U.S. patent application number 10/032924 was filed with the patent office on 2003-01-30 for method and reagents for testing for mutations in the brca1 gene.
Invention is credited to Dunn, James M., Leushner, James, Shipman, Robert.
Application Number | 20030022190 10/032924 |
Document ID | / |
Family ID | 24606900 |
Filed Date | 2003-01-30 |
United States Patent
Application |
20030022190 |
Kind Code |
A1 |
Shipman, Robert ; et
al. |
January 30, 2003 |
Method and reagents for testing for mutations in the BRCA1 gene
Abstract
Samples are tested for mutations in the BRCA1 gene using a
hierarchical approach. First, each sample is amplified in one or
more multiplex PCR amplification reactions. Each multiplex PCR
reaction produces a mixture of amplified fragments. The sizes and
amounts of these fragments are evaluated and compared to standard
values reflecting the sizes and amounts of fragments produced when
the same multiplex amplification is performed on the wild-type
BRCA1 gene. Differences between the observed fragment sizes and/or
amounts and those for the wild-type gene are indicative of a
mutation with the BRCA1 gene of the sample. Next, one or more of
the exons of the BRCA1 gene are sequenced, preferably only for
those samples where no mutation was detected by analysis of the
multiplex PCR fragments. The sequencing procedure can be performed
by amplification and sequencing of the multiplex amplification
mixture.
Inventors: |
Shipman, Robert;
(Mississauga, CA) ; Leushner, James; (North York,
CA) ; Dunn, James M.; (Scarborough, CA) |
Correspondence
Address: |
OPPEDAHL AND LARSON LLP
P O BOX 5068
DILLON
CO
80435-5068
US
|
Family ID: |
24606900 |
Appl. No.: |
10/032924 |
Filed: |
December 26, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10032924 |
Dec 26, 2001 |
|
|
|
08649950 |
May 14, 1996 |
|
|
|
6403303 |
|
|
|
|
08649950 |
May 14, 1996 |
|
|
|
08271946 |
Jul 8, 1994 |
|
|
|
5545527 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 2537/143 20130101;
C12Q 2600/16 20130101; C12Q 1/6827 20130101; C12Q 2600/156
20130101; C12Q 1/6886 20130101; C12Q 1/6827 20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
We claim:
1. A method for testing a sample for mutations in the BRCA1 gene
comprising the steps of (a) amplifying one or more exons or partial
exons of BRCA1 to produce amplified fragments; (b) determining the
sizes and amounts of the amplified fragments and comparing the
determined sizes or amounts to standard values for amplification of
the same exons or partial exons of wild-type BRCA1 gene, wherein a
difference in fragment size or amount is indicative of the presence
of a mutation in the BRCA1 gene; and (c) if no mutation is detected
in the BRCA1 gene as a result of the determination of the sizes and
amounts of the amplification fragments, determining the sequence of
one or more exons of the BRCA1 gene.
2. The method according to claim 1, wherein at least exons 2, 11
and 20, or portions thereof, are amplified to produce amplification
fragments.
3. The method according to claim 1, wherein two or more exons or
partial exons are amplified in a multiplex amplification reaction
to produce multiplex amplification products.
4. The method according to claim 3, wherein exons 1 and 21 of the
BRCA1 gene are amplified in one multiplex amplification
reaction.
5. The method according to claim 4, wherein exons 1 and 21 are
amplified using the primers identified by Sequence ID Nos. 1, 2, 67
and 68, or primers complementary thereto.
6. The method according to claim 3, wherein exons 2, 5, 9 and 14 of
the BRCA1 gene are amplified in one multiplex amplification
reaction.
7. The method according to claim 6, wherein exons 2, 5, 9 and 14
are amplified using the primers identified by Sequence ID Nos. 3,
4, 9, 10, 17, 18, 53 and 54, or primers complementary thereto.
8. The method according to claim 3, wherein exons 3, 7 and 15 of
the BRCA1 gene are amplified in one multiplex amplification
reaction.
9. The method according to claim 8, wherein exons 3, 7, and 15 are
amplified using the primers identified by Sequence ID Nos. 5, 6,
13, 14, 55, and 56, or primers complementary thereto.
10. The method according to claim 3, wherein exons 6, 10, 17 and 18
of the BRCA1 gene are amplified in one multiplex amplification
reaction.
11. The method according to claim 10, wherein exons 6, 10, 17 and
18 are amplified using the primers identified by Sequence ID Nos.
11, 12, 19, 20, 59, 60, 61 and 62, or primers complementary
thereto.
12. The method according to claim 3, wherein exons 4, 12 and 16 of
the BRCA1 gene are amplified in one multiplex amplification
reaction.
13. The method according to claim 12, wherein exons 4, 12, and 16
are amplified using the primers identified by Sequence ID Nos. 7,
8, 49, 50, 57 and 58, or primers complementary thereto.
14. The method according to claim 3, wherein exons 8, 13, 19 and 24
of the BRCA1 gene are amplified in one multiplex amplification
reaction.
15. The method according to claim 14, wherein exons 8, 13, 19 and
24 are amplified using the primers identified by Sequence ID Nos.
15, 16, 51, 52, 63, 64, 73 and 74, or primers complementary
thereto.
16. The method according to claim 3, wherein exons 20, 22, and 23
of the BRCA1 gene are amplified in one multiplex amplification
reaction.
17. The method according to claim 6, wherein exons 20, 22, and 23
are amplified using the primers identified by Sequence ID Nos. 65,
66, 69, 70, 71 and 72, or primers complementary thereto.
18. The method according to claim 3, wherein exons 2 and 20 are
amplified in one multiplex amplification reaction.
19. The method according to claim 3, wherein the sequence is
determined by amplifying a selected one of the multiplex
amplification products in an aliquot of the multiplex reaction
mixture and then sequencing the amplified multiplex amplification
products.
20. The method according to claim 19, wherein the amplification of
the multiplex reaction mixture and the sequencing of the amplified
multiplex reaction product are performed in a single vessel.
21. The method according to claim 19, wherein the multiplex
reaction mixture is amplified by combining the multiplex reaction
mixture with an amplification mixture containing two primers for
the selected one of the multiplex reaction products, a mixture of
dNTP's and a thermostable polymerase in a buffer suitable for
amplification, and exposing the resulting combination to a first
series of thermal cycles including at least an extension phase and
a denaturation phase to produce an amplified mixture containing the
amplified multiplex reaction product; adding a sequencing mixture
comprising a chain terminating nucleoside triphosphate to the
amplified mixture and exposing the resulting combination to a
second series of thermal cycles including at least an extension
phase and a denaturation phase to produce sequencing fragments; and
evaluating the size of the sequencing fragments.
22. The method according to claim 21, wherein the thermostable
polymerase is Thermo Sequenase.RTM..
23. The method according to claim 21, wherein the sequencing
mixture further comprises a fluorescently labeled sequencing
primer.
24. The method according to claim 23, wherein the sequencing
mixture further comprises a thermostable polymerase for sequencing
which incorporates dideoxynucleosides into an extending
oligonucleotide at a rate which is no less than about 0.4 times the
rate of incorporation of deoxynucleosides in an amplification
mixture.
25. The method according to claim 24, wherein the thermostable
polymerase for sequencing is Thermo Sequenase.RTM.
26. A kit for testing a sample for mutations in the BRCA1 gene
comprising a mixture of at least four oligonucleotide primers, said
primers being selected to amplify at least two different exons or
portions of exons of the BRCA1 gene in a multiplex amplification
reaction.
27. The kit according to claim 26, wherein the primers are selected
for amplification of exons 1 and 21 of the BRCA1 gene in one
multiplex amplification reaction.
28. The kit according to claim 27, wherein the primers are for
amplification of exons 1 and 21 are the primers identified by
Sequence ID Nos. 1, 2, 69 and 70, or primers complementary
thereto.
29. The kit according to claim 26, wherein the primers are selected
for amplification of exons 2, 5, 9 and 14 of the BRCA1 gene in one
multiplex amplification reaction.
30. The kit according to claim 29, wherein the primers for
amplification of exons 2, 5, 9 and 14 are the primers identified by
Sequence ID Nos. 3, 4, 9, 10, 17, 18, 55 and 56, or primers
complementary thereto.
31. The kit according to claim 26, wherein the primers are selected
for amplification of exons 3, 7 and 15 of the BRCA1 gene in one
multiplex amplification reaction.
32. The kit according to claim 31, wherein the primers for
amplification of exons 3, 7 and 15 are the primers identified by
Sequence ID Nos. 5, 6, 13, 14, 57, and 58, or primers complementary
thereto.
33. The kit according to claim 26, wherein the primers are selected
for amplification of exons 6, 10, 17 and 18 of the BRCA1 gene in
one multiplex amplification reaction.
34. The kit according to claim 33, wherein primers for
amplification of exons 6, 10, 17 and 18 are the primers identified
by Sequence ID Nos. 11, 12, 19, 20, 61, 62, 63 and 64, or primers
complementary thereto.
35. The kit according to claim 26, wherein the primers are selected
for amplification of exons 4, 12 and 16 of the BRCA1 gene in one
multiplex amplification reaction.
36. The kit according to claim 35, wherein the primers for
amplification of exons 4, 12, and 16 are the primers identified by
Sequence ID Nos. 7, 8, 51, 52, 59 and 60, or primers complementary
thereto.
37. The kit according to claim 26, wherein the primers are selected
for amplification of exons 8, 13, 19 and 24 of the BRCA1 gene in
one multiplex amplification reaction.
38. The kit according to claim 37, wherein the primers for
amplification of exons 8, 13, 19 and 24 are the primers identified
by Sequence ID Nos. 15, 16, 53, 54, 65, 66, 75 and 76, or primers
complementary thereto.
39. The kit according to claim 26, wherein the primers are selected
for amplification of exons 20, 22, and 23 of the BRCA1 gene in one
multiplex amplification reaction.
40. The kit according to claim 39, wherein the primers for
amplification of exons 20, 22, and 23 are the primers identified by
Sequence ID Nos. 67, 68, 71, 72, 73 and 74, or primers
complementary thereto.
41. The kit according to claim 26, wherein the primers are selected
for amplification of exons 2 and 20 in one multiplex amplification
reaction.
42. The kit according to claim 41, wherein the primers for
amplification of exons 2 and 20 are the primers identified by
Sequence ID Nos.: 3, 4, 65 and 66.
43. An oligonucleotide primer having the sequence as set forth in
any one of Sequence ID Nos. 1 through 77.
44. A method for testing a sample for mutations in the BRCA1 gene
comprising the steps of (a) amplifying one or more exons or partial
exons of BRCA1 to produce amplified fragments; (b) determining the
sizes and amounts of the amplified fragments and comparing the
determined sizes or amounts to standard values for amplification of
the same exons or partial exons of wild-type BRCA1 gene, wherein a
difference in fragment size or amount is indicative of the presence
of a mutation in the BRCA1 gene.
45. The method according to claim 44, wherein the amplification
step is performed using two or more primers having the sequences as
set forth Sequence ID Nos. 1 through 76.
46. The method according to claim 44, wherein two or more exons or
partial exons are amplified in a multiplex amplification reaction
to produce multiplex amplification products.
47. The method according to claim 46, further comprising the step
of determining the sequence a selected one of the multiplex
amplification products, wherein the sequence is determined by
amplifying the selected one of the multiplex amplification products
in an aliquot of the multiplex reaction mixture and then sequencing
the amplified multiplex amplification products.
48. The method according to claim 47, wherein the multiplex
reaction mixture is amplified by combining the multiplex reaction
mixture with an amplification mixture containing two primers for
the selected one of the multiplex reaction products, a mixture of
dNTP's and a thermostable polymerase in a buffer suitable for
amplification, and exposing the resulting combination to a first
series of thermal cycles including at least an extension phase and
a denaturation phase to produce an amplified mixture containing the
amplified multiplex reaction product; adding a sequencing mixture
comprising a chain terminating nucleoside triphosphate to the
amplified mixture and exposing the resulting combination to a
second series of thermal cycles including at least an extension
phase and a denaturation phase to produce sequencing fragments; and
evaluating the size of the sequencing fragments.
49. The method according to claim 49, wherein the thermostable
polymerase is Thermo Sequenase.RTM..
50. The method according to claim 49, wherein the sequencing
mixture further comprises a fluorescently labeled sequencing
primer.
51. The method according to claim 51, wherein the sequencing
mixture further comprises a thermostable polymerase for sequencing
which incorporates dideoxynucleosides into an extending
oligonucleotide at a rate which is no less than about 0.4 times the
rate of incorporation of deoxynucleosides in an amplification
mixture.
52. The method according to claim 52, wherein the thermostable
polymerase for sequencing is Thermo Sequenase.RTM.
Description
[0001] This application is a continuation in part of U.S. patent
application Ser. No. 08/271,946 filed Jul. 8, 1994 which is
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Genetic testing to determine the presence of or a
susceptibility to a disease condition offers incredible
opportunities for improved medical care, and the potential for such
testing increases almost daily as ever increasing numbers of
disease-associated genes and/or mutations are identified. One such
disease-associated gene is the BRCA1 gene. Mutations in the BRCA1
gene have been shown to be linked to breast and ovarian cancer.
Miki et al., "A Strong Candidate for the Breast Cancer and Ovarian
Cancer Susceptibility Gene BRCA1", Science 226: 66-71 (1994).
[0003] Since the identification of the BRCA1 gene, researchers have
tested many individuals using sequencing, single-stranded
conformational polymorphism, allele-specific oligonucleotide
hybridization and heteroduplex analysis to identify BRCA1 mutations
in families with a history of breast and ovarian cancer.
Shattuck-Eidens et al., "A Collaborative Survey of 80 Mutations in
the BRCA1 Breast and Ovarian Cancer Susceptibility Gene", J. Amer.
Med. Assoc. 273: 535-541 (1995). Diagnostic screening to identify
persons with these mutations, and thus with an apparent genetic
predisposition to breast and ovarian cancers offers the opportunity
for increased monitoring of high-risk patients which should lead to
earlier detection of cancer. Such early detection improves the
likelihood of successful treatment and the likelihood of long-term
post-detection survival. On the other hand, large scale screening
could be prohibitively expensive, absent a easily-performed,
low-cost test for mutations in the BRCA1 gene.
[0004] It as an object of the present invention to provide a
screening methodology which can be used to provide low-cost testing
for mutations in the BRCA1 gene.
[0005] It is a further object of the present invention to provide
reagents, particularly primers and primer cocktails, which can be
used in testing for mutations in the BRCA1 gene.
SUMMARY OF THE INVENTION
[0006] In accordance with the present invention, samples are tested
for mutations in the BRCA1 gene using a hierarchical approach.
First, each sample is amplified in one or more multiplex PCR
amplification reactions. Each multiplex PCR reaction produces a
mixture of amplified fragments. The sizes and amounts of these
fragments are evaluated and compared to standard values reflecting
the sizes and amounts of fragments produced when the same multiplex
amplification is performed on the wild-type BRCA1 gene. Differences
between the observed fragment sizes and/or amounts and those for
the wild-type gene are indicative of a mutation with the BRCA1 gene
of the sample.
[0007] The next step in the method of the invention is sequencing
of one or more regions within the BRCA1 gene. In accordance with
the hierarchical method, such sequencing will be performed on
samples where no mutation was detected by analysis of the multiplex
PCR fragments.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIG. 1 illustrates an embodiment of the sequencing step of
the method of the invention; and
[0009] FIGS. 2A and 2B illustrate two embodiments of the method of
the invention in which multiplex amplification and sequencing are
performed sequentially on the same initial aliquot of sample.
DETAILED DESCRIPTION OF THE INVENTION
[0010] To date, over thirty BRCA1 mutations have been identified in
the breast cancer families which have been studied. A substantial
number of these mutations are insertion or deletion mutations.
Furthermore, 75% of the currently known mutations are found in exon
11 and an additional 5% are found in exons 2 and 20. This type of
distribution makes BRCA1 well-suited for analysis using the type of
hierarchical analysis described in co-pending U.S. patent
application Ser. No. 08/271,946. Use of a hierarchical analysis
provides highly accurate test results at a reduced cost per
patient.
[0011] The first step in the hierarchical analysis is multiplex
amplification and fragment length analysis of at least exons 2, 11
and 20 of the BRCA 1 gene. For multiplex amplification, a sample to
be evaluated is combined with a several amplification primers.
Amplification primers are selected to hybridize with the known
sequence of the introns or exons of the BRCA1 gene. This sequence
can be found online at the Breast Cancer Information Core, which
has the following URL: http://www.nchgr.nih.gov/I-
ntramural_research/Lab_transfer/Bic/. Information about the cDNA
sequence can also be found from GenBank Accession No. U14680 or
Genome Data Base Accession No. GDB: 126611. While considerable
variation is theoretically possible in the sequence of these
primers, the practical requirements for multiplex amplification and
fragment analysis mean that primers cannot be simply selected at
random. These requirements impose at least the following
limitations on primers used in the method of the invention:
[0012] (1) in order to avoid the possibility of false positive
results the primer pair, i.e., the combination of the 5'-primer and
the 3'-primer for any given exon must be unique to the BRCA1 gene
so that only the BRCA1 gene will be amplified. This means that the
primer sequences will be generally somewhat longer than the minimum
which can be used as an amplification primer. Preferred primers are
from 18 to 23 nucleotides in length, without internal homology or
primer-primer homology.
[0013] (2) It is also desirable for the primers to form more stable
duplexes with the target DNA at the primers' 3'-ends than at their
5'-ends, because this leads to less false priming. Stability can be
approximated by GC content, since GC base pairs are more stable
than AT pairs, or by nearest neighbor thermodynamic parameters.
Breslauer et al., "Predicting DNA duplex stability from base
sequence", Proc. Nat'l Acad. Sci. USA 83: 3746-3750 (1986).
[0014] (3) To ensure complete amplification of each exon, the two
primers of a pair are preferably selected to hybridize in the
introns immediately flanking the exon to be amplified using the
primer pair.
[0015] (4) Primer pairs are advantageously selected to have similar
melting temperatures. Further, multiplex pools should contain
primer pairs with approximately the same thermal profile, so that
they can be effectively coamplified together. This goal can be
achieved by having groups of primer pairs with approximately the
same length and the same G/C content.
[0016] (5) The length of the gene region between the primer binding
sites on a normal BRCA1 gene should be different for each exon to
be multiplexed as a group. Differences of only one base in length
are sufficient, provided a high resolution gel capable of resolving
one base differences is used in analyzing the amplification
products. However, greater differences in length are preferred, to
avoid confusion in interpreting fragment sizes resulting from an
insertion or deletion mutation.
[0017] Table 1 shows a series of amplification primers for various
exons of the BRCA1 gene which meet these criteria when grouped into
one of the multiplex groups as shown in the Table. It will be
understood in the art that the same amplification products could be
produced using primer pairs complementary to those set forth in
Table 1. Because of the large size of exon 11, this exon is
preferably amplified in multiple overlapping fragments using
primers which bind to the exon in an interlocking manner so that
all regions of the exon are amplified and analyzed, rather than
using intron primers. This provides a more robust analysis, since
amplification of shorter regions provides more reliable results,
and also facilitates localization and identification of detected
insertion or deletion mutations. Melting temperatures and optimum
annealing temperatures in Table 1 are calculated assuming a salt
concentration of 50 mM and 250 pM primer concentration. Conditions
of actual use may be different, for example primer concentration of
200 nM to 1 .mu.M will normally be used. Because of variations in
primer and/or salt concentrations, experimental optimization using
the calculated temperature as a starting point may be
desirable.
[0018] While the foregoing set of primers provides the desirable
ability to coamplify regions of the BRCA1 gene for fragment length
analysis, it will be appreciated that other primers sets can be
used as well based upon the known sequence of the BRCA1 gene by
evaluating the uniqueness of the primer sequences and determining
the predicted melting temperature for each primer. This can be
accomplished in several ways. For example, the melting temperature,
Tm can be calculated using either of the following equations:
Tm(.degree. C.)=81.5+16.6.times.log [Na]+0.41.times.(%
GC)-675/length
[0019] where [Na] is the concentration of sodium ions, and the % GC
is in number percent, or
Tm(.degree. C.)=2.times.(A+T)+4.times.(G+C)
[0020] where A, T, G, and C represent the number of adenosine,
thymidine, guanosine and cytosine residues in the primer.
Alternatively, OLIGO.TM. software can be used to calculate Tm,
nearest neighbor and .DELTA.H/.DELTA.G values. In general, primers
for coamplification should be selected to have predicted melting
temperatures differing by less than 4.degree. C.
[0021] To perform the multiplex fragment analysis, each selected
set of primers is combined with an aliquot of sample in a reaction
mixture containing a template-dependant DNA polymerase, such as Taq
polymerase, T7 DNA Polymerase, or Thermo Sequenase.RTM.;
deoxynucleoside triphosphate feedstocks (A, C, C and T); and an
appropriate buffer to permit extension of the primers. The
resulting reaction mixture is thermally cycled through multiple
cycles of annealing (performed at or below an average of the
optimum annealing temperatures listed in Table 1), primer extension
(performed at about 70 to 72.degree. C.) and denaturation
(performed at a temperature of around 95.degree. C.). In practice,
each reaction condition is optimized using the predicted
temperatures as a starting points, and varying the temperature
within a range from about 44 to 66.degree. C.
[0022] After sufficient cycles to produce detectable levels of
amplification products, the product mixture is loaded onto a
separation matrix, e.g., a polyacrylamide gel, more specifically a
PAGE sequencing gel, and separated on the basis of fragment size.
Labeled amplification primers, particularly of amplification
primers labeled with fluorophores such a fluorescein, facilitate
detection of the separated bands within the separation matrix. The
size of each detected fragment is determined, and compared to the
expected size of the fragments for the multiplex amplification.
Deviations in size or loss of a band reflect the presence and size
of an insertion or deletion mutation involving the amplified
fragment forming that band. Reduction in the intensity of a band
generally reflects loss of one copy of the amplified exon or region
in the sample.
[0023] The amplification reaction are preferably performed in a
quantitative manner. This means that, for maximum effectiveness in
the method of the present invention, the amplification of the exons
in the sample should be carried out only for a number of cycles
during which doubling of DNA is still being achieved.
[0024] Because of the frequency of insertion and deletion mutations
among the known mutations in the BRCA1 gene, the fragment analysis
test may, in many instances provide all the information that is
needed to provide a diagnostic result. Where no insertion or
deletion mutation is detected in the fragment analysis, however,
the sample is further evaluated to determine the sequence of the
one or more exons (or partial exons) of the BRCA1 gene.
[0025] Sequencing can be performed in known manner, although it
will preferably be performed using a chain-termination sequencing
reaction as originally described by Sanger et al. More preferably,
the sequencing will be performed by amplification and sequencing of
an exon (or portion thereof) of the BRCA1 gene using the
methodologies disclosed in U.S. patent application Ser. No. ______
filed May 1, 1996 (Attorney Docket No. VGEN.P-020), which is
incorporated herein by reference. This amplification and sequencing
procedure can be carried out on a fresh aliquot of the original
sample, or on aliquots of one or more of the multiplex fragment
analysis product mixtures.
[0026] FIG. 1 illustrates a first embodiment of the sequencing step
of the present invention. As shown in FIG. 1, a sample containing a
target nucleic acid polymer which is to be amplified and sequenced
is combined with an amplification mixture containing two primers
for an exon or portion of an exon of the BRCA1 gene, a mixture of
dNTP's and thermostable polymerase in a buffer suitable for
amplification. The primers may be the same primers as disclosed in
Table 1, or other primers which hybridize selectively with the
selected part of the BRCA1 gene.
[0027] The mixture is amplified through an initial set of cycles,
for example 15-40 cycles. At this stage reagents for forming chain
termination products, namely a dideoxynucleoside triphosphate
(ddNTP) and optionally additional thermostable polymerase, dNTP's
and a labeled sequencing primer are added and additional cycles
(for example another 15-20 cycles) are performed during which both
amplification and the formation of chain termination products
occurs. The sequencing primer may be one of the primers disclosed
in Table 1 for the exon or exon portion or some other primer which
hybridizes specifically with the amplified portion of the BRCA1
gene, e.g., a nested primer. At the end of these cycles, the
product mixture is evaluated to determine the lengths of the chain
termination products, and hence the positions of the particular
base corresponding to the ddNTP within the target nucleic acid
polymer.
[0028] The thermostable polymerase used in at least the sequencing
step of this amplification and sequencing process, and preferably
in both steps, is one which incorporates dideoxynucleosides into an
extending oligonucleotide at a rate which is no less than about 0.4
times the rate of incorporation of deoxynucleosides in the same
amplification mixture. The commercially available enzyme Thermo
Sequenase.RTM. is such an enzyme.
[0029] A variation of this method which may be advantageous is the
use of asymmetric amplification to preferentially amplify one
strand of the target nucleic acid. In this case, the primer which
will produce the desired sequencing template strand is combined
with the sample in an amount greater than the other primer, e.g., a
10 to 50-fold excess. More amplification cycles may be required to
take full advantage of asymmetric amplification.
[0030] It may also be advantageous to biotinylate one of the
primers used for amplification. When amplification is carried out
with biotinylated primers, a partial separation of reagents can be
accomplished prior to the introduction of the sequencing reagents
by capturing the biotinylated amplification products on an avidin
or streptavidin-coated support, separating the liquid medium from
the support and replacing the liquid medium with the sequencing
reagents. In a preferred use of this approach, the biotinylated
products are captured on metal or magnetic beads, which are
captured with a magnet to facilitate separation of the
amplification liquid. While this step is not necessary to the
method, and is not intended to accomplish complete removal of the
amplification reagents, the use of this step can improve the
sensitivity of the procedure by reducing the number of background
oligonucleotides, particularly where a separate labeled-sequencing
primer is added with the ddNTP.
[0031] FIGS. 2A and 2B illustrate two embodiments of the method of
the invention. As shown in FIGS. 2A and 2B, a patient sample 1 is
first subjected to multiplex PCR to produce a complex mixture of
amplification products using sets of amplification primers for the
BRCA1 gene as disclosed in Table 1. The products of this mixture
are analyzed, to detect insertion or deletion mutations. If the
results of the fragment length analysis fail to show a mutation,
the sample 1 is further analyzed by sequencing a selected exon or
exons.
[0032] An aliquot of the original multiplex PCR amplification
mixture is used as the starting material for multiple cycles of
combined amplification and sequencing. Thus, the multiplex PCR
amplification mixture is combined with amplification and/or labeled
sequencing primers and amplified and sequenced in a single reaction
vessel. Preferably, the multiplex amplification PCR is performed
using capturable primers (for example biotin-labeled primers) and
separated from the multiplex amplification reagents using affinity
beads (e.g. avidin-coated beads) prior to the addition of the
amplification/sequencing reagents. (FIG. 2B). Additional aliquots
of the multiplex reaction mixture may be processed to sequence
different regions if no mutation is detected in the first
sequencing step.
[0033] It should be noted that the multiplex reaction performed in
the first step of this embodiment makes use of labeled primers.
Fluorescence from these primers may interfere with observation of a
few peaks in the sequencing ladder. This interference can be
minimized by utilizing a nested sequencing primer, which produces
fragments having a maximum length which is shorter than the
multiplex amplification products, or by the utilization of
distinguishable labels for the multiplex amplification and
sequencing primers.
[0034] The fragment analysis and sequencing steps of the present
invention may also be advantageously combined with additional
analytical steps for evaluation mutations in the BRCA1 gene. For
example, a ligation analysis of the type described in the U.S.
patent application Ser. No. 08/590,503 which is incorporated herein
by reference can be used before or after the fragment length
analysis to detect mutations in some or all of the exons of the
BRCA1 gene. Briefly, this technique makes use of a set of
oligonucleotide probes which hybridize in series along the length
of the exon or region being evaluated. The ligation of the probes
together forms a ligation product, the size of which is evaluated.
When the gene or gene fragment being analyzed corresponds to the
normal sequence and thus perfectly matches the probes, all of the
probes in the set are ligated together, and the ligation product
has a certain resulting size. When a mutation appears in the gene,
the hybridization of the probe overlapping the mutation is
impaired, with the result that some or all of the ligation product
is of smaller size. By evaluating the size of the ligation product,
both the existence of a mutation and its approximate position can
be identified.
[0035] Use of CLEAVASE (Third Wave Technologies, Inc. Madison Wis.)
provides another diagnostic technique which can be used according
to the invention to identify mutations in BRCA1 by determining the
sizes and amounts of amplified exon fragments. CLEAVASE is an
endonuclease which cuts single stranded DNA (ssDNA) molecules.
Since mutant ssDNA adopts a different conformation from wild-type
ssDNA, the CLEAVASE digestion products show a different array of
fragments. This array of fragments can be separated and examined by
electrophoresis, much like multiplex PCR fragments. The advantage
of CLEAVASE is that it can detect single base substitution
mutations as well as insertions and deletions. Therefore, it
detects fewer false negatives than multiplex PCR, though it does
not locate mutations as precisely as sequencing.
1TABLE 1 Prod Optimum Seq. Sense/ Size Annealing ID Anti- Tm MP
Exon (bp) Temp (.degree. C.) No. Primer sense (.degree. C.) P-1 1
234 59.1 1 GGTAGCCCCTTGGTTTCCCTC sense 59.3 A 2
ACGCCAGTACCCCAGACCATC anti 57.7 2 236 46.8 3 AATGATGAAAATGAAGTTGTC
sense 43.4 B 4 GTTCATTTGCATAGGAGATAA anti 44.1 2 275 47.7 75
AAACCTTCCAAATCTTCAAAT sense 46.9 C 76 TTCTGTTCATTTGCATAGGAG anti
47.3 2 286 46.9 75 AAACCTTCCAAATCTTCAAAT sense 46.9 B 77
TGTAAGGTCAATTCTGTTCAT anti 43.8 3 116 47.3 5 GAGCCTCATTTATTTTCTTTT
sense 44.9 C 6 TGAAGGACAAAAACAAAAGCT anti 48.8 4 204 49.2 7
ACCTTAAATTTTTCAACAGCT sense 45.2 E 8 CTCTACAGAAAACACAAAATT anti
41.0 5 202 46.6 9 GCCTTTTGAGTATTCTTTCTA sense 43.2 B 10
TTCTACTTTTCCTACTGTGGT anti 42.8 6 233 48.9 11 AGGTTTTCTACTGTTGCTGCA
sense 49.5 D 12 CAGCACTTCACTCTCATTCTT anti 46.1 7 218 47.3 13
CATACATTTTTCTCTAACTGC sense 41.5 C 14 GAAGAAGAAGAAAACAAATGG anti
45.5 8 193 50.4 15 AGGAGGAAAAGCACAGAACTG sense 50.5 F 16
TACTTAAAAAACCTGAGACCC anti 45.2 9 197 46.0 17 CAAGTACATTTTTTTAACCCT
sense 43.2 B 18 AAAGAGAGAAACATCAATCCT anti 44.1 10 227 48.9 19
TTTGACAGTTCTGCATACATG sense 46.0 D 20 CAAATGGTCTTCAGAATAATC anti
43.4 11a 314 49.6 21 CTCCAAGGTGTATGAAGTATG sense 44.0 I 22
CAGCCTTTTCTACATTCATTC anti 46.2 11b 348 49.8 23
ATTACAGCATGAGAACAGCAG sense 47.2 J 24 GAGTCATCAGAACCTAACAGT anti
42.2 11c 340 49.1 25 ATAGCAGCATTCAGAAAGTTA sense 44.2 H 26
TCAGTAACAAATGCTCCTATA anti 42.3 11d 314 50.2 27
CTCCCCAACTTAAGCCATGTA sense 51.2 K 28 TCGAGTGATTCTATTGGGTTA anti
46.8 11e 325 49.2 29 TGGTCATGAGAATAAAACAAA sense 45.1 I 30
TGGCATTTGGTTGTACTTTTT anti 49.4 11f 352 51.1 31
AAGCCCACCTAATTGTACTGA sense 48.4 L 32 TTTGGGGTCTTCAGCATTATT anti
50.8 11g 307 48.3 33 AAGAAGAGAAACTAGAAACAG sense 39.5 H 34
AATGGATACTTAAAGCCTTCT anti 44.3 11h 332 49.2 35
AAGGGACTAATTCATCGTTGT sense 47.2 I 36 GTCTGTACAGGGTTGATATTA anti
41.5 11i 255 50.4 37 TGAATGTGAACAAAAGGAAGA sense 47.4 K 38
ATGGGAAAAAGTGGTGGTATA anti 48.2 11j 346 48.6 39
AACGAAACTGGACTCATTACT sense 45.0 H 40 TGTTTCTACCTAGTTCTGCTT anti
43.2 11k 340 49.4 41 TGGGCTCCAGTATTAATGAAA sense 49.4 I 42
TCAGCAAAACTAGTATCTTCC anti 43.5 11l 313 49.8 43
CATGCATCTCAGGTTTGTTCT sense 49.3 J 44 TATGCCTAGTAGACTGAGAAG anti
40.9 11m 312 52.7 45 GCTTCCCTGCTTCCAACACTT sense 55.0 L 46
TGCCTCATTTGTTTGGAAGAA anti 52.5 11n 277 52.1 47
ACAGTGCAGTGAATTGGAAGA sense 49.7 K 48 CTCCCCAAAAGCATAAACATT anti
50.5 12 191 49.2 49 GCGTTTATAGTCTGCTTTTAC sense 43.9 E 50
TTGGAGTGGTATTCTTTTAAG anti 43.7 13 267 50.5 51
TATTTCATTTTCTTGGTACCA sense 44.6 F 52 ATAAAGGGGAAGGAAAGAATT anti
47.9 14 251 46.7 53 GAATTATCACTATCAGAACAA sense 38.6 B 54
CAATCAGAGTTCAATATAAAT anti 38.3 15 393 47.4 55
CCAGCAAGTATGAAATGTCCT sense 48.7 C 56 CTTTATGTAGCATTCAGAGTA anti
38.3 16 559 49.6 57 CTTAACAGAGACCAGAACTTT sense 42.4 E 58
TTTCCAGAATGTTGTTAAGTC anti 43.9 17 212 48.5 59
CTAGTATTCTGAGCTGTGTGC sense 44.3 D 60 CCTCGCCTCATGTCGTTTTAT anti
53.3 18 258 48.9 61 CTCTTTAGCTTCTTAGGACAG sense 42.8 D 62
CTCAAGACTCAAGCATCAGCA anti 50.6 19 215 50.5 63
TGTGAATCGCTGACCTCTCTA sense 50.0 F 64 AAGTGGTGCATTGATGGAAGG anti
53.9 20 169 52.0 65 TCTCTTATCCTGATGGCTGTG sense 49.0 G 66
ATACAGAGTGGTGGGGTGAGA anti 50.8 21 167 56.4 67
CAGTGGTGCGATCTCAGCTCA sense 56.2 A 68 AAGGCTGGTGCTGGAACTCTG anti
55.8 22 273 51.0 69 TAGAGGGCCTGGGTTAAGTAT sense 49.3 G 70
GAGAAGACTTCTGACGCTACC anti 46.6 23 152 51.1 71
CCTACTTTGACACTTTGAATG sense 44.3 G 72 AATGTGCCAAGAACTGTGCTA anti
50.1 24 252 50.9 73 TAATCTCTGCTTGTGTTCTCT sense 43.4 F 74
GTAGCCAGGACAGTAGAAGGA anti 47.9
EXAMPLE 1
[0036] Individual exons of the BRCA1 gene are amplified as
follows.
[0037] 5 ul of patient sample genomic DNA (20 ng/ul) is combined
with 2 ul 10X PCR Buffer, 0.6 ul 50 mM Mg2+, 0.4 ul 10 mM dNTP mix
(containing each of the 4 dNTPs), 1 ul DMSO (100%), and 8 ul ddH2O.
2 ul of a 50 ng/ul mixture of an amplification primer pair (i.e.
100 ng each primer), one of which is labeled with a detectable
label, are added to the mix. The amplification primer pair is one
of the pairs of exons designated in table 1 as being specific for a
particular exon. A suitable label is fluorescein, which can be
detected on an A.L.F. automated DNA sequencer (Pharmacia, Inc.,
Piscataway, N.J.).
[0038] The mixture is prepared on ice. Addition of 1 ul Taq
Polymerase (1 U/ul) (Roche Molecular Systems, Inc.), bringing the
total volume to 20 ul, is followed by thermal cycling as
follows:
[0039] Initial denaturation 94C 10 min
2 Cycle (20 - 35 times): anneal *47C 40 sec extend 72C 60 sec
aenature 94C 30 sec Final extension 72C 10 min then hold at room
temperature. *annealing temperature may vary within about 6.degree.
C. depending on empirically determined annealing temperature for
the specific primer pair(s).
[0040] An equal volume of Stop Solution comprising Formamide and a
visible dye is added after the reaction is complete. 6 ul of this
mixture is loaded into a single lane of an A.L.F. Sequencing Gel,
and the reaction products are detected.
EXAMPLE 2
[0041] Multiplex amplification of selected exons or parts of exons
of BRCA1 is achieved as follows:
[0042] 5 ul of patient sample genomic DNA (20 ng/ul) is combined
with 2 ul 10X PCR Buffer, 0.6 ul 50 mM Mg2+, 0.4 ul 10 mM dNTP mix
(containing equimolar amounts of each of the 4 dNTPs), 1 ul DMSO
(100%), and 8 ul ddH2O. 2 ul of a mixture containing 50 ng/ul of a
multiplex set of primers as indicated in Table 1, (i.e. 100 ng each
primer), one of each pair being labeled with a detectable label,
are added to the mix. A suitable label is fluorescein, which can be
detected on an A.L.F. automated DNA sequencer (Pharmacia, Inc.,
Piscataway, N.J.).
[0043] The mixture is prepared on ice. Addition of 1 ul Taq
Polymerase (1 U/ul) (Roche Molecular Systems, Inc.), bringing the
total volume to 20 ul, is followed by thermal cycling as
follows:
[0044] Initial denaturation 94C 10 min
3 Cycle (20-35 times) anneal *47C 40 sec extend 72C 60 sec denature
94C 30 sec Final extension 72C 10 min then hold at room
temperature. *annealing temperature may vary within about 6.degree.
C. depending on empirically determined annealing temperature for
the specific primer pair(s).
[0045] An equal volume of Stop Solution comprising formamide and a
visible dye is added after the reaction is complete. 6 ul of this
mixture is loaded into a single lane of an A.L.F. Sequencing Gel,
and the reaction products are detected.
EXAMPLE 3
[0046] Sequencing of an individual exon of BRCA1 is achieved as
follows.
[0047] Amplified, biotinylated PCR product is prepared as a
template for sequencing by generating the following mixture: 300 ng
genomic DNA (patient sample); 1X Taq polymerase Buffer (final: 10
mM Tris-HCl, pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.001% gelatin); and
0.2 mM each dNTP. To this mixture is added 8 pMol of each primer
selected from table 1 to amplify a specific exon of BRCA1, one of
which primers is biotinylated. The reaction mixture is kept on ice
until the addition of 2.5U Taq DNA polymerase. The final volume is
25 ul.
[0048] This reaction mixture is thermal cycled in a Perkin Elmer
9600 as follows:
4 94.degree. C. 2 min x1 cycle 94.degree. C. 30 sec *50.degree. C.
30 sec x35 cycles 65.degree. C. 2 min 65.degree. C. 7 min x1 cycle
*annealing temperature may vary within about 6.degree. C. depending
on empirically determined annealing temperature for the specific
primer pair(s).
[0049] At the end of the reaction, a 5 ul aliquot may be taken and
observed on a 1% agarose gel containing ethidium bromide to assess
integrity of the amplification reaction.
[0050] If the PCR product appears satisfactory, the reaction buffer
is exchanged using streptavidin/magnetic beads as follows:
[0051] 1. take 8 ul of streptavidin beads (Dynal), wash with 50 ul
2.times.BW buffer
[0052] 2. resuspend beads in 10 ul of 2.times.BW buffer
[0053] 3. remove 10 ul of PCR product from above and mix with
washed beads.
[0054] 4. sit at RT for up to 1 hour with periodic mixing by gently
tapping side of tube
[0055] 5. place on magnetic rack, allow PCR bound-beads to separate
and remove supernatant. Wash with 50 ul of 1.times.BW buffer,
separate on magnetic rack and remove supernatant. Repeat with 50 ul
of TE.
[0056] 6. resuspend bound beads in 10 ul of dH20.
[0057] 7. use 3 ul for cycle sequencing
[0058] *2.times.BW buffer: Binding/Washing buffer; 10 mM Tris pH
7.5, 1 mM EDTA, 2M NaCl
[0059] The amplification products are then ready for sequencing as
follows. A reaction mixture is prepared consisting of 2 ul T7
Thermo Sequenase.TM. buffer (Amersham Life Sciences, Cleveland)
(final: 26 mM Tris-HCl, pH 9.5, 6.5 mM MgCl2); 3 ul of PCR product
from above; 3 ul (final: .about.30 ng/5 pM) Fluoresceinated primer;
3 ul dH2O; and 2 ul diluted Thermo Sequenase.TM. enzyme (Amersham
Life Sciences, Cleveland) (final 6.4U). The total volume of 13 ul
is kept on ice.
[0060] The fluoresceinated primer used has the same sequence as the
non-biotinylated primer used in the amplification reaction, above,
but it is fluoresceinated so that it may be detected on an A.L.F.
Automated DNA Sequencing Apparatus (Pharmacia, Inc.; Piscataway,
N.J.)
[0061] The reagents are mixed well, and a 3 ul aliquot is added to
each of the 4 termination reaction tubes containing 3 ul of
Termination Mix. The final volume of 6 ul is covered with 10 ul
mineral oil before thermal cycling.
[0062] The d/ddA Termination mix contains 750 uM dNTPs, 2.5 uM
ddATP.
[0063] The d/ddC Termination mix contains 750 uM dNTPs, 2.5 uM
ddCTP.
[0064] The d/ddG Termination mix contains 750 uM dNTPs, 2.5 uM
ddGTP.
[0065] The d/ddT Termination mix contains 750 uM dNTPs, 2.5 uM
ddTTP.
[0066] The sequencing reactions are then thermal cycled in a Perkin
Elmer 9600 as follows:
5 94.degree. C. 2 min x1 cycle 94.degree. C. 30 sec *50.degree. C.
10 sec cycle 25 times 70.degree. C. 30 sec 70.degree. C. 2 min x1
cycle *annealing temperature may vary within about 6.degree. C.
depending on empirically determined optimization for the specific
amplification primer.
[0067] After the cycle sequencing reaction is complete, 6 ul of
STOP buffer comprising dextran blue in formamide is added to the
reaction mixture. 6 ul or half of the reaction products are loaded
onto an A.L.F. Sequencer.
EXAMPLE 4
[0068] Single-Tube Sequencing of a BRCA1 exon may be achieved as
follows.
[0069] The primer pair is selected from table 1 and is specific for
the designated exon of BRCA1. Asymmetric amplification of the
sequencing template strand is obtained using an excess ratio (10-50
fold) of template strand primer compared to the non-template strand
primer. The following reactants were combined in an Eppendorf tube
at 4 degrees C. in the following amounts:
[0070] 300 ng patient sample genomic DNA
[0071] Primer 1: 1 pmole
[0072] Primer 2: 20 pmole
[0073] 1.times.Thermo Sequenase.TM. buffer (Amersham Life Sciences,
Cleveland) (final: 26 mM Tris-HCl, pH 9.5, 6.5 mM MgCl2) 5%
DMSO
[0074] 0.2 mM dNTPs (i.e. 0.05 of each dATP, dCTP, dGTP, dTTP)
[0075] 0.25 units Thermo Sequenase.TM. enzyme (Amersham Life
Sciences, Cleveland)
[0076] Final reaction volume: 4 microliters. This small volume
allowed for the reaction to proceed close to completion, and
particularly to consume available dNTPs during the amplification
step. The reaction was overlaid with 10 microliters of Chill Out
Liquid Wax.
[0077] The reaction tube was place in a Perkin-Elmer 9600
Thermo-Cycling apparatus and thermal cycled as follows:
6 94.degree. C. 2 min x1 cycle 94.degree. C. 30 sec *60.degree. C.
30 sec x39 cycles 72.degree. C. 2 min 65.degree. C. 7 min x1 cycle
*annealling temperature may vary within about 6.degree. C.
depending on empirically determined optimization for the specific
primer pair.
[0078] After thermal cycling, the reaction vessel was cooled to 4 C
for 10 min, whereupon the Chill Out Wax solidified and prevented
any PCR carry over of product which could lead to
contamination.
[0079] 6 microliters of the following sequencing mix was then
added:
[0080] 1.2 microliters: Sequencing Primer (20 pmole)
[0081] 1.0 microliters concentrated Thermo Sequenase.TM. buffer
(Amersham Life Sciences, Cleveland) (final: 26 mM Tris-HCl, pH 9.5,
6.5 mM MgCl2)
[0082] 1.0 microliters thermal stable polymerase (Thermo Sequenase)
(3 units)
[0083] 1.0 microliters 20% (v/v) DMSO
[0084] 3.0 microliters 1:100 ratio of ddNTP and 4 dNTPs (final
concentrations of 2.5 microM and 250 microM respectively).
[0085] The Sequencing primer selected was a fluoresceinated version
of the subservient primer (i.e. the one originally added in lesser
amount). The fluorescent label allows for detection of reaction
products in an automated DNA sequencer, such as the Pharmacia
A.L.F.
[0086] The ddNTP selected corresponds to the desired termination
reaction, and is either ddATP, ddCTP, ddGTP or ddTTP.
[0087] The reaction was thermal cycled at the following
temperatures in a Perkin-Elmer 9600 thermal cycling apparatus for
15 cycles
[0088] 95.degree. C. 15 sec
[0089] 50.degree. C. 5 sec
[0090] 70.degree. C. 15 sec
[0091] After the thermal cycles, the reaction was cooled to 4 C. It
was mixed with 6 microliters stop solution (formamide and
glycerol), and 1-3 (up to 10) microliters were loaded per lane of
an A.L.F. automated sequencer.
EXAMPLE 5
[0092] Multiplex amplification of fragments of exon 11 listed in
Table 1 as fragments 11b, 11d, 11i and 11l, of BRCA1 was achieved
as follows:
[0093] 5 ul of patient sample genomic DNA (20 ng/ul) was combined
with 2 ul 10X PCR Buffer, 0.6 ul 50 mM Mg2+, 0.4 ul 10 mM dNTP mix
(containing each of the 4 dNTPs), 1 ul DMSO (100%), and 6 ul ddH2O.
1 ul of a mixture containing 50 ng/ul of each primer pair
(indicated in Table 1), (i.e. 50 ng each primer), one of each pair
being labeled on its 5' end with a fluorescein label, was added to
the mix, totaling 4 ul (1 ul for each primer pair).
[0094] The mixture was prepared on ice. Addition of 1 ul Taq
Polymerase (1 U/ul) (Roche Molecular Systems, Inc.), brought the
total volume to 20 ul, and was followed by thermal cycling as
follows:
[0095] Initial denaturation 94C 10 min
7 Cycle (20-35 times) anneal 50 C 40 sec extend 72 C 60 sec
denature 94 C 30 sec
[0096] Final extension 72C 10 min then held at room
temperature.
[0097] An equal volume of Stop Solution comprising formamide and a
visible dye was added after the reaction was completed. 6 ul of
this mixture was loaded into a single lane of an A.L.F. Sequencing
Gel, and the reaction products were detected on an A.L.F. automated
DNA sequencer (Pharmacia, Inc., Piscataway, N.J.).
EXAMPLE 6
[0098] The procedure of Example 2 is repeated, using a combination
of primers identified by Sequence ID Nos. 3, 4, 65 and 66 to
perform a multiplex amplification of exons 2 and 20.
Sequence CWU 1
1
* * * * *
References