgcc aagctgttta gcaggctttt tgccaagaag gagatgcgaa 60
ttctgatggt tggtcttgat gctgctggta agaccacaat cttgtacaag ctcaagctcg
120 gagagattgt caccaccatc cctactattg gtttcaatgt ggaaactgtg
gaatacaaga 180 acattagttt caccgtgtgg gatgtcgggg gtcaggacaa
gatccgtccc ttgtggagac 240 actacttcca gaacactcaa ggtctaatct
ttgttgttga tagcaatgac agagacagag 300 ttgttgaggc tcgagatgaa
ctccacagga tgctgaatga ggacgagctg cgtgatgctg 360 tgttgcttgt
gtttgccaac aagcaagatc ttccaaatgc tatgaacgct gctgaaatca 420
cagataagct tggccttcac tccctccgtc agcgtcattg gtatatccag agcacatgtg
480 ccacttcagg tgaagggctt tatgaaggtc tggactggct ctccaacaac
atcgctggca 540 aggcatgatg 550 24 550 DNA Oryza sativa 24 agatggggct
cacgttcacg aagctgttca gccgcctctt cgccaagaag gagatgagga 60
tcctcatggt cggtctcgat gcggccggta aaaccaccat cctctacaag ctcaagctcg
120 gcgagatcgt caccactatc cccaccatcg gttttaatgt cgaaactgtt
gagtacaaga 180 acattagctt caccgtttgg gatgttggtg gtcaggacaa
gatcaggccc ctgtggaggc 240 actatttcca gaacacccag ggcctcattt
ttgttgtgga cagcaatgac agagagcgtg 300 ttgttgaggc cagggatgag
ctccaccgta tgctgaatga ggatgagcta cgtgatgctg 360 tgctgctggt
gtttgcaaac aaacaagatc ttcctaatgc catgaacgct gctgagatca 420
ccgacaagct tggtctgcac tccttgcgcc agcggcactg gtacatccag agcacatgtg
480 ctacctctgg tgaggggttg tatgaggggc ttgactggct ttccaacaac
attgccaaca 540 aggcttgaag 550 25 8 PRT Arabidopsis thaliana 25 Gly
Leu Asp Ala Ala Gly Lys Thr 1 5 26 389 DNA Arabidopsis thaliana 26
tggtcttgat gctgctggta agaccacaat cttgtacaag ctcaagctcg gagagattgt
60 caccaccatc cctactattg gtttcaatgt ggaaactgtg gaatacaaga
acattagttt 120 caccgtggga tgtcgggggt caggacaaga tccgtccctt
gtggagacac tacttccaga 180 acactcaagg tctaatcttt gttgttgata
gcaatgacag agacagagtt gttgaggctc 240 gagatgaact ccacaggatg
ctgaatgagg acgagctgcg tgatgctgtg ttgcttgtgt 300 ttgccaacaa
gcaagatctt ccaaatgcta tgaacgctgc tgaaatcaca gataagcttg 360
gccttcactc cctccgtcag cgtcattgg 389 27 391 DNA N. benthiamiana 27
cggtcttgat gcagctggta aaaccaccat attgtacaag ctcaagctgg gagagatagt
60 taccactatt cctaccattg gattcaatgt ggagactgtt gaatacaaga
acataagctt 120 cacggtctgg gatgttggtg gtcaggacaa gatccgacca
ttgtggaggc attacttcca 180 aaacacacaa ggacttatct ttgtggtcga
tagtaatgat cgtgatcgtg ttgttgaggc 240 tagagatgag ctgcaccgga
tgttgaatga ggatgaactg agggatgctg tgctgcttgt 300 gtttgctaac
aagcaagatc ttccaaatgc tatgaatgct gctgagatta ctgacaagct 360
tggtcttcat tctctccgtc aacgtcactg g 391 28 26 DNA N. benthiamiana 28
aagaaggaga tgcgaattct gatggt 26 29 26 DNA N. benthiamiana 29
atgttgttgg agagccagtc cagacc 26 30 750 DNA Arabidopsis thaliana 30
tttcgatcta aggttcgtga tctccttctt ctctacgaag tttacacttt ttcttcaaag
60 gaaacaatga gccagtacaa tcaacctccc gttggtgttc ctcctcctca
aggttatcca 120 ccggagggat atccaaaaga tgcttatcca ccacaaggat
atcctcctca gggatatcct 180 cagcaaggct atccacctca gggatatcct
caacaaggtt atcctcagca aggatatcct 240 ccaccgtacg cgcctcaata
tcctccacca ccgcaagcat cagcaacaac agagcaagtc 300 ctggctttct
agaaggatgt cttgctgctc tgtgttgttg ctgtctcttg gatgcttgct 360
tctgattgga gtctctctct ctctgcataa agcttcggga tttatttgta agagggtttt
420 tgggttaaac aaaaacctta attgatttgt ggggcattaa aaatgaatct
ctcgatgatt 480 ctcttcgttt atgtggtaat gttcttcggt tataacattt
aacattgcta tcgacgttct 540 gcctagttgg atttgattat tgggaatgta
aattggttgg gaagacaccg ggccgttaat 600 gacagaaccc gaactgagat
ggagtatgat ctgaaatatt taaaacaatc ctcgcgacat 660 agcctccaat
ctcatcgtaa atattctttt taaactattc ccaatcttaa cttttatagt 720
ctggtcgact gaccactact ctttttcctt 750 31 543 DNA Arabidopsis
thaliana 31 cttaaaagca atatgacagt agagaagatc tctcacaaaa gacccaaaat
cgagtcgtgc 60 aaaattgtac gaacaacaaa atttaaaatt cagtccttat
caaagatcca atccagctgc 120 aactagcaac attggcttaa cgcttcttag
acacaccaac agtctttcct ctgcgaccag 180 ttgtcttggt gtgttgtcca
cgaacacgga gaccccagta atgtctcaga ccacgatggt 240 ttctgatttt
cttgagacgc tcaagatcat ccctgagctt catgtcaagg gcattggaga 300
caacttgaga gtacttccca tccttgtaat ctttctgtct gttcaaaaac cagtctggaa
360 tcttgaactg tcttgggttt gcaacaatag tcatgaggtt gtcaatctca
gctgcagata 420 actcaccagc cctcttgttc atgtcgacat cggctttctt
gcagacaatg ttggccaatc 480 tccttccaat acctttgata gaggtaaggg
caaacataat cttttgctta ccatcaacgg 540 tag 543 32 757 DNA Arabidopsis
thaliana 32 ctgacataag ttatgttctt tgcgaaaata aaagttattc cacaaacgca
ttcgataaaa 60 cattcaaaac cttcttcaga gtctaatccg tgaactgatg
atcgatatag cttcacacta 120 tatatcctct tcacttctta gacttcttct
tcggtacagc tgcagttgga gcaggtgtag 180 cagcaggtgc tggagcagct
acaggcgcaa catctccacc gggaccctta gctaaacgct 240 cctctctcct
agcatgcttc ctttctcggc tagccttgtt cttcgccctc ttagcctcaa 300
actgatcaag acagagtctt ctccctagcc ttctcaagcc tttgacttgt ggatactctc
360 catcaagaca cgcttgttct tgaacacatt tacccttaac acgcatgtac
atggtcatgg 420 tacatgtgct tgtcaatctt ctttcgtctc tctggatttc
ttcaaacaga cgcctaagaa 480 acacgccttc ctacgcattc cacagtacct
ttggttggga acctaactta cgggtacccc 540 ttccttttaa ccgattccag
agtggcgacc ctttatcttg gcaatcttca ttttgcgagc 600 ttggaacaag
agtgaatctt gggtggcttc tgatgatgaa acctctttaa actttctgag 660
gttttggcgg aaatggctga aacggatttg tgggaccaac caaattgcct ttcggcttaa
720 tactgatgcg accgtttgag taaaaaccgc cttcagg 757 33 11 DNA Tobacco
mosaic virus 33 tatagtattt t 11 34 11 DNA Tobacco mosaic virus 34
tataggtatt t 11 35 11 DNA Tobacco mosaic virus misc_feature
(1)...(11) n= a, t, c, or g 35 tatagntatt t 11 36 13 DNA Tobacco
mosaic virus misc_feature (1)...(12) n= a, t, c or g 36 tatagtngta
ttt 13 37 12 DNA Tobacco mosaic virus 37 tataggtatt tt 12 38 14 DNA
Tobacco mosaic virus 38 tatagtcgta tttt 14 39 15 DNA Tobacco mosaic
virus misc_feature (1)...(15) n= a. t, c or g 39 tatagtngtn gtatt
15 40 21 DNA Tobacco mosaic virus misc_feature (1)...(21) n= a, t,
c or g 40 tatagtngtn gtngtngtat t 21 41 16 DNA Tobacco mosaic virus
41 tatagtattt gtattt 16 42 12 DNA Tobacco mosaic virus 42
tatagtcgta tt 12
* * * * *