U.S. patent application number 09/974498 was filed with the patent office on 2003-01-23 for high affinity humanized anti-cea monoclonal antibodies.
Invention is credited to Anderson, W.H Kerr, Armour, Kathryn, Carr, Frank J., Harris, William J., Tempest, Philip R..
Application Number | 20030018171 09/974498 |
Document ID | / |
Family ID | 26699694 |
Filed Date | 2003-01-23 |
United States Patent
Application |
20030018171 |
Kind Code |
A1 |
Anderson, W.H Kerr ; et
al. |
January 23, 2003 |
High affinity humanized anti-CEA monoclonal antibodies
Abstract
Novel humanized monoclonal antibodies, fragments or derivatives
thereof which specifically bind carcinoembryonic antigen (CEA) are
provided as well as methods for their manufacture. These humanized
antibodies are useful in the treatment of cancers which express CEA
as well as for diagnostic purposes, e.g., for in vivo imaging of
tumors or cancer cells which express CEA.
Inventors: |
Anderson, W.H Kerr;
(Midland, MI) ; Tempest, Philip R.; (West
Wratting, GB) ; Carr, Frank J.; (The Holdings,
GB) ; Harris, William J.; (Carnoustie, GB) ;
Armour, Kathryn; (West Wratting, GB) |
Correspondence
Address: |
THE DOW CHEMICAL COMPANY
INTELLECTUAL PROPERTY SECTION
P. O. BOX 1967
MIDLAND
MI
48641-1967
US
|
Family ID: |
26699694 |
Appl. No.: |
09/974498 |
Filed: |
October 9, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09974498 |
Oct 9, 2001 |
|
|
|
09672609 |
Sep 28, 2000 |
|
|
|
09672609 |
Sep 28, 2000 |
|
|
|
09025403 |
Feb 18, 1998 |
|
|
|
09025403 |
Feb 18, 1998 |
|
|
|
PCT/US97/19642 |
Oct 30, 1997 |
|
|
|
60029694 |
Oct 31, 1996 |
|
|
|
Current U.S.
Class: |
530/388.15 |
Current CPC
Class: |
C07K 2319/00 20130101;
C07K 2317/24 20130101; A61K 2039/505 20130101; C07K 16/3007
20130101 |
Class at
Publication: |
530/388.15 |
International
Class: |
C07K 016/44 |
Claims
What is claimed is:
1. A humanized antibody or humanized antibody fragment which
specifically binds CEA wherein said humanized antibody or humanized
antibody fragment is derived from a murine antibody that binds
CEA.
2. The humanized antibody or humanized antibody fragment of claim 1
comprising CDRs which are obtained from said murine antibody, and
comprising VH FRs which have an amino acid sequence of the NEWM FRs
or the humanized COL-1 FRs of FIG. 1 or 13, and comprising VL FRs
which have an amino acid sequence of the REI FRs or the humanized
COL-1 FRs of FIG. 2 or 14.
3. The humanized antibody or humanized antibody fragment of claim 2
wherein said humanized antibody has an antigen binding affinity for
CEA which is at least 10% that of COL-1 and said humanized antibody
fragment has an amino acid sequence identical to that of a
constituent part of said humanized antibody.
4. The humanized antibody or humanized antibody fragment of claim 2
wherein said humanized antibody has an antigen binding affinity for
CEA which is at least 30% that of COL-1.
5. The humanized antibody or humanized antibody fragment of claim 2
wherein said murine antibody is any one of COL-1 through
COL-15.
6. The humanized antibody or humanized antibody fragment of claim 5
wherein said murine antibody is COL-1.
7. The humanized antibody or humanized antibody fragment of claim 6
wherein said humanized antibody is expressed by ATCC CRL-12208 and
said humanized antibody fragment has an amino acid sequence
identical to that of a constituent part of the antibody expressed
by ATCC CRL-12208.
8. The humanized antibody or humanized antibody fragment of claim 1
comprising a humanized variable heavy chain sequence of FIG. 1 or
13 or a humanized variable light chain sequence of FIG. 2 or 14, or
comprising both said humanized variable heavy chain sequence and
said humanized variable light chain sequence.
9. A nucleic acid sequence from which may be expressed a humanized
antibody or humanized antibody fragment according to claim 2.
10. A vector comprising a nucleic acid sequence according to claim
9.
11. The vector according to claim 10 wherein said vector is a bare
nucleic acid segment, a carrier-associated nucleic acid segment, a
nucleoprotein, a plasmid, a virus, a viroid, or a transposable
element.
12. A composition suitable for the treatment of cancer in that it
comprises a therapeutically effective amount of a humanized
antibody or humanized antibody fragment according to claim 1.
13. The composition of claim 12 wherein said humanized antibody or
humanized antibody fragment is, directly or indirectly, associated
with or linked to an effector moiety having therapeutic activity,
and the composition is suitable for the treatment of cancer.
14. The composition of claim 13 wherein said effector moiety is a
radionuclide, therapeutic enzyme, anti-cancer drug, cytokine,
cytotoxin, or anti-proliferative agent.
15. A composition suitable for the in vivo or in vitro detection of
cancer characterized in that it comprises a diagnostically
effective amount of a humanized antibody or humanized antibody
fragment according to claim 1.
16. The composition of claim 15 wherein said humanized antibody or
humanized antibody fragment is, directly or indirectly, associated
with or linked to a detectable label, and the composition is
suitable for detection of cancer.
17. The composition of claim 16 wherein the detectable label is a
radionuclide or an enzyme.
18. A method for in vivo treatment of a mammal having a
CEA-expressing cancer comprising a step of administering to the
mammal a therapeutically effective amount of a composition
according to claim 12.
19. A method of in vitro immunodetection of CEA-expressing cancer
cells comprising a step of contacting the cancer cells with a
composition according to claim 15.
20. The method of claim 19 wherein the humanized antibodies or
humanized antibody fragments of the composition are bound to a
solid support.
21. A method of in vivo immunodetection of CEA-expressing cancer
cells in a mammal comprising a step of administering to the mammal
a diagnostically effective amount of a composition according to
claim 15.
22. The method of claim 20 wherein said immunodetection is in vivo
tumor imaging.
23. A method of in vivo treatment of cancer comprising the steps of
(i) intravenously administering a radionuclide-labeled antibody,
(ii) thereafter detecting tumor cells using a radionuclide activity
probe, and (iii) thereafter removing the detected tumor cells by
surgical excision, characterized in that the antibody is a
humanized antibody or humanized antibody fragment according to
claim 1.
24. The method of claim 23, wherein the radionuclide is .sup.125I
or .sup.131I.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to humanized monoclonal
antibodies and fragments or derivatives thereof which specifically
bind carcinoembryonic antigen (CEA), which is an antigen expressed
by various human carcinomas including breast, lung, and
gastrointestinal carcinomas such as stomach and colon cancers. More
specifically, the present invention relates to humanized monoclonal
antibodies and humanized antibody fragments and derivatives thereof
which are derived from murine monoclonal antibody COL-1, a high
affinity anti-CEA antibody. The present invention further relates
to methods for producing such humanized monoclonal antibodies
specific to CEA, pharmaceutical and diagnostic compositions
containing such humanized monoclonal antibodies, and methods of use
thereof for the treatment or diagnosis of cancer.
BACKGROUND OF THE INVENTION
[0002] The identification of antigens expressed by tumor cells and
the preparation of mono clonal antibodies which specifically bind
such antigens is well known in the art. Anti-tumor monoclonal
antibodies exhibit potential application as both therapeutic and
diagnostic agents. Such monoclonal antibodies have potential
application as diagnostic agents because they specifically bind
tumor antigens and thereby can detect the presence of tumor cells
or tumor antigen in an analyte. For example, use of monoclonal
antibodies which bind tumor antigens for in vitro and in vivo
imaging of tumor cells or tumors using a labeled form of such a
monoclonal antibody is conventional in the art.
[0003] Moreover, monoclonal antibodies which bind tumor antigens
have well known application as therapeutic agents. The usage of
monoclonal antibodies themselves as therapeutic agents, or as
conjugates wherein the monoclonal antibody is directly or
indirectly attached to an effector moiety, e.g., a drug, cytokine,
cytotoxin, etc., is well known.
[0004] Essentially, if the monoclonal antibody is attached to an
effector moiety, then the monoclonal antibody functions as a
targeting moiety, i.e. it directs the effector moiety (which
typically possesses therapeutic activity) to the antibody's target,
e.g., a tumor which expresses the antigen bound by the monoclonal
antibody. In contrast, when the monoclonal antibody itself operates
as a therapeutic agent, the antibody functions both as a targeting
moiety--i.e. it will specifically bind a cell which expresses the
antigen--and as an effector which mediates therapeutic activity,
typically tumor cell lysis. A monoclonal antibody may possess one
or more of such effector functions, which include, e.g.,
antibody-dependent cellular cytotoxicity (ADCC) and complement
dependent cytotoxicity (CDC), among others; these functions are
effected by the portion of the antibody molecule generally referred
to in the literature as the Fc portion.
[0005] One specific tumor antigen to which various monoclonal
antibodies have been produced is the carcinoembryonic antigen
(CEA). CEA is an antigen complex having a molecular weight of about
180,000 D, which is expressed by numerous carcinomas including
gastrointestinal carcinomas, colorectal carcinomas, breast
carcinomas, ovarian carcinomas, and lung carcinomas. See, e.g.,
Robbins et al., Int'l J. Cancer, 53(6):892-897 (1993); Greiner et
al., J. Clin. Oncol., 10(5):735-746 (1992); Obuchi et al., Cancer
Res., 47(13):3565-3571 (1987); Muraro et al., Cancer Res., 45(11
Pt. 2):5769-5780 (1985).
[0006] The use of monoclonal antibodies to detect various, specific
CEA epitopes differentially expressed on human carcinomas has been
reported in the literature. See, e.g., Obuchi et al., Cancer Res.,
47(13):3565-3571 (1987); Muraro et al., Cancer Res., 45(11 Pt.
2):5769-5780 (1985).
[0007] In particular, Muraro et al. (id.) report generation of
monoclonal antibodies designated COL-1 through COL-15, which
exhibit a strong, selective reactivity for human colon carcinomas
versus normal adult tissues. These antibodies react with distinct,
restricted epitopes on CEA. Of these antibodies, the COL-1 antibody
has been the focus of considerable attention because of its high
affinity for CEA (1.4.times.10.sup.9 M.sup.-1) and also because it
comprises no detectable reactivity for CEA-related antigens such as
the nonspecific cross-treating antigen (NCA) and the normal fecal
antigen (NFA). Robbins et al., Int'l J. Canc., 53(6):892-897
(1993).
[0008] Because of its binding properties, COL-1 is currently being
evaluated for use as a therapeutic agent. For example, Siler et al.
(Biotech. Ther., 4(3-4):163-181 (1993)) report the administration
of .sup.131I-labeled COL-1 to LS-M4T human colon carcinoma
xenograft-containing athymic mice. They report that this treatment
resulted in reduction of the rate of tumor growth, within little or
no toxicity, and that their results demonstrate the potential
therapeutic efficacy of radiolabeled COL-1 in clinical trials.
Also, Yu et al. (J. Clin. Oncol., 14(6):1798-1809 (1996)) report
that .sup.131I-labeled COL-1 is now in phase 1 clinical trials in
patients having gastrointestinal malignancies. They further
indicate that the antibody conjugate is well tolerated, except for
some hematologic toxicity. In addition, the use of conjugates of
COL-1 and .beta.-galactosidase has been shown to specifically kill
in vitro tumor cells from a variety of tumor cell lines. Abraham et
al., Cell Biophys., 24-25:127-133 (1994).
[0009] However, while murine antibodies, such as COL-1 and other
anti-CEA murine antibodies, have applicability as therapeutic
agents in humans, they are disadvantageous in some respects.
Specifically, because murine antibodies are of foreign species
origin, they may be immunogenic in humans. This may result in a
neutralizing antibody response--a human anti-murine antibody (HAMA)
response--which is particularly problematic if the antibodies are
desired to be administered repeatedly, e.g., for treatment of a
chronic or recurrent disease condition. This is a significant
drawback, as some cancer treatments are effected over a prolonged
time period, e.g., over several years or longer. Also, because
these antibody molecules contain murine constant domains they may
not exhibit human effector functions.
[0010] In an effort to eliminate or reduce such problems, chimeric
antibodies have been disclosed. Chimeric antibodies contain
portions of two different antibodies, typically of two different
species. Generally, such antibodies contain human constant regions
attached to variable regions from another species, typically murine
variable regions. For example, some mouse/human chimeric antibodies
have been reported which exhibit binding characteristics of the
parental mouse antibody and effector functions associated with the
human constant region. See, e.g., U.S. Pat. No. 4,816,567 to
Cabilly et al.; U.S. Pat. No. 4,978,745 to Shoemaker et al.; U.S.
Pat. No. 4,975,369 to Beavers et al; and U.S. Pat. No. 4,816,397 to
Boss et al. Generally, these chimeric antibodies are constructed by
preparing a genomic gene library from DNA extracted from
pre-existing murine hybridomas. Nishimura et al., Cancer Res.,
47:999 (1987). The library is then screened for variable region
genes from both heavy and light chains exhibiting the correct
antibody fragment rearrangement patterns. Alternatively, cDNA
libraries are prepared from RNA extracted from the hybridomas and
then screened, or the variable regions are obtained by polymerase
chain reaction. The cloned variable region genes are then ligated
into an expression vector containing cloned cassettes of the
appropriate heavy or light chain human constant region gene. The
chimeric genes are then expressed in a cell line of choice, usually
a murine mycloma line. Such chimeric antibodies have been used in
human therapy.
[0011] Moreover, the production of a chimeric mouse anti-human
antibody derived from COL-1, which specifically binds CEA, has been
reported. See e.g., U.S. Pat. No. 5,472,693 to Gourlie et al.
(owned by The Dow Chemical Company).
[0012] Also, Morrison et al. report the preparation of several
anti-tumor chimeric monoclonal antibodies, in Important Advances in
Oncology, Recombinant Chimeric Monoclonal Antibodies, pp. 3-18 (S.
A. Rosenberg, ed., 1990) (J. B. Lippincott, Philadelphia, Pa.).
Results of clinical trials with chimeric cMAb-17-1A in patients
with metastatic colorectal carcinoma now show that this antibody
has a 6-fold longer circulation time and significantly reduced
immunogenicity as compared to the murine monoclonal antibody from
which it was derived. LoBuglio et al., Proc. Natl. Acad. Sci. USA,
86:4220-4224 (1989); Meredith et al., J. Nucl. Med., 32:1162-1168
(1991).
[0013] However, while such chimerized monoclonal antibodies
typically exhibit lesser immunogenicity, they are still potentially
immunogenic in humans because they contain murine variable
sequences which may elicit antibody responses. Thus, there is the
possibility that these chimeric antibodies may elicit an
anti-idiotypic response if administered to patients. Saleh et al.,
Cancer Immunol. Immunother., 32:185-190 (1990).
[0014] Because of the immunogenicity of chimeric antibodies,
methods have been developed recently for the production of
"humanized" antibodies. Ideally, "humanization" results in an
antibody that is less immunogenic, with complete retention of the
antigen-binding properties of the original molecule. In order to
retain all the antigen-binding properties of the original antibody,
the structure of its combining-site has to be faithfully reproduced
in the "humanized" version. This can potentially be achieved by
transplanting the combining site of the nonhuman antibody onto a
human framework, either: (a) by grafting only the nonhuman
complementarity determining regions (CDRs) onto human framework
regions (FRs) and constant regions, with or without retention of
critical framework residues (see, Jones et al., Nature, 321:522
(1986) and Verhoeyen et al., Science, 239:1539 (1988); or (b) by
transplanting the entire nonhuman variable domains (to preserve
ligand-binding properties) and also "cloaking" them with a
human-like surface through judicious replacement of exposed
residues (in order to reduce antigenicity) (see, Padlan, Molec.
Immunol., 28:489 (1991)).
[0015] Essentially, humanization by CDR-grafting involves
transplanting only the CDRs onto human framework and constant
regions. Theoretically, this should substantially eliminate
immunogenicity (except if allotypic or idiotypic differences
exist). Jones et al., Nature, 321:522-525 (1986); Verhoeyen et al.,
Science, 239:1534-1536 (1988), Riechmann et al., Nature,
332:323-327 (1988). However, CDR-grafting by itself may not yield
the desired result. Rather, it has been reported that some
framework residues of the original antibody may also need to be
preserved in order to preserve antigen binding activity. Riechmann
et al., Nature, 332:323-327 (1988); Queen et al., Proc. Natl. Acad.
Sci. USA, 86:10023-10029; Tempest et al., Biol. Technology,
9:266-271 (1991); Co et al., Nature, 351:501-502 (1991).
[0016] As discussed above, in order to preserve the antigen-binding
properties of the original antibody, the structure of its combining
site must be faithfully reproduced in the humanized molecule. X-ray
crystallographic studies have shown that the antibody combining
site is built primarily from CDR residues, although some
neighboring framework residues have been found to be involved in
antigen binding. Amit et al., Science, 233:747-753 (1986); Colman
et al., Nature, 326:358-363 (1987); Sheriff et al., Proc. Natl.
Acad. Sci. USA, 84:8075-8079 (1987); Padlan et al., Proc. Natl.
Acad. Sci. USA, 86:5938-5942 (1989); Fischmann et al., J. Biol.
Chem., 266:12915-12920 (1991); Tulip et al., J. Molec. Biol.,
227:122-148 (1992). It has also been found that the structures of
the CDR loops are significantly influenced by surrounding framework
structures. Chothia et al., J. Molec. Biol., 196:901-917 (1987);
Chothia et al., Nature, 342:877-883 (1989); Tramomonteno et al., J.
Molec. Biol., 215:175-182 (1990).
[0017] In addition to the effect of the framework residues on the
CDRs, small but significant differences from the relative
disposition of the variable light chain (V.sub.L) and variable
heavy (V.sub.H) domains have been noted (Colman et al., Nature,
326:358-363 (1987)) and those differences are ostensibly due to
variations in the residues involved in the interdomain contact
(Padlan et al., Molec. Immunol., 31:169-217 (1994)).
[0018] Furthermore, structural studies on the effect of the
mutation of interior residues, in which changes in side chain
volume are involved, have shown that the resulting local
deformations are accommodated by shifts in side chain positions
that are propagated to distant parts of the molecular interior.
This suggests that during humanization the interior residues in the
variable domains and in the interface between these domains, or at
least the interior volumes, should also be maintained; a
humanization protocol in which an interior residue is replaced by
one of different properties, such as size, charge, or
hydrophobicity, could result in a significant modification of the
antigen combining-site structure. One method of potentially
identifying the framework residues which need to be preserved is by
computer modeling. Alternatively, critical framework residues may
potentially be identified by comparing known antibody combining
site structures. Padlan, Molec. Immun., 31(3):169-217 (1994).
[0019] The residues which potentially affect antigen binding fall
into several groups. The first group comprises residues that are
contiguous with the combining site surface and which could
therefore make direct contact with antigens. These residues include
the amino-terminal residues and those adjacent to the CDRs. The
second group includes residues that could alter the structure or
relative alignment of the CDRs by contacting either the CDRs or the
opposite chains. The third group comprises amino acids with buried
side chains that could influence the structural integrity of the
variable domains. The residues in these groups are usually found in
the same positions (id.) according to the adopted numbering system.
See Kabat et al., Sequences of Proteins of Immunological Interest,
NIH Pub. No. 91-3242 (5th ed., 1991) (U.S. Dept. Health & Human
Services, Bethesda, Md.) and Genbank.
[0020] Given these effects of changes in amino acid residues,
although humanized antibodies are desirable because of their
potential low immunogenicity in humans, their production is
unpredictable. For example, sequence modification of antibodies may
result in substantial or even total loss of antigen binding
affinity, or loss of binding specificity. Alternatively, "humanized
antibodies" may still exhibit immunogenicity in humans,
irrespective of sequence modification.
[0021] Thus, there still exists a significant need in the art for
novel humanized antibodies to desired antigens. More specifically,
there exists a need in the art for humanized antibodies specific to
CEA, because of their potential as improved immunotherapeutic and
immunodiagnostic agents for treatment and diagnosis of cancers
expressing CEA, e.g., gastrointestinal and colorectal cancers,
breast cancers, lung cancers, and ovarian cancers, among
others.
OBJECTS OF THE INVENTION
[0022] Toward this end, it is an object of the invention to provide
humanized antibodies which are specific to human carcinoembryonic
antigen (CEA), i.e. anti-CEA (".alpha.CEA") antibodies. More
specifically, it is an object of the invention to provide humanized
antibodies derived from murine .alpha.CEA antibodies and in
particular from COL-1, a specific murine antibody of the IgG2a
isotype having high affinity for CEA.
[0023] It is also an object of the invention to provide
pharmaceutical compositions containing humanized .alpha.CEA
antibodies. It is a more specific object of the invention to
provide pharmaceutical compositions containing humanized antibodies
derived from the high affinity murine .alpha.CEA antibody,
COL-1.
[0024] It is another specific object of the invention to provide
methods of using humanized .alpha.CEA antibodies for treatment of
cancers which express CEA, in particular breast, lung, ovarian,
gastrointestinal, and colorectal cancers, among others.
[0025] It is another object of the invention to provide
immunodiagnostic compositions for detecting cancer cells, the
compositions containing a humanized .alpha.CEA antibody, preferably
derived from COL-1, which antibody is in labeled or unlabeled form.
It is another object of the invention to provide a method of
immunodiagnosis of cancer using compositions which contain a
humanized .alpha.CEA antibody, preferably derived from COL-1, which
is in labeled or unlabeled form.
[0026] It is still another object of the invention to provide
nucleic acid sequences which encode humanized .alpha.CEA antibodies
or fragments thereof. It is a more specific object of the invention
to provide nucleic acid sequences which encode humanized antibodies
derived from the high affinity murine .alpha.CEA antibody, COL-1.
It is another object of the invention to provide vectors which
provide for the expression of humanized .alpha.CEA antibodies, in
particular humanized antibodies derived from the high affinity
murine .alpha.CEA antibody, COL-1.
BRIEF DESCRIPTION OF THE FIGURES
[0027] FIG. 1 contains an alignment of the amino acid sequences of
murine COL-1 V.sub.H (COL1MuVH), a NEWM FR template, and a
humanized NEWM-based V.sub.H (COL1NMVH or "HuVH"). The CDRs are
boxed. Murine FR residues retained in the various humanized VHs
exemplified herein are are indicated by the symbols (.Arrow-up
bold.), (A), (T), (S), (T), (A), and (Y), according to the table
below.
1 Murine Residues COL1NMVH Retained at Position Version * 24 72 76
78 79 80 HuVH .Arrow-up bold. HuVHA .Arrow-up bold. HuVHAT
.Arrow-up bold. A T HuVHAA .Arrow-up bold. A A HuVHAY .Arrow-up
bold. A Y HuVHATAY .Arrow-up bold. A T A Y HuVHASTAY .Arrow-up
bold. A S T A Y HuVHT .Arrow-up bold. T HuVHS .Arrow-up bold. S
HuVHSTAY .Arrow-up bold. S T A Y (* -- Retained murine residues
indicated by the symbol (.Arrow-up bold.) are F-27, N-28, I-29,
K-30, N-97, and T-98.) HuVHSTAY is the version of COL1NMVH
expressed from the deposited cell line, ATCC CRL-12208.
[0028] FIG. 2 contains an alignment of the amino acid sequences of
murine COL-1 V.sub.K (COL1MuVK or "HuVK"), an REI FR template, and
a humanized REI-based V.sub.K (COL1REVK). The CDRs are boxed. The
murine FR residues retained in the humanized sequence are indicated
by the symbols: (F) for HuVKF, and (V) and (L) for HuVKVL. HuVKVL
is the version of COL1REVK expressed from the deposited cell line,
ATCC CRL-12208.
[0029] FIG. 3 shows the IgG1 expression vectors used to express the
subject humanized antibodies in NSO myeloma cells.
[0030] FIG. 4 shows binding of different COL-1 antibodies to CEA,
as measured by an ELISA assay.
[0031] FIG. 5 contains results of ELISA assays with COL-1
antibodies including those produced according to the invention.
[0032] FIG. 6 contains results of ELISA assays with COL-1
antibodies including those produced according to the invention.
[0033] FIG. 7 contains results of ELISA assays with COL-1
antibodies including those produced according to the invention.
[0034] FIG. 8 contains results of ELISA assays with COL-1
antibodies including those produced according to the invention.
[0035] FIG. 9 contains results of ELISA assays with COL-1
antibodies including those produced according to the invention.
[0036] FIG. 10 contains results of ELISA assays with COL-1
antibodies including those produced according to the invention.
[0037] FIG. 11 contains results of ELISA assays with COL-1
antibodies including those produced according to the invention.
[0038] FIG. 12 contains results of ELISA assays with COL-1
antibodies including those produced according to the invention.
[0039] FIG. 13 contains the amino acid sequences of the humanized
V.sub.H expressed by the deposited cell line ATCC CRL-12208.
[0040] FIG. 14 contains the amino acid sequences of the humanized
V.sub.K expressed by the deposited cell line ATCC CRL-12208.
[0041] FIG. 15 presents the nucleotide sequence of the DNA template
use to produce the initial humanized COL-1 heavy chain variable
region, HuVH.
[0042] FIG. 16 presents the nucleotide sequence of the DNA template
used to produce a variety of HuVH derivatives.
[0043] FIG. 17 presents the nucleotide sequence of the DNA template
used to produce the initial humanized COL-1 light chain variable
region, HuVK.
[0044] FIG. 18 presents the nucleotide sequence of the DNA template
used to produce a the HuVKVL derivative of HuVK.
DETAILED DESCRIPTION OF THE INVENTION
[0045] Prior to setting forth the invention, definitions of certain
terms which are used in this disclosure are set forth below.
[0046] Antibody--This refers to single chain, two-chain, and
multi-chain proteins and glycoproteins belonging to the classes of
polyclonal, monoclonal, chimeric, and hetero immunoglobulins
(monoclonal antibodies being preferred); it also includes synthetic
and genetically engineered variants of these immunoglobulins.
"Antibody fragment" includes Fab, Fab', F(ab').sub.2, and Fv
fragments, as well as any portion of an antibody having specificity
toward a desired target epitope or epitopes.
[0047] Humanized antibody--This will refer to an antibody derived
from a non-human antibody, typically murine, that retains or
substantially retains the antigen-binding properties of the parent
antibody but which is less immunogenic in humans. This may be
achieved by various methods including (a) grafting only the
non-human CDRs onto human framework and constant regions with or
without retention of critical framework residues, or (b)
transplanting the entire non-human variable domains, but "cloaking"
them with a human-like section by replacement of surface residues.
Such methods as are useful in practicing the present invention
include those disclosed in Jones et al., Morrison et al., Proc.
Natl. Acad. Sci. USA, 81:6851-6855 (1984); Morrison and Oi, Adv.
Immunol., 44:65-92 (1988); Verhoeyen et al., Science, 239:1534-1536
(1988); Padlan, Molec. Immun., 28:489-498 (1991); Padlan, Molec.
Immun., 31(3):169-217 (1994).
[0048] Complementarity Determining Region, or CDR--The term CDR, as
used herein, refers to amino acid sequences which together define
the binding affinity and specificity of the natural Fv region of a
native immunoglobulin binding site as delineated by Kabat et al.
(1991).
[0049] Framework Region--The term FR, as used herein, refers to
amino acid sequences interposed between CDRs. These portions of the
antibody serve to hold the CDRs in an appropriate orientation for
antigen binding.
[0050] Constant Region--The portion of the antibody molecule which
confers effector functions. In the present invention, murine
constant regions are substituted with human constant regions. The
constant regions of the subject chimeric or humanized antibodies
are derived from human immunoglobulins. The heavy chain constant
region can be selected from any of the five isotypes: alpha, delta,
epsilon, gamma or mu. Further, heavy chains of various subclasses
(such as the IgG subclasses of heavy chains) are responsible for
different effector functions and thus, by choosing the desired
heavy chain constant region chimeric antibodies with desired
effector function can be produced. Preferred constant regions are
gamma 1 (IgG1), gamma 3 (IgG3) and gamma 4 (IgG4). More preferred
is a constant region of the gamma 1 (IgG1) isotype. The light chain
constant region can be of the kappa or lambda type, preferably of
the kappa type.
[0051] Chimeric antibody--This is an antibody containing sequences
derived from two different antibodies, which typically are of
different species. Most typically chimeric antibodies comprise
human and murine antibody fragments, generally human constant and
murine variable regions.
[0052] Mammals--Animals that nourish their young with milk secreted
by mammary glands, preferably warm blooded mammals, more preferably
humans.
[0053] Immunogenicity--A measure of the ability of a targeting
protein or therapeutic moiety to elicit an immune response (humoral
or cellular) when administered to a recipient. The present
invention is concerned with the immunogenicity of the subject
humanized antibodies or fragments thereof.
[0054] Humanized reduced immunogenicity--This refers to a humanized
antibody exhibiting reduced immunogenicity relative to the parent
antibody, typically a murine antibody such as COL-1.
[0055] Humanized antibody substantially retaining the binding
properties of the parent antibody--This refers to a humanized
antibody which retains the ability to specifically bind the antigen
recognized by the parent antibody used to produce such humanized
antibody. Preferably the humanized antibody will exhibit the same
or substantially the same antigen-binding affinity and avidity as
the parent antibody, e.g., COL-1. Ideally, the affinity of the
antibody will not be less than 5% of the parent antibody affinity,
more preferably not less than about 30%, and most preferably the
affinity will not be less than 50% of the parent antibody. Methods
for assaying antigen-binding affinity are well known in the art and
include half-maximal binding assays, competition assays, and
Scatchard analysis. Suitable antigen binding assays are described
in this application.
[0056] In its broadest embodiment, the present invention is
directed to humanized antibodies which specifically bind CEA, an
antigen expressed by various human cancers, in particular
gastrointestinal, colorectal, breast, lung, and ovarian cancers.
Preferably, such humanized antibodies will be derived from
antibodies having good binding affinity to CEA, such as COL-1
through COL-15 disclosed by Muraro et al., Cancer Res., 45(11 Pt.
2):5769-5780 (1985).
[0057] Most preferably, such humanized antibodies will be derived
from COL-1, a murine antibody of the IgG2a isotype, which has been
reported to bind to CEA with high affinity (1.4.times.10.sup.9
M.sup.-1) with no detectable cross-reactivity for CEA-related
antigens, such as the non-specific cross-reacting antigen (NCA) and
the normal fecal antigen (NFA).
[0058] As discussed above, humanized antibodies afford potential
advantages over murine and also chimeric antibodies, e.g., reduced
immunogenicity in humans. This is advantageous because it should
reduce and potentially eliminate the eliciting of a HAMA response
when such humanized antibodies are administered in vivo, e.g.,
either for treatment of cancer or for diagnosis of cancer as by
tumor imaging. Also, such antibodies may exhibit improved plasma
clearance, pharmacokinetic, and tumor targeting properties.
[0059] However, as noted above, humanization may in some instances
adversely affect antigen binding. Preferably, the humanized
.alpha.CEA antibodies of the present invention will possess a
binding affinity for CEA of not less than about 5% and more
preferably not less than about 30%, and most preferably not less
than 50% of the CEA binding antigen affinity of the parent murine
antibody, preferably COL-1. Most preferably, the humanized
antibodies of the present invention will possess a binding affinity
for CEA of not less than about 5% and more preferably not less than
about 30% and most preferably not less than about 50% of the CEA
binding affinity of COL-1, or a chimeric antibody derived
therefrom.
[0060] Preferably, the humanized antibodies of the present
invention will bind the same epitope as COL-1. Such antibodies can
be identified based on their ability to compete with COL-1 for
binding to CEA or to CEA-expressing cells.
[0061] In general, the subject humanized antibodies are produced by
obtaining nucleic acid sequences encoding the variable heavy
(V.sub.H) and variable light chains (V.sub.L, e.g., V.sub.K) of an
antibody which binds CEA (preferably COL-1), identifying the CDRs
in said V.sub.H and V.sub.L sequences, and grafting such
CDR-encoding nucleic acid sequences onto selected human
framework-encoding nucleic acid sequences.
[0062] Preferably, the human framework amino acid sequences are
selected such that the resulting antibody is likely to be suitable
for in vivo administration in humans. This can be determined, e.g.,
based on previous usage of antibodies containing such human FRs.
Preferably, the human FRs will not themselves be significantly
immunogenic. Examples of such human frameworks include NEWM and
REI.
[0063] Alternatively, the amino acid sequences of the FRs of the
antibody to be humanized (e.g., COL-1) will be compared to those of
known human FRs, and the human FRs to be used for CDR-grafting will
be selected based on their comprising sequences highly similar to
those of the parent antibody, e.g., a murine antibody which binds
CEA. Numerous human FRs have been isolated and their sequences
reported in the literature. This enhances the likelihood that the
resultant CDR-grafted "humanized" antibody, which contains the CDRs
of the parent (e.g., murine) antibody grafted onto the selected
human FRs, will substantially retain the antigen binding structure
and thus retain the binding affinity of the parent antibody. As a
result of such studies, the FRs of REI and NEWM antibodies have
been identified as having amino acid sequences which are likely to
allow the CDRs of COL-1 To retain a significant degree of antigen
binding affinity. As noted, the selected human framework regions
will preferably be those that are expected to be suitable for in
vivo administration, i.e., not immunogenic. Based on their amino
acid sequences, REI and NEWM human framework regions are expected
to be substantially non-immunogenic.
[0064] In either method, the DNA sequences encoding the V.sub.H and
V.sub.L regions of the preferably murine .alpha.CEA antibody must
be obtained. Methods for cloning nucleic acid sequences encoding
immunoglobulins are well known in the art. Such methods will
generally involve the amplification of the immunoglobulin-encoding
sequences to be cloned using appropriate primers by polymerase
chain reaction (PCR). Primers suitable for amplifying
immunoglobulin nucleic acid sequences, and specifically murine
variable heavy and variable light sequences, have been reported in
the literature. After such immunoglobulin-encoding sequences have
been cloned, they will be sequenced by methods well known in the
art. This will be effected in order to identify the V.sub.H- and
V.sub.L-encoding sequences, and more specifically the portions
thereof which encode the CDRs and FRs. This can be effected by well
known methods which include, e.g., those disclosed in U.S. Pat. No.
4,816,397 to Boss et al. and U.S. Pat. No. 5,225,539 to Winter et
al.
[0065] Once the DNA sequences encoding the CDRs and FRs of the
antibody which is to be humanized have been identified, the amino
acid sequences encoding the CDRs are then identified (deduced based
on the nucleic acid sequences and the genetic code and by
comparison to previous antibody sequences) and the CDR-encoding
nucleic acid sequences are grafted onto selected human FR-encoding
sequences. This may be accomplished by use of appropriate primers
and linkers. Methods for selecting suitable primers and linkers to
provide for ligation of desired nucleic acid sequences is well
within the purview of the ordinary artisan.
[0066] As discussed above, the selected human FRs used for
humanization will preferably be those that are likely to be
suitable for in vivo administration, i.e. they are not in
themselves immunogenic in humans (e.g., because of allotypic
differences); examples thereof are REI and NEWM human FRs.
Alternatively, the human FRs will be selected such that they
comprise amino acid sequences which are highly similar to those of
the parent antibody's FR sequences. This may be effected by
comparing the amino acid sequences of the murine FRs to those of
previously reported human FRs (see, e.g., Kabat et al., id.).
[0067] After the CDR-encoding sequences are grafted onto the
selected human FR-encoding sequences, the resultant DNA sequences
encoding the "humanized" variable heavy and variable light
sequences will then be expressed to produce a humanized Fv or
humanized antibody which binds CEA. Typically, the humanized
V.sub.H and V.sub.L sequences will be expressed as part of a whole
.alpha.CEA antibody molecule, i.e. as a fusion protein with human
constant domain sequences whose encoding DNA sequences have been
obtained from a commercially available library or which have been
obtained using, e.g., one of the above-described methods for
obtaining DNA sequences. However, the V.sub.H and V.sub.L sequences
can also be expressed in the absence of constant sequences to
produce a humanized .alpha.CEA Fv. Nevertheless, fusion of human
constant sequences is potentially desirable because the resultant
humanized .alpha.CEA antibody may possess human effector functions
such as CDC and ADCC activity.
[0068] Methods for synthesizing DNA encoding a protein of known
sequence are well known in the art. Using such methods, DNA
sequences which encode the subject humanized V.sub.L and V.sub.H
sequences (with or without constant regions) are synthesized, and
then expressed in a vector system suitable for expression of
recombinant antibodies. This may be effected in any vector system
which provides for the subject humanized V.sub.L and V.sub.H
sequences to be expressed as a fusion protein with human constant
domain sequences and to associate to produce functional (antigen
binding) antibodies or antibody fragments. Useful methods are set
forth, e.g., in U.S. Pat. No. 4,816,397 to Boss et al. and U.S.
Pat. No. 5,225,539 to Winter et al.
[0069] Expression vectors and host cells suitable for expression of
recombinant antibodies and humanized antibodies in particular, are
well known in the art. The following references are representative
of methods and vectors suitable for expression of recombinant
immunoglobulins which may be utilized in carrying out the present
invention: Weidle et al., Gene, 51: 21-29 (1987); Dorai et al., J.
Immunol., 13(12):4232-4241 (1987); De Waele et al., Eur. J.
Biochem., 176:287-295 (1988); Colcher et al., Cancer Res.,
49:1738-1745 (1989); Wood et al., J. Immunol., 145(a):3011-3016
(1990); Bulens et al., Eur. J. Biochem., 195:235-242 (1991);
Beggington et al., Biol. Technology, 10:169 (1992); King et al.,
Biochem. J., 281:317-323 (1992); Page et al., Biol. Technology,
9:64 (1991); King et al, Biochem. J., 290:723-729 (1993); Chaudary
et al., Nature, 339:394-397 (1989); Jones et al., Nature,
321:522-525 (1986); Morrison and Oi, Adv. Immunol., 44:65-92
(1988); Benhar et al., Proc. Natl. Acad. Sci. USA, 91:12051-12055
(1994); Singer et al., J. Immunol., 150:2844-2857 (1993); Cooto et
al., Hybridoma, 13(3):215-219 (1994); Queen et al, Proc. Natl.
Acad. Sci. USA, 86:10029-10033 (1989); Caron et al., Cancer Res.,
32:6761-6767 (1992); Cotoma et al., J. Immunol. Meth., 152:89-109
(1992). Moreover, vectors suitable for expression of recombinant
antibodies are commercially available. The vector may, e.g., be a
bare nucleic acid segment, a carrier-associated nucleic acid
segment, a nucleoprotein, a plasmid, a virus, a viroid, or a
transposable element.
[0070] Host cells known to be capable of expressing functional
immunoglobulins include, e.g.: mammalian cells such as Chinese
Hamster Ovary (CHO) cells; COS cells; myeloma cells, such as NSO
and SP2/O cells; bacteria such as Escherichia coli; yeast cells
such as Saccharomyces cerevisiae; and other host cells. Of these,
CHO cells are used by many researchers given their ability to
effectively express and secrete immunoglobulins. NSO cells are one
of the preferred types of host cells useful in the present
invention.
[0071] Essentially, recombinant expression of humanized antibodies
is obtained by one of two general methods. In the first method, the
host cells are transfected with a single vector which provides for
the expression of both V.sub.H and V.sub.L variable sequences
optionally fused to selected constant regions. In the second
method, host cells are transfected with two vectors, each of which
provides for expression of either the V.sub.H or V.sub.L sequence,
each optionally fused to a selected constant region.
[0072] Human constant domain sequences are well known in the art,
and have been reported in the literature. Preferred human constant
light chain sequences (C.sub.L) include the kappa and lambda
constant light sequences. Preferred human constant heavy chain
sequences include human gamma 1, human gamma 2, human gamma 3,
human gamma 4, and mutated versions thereof which provide for
altered effect or function, e.g., enhanced in vivo half-life,
reduced Fc receptor binding, and the like.
[0073] After expression, the antigen binding affinity of the
resultant humanized antibody will be assayed by known methods,
e.g., Scatchard analysis. Ideally, the antigen-binding affinity of
the humanized antibody will approximate that of the parent
antibody, e.g., COL-1. As discussed above, ideally the affinity of
the humanized antibody will not be less than 5% of the parent
antibody, more preferably not less than 30%, and most preferably
not less than 50% of that of the parent antibody, e.g., COL-1.
[0074] In some instances, humanized antibodies produced by grafting
CDRs (from an antibody which binds CEA) onto selected human FRs may
provide humanized antibodies having the desired affinity to CEA.
However, it may be necessary or desirable to further modify
specific residues of the selected human FR in order to enhance
antigen binding. This may occur because it is believed that some
framework residues are essential to or at least affect antigen
binding. Preferably, those framework residues of the parent (e.g.,
murine) antibody which maintain or affect combining-site structures
will be retained. These residues may be identified by X-ray
crystallography of the parent antibody or Fab fragment, thereby
identifying the three-dimensional structure of the antigen-binding
site.
[0075] These residues may potentially be identified by X-ray
crystallography of the parent Fab, thereby identifying the
three-dimensional structure of the antigen-binding site. Also,
framework residues which may be involved in antigen binding may be
putatively selected based on previously reported humanized murine
antibody sequences. Thus, it may be beneficial to retain these and
other murine framework residues from the parent murine antibody to
optimize CEA binding. However, because of inherent unpredictability
associated with amino acid modification of proteins, and antibodies
in particular, the effects of such changes, if any, on antigen
binding are unpredictable. Nevertheless, such methodology will
ideally confer a "human-like" character to the resultant humanized
antibody thus rendering it less immunogenic while retaining the
interior and contacting residues which affect antigen-binding.
[0076] The present invention further embraces variants and
equivalents which are substantially homologous to the humanized
antibodies and antibody fragments set forth herein. These may
contain, e.g., conservative substitution mutations, i.e. the
substitution of one or more amino acids by similar amino acids. For
example, conservative substitution refers to the substitution of an
amino acid with another within the same general class, e.g., one
acidic amino acid with another acidic amino acid, one basic amino
acid with another basic amino acid, or one neutral amino acid by
another neutral amino acid. What is intended by a conservative
amino acid substitution is well known in the art.
[0077] The phrase "substantially homologous" is used in regard to
the similarity of a subject amino acid sequence (of an oligo- or
poly-peptide or protein) to a related, reference amino acid
sequence. This phrase is defined as at least about 75%
"correspondence"--i.e. the state of identical amino acid residues
being situated in parallel--between the subject and reference
sequences when those sequences are in "alignment," i.e. when a
minimal number of "null" bases have been inserted in the subject
and/or reference sequences so as to maximize the number of existing
bases in correspondence between the sequences. "Null" bases are not
part of the subject and reference sequences; also, the minimal
number of "null" bases inserted in the subject sequence may differ
from the minimal number inserted in the reference sequence. In this
definition, a reference sequence is considered "related" to a
subject sequence where 5 both amino acid sequences make up proteins
or portions of proteins which are either .alpha.CEA antibodies or
antibody fragments with .alpha.CEA binding affinity. Each of the
proteins comprising these .alpha.CEA antibodies or antibody
fragments may independently be antibodies or antibody fragments or
bi- or multi-functional proteins, e.g., such as fusion proteins,
bi- and multi-specific antibodies, single chain antibodies, and the
like.
[0078] The present invention is further directed to nucleic acid
sequences from which such humanized antibodies and antibody
fragments may be expressed, as well as expression vectors from
which these humanized antibodies and antibody fragments may be
expressed in transfected host cells.
[0079] In a preferred embodiment, such humanized antibodies and
corresponding nucleic acid sequences will be derived from COL-1.
Most preferably, the humanized V.sub.H sequence and the humanized
V.sub.L sequence will have the sequences substantially as depicted
in FIG. 1 or 13 or in FIG. 2 or 14, respectively, and as discussed
in the Examples set forth below. However, as discussed, the
invention further contemplates other modifications of these
humanized V.sub.H and V.sub.L sequences, e.g., sequences which
further comprise one or more conservative amino acid substitutions
or which retain one or more additional murine framework residues
which affect or do not significantly reduce antigen binding.
[0080] The subject humanized antibodies--because they specifically
bind CEA (an antigen expressed on many different cancer cell types,
e.g., lung carcinomas, breast carcinomas, gastrointestinal
carcinomas such as stomach cancers, colorectal carcinomas such as
colon cancers, ovarian carcinomas, etc.) and further because they
will not be significantly immunogenic in humans--should be suitable
for use as: therapeutics for the treatment or prevention of cancers
characterized by CEA expression; diagnostic agents, e.g., for
diagnosis and evaluating the prognosis of cancers characterized by
CEA expression (based on levels of CEA expression); tumor imaging
agents; or radiolabeled antibodies in the Radioimmunoguided
Surgery.RTM. System (RIGS.RTM.). See Hinkle et al., Antibody,
Immunoconjugates and Radiopharmaceuticals, 4(3):339-358 (1991).
[0081] One skilled in the art would be able (by routine
experimentation) to determine what amount of antibody would be
effective and non-toxic for the purpose of treating cancer.
Generally, however, an effective dosage will be in the range of
about 0.05 to 100 milligrams per kilogram body weight per day.
[0082] The humanized antibodies or humanized antibody fragments of
the invention may be administered to a human or other animal in
accordance with the aforementioned methods of treatment in an
amount sufficient to produce a therapeutic or prophylactic effect.
The antibodies of the subject invention can be administered to such
human or other animal in a conventional dosage form prepared by
combining the antibody of the invention with a conventional,
pharmaceutically acceptable carrier, diluent, and/or excipient
according to known techniques. It will be recognized by one of
ordinary skill in the art that the form and character of the
pharmaceutically acceptable carrier, diluent, and/or excipient is
dictated by the amount of active ingredient with which it is to be
combined, the route of administration, and other well-known
variables.
[0083] Pharmaceutically acceptable formulations may include, e.g.,
a suitable solvent, preservatives such as benzyl alcohol if
desired, and a buffer. Useful solvent may include, e.g., water,
aqueous alcohols, glycols, and phsophonate and carbonate esters.
Such aqueous solutions contain no more than 50% by volume of
organic solvent. Suspension-type formulations may include a liquid
suspending medium as a carrier, e.g., aqueous polyvinylpyrrolidone,
inert oils such as vegetable oils or highly refined mineral oils,
or aqueous cellulose ethers such as aqueous carboxymethylcellulose.
A thickener such as gelatin or an alginate may also be present, one
or more natural or synthetic surfactants or antifoam agents may be
used, and one or more suspending agents such as sorbitol or another
sugar may be employed therein. Such formations may contain one or
more adjuvants.
[0084] The route of administration of the antibodies (or fragment
thereof) of the present invention may be oral, parenteral, by
inhalation, or topical. The term parenteral as used herein includes
intravenous, intramuscular, subcutaneous, rectal, vaginal, or
intraperitoneal administration. The subcutaneous, intravenous, and
intramuscular forms of parenteral administration are generally
preferred.
[0085] The daily parenteral and oral dosage regimens for
prophylactically or therapeutically employing humanized antibodies
of the present invention will generally be in the range of about
0.005 to 100, but preferably about 0.5 to 10, milligrams per
kilogram body weight per day.
[0086] The antibodies of the present invention may also be
administered by inhalation. By "inhalation" is meant intranasal and
oral inhalation administration. Appropriate dosage forms for such
administration, such as an aerosol formulation or a metered dose
inhaler, may be prepared by conventional techniques. The preferred
dosage amount of a compound of the invention to be employed is
generally within the range of about 0.1 to about 100, more
preferably about 10 to 100, milligrams per kg body weight.
[0087] The antibody of the invention may also be administered
topically. By topical administration is meant non-systemic
administration. This includes the administration of a humanized
antibody (or humanized antibody fragment) formulation of the
invention externally to the epidermis or to the buccal cavity, and
instillation of such an antibody into the ear, eye, or nose, and
wherever it does not significantly enter the bloodstream. By
systemic administration is meant oral, intravenous,
intraperitoneal, subcutaneous, and intramuscular administration.
The amount of an antibody required for therapeutic, prophylactic,
or diagnostic effect will, of course, vary with the antibody
chosen, the nature and severity of the condition being treated and
the animal undergoing treatment, and is ultimately at the
discretion of the physician. A suitable topical dose of an antibody
of the invention will generally be within the range of about 1 to
100 milligrams per kilogram body weight daily.
[0088] Formulations
[0089] While it is possible for an antibody or fragment thereof to
be administered alone, it is preferable to present it as a
pharmaceutical formulation. The active ingredient may comprise, for
topical administration, from 0.001% to 10% w/w, e.g., from 1% to 2%
by weight of the formulation, although it may comprise as much as
10% w/w but preferably not in excess of 5% w/w and more preferably
from 0. 1% to 1% w/w of the formulation.
[0090] The topical formulations of the present invention, comprise
an active ingredient together with one or more acceptable
carrier(s) therefor and optionally any other therapeutic
ingredients(s). The carrier(s) must be "acceptable" in the sense of
being compatible with the other ingredients of the formulation and
not deleterious to the recipient thereof.
[0091] Formulations suitable for topical administration include
liquid or semi-liquid preparations suitable for penetration through
the skin to the site of where treatment is required, such as
liniments, lotions, creams, ointments or pastes, and drops suitable
for administration to the eye, ear, or nose.
[0092] Drops according to the present invention may comprise
sterile aqueous or oily solutions or suspensions and may be
prepared by dissolving the active ingredient in a suitable aqueous
solution of a bactericidal and/or fungicidal agent and/or any other
suitable preservative, and preferably including a surface active
agent. The resulting solution may then be clarified and sterilized
by filtration and transferred to the container by an aseptic
technique. Examples of bactericidal and fungicidal agents suitable
for inclusion in the drops are phenylmercuric nitrate or acetate
(0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate
(0.01%). Suitable solvents for the preparation of an oily solution
include glycerol, diluted alcohol and propylene glycol.
[0093] Lotions according to the present invention include those
suitable for application to the skin or eye. An eye lotion may
comprise a sterile aqueous solution optionally containing a
bactericide and may be prepared by methods similar to those for the
preparation of drops. Lotions or liniments for application to the
skin may also include an agent to hasten drying and to cool the
skin, such as an alcohol or acetone, and/or a moisturizer such as
glycerol or an oil such as castor oil or arachis oil.
[0094] Creams, ointments or pastes according to the present
invention are semi-solid formulations of the active ingredient for
external application. They may be made by mixing the active
ingredient in finely-divided or powdered form, alone or in solution
or suspension in an aqueous or non-aqueous fluid, with the aid of
suitable machinery, with a greasy or non-greasy basis. The basis
may comprise hydrocarbons such as hard, soft or liquid paraffin,
glycerol, beeswax, a metallic soap; a mucilage; an oil of natural
origin such as almond, corn, arachis, castor or olive oil; wool fat
or its derivatives, or a fatty acid such as stearic or oleic acid
together with an alcohol such as propylene glycol or macrogels. The
formulation may incorporate any suitable surface active agent such
as an anionic, cationic or non-ionic surface active such as
sorbitan esters or polyoxyethylene derivatives thereof. Suspending
agents such as natural gums, cellulose derivatives or inorganic
materials such as silicaceous silicas, and other ingredients such
as lanolin, may also be included.
[0095] Kits according to the present invention include frozen or
lyophilized humanized antibodies or humanized antibody fragments to
be reconstituted, respectively, by thawing (optionally followed by
further dilution) or by suspension in a (preferably buffered)
liquid vehicle. The kits may also include buffer and/or excipient
solutions (in liquid or frozen form)--or buffer and/or excipient
powder preparations to be reconstituted with water--for the purpose
of mixing with the humanized antibodies or humanized antibody
fragments to produce a formulation suitable for administration.
Thus, preferably the kits containing the humanized antibodies or
humanized antibody fragments are frozen, lyophilized, pre-diluted,
or pre-mixed at such a concentration that the addition of a
predetermined amount of heat, of water, or of a solution provided
in the kit will result in a formulation of sufficient concentration
and pH as to be effective for in vivo or in vitro use in the
treatment or diagnosis of cancer. Preferably, such a kit will also
comprise instructions for reconstituting and using the humanized
antibody or humanized antibody fragment composition to treat or
detect cancer. The kit may also comprise two or more component
parts for the reconstituted active composition. For example, a
second component part--in addition to the humanized antibodies or
humanized antibody fragments--may be bifunctional chelant,
bifunctional chelate, or a therapeutic agent such as a
radionuclide, which when mixed with the humanized antibodies or
humanized antibody fragments forms a conjugated system therewith.
The above-noted buffers, excipients, and other component parts can
be sold separately or together with the kit.
[0096] It will be recognized by one of skill in the art that the
optimal quantity and spacing of individual dosages of a humanized
antibody or humanized antibody fragment of the invention will be
determined by the nature and extent of the condition being treated,
the form, route and site of administration, and the particular
animal being treated, and that such optima can be determined by
conventional techniques. It will also be appreciated by one of
skill in the art that the optimal course of treatment, i.e., the
number of doses of an antibody or fragment thereof of the invention
given per day for a defined number of days, can be ascertained by
those skilled in the art using conventional course of treatment
determination tests.
[0097] The subject humanized antibodies may also be administered in
combination with other anti-cancer agents, e.g., other antibodies
or drugs. Also, the subject humanized antibodies or fragments may
be directly or indirectly attached to effector moieties having
therapeutic activity. Suitable effector moieties include by way of
example cytokines (IL-2, TNF, interferons, colony stimulating
factors, IL-1, etc.), cytotoxins (Pseudomonas exotoxin, ricin,
abrin, etc.), radionuclides, such as .sup.90Y, .sup.131I,
.sup.99mTc, .sup.111In, .sup.125I, among others, drugs
(methotrexate, daunorubicin, doxorubicin, etc.), immunomodulators,
therapeutic enzymes (e.g., beta-galactosidase), anti-proliferative
agents, etc. The attachment of antibodies to desired effectors is
well known. See, e.g., U.S. Pat. No. 5,435,990 to Cheng et al.
Moreover, bifunctional linkers for facilitating such attachment are
well known and widely available. Also, chelators (chelants and
chelates) providing for attachment of radionuclides are well known
and available.
[0098] Alternatively, the subject humanized .alpha.CEA antibodies
or fragments may be used as immunodiagnostic agents both in vivo
and in vitro. A particularly preferred usage is for in vivo imaging
of cancer cell lesions which express CEA. The subject antibodies
are preferred because they should elicit no significant HAMA or
allergic response. Thus, they may be used repeatedly to monitor the
disease status of a patient.
[0099] As noted above, another preferred application of the subject
humanized antibodies or fragments thereof is in the
Radioimmunoguided System.RTM. (RIGS.RTM.). This technique involves
the intravenous administration of a radiolabeled monoclonal
antibody or its fragment prior to surgery. After allowing for tumor
uptake and blood clearance of radioactivity, the patient is taken
to the operating room where surgical exploration is effected with
the aid of a hand-held gamma activity probe, e.g., the
Neoprobe.RTM. 1000. This helps the surgeon identify the tumor
metastases and lessen the complications of excision.
[0100] The RIGS.RTM. system is advantageous because it allows for
the detection of tumors not otherwise detectable by visual
inspection and/or palpation. See, O'Dwyer et al, Arch. Surg.,
121:1391-1394 (1986). This technique is described in detail in
Hinkle et al, Antibody, Immunoconjugates and Radiopharmaceuticals,
4:(3)339-358 (1991). This reference discloses the use of this
technique with .alpha.CEA antibodies including the COL-1 monoclonal
antibody. This technique is particularly useful for cancers of the
colon, breast, pancreas, and ovaries. Thus, this technique should
be applicable to the subject humanized antibodies which react with
CEA expressed by colon, breast, and ovarian cancers. Also, Hinkle
et al. (id.) cite numerous references describing this technique.
The subject humanized antibodies or fragments thereof may be
radiolabeled with radionuclides which are suitable for in vivo
administration, e.g., iodine radionuclides such as .sup.131I and
.sup.125I. Moreover, .sup.111In and .sup.99mTc are also
suitable.
[0101] The subject humanized antibodies may be used alone or in
combination with other antibodies. Also, the subject humanized
antibodies may be prepared in the form of a diagnostically
effective composition. Generally, this will entail the
incorporation of diagnostically acceptable carriers and excipients,
and labels which provide for detection. Suitable labels include
diagnostic radionuclides, enzymes, etc. Methods for using
antibodies for tumor imaging are well known in the art.
[0102] Without further elaboration, it is believed that one skilled
in the art can, using the preceding description, utilize the
present invention to its fullest extent. The invention will be
further clarified by a consideration of the following examples,
which are intended to be purely exemplary of the present invention
and thus to be construed as merely illustrative examples and not
limitations of the scope of the present invention an any way.
EXAMPLES
[0103] Materials and Methods
[0104] DNA Template Preparation
[0105] All recombination work was performed upon DNA sequences in
plasmid M13 vectors. The source of the NEWM framework regions for
producing the initial humanized COL-1 V.sub.H was an M13 construct
bearing--between the M13 BamH I and Hind III sites--a DNA segment
having the nucleotide sequence shown in FIG. 13. The source of REI
framework regions for producing the initial humanized COL-1 V.sub.L
was an M13 construct bearing--between the M13 BamH I and Hind III
sites--a DNA segment encoding the REI amino acid sequence of FIG.
2.
[0106] When overlap-extension procedures were used to introduce
mutations into a given DNA sequence, double stranded M13 DNA was
utilized. In contrast, when extension-ligation procedures were used
instead, the oligonucleotides were designed to anneal to only one
of the two DNA strands. In this latter procedure, the M13 DNA was
first treated to substitute uridine for every thymidine base in the
DNA, to produce uridinylated DNA. This was accomplished by
transfecting the M13 plasmid DNA into competent cells lacking
dUTPase and uracil glycosylase, normally RZ1032 cells (though CJ236
cells available from Bio-Rad of Hercules, Calif., are also
suitable) by combining the following ingredients.
[0107] 1 .mu.L of M13 plasmid DNA
[0108] 4 mL of LB broth
[0109] 40 .mu.L of competent RZ1032 cells.
[0110] The culture was shaken for 5 hours at 37.degree. C. and the
resulting single-stranded plasmid DNA (ssDNA) was isolated and
dissolved in 50 .mu.L Tris-EDTA buffer. The DNA was then treated
with uracil glycosylase by mixing together:
[0111] 1 .mu.L uridinylated ssDNA
[0112] 1 .mu.L 10.times. glycosylase buffer
[0113] 1 U uracil glycosylase (Gibco BRL, Gathersburg, Md.)
[0114] 40 .mu.L 25 mM MgCl.sub.2.
[0115] This mixture was then incubated at 37.degree. C. for one
hour and then 6.6 .mu.L 25 mM MgCl.sub.2 and 9.9 .mu.L 1M NaOH. The
mixture was then further incubated for 5 minutes at 37.degree. C.
and 16.5 .mu.L of 0.6M HCl was then added to neutralize the
mixture. The DNA was then ethanol precipitated and dissolved in
water.
[0116] M13 Oligonucleotide Primers
[0117] The following oligonucleotide primers were used throughout
the process of preparing the humanized COL-1 VHs and VLs
exemplified below.
2 10. 5'-CTAAAACGACGGCCAGT-3' and 11. 5'-AACAGCTATGACCATG-3' (both
for using in producing VHs); and 385. 5'-GCGGGCCTCTTCGCTATTACGC-3'
and 391. 5'-CTCTCTCAGGGCCAGGCGGTGA-3' (both for use in producing
VKs).
[0118] These primers are complementary to regions of the plasmid
M13 which are external both to the (NEWM or REI) target framework
sequences and to the BamH I site-to-Hind III site section of
M13.
[0119] Murine Variable Regions
[0120] In order to compare the antibody binding characteristics of
the antibodies produced according to the examples set forth below,
antibodies having a chimeric heavy chain (i.e. a heavy chain having
a murine COL-1 VH region and a human IgG1 constant region) and/or a
chimeric light chain (i.e. a light chain having a murine COL-1 VL
and a human K constant region) were expressed. The source of these
chimeric chains was the ATCC-deposited cell line CRL 11217
(Budapest) which expresses a chimeric COL-1 antibody having both
chains. The heavy chain of this antibody was termed "MuVH" and the
light chain thereof was termed "MuVL."
[0121] Oligonucleotide Phosphorylation Protocol
[0122] Mutating oligonucleotides used in non-overlap extensions
were phosphorylated according to the procedure below. In a final
volume of 25 .mu.L, the following ingredients were combined:
[0123] 10 pmol of each oligonucleotide,
[0124] 5 .mu.L of a 5.times. polynucleotide kinase buffer, and
[0125] 5 U of T4 polynucleotide kinase (Gibco BRL).
[0126] The phosphorylation reaction was started with the addition
of the enzyme and allowed to proceed for one hour at 37.degree.
C.
[0127] Annealing Protocol for Non-overlap Extension-ligations
[0128] The annealing step for non-overlap extension-ligations
involved performing one annealing in which all mutation-carrying
oligonucleotides and one primer oligonucleotide were annealed to a
single stranded DNA template in which all thymidine bases had been
replaced with uridine bases. The mutating oligonucleotides were
first phosphorylated according to the above oligonucleotide
phosphorylation protocol. In a final volume of 20 .mu.L, the
following ingredients were combined:
[0129] 1 pmol of each mutation-carrying phosphorylated
oligonucleotide
[0130] 1 pmol of a primer oligonucleotide
[0131] 4 .mu.L 5.times. annealing buffer
[0132] 0.2 pmol ssU-DNA template
[0133] The mixture was then heated to 90.degree. C. for 30 sec.,
then quickly cooled to 70.degree. C., and finally allowed to slowly
cool to 37.degree. C.
[0134] Extension-ligation Protocol for Non-overlap
Extension-ligations
[0135] After completion of the annealing step in which the primer
and phosphorylated mutating oligonucleotides were annealed to the
ssU-DNA template, extension-ligation was performed as follows. In a
final volume of 30 .mu.L, the following ingredients were
combined:
[0136] 20 .mu.L annealed ssU-DNA (i.e. the contents of the above
annealing procedure)
[0137] 2 .mu.L 5.times. annealing buffer
[0138] 2 .mu.L 0.1M dithiothreitol
[0139] 0.3 .mu.L 0.1M ATP
[0140] 1 .mu.L 6.25 mM dNTP mixture of equimolar amounts of dATP,
dTTP, dGTP, dCTP
[0141] 2.5 U T7 DNA polymerase (USB, now Amersham Life Sciences,
Cleveland, Ohio)
[0142] 0.5 U T4 DNA ligase (Gibco BRL)
[0143] Water to 30 .mu.L
[0144] This mixture was then incubated at room temperature for 1
hour.
[0145] Standard PCR Protocols
[0146] The following procedure was used, alternately, both to
amplify the non-overlap extension-ligation DNA sequences and to
perform extension of each overlap DNA sequence. In a final volume
of 50 .mu.L, the following ingredients were combined:
[0147] 2 .mu.L template DNA (either annealed ssU-DNA or
non-annealed ssDNA)
[0148] 5 .mu.L 10.times. Vent buffer (NEB, i.e. New England
Biolabs, Beverly, Mass.) or 10.times. Thermalase buffer (IBI of New
Haven, Conn.)
[0149] 2 .mu.L 6.25 mM dNTP mixture of equimolar amounts of dATP,
dTTP, dGTP, dCTP
[0150] 25 pmol of one oligonucleotide primer
[0151] 25 pmol of either a mutation-carrying oligonucleotide (for
overlap-extension) or a second oligonucleotide primer
[0152] 1 U Vent DNA polymerase (NEB) or Thermalase DNA polymerase
(IBI)
[0153] Reactions were initiated with the addition of the DNA
polymerase and then treated with about 15 cycles of: (1) 94.degree.
C. for 30 sec., (2) 50.degree. C. for 30 sec., and (3) 30-60
seconds at either 75.degree. C. (for Vent DNA polymerase) or
72.degree. C. (for Thermalase). Reactions were brought to
completion with 5 minutes at a constant temperature of either
75.degree. C. (for Vent DNA polymerase) or 72.degree. C. (for
Thermalase).
[0154] PCR Overlap-extension Amplification Protocol
[0155] After a pair of PCR reactions were performed--one for each
of the two (partially complementary) overlapping DNA segments, the
two resulting segments were joined according to the following PCR
procedure. In a final volume of 50 .mu.L, the following ingredients
were mixed:
[0156] 1 .mu.L of each overlap DNA (from the above overlap PCR
extension reactions)
[0157] 5 .mu.L 10.times. Vent buffer (NEB) or Thermalase buffer
(IBI)
[0158] 2 .mu.L 6.25 mM dNTP mixture of equimolar amounts of dATP,
dTTP, dGTP, dCTP
[0159] 25 pmol of each oligonucleotide primer used in the overlap
PCR extensions
[0160] 1 U Vent DNA polymerase (NEB) or Thermalase DNA polymerase
(IBI)
[0161] Reactions were initiated with the addition of the DNA
polymerase and then treated with about 15 cycles of: (1) 94.degree.
C. for 30 sec., (2) 50.degree. C. for 30 sec., and (3) 30-60
seconds at either 75.degree. C. (for Vent DNA polymerase) or
72.degree. C. (for Thermalase). Reactions were brought to
completion with 5 minutes at a constant temperature of either
75.degree. C. (for Vent DNA polymerase) or 72.degree. C. (for
Thermalase).
[0162] Transfer of Humanized COL-1 Variable Region DNA Sequences
from M13 to pSV
[0163] Vectors and Subsequent Antibody Expression Humanized
antibodies were expressed in pSV vectors grown in NSO cells as
follows. The humanized variable region constructs which were
produced in the plasmid, M13, were obtained by ethanol
precipitating the M13 plasmids (as cytosolic DNA), redissolving
them in aqueous solution, and digesting them with 10 U each of Hind
III and BamH I (both from BRL, i.e. Gibco BRL) for 1 hour at
37.degree. C. in a final volume of 100 .mu.L with Tris-EDTA buffer.
The resulting DNA fragments were then run on a low melting point
agarose gel, the band containing the humanized construct DNA was
cut out, and the DNA was purified using an ELUTIP `d` column with
20 .mu.L Tris-EDTA buffer. 10 .mu.L of the purified DNA preparation
was then combined with 1 .mu.L of a Hind III and BamH I-digested
pSV preparation, 3 .mu.L of 5.times. ligase buffer, and 1 U of T4
DNA ligase (BRL), in order to insert the construct into a pSV
plasmid. Humanized COL-1 VH constructs were inserted into pSVgpt
vectors bearing a human IgG1 heavy chain constant region; the
pSVgpt vector used is the "aLYS-30"shown in FIG. 5. Humanized COL-1
VL constructs were inserted into pSVhyg vectors bearing a human K
light chain constant domain; the pSVhyg vector used in the
"aLys-17" shown in FIG. 5. Each humanized variable region construct
was inserted adjacent to the respective constant region, i.e. so as
to replace either the HuVHLYS or the HuVLLys segment illustrated in
FIG. 5.
[0164] The resulting vectors were transfected into NSO cells as
follows. About 3 .mu.g of the VH vector, or about 6 .mu.g of the VL
vector, produced by the pSV-insertion procedures, was then
lineariized by digestion with 10 U PvuI (Gibco BRL). The digested
DNA was then precipitated with ethanol and redissolved in 50 .mu.L
of water. NSO cells were collected by centrifugation and
resuspended in 0.5 mL Dulbecco's Modified Eagle's Medium (DMEM) and
then transferred to a Gene Pulser cuvette (Bio-Rad). The DNA from
both one VH and one VL construct was gently mixed with the cells by
pipetting and the cuvette was left on ice for 5 minutes. Next, the
cuvette was inserted between the electrodes of the Bio-Rad Gene
Pulser and a single pulse of 170V at 960 .mu.F was applied. The
contents of the cuvette were then transferred to a flask containing
20 mL DMEM and the cells were allowed to rest for 1-2 days at
37.degree. C. Cells were again harvested by centrifugation and
resuspended in 36 mL selective DMEM. 1 .5 mL aliquots of this
resuspension were placed in each well of a 24-well plate and
incubated at 37.degree. C. for 4 days, at which time the medium in
each well was replaced with 1.5 mL of fresh selective DMEM. After 6
more days of incubation at 37.degree. C., surviving cell colonies
were visible to the naked eye and the supernatants of each well
were assayed for antibody production. Both whole antibody
production (i.e. without purification) and purified antibody
production were assayed. To obtain purified antibodies, the
supernatants were passed through a protein A column.
[0165] ELISA Assay Protocols
[0166] Antibody concentrations and antibody binding characteristics
were tested using enzyme-linked immunosorbent assay (ELISA)
procedures which are set forth as follows
[0167] Measurement of IgG concentration
[0168] The concentration of IgG secreted from transfected cells was
measured using an enzyme-linked immunosorbent assay (ELISA)
procedure which is set forth as follows.
[0169] Polyvinyl chloride (PVC) microtiter plates (Dynatech
Laboratories, Chantilly, Va., catalog # 001-010-2101) were coated
with goat anti-human IgG (10 mg/mL, GAHIG, Southern Biotechnology
Associates, Inc., Birmingham, Ala., catalog # 2010-01) diluted with
Milli-Q.RTM. water and placed on the plates using 50 mL/well.
Plates were air-dried overnight at ambient temperature or at
37.degree. C. for 3 hours. Prior to use, nonspecific binding was
blocked the addition of 0.2 mL/well of 1% (w/v) bovine serum
albumin (Sigma, St. Louis, Mo. catalog # A7888) in phosphate
buffered saline (Sigma, catalog # 1000-3) (PBS/BSA). All
incubations were carried out in a humidified container. Plates were
incubated for 1-2 hours at 37.degree. C. and the blocking solution
removed prior to sample addition. Two-fold serial dilutions of
samples or a standard IgG solution set at 500 ng/mL (50 ml/well)
were made in triplicate in the PBS/BSA solution. The plate was
incubated at 37.degree. C. for 3 hours or overnight at 4.degree. C.
The plate was washed 3-times with 0.025% Tween-20 (v/v, Sigma)
using an automatic plate washer. 50 ml/well of 1:1000 dilution of a
goat anti-human IgG conjugated to Horseradish Peroxidase (Southern
Biotechnology Associates Inc.) was added and incubated at
37.degree. C. for 1.5 hours. The wells were washed 3 times with
0.025% Tween-20 (v/v, Sigma) using an automatic plate washer and 50
ml/well OPD substrate buffer added. The color was developed for 4
minutes, stopped with 12.5 ml 12.5% H.sub.2SO.sub.4 and the
absorbance at 492 nm read. The concentration of IgG in the test
sample was estimated by comparison of the mean of the optical
densities a standard curve constructed from the standard IgG.
[0170] Determination of Relative Affinities of Humanized
Antibodies
[0171] Antibody binding characteristics were tested in an ELISA
using partially purified CEA antigen immoblizied on Polyvinyl
chloride (PVC) microtiter plates (Dynatech Laboratories, Chantilly,
Va., catalog # 001-010-2101) PVC plates were coated with 50 ml/well
CEA (Dow Chemical, lot #040191), diluted 1:300 in Milli-Q water.
Plates were air-dried overnight at ambient temperature or at
37.degree. C. for 3 hours. Prior to use, non-specific binding was
blocked by the addition of 0.2 mL/well of 1% (w/v) bovine serum
albumin (Sigma, St. Louis, Mo. catalog # A7888) in phosphate
buffered saline (Sigma, catalog # 1000-3) (PBS/BSA). Plates were
incubated for 1-2 hours at 37.degree. C. and the blocking solution
removed prior to sample addition. All incubations were carried out
in a humidified container. Two-fold serial dilutions (starting
concentration range of 1.0 .mu.g/ml-10 mg/ml) of the samples to be
tested in the PBS/BSA solution were added to triplicate wells of
the TAG-coated plate (50 ml/well). The plate was incubated
overnight at 4.degree. C. or 1-2 hours at 37.degree. C. The plate
was washed 3-times with 0.025% Tween-20 (v/v, Sigma) using an
automatic plate washer. 50 ml/well of 1:1000 dilution of a goat
anti-human IgG conjugated to Horseradish Peroxidase (Southern
Biotechnology Associates Inc.) was added and incubated at
37.degree. C. for 1.5 hours. The wells were washed 3 times with
0.025% Tween-20 (v/v, Sigma) using an automatic plate washer and 50
ml/well OPD substrate buffer added. The color was developed for 4
minutes, stopped with 12.5 ml 12.5% H.sub.2SO.sub.4 and the
absorbance at 492 nm read.
[0172] Determination of Affinity Constants for binding to CEA
[0173] Two-fold dilutions of purified Hu-COL-1 were prepared in
PBS/BSA over a range of 1.0g/ml-0.003 mg/ml and samples (20
ml/well) were applied in triplicate to TAG-coated PVC prepared and
blocked as described supra. Plates were incubated overnight at
4.degree. C. Following this incubation, samples were transferred
from the plate to the corresponding wells on the GAHIG-coated trap
plate. The original TAG plate was washed 3-times with 0.025%
Tween-20 (v/v, Sigma, catalog # P1379) using an automatic plate
washer. An .sup.125I-labeled goat anti-human IgG probe (ICN
Biomedicals, Inc., catalog # 68088) was diluted to 75,000 cpm/25 ml
in PBS/BSA and added (25 ml/well) to all wells. This TAG plate was
incubated for 1 hour at 37.degree. C.
[0174] After a 1 hour incubation at 37.degree. C., the trap plate
was washed as described above and .sup.125I-labeled GAHIG probe was
added. This plate was incubated for 1 hour at 37.degree. C. Both
plates (TAG and GAHIG-trap) containing probe were then washed with
a microplate washer to remove the unbound probe. A plate cutter (D.
Lee, Sunnyvale, Calif., Model HWC-4) was used to separate the wells
from the plate frame. The radioactivity in each well was quantified
by a gamma counter. The resulting data was analyzed according to
the method of Scatchard (Ann. NY Acad., 51:600-672 (1946)).
Example 1
[0175] Synthesis of Initial CDR-grafted (Humanized) Antibody from
Murine COL-1
[0176] We describe in this Example the construction of humanized
COL-1 Mabs (COL-1 HuVH/HuVK) using the V.sub.L and V.sub.H
frameworks of human Mabs REI and NEWM, respectively. The CDRs for
murine COL-1 were grafted onto human frameworks according to known
methods as discussed supra. In particular, human frameworks were
selected from antibodies which, based on previous studies, were
predicted to be suitable, i.e. which should not adversely affect
antigen binding and not exhibit significant immunogenicity in
humans. The human frameworks selected for the variable heavy and
variable light chains, respectively, were NEWM and REI.
[0177] In the production of the initial version of the humanized
VH, certain murine framework residues were also retained which,
based on previous studies, might allow retention of antigen binding
properties. Specifically, residues F27, N28, I29, K30, N97, and T98
of the murine heavy chain were initially retained.
[0178] The production of this NEWM-grafted humanized COL-1 V.sub.H
was accomplished using two rounds of a dual PCR procedure: the
standard PCR protocol (for overlap-extension) followed by PCR
amplification with oligonucleotide primers 10 and 11. This
procedure was carried out as described above using a
single-stranded M13 DNA template bearing, between the Hind III and
BamH I sites thereof, a DNA segment having the nucleotide sequence
shown in FIG. 13. The mutating oligonucleotides used in the first
round (with Vent DNA polymerase)were designed and synthesized with
the following sequences:
3 836. 5'-TGAGAATGGTGATACTGAATATGCCCCGAAGT; and 837.
5'-TCGGGGCATATTCAGTATCACCATTCTCAGGATC-3'. Those for the second
round (with Thermalase) were: 838.
5'-ACTATGATTACGACGCGTTGGTTCTTCGATGTCTGGGGCCAAGGG
TCCTTGGTCACCGTC-3'; and 839. 5'-ACGCGTCGTAATCATAGTAGATAGA-
CCCCGTGTATTACAGTAATA GACCGCGGTG-3'.
[0179] The resulting humanized VH was named COL1NMVH or "HuVH."
[0180] In the production of the initial version of the humanized
VL, no uniquely murine framework residues were retained. The
production of the REI-grafted humanized COL-1 V.sub.L was
accomplished by using two rounds of a procedure involving
performing the annealing and extension-ligation protocols described
above--followed by amplification by the standard Thermalase PCR
protocol--using a ssM13 template bearing, between the Hind III and
BamH I sites thereof, a ssU-DNA segment produced by the above
procedure using the REIVK sequence shown in FIG. 17 (or in the
second round, the mutated M13 template resulting from the first
round). The mutating oligonucleotides used in round number 1 were
designed and synthesized with the following sequences:
4 842. 5'-TATAGCCAGATGCACTGACACTTTTGCTGGCCCTACAGGTGATG-3'; 844.
5'-GCTCTGGGTCATCTGGATGTCGG-3'; 849.
5'-TTCTACTCACGTGTGATTTGCAGCTTGGTCCCTTGGCCGAACGTAGGAAGCTCCC
TACTGTGCTGGCAGTAG-3'; 850. 5'-ATGGTGAAGGTGTAGTCGGTACCGC-3- '; and
851. 5'-GCCTTACCTGGCGTCTGCTGGTACC-3'. The mutating oligonucleotide
used in the second round was: 841.
5'-GCACACCAGATTGTAGGTTGGATGCAAGG-3'
[0181] The resulting humanized VL was called called "COL1REVK" or
"HuVK."
[0182] Concurrently, a second humanized COL-1 VL was made by the
same procedure using the following mutating oligonucleotides.
5 For round 1: 842. 5'-TATAGCCAGATGCACTGACACTTTTGC-
TGGCCCTACAGGTGATG-3'; 844. 5'-GCTCTGGGTCATCTGGATGTCGG-3'; 849.
5'-TTCTACTCACGTGTGATTTGCAGCTTGGTCCCTTGGCCGAACGTAGGAA- GCTC
CCTACTGTGCTGGCAGTAG-3'; and 851. 5'-GCCTTACCTGGCGTCTGCTGGTACC-3'.
For round 2: 841. 5'-GCACACCAGATTGTAGGTTGGATGCAAGG-3'.
[0183] The resulting VL was termed "HuVKF."
[0184] A number of amino acid substituted-versions of HuVH and HuVK
were also constructed, using the above-described overlap extension
technique employing oligonucleotide primers 10 and 11 or primers
385 and 391, followed by PCR amplification with Vent DNA
polymerase. The mutating oligonucleotides and DNA templates are
described below under their resulting humanized variable region
name:
[0185] HuVHT (using the HuVH DNA shown in FIG. 16 as a
template)
6 954. 5'-GACAATGCTGACAGACACCAGCAA-3' and 955.
5'-TGCTGGTGTCTGTCAGCATTGTCA-3'; HuVHS (using the HuVH DNA as a
template) 684. 5'-CACCAGCAGCAACCAGTTCAG-3'and 683.
5'-ACTGGTTGCTCGTGGTGTCTA-3', HuVHSTAY (using the HuVHS DNA as a
template) 1026. 5'-ACCAGCAGCAACACAGCCTACC- TGAGACTCAGCAG-3'and
1028. 5'-TGCTGAGTCTCAGGTAGGCTGTGTTGCTGCTGGTGT-- 3'; HuVHA (using
the HuVH DNA as a template) 745. 5'-TGACCTGCACCGCGTCTGGCTTCAAC-3'
and 746. 5'-TTGAAGCCAGACGCGGTGCAGGTCAG-3'; HuVHAA (using the HuVHA
DNA as a template) 1071. 5'-GAGACTCAGCAGCGTGACAG-3' and 1072.
5'-CGCTGCTGAGTCTCAGGCTGAATGTGTTCTTGCTGGTGTC-3'; HuVHAT (using the
HuVHA DNA as a template) 1071. 5'-CCTGAGACTCAGCAGCGTGACAG-3'and
1074. 5'-CGCTGCTGAGTCTCAGGCTGGCC- TGGTTCTTGCTGGTG-3'; HuVHAY (using
the HuVHA DNA as a template) 1071. 5'-CCTGAGACTCAGCAGCGTGACAG-3'and
1073. 5'-CGCTGCTGAGTCTCAGGTAGAACTGGTTCTTGC-3'; HuVHATAY (using the
HuVHA DNA as a template) 1071. 5'-CCTGAGACTCAGCAGCGTGACAG-3'and
1075. 5'-CGCTGCTGAGTCTCAGGTAGGCT- GTGTTCTTGCTGGTGTC-3'; HuVHASTAY
(using the HuVHS DNA as a template) 745.
5'-TGACCTGCACCGCGTCTGGCTTCAAC-3'and 746.
5'-TTGAAGCCAGACGCGGTGCAGGTCAG-3'; and HuVKVL (using the HuVK DNA
shown in FIG. 18 as a template) 1010.
5'-ACTCCGACATCGTGCTGACCCAGAG-3'and 1011.
5'-CTCTGGGTCAGCACGATGTCGGAG-3'.
[0186] The above-produced M13 DNA constructs were transferred to
pSV vectors which were then transfected into NSO host cells,
according to the above-described procedures. The VH construct- and
VL construct-containing pSV vectors were transfected into NSO cells
in the following combinations (to produce antibodies having the
indicated combinations of VH and VL regions):
7 MuVH/MuVK; HuVH/HuVK; HuVH/MuVK; MuVH/HuVK; HuVHA/HuVK;
HuVHT/HuVK; HuVHT/HuVKF; HuVH/HuVKVL; HuVHS/HuVKVL; HuVHSTAY/HuVK;
HuVH/HuVKF; MuVH/HuVKF; and HuVHSTAY/HuVKVL.
[0187] Combinations of the other VHs with the various VKs are
expected to behave in an analogous manner, though having an
unpredictable variation in degree of binding. Final selection of
the optimum combination will be a function of obtaining an antibody
having the best, selective antigen binding properties with the
fewest murine amino acid substitutions.
[0188] The amino acid sequences of the initial humanized
(CDR-grafted) COL-1 variable heavy (V.sub.H) and variable light
(V.sub.K) regions, HUVH and HUVK, are show in FIGS. 1 and 2,
respectively. NSO transfectants were screened for whole antibody
expression and the antigen binding characteristics of the
antibodies produced thereby were measured by an ELISA test against
CEA. Results are presented in FIGS. 4-9. This data shows that--of
the graft-humanized and the mix-and-match clones--MuVH/HuVK
outperformed both HuVH/MuVK and HuVH/HuVK, but did not perform as
well as the chimeric MuVH/MuVK antibodies.
[0189] These results indicate that the initial fully humanized
antibody (HuVH/HuVK) exhibits a 20-fold loss in CEA antigen binding
affinity. Thus, it exhibits about 5% the binding affinity of murine
COL-1. Based on analysis of CEA binding of mix-and-match antibodies
(HuVH/HuVK) and (MuVH/HuVK), it was determined that the reduction
in CEA antigen binding was apparently largely attributable to the
amino acid sequence of humanized heavy chain. However, an
approximate 2-fold reduction in antigen binding also occurred
apparently because of the amino acid sequence of the humanized
kappa chain. This can be appreciated from the ELISA data in FIG.
4.
[0190] As a result of this research, an antibody comprising the
VHSTAY- and VKVL-containing heavy and light chains was deposited on
Oct. 16, 1996 with the American Type Culture Collection, 12301
Parklawn Drive, Rockville, Md. 20852 and accorded Accession Number
ATCC CRL-12208 (this is a murine plasmacytoma cell line). This
deposit was made in accordance with the Budapest Treaty. This
deposited cell line will be made irrevocably available, without
restriction, upon issuance of a patent to this application, or any
patent claiming benefit of priority to this application under 35
U.S.C. .sctn.120.
[0191] Based on the foregoing, it will be appreciated that the
humanized antibodies disclosed herein exhibit antigen-binding
characteristics, i.e., CEA affinities comparable to the parent
monoclonal antibody, nCOL-1 (murine antibody), and to chimeric
antibodies derived from nCOL-1, e.g., ChCOL-1.gamma.1 (ATCC No. CRL
11217). Moreover, based on the foregoing results, these antibodies
possess properties which will render them well suited for usage as
in vivo diagnostics or therapeutics, e.g., improved serum
clearance, metabolic properties, and little or no immunogenicity in
humans.
[0192] These properties are highly significant because they will
enable the subject humanized antibodies to be administered
repeatedly, in large dosages, and over a prolonged period of time
without significant adverse effects, e.g., a HAMA response or
non-specific cytotoxicity. This is important for cancer treatment
as well as for cancer diagnosis as it enables these antibodies to
be used over prolonged time periods. Moreover, the clearance
properties of the subject human antibodies will enable these
antibodies to effectively target desired target sites, e.g., CEA
expressing carcinomas (because of the effects of serum clearance on
targeting efficiency). Therefore, the humanized antibodies of the
present invention comprise a substantial improvement in relation to
previously disclosed antibodies specific to CEA.
[0193] Other embodiments of the invention will be apparent to those
skilled in the art from a consideration of this specification or
practice of the invention disclosed herein. It is intended that the
specification and examples be considered as exemplary only, with
the true scope and spirit of the invention being indicated by the
following claims.
Sequence CWU 0
0
* * * * *