U.S. patent application number 10/007557 was filed with the patent office on 2003-01-02 for mass spectrometric detection of polypeptides.
Invention is credited to Higgins, G. Scott, Koster, Hubert, Little, Daniel, Lough, David.
Application Number | 20030003465 10/007557 |
Document ID | / |
Family ID | 25446684 |
Filed Date | 2003-01-02 |
United States Patent
Application |
20030003465 |
Kind Code |
A1 |
Little, Daniel ; et
al. |
January 2, 2003 |
Mass spectrometric detection of polypeptides
Abstract
A process for ascertain sequence information about a nucleic
acid molecule by determining the identity of a polypeptide using
mass spectroscopy is provided. Depending on the polypeptide to be
identified, a process as disclosed is used, for example, to
diagnose a genetic disease or chromosomal abnormality, a
predisposition to a disease or condition, or infection by a
pathogenic organism; or for determining identity or heredity. Kits
for performing the disclosed processes also are provided.
Inventors: |
Little, Daniel; (Boston,
MA) ; Koster, Hubert; (La Jolla, CA) ;
Higgins, G. Scott; (Paisley, GB) ; Lough, David;
(Berwickshire, GB) |
Correspondence
Address: |
HELLER EHRMAN WHITE & MCAULIFFE LLP
4250 EXECUTIVE SQ
7TH FLOOR
LA JOLLA
CA
92037
US
|
Family ID: |
25446684 |
Appl. No.: |
10/007557 |
Filed: |
November 6, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10007557 |
Nov 6, 2001 |
|
|
|
09664977 |
Sep 18, 2000 |
|
|
|
6387628 |
|
|
|
|
10007557 |
Nov 6, 2001 |
|
|
|
09146054 |
Sep 2, 1998 |
|
|
|
6322970 |
|
|
|
|
10007557 |
Nov 6, 2001 |
|
|
|
08922201 |
Sep 2, 1997 |
|
|
|
6207370 |
|
|
|
|
Current U.S.
Class: |
435/6.13 ;
435/455; 435/69.1; 435/7.1 |
Current CPC
Class: |
G01N 33/6842 20130101;
G01N 33/6851 20130101; G01N 33/6848 20130101; H01J 49/00 20130101;
G01N 33/6818 20130101 |
Class at
Publication: |
435/6 ; 435/7.1;
435/69.1; 435/455 |
International
Class: |
C12Q 001/68; G01N
033/53; C12P 021/02; C12N 015/87 |
Claims
What is claimed is:
1. A kit for determining the identity of a target nucleic acid by
mass spectrometry, comprising a) a forward and a reverse primer
that hybridizes to a nucleic acid encoding the target polypeptide
for amplifying the nucleic acid; b) reagents for in vitro
transcription and translation of the amplified nucleic acid to
obtain the encoded polypeptide; and c) a reagent for isolating the
polypeptide; d) a reagent for mass spectrometric analysis of the
polypeptide; and d) optionally, instructions for use in determining
the identity of a target polypeptide by mass spectrometry to
thereby obtain sequence information about the nucleic acid.
2. A kit of claim 1, wherein the polypeptide is encoded by an
allelic variant of a polymorphic region of a gene of a subject.
3. A kit of claim 2, for determining whether a subject has or is at
risk of developing a disease or condition associated with a
specific allelic variant of a polymorphic region of the gene.
4. A kit of claim 3, wherein the disease or condition is associated
with an aberrant number of trinucleotide repeats.
5. A kit of claim 4, wherein the disease or condition is selected
from the group consisting of Huntington's disease, prostate cancer,
Fragile X syndrome type A, myotonic dystrophy type I, Kennedy
disease, Machado-Joseph disease, Dentatorubral and pallidolyusian
atrophy and spino bulbar muscular atrophy.
6. A kit of claim 3, wherein the gene is selected from the group
consisting of BRCA1, BRCA2, APC, dystrophin gene, .beta.-globin,
Factor IX, Factor VIIc, ornithine-d-amino-transferase, hypoxanthine
guanine phosphoribosyl transferase, CFTR, and a proto-oncogene.
7. A kit of claim 1, wherein the forward primer and/or the reverse
primer comprises an RNA polymerase promoter.
8. A kit of claim 7, wherein the RNA polymerase promoter is
selected from the group consisting of SP6 promoter, T3 promoter,
and T7 promoter.
9. A kit of claim 7, wherein the forward and/or the reverse primer
further comprises a nucleotide sequence, or complement thereof,
encoding a second polypeptide.
10. A kit of claim 9, wherein the second polypeptide is a Tag
polypeptide.
11. A kit of claim 10 , wherein the Tag polypeptide is selected
from the group consisting of a myc-epitope tag, a Haemophilys
influenza hemagglutinin protein tag and a HIS-6.
12. A kit of claim 10, wherein the Tag polypeptide is HIS-6 and the
reagent for isolating the polypeptide is nickel ion.
13. A kit of claim 1, further comprising a reference nucleic acid
or polypeptide.
14. A kit of claim 1, wherein the reagent for mass spectrometric
analysis comprises a reagent system for volatilizing and ionizing
the polypeptide prior to mass spectrometric analysis.
15. A kit of claim 14, wherein the reagent system comprises an
organic solvent.
16. The kit of claim 14, wherein the reagent system comprises an
inorganic solvent.
17. The kit of claim 16, wherein the inorganic reagent system
comprises an ammonium salt.
18. The kit of claim 1, wherein either the forward primer or the
reverse primer comprises a sequence of nucle.otides that, following
amplification, encode a regulatory element operably linked to the
nucleic acid encoding the target polypeptide.
19. The kit of claim 18, wherein the regulatory element is selected
from the group consisting of an RNA polymerase promoter, a ribosome
binding site, a START codon, and a transcription start signal.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 09/664,977, filed Sep. 18, 2000, to Daniel P. Little, Scott
Higgins, David Lough and Hubert Koster, entitled "DIAGNOSTICS BASED
ON MASS SPECTROMETRIC DETECTION OF TRANSLATED TARGET POLYPEPTIDES."
This application is a divisional of U.S. application Ser. No.
09/146,054, filed Sep. 2, 1998, to Daniel P. Little, Scott Higgins,
David Lough and Hubert Koster, entitled "MASS SPECTROMETRIC
DETECTION OF POLYPEPTIDES". This application also is a
continuation-in-part of U.S. application Ser. No. 08/922,201, filed
Sep. 2, 1997, to Daniel P. Little, Scott Higgins and Hubert Koster,
entitled "DIAGNOSTICS BASED ON MASS SPECTROMETRIC DETECTION OF
TRANSLATED TARGET POLYPEPTIDES." U.S. application Ser. No.
09/146,054 is a continuation-in-part of U.S. application Ser. No.
08/922,201. The subject matter of each of these applications is
herein incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The disclosed processes and kits relate generally to the
field of proteomics and molecular medicine, and more specifically
to processes using mass spectrometry to determine the identity of a
target polypeptide.
BACKGROUND
[0003] In recent years, the molecular biology of a number of human
genetic diseases has been elucidated by the application of
recombinant DNA technology. More than 3000 diseases are known to be
of genetic origin (Cooper and Krawczak, "Human Genome Mutations"
(BIOS Publ. 1993)), including, for example, hemophilias,
thalassemias, Duchenne muscular dystrophy, Huntington's disease,
Alzheimer's disease and cystic fibrosis, as well as various cancers
such as breast cancer. In addition to mutated genes that result in
genetic disease, certain birth defects are the result of
chromosomal abnormalities, including, for example, trisomy 21
(Down's syndrome), trisomy 13 (Patau syndrome), trisomy 18
(Edward's syndrome), monosomy X (Turner's syndrome) and other sex
chromosome aneuploidies such as Klinefelter's syndrome (XXY).
[0004] Other genetic diseases are caused by an abnormal number of
trinucleotide repeats in a gene. These diseases include
Huntington's disease, prostate cancer, spinal cerebellar ataxia 1
(SCA-1), Fragile X syndrome (Kremer et al., Science 252:1711-14
(1991); Fu et al., Cell 67:1047-58 (1991); Hirst et al., J. Med.
Genet. 28:824-29 (1991)); myotonic dystrophy type I (Mahadevan et
al., Science 255:1253-55 (1992); Brook et al., Cell 68:799-808
(1992)), Kennedy's disease (also termed spinal and bulbar muscular
atrophy (La Spada et al., Nature 352:77-79 (1991)), Machado-Joseph
disease, and dentatorubral and pallidolyusian atrophy. The aberrant
number of triplet repeats can be located in any region of a gene,
including a coding region, a non-coding region of an exon, an
intron, or a regulatory element such as a promoter. In certain of
these diseases, for example, prostate cancer, the number of triplet
repeats is positively correlated with prognosis of the disease.
[0005] Evidence indicates that amplification of a trinucleotide
repeat is involved in the molecular pathology in each of the
disorders listed above. Although some of these trinucleotide
repeats appear to be in non-coding DNA, they clearly are involved
with perturbations of genomic regions that ultimately affect gene
expression. Perturbations of various dinucleotide and trinucleotide
repeats resulting from somatic mutation in tumor cells also can
affect gene expression or gene regulation.
[0006] Additional evidence indicates that certain DNA sequences
predispose an individual to a number of other diseases, including
diabetes, arteriosclerosis, obesity, various autoimmune diseases
and cancers such as colorectal, breast, ovarian and lung cancer.
Knowledge of the genetic lesion causing or contributing to a
genetic disease allows one to predict whether a person has or is at
risk of developing the disease or condition and also, at least in
some cases, to determine the prognosis of the disease.
[0007] Numerous genes have polymorphic regions. Since individuals
have any one of several allelic variants of a polymorphic region,
each can be identified based on the type of allelic variants of
polymorphic regions of genes. Such identification can be used, for
example, for forensic purposes. In other situations, it is crucial
to know the identity of allelic variants in an individual. For
example, allelic differences in certain genes such as the major
histocompatibility complex (MHC) genes are involved in graft
rejection or graft versus host disease in bone marrow
transplantation. Accordingly, it is highly desirable to develop
rapid, sensitive, and accurate methods for determining the identity
of allelic variants of polymorphic regions of genes or genetic
lesions.
[0008] Several methods are used for identifying of allelic variants
or genetic lesions. For example, the identity of an allelic variant
or the presence of a genetic lesion can be determined by comparing
the mobility of an amplified nucleic acid fragment with a known
standard by gel electrophoresis, or by hybridization with a probe
that is complementary to the sequence to be identified.
Identification, however, only can be accomplished if the nucleic
acid fragment is labeled with a sensitive reporter function, for
example, a radioactive (.sup.32P, .sup.35S), fluorescent or
chemiluminescent reporter. Radioactive labels can be hazardous and
the signals they produce can decay substantially over time.
Non-radioactive labels such as fluorescent labels can suffer from a
lack of sensitivity and fading of the signal when high intensity
lasers are used. Additionally, labeling, electrophores' is and
subsequent detection are laborious, time-consuming and error-prone
procedures. Electrophoresis is particularly error-prone, since the
size or the molecular weight of the nucleic acid cannot be
correlated directly to its mobility in the gel matrix because
sequence specific effects, secondary structures and interactions
with the gel matrix cause artifacts in its migration through the
gel.
[0009] Mass spectrometry has been used for the sequence analysis of
nucleic acids (see, for example, Schram, Mass Spectrometry of
Nucleic Acid Components, Biomedical Applications of Mass
Spectrometry 34:203-287 (1990); Crain, Mass Spectrom. Rev.
9:505-554 (1990); Murray, J. Mass Spectrom. Rev. 31:1203 (1996);
Nordhoff et al., J. Mass Spectrom. 15:67 (1997)). In general, mass
spectrometry provides a means of "weighing" individual molecules by
ionizing the molecules in vacuo and making them "fly" by
volatilization. Under the influence of electric and/or magnetic
fields, the ions follow trajectories depending on their individual
mass (m) and charge (z). For molecules with low molecular weight,
mass spectrometry is part of the routine physical-organic
repertoire for analysis and characterization of organic molecules
by the determination of the mass of the parent molecular ion. In
addition, by arranging collisions of this parent molecular ion with
other particles such as argon atoms, the molecular ion is
fragmented, forming secondary ions by collisionally activated
dissociation (CAD); the fragmentation pattern/pathway very often
allows the derivation of detailed structural information. Many
applications of mass spectrometric methods are known in the art,
particularly in the biosciences (see Meth. Enzymol., Vol. 193,
"Mass Spectrometry" (McCloskey, ed.; Academic Press, NY 1990;
McLaffery et al., Acc. Chem. Res. 27:297-386 (1994); Chait and
Kent, Science 257:1885-1894 (1992); Siuzdak, Proc. Natl. Acad.
Sci., USA 91:11290-11297 (1994)), including methods for producing
and analyzing biopolymer ladders (see, International PCT
application No. WO 96/36732; U.S. Pat. No. 5,792,664). Despite the
effort to apply mass spectrometry methods to the analysis of
nucleic acid molecules, however, there are limitations, including
physical and chemical properties of nucleic acids. Nucleic acids
are very polar bipolymers that are difficult to volatilize.
[0010] Accordingly, a need exists for methods to determine the
identity of a nucleic acid molecule, particularly genetic lesions
in a nucleic acid molecule, using alternative methodologies.
Therefore it is an object herein to provide processes and
compositions that satisfy this need and provide additional
advantages.
SUMMARY OF THE INVENTION
[0011] Processes and kits for determining the identity of a target
polypeptide by mass spectrometry are provided. The processes
include the steps of determining the molecular mass of a target
polypeptide or a fragment or fragments thereof by mass
spectrometry, and then comparing the mass to a standard, whereby
the identity of the polypeptide can be ascertained. Identity
includes, but is not limited to, identifying the sequence of the
polypeptide, identifying a change in a sequence compared to a known
polypeptide, and other means by which polypeptides and mutations
thereof can be identified. Selection of the standard will be
determined as a function of the information desired.
[0012] One process for determining the identity of a target
polypeptide includes the steps of a) obtaining a target
polypeptide; b) determining the molecular mass of the target
polypeptide by mass spectrometry, and c) by comparing the molecular
mass of the target polypeptide with the molecular mass of a
corresponding known polypeptide. By comparing the molecular mass of
the target with a known polypeptide having a known structure, the
identity of the target polypeptide can be ascertained. As disclosed
herein, the polypeptide is obtained by methods including
transcribing a nucleic acid encoding the target polypeptide into
RNA and translating the RNA into the target polypeptide. If
desired, transcription of the nucleic acid or translation of the
RNA, or both, can be performed in vitro.
[0013] A process as disclosed herein also can include a step of
amplifying a nucleic acid encoding the target polypeptide prior to
step a), for example, by performing the polymerase chain reaction
(PCR) using a forward primer and a reverse primer. The forward
primer or the reverse primer can contain an RNA polymerase promoter
such as an SP6 promoter, T3 promoter, or T7 promoter. In addition,
a primer can contain a nucleotide sequence for a transcription
start site. A primer also can encode a translation START (ATG)
codon. Accordingly, a target polypeptide can be translated from a
nucleic acid that is not naturally transcribed or translated in
vivo, for example, by incorporating a START codon in the nucleic
acid to be translated, thereby providing a translation reading
frame. Furthermore, a primer can contain a nucleotide sequence, or
complement thereof, encoding a second peptide or polypeptide, for
example, a tag peptide such as a myc epitope tag, a Haemogphilus
influenza hemagglutinin peptide tag, a polyhistidine sequence, a
polylysine sequence or a polyarginine sequence. A process as
disclosed herein can be performed in vivo, for example, in a host
cell such as a bacterial host cell transformed with a nucleic acid
encoding a target polypeptide or a eukaryotic host cell such as a
mammalian cell transfected with a nucleic acid encoding a target
polypeptide.
[0014] A process as disclosed is performed using a mass
spectrometric analysis, including for example, matrix assisted
laser desorption ionization (MALDI), continuous or pulsed
electrospray ionization, ionspray, thermospray, or massive cluster
impact mass spectrometry and a detection format such as linear
time-of-flight (TOF), reflectron time-of-flight:, single quadruple,
multiple quadruple, single magnetic sector, multiple magnetic
sector, Fourier transform ion cyclotron resonance, ion trap, and
combinations thereof such as MALDI-TOF spectrometry. An advantage
of using a process as provided is that no radioactive label is
required. Another advantage is that relatively short polypeptides
can be synthesized from a target nucleic acid, thus providing an
accurate measurement of molecular weight by mass spectrometry, as
compared to analysis of the nucleic acid itself.
[0015] An RNA molecule encoding a target polypeptide can be
translated in a cell-free extract, which can be a eukaryotic
cell-free extract such as a reticulocyte lysate, a wheat germ
extract, or a combination thereof; or a prokaryotic cell-free
extract, for example, a bacterial cell extract such as an E. coli
S30 extract. If desired, translation and transcription of a target
nucleic acid can be performed in the same cell-free extract, for
example, a reticulocyte lysate or a prokaryotic cell extract.
[0016] A target polypeptide generally is isolated prior to being
detected by mass spectrometric analysis. For example, the
polypeptide can be isolated from a cell or tissue obtained from a
subject such as a human. The target polypeptide can be isolated
using a reagent that interacts specifically with the target
polypeptide, for example, an antibody that interacts specifically
with the target polypeptide, or the target polypeptide can be fused
to a tag peptide and isolated using a reagent that interacts
specifically with the tag peptide, for example, an antibody
specific for the tag peptide. A reagent also can be another
molecule that interacts specifically with the tag peptide, for
example, metal ions such as nickel or cobalt ions, which interact
specifically with a hexahistidine (His-6) tag peptide.
[0017] A target polypeptide can be immobilized to a solid support,
such as a bead or a microchip, which can be a flat surface or a
surface with structures made of essentially any material commonly
used for fashioning such a device. A microchip is useful, for
example, for attaching moieties in an addressable array.
Immobilization of a target polypeptide provides a means to isolate
the polypeptide, as well as a means to manipulate the isolated
target polypeptide prior to mass spectrometry.
[0018] Methods are provided for sequencing an immobilized target
polypeptide, including sequencing from the carboxyl terminus or
from the amino terminus. Furthermore, methods of determining the
identity of each of the target polypeptides in a plurality of
target polypeptides by multiplexing are provided.
[0019] In particular embodiments, post translational capture and
immobilization of a target polypeptide via a cleavable linker are
provided in order to orthogonally sequence a polypeptide. These
methods can include: 1) obtaining the target polypeptide; 2)
immobilizing the target polypeptide to a solid surface; 3) treating
the immobilized target polypeptide with an enzyme or chemical in a
time dependent manner to generate a series of deleted fragments; 4)
the cleaved polypeptide fragments are conditioned; 5) cleaving the
linker and thereby releasing the immobilized fragments; 6)
determining the mass of the release fragments; and 7) aligning the
masses of each of the polypeptide fragments to determine the amino
acid sequence. Variants of these methods in which one or more steps
are combined or eliminated are also contemplated.
[0020] In one embodiment, the second step includes immobilizing the
amino terminal portion of the polypeptide to a solid support via a
photocleavable linker. In a more preferred embodiment, the solid
support is activated as described in FIG. 2 and allowed to react
with the amino group of a target polypeptide.
[0021] In another embodiment, the second step includes immobilizing
the carboxy terminal portion of the polypeptide to a solid support
via a photocleavable linker. In a more preferred embodiment, a
photocleavable linker is a linker that can be cleaved from the
solid support with light. In a more preferred embodiment, the solid
support is activated as described in FIG. 3 and allowed to react
with the carboxy group of a target polypeptide.
[0022] In another embodiment, the second step includes immobilizing
either the carboxy or amino termini of group of different
polypeptides to a solid support in an array format via a
photocleavable linker. In a more preferred embodiment, discrete
areas of a silicon surface are activated with the chemistry
described in FIG. 2 and an array composed of from 2 to 999
positions.
[0023] In another embodiment, the second step includes immobilizing
the amino terminal portion of the polypeptide to a solid support
via a cleavable linker. In a more preferred embodiment, a cleavable
linker is a silyl linker that can be cleaved from the solid
support. In a more preferred embodiment, the solid support is
activated as described in FIG. 2 and allowed to react with the
amino group of a target polypeptide.
[0024] In another embodiment, the second step includes immobilizing
the carboxy terminal portion of the polypeptide to a solid support
via a cleavable linker. In a more preferred embodiment, a cleavable
linker is a silyl linker that can be cleaved from the solid
support. In a more preferred embodiment, the solid support is
activated as described in FIG. 3 and allowed to react with the
carboxy group of a target polypeptide.
[0025] In another embodiment, the second step includes immobilizing
either the carboxy or the amino termini of a group of different
polypeptides to a solid support in an array format via a cleavable
linker. In a more preferred embodiment, discrete areas of a silicon
surface are activated with the chemistry described in FIG. 2,
thereby forming an array, preferably composed of from 2 to 999
positions.
[0026] In another embodiment, the third step includes immobilizing
the amino terminal end of the target polypeptide(s) to the solid
support and treating with an exopeptidase. In a preferred
embodiment, exopeptidase digestion is carried out in a time
dependent manner to generate a nested group of immobilized
polypeptide fragments of varying lengths. In a more preferred
embodiment, exopeptidase is selected from a group of one or more
mono-peptidases and polypeptidases including carboxypeptidase Y,
carboxpeptidase P, carboxypeptidase A, carboxypeptidase G and
carboxypeptidase B.
[0027] In another embodiment, the exopeptidase is selected from a
group of one or more mono-peptidases and polypeptidases including
aminopeptidases including alanine aminopeptidase, leucine
aminopeptidase, pyroglutamate peptidase, dipeptidyl peptidase,
microsomal peptidase and other enzymes which progressively digest
the amino terminal end of a polypeptidase.
[0028] In another embodiment, the third step comprises a step where
exopeptidase digestion is carried out under reaction conditions
that remove any secondary or tertiary structure, leaving the
terminal residues of the polypeptide inaccessible to exopeptidases.
In a preferred embodiment, the reaction conditions expose the
terminus of a target polypeptide(s) to temperatures over about
70.degree. C. and below about 100.degree. C. In a more preferred
embodiment, the exopeptidase is a thermostable carboxypeptidase or
aminopeptidase. In another preferred embodiment, the reaction
conditions expose the terminus of a target polypeptide(s) to high
ionic strength conditions. In a more preferred embodiment, the
exopeptidase is a salt tolerant carboxypeptidase or
aminopeptidase.
[0029] In another embodiment, the second step includes conditioning
of polypeptide after enzymatic treatment or purification. In a more
preferred embodiment, methods of conditioning include methods that
prepare the polypeptide or polypeptide fragments in a manner that
generally improves mass spectrometric analysis. In a more preferred
embodiment, conditioning may include cation exchange.
[0030] Kits containing components useful for determining the
identity of a target polypeptide based on a process as disclosed
herein also are provided. Such a kit can contain, reagents for in
vitro transcription and/or translation of the amplified nucleic
acid to obtain the target polypeptide; optionally, a reagent for
isolating the target polypeptide; and instructions for use in
determining the identity of a target polypeptide by mass
spectrometric analysis. The kits may also include, for example,
forward or reverse primers capable of hybridizing to a nucleic acid
encoding the target polypeptide and amplifying the nucleic acid.
Such kits also can contain an organic or inorganic solvent, for
example, a salt of ammonium, or a reagent system for volatilizing
and ionizing the target polypeptide prior to mass spectrometric
analysis. In addition, a kit can contain a control nucleic acid or
polypeptide of known identity. A kit also can provide, for example,
a solid support for immobilizing a target polypeptide, including,
if desired, reagents for performing such immobilization. A kit
further can contain reagents useful for manipulating a target
polypeptide, for example, reagents for conditioning the target
polypeptide prior to mass spectrometry or reagents for sequencing
the polypeptide. A kit as disclosed herein is useful for performing
the various disclosed processes and can be designed, for example,
for use in determining the number of nucleotide repeats of a target
nucleic acid or whether a target nucleic acid contains a different
number of nucleotide repeats relative to a reference nucleic
acid.
[0031] A target polypeptide can be encoded by an allelic variant of
a polymorphic region of a gene of a subject, or can be encoded by
an allelic variant of a polymorphic region that is located in a
chromosomal region that is not in a gene. A process as disclosed
herein can include a step of determining whether the allelic
variant is identical to an allelic variant of a polymorphic region
that is associated with a disease or condition, thereby indicating
whether a subject has or is at risk of developing the disease or
condition associated with the specific allelic variant of the
polymorphic region of the gene. The disease or condition can be
associated, for example, with an abnormal number of nucleotide
repeats, for example, dinucleotide, trinucleotide, tetranucleotide
or pentanucleotide repeats. Since trinucleotide repeats, for
example, can be very long, determination of the number of
trinucleotide repeats by analyzing the DNA directly would not be
straightforward. Since a process for determining the identity of a
target polypeptide as disclosed herein is based on the analysis of
a polypeptide, particularly a polypeptide encoded essentially by
trinucleotide repeats, determination of the number of trinucleotide
repeats will be more accurate using the disclosed processes and
kits. A disease or condition that can be identified using a
disclosed process or kit includes, for example, Huntington's
disease, prostate cancer, Fragile X syndrome type A, myotonic
dystrophy type I Kennedy's disease, Machado-Joseph disease,
dentatorubral and pallidolyusian atrophy, and spino bulbar muscular
atrophy; as well as aging, which can be identified by examining the
number of nucleotide repeats in telomere nucleic acid from a
subject. The disease or condition also can be associated with a
gene such as genes encoding BRCA1, BRCA2, APC; a gene encoding
dystrophin, .beta.-globin, Factor IX, Factor VIIc,
ornithine-d-amino-transferase, hypoxanthine guanine phosphoribosyl
transferase, or the cystic fibrosis transmembrane receptor (CFTR);
or a proto-oncogene.
[0032] A process or a kit as disclosed herein can be used to
genotype a subject by determining the identity of one or more
allelic variants of one or more polymorphic regions in one or more
genes or chromosomes of the subject. For example, the one or more
genes can be associated with graft rejection and the process can be
used to determine compatibility between a donor and a recipient of
a graft. Such genes can be MHC genes, for example. Genotyping a
subject using a process as provided herein can be used for forensic
or identity testing purposes and the polymorphic regions can be
present in mitochondrial genes or can be short tandem repeats.
[0033] A disclosed process or kit also can be used to determine
whether a subject carries a pathogenic organism such as a virus,
bacterium, fungus or protist. A process for determining the isotype
of a pathogenic organism also is provided. Thus, depending on the
sequence to be detected, the processes and kits disclosed herein
can be used, for example, to diagnose a genetic disease or
chromosomal abnormality; a predisposition to or an early indication
of a gene influenced disease or condition, for example, obesity,
atherosclerosis, diabetes or cancer; or an infection by a
pathogenic organism, for example, a virus, bacterium, parasite or
fungus; or to provide information relating to identity, heredity or
compatibility using, for example, mini-satellite or micro-satellite
sequences or HLA phenotyping.
[0034] A process as disclosed herein provides a means for
determining the amino acid sequence of a polypeptide of interest.
Such a process can be performed, for example, by using mass
spectrometry to determine the identity of an amino acid residue
released from the amino terminus or the carboxyl terminus of a
polypeptide of interest. Such a process also can be performed, for
example, by producing a nested set of carboxyl terminal or amino
terminal deletion fragments of a polypeptide of interest, or
peptide fragment thereof, and subjecting the nested set of deletion
fragments to mass spectrometry, thereby determining the amino acid
sequence of the polypeptide.
[0035] A process of determining the amino acid sequence of a
polypeptide of interest can be performed, for example, using a
polypeptide that is immobilized, reversibly, if desired, to a solid
support. In addition, such a process can be performed on a
plurality of such polypeptides, which can be, for example, a
plurality of target polypeptides immobilized in an addressable
array on a solid support such as a microchip, which can contain,
for example, at least 2 positions, and as many as 999 positions, or
1096 positions, or 9999 positions, or more. In general, a target
polypeptide, or the amino acids released therefrom, are conditioned
prior to mass spectrometry, thereby increasing resolution of the
mass spectrum. For example, a target polypeptide can be conditioned
by mass modification. In addition, the amino acid sequences of a
plurality of mass modified target polypeptide can be determined by
mass spectrometry using a multiplexing format.
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] FIG. 1A shows the nucleotide sequence of a nucleic acid (SEQ
ID NO: 8) that can be obtained by PCR amplification of DNA
containing a non-variable stretch of 12 CAG repeats (shown without
italics) and a variable repeat of 10 CAG repeat units (represented
in italics) with primers (underlined) having the sequence (forward
primer) or the complement of the sequence (reverse primer). The T7
promoter sequence and the sequence encoding a hexahistidine (His-6)
peptide are represented in bold.
[0037] FIG. 1B shows the sequence (SEQ ID NO: 9) of the 71 amino
acid polypeptide encoded by the nucleic acid sequence shown in FIG.
1A. The stretch of 10 variable glutamine (Q) residues encoded by
the trinucleotide repeats is represented in italics. The His-6
peptide is represented in bold.
[0038] FIG. 2 sets forth an exemplary scheme for orthogonal
capture, cleavage and MALDI analysis of a polypeptide in which the
peptide is conjugated to a solid surface, which can be a microchip,
through the use of an acid cleavable diisopropylysilyl linker. The
peptide is conjugated to the linker at its amino terminus through
the formation of an amide bond. The immobilized polypeptide can be
truncated, for example, using a carboxypeptidase, or can be cleaved
using an endopeptidase such as trypsin, then is cleaved from the
solid support by exposure to acidic conditions such as the 3-HPA
(3-hydroxypicolinic acid) matrix solution. The cleaved polypeptide
then is subjected to mass spectrometry, for example, MALDI.
[0039] FIG. 3 illustrates additional linkers and capture strategies
for reversibly immobilizing a polypeptide on a solid surface, and
provides reaction conditions for conjugating a polypeptide by its
carboxyl terminus to a solid support using 1
-ethyl-3-(3-dimethylamino-propyl) carbodiimide hydrochloride
(EDC)/N-hydroxy succinimidyl (NHS).
DETAILED DESCRIPTION OF THE INVENTION
DEFINITIONS
[0040] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which this invention belongs. All patents,
applications and publications referred to herein are incorporated
by reference. For convenience, the meaning of certain terms and
phrases used in the specification and claims are provided.
[0041] As used herein, the term "allele" refers to an alternative
form of a nucleotide sequence in a chromosome. Reference to an
"allele" includes a nucleotide sequence in a gene or a portion
thereof, as well as a nucleotide sequence that is not a gene
sequence. Alleles occupy the same locus or position on homologous
chromosomes. A subject having two identical alleles of a gene is
considered "homozygous" for the allele, whereas a subject having
two different alleles is considered "heterozygous." Alleles of a
specific nucleotide sequence, for example, of a gene can differ
from each other in a single nucleotide, or several nucleotides,
where the difference can be due to a substitution, deletion, or
insertion of one or more nucleotides. A form of a gene containing a
mutation is an example of an allele. In comparison, a wild-type
allele is an allele that, when present in two copies in a subject,
results in a wild-type phenotype. There can be several different
wild-type alleles of a specific gene, since certain nucleotide
changes in a gene may not affect the phenotype of a subject having
two copies of the gene with the nucleotide changes.
[0042] The term "allelic variant" refers to a portion of an allele
containing a polymorphic region in the chromosomal nucleic acid.
The term "allelic variant of a polymorphic region of a gene" refers
to a region of a gene having one of several nucleotide sequences
found in that region of the gene in different individuals. The term
"determining the identity of an allelic variant of a polymorphic
region" refers to the determination of the nucleotide sequence or
encoded amino acid sequence of a polymorphic region, thereby
determining to which of the possible allelic variants of a
polymorphic region that particular allelic variant corresponds.
[0043] The term "polymorphism" refers to the coexistence, in a
population, of more than one form of an allele. A polymorphism can
occur in a region of a chromosome not associated with a gene or can
occur, for example, as an allelic variant or a portion thereof of a
gene. A portion of a gene that exists in at least two different
forms, for example, two different nucleotide sequences, is referred
to as a "polymorphic region of a gene." A polymorphic region of a
gene can be localized to a single nucleotide, the identity of which
differs in different alleles, or can be several nucleotides
long.
[0044] As used herein, the term "biological sample" refers to any
material obtained from a living source, for example, an animal such
as a human or other mammal, a plant, a bacterium, a fungus, a
protist or a virus. The biological sample can be in any form,
including a solid material such as a tissue, cells, a cell pellet,
a cell extract, or a biopsy, or a biological fluid such as urine,
blood, saliva, amniotic fluid, exudate from a region of infection
or inflammation, or a mouth wash containing buccal cells.
[0045] The term "polypeptide," as used herein, means at least two
amino acids, or amino acid derivatives, including mass modified
amino acids, that are linked by a peptide bond, which can be a
modified peptide bond. A polypeptide can be translated from a
nucleotide sequence that is at least a portion of a coding
sequence, or from a nucleotide sequence that is not naturally
translated due, for example, to its being in a reading frame other
than the coding frame or to its being an intron sequence, a 3' or
5' untranslated sequence, or a regulatory sequence such as a
promoter. A polypeptide also can be chemically synthesized and can
be modified by chemical or enzymatic methods following translation
or chemical synthesis. The terms "protein," "polypeptide" and
"peptide" are used interchangeably herein when referring to a
translated nucleic acid, for example, a gene product.
[0046] As used herein, the phrase "determining the identity of a
target polypeptide" refers to determining at least one
characteristic of the polypeptide, for example, the molecular mass
or charge, or the identity of at least one amino acid, or
identifying a particular pattern of peptide fragments of the target
polypeptide. Determining the identity of a target polypeptide can
be performed, for example, by using mass spectrometry to determine
the amino acid sequence of at least a portion of the polypeptide,
or to determine the pattern of peptide fragments of the target
polypeptide produced, for example, by treatment of the polypeptide
with one or more endopeptidases.
[0047] In determining the identity of a target polypeptide, the
number of nucleotide repeats encoding the target polypeptide can be
quantified. As used herein, the term "quantify," when used in
reference to nucleotide repeats encoding a target polypeptide,
means a determination of the exact number of nucleotide repeats
present in the nucleotide sequence encoding the target polypeptide.
As disclosed herein, the number of nucleotide repeats, for example,
trinucleotide repeats, can be quantified by using mass spectrometry
to determine the number of amino acids, which are encoded by the
repeat, that are present in the target polypeptide. It is
recognized, however, that the number of nucleotide repeats encoding
a target polypeptide need not be quantified to determine the
identity of a target polypeptide, since a measure of the relative
number of amino acids encoded by a region of nucleotide repeats
also can be used to determine the identity of the target
polypeptide by comparing the mass spectrum of the target
polypeptide with that of a corresponding known polypeptide.
[0048] As used herein, the term "nucleotide repeats" refers to any
nucleotide sequence containing tandemly repeated nucleotides. Such
tandemly repeated nucleotides can be, for example, tandemly
repeated dinucleotide, trinucleotide, tetranucleotide or
pentanucleotide sequences, or any tandem array of repeated
units.
[0049] As used herein, a reference polypeptide is a polypeptide to
which the target polypeptide is compared in order to identify the
polypeptide in methods that do not involve sequencing the
polypeptide. Reference polypeptides typically are known
polypeptides.
[0050] As used herein, the term "conditioned" or "conditioning,"
when used in reference to a polypeptide, particularly a target
polypeptide, means that the polypeptide is modified so as to
decrease the laser energy required to volatilize the polypeptide,
to minimize the likelihood of fragmentation of the polypeptide, or
to increase the resolution of a mass spectrum of the polypeptide or
of the component amino acids. Resolution of a mass spectrum of a
target polypeptide can be increased by conditioning the polypeptide
prior to performing mass spectrometry. Conditioning can be
performed at any stage prior to mass spectrometry and, in
particular, can be performed while the polypeptide is immobilized.
A polypeptide can be conditioned, for example, by treating the
polypeptide with a cation exchange material or an anion exchange
material, which can reduce the charge heterogeneity of the
polypeptide, thereby for eliminating peak broadening due to
heterogeneity in the number of cations (or anions) bound to the
various polypeptides in a population. Contacting a polypeptide with
an alkylating agent such as alkyliodide, iodoacetamide,
iodoethanol, or 2,3-epoxy-1-propanol, the formation of disulfide
bonds, for example, in a polypeptide can be prevented. Likewise,
charged amino acid side chains can be converted to uncharged
derivatives employing trialkylsilyl chlorides.
[0051] Conditioning of proteins is generally unnecessary because
proteins are relatively stable under acidic, high energy conditions
so that proteins do not require conditioning for mass spectrometric
analyses. There are means of improving resolution, however,
particularly for shorter peptides, such as by incorporating
modified amino acids that are more basic than the corresponding
unmodified residues. Such modification in general increases the
stability of the polypeptide during mass spectrometric analysis.
Also, cation exchange chromatography, as well as general washing
and purification procedures which remove proteins and other
reaction mixture components away from the target polypeptide, can
be used to clean up the peptide after in vitro translation and
thereby increase the resolution of the spectrum resulting from mass
spectrometric analysis of the target polypeptide.
[0052] As used herein, delayed extraction, refers to methods in
which conditions are selected to permit a longer optimum extraction
delay and hence a longer residence time, which results in increased
resolution (see, eg., Juhasz et al. (1996) Analysis, Anal. Chem.
68:941-946; and Vestal et al. (1995) Rapid Communications in Mass
Spectrometry 9:1044-1050; see also, e.g., U.S. Pat. No. 5,777,325,
U.S. Pat. No. 5,742,049, U.S. Pat. No. 5,654,545, U.S. Pat. No.
5,641,959, U.S. Pat. No. 5,654,545 and U.S. Pat. No. 5,760,393 for
descriptions of MALDI and delayed extraction protocols). In
particular, delayed ion extraction is a technique whereby a time
delay is introduced between the formation of the ions and the
application of the accelerating field. During the time lag, the
ions move to new positions according to their initial velocities.
By properly choosing the delay time and the electric fields in the
acceleration region, the time of flight of the ions can be adjusted
so as to render the flight time independent of the initial velocity
to the first order. For example, a particular method involves
exposure of the target polypeptide sample to an electric field
before and during the ionization process, which results in a
reduction of background signal due to the matrix, induces fast
fragmentation and controls the transfer of energy prior to ion
extraction.
[0053] As used herein, the term "multiplexing" refers to
simultaneously determining the identity of at least two target
polypeptides by mass spectrometry. For example, where a population
of different target polypeptides are present in an array on a
microchip or are present on another type of solid support,
multiplexing can be used to determine the identity of a plurality
of target polypeptides. Multiplexing can be performed, for example,
by differentially mass modifying each different polypeptide of
interest, then using mass spectrometry to determine the identity of
each different polypeptide. Multiplexing provides the advantage
that a plurality of target polypeptides can be identified in as few
as a single mass spectrum, as compared to having to perform a
separate mass spectrometry analysis for each individual target
polypeptide.
[0054] As used herein, the term "plurality," when used in reference
to a polynucleotide or to a polypeptide, means two or more
polynucleotides or polypeptides, each of which has a different
nucleotide or amino acid sequence, respectively. Such a difference
can be due to a naturally occurring variation among the sequences,
for example, to an allelic variation in a nucleotide or an encoded
amino acid, or can be due to the introduction of particular
modifications into various sequences, for example, the differential
incorporation of mass modified amino acids into each polypeptide in
a plurality.
[0055] As used herein, "in vitro transcription system" refers to a
cell-free system containing an RNA polymerase and other factors and
reagents necessary for transcription of a DNA molecule operably
linked to a promoter that specifically binds an RNA polymerase. An
in vitro transcription system can be a cell extract, for example, a
eukaryotic cell extract. The term "transcription," as used herein,
generally means the process by which the production of RNA
molecules is initiated, elongated and terminated based on a DNA
template. In addition, the process of "reverse transcription,"
which is well known in the art, is considered as encompassed within
the meaning of the term "transcription" as used herein.
Transcription is a polymerization reaction that is catalyzed by
DNA-dependent or RNA-dependent RNA polymerases. Examples of RNA
polymerases include the bacterial RNA polymerases, SP6 RNA
polymerase, T3 RNA polymerase, T3 RNA polymerase, and T7 RNA
polymerase.
[0056] As used herein, the term "translation" describes the process
by which the production of a polypeptide is initiated, elongated
and terminated based on an RNA template. For a polypeptide to be
produced from DNA, the DNA must be transcribed into RNA, then the
RNA is translated due to the interaction of various cellular
components into the polypeptide. In prokaryotic cells,
transcription and translation are "coupled", meaning that RNA is
translated into a polypeptide during the time that it is being
transcribed from the DNA. In eukaryotic cells, including plant and
animal cells, DNA is transcribed into RNA in the cell nucleus, then
the RNA is processed into mRNA, which is transported to the
cytoplasm, where it is translated into a polypeptide.
[0057] The term "translation system" refers to a cellular or
cell-free system for performing a translation reaction. The term
"cellular translation system" refers to a translation system based
on a permeabilized cell; the term "cell-free translation system" or
"in vitro translation system" refers to a cell extract or a
reconstituted translation system. The term "reconstituted
translation system" refers to a system containing purified or
partially purified translation factors such as elongation factors.
An in vitro translation system contains at least the minimum
elements necessary for translation of an RNA molecule into a
polypeptide. An in vitro translation system, which can be a
eukaryotic or prokaryotic system, typically contains ribosomes,
tRNA molecules, rRNA, an initiator methionyl-tRNA.sup.Met, proteins
or complexes involved in translation, for example, eukaryotic
initiation factor 2 (eIF.sub.2), eIF.sub.3 and eIF.sub.4F, and the
cap-binding complex, including the cap-binding protein.
[0058] The term "isolated" as used herein with respect to a nucleic
acid, including DNA and RNA, refers to nucleic acid molecules that
are substantially separated from other macromolecules normally
associated with the nucleic acid in its natural state. An isolated
nucleic acid molecule is substantially separated from the cellular
material normally associated with it in a cell or, as relevant, can
be substantially separated from bacterial or viral material; or
from culture medium when produced by recombinant DNA techniques; or
from chemical precursors or other chemicals when the nucleic acid
is chemically synthesized. In general, an isolated nucleic acid
molecule is at least about 50% enriched with respect to its natural
state, and generally is about 70% to about 80% enriched,
particularly about 90% or 95% or more. Preferably, an isolated
nucleic acid constitutes at least about 50% of a sample containing
the nucleic acid, and can be at least about 70% or 80% of the
material in a sample, particularly at least about 90% to 95% or
greater of the sample. An isolated nucleic acid can be a nucleic
acid fragment that does not occur in nature and, therefore, is not
found in a natural state.
[0059] The term "isolated" also is used herein to refer to
polypeptides that are substantially separated from other
macromolecules normally associated with the polypeptide in its
natural state. An isolated polypeptide can be identified based on
its being enriched with respect to materials it naturally is
associated with or its constituting a fraction of a sample
containing the polypeptide to the same degree as defined above for
an "isolated" nucleic acid, i.e., enriched at least about 50% with
respect to its natural state or constituting at least about 50% of
a sample containing the polypeptide. An isolated polypeptide, for
example, can be purified from a cell that normally expresses the
polypeptide or can be produced using recombinant DNA
methodology.
[0060] As used herein, the term "nucleic acid" refers to a
polynucleotide, including a deoxyribonucleic acid (DNA), a
ribonucleic acid (RNA), and an analog of DNA or RNA containing, for
example, a nucleotide analog or a "backbone" bond other than a
phosphodiester bond, for example, a phosphotriester bond, a
thioester bond, or a peptide bond (peptide nucleic acid). A nucleic
acid can be single stranded or double stranded and can be, for
example, a DNA-RNA hybrid. A nucleic acid also can be a portion of
a longer nucleic acid molecule, for example, a portion of a gene
containing a polymorphic region. The molecular structure of a
nucleotide sequence, for example, a gene or a portion thereof, is
defined by its nucleotide content, including deletions,
substitutions or additions of one or more nucleotides; the
nucleotide sequence; the state of methylation; or any other
modification of the nucleotide sequence.
[0061] Reference to a nucleic acid as a "polynucleotide" is used in
its broadest sense to mean two or more nucleotides or nucleotide
analogs linked by a covalent bond, including single stranded or
double stranded molecules. The term "oligonucleotide" also is used
herein to mean two or more nucleotides or nucleotide analogs linked
by a covalent bond, although those in the art will recognize that
oligonucleotides such as PCR primers generally are less than about
fifty to one hundred nucleotides in length. The term "amplifying,"
when used in reference to a nucleic acid, means the repeated
copying of a DNA sequence or an RNA sequence, through the use of
specific or non-specific means, resulting in an increase in the
amount of the specific DNA or RNA sequences intended to be
copied.
[0062] A process as disclosed herein can be used to determine a
nucleotide sequence of an unknown polynucleotide by comparing the
amino acid sequence of a polypeptide encoded by the unknown
polynucleotide with the amino acid sequence of a polypeptide
encoded by a corresponding known polynucleotide. The determined
nucleotide sequence of the unknown polynucleotide can be the same
as a naturally occurring nucleotide sequence encoding the
polypeptide, or can be different from the naturally occurring
sequence due to degeneracy of the genetic code.
[0063] As used herein, the term "unknown polynucleotide" refers to
a polynucleotide, the encoded polypeptide of which is being
examined by mass spectrometry. Generally, an unknown polynucleotide
is obtained from a biological sample The term "corresponding known
polynucleotide" means a defined counterpart of the unknown
polynucleotide. A corresponding known polynucleotide generally is
used as a control for comparison to the unknown polynucleotide and
can be, for example, the nucleotide sequence of an allele of the
unknown polynucleotide that is present in the majority of subjects
in a population. For example, an "unknown polynucleotide" can be a
DNA sequence that is obtained from a prostate cancer patient and
includes the polymorphic region that demonstrates amplification of
a trinucleotide sequence associated with prostate cancer, and the
"corresponding known polynucleotide" can be the same polymorphic
region from a subject that does not have prostate cancer, for
example, from a female subject. An unknown polynucleotide also can
be mutated gene, which can alter the phenotype of a subject as
compared to a subject not having the mutated gene. A mutated gene
can be recessive, dominant or codominant, as is well known in the
art.
[0064] The term "plasmid" refers generally to a circular DNA
sequence which, in its vector form, is not bound to a chromosome.
The terms "plasmid" and "vector" are used interchangeably herein,
since the plasmid is the most commonly used form of a vector.
Vectors such as a lambda vector can be linear but, nevertheless,
are included within the meaning of the term "plasmid" or "vector"
as used herein. Expression vectors and other vectors serving
equivalent functions, and that become known in the art subsequently
hereto, are included within the meaning of the term "plasmid" or
"vector" as used herein.
[0065] In general, a nucleic acid encoding a polypeptide of
interest, for example, a target polypeptide, is cloned into a
plasmid and is operably linked to regulatory elements necessary for
transcription or translation of the cloned nucleic acid. As used
herein, the term "operably linked" means that a nucleic acid
encoding a polypeptide is associated with a regulatory element,
particularly a promoter, such that the regulatory element performs
its function with respect to the nucleic acid molecule to which it
is linked. For example, a promoter element that is operably linked
to a nucleic acid allows for transcription of the nucleic acid when
the construct is placed in conditions suitable for transcription to
occur. It should be recognized that the term "regulatory element"
is used broadly herein to include a nucleotide sequence, either DNA
or RNA, that is required for transcription or translation, for
example, a nucleotide sequence encoding a STOP codon or a ribosome
binding site.
[0066] The term "target nucleic acid" refers to any nucleic acid of
interest, including a portion of a larger nucleic acid such as a
gene or an mRNA. A target nucleic acid can be a polymorphic region
of a chromosomal nucleic acid, for example, a gene, or a region of
a gene potentially having a mutation. Target nucleic acids include,
but are not limited to, nucleotide sequence motifs or patterns
specific to a particular disease and causative thereof, and to
nucleotide sequences specific as a marker of a disease but not
necessarily causative of the disease or condition. A target nucleic
acid also can be a nucleotide sequence that is of interest for
research purposes, but that may not have a direct connection to a
disease or that may be associated with a disease or condition,
although not yet proven so. A target nucleic acid can be any region
of contiguous nucleotides that encodes a polypeptide of at least 2
amino acids, generally at least 3 or 4 amino acids, particularly at
least 5 amino acids. A target nucleic acid encodes a target
polypeptide.
[0067] The term "target polypeptide" refers to any polypeptide of
interest that is subjected to mass spectrometry for the purposes
disclosed herein, for example, for identifying the presence of a
polymorphism or a mutation. A target polypeptide contains at least
2 amino acids, generally at least 3 or 4 amino acids, and
particularly at least 5 amino acids. A target polypeptide can be
encoded by a nucleotide sequence encoding a protein, which can be
associated with a specific disease or condition, or a portion of a
protein. A target polypeptide also can be encoded by a nucleotide
sequence that normally does not encode a translated polypeptide. A
target polypeptide can be encoded, for example, from a sequence of
dinucleotide repeats or trinucleotide repeats or the like, which
can be present in chromosomal nucleic acid, for example, a coding
or a non-coding region of a gene, for example, in the telomeric
region of a chromosome.
[0068] A process as disclosed herein also provides a means to
identify a target polypeptide by mass spectrometric analysis of
peptide fragments of the target polypeptide. As used herein, the
term "peptide fragments of a target polypeptide" refers to cleavage
fragments produced by specific chemical or enzymatic degradation of
the polypeptide. The production of such peptide fragments of a
target polypeptide is, defined by the primary amino acid sequence
of the polypeptide, since chemical and enzymatic cleavage occurs in
a sequence specific manner. Peptide fragments of a target
polypeptide can be produced, for example, by contacting the
polypeptide, which can be immobilized to a solid support, with a
chemical agent such as cyanogen bromide, which cleaves a
polypeptide at methionine residues, or hydroxylamine at high pH,
which can cleave an Asp-Gly peptide bond; or with an endopeptidase
such as trypsin, which cleaves a polypeptide at Lys or Arg
residues.
[0069] The identity of a target polypeptide can be determined by
comparison of the molecular mass or sequence with that of a
reference or known polypeptide. For example, the mass spectra of
the target and known polypeptides can be compared.
[0070] As used herein, the term "corresponding or known
polypeptide" is a known polypeptide generally used as a control to
determine, for example, whether a target polypeptide is an allelic
variant of the corresponding known polypeptide. It should be
recognized that a corresponding known protein can have
substantially the same amino acid sequence as the target
polypeptide, or can be substantially different. For example, where
a target polypeptide is an allelic variant that differs from a
corresponding known protein by a single amino acid difference, the
amino acid sequences of the polypeptides will be the same except
for the single difference. Where a mutation in a nucleic acid
encoding the target polypeptide changes, for example, the reading
frame of the encoding nucleic acid or introduces or deletes a STOP
codon, the sequence of the target polypeptide can be substantially
different from that of the corresponding known polypeptide.
[0071] As disclosed herein, a target polypeptide can be isolated
using a reagent that interacts specifically with the target
polypeptide, with a tag peptide fused to the target polypeptide, or
with a tag conjugated to the target polypeptide. As used herein,
the term "reagent" means a ligand or a ligand binding molecule that
interacts specifically with a particular ligand binding molecule or
ligand, respectively. The term "tag peptide" is used herein to mean
a peptide that is specifically bound by a reagent. The term "tag"
refers more generally to any molecule that is specifically bound by
a reagent and, therefore, includes a tag peptide. A reagent can be,
for example, an antibody that interacts specifically with an
epitope of a target polypeptide or an epitope of a tag peptide. For
example, a reagent can be an anti-myc epitope antibody, which can
interact specifically with a myc epitope fused to a target
polypeptide. A reagent also can be, for example, a metal ion such
as nickel ion or cobalt ion, which interacts specifically with a
polyhistidine tag peptide; or zinc, copper or, for example, a zinc
finger domain, which interacts specifically with an polyarginine or
polylysine tag peptide; or a molecule such as avidin, streptavidin
or a derivative thereof, which interacts specifically with a tag
such as biotin or a derivative thereof (see, e.g., U.S. application
Ser. No. 08/649,876. and also the corresponding published
International PCT application No. WO 97/43617, which describe
methods for dissociating biotin compounds, including biotin and
biotin analogs conjugated (biotinylated) to the polypeptide, from
biotin binding compounds, including avidin and streptavidin, using
amines, particularly ammonia).
[0072] The term "interacts specifically," when used in reference to
a reagent and the epitope, tag peptide or tag to which the reagent
binds, indicates that binding occurs with relatively high affinity.
As such, a reagent has an affinity of at least about
1.times.10.sup.6 M.sup.-1, generally, at least about
1.times.10.sup.7 M.sup.-1, and, in particular, at least about
1.times.10.sup.8 M.sup.-1, for the particular epitope, tag peptide
or tag. A reagent that interacts specifically, for example, with a
particular tag peptide primarily binds the tag peptide, regardless
of whether other unrelated molecules are present and, therefore, is
useful for isolating the tag peptide, particularly a target
polypeptide fused to the tag peptide, from a sample containing the
target polypeptide, for example, from an in vitro translation
reaction.
[0073] It can be advantageous in performing a disclosed process to
conjugate a nucleic acid, for example, a target nucleic acid, or a
polypeptide, for example, a target polypeptide, to a solid support
such as a bead, microchip, glass or plastic capillary, or any
surface, particularly a flat surface, which can contain a structure
such as wells, pins or the like. A nucleic acid or a polypeptide
can be conjugated to a solid support by various means, including,
for example, by a streptavidin or avidin to biotin interaction; a
hydrophobic interaction; by a magnetic interaction using, for
example, functionalized magnetic beads such as DYNABEADS, which are
streptavidin coated magnetic beads (Dynal Inc.; Great Neck N.Y.;
Oslo Norway); by a polar interaction such as a "wetting"
association between two polar surfaces or between
oligo/polyethylene glycol; by the formation of a covalent bond such
as an amide bond, a disulfide bond, a thioether bond; through a
crosslinking agent; and through an acid-labile or photocleavable
linker (see, for example, Hermanson, "Bioconjugate Techniques"
(Academic Press 1996)). In addition, a tag or a peptide such as a
tag peptide can be conjugated to polypeptide of interest,
particularly to a target polypeptide.
[0074] A process as disclosed herein can be useful for determining
the amino acid sequence of a polypeptide of interest, for example,
by using an agent that cleaves amino acids from a terminus of the
polypeptide to produce a nested set of deletion fragments of the
polypeptide and cleaved amino acids, and using mass spectrometry to
identify either the cleaved amino acids or the deletion fragments.
As used herein, the phrase "agent that cleaves amino acids from a
terminus of a polypeptide" refers to a means, which can be
physical, chemical or biological, for removing a carboxyl terminal
or an amino terminal amino acid from a polypeptide. A physical
agent is exemplified by a light source, for example, a laser, that
can cleave a terminal amino acid, particularly where the amino acid
is bound to the polypeptide through a photolabile bond. A chemical
agent is exemplified by phenylisothiocyanate (Edman's reagent),
which, in the presence of an acid, cleaves an amino terminal amino
acid from a polypeptide. A biological agent that cleaves an amino
acid from a terminus of a polypeptide is exemplified by enzymes
such as aminopeptidases and carboxypeptidases, which are well known
in the art (see, for example, U.S. Pat. No. 5,792,664;
International Publ. No. WO 96/367:32).
[0075] As used herein, the term "deletion fragment" refers to that
portion of a polypeptide that remains following cleavage of one or
more amino acids. The phrase "nested set of deletion fragments,"
when used in reference to a polypeptide to be sequenced, means a
population of deletion fragments that results from sequential
terminal cleavage of the amino acids of the polypeptide and that
contains at least one deletion fragment that terminates in each
amino acid of the portion of the polypeptide to be sequenced.
[0076] A process as disclosed herein can be used to identify a
subject that has or is predisposed to a disease or condition. As
used herein, the term "disease" has its commonly understood meaning
of a pathologic state in a subject. For purposes of the present
disclosure, a disease can be due, for example, to a genetic
mutation, a chromosomal defect or an infectious organism. The term
"condition," which is to be distinguished from conditioning of a
polypeptide, is used herein to mean any state of a subject,
including, for example, a pathologic state or a state that
determines, in part, how the subject will respond to a stimulus.
The condition of a subject is determined, in part, by the subject's
genotype, which can provide an indication as to how the subject
will respond, for example, to a graft or to treatment with a
particular medicament. Accordingly, reference to a subject being
predisposed to a condition can indicate, for example, that the
subject has a genotype indicating that the subject will not respond
favorably to a particular medicament.
[0077] Reference herein to an allele or an allelic variant being
"associated" with a disease or condition means that the particular
genotype is characteristic, at least in part, of the genotype
exhibited by a population of subjects that have or are predisposed
to the disease or condition. For example, an allelic variant such
as a mutation in the BRCA1 gene is associated with breast cancer,
and an allelic variant such as a higher than normal number of
trinucleotide repeats in a particular gene is associated with
prostate cancer. The skilled artisan will recognize that an
association of an allelic variant with a disease or condition can
be identified using well known statistical methods for sampling and
analysis of a population.
[0078] As used herein, the term "conjugated" refers to a stable
attachment, which can be a covalent attachment or a noncovalent
attachment, provided the noncovalent attachment is stable under the
condition to which the bond is to be exposed. In particular, a
polypeptide can be conjugated to a solid support through a linker,
which can provide a non-cleavable, cleavable or reversible
attachment.
[0079] As used herein, the term "solid support" means a flat
surface or a surface with structures, to which a functional group,
including a polypeptide containing a reactive group, can be
conjugated. The term "surface with structures" is used herein to
mean a support that contains, for example, wells, pins or the like,
to which a functional group, including a polypeptide containing a
reactive group, can be attached. Numerous examples of solid
supports are disclosed herein or otherwise known in the art.
[0080] As used herein, the term "starting nucleic acid" refers to
at least one molecule of a target nucleic acid, which encodes a
target polypeptide. The starting nucleic acid can be DNA or RNA,
including mRNA, and can be single stranded or double stranded,
including a DNA-RNA hybrid. A mixture of any of these nucleic acids
also can be employed as a starting nucleic acid for performing a
process as disclosed herein, as can the nucleic acids produced
following an amplification reaction.
[0081] It should be understood that the term "primer," as used
herein, can refer to more than one primer, particularly in the case
where there is some ambiguity in the information regarding the
terminal sequence of a nucleic acid to be amplified. For example,
where a nucleic acid sequence is inferred from protein sequence
information, a collection of primers containing sequences
representing all possible codon variations based on degeneracy of
the genetic code is used for each strand. One primer from this
collection is expected to be identical with a region of the
sequence to be amplified.
[0082] A process is provided for determining the identity of a
target polypeptide by using mass spectroscopy to determine the
molecular mass of the target polypeptide and comparing it to the
molecular mass of a polypeptide of known identity, thereby
determining the identity of the target polypeptide. The identity of
a target polypeptide can be, for example, the mass or amino acid
sequence of at least a portion of the target polypeptide or by
comparing the mass to a known polypeptide, which is a wild-type or
known mutein.
[0083] A target polypeptide can be obtained from a subject,
particularly from a cell or tissue in the subject or from a
biological fluid. A target polypeptide also can be obtained by in
vitro translation of an RNA molecule encoding the target
polypeptide; or by in vitro transcription of a nucleic acid
encoding the target polypeptide, followed by translation, which can
be performed in vitro or in a cell, where the nucleic acid to be
transcribed is obtained from a subject. Kits for performing the
processes are also provided.
[0084] A process as disclosed herein provides a fast and reliable
means for indirectly obtaining nucleic acid sequence information.
Since the mass of a polypeptide is only about 10% of the mass of
the corresponding DNA, the translated polypeptide generally is far
more amenable to mass spectrometric detection than the
corresponding nucleic acid. In addition, mass spectrometric
detection of polypeptides yields analytical signals of far higher
sensitivity and resolution than signals routinely obtained with
DNA, due to the inherent instability of DNA to volatilization and
its affinity for nonvolatile cationic impurities.
[0085] These processes and kits are particularly useful for a
number of applications, such as identifying mutations and thereby
screening for certain genetic disorders. A process as disclosed
herein also provides an efficient means for determining the
presence of a single base in a polynucleotide, for example, a
single base mutation that introduces a STOP codon into an open
reading frame of a gene, since such a mutation results in premature
protein truncation; or a single base difference that results in a
change in the encoded amino acid in an allelic variant of a
polymorphic gene, since different amino acids can be distinguished
based on their masses. Mutation screening by direct mass analysis
of a gene such as p53 or BRCA1 requires a system that permits
detection of a single base mutation, which can be difficult when
examining a DNA sequence directly. A single base mutation
resulting, for example, in a premature STOP codon, can radically
change the mass of the encoded protein by truncation and,
therefore, is readily identifiable using a process as disclosed
herein. A single base change need not result in a STOP codon in
order to be detectable, since a single base change that results in
an amino acid change, for example, alanine to glycine, also is
detectable using a process as disclosed herein (see Examples).
[0086] A process as disclosed herein can be used for identifying
the presence of nucleotide repeats, particularly an abnormal number
of nucleotide repeats, by determining the identity of a target
polypeptide encoded by such repeats. As disclosed herein, an
abnormal number of nucleotide repeats can be identified by using
mass spectrometry to compare the mass of a target polypeptide with
that of a corresponding known polypeptide.
[0087] In a particular application, the disclosed processes, and
the kits useful for performing such processes, can be used, for
example, in detecting an abnormal number of CAG repeats in the
SCA-1 gene or in detecting the presence of a nucleotide
substitution from a C to a G in one of the trinucleotide repeats in
a subject with spino-cerebellar ataxia 1 (SCA-1). Mass spectrometry
is used to determine the molecular mass of a target polypeptide
encoded by a nucleic acid containing the trinucleotide repeats and
comparing the molecular mass of the target polypeptide with the
molecular mass of a polypeptide encoded by a nucleic acid having a
known number of trinucleotide repeats and a known nucleotide
sequence (see Example 1). The identification of the nucleotide
sequence of the target nucleic acid by this method is made
possible, in part, due to the increased mass accuracy obtained by
using mass spectrometry to detect the translation product, rather
than directly detecting the nucleic acid by mass spectrometry.
[0088] For illustrative purposes, the open reading frame of the
gene containing the (CAG).sub.X repeat associated with SCA-1 is
shown in FIG. 1. The SCA-1 sequence contains, in addition to a
nonvariable stretch of 12 CAG repeats, a variable stretch that is
shown in FIG. 1A as containing 10 CAG repeats. As shown in FIG. 1A,
the SCA-1 gene encodes a 7.5 kiloDalton (kDa) protein containing 10
consecutive glutamine (Q) residues (FIG. 1B). Accurate direct mass
analysis of the 60 kDa 200-mer shown in FIG. 1A with currently
available mass spectrometric instrumentation would be challenging.
A recent study of the SCA-1 gene showed that 25 to 36 repeat units
generally are present in unaffected subjects, while affected
subjects have 43 to 81 repeat units. Assuming a worst case of 81
repeat units, 213 bases in addition to the 200-mer shown in FIG. 1A
would have to be detected with sufficient resolution. A nucleotide
sequence of greater than about a 400-mer (>120 kDa) has not been
detected satisfactorily by mass spectrometry. In comparison,
analysis of the translation product for the sequence having 81
repeats requires mass measurement of only about 137 amino acid
residues (about 15 kDa). A typical 0.3% mass accuracy for low
resolution instrumentation results in a maximum 13 Dalton error,
which is far lower than the mass of a single amino acid residue.
Accordingly, far better than single amino acid resolution can be
obtained with a process for determining the identity of a target
polypeptide as disclosed herein.
OBTAINING A TARGET POLYPEPTIDE
[0089] Any polypeptide for which identifying information is
required is contemplated herein as a target polypeptide. The
polypeptide may be obtained from any source. A target polypeptide,
or a target nucleic acid encoding the polypeptide, can be obtained
from a subject, which is typically a mammal, particularly a human.
Generally, the target polypeptide is isolated prior to mass
spectrometry so as to permit the determination of the molecular
mass of the polypeptide by mass spectrometric analysis. The degree
to which a polypeptide must be isolated for mass spectrometry is
known in the art and varies depending on the type of mass
spectrometric analysis performed.
[0090] A target polypeptide can be a portion of a protein, and can
be obtained using methods known in the art. For example, a protein
can be isolated from a biological sample using an antibody, then
can be cleaved using a proteinase that cuts selectively at specific
amino acid sequences, and the target polypeptide can be purified by
a method such as chromatography or electrophoresis. Thus, a process
as disclosed herein can be performed, for example, by subjecting a
protein, which contains a target polypeptide, to limited
proteolysis; isolating the target polypeptide; and examining it by
mass spectrometric analysis, thereby providing a means for
determining the identity of the target polypeptide.
[0091] An antibody, or antigen binding fragment of an antibody,
that interacts specifically with an epitope present on a
polypeptide of interest is characterized by having specific binding
activity for the epitope of at least about 1.times.10.sup.6
M.sup.-1, generally, at least about 1.times.10.sup.7 M.sup.-1 or
greater. Accordingly, Fab, F(ab').sub.2, Fd and Fv fragments of an
antibody that retain specific binding activity for a particular
epitope are included within the meaning of the term antibody.
[0092] An antibody useful for isolating a polypeptide of interest,
particularly a target polypeptide, can be a naturally occurring
antibody or a non-naturally occurring antibody, including, for
example, a single chain antibody, a chimeric antibody, a
bifunctional antibody or a humanized antibody, as well as an
antigen-binding fragment of such antibodies. Such non-naturally
occurring antibodies can be constructed using solid phase peptide
synthesis, can be produced recombinantly or can be obtained, for
example, by screening combinatorial libraries containing of
variable heavy chains and variable light chains (see Huse et al,
Science 246:1275-1281 (1989)). These and other methods of making,
for example, chimeric, humanized, CDR-grafted, single chain, and
bifunctional antibodies are well known to those skilled in the art
(Winter and Harris, Immunol. Today 14:243-246 (1993); Ward et al.,
Nature 341:544-546 (1989); Hilyard et al., Protein Engineering: A
practical approach (IRL Press 1992); Borrabeck, Antibody
Engineering, 2d ed. (Oxford University Press 1995); Harlow and
Lane, "Antibodies: A laboratory manual" (Cold Spring Harbor
Laboratory Press 1988)).
[0093] An antibody useful for isolating a target polypeptide can be
obtained from a commercial source, or can be raised using a protein
containing the target polypeptide, or a peptide portion thereof, as
an immunogen, or using an epitope that is fused to the polypeptide,
for example, a myc epitope. Such an immunogen can be prepared from
natural sources or produced recombinantly, or can be synthesized
using routine chemical methods. An otherwise non-immunogenic
epitope can be made immunogenic by coupling the hapten to a carrier
molecule such as bovine serum albumin (BSA) or keyhole limpet
hemocyanin (KLH), or by expressing the epitope as a fusion protein.
Various other carrier molecules and methods for coupling a hapten
to a carrier molecule are well known in the art (see, for example,
Harlow and Lane, "Antibodies: A laboratory manual" (Cold Spring
Harbor Laboratory Press 1988)).
[0094] An antibody that interacts specifically with a polypeptide
of interest, particularly a target polypeptide or peptide portion
thereof, is useful, for example, for determining whether the target
polypeptide is present in a biological sample. The identification
of the presence or level of the target polypeptide can be made
using well known immunoassay and immunohistochemical methods
(Harlow and Lane, "Antibodies: A laboratory manual" (Cold Spring
Harbor Laboratory Press 1988)). In particular, an antibody that
interacts specifically with a tag peptide fused to a target
polypeptide can be used to isolate the target polypeptide from a
sample, which can be, for example, a biological sample or an in
vitro translation reaction.
[0095] Methods for raising polyclonal antibodies, for example, in a
rabbit, goat, mouse or other mammal, are well known in the art
(Harlow and Lane, "Antibodies: A laboratory manual" (Cold Spring
Harbor Laboratory Press 1988)). In addition, monoclonal antibodies
can be obtained using methods that are well known and routine in
the art (Harlow and Lane, "Antibodies: A laboratory manual" (Cold
Spring Harbor Laboratory Press 1988)). Essentially, spleen cells
from a mouse immunized with a polypeptide of interest, or a peptide
portion thereof, can be fused to an appropriate myeloma cell line
such as SP/02 myeloma cells to produce hybridoma cells. Cloned
hybridoma cell lines can be screened using the immunizing
polypeptide to identify clones that secrete appropriately specific
antibodies. Hybridomas expressing antibodies having a desirable
specificity and affinity can be isolated and utilized as a
continuous source of the antibodies, which are useful, for example,
for inclusion in a kit as provided herein. Similarly, a recombinant
phage that expresses, for example, a single chain antibody of
interest also provides a monoclonal antibody that can be used for
preparing standardized kits.
[0096] Isolation and identification of a target polypeptide can be
facilitated by linking a tag to the polypeptide, for example, by
fusing the polypeptide to a tag peptide. Such a fusion polypeptide
can be obtained, for example, by in vitro transcription and
translation of a nucleotide sequence encoding the target
polypeptide linked in frame to a nucleotide sequence encoding the
tag peptide, then isolating the fusion polypeptides from the
translation reaction using a reagent that interacts specifically
with the tag peptide. The tag peptide can be, for example, a myc
epitope or a peptide portion of the Haemophilus influenza
hemagglutinin protein, against which specific antibodies can be
prepared and also are commercially available. A tag peptide also
can be a polyhistidine sequence, for example, a hexahistidine
sequence (His-6), which interacts specifically with metal ions such
as zinc, nickel, or cobalt ions, or a polylysine or polyarginine
sequence, comprising at least about four lysine or four arginine
residues, respectively, which interact specifically with zinc,
copper or, for example a zinc finger protein.
[0097] A tag can be added to the polypeptide either by chemical
modification of the polypeptide during or following its synthesis.
For example, a target polypeptide containing a tag can be obtained
by isolation from an in vitro translation reaction of a target
nucleic acid molecule, where the translation reaction is performed
in the presence of a modified amino acid and, if appropriate, a
mis-aminoacylated tRNA carrying the modified amino acid. The
modification of the amino acid is selected so that it contains a
tag that allows the isolation of a polypeptide containing the
modified amino acid. For example, a lysine residue can be replaced
with a biotinylated lysine analog (or other lysine analog
containing a tag) in the translation reaction, resulting in a
translated polypeptide that contains biotinylated lysine residues.
Such a tagged polypeptide can be isolated by affinity
chromatography on a bed of immobilized avidin or streptavidin, for
example. Other modified amino acids are disclosed in the U.S. Pat.
No. 5,643,722.
[0098] A target polypeptide can be isolated by affinity
purification using, for example, an antibody, avidin or other
specific reagent linked to a solid support. In such a method, the
translation reaction is poured over the support, which can be
present, for example, in a column, and the polypeptide is bound due
to its specifically interacting with the reagent. For example, a
target polypeptide fused to a polyhistidine tag peptide can be
isolated on a column or bed of chelated nickel ions, whereas a
target polypeptide fused to a polylysine or polyarginine tag can be
isolated on a column or bed of chelated zinc or copper ions. Beds
or columns having such divalent metal ions chelated thereto can be
obtained from a commercial source or prepared using methods known
in the art. The polypeptide then can be eluted from the column in
an isolated form and subjected to mass spectrometry.
ISOLATION OF A NUCLEIC ACID ENCODING A TARGET POLYPEPTIDE
[0099] In other embodiments, the polypeptide may be prepared from
nucleic acid that encodes it. Thus, the target polypeptide can be
isolated from a cell or tissue of the subject; or can be
synthesized in vitro from an RNA molecule, for example, by in vitro
translation, or from a DNA molecule by in vitro transcription and
translation; or can be synthesized in a eukaryotic or prokaryotic
host cell that is transformed with a target nucleic acid, which
encodes the target polypeptide.
[0100] In preferred embodiments herein, a target polypeptide is
isolated from a cell, a tissue or an in vitro translation system,
for example, a reticulocyte lysate system. In vitro translation or
in vitro transcription followed by translation are among the
preferred methods of preparation of the polypeptides. The
polypeptides can be purified after translation using any method
known to those of skill in the art for purification. For example,
the polypeptide can be isolated using a reagent that interacts
specifically with the target polypeptide or with a protein
containing the target polypeptide. Such a reagent can be an
antibody that interacts specifically with an epitope of the target
polypeptide, for example, an antibody to an epitope encoded by a
trinucleotide repeat sequence. If the target polypeptide contains
an amino acid that can be any of several amino acids, for example,
where the target polypeptide is from a mutated protein, the
antibody preferably interacts with an epitope that does not include
an epitope containing the mutated amino acid(s). Antibodies that
interact specifically with a protein containing a target
polypeptide, or with the target polypeptide, can be prepared using
methods well known in the art (Harlow and Lane, "Antibodies: A
laboratory manual" (Cold Spring Harbor Laboratory Press 1988)).
[0101] A target polypeptide can be obtained from an RNA molecule,
for example, by in vitro translation of the RNA molecule. The
target polypeptide also can be obtained from a DNA molecule, where
in vitro transcription of at least a portion of the DNA molecule is
performed prior to translation. In particular, at least a portion
of the DNA molecule containing the nucleotide sequence encoding the
target polypeptide can be amplified, for example, by PCR prior to
performing in vitro transcription or translation. Accordingly, a
process for determining the identity of a target polypeptide, as
disclosed herein, can include a step of isolating a target nucleic
acid molecule, which can be DNA or RNA and from which the target
polypeptide is obtained.
[0102] A nucleic acid sample, in an isolated or unisolated form,
can be utilized as a starting nucleic acid in a method as disclosed
herein, provided the sample is suspected of containing the target
nucleic acid. The target nucleic acid can be a portion of a larger
molecule or can be present initially as a discrete molecule such
that the specific sequence constitutes the entire nucleic acid.
[0103] It is not necessary that a starting nucleic acid contain
only the target nucleic acid in an isolated form. Provided that the
starting nucleic acid is in an isolated form, the target nucleic
acid can be a minor fraction of a complex mixture, for example, a
portion of the .beta.-globin gene contained in whole human DNA, or
a portion of nucleic acid sequence of a particular microorganism
that constitutes only a minor fraction of a particular biological
sample. A starting nucleic acid also can contain more than one
population of target nucleic acids.
[0104] The starting nucleic acid can be obtained from any source,
including a natural source such as bacteria, yeast, viruses,
protists, and higher organisms, including plants or animals,
particularly from tissues, cells or organelles of such sources, or
can be obtained from a plasmid such as pBR322, in which the nucleic
acid previously was cloned. The starting nucleic acid can represent
a sample of DNA, for example, isolated from an animal, particularly
a mammal such as a human subject, and can be obtained from any cell
source or body fluid. Examples of cell sources available in
clinical practice include, but are not limited to, blood cells,
buccal cells, cervico-vaginal cells, epithelial cells from urine,
or cells present in a tissue obtained, for example, by biopsy. Body
fluids include blood, urine and cerebrospinal fluid, as well as
tissue exudates from a site of infection or inflammation.
[0105] A nucleic acid molecule can be extracted from a cell source
or body fluid using any of numerous methods well known and routine
in the art, and the particular method used to extract the nucleic
acid will be selected as appropriate for the particular biological
sample, including whether the nucleic acid to be isolated is DNA or
RNA (see, for example, Sambrook et al., Molecular Cloning: A
laboratory manual (Cold Spring Harbor Laboratory Press 1989). For
example, freeze-thaw and alkaline lysis procedures can be useful
for obtaining nucleic acid molecules from solid materials such as
cell or tissue samples; heat and alkaline lysis procedures can be
useful for obtaining nucleic acid molecules from urine; and
proteinase K extraction or phenol extraction can be useful to
obtain nucleic acid from cells or tissues such as a blood sample
(Rolff et al., "PCR: Clinical diagnostics and research" (Springer
Verlag Publ. 1994)).
[0106] For utilization of a target nucleic acid from cells, the
cells can be suspended in a hypotonic buffer and heated to about
90.degree. C. to 100.degree. C. for about 1 to 15 minutes, until
cell lysis and dispersion of intracellular components occur. After
the heating step, amplification reagents, if desired, can be added
directly to the lysate. Such a direct amplification method can be
used, for example, on peripheral blood lymphocytes or amniocytes.
The amount of DNA extracted for analysis of human genomic DNA
generally is at least about 5 pg, which corresponds to about 1 cell
equivalent of a genome size of 4.times.10.sup.9 base pairs.
[0107] In some applications, for example, detection of sequence
alterations in the genome of a microorganism, variable amounts of
DNA can be extracted.
[0108] In general, the nucleotides forming a polynucleotide are
naturally occurring deoxyribonucleotides, such as adenine,
cytosine, guanine or thymine linked to 2'-deoxyribose, or
ribonucleotides such as adenine, cytosine, guanine or uracil linked
to ribose. A polynucleotide also includes nucleotide analogs,
including non-naturally occurring synthetic nucleotides or modified
naturally occurring nucleotides. Such nucleotide analogs are well
known in the art and are commercially available, as are
polynucleotides containing such nucleotide analogs (Lin et al.,
Nucl. Acids Res. 22:5220-5234 (1994); Jellinek et al., Biochemistry
34:11363-11372 (1995); Pagratis et al., Nature Biotechnol. 15:68-73
(1997)). The covalent bond linking the nucleotides of a
polynucleotide generally is a phosphodiester bond. The covalent
bond also can be any of numerous other bonds, including a
thiodiester bond, a phosphorothioate bond, a peptide-like bond or
any other bond known to those in the art as useful for linking
nucleotides to produce synthetic polynucleotides (see, for example,
Tam et al., Nucl. Acids Res. 22:977-986 (1994); Ecker and Crooke,
BioTechnology 13:351360 (1995)).
[0109] Where it is desired to synthesize a polynucleotide for use
in a process as disclosed herein or for inclusion in a kit, the
artisan will know that the selection of particular nucleotides or
nucleotide analogs and the covalent bond used to link the
nucleotides will depend, in part, on the purpose for which the
polynucleotide is prepared. For example, where a polynucleotide
will be exposed to an environment containing substantial nuclease
activity, the artisan will select nucleotide analogs or covalent
bonds that are relatively resistant to the nucleases. A
polynucleotide containing naturally occurring nucleotides and
phosphodiester bonds can be chemically synthesized or can be
produced using recombinant DNA methods, using an appropriate
polynucleotide as a template. In comparison, a polynucleotide
containing nucleotide analogs or covalent bonds other than
phosphodiester bonds generally will be chemically synthesized,
although an enzyme such as T7 polymerase can incorporate certain
types of nucleotide analogs and, therefore, can be used to produce
such a polynucleotide recombinantly from an appropriate template
(Jellinek et al., Biochemistry 34:11363-11372 (1995)).
[0110] A polynucleotide, for example, an oligonucleotide, that
specifically hybridizes to a nucleic acid, particularly to a target
nucleic acid or to sequences flanking a target nucleic acid is
particularly useful. Such a hybridizing polynucleotide is
characterized, in part, in that it is at least nine nucleotides in
length, such sequences being particularly useful as primers for the
polymerase chain reaction (PCR), and can be at least fourteen
nucleotides in length or, if desired, at least seventeen
nucleotides in length, such nucleotide sequences being particularly
useful as hybridization probes, as well as for PCR. It should be
recognized that the conditions required for specific hybridization
of a first polynucleotide, for example, a PCR primer, with a second
polynucleotide, for example, a target nucleic acid, depends, in
part, on the degree of complementarity shared between the
sequences, the GC content of the hybridizing molecules, and the
length of the antisense nucleic acid sequence, and that conditions
suitable for obtaining specific hybridization can be calculated
based on readily available formulas or can be determined
empirically (Sambrook et al., Molecular Cloning: A laboratory
manual (Cold Spring Harbor Laboratory Press 1989; Ausubel et al.,
Current Protocols in Molecular Biology (Green Publ., NY 1989)).
TRANSCRIPTION AND TRANSLATION OF A TARGET NUCLEIC ACID
[0111] A target polypeptide can be obtained by translating an RNA
molecule encoding the target polypeptide in vitro. If desired, the
RNA molecule can be obtained by in vitro transcription of a nucleic
acid, generally DNA, encoding the target polypeptide. Translation
of a target polypeptide can be effected by directly introducing an
RNA molecule encoding the polypeptide into an in vitro translation
reaction or by introducing a DNA molecule encoding the polypeptide
into an in vitro transcription/translation reaction or into an in
vitro transcription reaction, then transferring the RNA to an in
vitro translation reaction.
[0112] For in vitro transcription, the target DNA is operably
linked to a promoter, from which transcription is initiated in the
presence of an RNA polymerase capable of interacting with the
promoter, ribonucleotides, and other reagents necessary for in
vitro transcription. In vitro transcription can be performed as a
separate step from an in vitro translation reaction or can be
carried out in a single reaction, using well known methods (see,
for example, Sambrook et al., Molecular Cloning: A laboratory
manual (Cold Spring Harbor Laboratory Press 1989; see, also, U.S.
Pat. No. 4,766,072, which describes vectors useful for in vitro
transcription). In vitro transcription kits are well known and are
commercially available (Promega Corp.; Madison Wis.).
[0113] An in vitro transcription reaction is carried out by
incubating a template DNA, which generally includes the target
nucleic acid, for about 1 hour at 37.degree. C. or 40.degree. C.,
depending on the polymerase, in the presence of ribonucleotides, a
cap analog such as GpppG or a methylated derivative thereof, an
RNAase inhibitor, an RNA polymerase that recognizes the promoter
operably linked upstream of the DNA to be transcribed, and an
appropriate buffer containing Tris-HCl, MgCl.sub.2, spermidine and
NaCl. Following the transcription reaction, RNAase-free DNAse can
be added to remove the DNA template and the RNA purified, for
example, by phenol-chloroform extraction (see, Sambrook et al.,
Molecular Cloning: A laboratory manual (Cold Spring Harbor
Laboratory Press 1989). Usually about 5 to 10 .mu.g of RNA is
obtained per microgram of template DNA.
[0114] Where RNA is produced in a prokaryotic in vitro
transcription system, the RNA can be produced in an uncapped form,
such as by in vitro transcription in the absence of a cap analog,
since translation of RNA in a prokaryotic system does not require
the presence of a cap such as N.sub.7-methyl-G covalently linked to
the 5' end of the mRNA. Capped RNA is translated much more
efficiently than uncapped RNA in eukaryotic systems and, therefore,
it can be desirable to cap the RNA during transcription or during
translation when using a eukaryotic translation system. The in
vitro transcribed RNA can be isolated, for example, by ethanol
precipitation, then used for in vitro translation.
[0115] Translation systems can be cellular or cell-free and can be
prokaryotic or eukaryotic. Cellular translation systems generally
utilize intact cells, for example, oocytes, or utilize
permeabilized cells, whereas cell-free (in vitro) translation
systems utilize cell or tissue lysates or extracts, purified or
partially purified components, or combinations thereof.
[0116] In vitro translation systems are well known and are
commercially available and many different types and systems are
well known and routinely used. Examples of in vitro translation
systems include eukaryotic cell lysates such as rabbit reticulocyte
lysates, rabbit oocyte lysates, human cell lysates, insect cell
lysates and wheat germ extracts. Such lysates and extracts can be
prepared or are commercially available (Promega Corp.; Stratagene,
La Jolla Calif.; Amersham, Arlington Heights Ill.; and GIBCO/BRL,
Grand Island N.Y.). In vitro translation systems generally contain
macromolecules such as enzymes; translation, initiation and
elongation factors; chemical reagents; and ribosomes. Mixtures of
purified translation factors, as well as combinations of lysates or
lysates supplemented with purified translation factors such as
initiation factor-1 (IF-1), IF-2, IF-3 (alpha or beta), elongation
factor T (EF-Tu) or termination factors, also can be used for mRNA
translation in vitro.
[0117] Incubation times for in vitro translation range from about 5
minutes to many hours, but generally are about thirty minutes to
five hours, usually about one to three hours. Incubation can be
performed in a continuous manner, whereby reagents are flowed into
the system and nascent polypeptides removed or left to accumulate,
using a continuous flow system as described by Spirin et al.
(Science 242:1162-64 (1988)). Such a process can be desirable for
large scale production of nascent polypepotides. Incubation times
vary significantly with the volume of the translation mix and the
temperature of the incubation. Incubation temperatures can be
between about 4.degree. C. to 60.degree. C., generally about
15.degree. C. to 50.degree. C., and usually about 25.degree. C. to
45.degree. C., particularly about 25.degree. C. or about 37.degree.
C.
[0118] Translation reactions generally contain a buffer such as
Tris-HCl, HEPES, or other suitable buffering agent to maintain the
solution at about pH 6 to pH 8, generally about pH 7. Other
components of a translation system can include dithiothreitol (DTT)
or 2-mercaptoethanol as reducing agents, RNasin to inhibit RNA
breakdown, and nucleoside triphosphates or creatine phosphate and
creatine kinase to provide chemical energy for the translation
process.
[0119] An in vitro translation system can be a reticulocyte lysate,
which is available commercially or can be prepared according to
methods disclosed herein or otherwise known in the art.
Commercially available reticulocyte lysates are available, for
example, from New England Nuclear and Promega Corp. (Cat. #L4960,
L4970, and L4980). An in, vitro translation system also can be a
wheat germ translation system, which is available commercially or
can be prepared according to well known methods. Commercially
available wheat germ extracts can be obtained, for example, from
Promega Corp. (for example, Cat # L4370). An in vitro translation
system also can be a mixture of a reticulocyte lysate and a wheat
germ extract, as can be obtained commercially (for example, Promega
Corp., catalog # L4340). Other useful in vitro translation systems
include E. coli extracts, insect cell extracts and frog oocyte
extracts.
[0120] A rabbit reticulocyte lysate can be prepared as follows.
Rabbits are rendered anemic by inoculation with
acetylphenylhydrazine. About 7 days later, the rabbits are bled and
the blood ifs collected and mixed with an ice cold salt solution
containing NaCl, magnesium acetate (MgAc), KCl, and heparin. The
blood mixture is filtered through a cheesecloth, centrifuged, and
the buffy coat of white cells is removed. The pellet, which
contains erythrocytes and reticulocytes, is washed with the salt
solution, then lysed by the addition of an equal volume of cold
water. Endogenous RNA is degraded by treating the lysate with
micrococcal nuclease and calcium ions, which are necessary for
nuclease activity, and the reaction is stopped by the addition of
EGTA, which chelates the calcium ions and inactivates the nuclease.
Hemin (about 20 to 80 .mu.M), which is a powerful suppressor of an
inhibitor of the initiation factor eIF-2, also can be added to the
lysate. Translation activity of the lysates can be optimized by the
addition of an energy generating system, for example,
phosphocreatine kinase and phosphocreatine. The lysates then can be
aliquoted and stored at -70.degree. C. or in liquid nitrogen.
Further details regarding such a protocol are known (see, eq.,
Sambrook et al., Molecular Cloning: A laboratory manual (Cold
Spring Harbor Laboratory Press 1989).
[0121] An in vitro translation reaction using a reticulocyte lysate
can be carried out as follows. Ten .mu.l of a reticulocyte lysate,
which can be prepared as disclosed above or can be obtained
commercially, is mixed with spermidine, creatine phosphate, amino
acids, HEPES buffer (pH 7.4), KCl, MgAc and the RNA to be
translated, and incubated for an appropriate time, generally about
one hour at 30.degree. C. The optimum amount of MgAc for obtaining
efficient translation varies from one reticulocyte lysate
preparation to another and can be determined using a standard
preparation of RNA and a concentration of MgAc varying from 0 to 1
mM. The optimal concentration of KCl also can vary depending on the
specific reaction. For example, 70 mM KCl generally is optimal for
translation of capped RNA, whereas 40 mM generally is optimal for
translation of uncapped RNA. Optionally, the translation process is
monitored by a method such as mass spectrometric analysis.
Monitoring also can be performed, for example, by adding one or
more radioactive amino acids such as .sup.35S-methionine and
measuring incorporation of the radiolabel into the translation
products by precipitating the proteins in the lysaite such as with
TCA and counting the amount of radioactivity present in the
precipitate at various times during incubation. The translation
products also can be analyzed by immunoprecipitation or by
SDS-poly,acrylamide gel electrophoresis (see, for example, Sambrook
et al. Molecular Cloning: A laboratory manual (Cold Spring Harbor
Laboratory Press 1989; Harlow and Lane, "Antibodies: A laboratory
manual" (Cold Spring Harbor Laboratory Press 1988)).
[0122] A wheat germ extract can be prepared as described by Roberts
and Paterson (Proc. Natl. Acad. Sci., USA 70:2330-2334 (1973)) and
can be modified as described by Anderson (Meth. Enzymol. 101:635
(1983)), if desired.
[0123] The protocol also can be modified according to manufacturing
protocol L418 (Promega Corp.). Generally, wheat germ extract is
prepared by grinding wheat germ in an extraction buffer, followed
by centrifugation to remove cell debris. The supernatant is
separated by chromatography from endogenous amino acids and from
plant pigments that are inhibitory to translation. The extract also
is treated with micrococcal nuclease to destroy endogenous mRNA,
thereby reducing background translation to a minimum. The wheat
germ extract contains the cellular components necessary for protein
synthesis, including tRNA, rRNA and initiation, elongation and
termination factors. The extract can be optimized further by the
adding an energy generating system such as phosphocreatine kinase
and phosphocreatine; MgAc is added at a level recommended for the
translation of most mRNA species, generally about 6.0 to 7.5 mM
magnesium.
[0124] In vitro translation in wheat germ extracts can be performed
as described, for example, Erickson and Blobel (Meth. Enzymol.
96:38 (1982)), and can be modified, for example, by adjusting the
final ion concentrations to 2.6 mM magnesium and 140 mM potassium,
and the pH to 7.5 (U.S. Pat. No. 4,983,521). Reaction mixtures can
be incubated at 24.degree. C. for 60 minutes. Translations in wheat
germ extracts can also be performed as described in U.S. Pat. No.
5,492,817.
[0125] In vitro translation reactions can be optimized by the
addition of ions or other reagents. For example, magnesium is
important for optimal translation, as it enhances the stability of
assembled ribosomes and functions in their binding together during
translation. Magnesium also appears to facilitate polymerase
binding. Potassium also is important for optimizing translation
but, unlike magnesium, for coupled transcription and translation
reactions, the potassium ion concentration need not be altered
beyond standard translation preparation levels.
[0126] Potassium and magnesium are in the standard rabbit
reticulocyte lysate and their levels are partially from the
endogenous lysate level and partially from the additions made in
the preparation of the lysate, as are done for translation lysates.
Since the magnesium concentration should be adjusted within a
rather narrow range for optimal translation, the lysate magnesium
levels should be measured directly through the use of a magnesium
assay, prior to the addition of extra magnesium, so that the amount
of magnesium in a reaction can be standardized from one batch of
lysate to the next. The Lancer "Magnesium Rapid Stat Diagnostic
Kit" (Oxford Lab Ware Division, Sherwood Medical Co.; St. Louis
Mo.) is a useful assay for accurately measuring the magnesium level
in a biological fluid. Once the magnesium ion concentration for a
given batch of lysate is determined, additional magnesium, for
example, in the form of a concentrated magnesium salt solution, can
be added in a known manner to bring the magnesium concentration of
the lysate to within the optimal range or, in the case of a
modified lysate preparation to be used as one-half of a reaction
mixture, to within twice the optimal range. The final magnesium
concentration of rabbit reticulocyte lysate is adjusted, for
example, by adding a concentrated solution of MgCl.sub.2 or MgAc to
a concentration greater than 2.5 mM, but less than 3.5 mM,
generally between 2.6 mM and 3.0 mM.
[0127] A common addition to an in vitro translation reaction is an
amount of a polyamine sufficient to stimulate efficient chain
elongation. Accordingly, spermidine can be added to a reticulocyte
lysate translation reaction to a final concentration of about 0.2
mM. Spermidine also can be added to wheat germ extracts, generally
at a concentration of about 0.9 mM. Since the presence of
polyamines lowers the effective magnesium concentration in a
reaction, the presence of spermidine in a translation reaction
should be considered when determining the appropriate concentration
of magnesium to use. DTT also is added to the translation mixture,
generally at a final concentration of about 1.45 mM in reticulocyte
lysates and about 5.1 mM in wheat germ extracts.
[0128] Translation systems can be supplemented with additional
factors such as tRNA molecules, which are commercially available
(Sigma Chemical, St. Louis Mo.; Promega Corp., Madison Wis.;
Boehringer Mannheim Biochemicals, Indianapolis IN) or can be
prepared from E. coli, yeast, calf liver or wheat germ using well
known methods. Isolation and purification of tRNA molecules involve
cell lysis and phenol extraction, followed by chromatography on
DEAE-cellulose. Amino acid-specific tRNA, for example,
tRNA<fMet>, can be isolated by expression from cloned genes
and overexpressed in host cells and separated from total tRNA in
high yield and purity using, for example, preparative
polyacrylamide gel electrophoresis, followed by band excision and
elution (Seong and RajBhandary, Proc. Natl. Acad. Sci., USA
84:334-338, 1987)).
[0129] Translation efficiency can be improved by adding RNAase
inhibitors such as RNASIN or heparin to the translation reaction.
RNASIN can be obtained, for example, from Promega Corp. (Cat #
N2514). About 40 units of RNASIN are added to a 50 .mu.l reaction.
Although the addition of an RNAase inhibitor to reticulocyte
lysates is not crucial, only limited translation occurs if an
RNAase inhibitor is not added to a wheat germ extract translation
reaction.
[0130] The translation process, including the movement of the
ribosomes on the RNA molecules, is inhibited at an appropriate time
by the addition of an inhibitor of translation, for example,
cycloheximide at a final concentration of 1 .mu.g/ml. Magnesium
ion, for example, MgCl.sub.2, at a concentration of about 5 mM also
can be added to maintain the mRNA-80S ribosome-nascent polypeptide
complexes (polysomes).
[0131] For determining the optimal in vitro translation conditions,
translation of mRNA in an in vitro system can be monitored, for
example, by mass spectrometric analysis. Alternatively, a labeled
amino acid such as .sup.35S-methionine can be included in the
translation reaction together with an amino acid mixture lacking
this specific amino acid (e.g., methionine). A labeled
non-radioactive amino acid also can be incorporated into a nascent
polypeptide. For example, the translation reaction can contain a
mis-aminoacylated tRNA (U.S. Pat. No. 5,643,722). For example, a
non-radioactive marker can be mis-aminoacylated to a tRNA molecule
and the tRNA amino acid complex is added to the translation system.
The system is incubated to incorporate the non-radioactive marker
into the nascent polypeptide and polypeptides containing the marker
can be detected using a detection method appropriate for the
marker. Mis-aminoacylation of a tRNA molecule also can be used to
add a marker to the polypeptide in order to facilitate isolation of
the polypeptide. Such markers include, for example, biotin,
streptavidin and derivatives thereof (see U.S. Pat. No. 5,643,722).
The translation process can also be followed by mass spectrometric
analysis, which does not require the use of radioactivity or other
label.
[0132] In vitro transcription and translation reactions can be
performed simultaneously using, for example, a commercially
available system such as the Coupled Transcription/Translation
System (Promega Corp, catalog # L4606, #4610 or # 4950). Coupled
transcription and translation systems using RNA polymerases and
eukaryotic lysates are described in U.S. Pat. No. 5,324,637.
Coupled in vitro transcription and translation also can be carried
out using a prokaryotic system such as a bacterial system, for
example, E. coli S30 cell-free extracts (Zubay, Ann. Rev. Genet.
7:267 (1973)). Although such prokaryotic systems allow coupled in
vitro transcription and translation, they also can be used for in
vitro translation only. When using a prokaryotic translation
system, the RNA should contain sequence elements necessary for
translation of an RNA in a prokaryotic system. For example, the RNA
should contain prokaryotic ribosome binding sites, which can be
incorporated into a target nucleic acid sequence during
amplification using a primer containing the prokaryotic ribosome
binding sequence. The ribosome binding sequence is positioned
downstream of a promoter for use in in vitro transcription.
[0133] Cellular translation systems can be prepared as follows.
Cells are permeabilized by incubation for a short period of time in
a solution containing low concentrations of detergents in a
hypotonic media. Useful detergents include Nonidet-P 40 (NP40),
Triton X-100 (TX-100) or deoxycholate at concentrations of about
0.01 nM to 1.0 mM, generally between about 0.1 .mu.M to about 0.01
mM, particularly about 1 .mu.M. Such systems can be formed from
intact cells in culture, including bacterial cells, primary cells,
immortalized cell lines, human cells or mixed cell populations.
[0134] A target polypeptide can be obtained from a host cell
transformed with and expressing a nucleic acid encoding the target
polypeptide. The target nucleic acid can be amplified, for example,
by PCR, inserted into an expression vector, and the expression
vector introduced into a host cell suitable for expressing the
polypeptide encoded by the target nucleic acid. Host cells can be
eukaryotic cells, particularly mammalian cells such as human cells,
or prokaryotic cells, including, for example, E. coli. Eukaryotic
and prokaryotic expression vectors are well known in the art and
can be obtained from commercial sources. Following expression in
the host cell, the target polypeptide can be isolated using methods
as disclosed herein. For example, if the target polypeptide is
fused to a His-6 peptide, the target polypeptide can be purified by
affinity chromatography on a chelated nickel ion column.
AMPLIFICATION OF THE TARGET NUCLEIC ACID SEQUENCE
[0135] At least a portion of a target nucleic acid can be amplified
prior to obtaining the target polypeptide encoded by the nucleic
acid. PCR, for example, can be performed prior to in vitro
transcription and translation of a target nucleic acid.
Amplification processes include the polymerase chain reaction
(Newton and Graham, "PCR" (BIOS Publ. 1994)); nucleic acid sequence
based amplification; transcription-based amplification system,
self-sustained sequence replication; Q-beta replicase based
amplification; ligation amplification reaction; ligase chain
reaction (Wiedmann et al., PCR Meth. Appl. 3:57-64 (1994); Barany,
Proc. Natl. Acad. Sci., USA. 88, 189-93 (1991)); strand
displacement amplification (Walker et al., Nucl. Acids Res.
22:2670-77 (1994)); and variations of these methods, including, for
example, reverse transcription PCR (RT-PCR; Higuchi et al.,
Bio/Technology 11:1026-1030 (1993)), and allele-specific
amplification.
[0136] Where a nucleotide sequence of the target nucleic acid is
amplified by PCR, well known reaction conditions are used. The
minimal components of an amplification reaction include a template
DNA molecule; a forward primer and a reverse primer, each of which
is capable of hybridizing to the template DNA molecule or a
nucleotide sequence linked thereto; each of the four different
nucleoside triphosphates or appropriate analogs thereof; an agent
for polymerization such as DNA polymerase; and a buffer having the
appropriate pH, ionic strength, cofactors, and the like. Generally,
about 25 to 30 amplification cycles, each including a denaturation
step, an annealing step and an extension step, are performed, but
fewer cycles can be sufficient or more cycles can be required
depending, for example, on the amount of the template DNA molecules
present in the reaction. Examples of PCR reaction conditions are
described in U.S. Pat. No. 5,604,099.
[0137] A nucleic acid sequence can be amplified using PCR as
described in U.S. Pat. No. 5,545,539, which provides an improvement
of the basic procedure for amplifying a target nucleotide sequence
by including an effective amount of a glycine-based osmolyte in the
amplification reaction mixture. The use of a glycine-based osmolyte
improves amplification of sequences rich in G and C residues and,
therefore, can be useful, for example, to amplify trinucleotide
repeat sequences such as those associated with Fragile X syndrome
(CGG repeats) and myotonic dystrophy (CTG repeats).
[0138] A primer can be prepared from a naturally occurring nucleic
acid, for example, by purification from a restriction digest of the
nucleic acid, or can be produced synthetically. A primer is capable
of acting as a point of initiation of nucleic acid synthesis when
placed under conditions sufficient for synthesis of a primer
extension product. Particularly useful primers can hybridize
specifically to the target sequence or to sequences adjacent to the
target sequence.
[0139] Any specific nucleic acid sequence can be amplified by PCR.
It is only necessary that a sufficient number of bases at the ends
of the target sequence or in the target sequence be known so as to
allow preparation of two oligonucleotide primers that can hybridize
to the termini of the sequence to be amplified and its complement,
at relative positions along each sequence such that an extension
product synthesized from one primer, when it is separated from its
template (complement), can serve as a template for extension from
the other primer into a nucleic acid of defined length. The greater
the knowledge about the bases at both ends of the sequence, the
greater can be the specificity of the primers for the target
nucleic acid sequence and, therefore, the greater the efficiency of
the amplification process. If desired, however, a primer specific
for one end of the target nucleic acid can be used and a second
primer, based on a known sequence linked to the opposite terminus
of the target nucleic acid, can be used for amplification of the
complementary strand.
[0140] A primer must be sufficiently long to prime the synthesis of
extension products in the presence of the agent for polymerization.
The exact length of a primer will depend on many factors, including
the temperature at which hybridization and primer extension are to
be performed; the composition of the primer; and the method used.
Depending on the complexity of the target sequence, a primer
generally contains about 9 to about 25 nucleotides, although it can
contain more nucleotides. As compared to longer primers, shorter
primers generally require lower temperatures to form sufficiently
stable hybrid complexes with a template nucleic acid (see Sambrook
et al., Molecular Cloning: A laboratory manual (Cold Spring Harbor
Laboratory Press 1989).
[0141] Primers as disclosed herein are selected to be substantially
complementary to the different strands of each specific sequence to
be amplified. As such, the primers can hybridize specifically with
their respective complementary strands under defined hybridization
conditions. A primer sequence need not reflect the exact sequence
of the template. For example, a non-complementary nucleotide
fragment can be attached to the 5' end of the primer, with the
remainder of the primer sequence being complementary to the
template strand. Primers generally should have exact
complementarity with a sequence from the target nucleic acid, or
complement thereof, so that optimal amplification can be
obtained.
[0142] A forward or the reverse primer can contain, if desired, a
nucleotide sequence of a promoter, for example, a bacteriophage
promoter such as an SP6, T3 or T7 promoter. Amplification of a
target nucleic sequence using such a primer produces an amplified
target nucleic acid operably linked to the promoter. Such a nucleic
acid can be used in an in vitro transcription reaction to
transcribe the amplified target nucleic acid sequence. Nucleotide
sequences of the SP6, T3 and T7 promoter are set forth below:
1 SP6 promoter sequences: 5' d(CATACGATTTAGGTGACACTATAG)3' SEQ ID
NO: 1; 5' d(ATTTAGGTGACACTATAG)3' SEQ ID NO: 2; T3 promoter
sequence: 5' d(ATTAACCCTCACTAAAGGGA)3' SEQ ID NO: 3; and T7
promoter sequence: 5' d(TAATACGACTCACTATAGGG)3' SEQ ID NO: 4.
[0143] A primer, which can contain a promoter, also can contain an
initiation (ATG) codon, or complement thereof, as appropriate,
located downstream of the promoter, such that amplification of the
target nucleic acid results in an amplified target sequence
containing an ATG codon in frame with the desired reading frame.
The reading frame can be the natural reading frame or can be any
other reading frame. Where the target polypeptide does not exist
naturally, operably linking an initiation codon to the nucleic acid
encoding the target polypeptide allows translation of the target
polypeptide in the desired reading frame.
[0144] A forward or reverse primer also can contain a nucleotide
sequence, or the complement of a nucleotide sequence (if present in
the reverse primer), encoding a second polypeptide. The second
polypeptide can be a tag peptide, which interacts specifically with
a particular reagent, for example, an antibody. A second
polypeptide also can have an unblocked and reactive amino terminus
or carboxyl terminus.
[0145] The fusion of a tag peptide to a target polypeptide or other
polypeptide of interest allows the detection and isolation of the
polypeptide. A target polypeptide encoded by a target nucleic acid
fused to a sequence encoding a tag peptide can be isolated from an
in vitro translation reaction mixture using a reagent that
interacts specifically with the tag peptide, then the isolated
target polypeptide can be subjected to mass spectrometry, as
disclosed herein. It should be recognized that an isolated target
polypeptide fused to a tag peptide or other second polypeptide is
in a sufficiently purified form to allow mass spectrometric
analysis, since the mass of the tag peptide will be known and can
be considered in the determination.
[0146] Numerous tag peptides and the nucleic acid sequences
encoding such tag peptides, generally contained in a plasmid, are
known and are commercially available (e.g., NOVAGEN). Any peptide
can be used as a tag, provided a reagent such as an antibody that
interacts specifically with the tag peptide is available or can be
prepared and identified. Frequently used tag peptides include a myc
epitope, which includes a 10 amino acid sequence from c-myc (see
Ellison et al., J. Biol. Chem. 266:21150-2111 57 (1991)); the pFLAG
system (International Biotechnologies, Inc.); the pEZZ-protein A
system (Pharmacia); a 16 amino acid peptide portion of the
Haemophilus influenza hemagglutinin protein; a
glutathione-S-transferase (GST) protein; and a His-6 peptide.
Reagents that interact specifically with a tag peptide also are
known, and some are commercially available and include antibodies
and various other molecules, depending on the tag, for example,
metal ions such as nickel or cobalt ions, which interact
specifically with a polyhistidine peptide such as His-6; or
glutathione, which can be conjugated to a solid support such as
agarose and interacts specifically with GST.
[0147] A second polypeptide also can be designed to serve as a mass
modifier of the target polypeptide encoded by the target nucleic
acid. Accordingly, a target polypeptide can be mass modified by
translating an RNA molecule encoding the target polypeptide
operably linked to a mass modifying amino acid sequence, where the
mass modifying sequence can be at the amino terminus or the
carboxyl terminus of the fusion polypeptide. Modification of the
mass of the polypeptide derived from the target nucleic acid is
useful, for example, when several peptides are analyzed in a single
mass spectrometric analysis, since mass modification can increase
resolution of a mass spectrum and allow for analysis of two or more
different target polypeptides by multiplexing.
[0148] A mass modification includes modifications such as, but not
limited to, addition of a peptide or polypeptide fragment to the
target polypeptide. For example, a target polypeptide can be mass
modified by translating the target polypeptide to include
additional amino acids, such as polyhistidine, polylysine or
polyarginine. These modifications serve not only to aid in mass
spectrometric analyses, but also can aid in purification,
identification, immobilization. The modifications can be added
post-translationally or can be included in the nucleic acid that
encodes the resulting polypeptide.
[0149] In addition, where a plurality of target polypeptides is to
be differentially mass modified, each target polypeptide in the
plurality can be mass modified using a different polyhistidine
sequence, for example, His-4, His-5, His-6, and so on. The use of
such a mass modifying moiety provides the further advantage that
the moiety acts as a tag peptide, which can be useful, for example,
for isolating the target polypeptide attached thereto.
[0150] An advantage of the above processes is that they permit
multiplexing to be performed on a plurality of polypeptides, and,
therefore, are useful for determining the amino acid sequences of
each of a plurality of polypeptides, particularly a plurality of
target polypeptides.
[0151] More than one target nucleic acid can be amplified in the
same reaction using several pairs of primers, each pair of which
amplifies a different target nucleic acid sequence in a mixture of
starting nucleic acids. Amplification can be performed
simultaneously, provided the annealing temperature of all the
primer pairs is sufficiently similar, or can be performed
sequentially, starting with a first pair of primers having the
lowest annealing temperature of several pairs of primers, then,
after amplifying the first target nucleic acid, adding a second
pair of primers having a higher annealing temperature and
performing the second amplification at the higher temperature, and
so on. Individual reactions with different primer pairs also can be
performed, then the reaction products can be pooled. Using such
methods provide a means for simultaneously determining the identity
of more than one allelic variant of one or more polymorphic regions
of one or more genes or genetic lesion.
[0152] A primer, for example, the forward primer, also can contain
regulatory sequence elements necessary for translation of an RNA in
a prokaryotic or eukaryotic system. In particular, where it is
desirable to perform a translation reaction in a prokaryotic
translation system, a primer can contain a prokaryotic ribosome
binding sequence (Shine-Dalgarno sequence) located downstream of a
promoter sequence and about 5 to 10 nucleotides upstream of the
initiation codon. A prokaryotic ribosome binding sequence, for
example, can have the nucleotide sequence, TAAGGAGG (SEQ ID NO:
5).
[0153] A primer, generally the reverse primer, also can contain a
sequence encoding a STOP codon in one or more of the reading
frames, to assure proper termination of the target polypeptide.
Further, by incorporating into the reverse primer sequences
encoding three STOP codons, one into each of the three possible
reading frames, optionally separated by several residues,
additional mutations that occur downstream (3') of a mutation that
otherwise results in premature termination of a polypeptide can be
detected.
[0154] For preparing the primers for the amplification process, the
nucleotide sequences of numerous target nucleic acids can be
obtained from GenBank, or from relevant journal articles, patents
or published patent applications. Oligonucleotide primers can be
prepared using any suitable method, including, for example, organic
synthesis of a nucleic acid from nucleoside derivatives, and can be
performed in solution or on a solid support. The phosphotriester
method, for example, has been utilized to prepare gene fragments or
short genes. In the phosphotriester method, oligonucleotides are
prepared, then joined together to form longer nucleic acids (see
Narang et al., Meth. Enzymol. 68:90 (1979); U.S. Pat. No.
4,356,270). Primers also can be synthesized as described in U.S.
Pat. No. 5,547,835; U.S. Pat. No. 5,605,798 or U.S. Pat. No.
5,622,824.
[0155] Primers for amplification are selected such that the
amplification reaction produces a nucleic acid that, upon
transcription and translation, can result in a non-naturally
occurring polypeptide, for example, a polypeptide encoded by an
open reading frame that is not the open reading frame encoding the
natural polypeptide. Accordingly, by appropriate primer design, in
particular, by including an initiation codon in the desired reading
frame and, if present, downstream of a promoter in the primer, a
polypeptide produced from a target nucleic acid can be encoded by
one of the two non-coding frames of the nucleic acid. Such a method
can be used to shift out of frame STOP codons, which prematurely
truncate the protein and exclude relevant amino acids, or to make a
polypeptide containing an amino acid repeat more soluble.
[0156] A non-naturally occurring target polypeptide also can be
encoded by a 5' or 3' non-coding region of an exonic region of a
nucleic acid; by an intron; or by a regulatory element such as a
promoter sequence that contains, in one of the six frames (3 frames
per strand), at least a portion of an open reading frame. In these
situations, one primer for amplification of the target nucleic acid
contains a promoter and an initiation codon, such that the
amplified nucleic acid can be transcribed and translated in vitro.
Thus, a method for determining the identity of a target
polypeptide, as disclosed herein, permits the determination of the
identity of a nucleotide sequence located in any region of a
chromosome, provided a polypeptide of at least 2 amino acids,
generally at least 3 or 4 amino acids, particularly at least 5
amino acids, is encoded by one of the six frames of the
polynucleotide.
IMMOBILIZATION OF A POLYPEPTIDE TO A SOLID SUPPORT
[0157] For mass spectrometric analyses, a target polypeptide or
other polypeptide of interest can be conjugated and immobilized to
a solid support in order to facilitate manipulation of the
polypeptide. Such supports are well known to those of skill in the
art, and include any matrix used as a solid support for linking
proteins. The support is selected to be impervious to the
conditions of mass spectrometric analyses. Supports, which can have
a flat surface or a surface with structures, include, but are not
limited to, beads such as silica gel beads, controlled pore glass
beads, magnetic beads, Dynabeads, Wang resin; Merrifield resin,
SEPHADEX/SEPHAROSE beads or cellulose beads; capillaries; flat
supports such as glass fiber filters, glass surfaces, metal
surfaces (including steel, gold silver, aluminum, silicon and
copper), plastic materials (including multiwell plates or membranes
(formed, for example, of polyethylene, polypropylene, polyamide,
polyvinylidene difluoride), wafers, combs, pins or needles
(including arrays of pins suitable for combinatorial synthesis or
analysis) or beads in an array of pits; wells, particularly
nanoliter wells, in flat surfaces, including wafers such as silicon
wafers; and wafers with pits, with or without filter bottoms. A
solid support is appropriately functionalized for conjugation of
the polypeptide and can be of any suitable shape appropriate for
the support.
[0158] A solid support, such as a bead, can be functionalized for
the immobilization of polypeptides, and the bead can be further
associated with a solid support, if desired. Where a bead is to be
conjugated to a second solid support, polypeptides can be
immobilized on the functionalized support before, during or after
the bead is conjugated to the second support.
[0159] A polypeptide of interest can be conjugated directly to a
solid support or can be conjugated indirectly through a functional
group present either on the support, or a linker attached to the
support, or the polypeptide or both. For example, a polypeptide can
be immobilized to a solid support due to a hydrophobic, hydrophilic
or ionic interaction between the support and the polypeptide.
Although such a method can be useful for certain manipulations such
as for conditioning of the polypeptide prior to mass spectrometry,
such a direct interaction is limited in that the orientation of the
polypeptide is not known and can be random based on the position of
the interacting amino acids, for example, hydrophobic amino acids,
in the polypeptide. Thus, a polypeptide generally is immobilized in
a defined orientation by conjugation through a functional group on
either the solid support or the polypeptide or both.
[0160] A polypeptide of interest can be modified by adding an
appropriate functional group to the carboxyl terminus or amino
terminus of the polypeptide, or to an amino acid in the peptide,
for example, to a reactive side chain, or to the peptide backbone.
It should be recognized, however, that a naturally occurring amino
acid normally present in the polypeptide also can contain a
functional group suitable for conjugating the polypeptide to the
solid support. For example, a cysteine residue present in the
polypeptide can be used to conjugate the polypeptide to a support
containing a sulfhydryl group, for example, a support having
cysteine residues attached thereto, through a disulfide linkage.
Other bonds that can be formed between two amino acids, include,
for example, monosulfide bonds between two lanthionine residues,
which are non-naturally occurring amino acids that can be
incorporated into a polypeptide; a lactam bond formed by a
transamidation reaction between the side chains of an acidic amino
acid and a basic amino acid, such as between the y-carboxyl group
of Glu (or .beta.-carboxyl group of Asp) and the .epsilon.-amino
group of Lys; or a lactone bond produced, for example, by a
crosslink between the hydroxy group of Ser and the .gamma.-carboxyl
group of Glu (or .beta.-carboxyl group of Asp). Thus, a solid
support can be modified to contain a desired amino acid residue,
for example, a Glu residue, and a polypeptide having a Ser residue,
particularly a Ser residue at the carboxyl terminus or amino
terminus, can be conjugated to the solid support through the
formation of a lactone bond. It should be recognized, however, that
the support need not be modified to contain the particular amino
acid, for example, Glu, where it is desired to form a lactone-like
bond with a Ser in the polypeptide, but can be modified, instead,
to contain an accessible carboxyl group, thus providing a function
corresponding to the .gamma.-carboxyl group of Glu.
[0161] A polypeptide of interest also can be modified to facilitate
conjugation to a solid support, for example, by incorporating a
chemical or physical moiety at an appropriate position in the
polypeptide, generally the C-terminus or N-terminus. The artisan
will recognize, however, that such a modification, for example, the
incorporation of a biotin moiety, can affect the ability of a
particular reagent to interact specifically with the polypeptide
and, accordingly, will consider this factor, if relevant, in
selecting how best to modify a polypeptide of interest.
[0162] In one aspect of the processes provided herein, a
polypeptide of interest can be covalently conjugated to a solid
support and the immobilized polypeptide can be used to capture a
target polypeptide, which binds to the immobilized polypeptide. The
target polypeptide then can be released from immobilized
polypeptide by ionization or volatization for mass spectrometry,
whereas the covalently conjugated polypeptide remains bound to the
support.
[0163] Accordingly, a method to determine the identity of
polypeptides that interact specifically with a polypeptide of
interest is provided. For example, such a process can be used to
determine the identity of target polypeptides obtained from one or
more biological samples that interact specifically with the
immobilized polypeptide of interest. Such a process also can be
used, for example, to determine the identity of binding proteins
such as antibodies that bind to the immobilized polypeptide antigen
of interest, or receptors that bind to an immobilized polypeptide
ligand of interest, or the like. Such a process can be useful, for
example, for screening a combinatorial library of modified target
polypeptides such as modified antibodies, antigens, receptors,
hormones, or other polypeptides to determine the identity of those
target polypeptides that interact specifically with the immobilized
polypeptide.
[0164] In one aspect of the processes provided herein, a
polypeptide of interest can be covalently conjugated to a solid
support and the immobilized polypeptide can be used to capture a
target polypeptide, which binds to the immobilized polypeptide. The
target polypeptide then can be released from immobilized
polypeptide by ionization or volatization for mass spectrometry,
whereas the covalently conjugated polypeptide remains bound to the
support.
[0165] Accordingly, a process is provided to determine the identity
of polypeptides that interact specifically with a polypeptide of
interest. For example, such a process can be used to determine the
identity of target polypeptides obtained from one or more
biological samples that interact specifically with the immobilized
polypeptide of interest. Such a process also can be used, for
example, to determine the identity of binding proteins such as
antibodies that bind to the immobilized polypeptide antigen of
interest, or receptors that bind to an immobilized polypeptide
ligand of interest, or the like. Such a process can be useful, for
example, for screening a combinatorial library of modified target
polypeptides such as modified antibodies, antigens, receptors,
hormones, or other polypeptides to determine the identity of those
target polypeptides that interact specifically with the immobilized
polypeptide.
[0166] A polypeptide of interest can be conjugated to a solid
support, which can be selected based on advantages that can be
provided. Conjugation of a polypeptide to a support, for example,
provides the advantage that a support has a relatively large
surface area for immobilization of polypeptides. A support, such as
a bead, can have any three dimensional structure, including a
surface to which a polypeptide, functional group, or other molecule
can be attached. If desired, a support, such as a bead, can have
the additional characteristic that it can be conjugated further to
a different solid support, for example, to the walls of a capillary
tube. A support useful for the disclosed processes or kits
generally has a size in the range of about 1 to about 100 .mu.m in
diameter; can be made of any insoluble or solid material, as
disclosed above; and can be a swellable bead, for example, a
polymeric bead such as Wang resin, or a non-swellable bead such as
a controlled pore glass.
[0167] A solid surface also can be modified to facilitate
conjugation of a polypeptide of interest. A thiol-reactive
functionality is particularly useful for conjugating a polypeptide
to a solid support. A thiol-reactive functionality is a chemical
group that can rapidly react with a nucleophilic thiol moiety to
produce a covalent bond, for example, a disulfide bond or a
thioether bond. In general, thiol groups are good nucleophiles and,
therefore, thiol-reactive functionalities generally are reactive
electrophiles. A variety of thiol-reactive functionalities are
known in the art, including, for example, haloacetyls such as
iodoacetyl; diazoketones; epoxy ketones, .alpha.- and
.beta.-unsaturated carbonyls such as .alpha.-enones and
.beta.-enones; and other reactive Michael acceptors such as
maleimide; acid halides; benzyl halides; and the like. A free thiol
group of a disulfide, for example, can react with a free thiol
group by disulfide bond formation, including by disulfide exchange.
Reaction of a thiol group can be temporarily prevented by blocking
with an appropriate protecting group, as is conventional in the art
(see Greene and Wuts "Protective Groups in Organic Synthesis" 2nd
ed. (John Wiley & Sons 1991)).
[0168] Reducing agents that are useful for reducing a polypeptide
containing a disulfide bond include tris-(2-carboxyethyl)phosphine
(TCEP), which generally is used in a concentration of about 1 to
100 mM, usually about 10 mM, and is reacted at a pH of about 3 to
6, usually about pH 4.5, a temperature of about 20 to 45.degree.
C., usually about 37.degree. C., for about 1 to 10 hours, usually
about 5 hours); dithiothreitol, which generally is used in a
concentration of about 25 to 100 mM, and is reacted at a pH of
about 6 to 10, usually about pH 8, a temperature of about 25 to
45.degree. C., usually about 37.degree. C., for about 1 to 10
hours, usually about 5 hours. TCE provides an advantage in that it
is reactive at a low pH, which effectively protonates thiols, thus
suppressing nucleophilic reactions of thiols and resulting in fewer
side reactions than with other disulfide reducing agents.
[0169] A thiol-reactive functionality such as
3-mercaptopropyltriethoxysil- ane can be used to functionalize a
silicon surface with thiol groups. The amino functionalized silicon
surface then can be reacted with a heterobifunctional reagent such
as N-succinimidyl (4-iodacetyl) aminobenzoate (SIAB) (Pierce;
Rockford Ill.). If desired, the thiol groups can be blocked with a
photocleavable protecting group, which then can be selectively
cleaved, for example, by photolithography, to provide portions of a
surface activated for immobilization of a polypeptide of interest.
Photocleavable protecting groups are known in the art (see, for
example, published International PCT application No. WO 92/10092;
McCray et al., Ann. Rev. Biophys. Biophys. Chem. 18:239-270 (1989))
and can be selectively deblocked by irradiation of selected areas
of the surface using, for example, a photolithography mask.
LINKERS
[0170] As noted herein, the polypeptide can be linked either
directly to the support or via a linking moiety or moieties. Any
linkers known to those of skill in the art to be suitable for
linking peptides or amino acids to supports, either directly or via
a spacer, may be used. Linkers, include, Rink amide linkers (see,
e.g. Rink (1976) Tetrahedron Letteis 28:3787), trityl chloride
linkers (see, e.g., Leznoff (1978) Ace. Chem. Res. 11:327),
Merrifield linkers (see, e.g., Bodansky et al. (1976) Peptide
Synthesis, Academic Press, 2nd edition, New York). For example,
trityl linkers are known (see, e.g., U.S. Pat. No. 5,410,068 and
U.S. Pat. No. 5,61 2,474). Amino trityl linkers (see, FIG. 3) are
also known (see, e.g., U.S. Pat. No. 5,198,531). Linkers that are
suitable for chemically linking peptides to supports, include
disulfide bonds, thioether bonds, hindered disulfide bonds, and
covalent bonds between free reactive groups, such as amine and
thiol groups. These bonds can be produced using heterobifunctional
reagents to produce reactive thiol groups on one or both of the
polypeptides and then reacting the thiol groups on one polypeptide
with reactive thiol groups or amine groups on the other. Other
linkers include, acid cleavable linkers, such as bismaleimideothoxy
propane, acid labile-transferrin conjugates and adipic acid
diihydrazide, that would be cleaved in more acidic intracellular
compartments; photocleavable cross linkers that are cleaved by
visible or UV light, RNA linkers that are cleavable by ribozymes
and other RNA enzymes, and linkers, such as the various domains,
such as C.sub.H1, C.sub.H2, and C.sub.H3, from the constant region
of human IgG.sub.1 (see, Batra et al. (1993) Molecular Immunol.
30:379-386).
[0171] Any linker known to one skilled in the art for immobilizing
a polypeptide to a solid support can be used in a process as
disclosed herein. Combinations of any linkers are also contemplated
herein. For example, a linker that is cleavable under mass
spectrometric conditions, such as a silyl linkage or photocleavable
linkage, can be combined with a linker, such as an avidin biotin
linkage, that is not cleaved under these conditions, but may be
cleaved under other conditions.
[0172] A polypeptide of interest can be attached directly to a
support via a linker. For example, the polypeptide can be
conjugated to a support, such as a bead, through means of a
variable spacer. In addition, the conjugation can be directly
cleavable, for example, through a photocleavable linkage such as a
streptavidin or avidin to biotin interaction, which can be cleaved
by a laser as occurs for mass spectrometry, or indirectly through a
photocleavable linker (see U.S. Pat. No. 5,643,722) or an acid
labile linker, heat sensitive linker, enzymatically cleavable
linker or other such linker.
[0173] A linker can provide a reversible linkage such that it is
cleaved under the conditions of mass spectrometry. Such a linker
can be, for example, a photo-cleavable bond such as a charge
transfer complex or a labile bond formed between relatively stable
organic radicals. A linker (L) on a polypeptide can form a linkage,
which generally is a temporary linkage, with a second functional
group (L') on the solid support. Furthermore, where the polypeptide
of interest has a net negative charge, or is conditioned to have
such a charge, the linkage can be formed with L' being, for
example, a quaternary ammonium group. In this case, the surface of
the solid support carries a negative charge that repels the
negatively charged polypeptide, thereby facilitating desorption of
the polypeptide for mass spectrometric analysis. Desorption can
occur due to the heat created by the laser pulse or, where L' is a
chromophore, by specific absorption of laser energy that is in
resonance with the chromophore.
[0174] A linkage (L-L') can be, for example, a disulfide bond,
which is chemically cleavable by mercaptoethanol or dithioerythrol;
a biotin/streptavidin linkage, which can be photocleavable; a
heterobifunctional derivative of a trityl ether group, which can be
cleaved by exposure to acidic conditions or under conditions of
mass spectrometry (Koster et al, "A Versatile Acid-Labile Linker
for Modification of Synthetic Biomolecules," Tetrahedron Lett.
31:7095 (1990)); a levulinyl-mediated linkage, which can be cleaved
under almost neutral conditions with a hydrazinium/acetate buffer;
an arginine-arginine or a lysine-lysine bond, either of which can
be cleaved by an endopeptidase such as trypsin; a pyrophosphate
bond, which can be cleaved by a pyrophosphatase; or a
ribonucleotide bond, which can be cleaved using a ribonuclease or
by exposure to alkali condition.
[0175] The functionalities, L and L', can also form a charge
transfer complex, thereby forming a temporary L-L' linkage. Since
the "charge-transfer band" can be determined by UV/vis spectrometry
(see Foster, "Organic Charge Transfer Complexes" (Academic Press
1969)), the laser energy can be tuned to the corresponding energy
of the charge-transfer wavelength and specific desorption from the
solid support can be initiated. It will be recognized that several
combinations of L and L' can serve this purpose and that the donor
functionality can be on the solid support or can be coupled to the
polypeptide to be detected or vice versa.
[0176] A reversible L-L' linkage also can be generated by
homolytically forming relatively stable radicals. Under the
influence of the laser pulse, desorption, as well as ionization,
can take place at the radical position. Various organic radicals
can be selected such that, in relation to the dissociation energy
needed to homolytically cleave the bond between the radicals, a
corresponding laser wavelength can be selected (see Wentrup,
"Reactive Molecules" (John Wiley & Sons 1984)).
[0177] Other linkers include those that can be incorporated into
fusion proteins and expressed in a host cell. Such linkers may be
selected amino acids, enzyme substrates, or any suitable peptide.
The linker may be made, for example, by appropriate selection of
primers when isolating the nucleic acid. Alternatively, they may be
added by post translational modification of the protein of
interest.
[0178] In particular, selectively cleavable linkers, including
photocleavable linkers, acid cleavable linkers, acid-labile
linkers, and heat sensitive linkers are useful. Acid cleavable
linkers include, for example, bismaleimideothoxy propane, adipic
acid dihydrazide linkers (see Fattom et al, Infect. Immun.
60:584-589 (1992)), and acid labile transferrin conjugates that
contain a sufficient portion of transferrin to permit entry into
the intracellular transferrin cycling pathway (see Welhoner et al.,
J. Biol. Chem. 266:4309-4314 (1991)).
[0179] FIG. 2 shows a preferred embodiment of a method of
orthogonal capture, cleavage and MALDI analysis of a peptide. This
embodiment demonstrates capture through the amino-terminus of the
peptide. As shown, the peptide is captured onto a surface of a
support through the use of a diisopropylysilyl diether group. Other
silyl diether groups, including, but not limited to, dialkylsilyl,
diarylsilyl and alkylarylsilyl, may also be used. Reaction of a
hydroxylated support surface with duiisopropylsilyl dichloride and
a hydroxyester provides the starting surface-bound
diisopropylysilyl diether ester.
[0180] With reference to the FIGURE, R.sup.3 is any attachment
moiety, resulting from a support that has been derivatized for
linkage, with a derivatizing group that has a hydroxyl group
available for reaction. R.sup.3 also can be a linkage, such as
biotin-streptavidin or biotin-avidin. R.sup.3 includes groups such
as polyethylene glycol (PEG), an alkylene or arylene group.
[0181] The hydroxylated support surface may be prepared by methods
that are well-known to those of skill in the art. For example,
N-succinimidyl(4-iodacetyl) aminobenzoate (SIAB). Other agents as
linkers (R.sup.3) include, but are not limited to, dimaleimide,
dithio-bis-nitrobenzoic acid (DTNB),
N-succinimidyl-S-acetyl-thioacetate (SATA),
N-succinimidyl-3-(2-pyridyldithiol propionate (SPDP), succinimidyl
4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) ad
6-hydrazinonicotimide (HYNIC) may also be used in the novel
process. For further examples of cross-linking reagents, see, eg.,
Wong "Chemistry of Protein Conjugation and Cross-Linking," CRC
Press (1991), and Hermanson, "Bioconiugate Techniques" Academic
Press (1995). Hydroxyesters that may be used include, but are not
limited to, hydroxyacetate (glycolate), .alpha.-, .beta.-,
.gamma.-, . . . , .omega.-hydroxylakanotates,
.omega.-hydroxy(polyethyleneglycol)COOH, hydroxybenzoates,
hydroxyarylalkanoates and hydroxyalkylbenzoates. Thus, with
reference to FIG. 2, R.sup.4 may be any divalent group that is 2 or
more bonds in length, such as (CH.sub.2).sub.n, where n is 2 or
more, and polyethylene glycol. The derivatized support is then
reacted with the desired peptide to capture the peptide on the
support with loss of R.sup.1OH. The peptide may be reacted directly
with the ester group in embodiments where COOR.sup.1 is an active
ester group. In these preferred embodiments, R.sup.1 is selected
from groups such as, but not limited to, N-succinimidyl, sodium
3-sulfo-N-succinimidyl and 4-nitrophenyl. In other embodiments, the
ester is saponified, e.g., with hydroxide, to provide the
corresponding acid. This acid is then coupled with the
amino-terminus of the peptide under standard peptide coupling
conditions (eq., 1-(3-dimethylaminopropyl-3-ethylcarbodiimide
hydrochloride (EDC) and N-hydroxysuccinimide (NHS)). The captured
peptide is then truncated (fragmented) by reaction with an enzyme
or reagent specific for a given amide bond of the peptide. Cleavage
of the truncated peptide, containing an N-terminal fragment of the
original peptide, from the support is then accomplished by reaction
with mild acid. Acids suitable for this cleavage include, but are
not limited to, acetic acid, trifluoroacetic acid,
para-toluenesulfonic acid and mineral acids. A preferred acid is
3-hydroxypicolinic acid, which is also a suitable matrix for the
subsequent MALDI analysis.
[0182] FIG. 3 illustrates other preferred linkers and capture
strategies for MALDI analysis of peptides. As shown, the peptide
may be captured through the carboxy terminus by employing an
amino-derivatized support. The starting amino-derivatized support
may be prepared by reacting a hydroxylated support surface with
diisopropylysilyl dichloride and an aminoalcohol. Aminoalcohols
that may be used include, but are not limited to, .alpha.-,
.beta.-, .gamma.-, . . . , .omega.-aminoalkanols,
.omega.-hydroxy(polythyleneglycol)NH.sub.2, hydroxyanilines,
hydroxyarylalkylamines and hydroxyalkylanilined. Thus, with
reference to FIG. 3, R.sup.4 may be any divalent group that is 2 or
more bonds in length. Capture of the peptide by the
amino-derivatized support is achieved by dehydrative coupling of
the peptide with the amino group. Such peptide coupling conditions
are well-known to those of skill in the art. Illustrated is one set
of conditions for capture of the peptide (i.e.,
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC)
and N-hydroxysuccinimide (NHS)). The captured peptide may then be
truncated, cleaved from the support, and analyzed as shown in FIG.
2.
[0183] Also illustrated in FIG. 3 are other linkers useful in
capturing peptides on supports for MALDI analysis. For example,
trityl-containing linkers, functionalized with either ester or
amino moieties, may be used to capture peptides at the amino or
carboxy terminus, respectively. Other linkers known to those of
skill in art, e.g., photocleavable linkers, are also available for
use in capturing the peptides on the support surface.
Photocleavable Linkers
[0184] Photocleavable linkers are provided. The linkers contain
o-nitrobenzyl moieties and phosphate linkages, which allow for
complete photolytic cleavage of the conjugates within minutes upon
UV irradiation. The UV wavelengths used are selected so that the
irradiation will not damage the polypeptides and generally are
about 350 to 380 nm, usually about 365 nm.
[0185] A photocleavable linker can have the general structure of
formula I: 1
[0186] where R.sup.20 is w-(4,4'-dimethoxytrityloxy)alkyl or
.omega.-hydroxyalkyl; R.sup.21 is selected from hydrogen, alkyl,
aryl, alkoxycarbonyl, aryloxycarbonyl and carboxy; R.sup.22 is
hydrogen or (dialkylamino)(.omega.-cyanoalkoxy)P--; t is 0-3; and
R.sup.50 is alkyl, alkoxy, aryl or aryloxy.
[0187] A photocleavable linker also can have the formula II: 2
[0188] where R.sup.20 is .omega.-(4,4'-dimethoxytrityloxy)alkyl,
.omega.-hydroxyalkyl or alkyl; R.sup.21 is selected from hydrogen,
alkyl, aryl, alkoxycarbonyl, aryloxycarbonyl and carboxy; R.sup.22
is hydrogen or (dialkylamino)(.omega.-cyanoalkoxy)P--; and X.sup.20
is hydrogen, alkyl or OR.sup.20.
[0189] In a particular photocleavable linker, R.sup.20 is
3-(4,4'-dimethoxytrityloxy)propyl, 3-hydroxypropyl or methyl;
R.sup.21 is selected from hydrogen, methyl and carboxy; R.sup.22 is
hydrogen or (diisopropylamino) (2-cyanoethoxy)P--; and X.sup.20 is
hydregen, methyl or OR.sup.20. In another photocleavable, R.sup.20
is 3-(4,4'-dimethoxytrityloxy)propyl; R.sup.21 is methyl; R.sup.22
is (diisopropylamino)(2-cyanoethoxy)P--; and X.sup.20 is hydrogen.
In still another photocleavable linker, R.sup.20 is methyl;
R.sup.21 is methyl; R.sup.22 is (diisopropylamino)
(2-cyanoethoxy)P--; and X.sup.20 is
3-(4,4'-dimethoxytrityloxy)propoxy.
[0190] A photocleavable linker also can have the general formula of
formula III: 3
[0191] where R.sup.23 is hydrogen or
(dialkylarnino)(.omega.-cyanoalkoxy)P- --; and R.sup.24 is selected
from .omega.-hydroxyalkoxy,
.omega.-(4,4'-dimethoxytrityloxy)alkoxy, .omega.-hydroxyalkyl and
.omega.-(4,4'-dimethoxytrityloxy)alkyl, and is unsubstituted or
substituted on the alkyl or alkoxy chain with one or more alkyl
groups; r and s are each independently 0-4; and R.sup.50 is alkyl,
alkoxy, aryl or aryloxy.
[0192] In particular photocleavable linkers, R.sup.24 is
.omega.-hydroxyalkyl or .omega.-(4,4'-dimethoxytrityloxy)alkyl, and
is substituted on the alkyl chain with a methyl group. In another
photocleavable linker, R.sup.23 is hydrogen or
(diisopropylamino)(2-cyano- ethoxy)P--; and R.sup.24 is selected
from 3-hydroxypropoxy, 3-(4,4'-dimethoxytrityloxy)propoxy,
4-hydiroxybutyl, 3-hydroxy-1 -propyl, 1 -hydroxy-2-propyl,
3-hydroxy-2-methyl-1-propyl, 2-hydroxyethyl, hydroxymethyl,
4-(4,4'-dimethoxytrityloxy)butyl, 3-(4,4'-dimethoxytritylo-
xy)-1-propyl, 2-(4,4'-dimethoxytrityloxy)ethyl,
1-(4,4'-dimethoxytrityloxy- )-2-propyl,
3-(4,4'-dimethoxytriyloxy)-2-methyl-1-propyl and
4,4'-dimethyoxytrityloxymethyl. In still another photocleavable
linker, R.sup.23 is (diisopropylamino)(2-cyanoethoxy)P--; r and s
are 0; and R.sup.24 is selected from
3-(4,4'-dimethoxytrityloxy)propoxy,
4-(4,4'-dimethoxytritloxy)butyl, 3-(4,4'-dimethoxytrityloxy)propyl,
2-(4,4'-dimethoxytrityloxy)ethyl,
1-(4,4'-dimethoxytrityloxy)-2-propyl,
3-(4,4'-dimethoxytriyloxy)-2-methyl-1-propyl and
4,4'-dimethyoxytrityloxy- methyl. R.sup.24 is most preferably
3-(4,4'-dimethoxytrityloxy)propoxy.
Preparation of the Photocleavable Linkers
Preparation of Photocleavable Linkers of Formulae I or II
[0193] Photocleavable linkers of formulae I or II can be prepared
by the methods described below, by minor modification of the
methods by choosing the appropriate starting materials or by any
other methods known to those of skill in the art. Detailed
procedures for the synthesis of photocleavable linkers of formula
II are provided in Examples 2 and 3.
[0194] In the photocleavable linkers of formula II, where X.sup.20
is hydrogen, the linkers can be prepared in the following manner.
Alkylation of 5-hydroxy-2-nitrobenzaldehyde with an
.omega.-hydroxyalkyl halide, for example, 3-hydroxypropyl bromide,
followed by protection of the resulting alcohol, for example, as a
silyl ether, provides a
5-(.omega.-silyloxyalkoxy)-2-nitrobenzaldehyde. Addition of an
organometallic to the aldehyde affords a benzylic alcohol.
Organometallics that can be used include trialkylaluminurns (for
linkers where R.sup.21 is alkyl) such as trimethylaluminum;
borohydrides (for linkers where R.sup.21 is hydrogen) such as
sodium borohydride; or metal cyanides (for linkers where R.sup.21
is carboxy or alkoxycarbonyl) such as potassium cyanide. In the
case of the metal cyanides, the product of the reaction, a
cyanohydrin, is hydrolyzed under either acidic or basic conditions
in the presence of either water or an alcohol to afford the
compounds of interest.
[0195] The silyl group of the side chain of the resulting benzylic
alcohols can be exchanged for a 4,4'-dimethoxytriyl group by
desilylation using, for example, tetrabutylammonium fluoride, to
give the corresponding alcohol, followed by reaction with
4,4'-dimethoxytrityl chloride. Reaction, for example, with
2-cyanoethyl diisopropylchlorophosphoramidite affords the linkers
where R.sup.22 is (dialkylamino)(.omega.-cyanoalkoxy)P--.
[0196] A specific example of a synthesis of a photocleavable linker
of formula II is shown in the following scheme, which also
demonstrates use of the linker in oligonucleotide synthesis. This
scheme is intended to be illustrative only and in no way limits the
scope of the methods herein. Experimental details of these
synthetic transformations are provided in the Examples. 4
[0197] Synthesis of the linkers of formula II, where X.sup.20 is
OR.sup.20, 3,4-dihydroxyacetophenone is protected selectively at
the 4-hydroxyl by reaction, for example, with potassium carbonate
and a silyl chloride. Benzoate esters, propiophenones,
butyrophenones, and the like can be used in place of the
acetophenone. The resulting 4-silyloxy-3-hydroxyacetophenone then
is alkylated with an alkyl halide (for linkers where R.sup.20 is
alkyl) at the 3-hydroxyl and desilylated, for example, with
tetrabutylammonium fluoride to afford a
3-alkoxy-4-hydroxyacetophenone. This compound then is alkylated at
the 4-hydroxyl by reaction with an .omega.-hydroxyalkyl halide, for
example, 3-hydroxypropyl bromide, to give a
4-(.omega.-hydroxyalkoxy)-3-alkoxy acetophenone. The side chain
alcohol is then protected as an ester, for example, an acetate.
This compound is then nitrated at the 5-position, for example, with
concentrated nitric acid to provide the corresponding
2-nitroacetophenones. Saponification of the side chain ester, for
example, with potassium carbonate, and reduction of the ketone, for
example, with sodium borohydride, in either order gives a
2-nitro-4-(.omega.-hydroxyalkoxy)-5-alkoxybenzylic alcohol.
[0198] Selective protection of the side chain alcohol as the
corresponding 4,4'-dimethoxytrityl ether is then accomplished by
reaction with 4,4'-dimethoxytrityl chloride. Further reaction, for
example, with 2-cyanoethyl diisopropylchlorophosphoramidite affords
the linkers where R.sup.22 is
(dialkylamino)(.omega.-cyanoalkoxy)P--.
[0199] A specific example of the synthesis of a photocleavable
linker of formula II is shown in the following scheme. This scheme
is intended to be illustrative only and in no way limit the scope
of the methods herein. 5
Preparation of Photocleavable Linkers of Formula III
[0200] Photocleavable linkers of formula III can be prepared by the
methods disclosed herein, by minor modification of the methods by
choosing appropriate starting materials, or by other methods known
to those of skill in the art.
[0201] In general, photocleavable linkers of formula III are
prepared from .omega.-hydroxyalkyl- or alkoxyaryl compounds, in
particular .omega.-hydroxy-alkyl or alkoxy-benzenes. These
compounds are commercially available, or may be prepared from an
.omega.-hydroxyalkyl halide, for example, 3-hydroxypropyl bromide,
and either phenyllithium (for the .omega.-hydroxyalkylbenzenes) or
phenol (for the .omega.-hydroxyalkoxybenzenes). Acylation of the
.omega.-hydroxyl group, for example, as an acetate ester, followed
by Friedel-Crafts acylation of the aromatic ring with
2-nitrobenzoyl chloride provides a 4-(.omega.-acetoxy-alkyl or
alkoxy)-2-nitro benzophenone. Reduction of the ketone, for example,
with sodium borohydride, and saponification of the side chain ester
are performed in either order to afford a
2-nitrophenyl-4-(hydroxy-alkyl or alkoxy)phenylmethanol. Protection
of the terminal hydroxyl group as the corresponding
4,4'-dimethoxytrityl ether is achieved by reaction with
4,4'-dimethoxytrityl chloride. The benzylic hydroxyl group is then
reacted, for example, with 2-cyanoethyl
diisopropylchlorophosphoramidite to afford linkers of formula II
where R.sup.23 is (dialkylamino) (.omega.-cyanoalkoxy) P--.
[0202] Other photocleavable linkers of formula III can be prepared
by substituting 2-phenyl-1-propanol or 2-phenylmethyl-1-propanol
for the .omega.-hydroxy-alkyl or alkoxy-benzenes in the above
synthesis. These compounds are commercially available, but also can
be prepared by reaction, for example, of phenylmagnesium bromide or
benzylmagnesium bromide, with the requisite oxirane (propylene
oxide) in the presence of catalytic cuprous ion.
Chemically Cleavable Linkers
[0203] A variety of chemically cleavable linkers also can be used
to link a polypeptide to a solid support. Acid-labile linkers are
particularly useful chemically cleavable linkers for mass
spectrometry, especially for MALDI-TOF, because the acid labile
bond is cleaved during conditioning of the target polypeptide upon
addition of a 3-HPA matrix solution. The acid labile bond can be
introduced as a separate linker group, for example, an acid labile
trityl group, or can be incorporated in a synthetic linker by
introducing one or more silyl bridges using diisopropylysilyl,
thereby forming a diisopropylysilyl linkage between the polypeptide
and the solid support. The diisopropylysilyl linkage can be cleaved
using mildly acidic conditions such as 1.5% trifluoroacetic acid
(TFA) or 3-HPA/1 % TFA MALDI-TOF matrix solution. Methods for the
preparation of diisopropylysilyl linkages and analogs thereof are
well known in the art (see, for example, Saha et al., J. Org. Chem.
58:7827-7831 (1993)).
[0204] As disclosed herein, a polypeptide of interest can be
conjugated to a solid support such as a bead. In addition, a first
solid support such as a bead also can be conjugated, if desired, to
a second solid support, which can be a second bead or other
support, by any suitable means, including those disclosed herein
for conjugation of a polypeptide to a support. Accordingly, any of
the conjugation methods and means disclosed herein with reference
to conjugation of a polypeptide to a solid support also can be
applied for conjugation of a first support to a second support,
where the first and second solid support can be the same or
different.
[0205] Appropriate linkers, which can be crosslinking agents, for
use for conjugating a polypeptide to a solid support include a
variety of agents that can react with a functional group present on
a surface of the support, or with the polypeptide, or both.
Reagents useful as crosslinking agents include homobifunctional
and, in particular, heterobifunctional reagents. Useful
bifunctional crosslinking agents include, but are not limited to,
N-succinimidyl(4-iodoacetyl) aminobenzoate (SIAB), dimaleimide,
dithio-bis-nitrobenzoic acid (DTNB),
N-succinimidyl-S-acetyl-thioacetate (SATA),
N-succinimidyl-3-(2-pyridyldi- thio) propionate (SPDP),
succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-c- arboxylate
(SMCC) and 6-hydrazino-nicotimide (HYNIC).
[0206] A crosslinking agent can be selected to provide a
selectively cleavable bond between a polypeptide and the solid
support. For example, a photolabile crosslinker such as
3-amino-(2-nitrophenyl)propionic acid (Brown et al., Molec. Divers.
4-12 (1995); Rothschild et al., Nucl. Acids Res. 24:351-66 (1996);
U.S. Pat. No. 5,643,722) can be employed as a means for cleaving a
polypeptide from a solid support. Other crosslinking reagents are
well known in the art (see, for example, Wong, "Chemistry of
Protein Conjugation and Cross-Linking" (CRC Press 1991); Hermanson,
supra, 1996).
[0207] A polypeptide can be immobilized on a solid support such as
a bead, through a covalent amide bond formed between a carboxyl
group functionalized bead and the amino terminus of the polypeptide
or, conversely, through a covalent amide bond formed between an
amino group functionalized bead and the carboxyl terminus of the
polypepotide.
[0208] In addition, a bifunctional trityl linker can be attached to
the support, for example, to the 4-nitrophenyl active ester on a
resin such as a Wang resin, through an amino group or a carboxyl
group on the resin via an amino resin. Using a bifunctional trityl
approach, the solid support can require treatment with a volatile
acid such as formic acid or trifluoracetic acid to ensure that the
polypeptide is cleaved and can be removed. In such a case, the
polypeptide can be deposited as a beadless patch at the bottom of a
well of a solid support or on the flat surface of a solid support.
After addition of a matrix solution, the polypeptide can be
desorbed into a mass spectrometer.
[0209] Hydrophobic trityl linkers also can be exploited as
acid-labile linkers by using a volatile acid or an appropriate
matrix solution, for example, a matrix solution containing 3-HPA,
to cleave an amino linked trityl group from the polypeptide. Acid
lability also can be changed. For example, trityl,
monomethoxytrityl, dimethoxytrityl or trimethoxytrityl can be
changed to the appropriate p-substituted, or more acid-labile
tritylamine derivatives, of the polypeptide; i.e. trityl ether and
tritylamine bonds to the can be made to the polypeptide.
Accordingly, a polypeptide can be removed from a hydrophobic
linker, for example, by disrupting the hydrophobic attraction or by
cleaving tritylether or tritylamine bonds under acidic conditions,
including, if desired, under typical mass spectrometry conditions,
where a matrix such as 3-HPA acts as an acid.
[0210] As disclosed herein, a polypeptide can be conjugated to a
solid support, for example, a bead, and the bead, either prior to,
during or after conjugation of the polypeptide, can be conjugated
to a second solid support, where one or both conjugations result in
the formation of an acid-labile bond. For example, use of a trityl
linker can provide a covalent or a hydrophobic conjugation, and,
regardless of the nature of the conjugation, the trityl group is
readily cleaved in acidic conditions. Orthogonally cleavable
linkers also can be useful for binding a first solid support, for
example, a bead to a second solid support, or for binding a
polypeptide of interest to a solid support. Using such linkers, a
first solid support, for example, a bead, can be selectively
cleaved from a second solid support, without cleaving the
polypeptide from the support; the polypeptide then can be cleaved
from the bead at a later time. For example, a disulfide linker,
which can be cleaved using a reducing agent such as DTT, can be
employed to bind a bead to a second solid support, and an acid
cleavable bifunctional trityl group could be used to immobilize a
polypeptide to the support. As desired, the linkage of the
polypeptide to the solid support can be cleaved first, for example,
leaving the linkage between the first and second support intact.
Trityl linkers can provide a covalent or hydrophobic conjugation
and, regardless of the nature of the conjugation, the trityl group
is readily cleaved in acidic conditions.
[0211] A first a solid support such as a bead can be conjugated to
a second solid support using the methods, linkages and conjugation
means disclosed herein. In addition, a bead, for example, can be
bound to a second support through a linking group, which can be
selected to have a length and a chemical nature such that high
density binding of the beads to the solid support, or high density
binding of the polypeptides to the beads, is promoted. Such a
linking group can have, for example, "tree-like" structure, thereby
providing a multiplicity of functional groups per attachment site
on a solid support. Examples of such linking groups include
polylysine, polyglutamic acid, penta-erythrole and
tris-hydroxy-aminomethane.
[0212] A polypeptide can be conjugated to a solid support, or a
first solid support also can be conjugated to a second solid
support, through a noncovalent interaction. For example, a magnetic
bead made of a ferromagnetic material, which is capable of being
magnetized, can be attracted to a magnetic solid support, and can
be released from the support by removal of the magnetic field.
Alternatively, the solid support can be provided with an ionic or
hydrophobic moiety, which can allow the interaction of an ionic or
hydrophobic moiety, respectively, with a polypeptide, for example,
a polypeptide containing an attached trityl group or with a second
solid support having hydrophobic character.
[0213] A solid support also can be provided with a member of a
specific binding pair and, therefore, can be conjugated to a
polypeptide or a second solid support containing a complementary
binding moiety. For example, a bead coated with avidin or with
streptavidin can be bound to a polypeptide having a biotin moiety
incorporated therein, or to a second solid support coated with
biotin or derivative of biotin such as imino-biotin.
[0214] It should be recognized that any of the binding members
disclosed herein or otherwise known in the art can be reversed with
respect to the examples provided herein. Thus, biotin, for example,
can be incorporated into either a polypeptide or a solid support
and, conversely, avidin or other biotin binding moiety would be
incorporated into the support or the polypeptide, respectively.
Other specific binding pairs contemplated for use herein include,
but are not limited to, hormones and their receptors, enzymes and
their substrates, a nucleotide sequence and its complementary
sequence, an antibody and the antigen to which it interacts
specifically, and other such pairs knows to those skilled in the
art.
[0215] Immobilization of one or more polypeptides of interest,
particularly target polypeptides, facilitates manipulation of the
polypeptides. For example, immobilization of the polypeptides to a
solid support facilitates isolation of the polypeptides from a
reaction, or transfer of the polypeptides during the performance of
a series of reactions. As such, immobilization of the polypeptides
can facilitate conditioning the polypeptides or mass modification
of the polypeptides prior to performing mass spectrometric
analysis.
[0216] Examples of preferred binding pairs or linker/interactions
are provided in the Table.
2TABLE LINKER/INTERACTION EXAMPLES streptavidin-biotin.sup.a,c/
biotinylated pin, avidin beads, photolabile biotin.sup.b
photolabile biotin polypeptide hydrophobic.sup.a C18-coated pin,
tritylated polypeptide magnetic.sup.a electromagnetic pin,
steptavidin magnetic beads (e.g., DYNABEADS), biotin polypeptide
acid-labile linker.sup.b glass pin, bifunctional trityl-linked DNA
amide bond(s).sup.c silicon wafer, Wang resin, amino-linked
polypeptide disulfide bond.sup.a silicon wafer, beads are bound on
the flat surface forming arrays or in arrays of nanoliter wells,
thiol beads, thiolated polypeptide photocleavable bond/
biotinylated pin/wafer, avidin beads, linker photolabile biotin
polypeptide thioether bond.sup.c silicon wafer, beads are bound on
the flat surface forming arrays or in arrays of nanoliter wells,
thiolated peptide .sup.athese interactions are reversible.
.sup.bthese non-reversible interactions are rapidly cleaved.
.sup.cunless cleavable-linkers are incorporated at some point in
the scheme, only the complement of the solid-bound DNA can be
analyzed in these schemes.
CONDITIONING A POLYPEPTIDE
[0217] Conditioning of a polypeptide prior to mass spectrometry can
increase the resolution of a mass spectrum of the polypeptide,
thereby facilitating determining the identity of a target
polypeptide. A polypeptide can be conditioned, for example, by
treating the polypeptide with a cation exchange material or an
anion exchange material, which can reduce the charge heterogeneity
of the polypeptide, thereby reducing or eliminating peak
broadening. In addition, contacting a polypeptide with an
alkylating agent such as alkyliodide, iodoacetamide, iodoethanol,
or 2,3-epoxy-1-propanol, for example, can prevent the formation of
disulfide bonds in the polypeptide, thereby increasing resolution
of a mass spectrum of the polypeptide. Likewise, charged amino acid
side chains can be converted to uncharged derivatives by contacting
the polypeptides with trialkylsilyl chlorides, thus reducing charge
heterogeneity and increasing resolution of the mass spectrum.
[0218] There are also means of improving resolution, particularly
for shorter peptides, by incorporating modified amino acids that
are more basic than the corresponding unmodified residues. Such
modification in general increases the stability of the polypeptide
during mass spectrometric analysis. Also, cation exchange
chromatography, as well as general washing and purification
procedures which remove proteins and other reaction mixture
components away from the target polypeptide, can be used to clean
up the peptide after in vitro translation and thereby increase the
resolution of the spectrum resulting from mass spectrometric
analysis of the target polypeptide.
[0219] Conditioning also can involve incorporating modified amino
acids into the polypeptide, for example, mass modified amino acids,
which can increase resolution of a mass spectrum. For example, the
incorporation of a mass modified leucine residue in a polypeptide
of interest can be useful for increasing the resolution (e.g., by
increasing the mass difference) of a leucine residue from an
isoleucine residue, thereby facilitating determination of an amino
acid sequence of the polypeptide. A modified amino acid also can be
an amino acid containing a particular blocking group, such as those
groups used in chemical methods of amino acid synthesis. For
example, the incorporation of a glutamic acid residue having a
blocking group attached to the side chain carboxyl group can mass
modify the glutamic acid residue and, provides the additional
advantage of removing a charged group from the polypeptide, thereby
further increasing resolution of a mass spectrum of a polypeptide
containing the blocked amino acid.
USE OF A PIN TOOL TO IMMOBILIZE A POLYPEPTIDE
[0220] The immobilization of a polypeptide of interest to a solid
support using a pin tool can be particularly advantageous. Pin
tools include those disclosed herein or otherwise known in the art
(see, e.g., copending U.S. application Ser. Nos. 08/786,988) and
08/787,639, and International PCT application No. WO 98/20166).
[0221] A pin tool in an array, for example, a 4.times.4 array, can
be applied to wells containing polypeptides of interest. Where the
pin tool has a functional group attached to each pin tip, or a
solid support, for example, functionalized beads or paramagnetic
beads, are attached to each pin, the polypeptides in a well can be
captured (.gtoreq.1 pmol capacity). During the capture step, the
pins can be kept in motion (vertical, 1-2 mm travel) to increase
the efficiency of the capture. Where a reaction such as an in vitro
transcription is being performed in the wells, movement of the pins
can increase efficiency of the reaction.
[0222] Polypeptides of interest, particularly target polypeptides,
are immobilized due to contact with the pin tool. Further
immobilization can result by applying an electrical field to the
pin tool. When a voltage is applied to the pin tool, the
polypeptides are attracted to the anode or the cathode, depending
on their net charge. Such a system also can be useful for isolating
the polypeptides, since uncharged molecules remain in solution and
molecules having a charge opposite to the net charge of the
polypeptides are attracted to the opposite pole (anode or cathode).
For more specificity, the pin tool (with or without voltage) can be
modified to have conjugated thereto a reagent specific for the
polypeptide of interest, such that only the polypeptides of
interest are bound by the pins. For example, the pins can have
nickel ions attached, such that only polypeptides containing a
polyhistidine sequence are bound. Similarly, the pins can have
antibodies specific for a target polypeptide attached thereto, or
to beads that, in turn, are attached to the pins, such that only
the target polypeptides, which contain the epitope recognized by
the antibody, are bound by the pins.
[0223] Different pin conformations include, for example, a solid
pin configuration, or pins with a channel or with a hole through
the center, which can accommodate an optic fiber for mass
spectrometer detection. The pin can have a flat tip or any of a
number of configurations, including nanowell, concave, convex,
truncated conic or truncated pyramidal, for example, a size 4 to
800 .mu.m across .times.100 .mu.m in depth. The individual pins,
which can be any size desired, generally are as long as about 10
mm, usually about 5 mm long, and particularly about 1 mm long. The
pins and mounting plate can be made of polystyrene, which can be
one piece injection molded. Polystyrene is convenient for this use
because it can be functionalized readily and can be molded to very
high tolerances. The pins in a pin tool apparatus can be
collapsible, for example, controlled by a scissor-like mechanism,
so that the pins can be brought into closer proximity, reducing the
overall size.
[0224] Captured polypeptides can be analyzed by a variety of means
including, for example, spectrometric techniques such as UV/VIS,
IR, fluorescence, chemiluminescence, NMR spectroscopy, mass
spectrometry, or other methods known in the art, or combinations
thereof. If conditions preclude direct analysis of captured
polypeptides, the polypeptides can be released or transferred from
the pins, under conditions such that the advantages of sample
concentration are not lost. Accordingly, the polypeptides can be
removed from the pins using a minimal volume of eluent, and without
any loss of sample. Where the polypeptides are bound to the beads
attached to the pins, the beads containing the polypeptides can be
removed from the pins and measurements made directly from the
beads.
[0225] Prior to determining the identity of a target polypeptide by
mass spectrometry, a pin tool having the polypeptide attached
thereto can be withdrawn and washed several times, for example, in
ammonium citrate to condition the polypeptide prior to addition of
matrix. The pins then can be dipped into matrix solution, with the
concentration of matrix adjusted such that matrix solution adheres
only to the very tips of the pins. Alternatively, the pin tool can
be inverted and the matrix solution sprayed onto the tip of each
pin using a microdrop device. The polypeptides also can be cleaved
from the pins, for example, into a nanowell on a chip, prior to
addition of matrix. For analysis directly from the pins, a
stainless steel "mask" probe can be fitted over the pins, then the
mask probe can be installed in the mass spectrometer.
[0226] Two mass spectrometer geometries can be used for
accommodating a pin tool apparatus. A first geometry accommodates
solid pins. In effect, the laser ablates a layer of material from
the surface of the crystals, such that the resultant ions are
accelerated and focused through the ion optics. A second geometry
accommodates fibre optic pins, in which the laser strikes the
samples from behind. In effect, the laser is focused onto the pin
tool back plate and into a short optical fibre about 100 .mu.m in
diameter and about 7 mm in length to include thickness of the back
plate. This geometry requires that the volatilized sample go
through the depth of the matrix/bead mix, slowing and cooling down
the ions and resulting in a type of delayed extraction, which can
increase the resolution of the analysis (see, e.g., .Juhasz et al.
(1996) Analysis, Anal. Chem. 68:941-946, see also, e., U.S. Pat.
No. 5,777,325, U.S. Pat. No. 5,742,049, U.S. Pat. No. 5,654,545,
U.S. Pat. No. 5,641,959, U.S. Pat. No. 5,654,545 and U.S. Pat. No.
5,760,393 for descriptions of MALDI and delayed extraction
protocols).
[0227] The probe through which the pins are fitted also can be of
various geometries. For example, a large probe with multiple holes,
one for each pin, can be fitted over the pin tool and the entire
assembly is translated in the X-Y axes in the mass spectrometer.
The probe also can be a fixed probe with a single hole, which is
large enough to give an adequate electric field, but small enough
to fit between the pins. The pin tool then is translated in all
three axes, with each pin being introduced through the hole for
sequential analyses. This latter format is more suitable for a
higher density pin tool, for example, a pin tool based on a 384
well or higher density microplate format. These two probes are
suitable for the two mass spectrometer geometries, as disclosed
above.
[0228] Pin tools can be useful for immobilizing polypeptides of
interest in spatially addressable manner on an airray. Such
spatially addressable or pre-addressable arrays are useful in a
variety of processes, including, for example, quality control and
amino acid sequencing diagnostics. The pin tools described in the
copending applications U.S. application Ser. Nos. 08/786,988 and
08/787,639 and International PCT application No. WO 98/20166 are
serial and parallel dispensing tools that can be employed to
generate multi-element arrays of polypeptides on a surface of the
solid support. The array surface can be flat, with beads, or
geometrically altered to include wells, which can contain beads. A
pin tool that allows the parallel development of a sample array is
provided. Such a tool is an assembly of vesicle elements, or pins,
where each of the pins can include a narrow interior chamber
suitable for holding nanoliter volumes of fluid. Each of the pins
fits inside a housing that has an interior chamber. The interior
housing can be connected to a pressure source that can control the
pressure within the interior housing chamber to regulate the flow
of fluid through the interior chamber of the pins, thereby allowing
for the controlled dispensing of defined volumes of fluid from the
vesicles.
[0229] The pin tool also can include a jet assembly, which can
include a capillary pin having an interior chamber, and a
transducer element mounted to the pin and capable of driving fluid
through the interior chamber of the pin to eject fluid from the
pin. In this way, the tool can dispense a spot of fluid to a
support surface by spraying the fluid from the pin. The transducer
also can cause a drop of fluid to extend from the capillary so that
fluid can be passed to the array, or other solid support, by
contacting the drop to the surface of the array. The pin tool also
can form an array of polypeptides by dispensing the polypeptides in
a series of steps, while moving the pin to different locations
above the array surface to form the sample array. The pin tool then
can pass prepared polypeptide arrays to a plate assembly that
disposes the arrays for analysis by mass spectrometry, which
generates a set of spectra signal indicative of the composition of
the polypeptides under analysis.
[0230] The pin tool can include a housing having a plurality of
sides and a bottom portion having formed therein a plurality of
apertures, the walls and bottom portion of the housing defining an
interior volume; one or more fluid transmitting vesicles, or pins,
mounted within the apertures, having a nanovolume sized fluid
holding chamber for holding nanovolumes of fluid, the fluid holding
chamber being disposed in fluid communication with the interior
volume of the housing, and a dispensing element that is in
communication with the interior volume of the housing for
selectively dispensing nanovolumes of fluid form the nanovolume
sized fluid transmitting vesicles when the fluid is loaded with the
fluid holding chambers of the vesicles. This allows the dispensing
element to dispense nanovolumes of the fluid onto the surface of
the support when the apparatus is disposed over and in registration
with the support.
[0231] The fluid transmitting vesicle can have an open proximal end
and a distal tip portion that extends beyond the housing bottom
portion when mounted within the apertures. In this way the open
proximal end can dispose the fluid holding chamber in fluid
communication with the interior volume when mounted with the
apertures. Optionally, the plurality of fluid transmitting vesicles
are removably and replaceably mounted within the apertures of the
housing, or alternatively can include a glue seal for fixedly
mounting the vesicles within the housing.
[0232] The fluid holding chamber also can include a narrow bore,
which is dimensionally adapted for being filled with the fluid
through capillary action, and can be sized to fill substantially
completely with the fluid through capillary action. The plurality
of fluid transmitting vesicles includes an array of fluid
delivering needles, which can be formed of metal, glass, silica,
polymeric material, or any other suitable material, and, thus, as
disclosed herein, also can serve as a solid support.
[0233] The housing also can include a top portion, and mechanical
biasing elements for mechanically biasing the plurality of fluid
transmitting vesicles into sealing contact with the housing bottom
portion. In addition, each fluid transmitting vesicle can have a
proximal end portion that includes a flange, and further includes a
seal element disposed between the flange and an inner surface of
the housing bottom portion for forming a seal between the interior
volume and an external environment. The biasing elements can be
mechanical and can include a plurality of spring elements each of
which are coupled at one end to the proximal end of each of the
plurality of fluid transmitting vesicles, and at another end to an
inner surface of the housing top portion. The springs can apply a
mechanical biasing force to the vesicle proximal end to form the
seal.
[0234] The housing also can include a top portion, and a securing
element for securing the housing top portion to the housing bottom
portion. The securing element can include a plurality of
fastener-receiving apertures formed within one of the top and
bottom portions of the housing, and a plurality of fasteners for
mounting within the apertures for securing together the housing top
and bottom portions.
[0235] The dispensing element can include a pressure source fluidly
coupled to the interior volume of the housing for disposing the
interior volume at a selected pressure condition. Moreover, where
the fluid transmitting vesicles are to be filled through capillary
action, the dispensing element can include a pressure controller
that can vary the pressure source to dispose the interior volume of
the housing at varying pressure conditions. This allows the
controller varying element to dispose the interior volume at a
selected pressure condition sufficient to offset the capillary
action to fill the fluid holding chamber of each vesicle to a
predetermined height corresponding to a predetermined fluid amount.
Additionally, the controller can include a fluid selection element
for selectively discharging a selected nanovolume fluid amount from
the chamber of each the vesicles. In addition, a pressure
controller that operates under the controller of a computer program
operating on a data processing system to provide variable control
over the pressure applied to the interior chamber of the housing is
provided.
[0236] The fluid transmitting vesicle can have a proximal end that
opens onto the interior volume of the housing, and the fluid
holding chamber of the vesicles are sized to substantially
completely fill with the fluid through capillary action without
forming a meniscus at the proximal open end. Optionally, the
apparatus can have plural vesicles, where a first portion of the
plural vesicles include fluid holding chambers of a first size and
a second portion including fluid holding chambers of a second size,
whereby plural fluid volumes can be dispensed.
[0237] The tool also can include a fluid selection element that has
a pressure source coupled to the housing and in communication with
the interior volume for disposing the interior volume at a selected
pressure condition, and an adjustment element that couples to the
pressure source for varying the pressure within the interior volume
of the housing to apply a positive pressure in the fluid chamber of
each the fluid transmitting vesicle to vary the amount of fluid
dispensed therefrom. The selection element and adjustment element
can be computer programs operating on a data processing system that
directs the operation of a pressure controller connected to the
interior chamber.
[0238] The pin tool apparatus can be used for dispensing a fluid
containing a polypeptide of interest, particularly a target
polypeptide, into one or more wells of a multi-well device, which
can be a solid support. The apparatus can include a housing having
a plurality of sides and a bottom portion having formed therein a
plurality of apertures, the walls and bottom portion defining an
interior volume, a plurality of fluid transmitting vesicles,
mounted within the apertures, having a fluid holding chamber
disposed in communication with the interior volume of the housing,
and a fluid selection and dispensing means in communication with
the interior volume of the housing for variably selecting an amount
of the fluid loaded within the fluid holding chambers of the
vesicles to be dispensed from a single set of the plurality of
fluid transmitting vesicles. Accordingly, the dispensing means
dispenses a selected amount of the fluid into the wells of the
multi-well device when the apparatus is disposed over and in
registration with the device.
[0239] The fluid dispensing apparatus for dispensing fluid
containing a polypeptide of interest into one or more wells of a
multi-well device can include a housing having a plurality of sides
and top and bottom portions, the bottom portion having formed
therein a plurality of apertures, the walls and top and bottom
portions of the housing defining an interior volume, a plurality of
fluid transmitting vesicles, mounted within the apertures, having a
fluid holding chamber sized to hold nanovolumes of the fluid, the
fluid holding chamber being disposed in fluid communication with
the volume of the housing, and mechanical biasing element for
mechanically biasing the plurality of fluid transmitting vesicles
into sealing contact with the housing bottom portion.
DETERMINING THE MASS OF THE POLYPEPTIDE BY MASS SPECTROMETRY
[0240] The identity of an isolated target polypeptide is determined
by mass spectrometry. For mass spectrometry analysis, the target
polypeptide can be solubilized in an appropriate solution or
reagent system. The selection of a solution or reagent system, for
example, an organic or inorganic solvent, will depend on the
properties of the target polypeptide and the type of mass
spectrometry performed, and is based on methods well known in the
art (see, for example, Vorm et al., Anal. Chem. 61:3281 (1994), for
MALDI; Valaskovic et al., Anal. Chem. 67:3802 (1995), for ESI).
Mass spectrometry of peptides also is described, for example, in
International PCT application No. WO 93/24834 to Chait et al. and
U.S. Pat. No. 5,792,664.
[0241] A solvent is selected so as to considerably reduce or fully
exclude the risk that the target polypeptide will be decomposed by
the energy introduced for the vaporization process. A reduced risk
of target polypeptide decomposition can be achieved, for example,
by embedding the sample in a matrix, which can be an organic
compound such as a sugar, for example, a pentose or hexose, or a
polysaccharide such as cellulose. Such compounds are decomposed
thermolytically into CO.sub.2 and H.sub.2O such that no residues
are formed that can lead to chemical reactions. The matrix also can
be an inorganic compound such as nitrate of ammonium, which is
decomposed essentially without leaving any residue. Use of these
and other solvents is known to those of skill in the art (see,
e.g., U.S. Pat. No. 5,062,935).
[0242] Mass spectrometer formats for use in analyzing a target
polypeptide include ionization (I) techniques, such as, but not
limited to, matrix assisted laser desorption (MALDI), continuous or
pulsed electrospray (ESI) and related methods such as ionspray or
thermospray), and massive cluster impact (MCI). Such ion sources
can be matched with detection formats, including linear or
non-linear reflectron time-of-flight (TOF), single or multiple
quadrupole, single or multiple magnetic sector, Fourier transform
ion cyclotron resonance (FTICR), ion trap, and combinations thereof
such as ion-trap/time-of-flight. For ionization, numerous
matrix/wavelength combinations (MALDI) or solvent combinations
(ESI) can be employed. Sub-attomole levels of protein have been
detected, for example, using ESI mass spectrometry (Valaskovic, et
al., Science 273:1199-1202 (1996)) and MALDI mass spectrometry (Li
et al., J. Am. Chem. Soc. 118:1662-1663 (1996)).
[0243] Electrospray mass spectrometry has been described by Fenn et
al. (J. Phys. Chem. 88:4451-59 (1984); PCT Application No. WO
90/14148) and current applications are summarized in review
articles (Smith et al., Anal. Chem. 62:882-89 (1990); Ardrey,
Electrospray Mass Spectrometry, Spectroscopy Europe 4:10-18
(1992)). MALDI-TOF: mass spectrometry has been described by
Hillenkamp et al. ("Matrix Assisted UV-Laser Desorption/Ionization:
A New Approach to Mass Spectrometry of Large Biomolecules,
Biological Mass Spectrometry" (Burlingame and McCloskey, eds.,
Elsevier Science Publ. 1990), pp. 49-60). With ESI, the
determination of molecular weights in femtomole amounts of sample
is very accurate due to the presence of multiple ion peaks, all of
which can be used for mass calculation.
[0244] The mass of a target polypeptide determined by mass
spectrometry can be compared to the mass of a corresponding known
polypeptide. For example, where the target polypeptide is a mutant
protein, the corresponding known polypeptide can be the
corresponding normal protein. Similarly, where the target
polypeptide is suspected of being translated from a gene having an
abnormally high number of trinucleotide repeats, the corresponding
known polypeptide can be the corresponding protein having a wild
type number of repeats, if any. Where the target polypeptide
contains a number of repeated amino acids directly correlated to
the number of trinucleotide repeats transcribed and translated from
DNA, the number of repeated trinucleotide repeats in the DNA
encoding the polypeptide can be deduced from the mass of the
polypeptide. If desired, a target polypeptide can be conditioned
prior to mass spectrometry, as disclosed herein, thus facilitating
identification of the polypeptide.
MALDI
[0245] Matrix assisted laser desorption (MALDI) is preferred among
the mass spectrometric methods herein. Methods for performing MALDI
are well known to those of skill in the art (see, eg., ). Numerous
methods for improving resolution are also known. For example,
resolution in MALDI TOF mass spectrometry can be improved by
reducing the number of high energy collisions during ion extraction
(see, eq., Juhasz et al. (1996) Analysis, Anal. Chem. 68:941-946,
see also, e.g., U.S. Pat. No. 5,777,325, U.S. Pat. No. 5,742,049,
U.S. Pat. No. 5,654,545, U.S. Pat. No. 5,641,959, U.S. Pat. No.
5,654,545, U.S. Pat. No. 5,760,393 and U.S. Pat. No. 5,760,393 for
descriptions of MALDI and delayed extraction protocols).
AMINO ACID SEQUENCING OF TARGET POLYPEPTIDES
[0246] A process of determining the identity of a target
polypeptide using mass spectrometry, as disclosed herein, can be
performed by determining the amino acid sequence, or a portion
thereof, of a target polypeptide. Amino acid sequencing can be
performed, for example, from the carboxyl terminus using
carboxypeptidase such as carboxypeptidase Y, carboxypeptidase P,
carboxypeptidase A, carboxypeptidase G or carboxypeptidase B, or
other enzyme that progressively digests a polypeptide from its
carboxyl terminus; or from the N-terminus of the target polypeptide
by using the Edman degradation method or using an aminopeptidase
such as alanine aminopeptidase, leucine aminopeptidase,
pyroglutamate peptidase, dipeptidyl peptidase, microsomal
peptidase, or other enzyme that progressively digests a polypeptide
from its amino terminus. If desired, the target polypeptide first
can be cleaved into peptide fragments using an enzyme such as
trypsin, chymotrypsin, Asp-N, thrombin or other suitable enzyme.
The fragments then can be isolated and subjected to amino acid
sequencing by mass spectrometry, or a nested set of deletion
fragments of the polypeptide can be prepared by incubating the
polypeptide for various periods of time in the presence of an
aminopeptidase or a carboxypeptidase and, if desired, in the
presence of reagents that modify the activity of a peptidase on the
polypeptide (see, for example, U.S. Pat. No. 5,792,664;
International Publ. No. WO96/36732). If desired, a tag, for
example, a tag peptide, can be conjugated to a fragment of a target
polypeptide. Such a conjugation can be performed prior to or
following cleavage of the target polypeptide.
[0247] Amino acid sequencing of a target polypeptide can be
performed either on the free polypeptide or after immobilizing the
polypeptide on a solid support. A target polypeptide can be
immobilized on a solid support, for example, by linking the
polypeptide to the support through its amino terminus or its
carboxyl terminus or directly or via a linker or [linkers by
methods known to those of skill in the art or as described herein,
then treating the immobilized polypeptide with an exopeptidase
specific for the unbound terminus. For example, where a target
polypeptide is linked to a solid support through its amino
terminus, the immobilized polypeptide can be treated with a
carboxypeptidase, which sequentially degrades the polypeptide from
its carboxyl terminus. Alternatively, where the target polypeptide
is linked to a solid support through its carboxyl terminus, the
polypeptide can be digested from its amino terminus using, for
example, Edman's reagent.
[0248] For amino acid sequencing, the target polypeptide is treated
with the protease in a time-limited manner, and released amino
acids are identified by mass spectrometry. If desired, degradation
of a target polypeptide can be performed in a reactor apparatus
(see International Publ. No. WO 94/21822, published Sep. 29, 1994),
in which the polypeptide can be free in solution and the protease
can be immobilized, or in which the protease can be free in
solution and the polypeptide can be immobilized. At time intervals
or as a continuous stream, the reaction mixture containing a
released amino acid is transported to a mass spectrometer for
analysis. Prior to mass spectrometric analysis, the released amino
acids can be transported to a reaction vessel for conditioning,
which can be by mass modification. The determination of the amino
acid sequence of the target polypeptide, particularly the
identification of an allelic variation in the target polypeptide as
compared to a corresponding known polypeptide, can be useful, for
example, to determine whether the subject from which the target
polypeptide was obtained has or is predisposed to a particular
disease or condition.
[0249] If desired, the target polypeptide can be conditioned, for
example, by mass modified prior to sequencing. It should be
recognized, however, that mass modification of a polypeptide prior
to chemical or enzymatic degradation, for example, can influence
the rate or extent of degradation. Accordingly, the skilled artisan
will know that the influence of conditioning and mass modification
on polypeptide degradation should be characterized prior to
initiating amino acid sequencing.
[0250] A process as disclosed herein is conveniently performed in a
multiplexing format, thereby allowing a determination of the
identities of a plurality of two or more target polypeptides in a
single procedure. For multiplexing, a population of target
polypeptides can be synthesized by in vitro translation, where each
of the target nucleic acids encoding each of the target
polypeptides is translated, in a separate reaction, in the presence
of one or more mass modifying amino acids. The population of target
polypeptides can be encoded, for example, by target nucleic acids
representing the different polymorphic regions of a particular
gene. Each of the individual reactions can be performed using one
or more amino acids that are differentially mass modified, for
example, differentially mass modified, particularly using basic
residues. Following translation, each target polypeptide is
distinguishable by the particular mass modified amino acid.
[0251] A plurality of target polypeptides also can be obtained, for
example, from naturally occurring proteins and examined by
multiplexing, provided that each of the plurality of target
polypeptides is differentially mass modified. For example, where a
plurality of target polypeptides are being examined to determine
whether a particular polypeptide is an allelic variant containing
either a Gly residue or an Ala residue, the Gly and Ala residues in
each polypeptide in the plurality can be mass modified with a mass
label specific for that polypeptide. Identification of a Gly or Ala
residue having a particular mass can be used to determine the
particular polypeptide and the nature of the polymorphism.
[0252] Amino acid modifications can be effected during or after in
vitro translation of the target polypeptide. For example, any amino
acid with a functional group on a side chain can be derivatized
using methods known to those of skill in the art. For example,
N-succinimidyl-3(2-pyridyldith- io)propionate (SPDP) can be used to
introduce sulfhydryl groups on lysine residues, thereby altering
the mass of the polypeptide compared to the untreated
polypeptide.
IDENTIFYING THE POLYPEPTIDE BY COMPARING THE MASS OF TARGET
POLYPEPTIDE TO A KNOWN POLYPEPTIDE
[0253] In methods other than those in which the polypeptide is
sequenced and thereby identified, identification of the polypeptide
is effected by comparison with a reference (or known) polypeptide.
The result indicative of identity is a function of the selected
reference polypeptide. The reference polypeptide can be selected so
that the target polypeptide will either have a mass substantially
identical (identical within experimental error) to the reference
polypeptide, or will have a mass that is different from the
reference polypeptide.
[0254] For example, if the reference polypeptide is encoded by a
wild type allele of a gene that serves as a genetic marker, and the
method is for screening for the presence of a disease or condition
that is indicated by a mutation in that allele, then presence of
the mutation will be identified by observing a difference between
the mass of the target polypeptide and reference polypeptide.
Observation of such difference thereby "identifies" the polypeptide
and indicates the presence of the marker for the disease or
condition. This result will indicate the presence of a
mutation.
[0255] Alternatively, if the reference polypeptide is encoded by a
mutant allele of a gene that serves as a genetic marker, and the
method is for screening for the presence of a disease or condition
that is indicated by a mutation in that allele, then presence of
the mutation will be identified by observing no difference between
the mass of the target polypeptide and reference polypeptide.
Observation of no difference thereby "identifies" the polypeptide
and indicates the presence of the marker for the disease or
condition. Furthermore, this result can provide information about
the specific mutation.
IDENTIFYING A TARGET POLYPEPTIDE BASED ON PEPTIDE FRAGMENTS OF THE
TARGET POLYPEPTIDE
[0256] A process as disclosed herein also provides a means for
determining the identity of a target polypeptide by comparing the
masses of defined peptide fragments of the target polypeptide with
the masses of corresponding peptide fragments of a known
polypeptide. Such a process can be performed, for example, by
obtaining the target polypeptide by in vitro translation, or by in
vitro transcription followed by translation, of a nucleic acid
encoding the target polypeptide; contacting the target polypeptide
with at least one agent that cleaves at least one peptide bond in
the target polypeptide, for example, an endopeptidase such as
trypsin or a chemical cleaving agent such as cyanogen bromide, to
produce peptide fragments of the target polypeptide; determining
the molecular mass of at least one of the peptide fragments of the
target polypeptide by mass spectrometry; and comparing the
molecular mass of the peptide fragments of the target polypeptide
with the molecular mass of peptide fragments of a corresponding
known polypeptide. The masses of the peptide fragments of a
corresponding known polypeptide either can be determined in a
parallel reaction with the target polypeptide, wherein the
corresponding known polypeptide also is contacted with the agent;
can be compared with known masses for peptide fragments of a
corresponding known polypeptide contacted with the particular
cleaving agent; or can be obtained from a database of polypeptide
sequence information using algorithms that determine the molecular
mass of peptide fragment of a polypeptide.
[0257] The disclosed process of determining the identity of a
target polypeptide by performing mass spectrometry on defined
peptide fragments of the target polypeptide is particularly
adaptable to a multiplexing format. Accordingly, a process is
provided for determining the identity of each target polypeptide in
a plurality of target polypeptides, by obtaining the plurality of
target polypeptides; contacting each target polypeptide with at
least one agent that cleaves at least one peptide bond in each
target polypeptide to produce peptide fragments of each target
polypeptide; determining the molecular mass of at least one of the
peptide fragments of each target polypeptide in the plurality by
mass spectrometry; and comparing the molecular mass of the peptide
fragments of each target polypeptide with the molecular mass of
peptide fragments of a corresponding known polypeptide.
[0258] In performing a process as disclosed, it can be desirable to
condition the target polypeptides. The polypeptides can be
conditioned prior to cleavage, or the peptide fragments of the
target polypeptide that will be examined by mass spectrometry can
be conditioned prior to mass spectrometry. It also can be desirable
to mass modify the target polypeptide, particularly to
differentially mass modify each target polypeptide where a
plurality of target polypeptides is being examined in a
multiplexing format. Mass modification can be performed either on
each polypeptide prior to contacting the polypeptide with the
cleaving agent, or on the peptide fragments of the polypeptide that
will examined by mass spectrometry.
[0259] A target polypeptide, particularly each target polypeptide
in a plurality of target polypeptides, can be immobilized to a
solid support prior to conditioning or mass modifying the
polypeptide, or prior to contacting the polypeptide with a cleaving
agent. In particular, the solid support can be a flat surface, or a
surface with a structure such as wells, such that each of the
target polypeptides in the plurality can be positioned in an array,
each at a particular address. In general, a target polypeptide is
immobilized to the solid support through a cleavable linker such as
an acid labile linker, a chemically cleavable linker or a
photocleavable linker. Following treatment of the target
polypeptide, the released peptide fragments can be analyzed by mass
spectrometry, or the released peptide fragments can be washed from
the reaction and the remaining immobilized peptide fragment can be
released, for example, by chemical cleavage or photocleavage, as
appropriate, and can be analyzed by mass spectrometry.
[0260] It also can be useful to immobilize a particular target
polypeptide to the support through both the amino terminus and the
carboxyl terminus using, for example, a chemically cleavable linker
at one terminus and a photocleavable linker at the other end. In
this way, the target polypeptides, which can be immobilized, for
example, in an array in wells, can be contacted with one or more
agents that cleave at least one peptide bond in the polypeptides,
the internal peptide fragments then can be washed from the wells,
along with the agent and any reagents in the well, leaving one
peptide fragment of the target polypeptide immobilized to the solid
support through the chemically cleavable linker and a second
peptide fragment, from the opposite end of the target polypeptide,
immobilized through the photocleavable linker. Each peptide
fragment then can be analyzed by mass spectrometry following
sequential cleavage of the fragments, for example, after first
cleaving the chemically cleavable linker, then cleaving the
photocleavable linker. Such a method provides a means of analyzing
both termini of a polypeptide, thereby facilitating identification
of the target polypeptide. It should be recognized that
immobilization of a target polypeptide at both termini can be
performed by modifying both ends of a target polypeptide, one
terminus being modified to allow formation of a chemically
cleavable linkage with the solid support and the other terminus
being modified to allow formation of a photocleavable linkage with
the solid support. Alternatively, the target polypeptides can be
split into two portions, one portion being modified at one terminus
to allow formation, for example, of a chemically cleavable linkage,
and the second portion being modified at the other terminus to
allow formation, for example, of a photocleavable linkage. The two
populations of modified target polypeptides then can be
immobilized, together, on a solid support containing the
appropriate functional groups for completing immobilization.
EXEMPLARY USES
[0261] Methods for determining the identity of a target polypeptide
are disclosed herein. The identity of the target polypeptide allows
information to be obtained regarding the DNA sequence encoding the
target polypeptide. The target polypeptide can be from a eukaryote
such as a vertebrate, particularly a mammal such as a human, or can
be from a prokaryote, including a bacterium or a virus. Generally,
the target polypeptide can be from any organism, including a
plant.
[0262] A target polypeptide can be immobilized to a solid support,
thereby facilitating manipulation of the polypeptide prior to mass
spectrometry. For example, a target polypeptide can be translated
in vitro. Such a method of obtaining a target polypeptide
conveniently allows attachment of a tag to the polypeptide, for
example, by producing a fusion polypeptide of the target
polypeptide and a tag peptide such as a polyhistidine tag. The
presence of a tag peptide such as a polyhistidine tag provides a
means to isolate the target polypeptide, for example, from the in
vitro translation reaction, by passing the mixture over a nickel
chelate column, since nickel ions interact specifically with a
polyhistidine sequence. The target polypeptide then can be captured
by conjugation to a solid support, thereby immobilizing the target
polypeptide. If general, conjugation of the polypeptide to the
solid support can be mediated through a linker, which provides
desirable characteristics such as being readily cleavable, for
example, chemically cleavable, heat cleavable or photocleavable. As
shown in FIG. 2, for example, the target polypeptide can be
immobilized at its amino terminus to a solid support through a
diisopropylysilyl linker, which readily is cleavable under acidic
conditions such as when exposed to the mass spectrometry matrix
solution 3-HPA. For example, the solid support, or a linker
conjugated to the support or a group attached to such a linker, can
be in the activated carboxy form such as a sulfo-NHS ester, which
facilitates conjugation of the polypeptide through its amino
terminus. Furthermore, conjugation of a polypeptide to a solid
support can be facilitated by engineering the polypeptide to
contain, for example, a string of lysine residues, which increases
the concentration of amino groups available to react with an
activated carboxyl support. Of course, a polypeptide also can be
conjugated through its carboxyl terminus using a modified form of
the linker shown in FIG. 2 (see FIG. 3), or can be conjugated using
other linkers as disclosed herein or otherwise known in the art.
The immobilized target polypeptide then can be manipulated, for
example, by proteolytic cleavage using an endopeptidase or a
chemical reagent such as cyanogen bromide, by sequential truncation
from its free end using an exopeptidase or a chemical reagent such
as Edman's reagent, or by conditioning in preparation for mass
spectrometric analysis, for example, by cation exchange to improve
mass spectrometric analysis. An advantage of performing such
manipulations with an immobilized polypeptide is that the reagents
and undesirable reaction products can be washed from the remaining
immobilized polypeptide, which then can be cleaved from the solid
support in a separate reaction or can be subjected to mass
spectrometry, particularly MALDI-TOF, under conditions that cleave
the polypeptide from the support, for example, exposure of a
polypeptide linked to the support through a photocleavable linker
to the MALDI laser.
[0263] For purposes of the conjugation reactions, as well as
enzymatic reactions, it is assumed that the termini of a target
polypeptide are more reactive than the amino acid side groups due,
for example, to steric considerations. However, it is recognized
that amino acid side groups can be more reactive than the relevant
terminus, in which case the artisan would know that the side group
should be blocked prior to performing the reaction of interest.
Methods for blocking an amino acid side group are well known and
blocked amino acid residues are readily available and used, for
example, for chemical synthesis of peptides. Similarly, it is
recognized that a terminus of interest of the polypeptide can be
blocked due, for example, to a post-translational modification, or
can be buried within a polypeptide due to secondary or tertiary
conformation. Accordingly, the artisan will recognize that a
blocked amino terminus of a polypeptide, for example, must be made
reactive either by cleaving the amino terminal amino acid or by
deblocking the amino acid. In addition, where the terminus of
interest is buried within the polypeptide structure, the artisan
will know that the polypeptide, in solution, can be heated to about
70 to 100.degree. C. prior to performing a reaction. It is
recognized, for example, that when the reaction to be performed is
an enzymatic cleavage, the enzymes selected should be stable at
elevated temperatures. Such temperature stable enzymes, for
example, thermostable peptidases, including carboxypeptidases and
aminopeptidases, are obtained from thermophilic organisms and are
commercially available. In addition, where it is desirable not to
use heat to expose an otherwise buried terminus of a polypeptide,
altering the salt conditions can provide a means to expose the
terminus. For example, a polypeptide terminus can be exposed using
conditions of high ionic strength, in which case an enzyme such as
an exopeptidase is selected based on its tolerance to high ionic
strength conditions.
[0264] Depending on the target polypeptide to be detected, the
disclosed methods allow the diagnosis, for example, of a genetic
disease or chromosomal abnormality; a predisposition to or an early
indication of a gene influenced disease or condition such as
obesity, atherosclerosis, diabetes or cancer; or an infection by a
pathogenic organism, including a virus, bacterium, parasite or
fungus; or to provide information relating to identity or heredity
based, for example, on an analysis of mini-satellites and
micro-satellites, or to compatibility based, for example, on HLA
phenotyping.
[0265] A process is provided herein for detecting genetic lesions
that are characterized by an abnormal number of trinucleotide
repeats, which can range from less than 10 to more than 100
additional trinucleotide repeats relative to the number of repeats,
if any, in a gene in a non-affected individual. Diseases associated
with such genetic lesions include, for example, Huntington's
disease, prostate cancer, SCA-1, Fragile X syndrome (Kremer et al.,
Science 252:1711-14 (1991); Fu et al., Cell 67:1047-58 (1991);
Hirst et al., J. Med. Genet. 28:824-29 (1991), myotonic dystrophy
type I (Mahadevan et al., Science 255:1253-55 (1992); Brook et al.,
Cell 68:799-808 (1992)), Kennedy's disease (also termed spinal and
bulbar muscular atrophy; La Spada et al., Nature 352:77079 (1991));
Machado-Joseph disease, and dentatorubral and pallidolyusian
atrophy. The abnormal number of triplet repeats can be located in
any region of a gene, including a coding region, a non-coding
region of an exon, an intron, or a promoter or other regulatory
element. For example, the expanded trinucleotide repeat associated
with myotonic dystrophy occurs in the 3' untranslated region (UTR)
of the MtPK gene on chromosome 19. In some of these diseases, for
example, prostate cancer, the number of trinucleotide repeats is
positively correlated with prognosis of the disease such that a
higher number of trinucleotide repeats correlates with a poorer
prognosis.
[0266] A process for determining the identity of an allelic variant
of a polymorphic region of a gene, particularly a human gene, also
is provided. Allelic variants can differ in the identity of a
single nucleotide or base pair, for example, by substitution of one
nucleotide; in two or more nucleotides or base pairs; or in the
number of nucleotides due, for example, to additions or deletions
of nucleotides or of trinucleotide repeats; or due to chromosomal
rearrangements such as translocations. Specific allelic variants of
polymorphic regions are associated with specific diseases and, in
some cases, correlate with the prognosis of the disease. A specific
allelic variant of a polymorphic region associated with a disease
is referred to herein as a "mutant allelic variant" and is
considered to be a "genetic lesion."
[0267] Also provided is a process for determining the genetic
nature of a phenotype or for identifying a predisposition to that
phenotype. For example, it can be determined whether a subject has
a predisposition to a specific disease or condition, i.e., whether
the subject has, or is at risk of developing, a disease or
condition associated with a specific allelic variant of a
polymorphic region of a gene. Such a subject can be identified by
determining whether the subject carries an allelic variant
associated with the specific disease or condition. Furthermore, if
the disease is a recessive disease it can be determined whether a
subject is a carrier of a recessive allele of a gene associated
with the specific disease or condition.
[0268] Numerous diseases or conditions have been genetically linked
to a specific gene and, more particularly, to a specific mutation
or genetic lesion of a gene. For example, hyperproliferative
diseases such as cancers are associated with mutations in specific
genes. Such cancers include breast cancer, which has been linked to
mutations in BRCA1 or BRCA2. Mutant alleles of BRCA1 are described,
for example, in U.S. Pat. No. 5,622,829. Other genes such as tumor
suppressor genes, which are associated with the development of
cancer when mutated, include, but are not limited to, p53
(associated with many forms of cancer); Rb (retinoblastoma); WT1
(Wilm's tumor) and various proto-oncogenes such as c-myc and c-fos
(see Thompson and Thompson, "Genetics in Medicine" 5th Ed.; Nora et
al., "Medical Genetics" 4th Ed. (Lea and Febiger, eds.).
[0269] A process as disclosed herein also can be used to detect DNA
mutations that result in the translation of a truncated
polypeptide, as occurs, for example, with BRCA1 and BRCA2.
Translation of nucleic acid regions containing such a mutation
results in a truncated polypeptide that easily can be
differentiated from the corresponding non-truncated polypeptide by
mass spectrometry.
[0270] A process as disclosed herein also can be used to genotype a
subject, for example, a subject being considered as a recipient or
a donor of an organ or a bone marrow graft. For example, the
identity of MHC alleles, particularly HLA alleles, in a subject can
be determined. The information obtained using such a method is
useful because transplantation of a graft to a recipient having
different transplantation antigens than the graft can result in
rejection of the graft and can result in graft versus host disease
following bone marrow transplantation.
[0271] The response of a subject to medicaments can be affected by
variations in drug modification systems such as; the cytochrome
P450 system, and susceptibility to particular infectious diseases
can be influenced by genetic status. Thus, the identification of
particular allelic variants can be used to predict the potential
responsiveness of a subject to specific drug or the susceptibility
of a subject to an infectious disease. Genes involved in
pharmacogenetics are known (see, e., Nora et al, "Medical Genetics"
4th Ed. (Lea and Febiger, eds.).
[0272] Some polymorphic regions may not be related to any disease
or condition. For example, many loci in the human genome contain a
polymorphic short tandem repeat (STR) region. STR loci contain
short, repetitive sequence elements of 3 to 7 base pairs in length.
It is estimated that there are 200,000 expected trimeric and
tetrameric STRs, which are present as frequently as once every 15
kb in the human genome (see, eg., International PCT application No.
WO 9213969 A1, Edwards et al., Nucl. Acids Res. 19:4791 (1991);
Beckmann et al. (1992) Genomics 12:627-631). Nearly half of these
STR loci are polymorphic, providing a rich source of genetic
markers. Variation in the number of repeat units at a particular
locus is responsible for the observed polymorphism reminiscent of
variable nucleotide tandem repeat (VNTR) loci (Nakamura et al.
(1987) Science 235:1616-1622); and minisatellite loci (Jeffreys et
al. (1985) Nature 314:67-73), which contain longer repeat units,
and microsatellite or dinucleotide repeat loci (Luty et al. (1991)
Nucleic Acids Res. 19:4308; Litt et al. (1990) Nucleic Acids Res.
18:4301; Litt et al. (1990) Nucleic Acids Res. 18:5921; Luty et al.
(1990) Am. J. Hum. Genet. 46:776-783; Tautz (1989) Nucl. Acids Res.
17:6463-6471; Weber et al. (1989) Am. J. Hum. Genet. 44:388-396;
Beckmann et al (1992) Genomics 12:627-631).
[0273] Polymorphic STR loci and other polymorphic regions of genes
are extremely useful markers for human identification, paternity
and maternity testing, genetic mapping, immigration and inheritance
disputes, zygosity testing in twins, tests for inbreeding in
humans, quality control of human cultured cells, identification of
human remains, and testing of semen samples, blood stains and other
material in forensic medicine. Such loci also are useful markers in
commercial animal breeding and pedigree analysis and in commercial
plant breeding. Traits of economic importance in plant crops and
animals can be identified through linkage analysis using
polymorphic DNA markers. Efficient processes for determining the
identity of such loci are disclosed herein.
[0274] STR loci can be amplified by FPCR using specific primer
sequences identified in the regions flanking the tandem repeat to
be targeted. Allelic forms of these loci are differentiated by the
number of copies of the repeat sequence contained within the
amplified region. Examples of STR loci include but are not limited
to pentanucleotide repeats in the human CD4 locus (Edwards et al.,
Nucl. Acids Res. 19:4791 (1991)); tetranucleotide repeats in the
human aromatase cytochrome P-450 gene (CYP19; Polymeropoulos et
al., Nucl. Acids Res. 19:195 (1991)); tetranucleotide repeats in
the human coagulation factor XIII A subunit gene (F13A1;
Polymeropoulos et al., Nucl. Acids Res. 19:4306 (1991));
tetranucleotide repeats in the F13B locus (Nishimura et al., Nucl.
Acids Res. 20:1167 (1992)); tetranucleotide repeats in the human
c-les/fps, proto-oncogene (FES; Polymeropoulos et al., Nucl. Acids
Res. 19:4018 (1991)); tetranucleotide repeats in the LFL gene
(Zuliani et al., Nucl. Acids Res. 18:4958 (1990)); trinucleotide
repeats polymorphism at the human pancreatic phospholipase A-2 gene
(PLA2; Polymeropoulos et al., Nucl. Acids Res. 18:7468 (1990));
tetranucleotide repeats polymorphism in the VWF gene (Ploos et al.,
Nucl. Acids Res. 18:4957 (1990)); and tetranucleotide repeats in
the human thyroid peroxidase (hTPO) locus (Anker et al., Hum. Mol.
Genet. 1:137 (1992)).
[0275] A target DNA sequence can be part of a foreign genetic
sequence such as the genome of an invading microorganism,
including, for example, bacteria and their phages, viruses, fungi,
protozoa, and the like. The processes provided herein are
particularly applicable for distinguishing between different
variants or strains of a microorganism in order, for example, to
choose an appropriate therapeutic intervention. Examples of
disease-causing viruses that infect humans and animals and that can
be detected by a disclosed process include but are not limited to
Retroviridae (e.g., human immunodeficiency viruses such as HIV-1
(also referred to as HTLV-III, LAV or HTLV-III/LAV; Ratner et al.,
Nature, 313:227-284 (1985); Wain Hobson et al., Cell, 40:9-17
(1985), HIV-2 (Guyader et al., Nature, 328:662-669 (1987); European
Pat. Publication No. 0 269 520; Chakrabarti et al., Nature,
328:543-i47 (1987); European Pat. Application No. 0 655 501), and
other isolates such as HIV-LP (International Publication No. WO
94/00562); Picornaviridae (e.g., polioviruses, hepatitis A virus,
(Gust et al., Intervirology, 20:1-7 (1983)); enteroviruses, human
coxsackie viruses, rhinoviruses, echoviruses); Calcivirdae (e.g.
strains that cause gastroenteritis); Togaviridae (e.g., equine
encephalitis viruses, rubella viruses); Flaviridae (e.g., dengue
viruses, encephalitis viruses, yellow fever viruses); Coronaviridae
(e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis
viruses, rabies viruses); Filoviridae (e.g., ebola viruses);
Pararnyxoviridae (e.g., parainfluenza viruses, mumps virus, measles
virus, respiratory syncytial virus); Orthomyxoviridae (e.g.,
influenza viruses); Bungaviridae (e.g., Hantaan viruses, bunga
viruses, phleboviruses and Nairo viruses); Arenaviridae
(hemorrhagic fever viruses); Reoviridae (e.g., reoviruses,
orbivirusles and rotaviruses); Birnaviridae; Hepadnaviridae
(Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae;
Hepadnaviridae (Hepatitis B virus); Parvoviridae (most
adenoviruses); Papovaviridae (papilloma viruses, polyoma viruses);
Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex
virus type 1 (HSV-1) and HSV-2, varicella zoster virus,
cytomegalovirus, herpes viruses; Poxviridae (variola viruses,
vaccinia viruses, pox viruses); Iridoviridae (e.g., African swine
fever virus); and unclassified viruses (e.g., the etiological
agents of Spongiform encephalopathies, the agent of delta hepatitis
(thought to be a defective satellite of hepatitis B virus), the
agents of non-A, non-B hepatitis (class 1=internally transmitted;
class 2=parenterally transmitted, i.e., Hepatitis C); Norwalk and
related viruses, and astroviruses.
[0276] Examples of infectious bacteria include but are not limited
to Helicobacter pyloris, Borelia burgdorferi, Legionella
pneumophilia, Mycobacteria sp. (e.g. M. tuberculosis, M. avium, M.
intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus,
Neisseria gonorrheae, Neisseria meningitidis, Listeria
monocytogenes, Streptococcus pyolfenes (Group A Streptococcus),
Streptococcus agalactiae (Group B Streptococcus), Streptococcus sp.
(viridans group), Streptococcus faecalis, Streptococcus bovis,
Streptococcus sp. (anaerobic species), Streptococcus pneumoniae,
pathogenic Campylobacter sp., Enterococcus sp., Haemophilus
influenzae, Bacillus antracis, Corynebacterium diphtheriae,
Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium
perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella
pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium
nucleatum, Streptobacillus moniliformis, Treponema pallidium,
Treponema pertenue, Leptospira, and Actinomyces israelli.
[0277] Examples of infectious fungi include but are not limited to
Cryptococcus neoformans, Histoplasma capsulaturm, Coccidioides
immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida
albicans. Other infectious organisms include protists such as
Plasmodium falciparum and Toxoplasma gondii.
[0278] The processes and kits provide herein are further
illustrated by the following examples, which should not be
construed as limiting in any way. The contents of all cited
references including literature references, issued patents,
published patent applications as cited throughout this application
are hereby expressly incorporated by reference. The practice of the
processes will employ, unless otherwise indicated, conventional
techniques of cell biology, cell culture, molecular biology,
transgenic biology, microbiology, recombinant DNA, and immunology,
which are within the skill of the art. Such techniques are
explained fully in the literature. See, for example, DNA Cloning,
Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide
Sinthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No:
4,683,194; Nucleic Acid Hybridization (B. D. Hames & S. J.
Higgins eds. 1984); Transcription and Translation (B. D. Hames
& S. J. Higgins eds. 1984); Culture of Animal Cells (R. I.
Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells and Enzymes
(IRL Press, 1986); B. Perbal, A Practical Guide to Molecular
Cloning (1984); the treatise, Methods In Enzymology (Academic
Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J.
H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor
Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al.
eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer
and Walker, eds., Academic Press, London, 1987); Handbook Of
Experimental Immunology, Volumes I-IV (D. M. Weir and C. C.
Blackwell, eds., 1986); Manipulating the Mouse Embryo (Cold Spring
Harbor Laboratory press, Cold Spring Harbor, N.Y., 1986).
[0279] The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
invention.
EXAMPLE 1
[0280] This example demonstrates that genomic DNA obtained from
patients with spinal cerebellar ataxia 1 (SCA-1) can be used to
identify target polypeptides encoded by trinucleotide repeats
associated with SCA-1.
Genomic DNA Amplification
[0281] Human genomic DNA was extracted using the QIAMP Blood Kit
(Qiagen), following the manufacturer's protocol. A region of the
extracted DNA containing the (CAG) repeat associated with SCA-1 was
amplified by PCR using primers modified to contain a transcription
promoter sequence and a region coding for a His-6 tag peptide. The
forward primer had the following nucleotide sequence, in which the
T7 promoter sequence is italicized and the bases on the 5'-side of
the promoter are random:
[0282] 5'-d(GAC TTT ACT TGT ACG TGC ATA ATA CGA CTC ACT ATA GGG AGA
CTG ACC ATG GGC AGT CTG AGC CA) (SEQ ID NO: 6).
[0283] The reverse primer had the following nucleotide sequence, in
which the nucleotide sequence encoding the His-6 tag peptide is
represented in bold and the first six 5'-bases are random:
[0284] 5'-d(TGA TTC TCA ATG ATG ATG ATG ATG ATG AAC TTG AAA TGT GGA
CGT AC) (SEQ ID NO: 7).
[0285] Total reaction volume was 50 .mu.l with 20 pmol primers per
reaction. Taq polymerase including 10X buffer was obtained from
Boehringer Mannheim and dNTPs were obtained from Pharmacia. Cycling
conditions included 5 min at 94.degree. C., followed by 35 cycles
of 30 sec at 94.degree. C., 45 sec at 53.degree. C., 30 sec at
72.degree. C., with a final extension time of 2 min at 72.degree.
C. PCR products were purified using the Qiagen QUIAQUICK kit and
elution of the purified products was performed using 50 .mu.L 10 mM
Tris-HCl buffer (pH 8).
Coupled In Vitro Transcription and Translation
[0286] Coupled transcription and translation was performed using
the TNT reaction buffer (Promega). Reaction components, in a total
volume of 50 .mu.l, were thawed and mixed according to the
manufacturer's protocol, using 1 .mu.l of T7 RNA polymerase and 1
pmol of amplified DNA, except that unlabeled methionine was used in
place of .sup.35S-methionine. The reaction mixture was incubated at
30.degree. C. for 90 min.
Target Polypeptide Purification
[0287] The translated His-6 tagged polypeptide was purified from
the wheat germ extract mixture using the Qiagen QIAEXPRESS Ni-NTA
protein purification system according to the manufacturer's
protocol. Briefly, the extract mixture was washed by centrifugation
through a spin column containing a nickel-nitriloacetic acid resin,
which affinity captures the His-6 peptide tag on the polypeptide.
The polypeptide was eltited from the column with 100 mM
imidazole.
Mass Spectrometry
[0288] The translated polypeptide was mixed with matrix either
directly from the elution solution or first was lyophilized and
resuspended in 5 .mu.l H.sub.2O. This solution was mixed 1:1 (v:v)
with matrix solution (concentrated sinnapinic acid in 50/50 v:v
ethanol/H.sub.2O), and 0.5 .mu.l of the mixture was added to a
sample probe for analysis in a linear time-of-flight mass
spectrometer operated in delayed ion extraction mode with a source
potential of 25 kV. Internal calibration was achieved for all
spectra using three intense matrix ion signals.
RESULTS
[0289] Genomic DNA was obtained from 4 patients having SCA-1, as
described above. Three of the patients had 10, 15, or 16 CAG
repeats and the fourth patient had an unknown number of
trinucleotide repeats.
[0290] A region containing the trinucleotide repeats was PCR
amplified using primers (SEQ ID NOS: 6 and 7) that hybridized to
sequences located on either side of the repeats. The nucleotide
sequence (SEQ ID NO: 8) of a PCR product amplified from a region
containing 10 CAG repeats is shown in FIG. 1A and the amino acid
sequence (SEQ ID NO: 8) of a polypeptide encoded by the amplified
nucleic acid is shown in FIG. 1B (SEQ ID NO. 9).
[0291] The amplified DNA from each patient was subjected to in
vitro transcription and translation, and the target polypeptides
were isolated on a nickel chromatography column. Mass spectrometric
analysis of the peptides encoded by target polypeptides encoded by
the 10, 15, and 16 CAG repeats indicated that these peptides had a
molecular mass of 8238.8, 8865.4, and 8993.6 Daltons, respectively.
The polypeptide encoded by the nucleic acid from the fourth
patient, having an unknown number of trinucleotide repeats, had a
molecular weight of 8224.8 Da. While this value does not correspond
exactly with a unit number of repeats (10 is the closest), it is
consistent with detection of a point mutation; i.e., the -14 Dalton
shift for this polypeptide corresponds to an Ala.fwdarw.Gly
mutation due to a C.fwdarw.(3 mutation in one of the repeats. This
result demonstrates that the disclosed process allows the
identification of a target polypeptide encoded by a genetic lesion
associated with a disease. In addition, the results demonstrate
that such a process allows the detection of a single base
difference between two nucleic acids.
[0292] Detection of such subtle differences in the protein lengths
are not reproducibly obtained with electrophoretic methods even
with use of multiple internal standards. Even low performance MS
instrumentation is capable of far better than 0.1 % mass accuracy
in this mass range using internal calibration; higher performance
instrumentation such as Fourier transform MS is capable of ppm mass
accuracy with internal or external calibration. It is should be
noted that the mass difference between the 15 and 16 repeat unit
polypeptides is 1.4% and the 14 Dalton mass shift due to the point
mutation between the 10 repeat patients is 0.17%. Clearly, each of
these situations can be routinely analyzed successfully.
EXAMPLE 2
1-(2-Nitro-5-(3-O-4,4'-dimethoxytrityll)ropoxy)phenyl)-1-O-((2-cyanoethoxy-
)-diisopropylaminophosphino)ethane
A. 2-Nitro-5-(3-hydroxyprolpoxy)benzaldehyde
[0293] 3-Bromo-1-propanol (3.34 g, 24 mmol) was refluxed in 80 ml
of anhydrous acetonitrile with 5-hydroxy-2-nitrobenzaldehyde (3.34
g, 20 mmol), K.sub.2CO.sub.3 (3.5 g), and KI (100 mg) overnight (15
hr). The reaction mixture was cooled to room temperature and 150 ml
of methylene chloride was added. The mixture was filtered and the
solid residue was washed with methylene chloride. The combined
organic solution was evaporated to dryness and redissolved in 100
ml methylene chloride. The resulted solution was washed with
saturated NaCl solution and dried over sodium sulfate. 4.31 g (96%)
of desired product was obtained after removal of the solvent in
vacuo.
[0294] R.sub.f=0.33 (dichloromethane/methanoil, 95/5).
[0295] UV (methanol) maximum: 313, 240 (shoulder), 215 nm; minimum:
266 nm.
[0296] .sup.1H NMR (DMSO-d.sub.6).delta. 10.28 (s, 1H), 8.17 (d,
1H), 7.35 (d, 1H), 7.22 (s, 1 H), 4.22(t, 2H), 3.54 (t, 2H), 1.90
(m, 2H).
[0297] .sup.13C NMR (DMSO-d.sub.6).delta. 189.9, 153.0, 141.6,
134.3, 127.3, 118.4, 114.0, 66.2, 56.9, 31.7.
B. 2-Nitro-5-(3-O-t-butyidimethylsilylpropoxy)benzaldehyde
[0298] 2-Nitro-5-(3-hydroxypropoxy)benzaldehyde(1 g, 4.44 mmol) was
dissolved in 50 ml anhydrous acetonitrile. To this solution was
added 1 ml of triethylamine, 200 mg of imidazole, and 0.8 g (5.3
mmol) of tBDMSCl. The mixture was stirred at room temperature for 4
hr. Methanol (1 ml) was added to stop the reaction. The solvent was
removed in vacuo and the solid residue was redissolved in 100 ml
methylene chloride. The resulting solution was washed with
saturated sodium bicarbonate solution and then water. The organic
phase was dried over sodium sulfate and the solvent was removed in
vacuo. The crude mixture was subjected to a quick silica gel column
with methylene chloride to yield 1.44 g (96%) of
2-nitro-5-(3-O-t-butyl dimethylsilylpropoxy)benzaldehyde.
[0299] R.sub.f=0.67 (hexane/ethyl acetate, 5/1).
[0300] UV (methanol), maximum: 317, 243, 215 nm; minimum: 235, 267
nm.
[0301] .sup.1H NMR (DMSO-d.sub.6).delta. 10.28 (s, 1H), 8.14 (d,
1H), 7.32 (d, 1H), 7.20 (s, 1H), 4.20 (t, 2H), 3.75 (t, 2H), 1.90
(m, 2H), 0.85 (s, 9H), 0.02 (s, 6H).
[0302] .sup.13C NMR (DMSO-d.sub.6).delta. 189.6, 162.7, 141.5,
134.0, 127.1, 118.2, 113.8, 65.4, 58.5, 31.2, 25.5, -3.1, -5.7.
C. 1
-(2-Nitro-5-(3-O-t-butyidimethylsilylpropoxy)phenyl)ethanol
[0303] High vacuum dried
2-nitro-5-(3-O-t-butyidimethylsilylpropoxy) benzaldehyde (1.02 g, 3
mmol) was dissolved 50 ml of anhydrous methylene chloride. 2 M
trimethylaluminium in toluene (3 ml) was added dropwise within 10
min and the reaction mixture was kept at room temperature. It was
stirred further for 10 min and the mixture was poured into 10 ml
ice cooled water. The emulsion was separated from water phase and
dried over 100 g of sodium sulfate to remove the remaining water.
The solvent was removed in vacuo and the mixture was applied to a
silica gel column with gradient methanol in methylene chloride.
0.94 g (86%) ol desired product was isolated.
[0304] R.sub.f=0.375 (hexane/ethyl acetate, 5/1).
[0305] UV (methanol), maximum: 306, 233, 206 nm; minimum: 255, 220
nm.
[0306] .sup.1H NMR (DMSO-d.sub.6).delta. 8.00 (d, 1H), 7.36 (s,
1H), 7.00 (d, 1H), 5.49 (b, OH), 5.31 (q, 1H), 4.19 (m, 2H), 3.77
(t, 2H), 1.95 (m, 2H), 1.37 (d, 3H), 0.86 (s, 9H), 0.04 (s,
6H).
[0307] .sup.13C NMR (DMSO-d.sub.6).delta. 6 162.6, 146.2, 139.6,
126.9, 112.9, 112.5, 64.8, 63.9, 58.7, 31.5, 25.6, 24.9, -3.4,
-5.8.
D. 1-(2-Nitro-5-(3-hydroxylpropoxy)phenyl)ethanol
[0308]
1-(2-Nitro-5-(3-O-t-butyldimethiylsilylpropoxy)phenyl)ethanol (0.89
g,
[0309] 2.5 mmol) was dissolved in 30 ml of THF and 0.5 mmol of
nBu.sub.4NF was added under stirring. The mixture was stirred at
room temperature for 5 hr and the solvent was removed in vacuo. The
remaining residue was applied to a silica gel column with gradient
methanol in methylene chloride.
1-(2-nitro-5-(3-hydroxypropoxy)phenyl)ethanol (0.6 g (99%) was
obtained.
[0310] R.sub.f=0.17 (dichloromethane/methanol, 95/5).
[0311] UV (methanol), maximum: 304, 232, 210 nm; minimum: 255, 219
nm.
[0312] .sup.1H NMR (DMSO-d.sub.6).delta. 8.00 (d, 1H), 7.33 (s,
1H), 7.00 (d, 1H), 5.50 (d, OH), 5.28 (t, OH), 4.59 (t, 1H), 4.17
(t, 2H), 3.57 (m, 2H), 1.89 (m, 2H), 1.36 (d, 2H).
[0313] .sup.13C NMR (DMOS-d.sub.6).delta. 162.8, 146.3, 139.7,
127.1, 113.1, 112.6, 65.5, 64.0, 57.0, 31.8, 25.0.
E. 1 -(2-Nitro-5-(3-O-4,4'-imethoxytritylpropoxy)phenyl)ethanol
[0314] 1-(2-Nitro-5-(3-hydroxypropoxy)phenyl)ethanol (0.482 g, 2
mmol) was co-evaporated with anhydrous pyridine twice and dissolved
in 20 ml anhydrous pyridine. The solution was cooled in ice water
bath and 750 mg (2.2 mmol) of DMTCl was added. The reaction mixture
was stirred at room temperature overnight and 0.5 ml methanol was
added to stop the reaction. The solvent was removed in vacuo and
the residue was co-evaporated with toluene twice to remove trace of
pyridine. The final residue was applied to a silica gel column with
gradient methanol in methylene chloride containing drops of
triethylamine to yield 0.96 g (89%) of the desired product
1-(2-nitro-5-(3-O-4,4'-dimethoxytrityl-propoxy)phenyl)ethanol.
[0315] R.sub.f=0.5.sup.0 (dichloromethane/methanol, 99/1).
[0316] UV (methanol), maximum: 350 (shoulder), 305, 283, 276
(shoulder), 233, 208 nm; minimum: 290, 258, 220 nm.
[0317] .sup.1H NMR (DMSO-d.sub.6).delta. 8.00 (d, 1H), 6.82-7.42
(ArH), 5.52 (d, OH), 5.32 (m, 1H), 4.23 (t, 2H), 3.71 (s, 6H), 3.17
(t, 2H), 2.00 (m, 2H), 1.37 (d, 3H).
[0318] .sup.13C NMR (DMOS-d.sub.6).delta. 162.5, 157.9, 157.7,
146.1, 144.9, 140.1, 139.7, 135.7, 129.5, 128.8, 127.6, 127.5,
127.3, 126.9, 126.4, 113.0, 112.8, 112.6, 85.2, 65.3, 63.9, 59.0,
54.8, 28.9, 24.9.
F. 1 -(2-Nitro-5-(3-O-4,4'-dimethoxytritylpropoxy)phenyl)-1
-O-((2-cyanoethoxy)-diisopropylaminophosphino)ethane
[0319] 1-(2-Nitro-5-(3-O-4,4'-dimethoxytritylpropoxy)phenyl)ethanol
(400 mg, 0.74 mmol) was dried under high vacuum and was dissolved
in 20 ml of anhydrous methylene chloride. To this solution, it was
added 0.5 ml N,N-diisopropylethylamine and 0.3 ml (1.34 mmol) of
2-cyanoethyl-N,N-diisopropylchlorophosphoramidite. The reaction
mixture was stirred at room temperature for 30 min and 0.5 ml of
methanol was added to stop the reaction. The mixture was washed
with saturated sodium bicarbonate solution and was dried over
sodium sulfate. The solvent was removed in vacuo and a quick silica
gel column with 1% methanol in methylene chloride containing drops
of triethylamine yield 510 mg (93%) the desired
phosphoramidite.
[0320] R.sub.f=0.87 (dichloromethane/methanol, 99/1).
EXAMPLE 3
1-(4-(3-O-4,4'-Dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)- 1
-O-((2-cyanoethoxy)-diisopropylaminophosphino)ethane
A. 4-(3-Hydroxypropoxy)-3-methoxyacetophenone
[0321] 3-Bromo-1-propanol (53 ml, 33 mmol) was refluxed in 100 ml
of anhydrous acetonitrile with 4-hydroxy-3-methoxyacetophenone (5
g, 30 mmol), K.sub.2CO.sub.3 (5 g), and KI (300 mg) overnight (15
h). Methylene chloride (150 ml) was added to the reaction mixture
after cooling to room temperature. The mixture was filtered and the
solid residue was washed with methylene chloride. The combined
organic solution was evaporated to dryness and redissolved in 100
ml methylene chloride. The resulted solution was washed with
saturated NaCl solution and dried over sodium sulfate. 6.5 g
(96.4%) of desired product was obtained after removal of the
solvent in vacuo.
[0322] R.sub.f=0.41 (dichloromethane/methanol, 95/5).
[0323] UV (methanol), maximum: 304, 273, 227, 210 nm: minimum: 291,
244, 214 nm.
[0324] .sup.1H NMR (DMSO-d.sub.6).delta. 7.64 (d, 1H), 7.46 (s,
1H), 7.04 (d, 1H), 4.58 (b, OH), 4.12 (t, 2H), 3.80 (s, 3H), 3.56
(t, 2H), 2.54 (s, 3H), 1.88 (m, 2H).
[0325] .sup.13C NMR (DMSO-d.sub.6).delta. 196.3, 152.5, 148.6,
129.7, 123.1, 111.5, 110.3, 65.4, 57.2, 55.5, 31.9, 26.3.
B. 4-(3-Acetoxypropoxy)-3-methoxyacetophenone
[0326] 4-(3-Hydroxypropoxy)-3-methoxyacetophenone (3.5 g, 15.6
mmol) was dried and dissolved in 80 ml anhydrous acetonitrile. To
this mixture, 6 ml of triethylamine and 6 ml of acetic anhydride
were added. After 4 h, 6 ml methanol was added and the solvent was
removed in vacuo. The residue was dissolved in 100 ml
dichloromethane and the solution was washed with dilute sodium
bicarbonate solution, then water. The organic phase was dried over
sodium sulfate and the solvent was removed. The solid residue was
applied to a silica gel column with methylene chloride to yield 4.1
g of 4-(3-acetoxypropoxy)-3-methoxyacetophenone (98.6%).
[0327] R.sub.f=0.22 (dichloromethane/methanol, 99/1).
[0328] UV (methanol), maximum: 303, 273, 227, 210 nm; minimum: 290,
243, 214 nm.
[0329] .sup.1H NMR (DMSO-d.sub.6).delta. 7.62 (d, 1H), 7.45 (s,
1H), 7.08 (d, 1H), 4.12 (m, 4 H, 3.82 (s, 3H), 2.54 (s, 3H), 2.04
(m, 2H), 2.00 (s, 3H).
[0330] .sup.13C NMR (DMSO-d.sub.6).delta. 196.3, 170.4, 152.2,
148.6, 130.0, 123.0, 111.8, 110.4, 65.2, 60.8, 55.5, 27.9, 26.3,
20.7.
C. 4-(3-Acetoxypropoxy)-3-methoxy-6-nitroacetophenone
[0331] 4-(3-Acetoxypropoxy)-3-methoxyacetophenone (3.99 g, 15 mmol)
was added portionwise to 15 ml of 70% HNO.sub.3 in water bath; the
reaction temperature was maintained at the room temperature. The
reaction mixture was stirred at room temperature for 30 min and 30
g of crushed ice was added. This mixture was extracted with 100 ml
of dichloromethane and the organic phase was washed with saturated
sodium bicarbonate solution. The solution was dried over sodium
sulfate and the solvent was removed in vacuo. The crude mixture was
applied to a silica gel column with gradient methanol in methylene
chloride to yield 3.8 g (81.5%) of desired product
4-(3-acetoxypropoxy)-3-methoxy-6-nitroacetophenone and 0.38 g (8%)
of ipso-substituted product
5-(3-acetoxypropoxy)-4-methoxy-1,2-dinitrobenzen- e. Side
ipso-substituted product 5-(3-acetoxypropoxy)-4-methoxy-1,2-dinitr-
obrenzene:
[0332] R.sub.f=0.47 (dichloromethane/methanol, 99/1).
[0333] UV (methanol), maximum: 334, 330, 270, 240, 212 nm; minimum:
310, 282, 263, 223 nm.
[0334] .sup.1H NMR (CDCl.sub.3).delta. 7.36 (s, 1H), 7.34 (s, 1H),
4.28 (t, 2H), 4.18 (t, 2H), 4.02 (s, 3H), 2.20 (m, 2H), 2.08 (s,
3H).
[0335] .sup.13C NMR (CDCl.sup.3).delta. 170.9, 152.2, 151.1, 117.6,
111.2, 107.9, 107.1, 66.7, 60.6, 56.9, 28.2, 20.9.
[0336] Desired product
4-(3-acetoxypropoxyp-3-methoxy-6-nitroacetophenone:
[0337] R.sub.f=0.29 (dichloromethane/methanol, 99/1).
[0338] UV (methanol), maximum: 344, 300, 246, 213 nm; minimum: 320,
270, 227 nm.
[0339] .sup.1H NMR (CDCl.sub.3).delta. 7.62 (s, 1H), 6.74 (s, 1H),
4.28 (t, 2H), 4.20 (t, 2H), 3.96 (s, 3H), 2.48 (s, 3H), 2.20 (m,
2H), 2.08 (s, 3H)
[0340] .sup.13C NMR (CDCl.sub.3).delta. 200.0, 171.0, 154.3, 148.8,
138.3, 133.0, 108.8, 108.0, 66.1, 60.8, 56.6, 30.4, 28.2, 20.9.
D. 1-(4-(3-Hydroxypropoxy)-3-methoxy-6-nitrophenyl)ethanol
[0341] 4-(3-Acetoxypropoxy)-3-methoxy-6-nitroacetophenone (3.73 g,
12 mmol) was added 150 ml ethanol and 6.5 g of K.sub.2CO.sub.3. The
mixture was stirred at room temperature for 4 hr and TLC with 5%
methanol in dichloromethane indicated the completion of the
reaction. To this same reaction mixture was added 3.5 g of
NaBH.sub.4 and the mixture was stirred at room temperature for 2
hr. Acetone (10 ml) was added to react with the remaining
NaBH.sub.4. The solvent was removed in vacuo and the residue was
uptaken into 50 g of silica gel. The silica gel mixture was applied
on the top of a silica gel column with 5% methanol in methylene
chloride to yield 3.15 g (97%) of desired product
1-(4-(3-hydroxypropoxy)- -3-methoxy-6-nitrophenyl)ethanol.
[0342] Intermediate product
4-(3-hydroxypropoxy)-3-methoxy-6-nitroacetophe- none after
deprotection:
[0343] R.sub.f=0.60 (dichloromethane/methanol, 95/5).
[0344] Final product
1-(4-(3-hydroxypropoxy)-3-methoxy-6-nitrophenyl)ethan- ol:
[0345] R.sub.f=0.50 (dichloromethane/methanol, 95/5).
[0346] UV (methanol), maximum: 344, 300, 243, 219 nm: minimum: 317,
264, 233 nm.
[0347] .sup.1H NMR (DMSO-d.sub.6).delta. 7.54 (s, 1H), 7.36 (s,
1H), 5.47 (d, OH), 5.27 (m, 1H), 4.55 (t, OH), 4.05 (t, 2H), 3.90
(s, 3H), 3.55 (q, 2H), 1.88 (m, 2H), 1.37 (d, 3H).
[0348] .sup.13C NMR (DMSO-d.sub.6).delta. 153.4, 146.4, 138.8,
137.9, 109.0, 108.1, 68.5, 65.9, 57.2, 56.0, 31.9, 29.6.
E.
1-(4-(3-O-4,4'-Dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)ethanol
[0349] 1-(4-(3-Hydroxypropoxy)-3-methoxy-6-nitrophenyl)ethanol
(0.325 g, 1.2 mmol) was co-evaporated with anhydrous pyridine twice
and dissolved in 15 ml anhydrous pyridine. The solution was cooled
in ice-water bath and 450 mg (1.33 mmol) of DMTCI was added. The
reaction mixture was stirred at room temperature overnight and 0.5
ml methanol was added to stop the reaction. The solvent was removed
in vacuo and the residue was co-evaporated with toluene twice to
remove trace of pyridine. The final residue was applied to a silica
gel column with gradient methanol in methylene chloride containing
drops of triethylamine to yield 605 mg (88%) of desired product
1-(4-(3-O-4,4'-dimethoxytritylpropoxy)-3-methoxy-
-6-nitrophenyl)ethanol.
[0350] R.sub.f=0.50 (dichloromethane/methanol, 95/5).
[0351] UV (methanol), maximum: 354, 302, 282, 274, 233, 209 nm;
minimum: 322, 292, 263, 222 nm.
[0352] .sup.1H NMR (DMSO-d.sub.6).delta. 7.54 (s, 1H), 6.8-7.4
(ArH), 5.48 (d, OH), 5.27 (m, 1H), 4.16 (t, 2H), 3.85 (s, 3H), 3.72
(s, 6H), 3.15 (t, 2H), 1.98 (t, 2H), 1.37
[0353] .sup.13C NMR (DMSO-d.sub.6).delta.157.8, 153.3, 146.1,
144.9, 138.7, 137.8, 135.7, 129.4, 128.7, 127.5, 127.4, 126.3,
112.9, 112.6, 108.9, 108.2,85.1,65.7, 63.7, 59.2, 55.8, 54.8, 29.0,
25.0.
[0354] F.
1-(4-(3-O-4,4'-Dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)-- 1
-O-((2-cyanoethoxy)-diisopropylaminophospino)ethane
[0355]
1-(4-(3-O-4,4'-Dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)etha-
nol (200 mg, 3.5 mmol) was dried under high vacuum and was
dissolved in 15 ml of anhydrous methylene chloride. To this
solution, it was added 0.5 ml N,N-diisopropylethylamine and 0.2 ml
(0.89 mmol) of 2-cyanoethyl-N,N-diisoproylcholorophosphoramidite.
The reacation mixture was stirred at room temperature for 30 min
and 0.5 ml of methanol was added to stop the reaction. The mixture
was washed with saturated sodium bicarbonate solution and was dried
over sodium sulfate. The solvent was removed in vacuo and a quick
silica gel column with 1% methanol in methylene chloride containing
drops of triethylamine yield 247 mg (91.3%) the desired
phosphoramidite 1-(4-(3-O-4,4'-dimethoxytritylpropoxy)-3-meth-
oxy-6-nitrophenyl)-1-O-((2-cyanoethoxy)-diisopropylaminophosphino)ethane.
R.sub.f=0.87 (dichloromethane/methanol, 99/1).
[0356] Since modifications will be apparent to those of skill in
this art, it is intended that this invention be limited only by the
scope of the appended claims.
Sequence CWU 1
1
9 1 24 DNA Bacteriophage SP6 promoter (1)..(24) SP6 promoter
sequence (single-stranded) 1 catacgattt aggtgacact atag 24 2 18 DNA
Bacteriophage SP6 promoter (1)..(18) SP6 promoter sequence
(single-stranded) 2 atttaggtga cactatag 18 3 20 DNA Bacteriophage
T3 promoter (1)..(20) T3 promoter sequence (single-stranded) 3
attaaccctc actaaaggga 20 4 20 DNA Bacteriophage T7 promoter
(1)..(20) T7 promoter sequence (single-stranded) 4 taatacgact
cactataggg 20 5 8 DNA Prokaryote misc_feature (1)..(8) Primer
sequence containing the Shine-Dalgarno (prokaryotic ribosome
binding) sequence 5 taaggagg 8 6 65 DNA Artificial Sequence
Description of Artificial Sequence Primer containing T7 promoter
sequence 6 gactttactt gtacgtgcat aatacgactc actataggga gactgaccat
gggcagtctg 60 agcca 65 7 47 DNA Artificial Sequence Description of
Artificial Sequence Primer encoding His-6 "tag" peptide 7
tgattctcaa tgatgatgat gatgatgaac ttgaaatgtg gacgtac 47 8 270 DNA
Homo sapiens repeat_region (88)..(162) "CAG" repeat region
associated with spinal cerebellar ataxia 1 (SCA-1) 8 gactttactt
gtacgtgcat aatacgactc actataggga gactgaac 48 atg ggc agt ctg agc
cag acg ccg gga cac aag gct gag cag cag cag 96 Met Gly Ser Leu Ser
Gln Thr Pro Gly His Lys Ala Glu Gln Gln Gln 1 5 10 15 cag cag cag
cag cag cag cag cag cag cat cag cat cag cag cag cag 144 Gln Gln Gln
Gln Gln Gln Gln Gln Gln His Gln His Gln Gln Gln Gln 20 25 30 cag
cag cag cag cag cag cac ctc acg agg gct ccg ggc ctc atc acc 192 Gln
Gln Gln Gln Gln Gln His Leu Ser Arg Ala Pro Gly Leu Ile Thr 35 40
45 ccg ggt ccc ccc cac cag ccc agc aga acc agt acg tcc aca ttt caa
240 Pro Gly Pro Pro Gly Gln Pro Ser Arg Thr Ser Thr Ser Thr Gly Gln
50 55 60 gtt cat cat cat cat cat cat tgagaatca 270 Val His His His
His His His 65 70 9 71 PRT Homo sapiens REPEAT (14)..(38) "Gln"
repeat region associated with spinal cerebellar ataxia 1 (SCA-1) 9
Met Gly Ser Leu Ser Gln Thr Pro Gly His Lys Ala Glu Gln Gln Gln 1 5
10 15 Gln Gln Gln Gln Gln Gln Gln Gln Gln His Gln His Gln Gln Gln
Gln 20 25 30 Gln Gln Gln Gln Gln Gln His Leu Ser Arg Ala Pro Gly
Leu Ile Thr 35 40 45 Pro Gly Pro Pro Gly Gln Pro Ser Arg Thr Ser
Thr Ser Thr Gly Gln 50 55 60 Val His His His His His His 65 70
* * * * *