U.S. patent application number 09/991119 was filed with the patent office on 2002-12-26 for glial cell line-derived neurotrophic factor.
This patent application is currently assigned to Amgen Inc.. Invention is credited to Bektesh, Susan, Collins, Franklin D., Doherty, Daniel H., Lile, Jack, Lin, Leu-Fen H..
Application Number | 20020197675 09/991119 |
Document ID | / |
Family ID | 27505700 |
Filed Date | 2002-12-26 |
United States Patent
Application |
20020197675 |
Kind Code |
A1 |
Lin, Leu-Fen H. ; et
al. |
December 26, 2002 |
Glial cell line-derived neurotrophic factor
Abstract
A novel neurotrophic factor referred to as glial derived
neurotrophic factor (GDNF) has been identified and isolated from
serum free growth conditioned medium of B49 glioblastoma cells. Rat
and human genes encoding GDNF have been cloned and sequenced. A
gene encoding GDNF has been subcloned into a vector, and the vector
has been used to transform a host cell in order to produce
biologically active GDNF in a recombinant DNA process.
Inventors: |
Lin, Leu-Fen H.; (Boulder,
CO) ; Collins, Franklin D.; (Agoura Hills, CA)
; Doherty, Daniel H.; (Boulder, CO) ; Lile,
Jack; (Nederland, CO) ; Bektesh, Susan;
(Boulder, CO) |
Correspondence
Address: |
U. S. Patent Operations/ RKL
Dept. 4300, M/S 27-4-A
AMGEN, INC.
One Amgen Center Drive
Thousand Oaks
CA
91320-1799
US
|
Assignee: |
Amgen Inc.
|
Family ID: |
27505700 |
Appl. No.: |
09/991119 |
Filed: |
November 13, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09991119 |
Nov 13, 2001 |
|
|
|
08452229 |
May 26, 1995 |
|
|
|
08452229 |
May 26, 1995 |
|
|
|
08182183 |
May 23, 1994 |
|
|
|
08182183 |
May 23, 1994 |
|
|
|
PCT/US92/07888 |
Sep 17, 1992 |
|
|
|
PCT/US92/07888 |
Sep 17, 1992 |
|
|
|
07855413 |
Mar 19, 1992 |
|
|
|
07855413 |
Mar 19, 1992 |
|
|
|
07788423 |
Nov 6, 1991 |
|
|
|
07788423 |
Nov 6, 1991 |
|
|
|
07774109 |
Oct 8, 1991 |
|
|
|
07774109 |
Oct 8, 1991 |
|
|
|
07764685 |
Sep 20, 1991 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 514/18.2; 514/8.3; 514/8.4; 530/350; 530/387.1;
536/23.5 |
Current CPC
Class: |
A61P 25/00 20180101;
C07K 14/475 20130101; Y10S 530/839 20130101; Y10S 530/809 20130101;
A61P 25/16 20180101; A61K 9/0085 20130101; A61P 25/28 20180101;
A61K 38/00 20130101; A61P 25/26 20180101 |
Class at
Publication: |
435/69.1 ;
530/350; 536/23.5; 435/320.1; 435/325; 514/12; 530/387.1 |
International
Class: |
A61K 038/00; C07K
001/00; C07K 016/00; C07K 017/00; C07K 014/00; C12N 005/02; C12N
005/00; C12N 015/74; C12N 015/70; C12N 015/63; C12N 015/09; C12N
015/00; C12P 021/06; C07H 021/04 |
Claims
1. Substantially purified glial derived neurotrophic factor.
2. The substantially purified glial derived neurotrophic factor of
claim 1 having a specific activity of at least about 12,000
TU/.mu.g.
3. The substantially purified glial derived neurotrophic factor of
claim 1 having a specific activity at least about 24,000 times
greater than the specific activity of B49 conditioned medium.
4. The substantially purified glial derived neurotrophic factor of
claim 1 having a molecular weight of about 31-42 kD on non-reducing
SDS-PAGE.
5. The substantially purified glial derived neurotrophic factor of
claim 4 comprising a dimeric polypeptide species having a specific
activity of at least about 12,000 TU/.mu.g.
6. The substantially purified glial derived neurotrophic factor of
claim 1 having a molecular weight of about 20-23 kD on reducing
SDS-PAGE.
7. The substantially purified glial derived neurotrophic factor of
claim 6 comprising a monomeric polypeptide sequence.
8. The substantially purified glial derived neurotrophic factor of
claim 1 comprising an amino acid sequence as follows:
(Ser)-Pro-Asp-Lys-Gln-Ala-A- la-Ala-Leu-Pro-Arg-Arg-Glu-(Arg)-Asn-(
)-Gln-Ala-Ala-Ala-Ala-(Ser)-Pro-(As- p)-(Asn)
9. The substantially purified glial derived neurotrophic factor of
claim 1 comprising the amino acid sequence of mature rat glial
derived neurotrophic factor as set forth in FIG. 14 (SEQ ID
NO:4).
10. The substantially purified glial derived neurotrophic factor of
claim 1 comprising the amino acid sequence of mature human glial
derived neurotrophic factor as set forth in FIG. 19 (SEQ ID
NO:5).
11. A substantially purified glial derived neurotrophic factor
characterized by the following: (a) an apparent molecular weight of
about 31-42 kD on non-reducing SDS-PAGE; (b) an apparent molecular
weight of about 20-23 kD on reducing SDS-PAGE; and (c) a specific
activity of at least about 12,000 TU/mg.
12. The substantially purified protein glial derived neurotrophic
factor of claim 11 further characterized by comprising the amino
acid sequence of mature rat glial derived neurotrophic factor as
set forth in FIG. 14 (SEQ ID NO:4)
13. The substantially purified protein glial derived neurotrophic
factor of claim 11 further characterized by comprising the amino
acid sequence of mature human glial derived neurotrophic factor as
set forth in FIG. 19 (SEQ ID NO:5).
14. The substantially purified glial derived neurotrophic factor of
claim 11 produced by recombinant DNA technology.
15. The substantially purified glial derived neurotrophic factor of
claim 1 produced by recombinant DNA technology.
16. The substantially purified glial derived neurotrophic factor of
claim 15 comprising the amino acid sequence of mature rat glial
derived neurotrophic factor as set forth in FIG. 14 (SEQ ID
NO:4).
17. The substantially purified glial derived neurotrophic factor of
claim 15 comprising the amino acid sequence of mature human glial
derived neurotrophic factor as set forth in FIG. 19 (SEQ ID
NO:5).
18. A pharmaceutical composition comprising an effective amount of
substantially purified glial derived neurotrophic factor in a
pharmaceutically suitable carrier.
19. The pharmaceutical composition of claim 18 wherein said factor
is comprised of the amino acid sequence of mature rat glial derived
neurotrophic factor as set forth in FIG. 14 (SEQ ID NO:4).
20. The pharmaceutical composition of claim 18 wherein said factor
is comprised of the amino acid sequence of mature human glial
derived neurotrophic factor as set forth in FIG. 19 (SEQ ID
NO:5).
21. The pharmaceutical composition of claim 18 wherein said factor
is produced by recombinant DNA technology.
22. The pharmaceutical composition of claim 21 wherein said factor
is comprised of the amino acid sequence of mature rat glial derived
neurotrophic factor as set forth in FIG. 14 (SEQ ID NO:4).
23. The pharmaceutical composition of claim 21 wherein said factor
is comprised of the amino acid sequence of mature human glial
derived neurotrophic factor as set forth in FIG. 19 (SEQ ID
NO:5).
24. A method for obtaining substantially purified glial derived
neurotrophic factor comprising: preparing a serum-free
growth-conditioned medium of B49 glioblastoma cells; concentrating
the conditioned medium; performing heparin sepharose chromatography
on the concentrated conditioned medium; performing fast protein
liquid chromatography or fractions obtained from said heparin
sepharose chromatography; and performing reverse-phase
high-performance liquid chromatography or fractions obtained from
said fast protein liquid chromatography.
25. The method of claim 24 further comprising: subjecting fractions
obtained by reverse-phase high performance liquid chromatography to
preparative SDS-PAGE; and performing reverse-phase high-performance
liquid chromatography on fractions obtained by preparative
SDS-PAGE.
26. A purified and isolated nucleic acid sequence encoding glial
derived neurotrophic factor.
27. The nucleic acid sequence of claim 26 comprised of the rat
nucleic acid sequence encoding mature rat glial derived
neurotrophic factor as set forth in FIG. 13 (SEQ ID NO:3).
28. The nucleic acid sequence of claim 26 comprised of the human
nucleic acid sequence encoding mature human glial derived
neurotrophic factor as set forth in FIG. 19 (SEQ ID NO:5).
29. A purified and isolated nucleic acid sequence encoding pre-pro
glial derived neurotrophic factor.
30. The nucleic acid sequence of claim 28 comprised of the human
nucleic acid sequence encoding pre-pro rat glial derived
neurotrophic factor as set forth in FIG. 13 (SEQ ID NO:3).
31. The nucleic acid sequence of claim 28 comprised of the human
nucleic acid sequence encoding pre-pro human glial derived
neurotrophic factor as set forth in FIGS. 19 (SEQ ID NO:5) and 22
(SEQ ID NO:8).
32. The nucleic acid sequence of claim 26 encoding mature rat glial
derived neurotrophic factor.
33. The nucleic acid sequence of claim 32 encoding the amino acid
sequence of mature rat glial derived neurotrophic factor as set
forth in FIG. 14 (SEQ ID NO:4).
34. The nucleic acid sequence of claim 26 encoding mature human
glial derived neurotrophic factor.
35. The nucleic acid sequence of claim 34 encoding the amino acid
sequence of mature human glial derived neurotrophic factor as set
forth in FIG. 19 (SEQ ID NO:5).
36. The nucleic acid sequence of claim 26 encoding GDNF selected
from the group consisting of: (a) a nucleic acid sequence which
encodes the amino acid sequence for pre-pro rat GDNF set forth in
FIG. 13 (SEQ ID NO:3); (b) a nucleic acid sequence which encodes
the amino acid sequence for mature rat GDNF set forth in FIG. 13
(SEQ ID NO:3); (c) a nucleic acid sequence which encodes the amino
acid sequence for pre-pro human GDNF set forth in FIGS. 19 (SEQ ID
NO:5) and 22 (SEQ ID NO:8); (d) a nucleic acid sequence which
encodes the amino acid sequence for mature human GDNF set forth in
FIG. 19 (SEQ ID NO:5); (e) a nucleic acid sequence which encodes an
amino acid sequence with dopaminergic activity, and said amino acid
sequence is recognized by an antibody which binds to a portion of
GDNF; and (f) a nucleic acid sequence which (1) hybridizes to the
complementary sequence of (a), (b), (c) or (d) and (2) encodes an
amino acid sequence with dopaminergic activity.
37. A method for preventing or treating nerve damage which
comprises administering to a patient in need thereof a
therapeutically effective amount of glial derived neurotrophic
factor.
38. The method of claim 37 wherein said nerve damage is Parkinson's
disease.
39. A pharmaceutical composition for preventing or treating
Parkinson's disease comprising an effective amount of glial derived
neurotrophic factor in a pharmaceutically suitable carrier.
40. A pharmaceutical composition for preventing or treating damaged
or improperly functioning dopaminergic nerve cells comprising an
effective amount of glial derived neurotrophic factor in a
pharmaceutically suitable carrier.
41. A method for preventing damage to or treating damaged or
improperly functioning dopaminergic nerve cells which comprises
administering to a patient in need thereof a therapeutically
effective amount of glial derived neurotrophic factor.
42. A recombinant DNA molecule comprising expression regulatory
elements operatively linked to a nucleic acid sequence encoding
glial derived neurotrophic factor.
43. A host cell transformed with the vector of claim 42.
44. A recombinant DNA method for production of glial derived
neurotrophic factor comprising: (a) subcloning a DNA sequence
encoding for glial derived neurotrophic factor into an expression
vector which comprises the regulatory elements needed to express
the DNA sequence; (b) transforming a host cell with said expression
vector; (c) culturing the host cells under conditions for
amplification of the vector and expression of glial derived
neurotrophic factor; and (d) harvesting the glial derived
neurotrophic factor from the host cell culture.
45. The recombinant DNA method of claim 44 wherein said host cell
is an animal cell.
46. The recombinant DNA method of claim 45 wherein said host cell
is COS-7 cells.
47. The recombinant DNA method of claim 44 wherein said host cell
is a bacterial cell.
48. The recombinant DNA method of claim 47 wherein said host cell
is E. coli.
49. The recombinant DNA method of claim 48 further comprising the
step of refolding the harvested glial derived neurotrophic
factor.
50. A recombinant DNA method for production of glial derived
neurotrophic factor comprising: (a) culturing the host cell of
claim 43 under conditions for amplification of the vector and
expression of glial derived neurotrophic factor; and (b) harvesting
the glial derived neurotrophic factor from the host cell
culture.
51. The recombinant DNA method of claim 50 wherein said host cell
is an animal cell.
52. The recombinant DNA method of claim 51 wherein said host cell
is COS-7 cells.
53. The recombinant DNA method of claim 50 wherein said host cell
is a bacterial cell.
54. The recombinant DNA method of claim 53 wherein said host cell
is E. coli.
55. The recombinant DNA method of claim 54 further comprising the
step of refolding the harvested glial derived neurotrophic
factor.
56. Substantially purified glial derived neurotrophic factor
prepared according to the method of claim 24.
57. Substantially purified glial derived neurotrophic factor
prepared according to the method of claim 55.
58. Substantially purified glial derived neurotrophic factor
prepared according to the method of claim 44.
59. Substantially purified glial derived neurotrophic factor
prepared according to the method of claim 50.
60. Substantially purified antibodies that recognize glial derived
neurotrophic factor.
61. The antibodies of claim 60 wherein said antibodies are
monoclonal.
62. The antibodies of claim 60 wherein said antibodies are
polyclonal.
63. A method for preventing or treating nerve damage which
comprises implanting cells that secrete glial derived neurotrophic
factor into the body of patients in need thereof.
64. The method of claim 63 wherein said patient is suffering from
Parkinson's disease.
65. The method of claim 63 wherein said cells are the cells of
claim 42.
66. The method of claim 63 wherein said cells are naturally
occurring cells that secrete glial derived neurotrophic factor.
67. The method of claim 63 wherein said cells are maintained within
a biocompatible, semipermeable membrane.
68. The method of claim 63 wherein said glial derived neurotrophic
factor is comprised of the amino acid sequence of mature human
glial derived neurotrophic factor as set forth in FIG. 19 (SEQ ID
NO:5).
69. The method of claim 63 wherein said glial derived neurotrophic
factor is comprised of the amino acid sequence of mature rat glial
derived neurotrophic factor as set forth in FIG. 14 (SEQ ID
NO:4).
70. A device for preventing or treating nerve damage by
implantation in a patient comprising: a semipermeable membrane; and
a cell that secretes glial derived neurotrophic factor encapsulated
within said membrane, said membrane being permeable to said glial
derived neurotrophic factor, and impermeable to factors from said
patents detrimental to said cells.
71. The device of claim 70 wherein said cells are the cells of
claim 42.
72. The device of claim 70 wherein said cells are naturally
occurring cells that secrete glial derived neurotrophic factor.
73. The device of claim 70 wherein said glial derived neurotrophic
factor is comprised of the amino acid sequence of mature human
glial derived neurotrophic factor as set forth in FIG. 19 (SEQ ID
NO:5).
74. The device of claim 70 wherein said glial derived neurotrophic
factor is comprised of the amino acid sequence of mature rat glial
derived neurotrophic factor as set forth in FIG. 14 (SEQ ID NO:4).
Description
FIELD OF THE INVENTION
[0001] The present invention relates to neurotrophic factors and
glial derived neurotrophic factor (GDNF) in particular. Also
included within this invention are processes for purification of
GDNF from natural sources and processes for cloning rat and human
genes encoding GDNF, as well as the nucleic acid sequence of the
rat and human genes that encode GDNF. The GDNF gene has been
subcloned into an expression vector, and the vector used to express
biologically active GDNF. In addition, this invention includes the
use of GDNF for preventing and treating nerve damage and nerve
related diseases such as Parkinson's disease.
[0002] Antibodies to GDNF are disclosed, as well as methods for
identifying members of the GDNF family of neurotrophic factors. And
finally, methods are described for preventing or treating nerve
damage by implanting into patients cells that secrete GDNF.
BACKGROUND OF THE INVENTION
[0003] Neurotrophic factors are natural proteins, found in the
nervous system or in non-nerve tissues innervated by the nervous
system, whose function is to promote the survival and maintain the
phenotypic differentiation of nerve and/or glial cells (Varon and
Bunge 1979 Ann. Rev. Neuroscience 1:327; Thoenen and Edgar 1985
Science 229:238). Because of this physiological role, neurotrophic
factors may be useful in treating the degeneration of nerve cells
and loss of differentiated function that occurs in a variety of
neurodegenerative diseases.
[0004] In order for a particular neurotrophic factor to be
potentially useful in treating nerve damage, the class or classes
of damaged nerve cells must be responsive to the factor. Different
neurotrophic factors typically affect distinctly different classes
of nerve cells. Therefore, it is advisable to have on hand a
variety of different neurotrophic factors to treat each of the
classes of damaged neurons that may occur with different forms of
disease or injury.
[0005] Neurotrophic factors can protect responsive neurons against
a variety of unrelated insults. For example, the neurotrophic
factor nerve growth factor (NGF) will rescue a significant portion
of sensory neurons from death caused by cutting their axonal
processes (Rich et al. 1987 J. Neurocytol 16:261; Otto et al. 1987
J. Neurosci 83:156), from ontogenetic death during embryonic
development (Hamburger et al. 1984 J. Neurosci 4:767), and from
damage caused by administration of taxol or cisplatin (Apfel et al.
1991 Ann Neurol. 29: 87). This apparent generality of protection
has lead to the concept that if a neurotrophic factor protects
responsive neurons against experimental damage, it may be useful in
treating diseases that involve damage to those neurons in patients,
even though the etiology may be unknown.
[0006] A given neurotrophic factor, in addition to having the
correct neuronal specificity, must be available in sufficient
quantity to be used as a pharmaceutical treatment. Since
neurotrophic factors are typically present in vanishingly small
amounts in tissues (e.g., Hofer and Barde 1988 Nature 331:261; Lin
et al. 1989 Science 246:1023), it would be inconvenient to prepare
pharmaceutical quantities of neurotrophic factors directly from
animal tissues. As an alternative, it would be desirable to locate
the gene for a neurotrophic factor and use that gene as the basis
for establishing a recombinant expression system to produce
potentially unlimited amounts of the protein.
[0007] The inventors of this application describe a method for
screening biological samples for neurotrophic activity on the
embryonic precursors of the substantia nigra dopaminergic neurons
that degenerate in Parkinson's disease. This bioassay for
identifying neurotrophic factors that may be useful in treating
Parkinson's disease is based on an assay previously described
(Friedman et al. 1987 Neuro. Sci. Lett. 79:65-72, specifically
incorporated herein by this reference) and implemented with
modifications in the present invention. This assay was used to
screen various potential sources for neurotrophic activity directed
to dopaminergic neurons. The present invention describes the
characterization of a new neurotrophic factor that was purified
from one such source, the conditioned culture medium from a
glioblastoma cell line, B49 (Schubert et al. 1974 Nature
249:224-27, specifically incorporated herein by this reference).
The conditioned medium from this cell line was previously reported
to contain dopaminergic neurotrophic activity (Bohn et al. 1989
Soc. Neurosci. Abs. 15:277). In this previous report, the source of
the neurotrophic activity was not purified, characterized
chemically, or shown to be the consequence of a single agent in the
conditioned medium. Nerve damage is caused by conditions that
compromise the survival and/or proper function of one or more types
of nerve cells. Such nerve damage may occur from a wide variety of
different causes, some of which are indicated below.
[0008] Nerve damage may occur through physical injury, which causes
the degeneration of the axonal processes and/or nerve cell bodies
near the site of injury. Nerve damage may also occur because of
temporary or permanent cessation of blood flow to parts of the
nervous system, as in stroke. Nerve damage may also occur because
of intentional or accidental exposure to neurotoxins, such as the
cancer and AIDS chemotherapeutic agents cisplatinum and
dideoxycytidine (ddC), respectively. Nerve damage may also occur
because of chronic metabolic diseases, such as diabetes or renal
dysfunction. Nerve damage may also occur because of
neurodegenerative diseases such as Parkinson's disease, Alzheimer's
disease, and Amyotrophic Lateral Sclerosis (ALS), which result from
the degeneration of specific neuronal populations.
[0009] This application describes a novel neurotrophic factor.
Neurotrophic factors are natural proteins that promote the normal
functions of specific nerve cells and/or protect the same cells
against a variety of different forms of damage. It is these
properties that suggest that GDNF may be useful in treating various
forms of nerve damage, including those forms indicated specifically
above.
[0010] Parkinson's disease is identified by a unique set of
symptoms that include rigidity, bradykinesis, seborrhea,
festination gait, flexed posture, salivation, and a "pill rolling"
tremor. The disease is encountered in all races throughout the
world, and the average age of onset is 60 years.
[0011] After years of conflicting theories and controversy, a
biochemical basis for Parkinson's disease has emerged as the major
cause. (See, e.g., Bergman, 1990 Drug Store News, 12:IP19.) Of
significant importance to an understanding of Parkinson's disease
are the areas of the brain known as the substantia nigra the basal
ganglia, and particularly, the corpus striatum. The substantia
nigra, a bilaterally paired layer of pigmented gray matter in the
mid-brain, is involved with dopamine transmission, while the normal
basal ganglia function involves a series of interactions and
feedback systems which are associated with the substantia nigra and
mediated in part by dopamine, acetylcholine and other
substances.
[0012] In Parkinson's disease, there is a dysfunction in the
dopaminergic activity of the substantia nigra which is caused by
neuronal degeneration. This results in a state of dopamine
deficiency and a shift in the balance of activity to a cholinergic
predominance. Therefore, although there is no increase in the
concentration of acetylcholine, the excitatory effects on the
central nervous system (i.e., tremors) by this cholinergic mediator
overwhelm the inhibiting effects of the depleted dopamine.
[0013] The most effective treatment for Parkinson's disease to date
is the oral administration of Levodopa. Levodopa penetrates the
central nervous system and is enzymatically converted to dopamine
in the basal ganglia. It is believed that beneficial effects of
Levodopa are, therefore, in increasing the concentration of
dopamine in the brain. Unfortunately, neither Levodopa or any of
the less commonly utilized medications actually stem the
progression of the disease which is caused by the degeneration of
dopaminergic neurons.
[0014] Other researchers have reported the existence of
dopaminergic activity in various biological sources. In PCT
publication WO91/01739 of Springer et al., a dopaminergic
neurotrophic activity was identified in an extract derived from
cells of the peripheral nervous system. The activity identified was
not purified; but was attributed to a factor having a molecular
weight of less than 10,000 daltons. The factor was isolated from
rat sciatic nerve but is apparently not CNTF, which is also found
in the nerve (Lin et al. 1989 Science 246:1023).
[0015] In U.S. Pat. No. 5,017,735 of Appel et al., dopaminergic
activity was identified in an extract from caudate-putamen tissue.
Again, no factors giving rise to the activity were purified and the
apparent molecular weight of the activity containing fractions was
relatively small. See also, Niijima et al. 1990 Brain Res.
528:151-154 (chemically deafferented striatum of adult rat brain);
Lo et al. 1990 Soc. Neurosci. Abstr., 16:809 (striatal-derived
neurotrophic factor). In addition, other known neurotrophic factors
have also been shown to have dopaminergic activity, e.g., Brain
derived neurotrophic factor (BDNF), and acidic and basic Fibroblast
Growth Factors.
[0016] The GNDF of the present invention was isolated based on its
ability to promote the functional activity and survival in cell
culture of dopaminergic nerve cells isolated from the rat embryo
mesencephalon. These dopaminergic nerve cells are the embryonic
precursor of the dopaminergic nerve cells in the adult substantia
nigra that degenerate in Parkinson's disease. Therefore, GDNF may
be useful in reducing the neuronal degeneration that causes the
symptoms of Parkinson's disease.
[0017] Furthermore, GDNF may be useful in treating other forms of
damage to or improper function of dopaminergic nerve cells in human
patients. Such damage or malfunction may occur in schizophrenia and
other forms of psychosis. Current treatments for such conditions
often require drugs active at dopamine receptors, suggesting that
improper function of the dopaminergic neurons innervating these
receptor-bearing neuronal populations may be involved in the
disease process.
[0018] Based on previous experience with other neurotrophic
factors, new forms of nerve damage that may be treated with GDNF
will emerge as more is learned about the various types of nerve
cells that are responsive to this neurotrophic factor. For example,
nerve growth factor (NGF) only emerged as a potentially useful
treatment for Alzheimer's disease when it was recently discovered
that NGF acts as a neurotrophic factor for the basal forebrain
cholinergic neurons that degenerate in Alzheimer's disease.
(Williams, et al. 1986 Proc. Natl. Acad. Sci. USA 83:9231). Methods
are provided in the present invention for determining other forms
of nerve damage that may be usefully treated with GDNF.
[0019] Patrick Aebischer and coworkers have described the use of
semipermeable, implantable membrane devices that are useful as
means for delivering drugs or medicaments in certain circumstances.
For example, they have proposed the encapsulation of cells that
secrete neurotransmitter factors, and the implantation of such
devices into the brain of patients suffering from Parkinson's
Disease. See, U.S. Pat. No. 4,892,538 of Aebischer et al.; U.S.
Pat. No. 5,011,472 of Aebischer et al.; U.S. Pat. No. 5,106,627 of
Aebisher et al.; PCT Application WO 91/10425; PCT Application WO
91/10470; Winn et al. 1991 Exper. Neurol. 113:322-329; Aebischer et
al. 1991 Exper. Neurol. 111:269-275; and Tresco et al. 1992 ASAIO
38:17-23.
SUMMARY OF THE INVENTION
[0020] This invention relates to and claims substantially purified
glial derived neurotrophic factor (GDNF). In one embodiment of this
invention, substantially purified GDNF is obtained having a
specific activity at least about 24,000 times greater than the
specific activity of B49 conditioned medium. The substantially
purified GDNF has a specific activity of at least about 12,000
TU/.mu.g.
[0021] The substantially purified GDNF of the present invention has
an apparent molecular weight of about 31-42 kD on non-reducing
SDS-PAGE, and about 20-23 kD on reducing SDS-PAGE. The
substantially purified GDNF has an amino terminal sequence
comprised substantially of the amino acid sequence (SEQ ID NO:1):
(Ser)-Pro-Asp-Lys-Gln-Ala-Ala-Ala-Leu-Pro-Arg-Arg- -Glu-(Arg)-Asn-(
)-Gln-Ala-Ala-Ala-Ala-(Ser)-Pro-(Asp)-(Asn). The amino acid
sequence of mature and "pre-pro" forms of rat GDNF is as set forth
in FIGS. 13 and 14 (SEQ ID NO:3 and SEQ ID NO:4). The amino acid
sequence of mature human GDNF is as set forth in FIG. 19 (SEQ ID
NO:5). The amino acid sequence of the pre-pro form of human GDNF is
set forth in FIGS. 19 (SEQ ID NO:5) and 22 (SEQ ID NO:8).
[0022] One aspect of the invention is a method for obtaining
purified GDNF comprising: 1) preparing a serum-free growth
conditioned medium of B49 glioblastoma cells; 2) concentrating the
conditioned medium; 3) performing heparin sepharose chromatography
on the concentrated conditioned medium; 4) performing fast protein
liquid chromatography on fractions obtained from said heparin
sepharose chromatography; and 5) performing reverse-phase
high-performance liquid chromatography on fractions obtained from
said fast protein liquid chromatography. In one embodiment, the
method of obtaining purified GDNF is further comprised of the
steps: 6) subjecting fractions obtained by reverse-phase high
performance liquid chromatography to preparative SDS-PAGE; and 7)
performing reverse-phase high-performance liquid chromatography on
factions obtained by preparative SDS-PAGE.
[0023] Also described is the cloning of the rat GDNF gene from a
cDNA library prepared from the B49 cell line The nucleic acid
sequence encoding mature and pre-pro rat GDNF is set forth in FIG.
13 (SEQ ID NO:3). The method for obtaining a human gene coding for
GDNF is also disclosed. The nucleic acid sequence encoding mature
human GDNF is as set forth in FIG. 19 (SEQ ID NO:5). The nucleic
acid sequence encoding the first 50 amino acids of the pre-pro
segment of human GDNF is as set forth in FIG. 22 (SEQ ID NO:8).
[0024] This invention also includes pharmaceutical compositions
comprising an effective amount of purified GDNF in a
pharmaceutically suitable carrier. Also described is a method for
preventing or treating nerve damage which comprises administering
to a patient in need thereof a therapeutically affective amount of
GDNF. In preferred embodiments, the nerve damage is Parkinson's
disease or damaged or improperly functioning dopaminergic nerve
cells.
[0025] In the preferred embodiment of this invention, GDNF is
produced by recombinant DNA methods, utilizing the genes coding for
GDNF as described herein. The present invention includes a vector
for use in producing biologically active GDNF comprised of
expression regulatory elements operatively linked to a nucleic acid
sequence coding for mature or pre-pro GDNF, and a host cell
transformed by such a vector. Also included is a recombinant DNA
method for the production of GDNF comprising: subcloning a DNA
sequence coding for GDNF into an expression vector which comprises
the regulatory elements needed to express the DNA sequence;
transforming a host cell with said expression vector; culturing the
host cells under conditions for amplification of the vector and
expression of GDNF; and harvesting the GDNF.
[0026] A recombinant DNA method is described for the production of
GDNF comprising: culturing the host cells of this invention under
conditions for amplification of the vector and expression of GDNF;
and harvesting the GDNF.
[0027] This invention includes substantially purified antibodies
that recognize GDNF. Also included is a method for preventing or
treating nerve damage which comprises implanting cells that secrete
glial derived neurotrophic factor into the body of patients in need
thereof. Finally, the present invention includes a device for
preventing or treating nerve damage by implantation into a patient
comprising a semipermeable membrane, and a cell that secretes GDNF
encapsulated within said membrane and said membrane being permeable
to GDNF and impermeable to factors from the patient detrimental to
the cells.
DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 depicts the results of heparin sepharose
chromatography on a solution of concentrated B49 glioblastoma cells
serum-free growth conditioned medium. The results show the eluate
O.D..sub.290 (--), conductance (-.DELTA.-), and GDNF activity in TU
(-o-). Fractions marked by a bar were pooled for further
purification.
[0029] FIG. 2 depicts the results of FPLC superose chromatography
from the pooled fractions of FIG. 1. The results are shown of
O.D..sub.250 (--), and GDNF activity in TU (-o-).
[0030] FIG. 3 depicts the results of RP-HPLC on fraction 14 from
FIG. 2. The results are shown of O.D..sub.214, with the GDNF
activity in TU shown below.
[0031] FIG. 4 depicts the results of analysis by silver-stained
SDS-PAGE of fractions 3-10 obtained from FIG. 3 above. Lane S
contains molecular weight standards.
[0032] FIG. 5 depicts the results of preparative SDS-PAGE on
fractions 5 and 6 from FIG. 4. Gel slices were tested for GDNF
activity in TU. Gel slices were also correlated to molecular weight
by use of molecular weight markers (Amersham).
[0033] FIG. 6 depicts the results of the RP-HPLC on fractions 16-23
from FIG. 5. Chromatogram A contains the sample, and chromatogram B
is a control (pooled gel extract from corresponding slices of a
blank lane).
[0034] FIG. 7 depicts the results of analysis by silver-stained
SDS-PAGE of peak 3 from FIG. 6A (lane 1) and a molecular weight
control (lane S).
[0035] FIG. 8 describes the amino-terminal amino acid sequence
obtained from purified GDNF. The empty parenthesis indicates a
position where the amino acid could not be determined using the
sequencing technique employed. Where residues are given in
parentheses, there was some uncertainty as to the identification of
that residue. The complete correct amino-terminal amino acid
sequence is shown in FIG. 19 below.
[0036] FIG. 9 depicts the results of RP-HPLC on trypsin digested
purified GDNF. Chromatogram A contains the sample, and chromatogram
B is a control (containing trypsin only).
[0037] FIG. 10 depicts the results of the RP-HPLC of peak 37 from
FIG. 9. following treatment with cyanogen bromide.
[0038] FIG. 11 depicts the results of RP-HPLC on the reduction
product of peak 1 from FIG. 10.
[0039] FIG. 12 describes an internal amino acid sequence obtained
from purified GDNF.
[0040] FIG. 13 depicts the nucleic acid sequence obtained for rat
DDNF derived from a B49 cell library cDNA clone .lambda.ZapII76.1.
Also depicted is the inferred amino acid sequence for GDNF. The
nucleic acid sequence coding for mature GDNF is underlined. The
amino-terminal sequence of the most preferred pre-pro form of GDNF
is marked with an *.
[0041] FIG. 14 depicts the inferred amino acid sequence of mature
GDNF.
[0042] FIG. 15 depicts the results of purified B49 cell GDNF and
human recombinant CNTF to promote the survival of parasympathetic
neurons from chick embryo ciliary ganglia. Increasing optical
density on the Y-axis represents increasing neuronal survival. The
X-axis represents decreasing concentrations of each neurotrophic
factor. The curve labeled control is equal volumes of inactive HPLC
fractions adjacent to those containing the GDNF used to generate
the curve labeled GDNF.
[0043] FIG. 16 depicts the results of purified B49 cell GDNF and
human recombinant CNTF to promote the survival of sympathetic
neurons from chick embryo sympathetic chain ganglia. Increasing
optical density on the Y-axis represents increasing neuronal
survival. The X-axis represents decreasing concentrations of each
neurotrophic factor. The curve labeled control is equal volumes of
inactive HPLC fractions adjacent to those containing the GDNF used
to generate the curve labeled GDNF.
[0044] FIG. 17 depicts the results of bioassay of COS cell
conditioned media for ability to increase dopamine uptake by
mesencephalic dopaminergic neurons in culture. The Y-axis presents
the amount of radiolabeled dopamine taken up versus increasing
amounts of concentrated COS cell culture medium on the X-axis. The
curve labeled B-1 represents the serum-free conditioned medium from
COS cells transfected with the GDNF gene in the proper orientation
for expression of GDNF. The curve labeled C-1 represents the
serum-free conditioned medium from COS cells transfected with the
GDNF gene in the opposite orientation, which prevents expression of
GDNF.
[0045] FIG. 18 depicts the results of bioassay of COS cell
conditioned media for ability to increase survival in culture of
sympathetic neurons from the sympathetic chain in chicken embryos.
The Y-axis presents the amount of MTT dye reduced by the cultures
and is proportional to neuronal survival. The X-axis represents
increasing dilution of concentrated COS cell culture medium. The
curve labeled GDNF represents the serum-free conditioned medium
from COS cells transfected with the GDNF gene in the proper
orientation for expression of GDNF. The curve labeled CONTROL
represents the serum-free conditioned medium from COS cells
transfected with the GDNF gene in the opposite orientation, which
prevents expression of GDNF.
[0046] FIG. 19 depicts a portion of the nucleic acid sequence
obtained for human GDNF, as described-in Example 2C below,
including the entire portion of the gene encoding for mature human
GDNF. Also depicted is the inferred amino acid sequence for mature
human GDNF. The amino acid sequence for mature human GDNF is
underlined.
[0047] FIG. 20 depicts the ability of GDNF to stimulate dopamine
uptake and tyrosine hydroxylase (TH) immunostaining in dopaminergic
neurons. Cultures were established as described in Example 1B. GDNF
was added on the day of plating and replenished after nine days in
vitro. A. .sup.3H-DA uptake was measured after 15 days in vitro. B.
Cultures were fixed after 16 days in vitro with 4%
paraformaldehyde, washed extensively, permeabilized with 0.2%
Triton x-100 and stained with polyclonal antibody to TH (Eugine
Tech International, Allendale, N.J.). Primary antibody binding was
visualized using a Vectastain ABC kit (Vector Labs, Burlingame,
Calif.).
[0048] FIG. 21 depicts the specificity of GDNF to dopaminergic
neurons. Cultures were established as described in Example 1B. GDNF
was added on the day of plating. A. .sup.3H-DA uptake was measured
after seven days in vitro. B. .sup.14C-GABA uptake was measured
after eight days in vitro. Cells were incubated and treated as for
.sup.3H-DA uptake, except the uptake buffer consists of
Kreb-Ringer's phosphate buffer, pH 7.4, containing 5.6 mM glucose,
1.3 mM EDTA, 10 .mu.M amino-oxyacetic acid (to prevent GABA
breakdown), 2 mM .beta.-alanine (to inhibit glia uptake of GABA)
and 0.1 .mu.M .sup.14C-GABA (150 mC.sub.i/mmole, New England
Nuclear, Boston, Mass.). In the presence of 1 mM diaminobutyric
acid (DABA), a potent inhibitor of .sup.14C-GABA uptake into GABA
neurons, the .sup.14C-uptake was reduced to 10%. Control values in
the presence of DABA were subtracted from experimental values.
[0049] FIG. 22 depicts a portion of the nucleic acid sequence
obtained for human GDNF, as described in Example 2D below,
including the coding sequence of amino acids 1-50 of human pre-pro
GDNF. Also depicted is the inferred amino acid sequence for the
first 50 amino acids of human pre-pro GDNF. This information, in
conjunction with coding sequence information given in FIG. 19,
provides the full coding sequence for human pre-pro GDNF, and the
inferred amino acid sequence for the human pre-pro GDNF
protein.
[0050] FIG. 23 depicts a map of SacII and PstI sites within the
plasmid of pBSSK- .lambda.3AluI, as described in Example 2D
below.
[0051] FIG. 24 depicts the specificity of GDNF to dopaminergic
neurons. Cultures were prepared as described in Example 1B. GDNF
was added on the day of plating, and uptake was measured after 6
days in vitro. A depicts dopamine uptake and B depicts serotonin
uptake.
[0052] FIG. 25 depicts Coomassie Blue stained SDS-PAGE, run under
reducing conditions, of fractions from chromatography of a
bacterial extract containing unrefolded GDNF on an S-Sepharose
column prior to refolding (see Example 6C). Lanes 2-8 represent
consecutive fractions from the column eluate. Fractions 3-5,
enriched for GDNF, were pooled for refolding. Lane 1 is molecular
weight standards (SDS-70L, Sigma).
[0053] FIG. 26 depicts Coomassie Blue stained SDS-PAGE of the GDNF
solution; prior to refolding (lanes 6 & 13), after refolding
(lane 2), and after refolding and subsequent back reduction with
150 mM 2-mercaptoethanol (lane 5). The material prior to refolding
and after back reduction runs as a monomer at about 16 kDa. GDNF
after successful refolding runs (without reduction) as a dimer at
about 30 kDa (see Example 6C). Lane 15 is molecular weight
standards (SDS-70L, Sigma).
[0054] FIG. 27 depicts the results of a bioassay using refolded
GDNF; measuring the ability to promote the survival of chick embryo
sympathetic neurons in culture. The bioassay procedure is as
described in Example 4A. Optical density (proportional to the
number of surviving neurons) on the Y-axis is plotted against GDNF
concentration on the X-axis (determined by laser-densitometry
scanning of Coomassie Blue stained SDS-PAGE gels). The calculated
ED50 of refolded GDNF for chick embryo sympathetic neuron survival
is about 3 ng/ml.
[0055] FIG. 28 depicts the results of a bioassay using refolded
GDNF, measuring the ability to increase dopamine uptake by nigral
dopaminergic neurons in cultures of rat embryonic mesencephalon.
The bioassay procedure is as described in Example 1B. Dopamine
uptake on the Y-axis is plotted against GDNF concentrations on the
X-axis. The calculated ED50 of refolded GDNF for increasing
dopamine uptake in these cultures is about 3 pg/ml.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0056] Reference will now be made in detail to the presently
preferred embodiments of the invention, which, together with the
following examples, serve to explain the principles of the
invention.
[0057] Prior to this invention, GDNF had not been identified as a
discrete biologically active substance or existed in a
substantially pure form. As described herein, a detailed
description of GDNF is provided, along with a description of: its
physical, chemical and biological characteristics; its utility; how
to make it; useful compositions containing it; nucleic acid
sequences coding for it; vectors containing such nucleic acid
sequences; host cells transformed by such vectors; recombinant
techniques for its production; and other aspects of the
invention.
[0058] GDNF is a protein that may be identified in or obtained from
glial cells and that exhibits neurotrophic activity. More
specifically, GDNF is a dopaminergic neurotrophic protein that is
characterized in part by its ability to increase dopamine uptake on
the embryonic precursors of the substantia nigra dopaminergic
neurons, and further by its ability to promote the survival of
parasympathetic and sympathetic nerve cells. Substantially purified
GDNF is further characterized in several ways:
[0059] 1. It has a specific activity of at least about 12,000
TU/.mu.g.
[0060] 2. It has a molecular weight on reducing SDS-PAGE of about
20-23 kD.
[0061] 3. It has a molecular weight on non-reducing SDS-PAGE of
about 31-42 kD.
[0062] 4. It has a specific activity of at least about 24,000 times
greater than the specific activity of B49-conditioned medium.
[0063] 5. It has the ability to upregulate tyrosine hydroxylase
immunoreactivity in mesencephalic culture.
[0064] 6. It has the amino terminal amino acid sequence as shown in
FIG. 8 (SEQ ID NO:1).
[0065] 7. It has the internal amino acid sequence as shown in FIG.
12 (SEQ ID NO:2).
[0066] The GDNF of the present invention is more fully described in
detail below. It is to be understood that this aspect of the
invention covers any dopaminergic neurotrophic protein having an
amino terminal amino acid sequence the same or substantially
homologous to that given in FIG. 8 (SEQ ID NO:1). This invention
also includes any dopaminergic neurotrophic protein having an
internal amino acid sequence the same or. substantially homologous
to that given in FIG. 12 (SEQ ID NO:2).
[0067] This invention includes a novel dopaminergic neurotrophic
protein that is defined herein as glial-derived neurotrophic factor
(GDNF). GDNF has been identified in and isolated from a serum-free
growth conditioned medium of B49 glioblastoma cells in a
substantially purified form.
[0068] GDNF has been purified and characterized, and partial amino
acid sequences of the purified material have been obtained. Based
on the partial amino acid sequence obtained, DNA probes were
designed for obtaining a rat cDNA clone that may be used in the
recombinant production of GDNF. The nucleic acid sequence of such
clone and the inferred amino acid sequence of rat GDNF is given in
FIGS. 13 (SEQ ID NO:3) and 14 (SEQ ID NO:4).
[0069] The amino-terminal amino acid sequence of GDNF has been
determined, and is shown in FIG. 8 (SEQ ID NO:1). A portion of the
internal amino acid sequence of GDNF has also been determined, and
is shown in FIG. 12 (SEQ ID NO:2). The purified GDNF has an
apparent molecular weight of about 31-42 kD on SDS-PAGE under
non-reducing conditions, and about 20-23 kD on SDS-PAGE under
reducing conditions. Although not being limited by such theory, it
is postulated that this information is consistent with GDNF being a
glycosylated, disulfide-bonded dimer in its naturally occurring
state.
[0070] As described in more detail in Example 6C below, expression
of the human GDNF gene in a bacterial expression system leads to
the production of recombinant human GDNF or rhGDNF. The material
isolated after expression is essentially biologically inactive, and
exists as a monomer. Following refolding, GDNF exists as a
biologically active disulfide-bonded dimer. GDNF, therefore, is a
disulfide-bonded dimer in its natural, biologically active form.
This invention, however, includes GDNF in both its monomeric and
dimeric, and biologically inactive and biologically active
forms.
[0071] Probes were prepared based on the nucleic acid sequence of
rat GDNF in order to clone the genomic DNA gene coding for human
GDNF. The human gene encoding mature GDNF, and the amino acid
sequence of human mature GDNF are given in FIG. 19 (SEQ ID
NO:5).
[0072] GDNF may also be characterized by its ability to increase
dopamine uptake on the embryonic precursors of the substantia nigra
dopaminergic neurons, as described in Example 1 below. GDNF may
further be characterized by its ability to promote the survival of
parasympathetic and sympathetic nerve cells, as described in
Example 4 below.
[0073] GDNF may be characterized additionally by its ability to
upregulate tyrosine hydroxylase immunoreactivity in mesencephalic
cultures. An example of this characteristic is described in Example
1E and shown in FIG. 20. In addition, GDNF has been shown to have
some specificity to dopaminergic neurons relative to neurons
generally. For example, this was demonstrated by the limited effect
on .gamma.-aminobutyric acid (GABA) uptake in neurons containing
GABA. This is also described in Example 1E and shown in FIG. 21.
GDNF has also been shown to have limited, if any, effect on
serotonin uptake in serotonergic neurons. This is described in
Example 1E and shown in FIG. 24.
[0074] Throughout this specification, any reference to glial
derived neurotrophic factor should be construed to refer to
neurotrophic factors of any origin which are substantially
homologous to and which are biologically equivalent to the GDNF
characterized and described herein. The degree of homology between
the rat and human protein is about 93% and all mammalian GDNF will
have a similarly high degree of homology. Such GDNFs may exist as
dimers in their biologically active form.
[0075] The present invention encompasses glycosylated and
non-glycosylated forms of GDNF as well as truncated forms of the
naturally-occurring and recombinant GDNF as described herein. In a
further embodiment, GDNP is modified by attachment of one or more
polyethylene glycol (PEG) or other repeating polymeric moieties.
The present invention also encompasses GDNF recombinantly produced
in bacterial expression systems containing an amino-terminal
methionine residue.
[0076] By "biologically equivalent" as used throughout the
specification and claims, we mean compositions of the present
invention which are capable of demonstrating some or all of the
same neurotrophic properties in a similar fashion, but not
necessarily to the same degree as the GDNF isolated from the B49
conditioned medium. By "substantially homologous" as used
throughout the ensuing specification and claims, is meant a degree
of homology to the GDNF isolated from the B49 conditioned medium in
excess of that displayed by any previously reported GDNF.
Preferably, the degree of homology is in excess of 70%, most
preferably in excess of 80%, and even more preferably in excess of
90%, 95% or 99%. The percentage of homology as described herein is
calculated as the percentage of amino acid residues found in the
smaller of the two sequences which align with identical amino acid
residues in the sequence being compared when four gaps in a length
of 100 amino acids may be introduced to assist in that alignment as
set forth by Dayhoff, in Atlas of Protein Sequence and Structure
Vol. 5, p. 124 (1972), National Biochemical Research Foundation,
Washington, D.C., specifically incorporated herein by reference.
Also included as substantially homologous is any GDNF which may be
isolated by virtue of cross-reactivity with antibodies to the GDNF
described herein or whose genes may be isolated through
hybridization with the gene or with segments of the gene for GDNF
described herein.
[0077] A preferred GDNF of the present invention has been isolated
from B49 conditioned medium and has been isolated in a
substantially purified form. An additional preferred GDNF is
prepared by recombinant DNA technology to yield GDNF in a
substantially purified form. For the purposes of the present
application, "pure form" or "substantially purified form," when
used to refer to the GDNF disclosed herein, shall mean a
preparation which is substantially free of other proteins which are
not GDNF. Preferably, the GDNF of the present invention is at least
50% percent pure, preferably 75% pure and more preferably 80%, 95%
or 99% pure. In one embodiment of the present invention, the GDNF
protein preparation is of such substantially purified form so as to
enable one of ordinary skill in the art to determine at least
portions of its amino acid sequence without first performing
further purification steps.
[0078] In a preferred embodiment of this invention, GDNF is
purified from B49 conditioned medium as described in Example 1
below. Of course, given the information set forth herein, it will
be apparent to those skilled in the art that other sources of GDNF
may be identified, and that the purification of GDNF from such
sources can be accomplished generally according to the method of
purification presented here.
[0079] The dopaminergic activity of the GDNF is used to facilitate
the purification process. The bioassay for dopaminergic
neurotrophic activities is described in Example 1B below. Briefly,
cultures of dissociated mesencephalic cells are prepared, either in
serum rich or serum free environments. Samples to be tested for
dopaminergic activity are desalted and serially added to the cell
cultures and the dishes are incubated for 6 days at 37.degree. C.
in a humidified atmosphere containing 6.5% CO.sub.2. The cultures,
in the presence of the testing material, are then incubated at
37.degree. C. with tritiated dopamine (.sup.3H-DA). The dopamine
uptake is halted, the cells washed, and the dopamine uptake
analyzed by scintillation counting of retained tritium in the
cultures.
[0080] The purification of GDNF is described below in detail in
Example 1C. The process of purification is detailed in Table I. The
conditioned medium starting material is prepared from B49
glioblastoma cells by placing the cells in serum free medium for 2
days, when the conditioned medium is collected and replenished.
This cycle is repeated to yield 3 harvests of conditioned medium
from each batch of B49 cells. The conditioned medium is centrifuged
and concentrated about 10 fold prior to further purification.
[0081] The first step of preparation of this crude mixture defined
herein as serum-free growth conditioned medium of B49 glioblastoma,
is introducing the conditioned medium onto a Heparin Sepharose
column equilibrated with 50 mM NaPi buffers, pH 8.0, containing
0.15 N NaCl. A gradient buffer solution made up of 50 mM NaPi, pH
8.0 containing 1.5 N NaCl is introduced to the column after elution
is stabilized. Fractions from this chromatography are measured for
GDNF activity, and those fractions containing the GDNF activity are
pooled for further purification.
[0082] The pooled fractions are subjected to fast protein liquid
chromatography (FPLC) on a Superose column, with a solvent buffer
of 50 mM NaPi buffer, pH 7.4, containing 0.5 N NaCl. Again, the
GDNF activity of fractions obtained is determined. A single
fraction from this procedure is then acidified and loaded onto a
C-8 reverse phase high performance liquid chromatography (HPLC)
column. Fractions identified containing GDNF activity are combined
for further purification and for protein sequencing. As shown in
Table 1 below, the GDNF obtained at this point has a specific
activity about 24,000 fold in excess of conditioned medium. Amino
terminal sequencing of the protein obtained at this point gives the
amino terminal sequence as shown in FIG. 8 (SEQ ID NO:1).
[0083] Further purification of the GDNF obtained from HPLC can be
accomplished by performing preparative SDS-PAGE on the fractions
containing the GDNF activity. Added to the protein containing
fractions are buffer containing glycerol and SDS, and the solution
is run on non-reduced 15% SDS-PAGE, with electrophoresis conducted
at 10.degree. C. at 40 mA/gel for 2 hours. The portion of the gel
corresponding to a molecular weight of about 30-42 kD has been
found to contain the GDNF activity by bioassay. A second HPLC
chromatography of the material isolated from SDS-PAGE yields a
single peak of GDNF, as shown in FIG. 6.
1TABLE 1 PURIFICATION OF GDNF FROM B49 CELL CM PROTEINS BIOACTIVITY
SP. ACT YIELD STEP (MG) (TU .times. 10.sup.-3) (TU/.mu.g) FOLD (%)
CM 200 94 0.5 (1) (100) 1. Heparin Sepharose 3.1 37 12 24 39 2.
FPLC Superose 0.3.sup.a 31 103 206 33 3. RP-HPLC 0.001.sup.b 12
12,000 24,000 13 4. Preparative SDS-PAGE n.d 7 n.d n.d 7 5. RP-HPLC
0.0003.sup.b 5 17,000 34,000 5 .sup.abased on O.D..sub.280
.sup.bbased on the recovery from protein sequencing (in picamoles)
and an assumed molecular weight (from non-reducing SDS-PAGE) OF 36
kD for GDNF. n.d = not determined
[0084] The amino terminal sequences of GDNF were determined for the
material from HPLC before and after preparative SDS-PAGE. The
procedures utilized for obtaining amino acid sequences of purified
GDNF are given in Example 1D. Amino-terminal sequence was obtained
with a gas phase protein sequencer. Internal sequences were
obtained from the material obtained by HPLC that had not been
further purified by preparative SDS-PAGE. Internal amino acid
sequence was obtained by incubating the purified GDNF with trypsin.
The trypsin fragments obtained were separated by HPLC. One fragment
was found to contain the first 13 amino acid residues of the
amino-terminal sequence of the untreated protein. A second fragment
was treated with CNBr, purified by HPLC, reduced, and again
purified on HPLC. The amino acid sequence obtained is shown in FIG.
12 (SEQ ID NO:2). Those sequences given in parentheses were
determined to a small degree of confidence.
[0085] This invention includes the method for cloning. the gene for
GDNF, and the gene that was identified that encodes GDNF. A
detailed procedure for the cloning of rat and human genes for GDNF
is given below in Example 2. Again, those skilled in the art will
appreciate that other methods for cloning such a gene are obvious
in light of the disclosure herein. In particular, the cloning of
genes from other species encoding GDNF will be obvious in view of
the disclosures and procedures described herein.
[0086] The rat GDNF gene described herein was obtained from a cDNA
library constructed from poly A+ RNA isolated from B49 cells, which
was screened with a degenerate oligonucleotide probe based on the
amino acid sequence obtained from the purified GDNF. The cDNA was
obtained according to standard procedures, treated to contain
EcoRI-digested linkers, and inserted into the .lambda.Zap II
cloning vector. The hybridization probe used was .sup.32P-labeled,
and consisted of the following degenerate oligonucleotide (SEQ ID
NO:7):
2 5' > CCIGATAAACAAGCIGCIGC>3' C G G
[0087] Several positive clones were obtained, and one clone
(.lambda.ZapII76.1) was positively identified by DNA sequencing as
encoding a portion of GDNF that was not used in designing the
degenerate probe.
[0088] The procedure for obtaining the nucleotide sequence of the
cDNA clone contained in .lambda.ZapII76.1 is given in Example 2B.
below. The nucleotide sequence of the first 877 base pairs of the
5' end of the cDNA clone was determined, and is shown in FIG. 13
(SEQ ID NO:2). In FIG. 13, the clone shown contains an open reading
frame (ORF) of 227 amino acids that includes the amino-terminus of
purified GDNF and is consistent with the sequence for an internal
peptide obtained by cleavage of purified GDNF.
[0089] The inferred amino acid sequence given in FIG. 14 (SEQ ID
NO:4) shows the amino acid sequence for the "mature GDNF". By
"mature GDNF", is meant the sequence of the purified GDNF obtained
from the B49 conditioned medium. Of course, the purified GDNF may
exist as a dimer or other multimer and may be glycosylated or
chemically modified in other ways. Mature GDNF may be truncated at
the carboxyl terminus, in particular by proteolytic processing of
the lys-arg residues 6 and 5 residues from the carboxyl terminal
end. Examination of the nucleic acid sequence of the
.lambda.ZapII76.1 rat clone as shown in FIG. 13 (SEQ ID NO:2)
suggests that GDNF is initially translated as a pre-pro-GDNF
polypeptide and that proteolytic processing of the signal sequence
and the "pro" portion of this molecule result in purified GDNF
having the same mature sequence as that obtained from B49
conditioned medium. It is postulated, that the pre-pro-GDNF
polypeptide begins at the first ATG --methionine encoding --codon
at the 5' end of the clone (position 50 in FIG. 13). The present
invention includes, therefore, any and all pre-pro GDNF
polypeptides that may be translated from the gene shown in FIG. 13,
as well as any and all pre-pro GDNF polypeptides translated from a
more complete clone that may be easily obtained by one of skill in
the art using standard laboratory procedures and the clone
described herein.
[0090] Review of the rat nucleic acid sequence given in FIG. 13
(SEQ ID NO:2) shows that the predicted amino acid sequence located
between positions 518 and 538 is Asp-Lys-Ile-Leu-Lys-Asn-Leu which
is consistent with the amino acid sequence determined for a peptide
derived from purified mature GDNF by the process described in the
section on internal sequence in Example 1 below. A TGA stop codon
at position 706 terminates the ORF. The predicted length of the
purified GDNF is thus 134 amino acid residues, and the predicted
molecular weight of this polypeptide is 14,931. Two potential
N-linked glycosylation sites occur at positions 425 and 533.
Glycosylation at either or both of these sites would increase the
molecular weight of the molecule.
[0091] The serine residue at position 281, which corresponds to the
start of the sequence of purified mature GDNF, is preceded by the
sequence Lys-Arg which provides a potential proteolytic cleavage
site for processing of a putative precursor form of GDNF to produce
the form of the molecule that is purified from B49 cells. A
potential translational initiation codon (ATG) occurs at position
50 in the sequence and is closely followed by a potential secretory
signal sequence. The sequences flanking this ATG show sufficient
similarity to the Kozak consensus sequence (Kozak 1987 Nucleic
Acids Res. 15:125-48) to indicate that this ATG could be utilized
as a translational initiation site. Moreover, this ATG is the most
5' ATG in the sequence of the cDNA clone. These facts suggest it as
a potential start site for translation of a precursor form of
GDNF.
[0092] These above noted features of the nucleotide sequence of the
rat cDNA clone suggest the possibility that GDNF is initially
translated as a pre-pro-GDNF polypeptide and that proteolytic
processing of the signal sequence and the "pro" portion of this
molecule result in production of the form of GDNF that is purified
from B49 cell conditioned medium. However, the occurrence of other
forms of GDNF is also consistent with the sequence data. For
example, two other potential ATG translational starts occur within
the 681 bp ORF: one at position 206 and one at 242. These ATG's are
located upstream of the start of the amino-terminal sequence of
purified GDNF. Although, in eukaryotes, translational initiation
generally occurs at the 5'-most ATG of the mRNA (Kozak, supra,)
there are instances in which a proportion of the translational
initiations occur at a downstream ATG. Thus, alternative precursor
forms of GDNF could conceivably arise by translational initiation
at these ATG codons. Proteolytic processing of these polypeptides
could result in production of the same form of purified GDNF
observed in B49 cell conditioned medium. Moreover, the open reading
frame extends through the 5' end of the sequence of the cDNA clone.
It is therefore possible that the initiation of translation occurs
at an upstream ATG not present in the cDNA clone. In this
eventuality, GDNF would be translated as an even larger precursor
containing the amino acid sequence described here and additional
sequence upstream. Processing of such a hypothetical precursor form
could also lead to production of the purified form of GDNF reported
here. It would be possible to detect potential upstream ATG starts
by sequencing the 5' end of the mRNA containing the GDNF gene via
primer extension with reverse transcriptase (Maniatis et al.
supra). Additionally, other cDNA clones could be obtained from B49
libraries and the 5' ends of these clones could be sequenced. The
size of the 5' mRNA located upstream of the first ATG could be more
roughly determined by the techniques of "S1mapping" (Maniatis et
al. supra) and/or simple sizing of primer extension products of the
reverse transcriptase reaction. While a variety of putative forms
of the primary translational product that contains the sequences
encoding purified GDNF can be postulated, the partial DNA sequence
presented here for the cDNA clone carried in the recombinant phage
.lambda.ZapII76.1 clearly defines the coding sequence that
constitutes the purified GDNF polypeptide isolated from the B49
cell conditioned medium.
[0093] In Example 2C below, the cloning of the human gene that
encodes GDNF, is described. A human genomic library was screened
with a probe derived from the rat cDNA clone described in Example
2B. A genomic DNA clone of the human GDNF gene was identified and
the sequence of the gene coding for mature human GDNF is given in
FIG. 19 (SEQ ID NO:5).
[0094] The sequence given in FIG. 19 for the gene for human GDNF
does not give the entire coding sequence for the pre-pro portion of
GDNF. The process for obtaining the coding sequence for the first
50 amino acids of human pre-pro GDNF is described below in Example
2D. The sequence obtained is given in FIG. 22 (SEQ ID NO:8). The
map of plasmid pB55K-.lambda.3Alul used to obtain the sequence is
as shown in FIG. 23.
[0095] This invention includes nucleic acid sequences encoding
GDNF. Relatively highly homologous sequences coding for rat (FIG.
13) (SEQ ID NO:3) and human (FIG. 19) (SEQ ID NO:5) GDNF are given
herein. Also included within the scope of this invention are
substantially similar nucleic acid sequences that code for the same
or highly homologous amino acid sequences. For example, when
preparing a construct for expression of mature GDNF in a bacterial
expression system such as E. coli, certain codons in the nucleic
acid sequence given in FIG. 19 (SEQ ID NO:5) may be substituted
with codons more readily expressed in E coli according to well
known and standard procedures. Such modified nucleic acid sequences
would be included within the scope of this invention.
[0096] Specific nucleic acid sequences can be modified by those of
skill in the art. Therefore, this invention also includes all
nucleic acid sequences which encode for the amino acid sequences
for mature rat and mature human GDNF as set forth in FIGS. 14 (SEQ
ID NO:4) and 19 (SEQ ID NO:5), and pre-pro rat GDNF as set forth in
FIG. 13 (SEQ ID NO:3) and for pre-pro human GDNF as set forth in
FIGS. 19 (SEQ ID NO:5) and 22 (SEQ ID NO:8). The present invention
also incorporates nucleic acid sequences which will hybridize with
all such nucleic acid sequences--or the compliments of the nucleic
acid sequences where appropriate--and encode for a polypeptide
having dopaminergic activity. The present invention also includes
nucleic acid sequences which encode for polypeptides that have
dopaminergic activity and that are recognized by antibodies that
bind to GDNF.
[0097] The present invention also encompasses vectors comprising
expression regulatory elements operatively linked to any of the
nucleic acid sequences included within the scope of the invention.
This invention also incorporates host cells--of any variety--that
have been transformed with vectors comprising expression regulatory
elements operatively linked to any of the nucleic acid sequences
included within the scope of this invention.
[0098] The expression of GDNF in COS cells is described below in
Example 5. The gene encoding GDNF depicted in FIG. 13 was subcloned
into the plasmid vector pSG5, a vector designed for the transient
expression of cloned gene cells such as COS cells. Plasmids
containing the GDNF gene in the proper and improper orientation
were selected and the DNA transfected into COS-7 cells. Following
cultivation, the transformed cells were harvested. The COS-7
conditioned medium was tested for bioactivity in both the
dopaminergic assay and the sympathetic ganglia neuron assay. The
conditioned medium from the cells containing the gene for GDNF in
the proper orientation was found to have biological activity in
both such assays, indicating that biologically active GDNF had been
successfully produced via recombinant DNA processes.
[0099] In a preferred embodiment of the present invention, human
mature GDNF is prepared by recombinant DNA technology in a
bacterial expression system.
[0100] The expression of human GDNF in E. coli is described below
in Example 6. The portion of the human GDNF gene that codes for
mature human GDNF as shown in FIG. 19, was used to prepare a human
GDNF construct. Such construct was ligated into a plasmid vector,
which was transformed into E. coli strain JM107. After culturing of
the transformed host cells, the GDNF produced was harvested. A
protein of the expected molecular weight for mature human GDNF
(about 15,000 daltons) was obtained, and amino terminal sequencing
confirmed that the protein obtained was mature human GDNF.
[0101] The refolding and naturation of human GDNF expressed in E.
coli is described below in Example 6C. In the embodiment of the
invention described, the expressed protein-containing extract
obtained was partially purified prior to refolding by ion exchange
chromatography on S-Sepharose Fast Flow resin. Refolding was
accomplished by adding: first dithiothreitol, then glutathione
disodium salt, then a refold buffer to the GDNF-containing extract.
The refolded rhGDNF was substantially fully biologically active,
and existed as a disulfide-bonded dimer in its biologically active
form. The GDNF prior to refolding --and after reduction of the
refolded material --existed in a monomeric state and was
substantially biologically inactive.
[0102] GDNF may also be produced by expression in other expression
systems. For example, with the nucleic acid sequence coding for
mature human GDNF as shown in FIG. 19, one skilled in the art could
produce GDNF in other expression systems. Vectors containing the
nucleic acid sequence coding for GDNF operatively linked to
expression regulatory elements may be transformed into other
microorganism host cells including Bacillus, Pseudomonas and yeast.
Baculovirus expression systems may also be employed.
[0103] As noted above, the present invention relates to methods for
treating nerve damage in patients suffering therefrom. These
methods comprise the administration of a therapeutically effective
amount of a human protein glial-derived neurotrophic factor (GDNF)
to a patient suffering from nerve damage.
[0104] A disease or medical indication is to be considered to be
nerve damage if the survival or function of nerve cells and/or
their axonal processes is compromised. In a preferred embodiment,
such nerve damage occurs as the result of one of the following
conditions: 1) Physical injury, which causes the degeneration of
the axonal processes and/or nerve cell bodies near the site of
injury; 2) Ischemia, as in stroke; 3) Exposure to neurotoxins, such
as the cancer and AIDS chemotherapeutic agents cisplatinum and
dideoxycytidine (ddC), respectively; 4) Chronic metabolic diseases,
such as diabetes or renal dysfunction; and, 4) Neurodegenerative
diseases such as Parkinson's disease, Alzheimer's disease, and
Amyotrophic Lateral Sclerosis (ALS), which cause the degeneration
of specific neuronal populations. A non-exclusive list of
conditions involving nerve damage includes Parkinson's disease,
Alzheimer's disease, Amyotrophic Lateral Sclerosis, Stroke,
Diabetic Polyneuropathy, Toxic Neuropathy caused by the cancer
chemotherapeutic agents taxol or cisplatin or vincristine, Toxic
Neuropathy caused by the AIDS chemotherapeutic agents ddI or ddC,
and physical damage to the nervous system such as that caused by
physical injury of the brain and spinal cord or crush or cut
injuries to the arm and hand.
[0105] Methods for producing GDNF are also disclosed herein. One
disclosed method consists of isolating GDNF from various sources,
such as glial cell line conditioned medium. A second method
involves isolating the genes responsible for coding GDNF, cloning
the gene in suitable vectors and cell types, and expressing the
gene in order to produce the GDNF. The latter method, which is
exemplary of recombinant DNA methods in general, is a preferred
method of the present invention. Recombinant DNA methods are
preferred in part because they are capable of achieving
comparatively higher amounts of protein at greater purity.
Recombinant human GDNF is the most preferred protein for the
preparation of therapeutic compositions and for the treatment of
nerve damage.
[0106] This invention includes means for identifying and cloning
genes that encode proteins that share amino acid sequence homology
with GDNF, as well as all such identified proteins.
[0107] A mammalian gene family comprised of three neurotrophic
factors has been described (Leibrock et al. 1989 Nature
341:149-152, Maisonpierre et al. 1990 Science 247:1446-1451.) The
mature forms of the three proteins comprising this family [nerve
growth factor (NGF), brain derived neurotrophic factor (BDNF), and
neurotrophin-3 (NT-3)] share -50% amino acid identity with each
other. The positions of the six cysteine residues present in each
of these proteins are precisely conserved. Although structurally
similar, these three proteins display different tissue
distributions (Ernfors et al. 1990 Neuron 5:511-526, Maisonpierre
et al. 1990 Neuron 5:501-509, and Phillips et al. 1990 Science
250:290-294) and different in vitro activities (Rosenthal et al.
1990 Neuron 4:767-773, Whittemore et al. 1987 Brain Res Rev
12:439).
[0108] GDNF displays no significant homology to any previously
described protein but unidentified genes may exist that encode
proteins that have substantial amino acid sequence homology to GDNF
and which could function in vivo as neurotrophic factors with
different tissue specific distribution patterns and/or different
spectra of activities. Such proteins would constitute members of
the GDNF family of neurotrophic factors. The DNA sequences for the
rat and human GDNF genes, presented in FIGS. 13 (SEQ ID NO:3) and
19 (SEQ ID NO:5) and 22 (SEQ ID NO:8) respectively, could be used
to identify new members of such a putative "GDNF gene family".
[0109] As a consequence of the conservation of amino acid sequence
among the protein products of the members of a gene family such as
the "NGF gene family" noted above or the "GDNF gene family," there
is considerable conservation of sequence at the DNA level.
Therefore, under appropriate hybridization conditions, nucleic acid
"cross-hybridization" can occur between genes within the family,
i.e., a nucleic acid probe derived from the sequence of one of the
family members will form a stable hybrid duplex molecule with
nucleic acid molecules from different members of the family which
have sequences related, but not identical, to the probe (Beltz et
al. 1983 Methods in Enzymology 100:266-285). Therefore, one may
screen for genes related by sequence homology to GDNF by preparing
unique or degenerate DNA (or RNA) probes based on the sequence of
GDNF from the rat, human or any other species and performing
hybridization experiments with a variety of target DNAs (or RNAs)
under conditions that will allow stable formation of imperfectly
paired nucleic acid duplexes.
[0110] Such hybridization conditions, often termed "reduced
stringency" are well described in the literature (Beltz et al.
supra, Sambrook et al. 1989 Molecular Cloning, 2nd edition, Cold
Spring Harbor Press) and most frequently involve reduction in
temperature of the hybridization reaction when carried out in
aqueous solution and/or reduction in concentration of formamide in
hybridization systems normally employing solutions containing 50%
formamide. Other means of reducing hybridization stringency have
also been described and could be employed (Sambrook et al., supra).
The nucleic acid targets in these hybridization experiments could
include:
[0111] 1) genomic DNA libraries containing human, rat, or any
mammalian species, or any other species DNA cloned into any
convenient vector including bacteriophages, plasmids, cosmids,
yeast artificial chromosomes, or any other type of vector;
[0112] 2) cDNA libraries generated from RNA from any tissue type
obtained from any of the above noted organisms or obtained from
culture of any type of primary cell obtained from any of the above
noted organisms, or from any type of stable cell line currently
existing or produced from any primary cell culture;
[0113] 3) genomic DNAs as described in item #1 above which are
digested with restriction enzymes and prepared for Southern blot
analysis by gel electrophoresis and transfer onto a solid
support;
[0114] 4) RNAs as described in item #2 above which are subject to
electrophoresis and transfer to a solid support for Northern blot
analysis. Such RNAs could include total cellular RNA or
fractionated, poly A+ RNA.
[0115] 5) Products of polymerase chain reactions (PCR) which employ
oligonucleotide primers based on sequences occurring in GDNF and
employing as templates any of the nucleic acid sources described in
items #1 through 4.
[0116] Any nucleic acid sequence which is demonstrated to hybridize
to a GDNF based probe under some empirically determined set of
hybridization conditions may be cloned and sequenced by any of a
variety of techniques well known to one skilled in the art and the
degree of sequence homology may be directly determined to identify
members of a GDNF gene family. Such a hybridization approach was
used to clone NT-3 by screening with a probe based on NGF sequence
(Kaisho et al. 1990 FEBS Letters 266:187-191).
[0117] An alternative method for identifying GDNF family members
involves use of the polymerase chain reaction (PCR) to amplify
sequences from GDNF family members followed by cloning and analysis
of amplified sequences. Degenerate (or nondegenerate)
oligonucleotide primers for PCR may be synthesized based on the
sequence of GDNF. Given the conservation of cysteine location and
the conservation of amino acid sequences in the immediate vicinity
of the cysteine residues that is observed for the NGF family, the
regions around the cysteines in mature GDNF represent obvious
candidates for primer synthesis but a variety of other primers
could also be chosen from both the mature and pre-pro-portions of
the protein. PCR reactions may be performed under conditions of
reduced annealing temperature which would allow amplification of
not only the GDNF sequence but the sequences of any GDNF family
members. See, Innis et al. 1990 PCR Protocals: A Guide to Methods
and Applications, Academic Press. The products of such PCR
reactions may be size selected by gel electrophoresis, cloned into
an appropriate vector and the cloned DNA sequenced to identify GDNF
family members. Alternatively, the clones may first be screened by
hybridization to a probe specific for GDNF under conditions of high
stringency to identify GDNF clones. Any clones that fail to
hybridize to GDNF under high stringency would then be sequenced or
such clones could be hybridized to a GDNF probe under conditions of
reduced stringency and any clones that did hybridize to the GDNF
probe under these conditions would then be sequenced.
[0118] A second approach using PCR for cloning GDNF family members
would be to label the products of the PCR reaction described above
and use those products as a probe to screen nucleic targets
enumerated above under conditions of high and/or low stringency.
Hybridizing clones or nucleic segments could be analyzed as
detailed above to identify GDNF clones and family members. Such an
approach has been used to clone NT-3 based on the sequences of NGF
and BDNF (Maisonpierre et al. 1990 Science 247:1446-1451).
[0119] In a preferred embodiment of the present invention, a
therapeutic or pharmaceutical composition comprising GDNF is
administered in an effective amount to patients suffering from
nerve damage. In a preferred embodiment of the present invention,
GDNF is used therapeutically to treat patients suffering from
Parkinson's disease. Those skilled in the art are familiar with the
variety of assays available for indicating which neurons would be
responsive to treatment with GDNF, and the determination of other
receptive neurons receptive to GDNF could be performed without
undue experimentation. One skilled in the art could readily
determine where the message for GDNF is expressed throughout the
body and what the levels of GDNF protein are in each of those
regions. One skilled in the art could also determine the location
of binding sites for GDNF throughout the nervous system. This
information would allow one skilled in the art to determine the
neuronal types likely to be responsive to GDNF, which would in turn
suggest the appropriate clinical indications for this protein.
Suitable cell culture and animal experiments could then be run to
determine the likelihood that GDNF would be useful in treating such
indications.
[0120] Purified GDNF isolated from B49 conditioned medium has also
been shown to promote the survival of parasympathetic and
sympathetic nerve cells in cultures. These results are described in
detail in Example 4.
[0121] Because it is possible that the neurotrophic function of
GDNF is imparted by one or more discrete and separable portions, it
is also envisioned that the method of the present invention could
be practiced by administering a therapeutic composition whose
active ingredient consists of that portion (or those portions) of
GDNF which controls (or control) GDNF neurotrophic function.
[0122] The therapeutic or pharmaceutical composition of the present
invention is preferably administered parenterally by injection or
directly into the cerebral spinal fluid (CSF) by continuous
infusion from an implanted pump. Also, other effective
administration forms, such as parenteral slow-release formulations,
inhalant mists, orally active formulations, or suppositories, are
also envisioned. Also, administration in connection with one or
more agents capable of promoting penetration of GDNF across the
blood-brain barrier is envisioned. One preferred vehicle is
physiological saline solution, but it is contemplated that other
pharmaceutically acceptable carriers, such as artificial CSF, may
also be used. In one preferred embodiment it is envisioned that the
carrier and the GDNF constitute a physiologically-compatible,
slow-release formulation. The primary solvent in such a carrier may
be either aqueous or non-aqueous in nature. In addition, the
carrier may contain other pharmacologically-acceptable excipients
for modifying or maintaining the pH, osmolarity, viscosity,
clarity, color, sterility, stability, rate of dissolution, or odor
of the formulation. Similarly, the carrier may contain still other
pharmacologically-acceptable excipients for modifying or
maintaining the stability, rate of dissolution, release, or
absorption or penetration across the blood-brain barrier of the
GDNF. Such excipients are those substances usually and customarily
employed to formulate dosages for parenteral administration in
either unit dose or multi-dose form or for direct infusion into the
CSF by continuous or periodic infusion from an implanted pump.
[0123] Once the therapeutic composition has been formulated, it may
be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or dehydrated or lyophilized powder. Such
formulations may be stored either in a ready to use form or
requiring reconstitution immediately prior to administration. The
preferred storage of such formulations is at temperatures at least
as low as 4.degree. C. and preferably at -70.degree. C.
[0124] Preferably, the manner of parenterally administering the
formulations containing GDNF is via a subcutaneous, intramuscular,
intrathecal or intracerebral route. To achieve the desired dose of
GDNF, repeated daily or less frequent subcutaneous or intramuscular
injections may be administered, or GDNF may be infused continuously
or periodically from an implanted pump. The frequency of dosing
will depend on pharmacokinetic parameters of GDNF in the
formulation and route of administration used.
[0125] To achieve the desired dose of GDNF to dopaminergic and
other damaged nerve cells whose cell bodies are within the brain
and spinal cord, it is contemplated that GDNF will be administered
into the brain or spinal cord subarachnoid space or
intracerebroventricularly. Administration can be continuous or
periodic and be accomplished by a constant- or programmable-flow
implantable pump or by periodic injections. Administration can also
occur in conjunction with agents that allow GDNF to penetrate the
blood-brain barrier.
[0126] It is also contemplated that certain formulations containing
GDNF are to be administered orally. Preferably, GDNF which is
administered in this fashion is encapsulated. The encapsulated GDNF
may be formulated with or without those carriers customarily used
in the compounding of solid dosage forms. Preferably, the capsule
is designed so that the active portion of the formulation is
released at that point in the gastro-intestinal tract when
bioavailability is maximized and pre-systemic degradation is
minimized. Additional excipients may be included to facilitate
absorption of GDNF. Diluents, flavorings, low melting point waxes,
vegetable oils, lubricants, suspending agents, tablet
disintegrating agents, and binders may also be employed.
[0127] Regardless of the manner of administration, the specific
dose is calculated according to the approximate body weight or body
surface area of the patient. Further refinement of the calculations
necessary to determine the appropriate dosage for treatment
involving each of the above mentioned formulations is routinely
made by those of ordinary skill in the art and is within the ambit
of tasks routinely performed by them without undue experimentation,
especially in light of the dosage information and assays disclosed
herein. These dosages may be ascertained through use of the
established assays for determining dosages utilized in conjunction
with appropriate dose-response data.
[0128] In one embodiment of this invention, GDNF may be
therapeutically administered by implanting into patients cells
capable of synthesizing and secreting a biologically-active form of
GDNF. Such GDNF-producing cells may be cells that are natural
producers of GDNF (analogous to B49 cells) or they could be cells
whose ability to produce GDNF has been augmented by transformation
with the GDNF gene in a form suitable for promoting its expression
and secretion. In order to minimize a potential immunological
reaction in patients from administering GDNF of a foreign species,
it is preferred that the natural-GDNF-producer cells be of human
origin and produce human GDNF. Likewise, one would transform cells
to express human GDNF using an expression construct coding for
human GDNF by methods analogous to those used in Examples 5 and 6
below.
[0129] Cells capable of naturally secreting human GDNF may be
identified using the following tools: (1) Oligonucleotides
representing a portion of the messenger RNA for human GDNF or
complementary to a portion of the messenger RNA for human GDNF may
be used to discover cell lines producing the human GDNF message by
Northern blot analysis, RNase protection, in situ hybridization,
the Polymerase Chain Reaction, or other related methods; or (2)
Polyclonal or monoclonal antibodies that recognize human GDNF may
be used to discover cell lines whose extracts or conditioned
culture medium contain GDNF protein by Western blot analysis, ELISA
assay, radioimmunological assay, or other related methods. A
preferred strategy is to screen the conditioned culture medium from
a series of cells of human origin with antibodies to human GDNF by
the methods of (2) above to discover cells secreting GDNF into
their culture medium. Confirmation of the GDNF so produced would
come from purification and amino acid sequence analysis, as
performed with the GDNF produced by B49 cells and secreted into
their culture medium. Example 7 below describes the production and
isolation of antibodies to human recombinant GDNF.
[0130] Cells naturally secreting or cells transformed to secrete
human GDNF may be used to treat patients. Human or non-human animal
cells may be implanted in patients in semi-permeable polymeric
enclosures to allow release of GDNF, but prevent destruction of the
cells by the patient's immune system. Alternatively, the patient's
own cells, transformed to produce GDNF ex vivo, could be implanted
directly into the patient without such encapsulation.
[0131] The methodology for the membrane encapsulation of living
cells is familiar to those of ordinary skill in the art, and the
preparation of the encapsulated cells and their implantation in
patients may be accomplished without undue experimentation. See,
U.S. Pat. Nos. 4,892,538; 5,011,472; and 5,106,627, each of which
is specifically incorporated herein by reference. A system for
encapsulating living cells is described in PCT Application WO
91/10425 of Aebischer et al., specifically incorporated herein by
reference. See also, PCT Application WO 91/10470 of Aebischer et
al.; Winn et al 1991 Exper. Neurol. 113:322-329; Aebischer et al.
1991 Exper. Neurol. 111:269-275; Tresco et al. 1992 ASAIO 38:17-23,
each of which is specifically incorporated herein by reference.
[0132] In particular, cells secreting GDNF may be implanted in
Parkinson's disease patients in the striatum to provide GDNF to the
terminal fields of nigral dopaminergic neurons and into the nigra
to provide GDNF to the dopaminergic cell bodies. Such
locally-applied GDNF would promote sprouting and reinnervation of
the striatum by dopaminergic terminals and would prevent or slow
the further degeneration of the dopaminergic nerve cells.
[0133] The present invention includes, therefore, a method for
preventing or treating nerve damage by implanting cells into the
body of a patient in need thereof; such cells either selected for
their natural ability to generate GDNF or engineered to secrete
GDNF. Preferably, the secreted GDNF being human mature GDNF when
the patient is human.
[0134] It should be noted that the GDNF formulations described
herein may be used for veterinary as well as human applications and
that the term "patient" should not be construed in a limiting
manner. In the case of veterinary applications, the dosage ranges
should be the same as specified above.
[0135] It is understood that the application of teachings of the
present invention to a specific problem or environment will be
within the capabilities of one having ordinary skill in the art in
light of the teachings contained herein. Examples of representative
uses of the present invention appear in the following examples.
EXAMPLES
Example 1
Purification and Sequencing of GDNF.
[0136] This example describes methods for the bioassay and
purification of GDNF. It also describes methods for preparing the
B49 cell line conditioned medium that is the starting material for
purification. Methods for obtaining amino acid sequence of purified
GDNF and partial amino acid sequences obtained from the purified
protein are also described.
[0137] A. Materials.
[0138] Timed pregnant rats were from Zivie Miller lab, Allison
Park, Pa. Unless specified, all reagents were from Sigma Chemical
Co., St. Louis, Mo.
[0139] B. Bioassay for Dopaminercric Neurotrophic Activities.
[0140] Culture Conditions:
[0141] Dissociated mesencephalic cell cultures were prepared as
previously described (Friedman and Mytilineou 1987 Neurosci. Lett.
79:65-72), with minor modifications. Briefly, rostral mesencephalic
tegmentum from brains of Sprague-Dawley rat embryos, at the 16th
day of gestation, were dissected under the microscope in sterile
conditions, collected in Ca.sup.2+- and Mg.sup.2+-free Dulbecco's
phosphate buffered saline (Gibco, Gaithersburg, Md.) and
dissociated mechanically by mild trituration. The cells were plated
in 100 .mu.l per well onto 16-mm diameter tissue culture wells
(Falcon, Lincoln Park, N.J., 24-well plate) containing 400 .mu.l
medium to give a density of 2.5-3.5.times.10.sup.5 cells per well.
The culture wells had been previously exposed to 0.1 mg/ml solution
of poly L-ornithine in 10 mM sodium borate, pH 8.4, for 3 hours at
37.degree. C., washed 3 times in milli-Q H.sub.2O and once in
Earle's balanced salt solution (Gibco). The feeding medium (10/10)
consisted of minimal essential medium (MEM, Gibco) supplemented
with glucose (33 mM), sodium bicarbonate (24.5 mM), glutamine (2
mM), HEPES (15 mM), penicillin G (5 U/ml), streptomycin (5
.mu.g/ml), 10% heat-inactivated fetal calf serum (Gibco) and 10%
heat inactivated horse serum (Gibco). The cultures were kept at
37.degree. C. in a water-saturated atmosphere containing 6.5%
CO.sub.2. After 3 hours, when most of the cells had adhered to the
bottom of the well, the medium was replaced with 500 .mu.l of fresh
medium. At this time, a serial dilution of the sample to be assayed
for GDNF activity was added to each well in duplicate and the
plates were incubated in the 37.degree. C. incubator. After a week,
the cultures were treated for 24 hours with fluorodeoxyuridine (13
g/ml) and uridine (33 .mu.g/ml) to prevent excessive glial
proliferation and subsequently fed with the above medium without
fetal calf serum. The feeding medium was changed weekly.
[0142] Alternatively, chemically defined serum-free medium was used
in which serum was replaced by a mixture of proteins; hormones and
salts. The defined medium (DM) consisted of a mixture of MEM and
F12 nutrient mixture (both Gibco, 1:1; vol/vol) with glucose (33
mM), glutamine (2 mM) NaHCO.sub.3 (24.5 mM), HEPES (15 mM),
supplemented with transferrin (100 .mu.g/ml), insulin (25
.mu.g/ml), putrescine (60 .mu.M), progesterone (20 nM), sodium
selenite (30 nM) penicillin G (5 U/ml) and streptomycin (5
.mu.g/ml). The osmolarity of the DM was adjusted to 325 by the
addition of milli-Q H.sub.2O. (110-125 ml H.sub.2O/1). Using DM,
few nonneuronal cells were evident, by morphology or by staining
for glial fibrillary acidic protein (GFAP), which is an
astrocyte-specific cytoskeletal protein. GDNF is active in
stimulating dopamine uptake in both serum-containing and defined
media. All assays reached in the following examples were done in
serum-containing medium.
[0143] The functional status of the dopaminergic neurons may be
assayed in these cultures by measuring dopamine uptake through
specific "scavenger" transporters in the dopaminergic neurons and
by counting the number of neurons positive for the dopamine
synthetic enzyme tyrosine hydroxylase using immunohistochemistry.
The possibility of significant contamination of the cultures with
the noradrenergic neurons, which can also transport dopamine and
also contain tyrosine hydroxylase, was ruled out by careful
dissection and by demonstrating that the dopamine transporters have
the pharmacological profile characteristic of dompainergic, rather
than noradrenergic, neurons. Dopamine uptake in these cultures is
inhibited by GBR12909, an inhibitor of the monoamine transporter on
dompainergic neurons, with an ED.sub.50 of 20nM. In contrast, at
least 300-fold more desipramine, an inhibitor of monoamine
transporter or noradrenergic neurons, is required to inhibit
dopamine uptake in their cultures. These values are those that have
been reported for the monoamine transporter in dopaminergic
neurons.
[0144] Sample Preparation:
[0145] Prior to being assayed for dopaminergic neurotrophic
activity in the mesencephalic cell cultures, all the samples
generated from Step 1 to Step 3 of purification (see Section C
below) were desalted as follows. One hundred .mu.l of the medium
10/10 (as a carrier) was added to a Centricon-10(Amicon) and
allowed to sit for 10 minutes. Aliquots of the sample to be assayed
were added to the Centricon, followed by 1 ml of Dulbecco's high
glucose Modified Eagle medium, without bicarbonate, but containing
10 mM HEPES, pH 7.2 (solution A), and centrifuged at 5,000.times. g
for 70 minutes. The retentate (about 0.1 ml) was brought back to
1.1 ml with fresh solution A and reconcentrated twice. The sample
was filtered through a 0.11 .mu.m Ultrafree-MC sterile Durapore
unit (Millipore, Bedford Mass.) prior to being added to the culture
well.
[0146] .sup.3H-dopamine Uptake:
[0147] Uptake of tritiated dopamine (.sup.3H-DA) was performed in
cultures at day 6 or day 7 as described previously (Friedman and
Mytilineou (1987) Neurosci. Lett. 79:65-72) with minor
modifications, and all the solutions were maintained at 37.degree.
C. Briefly, the culture medium was removed, rinsed twice with 0.25
ml of the uptake buffer which consists of Krebs-Ringer's phosphate
buffer, pH 7.4, containing 5.6 mM glucose, 1.3 MM EDTA, 0.1 mM
ascorbic acid and 0.5 mM pargyline, an inhibitor of monoamine
oxidase. The cultures were incubated with 0.25 ml of 50 nM
.sup.3H-DA (New England Nuclear, Boston, Mass. sp. act 36-37
Ci/mmol) for 15 minutes at 37.degree. C. .sup.3H-DA uptake was
stopped by removing the incubation mixture and cells were then
washed twice with 0.5 ml of the uptake buffer. In order to release
.sup.3H-DA from the cells, the cultures were incubated with 0.5 ml
of 95% ethanol for 30 min at 37.degree. C., and then added to 10 ml
of EcoLite (ICN, Irvine, Calif.) and counted on a scintillation
counter. Blank values were obtained by adding to the uptake buffer
0.5 mM GBR-12909 (RBI), a specific inhibitor of the high-affinity
uptake pump of the dopamine neurons (Heikkila et al. 1984 Euro J.
Pharmacol. 103:241-48) and were usually less than 5% of the
.sup.3H-DA uptake in untreated control cultures. The number of
trophic units (TU) of GDNF activity was defined as the reciprocal
of the dilution that gave 50% of maximal stimulation of the
.sup.3H-DA uptake of the culture. Specific activity was determined
by dividing the number of TUs by the amount of protein present in
the sample.
[0148] C. Purification of GDNF.
[0149] Starting Material:
[0150] B49 glioblastoma cells obtained from D. Schubert, Salk
Institute, La Jolla, Calif. (See Schubert et al. 1974 Nature
249:224-27) were grown to confluence in DMEM medium containing 10%
fetal calf serum, 4 mM glutamine, 50 U/ml penicillin-G and 50
.mu.g/ml streptomycin in culture flasks (225 cm.sup.2, Costar,
Cambridge, Mass.). The serum-free growth-conditioned medium (CM)
was prepared by washing the culture once with 10 ml of serum-free
medium and then placing the cells in 50 ml per flask of serum-free
medium for 2 days. CM was collected, and the cells were replenished
with fresh serum-free medium every 2 days thereafter until day 6.
The combined CM of 3 harvests from each batch of cells was
centrifuged at 5,000.times. g for 20 min at 4.degree. C. to remove
cells and debris. The supernatant was concentrated approximately
10-fold via Amicon concentrator (YM10 membrane) and centrifuged at
40,000.times. g for 20 minutes at 4.degree. C. The supernatant was
filtered through 0.2 .mu. Micro Culture Capsule (Gelman Sciences)
and could be stored at 4.degree. C. for up to one month.
[0151] Step 1. Heparin Sepharose Chromatography:
[0152] The above preparation (200 mg of protein) was loaded onto a
column (1.times.25 cm) of Heparin Sepharose CL-6B (Pharmacia,
Piscataway, N.J.) equilibrated with 50 mM NaPi buffer, pH 8.0,
containing 0.15 N NaCl (buffer A). The column was then washed with
the same buffer until the optical density at 280 nm (O.D.sub.280)
of the effluent returned to baseline and eluted with a 100 ml
linear gradient running from buffer A into 50 mM NaPi, pH 8.0,
containing 1.5 N NaCl (buffer B). Two ml fractions were collected.
Fractions were analyzed for conductivity and the GDNF activity.
FIG. 1 shows such a chromatography. The profile of eluted proteins
is plotted as O.D.sub.280. Superimposed are plots of the
conductivity and GDNF activity measured in each fraction. The
fractions indicated by the bar with peak GDNF activity (around
0.6-0.8 N NaCl) were pooled for further analysis.
[0153] Step 2. FPLC Superose Chromatography:
[0154] The above pool was concentrated to 0.4 ml via Amicon
concentrator (Amicon, Beverly, Mass., YM10 membrane) and
chromatographed on a fast protein liquid chromatography (FPLC)
Superose 12 column (Pharmacia) in 50 mM NaPi buffer, pH 7.4,
containing 0.5 N NaCl with a flow rate of 0.5 ml/min. After 14 min
of elution, fractions of 0.5 ml were collected into siliconized
microfuge tubes containing 5 .mu.l of 0.4% Tween 20. Aliquots from
each fraction were analyzed for GDNP activity. FIG. 2 shows such a
chromatography with the protein profile traced at O.D.sub.280 and
with the GDNF activity pattern superimposed. 85% of the GDNF
activity loaded on the column was recovered in fractions
#12-15.
[0155] Step 3. RP-HPLC:
[0156] Fraction #14 from above was acidified with 10 .mu.l of 25%
trifluoroacetic acid (TFA). Half of the acidified material was
loaded onto a narrow bore Aquapore RP-300 C-8 reverse phase HPLC
column (Brownlee column, Applied Biosystems, San Jose, Calif.),
2.1.times.220 mm, and eluted with an H.sub.2O/0.1% TFA: 80%
acetonitrile/0.085% TFA gradient. Protein containing fractions were
collected manually into siliconized microfuge tubes based on the UV
absorption at 214 nm. Aliquots from each fraction were analyzed for
GDNF activity. FIG. 3 shows such a chromatography with the protein
profile traced at O.D.sub.214 and with the activity pattern in the
lower panel. Fractions 5 and 6 contained about 90% of the activity
recovered in RP-HPLC, while fraction 7 accounted for the remaining
10% of the activity. FIG. 4 shows a silver stained SDS-PAGE gel run
of the fractions around the GDNF activity peak shown in FIG. 3.
[0157] Step 4. Preparative SDS-PAGE:
[0158] Fractions 5 and 6 containing the peak GDNF activity were
pooled and concentrated to 20 .mu.l in the presence of 10 .mu.l of
0.4% Tween 20 on a speed vac. Added to the sample were 1 .mu.l of 1
M Tris base and 5 .mu.l of 0.2 M Tris-HCl, pH 6.8, containing 40%
glycerol and 5% SDS, and run on non-reduced 15% SDS-PAGE (Laemmli
1970 Nature 277:680-684) (slab of 0.075.times.14.times.11.5 cm, 20
well-comb, 0.075.times.0.4.times.2.8 cm/sample well).
Electrophoresis was conducted at 10.degree. C. at 40 mA/gel for 2
hours. The gel strip was sliced into 1.14 mm slices. Each slice was
cut into 2 smaller pieces and eluted with 3 sequential changes of
25 .mu.l 5 mM NaPi, pH 6.7 containing 0.01% Tween 20, over a 20
hour period with continuous rocking at 4.degree. C. The 3 aliquots
of eluted material were combined, assayed for GDNF activity (FIG.
5), and the eluate with highest activity (from gel slice #16-23
corresponding to 30-42 kD in FIG. 5) was pooled. A blank gel strip
(on top of which was loaded only the SDS-PAGE sample buffer prior
to electrophoresis) was processed similarly as a control.
[0159] Step 5. RP-HPLC:
[0160] The pooled gel eluent was concentrated to about 150 .mu.l on
a speed vac, acidified with 20 .mu.l of 25% TFA and run on RP-HPLC
as described in Step 3. Protein containing fractions were collected
manually into siliconized microfuge tubes, based on O.D.sub.214 and
assayed for GDNF activity. FIG. 6 shows the results of such
chromatography. As a control, the eluent from similarly sized blank
gel slices was also run on RP-HPLC. The only significant
O.D.sub.214 peak in the sample above the control profile (FIG. 6,
panel A vs. B) is peak 3, which contains 70% of the GDNF activity
loaded on the HPLC column. FIG. 7 shows peak 3 run on a
silver-stained SDS-PAGE gel. The only visible stain is a very broad
band between 30-42 kD, coinciding with the GDNF activity profile
observed in preparative SDS-PAGE (FIG. 5). The summary of a typical
purification is given in Table I.
[0161] D. Amino Acid Sequence of Purified GDNF.
[0162] Amino-terminal Sequence:
[0163] Peak 3 in FIG. 6 was sequenced with a gas phase protein
sequencer (Applied Biosystems). The sequence obtained is given in
FIG. 8. Sequencing of fractions with the peak GDNF activity after
step 3 of the purification (fractions 5 and 6 in FIG. 3) also
revealed a single sequence, identical to that in FIG. 8, obtained
with the purified sample. The only material these different
fractions have in common is the material running as a smear between
30-42 kDa. Therefore, the contaminating bands outside the 30-42 kD
regions seen in silver-stained gel of fractions 5 and 6 in FIG. 4
could a) be too small in amount (<1 picomoles) to be sequenced
by the current technology; b) be related to the 30-42 kD smear band
in sequence; or c) have a blocked amino-terminus.
[0164] Internal Sequence:
[0165] GDNF preparation after step 3 of the purification described
above was used as the starting material to obtain internal
sequence. Fractions 5 and 6 in FIG. 3 were pooled into a
siliconized microfuge tube containing 9 Al of 0.4% Tween and
concentrated to 40 .mu.l on a speed vac. Added to the sample were
160 .mu.l of 1% NH.sub.4HCO.sub.3 containing 2.5 M guanidine
hydrochloride and 1 .mu.g of trypsin, and incubated overnight at
37.degree. C. The mixture was acidified with 20 .mu.l of 25% TFA,
concentrated to about 150 .mu.l on a speed vac, and peptides were
separated on a narrow bore Aquapore RP-300 C8 reverse phase HPLC
column (Brownlee column), 2.1.times.220 mm, and eluted with an
H.sub.2O/0.1% TFA:80% acetonitrile/0.085% TFA gradient. Peptide
containing fractions were collected manually into siliconized
microfuge tubes based on the absorption at 214 nm. FIG. 9 shows the
results of such chromatography. Sequence of peak 10 in FIG. 9 was
determined to be identical to the first 13 amino acid residues of
the amino-terminal sequence of the untreated protein shown in FIG.
8 (SEQ ID NO:1). Peak 37 in FIG. 9 was further treated with CNBr.
The sample was concentrated to 20 .mu.l on a speed vac. Added to
the sample was 70 .mu.l of 90% formic acid and 5 mg of CNBr, and
the sample was incubated in the dark overnight at room temperature.
This mixture was concentrated to 20 .mu.l on a speed vac, diluted
with 100 .mu.l of 0.1% TFA and separated on reverse phase HPLC as
described above. FIG. 10 shows the results of such chromatography.
Peak 1 in FIG. 10 was concentrated to 20 .mu.l in the presence of 5
.mu.l of 0.4% Tween 20 on a speed vac. Added to the sample was 100
.mu.l of 1% NH.sub.4HCO.sub.3 and 5 .mu.l of 50 mM dithiothreitol
and the sample was incubated at room temperature for an hour. The
mixture was acidified with 10 .mu.l of 25% TFA, concentrated to 100
.mu.l on a speed vac and separated on reverse phase HPLC as above.
FIG. 11 shows the results of such chromatography. Both peaks 33 and
34 in FIG. 11 gave an identical sequence (FIG. 12) (SEQ ID
NO:2).
[0166] E. Characteristics of GDNF.
[0167] Mobility on SDS-PAGE:
[0168] Without any heat treatment of the sample and under
non-reducing conditions, GDNF runs as a smear band between 31-42 kD
on SDS-PAGE. When the sample is heated at 100.degree. C. for 3 min
in the presence of reducing agent (4%.beta.-mercaptoethanol), GDNF
runs as discrete multiple bands between 20-23 kD. Since about 50%
of the bioactivity loaded onto the gel could be recovered under the
former (non-reducing) but not the latter (reducing) conditions,
GDNF may be a disulfide-bonded dimer and only active as a dimer.
While a single amino-terminus suggests the GDNF preparation is
homogeneous with respect to the core primary-structure, the smear
or multiple banding pattern is suggestive of a heterogeneously
glycosylated protein.
[0169] Specific Activity:
[0170] Purified GDNF had an estimated specific activity of about 17
trophic units/ng, which indicates that half-maximal stimulation of
dopamine uptake occurs at the relatively low concentration of
approximately 60 pg/ml. The specific activity measured for purified
GDNF may be underestimated somewhat due to partial inactivation of
GDNF during purification by exposure to the acidified organic
solvents used in RP-HPLC and to the denaturing conditions in
SDS-PAGE.
[0171] Specificity of GDNF:
[0172] GDNF was purified by its ability to enhance the uptake of
dopamine in dopamine neurons (FIG. 20A). To determine whether GDNF
also upregulated another index of survival and/or maturation of the
dopamine neurons, tyrosine hydroxylase (TH) immunoreactivity in the
mesencephalic cultures was also measured. TH is a marker specific
to dopamine neurons in the cultures. The upregulation of
immunoreactivity by GDNF could be due to the increased survival of
dopamine neurons and/or to an increase in production of TH per
dopamine neurons. Purified GDNF added at the day of plating and
cultures examined eight days later resulted in a tenfold higher
number of TH.sup.+ neurons over controls without GDNF. If a second
dose of GDNF was added at day 9 and cultures examined seven days
later (16 days in vitro), a similar dose-dependent increase over
control could still be observed (FIG. 20B). Thus, GDNF could
sustain survival of dopamine neurons and/or increase the expression
of the TH gene in mesencephalic dopamine neurons.
[0173] To demonstrate that GDNF exerts a specific stimulating
effect on the maturation and/or survival of dopamine neurons and
not a general action on all neurons, the responsiveness to GDNF of
neurons containing .gamma.-aminobutyric acid (GABA), which are also
present in mesencephalic cultures, was analyzed. H.sup.3-dopamine
(.sup.3H-DA) and .sup.14C-GABA uptake were measured in sister
cultures of mesencephalic cells which had been grown with various
concentrations of GDNF for 15 and 16 days, respectively. As
described above, GDNF enhanced the .sup.3H-DA uptake capacity of
mesencephalic dopamine neurons .about.150% over control without
GDNF (FIG. 21A). However, GDNF had no significant effect on the
capacity of GABA neurons to take up .sup.14C-GABA since the
.sup.14C-GABA uptake in the presence of GDNF was only .about.20%
higher than that of the control (FIG. 21B). This is also
illustrated by the increase in the .sup.3H-DA/.sup.14C-GABA uptake
ratio calculated (FIG. 21C). These data indicate that dopamine and
GABA mesencephalic neurons respond differently to the presence of
GDNF and the stimulating effect of GDNF on .sup.3H-DA uptake in
mesencephalic cultures is specific for dopamine as contrasted to
GABA neurons.
[0174] These observations further illuminate why GDNF may be used
to treat Parkinson's disease or other disorders involving
dopaminergic neurons. These results demonstrate that GDNF
upregulates at least two important properties of dopaminergic
neurons: dopamine uptake and TH enzyme levels. The results also
demonstrate that the effects of GDNF are at least partially
specific for dopaminergic neurons, since GABA neurons are not
similarly affected.
[0175] In addition to dopaminergic and GABAergic neurons, there is
another neuronal population, serotonergic neurons, in the rat
embryo mesencephalic cultures. Some factors, such as epidermal
growth factor (EGF) that increase dopamine uptake by dopaminergic
neurons in mesencephalic cultures, also increase serotonin uptake
by the serotonergic neurons and GABA uptake by GABAergic neurons.
See, Casper et al. 1991 J. Neurosci, 30:372. This indicates that
these factors are not specific for dopaminergic neurons.
[0176] In contrast, GDNF fails to increase the uptake of serotonin
by the serotonergic neurons. .sup.3H-serotonin uptake was measured
in the same manner as for .sup.3H-DA uptake as described in Example
1B, except that the uptake buffer contained 50 nM .sup.3H-serotonin
(11 Ci/mole, Amersham, Arlington Heights, Ill.) instead of
.sup.3H-DA. In the presence of 10 .mu.M citalpram (obtained from
Dr. C. Mytilineou, Mount Sinai School of Medicine), a known potent
inhibitor of serotonin uptake in serotonin neurons, the
.sup.3H-serotonin uptake was reduced to 15%. Control values in the
presence of citalpram were subtracted from experimental values
shown in FIG. 24 In contrast to non-specific factors like EGF, GDNF
fails to increase GABA uptake (FIG. 21) and serotonin uptake (FIG.
24) under conditions in which dopamine uptake is increased
significantly. These and the results described above indicate that
GDNF is specific for dopaminergic neurons in the mesencephalic
cultures when compared to the GABAergic and serotonergic neurons
present in the same cultures. Such specificity enhances the
usefulness of GDNF for treating Parkinson's disease, which is
considered to be a disease specific to the mesencephalic (nigral)
dopaminergic neurons.
Example 2
Cloning of the Gene for GDNF.
[0177] A. Cloning of a cDNA Copy of the Rat Gene That Encodes
GDNF.
[0178] In order to clone the gene encoding GDNF, a CDNA library was
constructed from poly A.sup.+ RNA isolated from B49 cells, and this
library was screened with a degenerate oligonucleotide probe based
on the amino acid sequence obtained from purified GDNF. A cDNA
clone that hybridized to this probe was determined, by DNA
sequencing, to contain DNA sequences that are located 3' to the
sequences used in the degenerate oligonucleotide probe, that
encoded an amino acid sequence present in GDNF and located
carboxyterminal to the amino acid sequence upon which the screening
oligo probe was based.
[0179] Culture conditions for the B49 cell line are described in
detail in Example 1 above. For RNA preparation, cells were grown to
near confluence in serum containing medium, washed once in
serum-free medium (DMEM) and grown for 4 days in DMEM with one
medium change after 2 days. The cells were then harvested and total
RNA extracted by the method of Chomczynski and Sacchi 1987
Analytical Biochemistry 162:156-159. Poly adenylated RNA was
prepared from this total RNA by passage over an oligo dT cellulose
affinity column as described by Maniatis et al. 1989 Molecular
Cloning 2nd Edition, CSH Press.
[0180] Synthesis of cDNA was carried out using M-MLV RNaseH.sup.-
reverse transcriptase (Bethesda Research Lab, Gaithersburg, Md.)
according to the protocols described by the vendor. The first
strand reaction was primed with an oligo dT.sub.15 primer
(Pharmacia) and also included 8 units of RNasin (Promega, Madison,
Wis.) per 5 .mu.g of poly A+ RNA. Second strand synthesis was
directed by E. coli DNA polymeraseI, E. coli RNaseH, and E. coli
DNA Ligase (all from BRL) according to the vendor's protocol. To
facilitate cloning, the CDNA was treated with T4 DNA polymerase
(BRL) to produce flush ends and methylated with EcoRI methylase
(BRL). These steps were performed in accordance with protocols
supplied by the enzyme vendor. The cDNA was then extracted two
times with one volume of a 1:1 mixture of phenol and chloroform and
the aqueous fraction precipitated with 1/2 volume of 7.5 M
NH.sub.4Ac and 3 vol of ethanol at room temperature. The
precipitate was recovered by centrifugation for 15 min at room
temperature, at 16,000.times. g, washed with 70% ethanol, vacuum
dried and resuspended in 50 .mu.l, 50 mM Tris-HCl (7.6), 10 mM
Mgcl.sub.2, 1 mM ATP, 1 mM DTT, 5% PEG8000, containing 500 picomole
phosphorylated linker (CCCGAATTCGGG, Pharmacia) (SEQ ID NO:9) and 3
units of T4 DNA ligase (BRL). Linker ligation was carried out at
16.degree. C. overnight (-16 h). The reaction mixture was extracted
with phenol/chloroform and precipitated as above. The washed pellet
was dried and resuspended in 50 .mu.l EcoRI digestion buffer (100
mM Tris-HCl (7.5), 5 mM MgCl.sub.2, 50 mM NaCl and 0.025% Triton
X-100) to which 400 units of EcoRI (New England Biolabs, Beverly,
Mass.) was added. The reaction was incubated at 37.degree. C. for 2
h. Following precipitation (as above) the pellet was resuspended in
EcoRI digestion buffer and a second round of EcoRI digestion was
performed as described above. This reaction was precipitated and
resuspended in 40 .mu.l 10 mM Tris-HCl (8.0), 1 mM EDTA, 100 mM
NaCl. This cDNA, which now contained EcoRI-digested linkers, was
size fractionated by centrifugation through a sephacryl S-300
(Pharmacia) spin column at about 1100 g for 5 min. The flow through
from this column was collected, ethanol precipitated as above, and
resuspended in 10 mM Tris-HCl (8.0), 1 mM EDTA at a concentration
of about 0.1 .mu.g/.mu.l.
[0181] A cDNA library was constructed in the .lambda.ZapII
(Stratagene, La Jolla, Calif.) cloning vector. Typically 1 .mu.g of
EcoRI-digested and phosphatased vector arms (purchased from
Stratagene) were ligated to 0.1 .mu.g of EcoRI Tinkered CDNA in a 5
.mu.l ligation using about 3 Weiss units T4 DNA ligase (NEB) in 50
mM Tris-HCl (7.6), 7 mM MgCl.sub.2, 1 mM DTT, 5% PEG8000 and 1 mM
ATP. Ligations were carried out at 16.degree. C. overnight.
Ligations were packaged in GigapackII Gold packaging extracts
(purchased from Stratagene) according to the protocol provided by
the vendor. Libraries were plated for titering and screening on the
XL1-Blue host provided by Stratagene.
[0182] From one such ligation and packaging, about 270,000 plaque
forming units were plated out on a total of 12, 150 mm diameter,
petri plates. Duplicate nitrocellulose filter lifts were prepared
from these plates after the procedures described by Maniatis et al.
The filters were hybridized to the following .sup.32P-labeled
degenerate oligonucleotide (SEQ ID NO:7) (I=inosine):
3 5' > CCIGATAAACAAGCIGCIGC > 3' C C C
[0183] This sequence is based on the amino acid sequence (FIG.
8)(SEQ ID NO:1) obtained around the amino-terminus of purified GDNF
(SEQ ID NO:10) as described in Example 1 above:
[0184] Pro-Asp-Lys-Gln-Ala-Ala-Ala
[0185] The oligonucleotide was labeled with .sup.32P derived from
.sup.32P-ATP (Amersham, Arlington Heights, Ill.) using T4
polynucleotide kinase (Pharmacia or United States Biochemical,
Cleveland, Ohio). Hybridization reactions were carried out in
6.times. SSPE, 0.1% SDS, 0.1 mg/ml tRNA (SIGMA, St. Louis, Mo.),
and 2.times. Denhardt's (0.4 mg/ml each: ficoll,
polyvinylpyrrolidine, BSA fraction V) reagent, at 50.degree. C.
overnight (about 16 h). The hybridization solution contained
2-3.times.10.sup.6 cpm of labeled oligo per ml of solution.
Following hybridization, filters were washed twice at room
temperature in 2.times. SSPE, 0.1% SDS and twice in the same
solution pre-heated to 50.degree. C. The filters were allowed to
air dry and exposed to film for 7 days at -70.degree. C. using
intensifying screens.
[0186] The developed films were examined to identify plaques which
hybridized to the screening oligonucleotide. In this primary
screen, 24 putative duplicate positives were identified. Areas of
the library plates corresponding to the positive signals were
excised, resuspended and replated for a second round of screening
via the hybridization procedure detailed above. In this second
screen, 8 of the original 24 retested as positives, while 16 gave
negative results. These eight positives were plaque purified
through 1 or 2 additional rounds of hybridization and six of these
were subsequently analyzed by DNA sequencing to determine if they
contained DNA sequences that could encode GDNF.
[0187] The phagemid portion of the .lambda.ZapII phage, which
contains the cloned inserts, is referred to as pBluescript SK-.
pBluescript- phagemid was excised from each of the .lambda.ZapII
recombinants that hybridized to the oligonucleotide probe. The
procedure for in vivo excision of the recombinant pBluescript SK-
plasmid from the .lambda.ZapII vector is given in detail by the
vendor protocols. Briefly, coinfection of .lambda.ZAPII and an M13
"helper" phage results in packaging of a single-stranded DNA copy
of the recombinant pBluescript within an infectious M13 virion.
When such a virion infects a sensitive cell, the single-stranded
DNA is converted to a double-stranded DNA and is propagated
vertically as a plasmid. Selection for this event is afforded by
the ampicillin resistance gene encoded on pBluescript SK-. Thus E.
coli XL1-Blue derivatives containing the "rescued" recombinant
pBluescript SK- plasmid from each of the eight positive
.lambda.ZapII clones were readily obtained following the protocols
described by Stratagene and employing the "helper" phage provided
along with the .lambda.ZapII vector.
[0188] For DNA sequencing, double-stranded plasmid DNA was prepared
from six of these recombinant plasmids by a "mini-prep" procedure
based on Birnboim and Doily 1979 NAR 7:1513-1523. DNA sequencing
reactions using the dideoxy-chain terminating method were performed
using these templates and the screening oligo as the primer.
Reagents for sequencing were obtained from United States
Biochemical as a kit (Sequenase Version 2.0) and sequencing
procedures were carried out according to the protocols provided by
the vendor. One clone, pBluescript SK-76.1, derived from the clone
.mu.ZapII76.1 gave the following sequence (SEQ ID NO:11):
4 5' > GAG AGG AAC CGG CAA GCT GCA GCT GCC AGC CCA > 3' T AA
TA T A T
[0189] This sequence can be translated to give the following amino
acid sequence (SEQ ID NO:12):
[0190] Glu-Arg-Asn-Arg-Gln-Ala-Ala-Ala-Ala-Ser-Pro
[0191] which matches the amino acid sequence determined for a
region of the amino-terminus of GDNF commencing 5 amino acid
residues carboxyterminal to the end of the amino acid sequence used
to generate the screening oligo/sequencing primer. This result
demonstrated that the cDNA clone contained in .lambda.ZapII76.1
must encode a portion of, or all of, the GDNF protein purified from
the B49 cell conditioned medium.
[0192] B. Nucleotide Sequence of the Region of the cDNA Clone
[0193] .lambda.ZapII76.1 That Includes the Coding Sequence of
GDNF.
[0194] The nucleotide sequence of the first 877 base pairs of the
5' end of the cDNA clone was determined. This region was found to
contain an open reading frame (ORF) of 227 amino acids that
includes the amino acid sequence obtained for the amino-terminus of
purified GDNF and a sequence that is consistent with the internal
peptide derived by cleavage of purified GDNF. The carboxyterminal
134 amino acids predicted for this ORF comprise the predicted amino
acid sequence of the purified mature GDNF protein. The preceding 93
amino acids include a potential initiating ATG codon followed by a
putative secretion signal sequence and contain potential
proteolytic processing sites for cleavage of a precursor or
"pre-pro" form of the protein to generate the mature, purified form
of GDNF described above in Example 1.
[0195] Template DNA for sequencing reactions included
single-stranded and double-stranded versions of the plasmid
pBluescript SK-76.1 DNA. Double-stranded DNA was prepared from
cultures of XL1-Blue (pBluescript SK- 76.1) by a "boiling prep"
procedure (Anal. Biochem 114:193:97) and banded in a CsCl density
gradient. Single-stranded template was produced by infection of
XL1-Blue (pbluescript SK-76.1) with a "helper" M13 phage supplied
by the vendor (Stratagene) using the relevant protocols supplied
along with the phage. Single-stranded oligonucleotide primers of 15
to 23 nucleotides in length were synthesized on an Applied
Biosystems (Foster City, Calif.) DNA Synthesizer, model 380A
synthesizer and generally used without purification. The sequence
determination was performed using the dideoxy-chain termination
method. Reagents used were included in the Sequenase Version 2.0
kit (United States Biochemical) and used in accordance with the
protocols supplied by the vendor.
[0196] The nucleotide sequence of the first 877 nucleotides of the
5' end of the CDNA clone .lambda.ZapII76.1, which contains the
coding sequence for the purified mature GDNF protein is shown in
FIG. 13 (SEQ ID NO:3) along with the inferred amino acid sequence
of a 681 base pair open reading frame (ORF) that is found within
this sequence. The sequence corresponding to purified mature GDNF
starts at position 281 with a serine residue, and is shown in FIG.
14 (SEQ ID NO:4). The DNA sequence obtained for this region
predicts an amino acid sequence which agrees perfectly with the
first 23 residues of amino acid sequence observed at the
amino-terminus of purified GDNF (see Example 1).
[0197] Based on an analysis of the gene as depicted in FIG. 13, it
is likely that GDNF is initially translated as a pre-pro GDNF
polypeptide and that proteolytic processing of the signal sequence
and the "pro" portion of this molecule result in production of the
form of GDNF that is purified from B49 cell conditioned medium. The
most likely site of translation initiation for such a pre-pro form
is the ATG codon that occurs at position 50 in the sequence of FIG.
13 (SEQ ID NO:3).
[0198] C. Cloning the Human Gene That Encodes GDNF.
[0199] The amino acid sequences of many neurotrophic factors are
highly conserved across a variety of mammalian species
(Hallb{umlaut over (oo)}k, et al. 1991 Neuron 6:845-858; McDonald,
et al. 1991 BBA (in press)). As a consequence of the conservation
of the amino acid sequences there is considerable conservation of
the nucleotide sequences of the genes that encode these proteins.
Therefore, it is generally true that the gene encoding a
neurotrophic factor in one mammalian species can cross-hybridize
(i.e. form a stable double-stranded DNA hybrid) with the genes
encoding that factor in other mammalian species under appropriate
annealing conditions. This property was used to identify cloned
human DNA segments that include the gene for GDNF.
[0200] A human genomic library constructed in the vector
.lambda.FIXII was purchased from Stratagene (catalog #946203) and
screened using a .sup.32P-labeled probe derived from the rat cDNA
clone of GDNF (pBluescript SK-76.1) described above in Example 2B.
The probe consisted of about 250 bp of coding sequence from the
mature GDNF by specific amplification using the polymerase chain
reaction (Saiki et al. 1985 Science 230:1350) and was produced as
follows. A 50 .mu.l or 100 .mu.l PCR reaction was performed using
<1 ng .lambda.ZapII76.1 DNA as template and 10-20 pmol each of
two oligonucleotide primers based on sequence from rat GDNF. One
oligo was the "screening oligo" (also termed DHD-21) described in
Example 2A above, while the second oligo (DHD-26) (SEQ ID NO:13)
had the sequence:
5 5' > AAATTTTTIAAIATTTTATC > 3' GG C G C G
[0201] which is based on the amino acid sequence
(Asp-Lys-Ile-Leu-Lys-Asn-- Leu) (SEQ ID NO:14) obtained from an
internal peptide product of cleavage of GDNF (see Example 1). The
reaction was carried out in 10 mM Tris-HCl (pH 8.3 at 25.degree.
C.), 50 mM KCl, 1.5 mM MgCl.sub.2, 10 .mu.g/ml BSA (Promega R3961),
0.2 mM each dNTPs (Pharmacia), using 2.5-5 .mu. of Polymerase
(USB). The reaction consisted of 30 cycles of: 95.degree. C. for 1
minute, 44.degree. C. for 11/2 minutes and 72.degree. C. for 11/2
minutes. The product of this reaction was observed by agarose gel
electrophoresis to be about 250 bp which is consistent with the
positions of the two primers in the cDNA sequence shown in FIG. 13.
This unlabeled fragment was eluted from the gel by
centrifugation-with an Ultrafree-MC Filter Unit (Millipore,
Bedford, Mass.) according to the vendor protocols, and used as
template in subsequent PCR labeling reactions employing the same
two oligo primers. These reactions were performed under identical
conditions except that the concentration of cold dCTP was reduced
to 12.5 .mu.M and 2.5 .mu.M 3000-5000 Ci/mmol .alpha.-.sup.32P dCTP
(AMERSHAM) was added to the reaction. Products of the labeling
reaction were passed over a BioSpin 6 spin column (BioRad,
Richmond, Calif.). The flow-through from this column was used as
the probe to screen the human genomic library.
[0202] The library was plated out using the E. coli strain PLK17
provided by STRATAGENE. Twenty-four 150 mm petri plates each
containing approximately 50,000 plaques were prepared. Duplicate
nitrocellulose filter lifts were prepared from each plate according
to the procedures described by Maniatis et al. supra. These
forty-eight filters were probed with 250.times.10.sup.6 cpm of the
PCR probe (denatured by treatment with 0.5 N NaOH) described above
in 250 ml 6.times. SSPE, 0.1% SDS, 2.times. Denhardt's reagent, 0.1
mg/ml tRNA and 30% formamide (USB).at 42.degree. C. overnight
(.about.16h). Filters were then washed twice in 250 ml 2.times.
SSPE, 0.1% SDS at room temperature and twice in 1.6 l 0.1.times.
SSPE, 0.1% SDS preheated to 50.degree. C. The filters were allowed
to dry at room temperature and placed under film for 6 days at
-70.degree. C. with intensifying screens. Films were developed and
scored. Six strong duplicating positives were observed. Areas of
the library plates corresponding to the positive signals were
excised, resuspended, and replated for a second round of screening
via the above detailed hybridization procedure. All six retested as
positive and were plaque-purified via one additional round of
plating and hybridization.
[0203] It is a matter of routine operations for one skilled in the
art to subclone and sequence the segment of DNA around the region
that hybridizes to the probe, and thus determine all or part of the
sequence of the human gene for GDNF. If the entire human GDNF gene
is not represented in these clones, it is also a routine matter to
"walk" along the genome and clone overlapping segments of DNA
around this region to obtain and sequence any remaining portion of
the gene.
[0204] The above noted procedures and a variety of others that
would be obvious to one skilled in the art could be applied to
screen other human gene libraries. For example using the above
described probe and hybridization protocol, a human CDNA library
was screened that was constructed from A.sup.+ RNA extracted from
the human putamen. This library, contained in the cloning vector
.lambda.gt10, was purchased from Clontech (Palo Alto, Calif.)
(catalog #HL1092a, Lot #1561). This library was plated (.SIGMA.
about 250,000 plaques) on E. coli LE392 (Maniatis et al. supra) at
a density of about 20,000 plaques per plate and screened by
hybridization under the conditions described above. Following
hybridization, filters were washed twice at room temperature in
0.2.times. SSPE, 0.1% SDS and twice in 0.1.times. SSPE, 0.1% SDS
preheated to 50.degree. C. Filters were air-dried at room
temperature and placed under film. After 3 days exposure at
70.degree. C. with intensifying screens, films were developed and 8
duplicate positives were identified.
[0205] Six .lambda.FIX II clone from a human genomic library were
identified by hybridization with a rat GDNF probe and
plaque-purified to homogeneity (see above). Lysates of each phage
were prepared by the method of Sambrook et al. (Molecular Cloning:
A Laboratory Manual; 1989). DNA was prepared from these clones by
the following procedure: DNAase I (Pharmacia) and RNAase A (Sigma)
was added to 5 ml of each culture to give a final concentration of
1 .mu.g/ml. The solution was incubated at 37.degree. C. for 1 hour.
Then 5 ml of 20% polyethylene glycol (Sigma),2M NaCl, was added and
the solution was incubated at 0.degree. C. for 1 hour. The
.lambda.phage were pelleted by centrifugation at 12,000.times. g
for 10 min. The phage pellet was resuspended in 250 .mu.l of TE (10
mM TRIS, pH 7.4, 1 mM EDTA) and sequentially extracted with an
equal volume of: a. chloroform; b. phenol; c. a 1:1 mixture of
chloroform and phenol; and d. chloroform. Ammonium acetate was
added to give a final concentration of 0.25 M and the DNA was
precipitated by the addition of 2 volumes of ethanol and
centrifugation at 10,000.times. g. The DNA pellet was resuspended
in TE.
[0206] DNA from each of the six .lambda.isolates was digested with
various restriction endonucleases and the fragments separated by
electrophoresis through an agarose gel (Sambrook et al.). The DNA
fragments were transferred to two identical nylon membranes
(Schleicher and Schuell) and hybridized with radiolabeled probes
from rat GDNF. In rat GDNF, there is an Eco R1 site between
nucleotides 356 and 357 (following the numbering of FIG. 13). This
cleaves within the coding sequence of mature GDNF. To determine
whether the human genomic GDNF clones have a site at an homologous
position, Eco R1 was used as one of the restriction endonucleases
for digesting the human clones. Specific radiolabeled probes were
made for regions of the gene either upstream (probe 1) or
downstream (probe 2) of the Eco R1 site in rat GDNF. Probe 1 was
268 bp long and consisted of 14 bp of 5' untranslated sequence of
rat GDNF and 254 bp of coding sequence (amino acids 1 through 85).
It was prepared by amplification of .lambda.Zap II76.1 DNA using
the polymerase chain reaction and the oligonucleotide primers PD1
(GACGGGACTCTAAGATG) (SEQ ID NO:15) and DHD23
(GCIGCIGC(C/T)TG(T/C)TT(A/G)TCIGG) (SEQ ID NO:16). The reaction
conditions for preparing the probe are as described above except
that the reaction consisted of 30 cycles of: 95.degree. C. for 1
minute, 50.degree. C. for 11/2 minutes and 72.degree. C. for 11/2
minutes. Probe 2 was 195 bp long and consisted of 17 nucleotides of
3' untranslated sequence of rat GDNF and 178 bp of coding sequence
(amino acids 153 through 211). It was prepared using the polymerase
chain reaction and oligonucleotide primers LF2 (CGAGACAATGTACGACA)
(SEQ ID NO:17)and PD2 (CTCTGGAGCCAGGGTCA) (SEQ ID NO:18) and
.lambda.ZAPII76.1 as the DNA template. The reaction conditions were
the same as for probe 1.
[0207] Five of the six .lambda.clones gave identical hybridization
patterns. Probe 1 hybridized to an approximately 700 bp Eco R1
fragment and probe 2 hybridized to an approximately 2.8 Kb Eco R1
fragment. The fact that the two probes hybridized to two different
Eco R1 DNA fragments strongly suggested that the human GDNF gene
contains an homologous Eco R1 site. The 700 bp and the 1.8 Kb Eco
R1 fragments were subcloned separately into Bluescript SK-
(Strategene). Nucleotide sequences of these two fragments were
determined as described in Example 2B. The sequence of these DNA
fragments is shown in FIG. 19 (SEQ ID NO:5). From the sequence it
is clear that there is an intron preceding amino acid 52 of
pre-proGDNF. There is no intron in the portion of the gene that
codes for mature human GDNF. The predicted amino acid sequence of
mature human GDNF is 93% homologous to mature rat GDNF. This is
approximately the same degree of amino acid sequence homology found
among rat and human proteins for other neurotrophic factors (Amino
acid sequence homology between rat and human CNTF is 83%; McDonald
et al. BBA (1991) (in press). Amino acid sequence homology between
rat and human NGF is 95%, BDNF is 100%, and NT-3 is 100t; Hallbook
et al. 1991 Neuron 6:845-855).
[0208] To obtain the complete human pre-proGDNF sequence, a
radiolabeled hybridization probe may be made based on the sequence
of human GDNF already obtained and use this to screen human CDNA
libraries. Because cDNAs are copies of the processed mRNA, the
introns are not present and the sequence of the complete coding
sequence can be obtained. Alternatively, now that the position of
the intron relative to the coding sequence is known, a
hybridization probe that is specific for sequences upstream of the
intron can be made from the rat cDNA clone and this probe can be
used to screen a genomic library for clones that contain the 5'
exon(s).
[0209] D. Nucleotide Sequence Encoding the First 50 Amino Acids of
Human Pre-proGDNF
[0210] As detailed in Example 2C, there is an intron that splits
the nucleotide sequence corresponding to amino acid 51 of human
pre-proGDNF. In order to obtain the sequence of this portion of the
molecule, a human genomic library was screened with a probe derived
from the amino-terminal coding sequence of rat pre-proGDNF and one
hybridizing clone was sequenced and shown to contain the coding
sequence of amino acids 1 through 50 of human pre-proGDNF as shown
in FIG. 22 (SEQ ID NO:8)
[0211] For this library screen a PCR probe was synthesized as
described in Example 2C. The oligonucleotide primers employed
were:
6 PD1 = 5' > CCCGAATTCGACGGGACTCTAAGATG > 3' (SEQ ID NO:19)
LFA = 5' > CGGTGGCCGAGGGAGTGGTCTTC > 3' (SEQ ID NO:20)
[0212] Conditions for the PCR (both "cold" and .sup.32P-labelling)
reactions were as described in Example 2B except that the reaction
consisted of 25 or 30 cycles of: 95.degree. C. for 1 min.,
50.degree. C. for 11/2 min., and 72.degree. C for 1 min. The
product of this reaction contains the first 122 bp of rat
pre-proGDNF coding sequence and 14 base pair 5' to the putative
initiator ATG (see FIG. 13 and SEQ ID NO:3). Conditions for
screening the human genomic library with this probe were as
described in Example 2C. The same filter lifts used to identify
clones carrying sequences for mature human GDNF were washed twice
for 15 min. in deionized-distilled H.sub.2O heated to boiling,
probed overnight, and washed according to the protocol described in
Example 2C. The filters were exposed to film for 3 days at
-70.degree. C. with intensifying screens. When developed, numerous
duplicate positives of varying intensities were observed. Twelve
relatively strong positives were picked and 10 of these were plaque
purified by successive rounds of hybridization under the screening
conditions.
[0213] The cloned DNAs of these recombinant phages were analyzed by
Southern blot hybridization. An approximately 1000 bp AluI fragment
was found to hybridize to the screening probe and was subcloned
into SmaI-digested pBluescript SK- to produce pBSSK-.lambda.3AluI.
This cloned AluI fragment was further subcloned to facilitate
sequencing of the relevant DNA segment. Purified pBSSK-13AluI DNA
was digested with a series of restriction enzymes that cleave the
vector only once (within the polylinker region) and the digestion
products analyzed by agarose gel electrophoresis. Two restriction
enzymes (PstI and SacII) were thus identified that cleaved once
within the cloned DNA. FIG. 22 shows a map of SacII and PstI sites.
Southern blots revealed that the region of the cloned segment that
hybridized to the screening probe was located between the SacII and
PstI sites of the cloned AluI segment. Therefore, for sequencing,
two deletion derivatives of pBBSK-.lambda.3AIuI were constructed.
In one instance the small, about 300 bp, PstI fragment was deleted
as follows: The plasmid was digested with PstI and the digest was
ligated and transformed into E. coli. Transformants were screened
for those lacking the small PstI fragment. In parallel, the 300 bp
SacII fragment was similarly deleted from pBSSK-.lambda.3AluI to
produce a second deletion derivative. These two deletion plasmids
were used as templates for sequencing reactions. Sequencing was
carried out as described in Example 2B.
[0214] FIG. 22 (SEQ ID NO:8) presents 233 base pairs of the
sequence thus obtained. This sequence contains a region of 151 bp
that exhibits a very high degree of homology with the first 151 bp
of coding sequence for rat pre-proGDNF; 88% identity at the amino
acid level and 95% identity at the DNA level. Therefore, it is
concluded that this region is part of the exon that carries the
coding sequence of the amino-terminal 50 residues of the human
pre-proGDNF and the first nucleotide of the codon for residue 51.
The sequence immediately 3' to this 151 bp sequence is homologous
to the consensus sequence for the 5' end of mammalian introns
[Shapiro and Senapathy 1987 Nucl. Acids Res. 15:7155-7174]. The
sequence immediately 5' to the putative initiator ATG shows strong
homology to the rat sequence for 28 bp; 27 of 28 residues are
identical. At this point the upstream sequence diverges sharply.
The sequence around the point of divergence shows considerable
homology to the consensus sequence for the 3' end of mammalian
introns. (Shapiro and Senapathy, supra.) Thus, it seems likely that
this is a splice site although there is no direct evidence for
this. The open reading frame containing human pre-proGDNF extends
at least 27 base pairs upstream of the initiator ATG. As discussed
in the Detailed Description of Preferred Embodiments above, it is
possible that other forms of a pre-proGDNF could be produced that
would contain additional upstream amino acids. These forms might
also be processed to produce the mature GDNF molecule that has been
purified and sequenced (see Example 1).
[0215] The nucleotide sequences presented here and in Example 2C,
contain the entire coding sequence for a human pre-proGDNF that
exhibits extensive homology to the rat pre-proGDNF which has been
successfully expressed in mammalian cells (see Example 5) to
produce active rat GDNF.
Example 3
Use of GDNF to Prevent Experimental Parkinsonism
[0216] This example describes methods for creating experimental
Parkinsonism in monkeys by appropriate administration to the
animals of the neurotoxin MPTP (1-methyl-4-phenyl-1,2,3,6
tetrahydro-pyridine). It also describes methods for administering
GDNF to animals exposed to MPTP in order to alleviate the
development of Parkinsonism in such animals.
[0217] A. Administration of GDNF in Monkeys Treated with MPTP to
Produce Experimental Parkinsonism.
[0218] A stainless-steel cannula may be implanted into the right
lateral ventricle and connected to a subcutaneously-implanted
osmotic minipump (Alzet 2002). The minipump contains GDNF at
various concentrations or its diluent as a negative control. The
pump delivers 0.5 .mu.l/h for 14 days. Two days after the
cannula-pump implant, monkeys (Cebus apella) receive an injection
of 0.6 mg/kg of MPTP into the right carotid artery. Six weeks after
the initial implant, animals are perfused with saline and the brain
rapidly removed. The brain is dissected on ice and punches of
tissue are removed from the caudate nucleus and putamen. The
substantia nigra is placed in fixative. The caudate-putamen tissue
is analyzed by HPLC-EC for dopamine, the substantia nigra is
processed for tyrosine hydroxylase (TH) immunoreactivity.
[0219] B. Efficacy of GDNF.
[0220] Degeneration of nigral dopaminergic nerve cells and their
axonal projections to the caudate/putamen cause experimental
Parkinsonism in this monkey model. There are several experimental
indications that GDNF may prevent or reduce the severity of this
neuronal degeneration. For example, GDNF may prevent the loss of TH
positive nerve cell bodies in the substantia nigra. This indicates
sparing by GDNF of nigral dopaminergic nerve cells from the toxic
effects of MPTP. GDNF may also prevent the loss of TH positive
fibers in the caudate/putamen. This indicates sparing by GDNF of
the axonal projections of the nigral dopaminergic neurons from the
toxic effects of MPTP. GDNF may also prevent the loss of dopamine
content in the caudate/putamen. This indicates sparing from the
toxic effects of MPTP by GDNF of the axons and their dopamine
content extending from the nigral dopaminergic neurons to the
caudate/putamen.
Example 4
Biological Activities and Potential Clinical Indications for
GDNF
[0221] Purified GDNF increases dopamine uptake by dopaminergic
neurons present in cultures of embryonic mesencephalic nerve cells
in both enriched and defined culture media, as demonstrated in
Example 1. This indicates that GDNF is a neurotrophic factor for
these dopaminergic nerve cells. As such, GDNF may prove useful in
treating the degeneration of these neurons that occurs in
Parkinson's disease. In addition, GDNF may prove useful in treating
improper functioning of other brain dopaminergic neurons. Such
improper functioning may occur in schizophrenia and other disorders
requiring treatment with neuroleptics.
[0222] A. Purified GDNF Promotes the Survival of Parasympathetic
and Sympathetic Nerve Cells in Culture:
[0223] 1. Assay for Neuronal Survival:
[0224] Materials
[0225] 3-[4,5-dimethylthiazol-2 yl)-2,5-diphenyl-tetrazolium
bromide (MTT) was obtained from Sigma Chemical Co., St. Louis,
Missouri. Fetal calf serum was purchased from Hyclone Laboratories,
Logan, Utah. Culture media and salt solutions were obtained from
Irvine Scientific, Santa Ana, Calif. Culture dishes were obtained
from Costar, Cambridge, Mass. Utility grade pathogen-free fertile
chick embryo eggs were obtained from Spafas, Roanoke, Ill.
[0226] Assay
[0227] Cultures of primary chick embryo ciliary ganglia and
sympathetic chain ganglia were prepared as previously described
(Collins 1978 Develop. Biol. 65:50; Manthorpe et al. 1986 Develop.
Brain Res. 25:191). Briefly, ciliary or sympathetic ganglia were
removed from fertile, pathogen free chicken eggs that had been
incubated for 8 and 10 days, respectively, at 38.degree. C. in a
humidified atmosphere. The ganglia were chemically dissociated by
exposure first to Hanks' Balanced Salt Solution without divalent
cations, containing 10 mM HEPES buffer pH 7.2 for 10 min at
37.degree. C., and then by exposure to a solution of 0.125%
bactotrypsin 1:250 (Difco, Detroit, Mich.) in Hanks' Balanced Salt
Solution modified as above for 12 min at 37.degree. C.
Trypsinization was stopped by addition of fetal calf serum to a
final concentration of 10%.
[0228] After this treatment, ganglia were transferred to a solution
consisting of Dulbecco's high glucose Modified Eagle Medium without
bicarbonate containing 10% fetal calf serum and 10 mM HEPES, pH 7.2
and were mechanically dissociated by trituration approximately 10
times through a glass Pasteur pipet whose opening had been fire
polished and constricted to a diameter such that it took 2 seconds
to fill the pipet.
[0229] The dissociated ganglia were then plated in culture medium
(Dulbecco's Modified Eagle Medium supplemented with 10% fetal calf
serum, 4 mM glutamine, 60 mg/L penicillin-G, 25 mM HEPES, pH 7.2)
in 100 mm diameter tissue culture dishes (40 dissociated ganglia
per dish) for three hours. This preplating was done in order to
separate the nonneuronal cells, which adhere to the dish, from the
nerve cells, which do not adhere. After three hours, the
nonadherent nerve cells were collection by centrifugation,
resuspended in culture medium, and plated in 50 .mu.l per well onto
half area 96 well microtiter tissue culture plates at a density of
1500 nerve cells per well. The microtiter wells had been previously
exposed to a 1 mg/ml solution of poly-L-ornithine in 10 mM sodium
borate, pH 8.4 overnight at 4.degree. C., washed in distilled water
and air dried.
[0230] Ten .mu.l of a serial dilution of the sample to be assayed
for neurotrophic activity was added to each well and the dishes
were incubated for 20 hours at 37.degree. C. in a humidified
atmosphere containing 7.5% CO.sub.2 After 18 hours for ciliary and
40 hours for sympathetic ganglia, 15 .mu.l per well of a 1.5 mg/ml
solution of the tetrazolium dye MTT in Dulbecco's high glucose
Modified Eagle Medium without bicarbonate containing 10 mM HEPES,
pH 7.2, was added and the cultures placed in the 37.degree. C.
incubator for 4 hours. Then, 75 .mu.l of a solution of 6.7 ml of 12
M HCl per liter of isopropanol was added and the contents of each
well triturated 30 times to break open the cells and suspend the
dye. The absorbance of 570 nm was determined relative to a 690 nm
reference for each well using an automatic microtiter plate reader
(Dynatech, Chantilly, Va.). The absorbance of wells which had not
received any neurotrophic agent (negative controls) was subtracted
from the absorbance of sample-containing wells. The resulting
absorbance is proportional to the number of living cells in each
well, defined as those nerve cells capable of reducing the dye. The
number of trophic units of neurotrophic activity was defined as the
reciprocal of the dilution that gave 50% of maximal survival of
nerve cells. Specific activity was determined by dividing the
number of trophic units by the amount of protein present in the
sample.
[0231] Results
[0232] As illustrated in FIG. 15, purified GDNF promotes the
survival in culture of parasympathetic nerve cells from chick
embryo ciliary ganglia. As illustrated in FIG. 16, purified GDNF
also promotes the survival in culture of sympathetic nerve cells
from chick embryo sympathetic chain ganglia.
[0233] These results indicate that GDNF acts as a survival factor
for parasympathetic and sympathetic neurons. As such, it may be
useful in treating various forms of nerve damage to the autonomic
(i.e., parasympathetic and sympathetic) nervous system. Such damage
may occur from metabolic conditions, such as diabetes or renal
dysfunction. Such damage may also occur from treatment of patients
with various chemotherapeutic agents, such as the cancer
chemotherapeutic agents cisplatin and vincristine, or the AIDS
chemotherapeutic agents, ddI and ddC. Such damage may also occur
from genetic conditions, such as dysautonomia. Such damage may also
occur from traumatic injury.
Example 5
Expression of Recombinant GDNF in Animal Cells
[0234] A. Construction of Recombinant Plasmids for COS Cell
Expression.
[0235] An approximately 1.5 kb SmaI fragment of pBluescript SK-76.1
that contains the entire GDNF coding sequence was subcloned into
the plasmid vector pSG5 (Green et al. 1988 Nucl. Acids. Res.
16:369) which is designed for transient expression of cloned genes
in cells expressing SV40 T antigen, such as COS cells.
[0236] The DNA sequence of the GDNF cDNA (FIG. 13) (SEQ ID NO:3)
and restriction endonuclease mapping identified a SmaI fragment
delineated by one SmaI site located in the polylinker of the vector
(18 bp 5' to the 5' end of the cDNA clone) and one SmaI site
(.about.1500 bp distant) located within the cDNA clone
approximately 800 bp 3' to the end of coding sequence for mature
GDNF. This SmaI fragment was cloned into pSG5 as follows. Purified
pSG5 plasmid DNA (Stratagene) was digested with EcoRI and treated
with calf intestinal alkaline phosphatase (CIAP), (Promega)
according to the vendor protocols. Subsequently the vector was
electrophoresed and eluted from an agarose gel. Purified
pBluescript SK-76.1 plasmid DNA was methylated with EcoRI
methylase, digested with SmaI and ligated with the EcoRI linker
molecule described in Example 2A. Following EcoRI digestion and
agarose gel electrophoresis, the approximately 1.5 Kb SmaI fragment
of interest (now EcoRI methylated and linked) was eluted and
ligated to the EcoRI digested and phosphatased pSG5 vector.
Ligation products were used to transform competent E. coli XL1-Blue
using the CaCl.sub.2 procedure (Maniatis et al. supra).
Ampicillin-resistant transformants were selected and analyzed for
recombinant plasmids by restriction endonuclease digestion and
agarose gel electrophoresis. Digestion with EcoRI indicated that
most transformants contained plasmids carrying the desired insert.
Digestion with BamHI identified the orientation of the cloned GDNF
gene relative to the SV40 promoter present in the vector (note the
BamHI site at position 15 in the sequence in FIG. 13). Both
orientations were obtained.
[0237] Two transformants were chosen for further analysis; one
contained a plasmid, termed pSG5::rGDNF-7, carrying the GDNF gene
in the proper orientation for it to be expressed in RNA transcripts
initiated at the SV40 promoter, while the second contained a
plasmid, termed pSG5::rGDNF-4, carrying the GDNF gene in the
opposite orientation; in which RNA transcripts initiating at the
SV40 promoter will not express GDNF. Purified preparations of both
of these plasmids were prepared by CsCl density gradient
centrifugation for use in COS cell expression experiments.
[0238] B. Expression of GDNF in COS-7 Cells.
[0239] Plasmid DNA from these constructs was prepared by the method
of alkaline lysis followed by CsCl density centrifugation (Maniatis
et al., supra). This DNA was transfected into COS-7 cells by the
method of Sompayrac and Danna (1981 Proc. Natl. Acad. Sci. USA
78:7575-7578). As a control, equivalent COS cell cultures were
transfected with plasmid vector DNA containing the GDNF insert in
the opposite orientation, which would not allow expression of the
GDNF protein. Per 100 mm culture dish, 30 .mu.g lipofectin and
0.3-1 .mu.g plasmid DNA were used.
[0240] After transfecting for 24 hours, the medium was aspirated
off and replaced with OptiMEM I.+-.3% FCS. Cultures were incubated
for 48 hours and harvested as follows:
[0241] a) the medium (conditioned medium or CM) was drawn off and
stored at -80.degree. C.;
[0242] b) 5 ml of PBS+2.5 mM EDTA was added to the cell lawn and
held at 25.degree. C. for 3 minutes; and, then the cells were
pipetted off the dish and centrifuged at 1000.times. g for 5
minutes. The supernatant was removed and the cell pellets were
stored at -80.degree. C.
[0243] The CM was concentrated 30-fold on Centricon 10
concentrators and assayed for bioactivity. The cell pellets were
sonicated in 500 .mu.l 10 mM EDTA, pH 7.0, plus 1 mM benzamidine,
100 .mu.M PMSF, 1 mM E-amino-N-caproic acid. The cell lysates were
centrifuged at 14,000.times. g for 5 minutes and the supernatants
assayed for bioactivity.
[0244] C. Bioassay of Expressed GDNF
[0245] The cell lysate and culture media from COS cells transfected
with GDNF-expressing and control plasmids (with the GDNF coding
sequence in the incorrect orientation) were assayed for both the
ability to increase dopamine uptake in cultures of mesencephalic
neurons (see Example 1) and for the ability to increase the
survival of sympathetic ganglia neurons (see Example 4). The COS
cell culture medium (FIG. 17) and cell lysate (data not shown)
increased dopamine uptake, as expected of GDNF. As shown in FIG.
18, the COS cell culture medium and cell lysate increased the
survival of sympathetic chain neurons, as expected of GDNF.
[0246] These results clearly indicate that expression of the GDNF
gene in an animal cell results in the production of a protein with
the biological activities demonstrated for purified GDNF.
Example 6
Expression of Human GDNF in E. coli
[0247] A. Construction of a Plasmid Which Codes for Human GDNF
[0248] Using the sequence information of the human GDNF gene
(Example 2C), synthetic oligonucleotides PD3 and PD4 were made as
primers for the amplification of the human GDNF gene and its
expression from a plasmid expression vector in E. coli. The
sequences of oligonucleotides PD3 (SEQ ID NO:21) and PD4 (SEQ ID
NO:22) are:
7 PD3: 5' CGCCGATCCAATAAGGAGGAAAAAAAATGTCACCAGATAAACAAAT 3' PD4: 5'
CGCGGTACCCAGTCTCTGGAGCCGGA 3'
[0249] Oligonucleotide PD3 is 46 nucleotides long. The 17
nucleotides at the 3' end are a perfect match to the human GDNF
gene in the region that codes for the N-terminus terminus of the
mature protein. These 17 nucleotides are preceded by a translation
initiation codon, ATG, so that synthesis of mature human GDNF will
start at the correct amino acid in E. coli The other nucleotides
are designed to provide other signals deemed necessary for good
expression in E. coli as well as a BamH1 endonuclease restriction
site necessary for construction of the GDNF expression plasmid.
[0250] Oligonucleotide PD4 is 26 nucleotides long. The 17
nucleotides at the 3' end are a perfect match to 17 nucleotides of
the human GDNF gene 3' of the stop codon. This oligonucleotide also
provides sequences necessary to reconstruct a KpnI restriction
endonuclease site for construction of the GDNF expression
plasmid.
[0251] The reaction conditions for the amplification of the human
GDNF are as follows: the total reaction volume was 100.mu.l and
contained 1 ng of a ADNA clone containing the human GDNF gene, 20
pmoles each of PD3 and PD4, 20 mM Tris-HCl pH8.8, 10 mM KC1, 6 mM
(NH.sub.4).sub.2SO.sub.4, 1.5 MM MgCl.sub.2, and 0.1% Triton X-100.
The reaction mixture was heated to 95.degree. C. for 5 minutes,
cooled to 44.degree. C., and 2 units of Pfu DNA polymerase
(stratagene) was added. The reaction consisted of 30 cycles of:
72.degree. C. for 11/2 minutes, 95.degree. C. for 1 minute, and
44.degree. C. for 1h minutes. At the end of the reaction,
MgCl.sub.2 was added to a final concentration of 10 mM. 5 units of
DNA polymerase I large (Klenow) fragment (Promega) was added and
the reaction incubated at 37.degree. C. for 10 minutes. Then 10
.mu.l of 3M NaAc and 220 .mu.l of EtOH was added and the solution
centrifuged at 12,000.times. g for 15 minutes to precipitate the
DNA. The precipitated DNA was resuspended in 100 of 50 MM Tris-HCl
(pH 8), 50 mM NaCl, 10 mM MgCl.sub.2, 20 units of BamH1 and 20
units of KpnI and incubated at 37.degree. C. for 1 hour. A DNA
fragment of the correct size was identified after electrophoresis
through an agarose gel and purified using an Ultrafree-MC Filter
Unit (Millipore). This fragment was ligated into an E. coli
expression vector, pT3XI-2, (described below). Ligation conditions
were as follows: the total reaction volume was 5.mu.l and contained
10 ng of pT3XI-2 DNA linearized with KpnI and BamHI, 5 ng of the
human GDNF DNA fragment as described above, 50 mM Tris-HCl (pH
7.6), 10 mM MgCl.sub.2, 1 mM ATP, 1 mM DTT, 5% polyethlene
glycol-8000, and 1 unit of T4 DNA ligase (Bethesda Research
Laboratories). The reaction was incubated at 14.degree. C. for 2
hours.
[0252] The vector pT3XI-2 was constructed in the following manner.
The starting plasmid for this construction was plasmid pKK223-3
(Brosius and Holy, 1984) purchased from Pharmacia. Plasmid pKK223-3
carries a partial gene for tetracycline resistance. This
nonfunctional gene was replaced by a complete tetracycline
resistance gene carried on plasmid pBR322. Plasmid pKK223-3 was
digested completely with SphI and partially with BamH1. A 4.4
kilobase pair fragment was gel purified and combined with a
synthetic adapter (SEQ ID NO:23):
8 5' GATCTAGAATTGTCATGTTTGACAGCTTATCAT 3' 3'
ATCTTAACAGTACAAACTGTCGAATAGTAGC 5' BglII ClaI
[0253] and a 539 base pair fragment of DNA from a ClaI, SphI digest
of the tetracycline resistance gene of pBR322 (PL Biochemicals,
27-4891-01). The resulting plasmid was designated pCJ1.
[0254] Next, a XhoI linker purchased from New England Biolabs was
inserted into plasmid pCJl's PvuII site to form plasmid pCJX-1.
This insertion disrupts the rop gene which controls plasmid copy
number. Next, an EcoRI fragment containing the lacI gene was
purified from plasmid pMC9 (Calos et al., 1983), then inserted into
the XhoI site with XhoI to EcoRI adapters. The polylinker region in
plasmid pKK223-3 was next replaced with a polylinker containing
additional sites by cutting with EcoRI and PstI (SEQ ID NO:24):
9 5' AATTCCCGGG TACCAGATCT GAGCTCACTA GTCTGCA3' 3' GGGCCC
ATGGTCTAGA CTCGAGTGAT CAG 5'
[0255] The plasmid vector so obtained is designated pCJXI-1.
[0256] Finally, the tetracycline resistance gene was replaced with
a similar gene which had the recognition sites for restriction
enzymes HindIII, BamH1, and SalI destroyed by bisulfite
mutagenesis. The following procedure was used to mutate the
tetracycline resistance gene of pBR322. Plasmid pBR322 was cut with
HindIII, then mutagenized with sodium bisulfite (Shortle and
Botstein, 1983). The mutagenized DNA was ligated to form circular
DNA, then cut with HindIII to linearize any plasmid that escaped
mutagenesis. E. coli JM109 (Yanisch-Perron et al., 1985).
Tetracycline-resistant plasmids were isolated and checked for loss
of the HindIII site in the tetracycline resistance gene.
Successfully mutated plasmid was designated pT1. A similar
procedure was followed to mutagenize the BamH1 site in pT1,
yielding plasmid pT2. Plasmid pT2 in turn was mutagenized to remove
the SalI site, forming plasmid pT3. A ClaI-StyI fragment of pT3
carrying the mutated tetracycline resistance gene was isolated and
used to replace the homologous fragment of pCJXI-l to form pT3XI-2.
The mutated tetracycline resistance gene still encodes for a
functional protein. Downstream of the tac promoter region, a
polylinker was introduced which contains, among other sites, BamH1
and KpnI restriction sites useful for cloning genes for expression
in E. coli After the 2 hour ligation of the vector with the human
mature GDNF construct, 2 .mu.l of the reaction mix was used to
transform Epicurian Coli SURE.RTM. supercompetant E. coli cells
(Statagene) according to the manufacturer's instructions. DNA
sequence of one of the recombinant plasmids was determined as
described in Example 2B. The sequence confirmed that this plasmid
contained the complete coding sequence of the human GDNF gene
coding for mature human GDNF.
[0257] B. Expression of Human GDNF in E. coli
[0258] The recombinant plasmid containing DNA sequences encoding
human GDNF was transformed into E. coli strain JM107.O
slashed.MCB0005, a T1 resistant variant of JM107 (Yanisch-Perron et
al. (1985)), using the CaCl.sub.2 method described in Sambrook et
al. (1989). One of the recombinants was grown in 50 ml of LB media
(Sambrook et al.) with 100 .mu.g/ml ampicillin (Sigma) with shaking
at 37.degree. C. overnight. The next day the culture was diluted
1:70 in LB media with 100 .mu.g/ml ampicillin and grown for 5 hours
with shaking at 37.degree. C. 20 ml of cells were harvested by
centrifugation at 8,000.times. g for ten minutes. The pellet was
resuspended in 4 ml of 10 mM EDTA pH 7.4. The cells were disrupted
using a French Press Pressure Cell (SLM Instruments) at 18,000
psig. The lysate was centrifuged at 12,000.times. g for 15 minutes
at 4.degree. C. The pellet was resuspended in 10 mM EDTA. It has
been found that relatively more GDNF accumulates if fermentation is
allowed to take place at 42.degree. C. rather than 37.degree. C. or
30.degree. C.
[0259] The presently preferred method for obtaining high levels of
GDNF expression in E. coli using the recombinant plasmid described
in Example 6A (in which the coding sequence for human mature GDNF
is cloned in the expression vector pT3XI-2) is as follows. For a 10
l fermentation a 500 ml inoculum is grown in LB medium (pH 7)
containing 15 .mu.g/ml tetracycline at 37.degree. C. in a 2 l
baffled shake flask to an optical density (A.sub.660) of between 2
and 3. This culture is used to inoculate 10 l of growth medium
containing: 12 g/l tryptone, 24 g/l yeast extract, 25 g/l glycerol,
1.3 g/l KH.sub.2HPO.sub.4, 0.4 g/l KH.sub.2PO.sub.4, 0.1 ml/l of
4:1 mixture of Macol19:GE60, and 15 mg/l tetracycline HCl. This
culture is grown for approximately 12 to 18 hours at 42.degree. C.
to optical densities of approximately 12 to 20 (A.sub.660) The pH
of the fermentation is maintained at 7.0 and the dissolved oxygen
is maintained at 30% of saturation. Post-fermentation, the culture
is chilled at 4.degree. C. and cells are harvested by
centrifugation.
[0260] The production of human GDNF from this plasmid described
above is not specific to this strain of E. coli but can be produced
in any suitable strain. The plasmid has been transformed into two
other strains of E. coli, JM108 (Yanisch Perron et al., 1985) and
SURE.RTM. (Stratagene). In both of these strains a new protein band
of the correct molecular weight has been visualized by Coomassie
Blue staining after electrophoresis through a polyacrylamide
gel.
[0261] An aliquot of the resuspended material was electrophoresed
through a polyacrylamide gel. The gel was stained with Coomassie
Blue. A protein of the expected molecular weight for GDNF (15,000
daltons) was present only in the cultures that contained the
recombinant human GDNF plasmid but not in the cultures that
contained vector pT3XI-2 alone. The recovered protein was subjected
to standard amino terminal sequencing procedures, and the first 22
amino acids of this protein are identical to the amino acid
sequence of human GDNF as shown in FIG. 19, confirming that human
GDNF is being correctly expressed in E. coli.
[0262] C. Refolding and Bioactivity of Recombinant Human GDNF
Produced in Bacteria
[0263] Preparation of Material for Refolding.
[0264] The E. coli transformant JM107 (pT3.times.12::huGDNF) was
grown to stationary phase at 37.degree. C. in a yeast extract
(#0127-01 Difco Laboratories, Detroit, Mich.) and tryptone
(#0123-05 Difco Laboratories, Detroit, Mich.) based complex medium
(24 g/L yeast extract, 12 g/L tryptone, 5 g/L glycerol, 1.3 g/L
K.sub.2HPO.sub.4, 0.4 g/L KH.sub.2PO.sub.4, 0.1 ml/L Macol 19/GE60
(4:1), 15 mg/L tetracycline) without IPTG induction. The cells were
centrifuged at 16,000.times. g in a JA10 rotor at 4.degree. C. for
20 minutes and the cell paste stored at -20.degree. C.
[0265] The cells were processed as follows: 5 gm of cell paste was
homogenized with 40 ml of 10 mM EDTA, pH 7.0 on ice using an OCI
Instruments homogenizer. The slurry was French-pressed three times
at 20,000 psi then centrifuged at 30,000.times. g in a JA 20 rotor
for 10 minutes at 4.degree. C. The supernatant was discarded and
the pellet was homogenized and centrifuged as above. In one
embodiment, the pellet from the re-extraction was homogenized with
40 mL of 25 mM Tris, pH 7.4, centrifuged as above, and the
supernatant discarded. The pellet was homogenized with 20 mL of 50
mM Tris, pH 8.0, containing 8 M urea with or without addition of 30
mM 2-mercaptoethanol, centrifuged as above and the supernatant
retained. The supernatant is referred to as the TU extract. In the
preferred embodiment, the pellet was homogenized in 40 ml of 10 mM
Tris, pH 8.0, containing 1 mM EDTA, 1% NP-40, centrifuged as above,
and the supernatant discarded. The pellet was solubilized by
sulfonylation as follows: The pellet was homogenized in 25 ml of 20
mM sodium phosphate, pH 7.4 containing 8m urea, 100 mM sodium
sulfite and 10 mM sodium tetrathionate. The sulfonylation was
allowed to proceed at 4.degree. C. overnight with stirring and then
centrifuged at 16,000.times. g, 4.degree. C., for 10 minutes to
clarify the solution.
[0266] Partial Purification of TU Extract Prior to Refolding.
[0267] The TU extract was partially purified by ion exchange
chromatography on S-Sepharose Fast Flow resin (Pharmicia). The
column was equilibrated and run at room temperature in 25 mM Tris,
pH 7.4, containing a 8 M urea and 30 mM 2-mercaptoethanol (buffer
A). After loading the sample and washing with buffer A to baseline
optical density, the column was eluted at 10% column volume per
minute with 5 column volumes each of buffer A and 100 mM Tris, pH
9.0, containing 8 M urea, 500 mM NaCl, and 30 mM 2-mercaptoethanol
(buffer B). Column fractions were monitored at 280 nM and analyzed
by SDS-PAGE. GDNF eluted as the major protein peak at 60-70% of the
gradient. Fractions enriched in GDNF were pooled for refolding
(FIG. 25).
[0268] Partial Purification of Sulfonylated Extract Prior to
Refolding.
[0269] The sulfonylated extract was partially purified by ion
exchange chromatography on Q-Sepharose Fast Flow resin (Pharmicia)
The column was equilibrated and run at 4.degree. C. in 10 mM Tris,
pH 8.0, containing 4M urea (buffer A). After loading the sample and
washing with buffer A to baseline optical density, the column was
eluted as 5t column volume per minute with 5 column volumes each of
buffer A and 10 mM Tris, pH 8.0, containing 4M urea and 500 mM NaCl
(buffer B). Column fractions were monitored at 280 nM and analyzed
by SDS-PAGE. GDNF eluted at the major protein peak at 50% of the
gradient. Fractions enriched in GDNF were pooled for refolding.
[0270] Refolding of Partially Purified TU Extract.
[0271] GDNF, partially purified as described above, was refolded as
follows: To 4 ml of pooled column eluate containing GDNF at
approximately 1 mg/ml, dithiothreitol was added to 5 mM. The tube
was capped so as to exclude air and held at 25.degree. C. for 15
minutes. Next, oxidized glutathione disodium salt was added to 15
mM, the tube capped again so as to exclude air, and held at
25.degree. C. for 15 minutes. This solution was then diluted with
14 volumes of refold buffer (100 mM Na.sub.2HPO.sub.4), 10 mM
ethanolamine, pH 8.3, containing 4 M urea; 5% polyethylene glycol
300; and 2 mM cysteine) and held under argon at 5.degree. C. for 3
days.
[0272] Refolding of Partially Purified Sulfonylated Extract.
[0273] GDNF, partially purified as described above, was refolded as
follows: Pooled column eluate containing GDNF at approximately
3mg/ml was diluted with 19 volumes of refold buffer (100 mM
Na.sub.2HPO.sub.4 Tris, pH 8.3, containing 4 M urea; 5%
polyethylene glycol 300; and 3 mM cysteine) and held under argon at
5.degree. C. for 3 days.
[0274] Analysis of Refolded GDNF by SDS-PAGE.
[0275] GDNF extracted from bacteria without prior exposure to
reducing agents migrates as a monomer on SDS-PAGE, at an apparent
molecular weight of about 16 kDa compared to the migration of
molecular weight standard proteins. There is no detectable GDNF at
the position of a dimer. GDNF, exposed to reducing agent (30-150 mM
2-mercaptoethanol) either during extraction or just before SDS-PAGE
but prior to refolding, migrates at a position indistinguishable
from the non-reduced bacterial protein, with an apparent molecular
weight of about 16 kDa (FIG. 26, lanes 6 & 13). This indicates
that GDNF prepared from the bacterial cells is not dimerized prior
to refolding.
[0276] After refolding as above, most of the bacterially-produced
recombinant GDNF migrates on non-reducing SDS-PAGE as an apparent
dimer at approximately 30 kDa (FIG. 26, lane 2). Reduction of the
refolded GDNF with 150 mM 2-mercaptoethanol prior to SDS-PAGE
causes it to again migrate at the position of the monomer at
approximately 16 kDa (FIG. 23, lane 5). These results indicate that
refolding of GDNF causes the protein to become a disulfide-bonded
dimer. SDS-PAGE of refolded GDNF was run without reduction, and the
gel sliced along its length and the slices assayed for bioactivity
in the sympathetic ganglia neuron survival assay (see below). The
only detectable bioactivity was at the position of the dimer,
indicating that the dimer is biologically active.
[0277] Analysis of Refolded GDNF on Reversed-phase HPLC
(RP-HPLC).
[0278] GDNF partially purified by S-Sepharose or Q-Sepharose
chromatography, but prior to refolding, migrated on RP-HPLC,
performed as indicated below, with a retention time of about 21
minutes. GDNF after refolding migrated under identical conditions
with a retention time of about 15 minutes. A shift in retention
time is expected for successful refolding of GDNF. It is often seen
that a shift in retention times on RP-HPLC is observed after
refolding of proteins.
[0279] RP-HPLC of these samples was performed as follows: at a flow
rate of 1 ml/minute: A O.46.times.25 cm C-4 column (VyDac #214TP54)
was developed as follows: Solvent A=0.1% trifluoracetic acid (TFA)
in water; Solvent B=0.1% TFA in acetonitrile; From 0.5 to 1.5
minutes, B is increased from 5% to 25%; From 1.5 to 31.5 minutes, B
is increased from 25% to 55%.
[0280] Analysis of Refolded GDNF by Bioassays.
[0281] Refolded GDNF was bioassayed in both the chick embryo (E10)
sympathetic ganglia neuron survival bioassay (Example 4A) and the
rat embryo (E16) mesencephalic culture dopamine uptake bioassay
(Example 1B). Prior to refolding, GDNF, exposed to 30 mM
2-mercaptoethanol and purified by S-Sepharose or Q-Sepharose
chromatography as above, exhibited no detectable bioactivity in the
mesencephalic culture dopamine uptake assay and greatly reduced
bioactivity in the sympathetic neuron survival bioassay. The
apparent ED50 in the sympathetic neuron survival bioassay of
S-Sepharose chromatographed material was about 1 .mu.g/ml, which is
about 333-fold lower than refolded rhGDNF (see below). For
Q-Sepharose chromatographed material the apparent ED50 in the
sympathetic neuron survival bioassay was about 3 .mu.g/ml, which is
about 100-fold lower than refolded rhGDNF (see below). After
refolding, GDNF, with or without prior exposure to
2-mercaptoethanol, was apparently fully active in both bioassays
(FIGS. 27-28). This result indicates that GDNF acquired significant
bioactivity upon refolding and also that the reduced or absent
bioactivity before refolding was not due to exposure to
2-mercaptoethanol.
[0282] The ED50 of refolded recombinant human GDNF (rhGDNF) in
these bioassays was similar to that observed previously for rat
GDNF purified from B49-cell conditioned medium. In the sympathetic
neuron survival bioassay the ED50 for rhGDNF was about 3 ng/ml
(FIG. 27) and the ED50 for rat GDNF was about 5 ng/ml. In the
mesencephalic culture dopamine uptake assay, the ED50 for rhGDNF
was about 30 pg/ml (FIG. 28) and for rat GDNF about 50 pg/ml. These
results indicate that a substantial proportion of rhGDNF was
successfully refolded and fully biologically active.
Example 7
Production and Isolation of Antibodies to GDNF
[0283] Antibodies to rhGDNF were generated by the following
procedure. This procedure is seen to include but not be limited to
this adjuvant, immunization protocol, and species of animal. Also,
antibodies to GDNF may be raised using the refolded, native protein
or the denatured, inactive protein as in the procedure given below
or with contiguous peptides of the GDNF sequence from human or
other animal species.
[0284] Monoclonal antibodies may be generated by one of many
standard procedures (see Antibodies, a laboratory manual; Cold
Spring Harbor Laboratory 1988 ISBN 087969-314-2 editor Ed Harlow
and David Lane). In brief, such a procedure for generating
monoclonal antibodies typically but not exclusively involves
immunizing the appropriate animals and monitoring the antibody
response of these animals to the immunizing protocol, isolating
antibody producing cells such as from a lymphoid organ of one or
more responsive animals, fusing these cells with an appropriate
cell line such as myeloma cells to produce hybridomas that are
antibody secreting immortal cells, and screening to progressively
isolate hybridomas until single cell clones are obtained producing
the desired monoclonal antibody.
[0285] Polyclonal antibodies in rabbits were raised as follows: Two
milliters of sterile saline containing 0.005-0.25mg rhGDNF were
injected into a vial of the RIBI adjuvant MPL-TDM-CWS emulsion
(RIBI ImmunoChem Research, Inc.) and vortexed to form an emulsion
as per the manufacturer's instructions. Anesthetized female New
Zealand white rabbits were injected following the suggested
immunization protocol from RIBI. One milliliter of adjuvant antigen
emulsion was administered as follows:
[0286] 0.30 ml intradermal (0.05 ml in each of six sites)
[0287] 0.40 ml intramuscular (0.20 ml into each hind leg)
[0288] 0.10 ml subcutaneous (neck region)
[0289] 0.20 ml intraperitoneal
[0290] The animals were injected again (boosted) every 4-6 weeks by
the same protocol. Blood was drawn from the-animals before the
first injection and at 10-14 days after each boost to test for
antibody production with a neutralization assay or a standard
ELISA.
[0291] The neutralization assay was carried out as follows using
the rat E16 mesencephalic culture assay. Rabbit test serum was
diluted into Dulbecco's minimal essential medium buffered with 25
mM HEPES to pH7.4 containing 5mg/ml of bovine serum albumin
(referred to as BSA5). This in turn was added to the assay wells
(25 .mu.l of diluted test serum into 500 .mu.l of tissue culture
solution) and allowed to incubate at 37.degree. for 30 minutes.
Next rhGDNF was added as 25 .mu.l of a stock diluted solution in
BSA5 containing rhGDNF at 6.32 ngm/ml for a final rhGDNF
concentration of 0.316 ngm/ml in the assay. Dopamine uptake was
measured after eight days in culture by the previously described
procedure. Results with antisera from the second boosts are shown
below for the neutralization assay (Refer to Table 2 below).
10TABLE 2 Rabbit Number Antigen *Neut. EC.sub.50 +Elisa EC.sub.50
1604 refolded rhGDNF 20 .times. 10.sup.3 25 .times. 10.sup.3 2257
refolded rhGDNF 12 .times. 10.sup.3 7 .times. 10.sup.3 2506
refolded rhGDNF 2 .times. 10.sup.3 3 .times. 10.sup.3 9380
denatured rhGDNF 2 .times. 10.sup.3 2 .times. 10.sup.3 *antiserum
dilution for 50% neutralization of GDNF stimulated dopamine uptake
+antiserum dilution for 50% of the maximum (plateau) signal in
ELISA
[0292] The antisera were also titered for GDNF antibodies in a
standard ELISA by the following procedure: Microtiter plates (96
well, Nunc maxisorp) were coated with 100 .mu.l per well of rhGDNF
at 1.0 .mu.gm/ml in 50 mM sodium bicarbonate, pH9.6 coating buffer
overnight at 4.degree. C. The plates were washed four times with
plate wash buffer (PWB; phosphate buffered physiological saline,
pH7.2 containing 0.5% Tween 20) and then blocked for 2 hours at
25.degree. C. with 200 .mu.l per well of 2% bovine serum albumin in
phosphate buffered physiological saline, pH7.2. The plates were
washed again with PWB and serum samples to be titered (100 .mu.l)
diluted in 20% normal goat serum and PWB) added to the wells.
Plates were incubated for 1.5 hours at 35.degree. C. and washed
again with PWB. Alkaline phosphatase conjugated goat anti-rabbit
IgG (Jackson Immunochemicals) at a 1:2500 dilution in PWB was added
to each well (100 .mu.l) and incubated for 1.5 hours at 35.degree.
C. The plates were washed with PWB as before. Next p-NPP substrate
(disodium p-nitrophenyl phosphate; Sigma Cat. No. MP389) was added
to each well (100 .mu.l at 1.0 mg/ml p-NPP in 10% diethanolamine,
pH9.8) and the plate incubated at 25.degree. C. Color development
was followed by reading the plates at 405-490 nm on a plate reader
(Molecular Devices Enax).
[0293] Antisera were also used to detect and quantitate GDNF on
Western Blots as follows: Sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS PAGE) was performed by the basic procedure
first described by U. K. Laemmli (Nature 227:680-685 (1970)) using
a 121/2% acrylamide resolving gel and 41/2% acrylamide stacking
gel. Gels (16.times.14.times.0.15 cm) were electrophoresed at 40m
amp constant current for 3 hours. For reduction/denaturation,
samples were heated at 100.degree. C. for 10 minutes in sample
buffer containing 1% SDS and 150 mM 2-mercaptoethanol.
[0294] For Western blotting, the gel was then transblotted onto
Immobilon-P membrane (Millipore Cat. No. IPVH 151 50) at 80 m amp
constant current for 16 hours in 25 mM Trisbase, 192 mM glycine,
0.1% SDS, and 20% methanol and processed as follows:
[0295] 1) The membrane was blocked for one hour at 25.degree. C. in
blocking buffer (10 mM Tris, pH 7.4 containing 150 mM NaCl; 0.05t
Tween 20; 4% skim milk; and 0.02% sodium azide) with gentle
rocking.
[0296] 2) The membrane was next incubated at 25.degree. C. for 2
hours with gentle rocking in blocking buffer containing diluted
primary antisera to GDNF.
[0297] 3) The membrane was washed (4 5-minute washes) in blocking
buffer.
[0298] 4) The membrane was next incubated at 25.degree. C. for 2
hours with gentle rocking in blocking buffer containing diluted
secondary antibody (alkaline phosphatase conjugated affinity
purified goat anti-rabbit IgG; Cappel Cat. No. 59299).
[0299] 5) The membrane was washed (4 5-minute washes) with blocking
buffer excluding the skim milk.
[0300] 6) The membrane was developed in 50 ml of developing buffer
(100 mM Tris, pH 9.5 containing 100 mM NaCl and 5 mM MgCl.sub.2)
with 165 .mu.l of NBT and 83 .mu.l of BCIP (Promega kit Cat No.
P3771) at 25.degree. C. with gentle rocking until the desired
staining is achieved.
Example 8
Preparation of Membrane Encapsulated Cells That Secrete GDNF, and
Implantation into Patient.
[0301] Cells that secrete GDNF may be encapsulated into
semipermeable membranes for implantation into patients suffering
from nerve damage. In a preferred embodiment, the patient is
suffering from Parkinson's disease, and the encapsulated cells that
secrete GDNF are implanted into the striatum of the patient to
provide GDNF to the dopaminergic cell bodies.
[0302] In one embodiment of the invention, cells that have been
engineered to secrete GDNF--such as those prepared and described in
Examples 5 and 6 above--are incorporated into biocompatible,
implantable, and retrievable polymeric inserts. The inserts may be
designed so as to permit the secreted GDNF to enter into the tissue
surrounding the implanted cells, while preventing factors from the
surrounding tissue that would be detrimental to the cells from
access to the cells.
[0303] The cells that have been engineered to secrete GDNF may be
encapsulated into such semipermeable membranes according to the
method described in published PCT application WO 91/10425, entitled
Cell Capsule Extrusion Systems. The membrane encapsulated cells may
be implanted into the striatum pursuant to standard surgical
procedures.
Sequence CWU 1
1
* * * * *