U.S. patent application number 10/211341 was filed with the patent office on 2002-12-26 for primer-mediated polynucleotide synthesis and manipulation techniques.
This patent application is currently assigned to Stratagene. Invention is credited to Padgett, Kerstien A., Sorge, Joseph A..
Application Number | 20020197642 10/211341 |
Document ID | / |
Family ID | 27081577 |
Filed Date | 2002-12-26 |
United States Patent
Application |
20020197642 |
Kind Code |
A1 |
Sorge, Joseph A. ; et
al. |
December 26, 2002 |
Primer-mediated polynucleotide synthesis and manipulation
techniques
Abstract
The invention provides improved techniques for conveniently
manipulating polynucleotides of interest without the need to rely
upon the presence of naturally occurring restriction sites.
Additionally, using the methods and primers of the invention, one
may synthesize a polynucleotide of interest in a form which is
easily and directionally cloned into a DNA sequence of choice
without necessarily introducing extraneous nucleotides in the final
polynucleotide product. The methods of the invention employ
releasable primers that comprise a recognition site for a releasing
enzyme joined to a region for annealing to the polynucleotide
template of interest. Polynucleotide sequences of interest are
synthesized using one or more synthesis primers, wherein at least
one of the primers is a releasable primer. After synthesis, the
synthesis product is cleaved by a releasing enzyme. In a preferred
embodiment of the invention, inhibitory base analogs are
incorporated in the synthesis product to protect against the
formation of unwanted internal cleavage products. In another
embodiment of the invention, at least one of the releasable primers
is bound to an immobilizing solid phase support so as to produce
immobilized synthesis products that may be conveniently released by
a releasing enzyme. Another aspect of the invention is to provide
releasable primers and kits for performing the subject methods.
Typically, such kits may comprise a releasing enzyme and one or
more reagents for performing a polynucleotide synthesis reaction,
preferably a cyclic amplification reaction.
Inventors: |
Sorge, Joseph A.; (Rancho
Santa Fe, CA) ; Padgett, Kerstien A.; (San Diego,
CA) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT &
DUNNER LLP
1300 I STREET, NW
WASHINGTON
DC
20006
US
|
Assignee: |
Stratagene
|
Family ID: |
27081577 |
Appl. No.: |
10/211341 |
Filed: |
August 5, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10211341 |
Aug 5, 2002 |
|
|
|
09795965 |
Feb 28, 2001 |
|
|
|
09795965 |
Feb 28, 2001 |
|
|
|
08713404 |
Sep 13, 1996 |
|
|
|
6261797 |
|
|
|
|
08713404 |
Sep 13, 1996 |
|
|
|
08592938 |
Jan 29, 1996 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/91.2 |
Current CPC
Class: |
C12N 15/10 20130101;
C12Q 1/686 20130101; C12N 15/66 20130101; C12Q 2525/131 20130101;
C12Q 2525/117 20130101; C12Q 1/686 20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
What is claimed is:
1. A method of producing a polynucleotide of interest, said method
comprising the steps: synthesizing the polynucleotide of interest
in a polynucleotide synthesis reaction employing a first releasable
primer, whereby a polynucleotide synthesis product is produced; and
cleaving the polynucleotide synthesis product with a releasing
enzyme specific for the releasable primer, whereby a released
synthesis product is produced.
2. A method according to claim 1, wherein said polynucleotide
synthesis reaction employs a second primer.
3. A method according to claim 2, wherein the second primer is a
releasable primer.
4. A method according to claim 2, wherein said polynucleotide
synthesis reaction is a cyclic amplification reaction.
5. A method according to claim 4, wherein the cyclic amplification
reaction is a polymerase chain reaction.
6. A method according to claim 1, wherein the releasable primer
comprises a recognition site for a type IIS restriction
endonuclease.
7. A method according to claim 3, wherein the first and second
releasable primers comprise recognition sites for a type IIS
restriction endonuclease.
8. A method according to claim 1, wherein the releasable primer is
bound to a solid phase support.
9. A method according to claim 1, wherein at least one inhibitory
base analog is present in the released synthesis product.
10. The method according to claim 9 wherein the inhibitory base
analog is a methylated analog.
11. The method according to claim 10, wherein the inhibitory base
analog is 5-methyl-cytosine.
12. The method according to claim 11, wherein the releasing enzyme
is Eam1104I.
13. A method according to claim 3, wherein at least one inhibitory
base analog is present in the released synthesis product.
14. A method according to claim 13, wherein the inhibitory base
analog is a methylated analog.
15. A method according to claim 14, wherein the inhibitory base
analog is 5-methyl-cytosine.
16. A method according to claim 15, wherein the releasing enzyme is
Eam1104I.
17. A method of constructing a polynucleotide of interest, said
method comprising the steps of: synthesizing a first polynucleotide
of interest in a polynucleotide synthesis reaction employing first
and second primers, wherein at least one of said first and second
primers is a releasable primer, whereby a first polynucleotide
synthesis is produced; cleaving the first polynucleotide synthesis
product with a releasing enzyme specific for a recognition site of
said first releasable primer, whereby a first released synthesis
product is produced; synthesizing a second polynucleotide of
interest in a second polynucleotide synthesis reaction employing
third and fourth primers, wherein at least one of said third and
fourth primers is a releasable primer, whereby a second
polynucleotide synthesis product is produced; cleaving the second
polynucleotide synthesis product with said releasing enzyme
specific for the recognition site of said third releasable primer,
whereby a second released synthesis product is produced; and
ligating the first released synthesis product to the second
released synthesis product.
18. A method according to claim 17, wherein said first
polynucleotide synthesis reaction is a cyclic amplification
reaction.
19. A method according to claim 18, wherein said second
polynucleotide synthesis reaction is a cyclic amplification
reaction.
20. A method according to claim 19, wherein the first, second,
third, and fourth primers are releasable primers.
21. A method according to claim 20, wherein at least one inhibitory
base analog is present in the first polynucleotide synthesis
product.
22. A method according to claim 21, wherein at least one inhibitory
base analog is present in the second polynucleotide synthesis
product.
23. The method according to claim 21 wherein the inhibitory base
analog is a methylated analog.
24. The method according to claim 23, wherein the inhibitory base
analog is 5-methyl-cytosine.
25. The method according to claim 24, wherein the releasing enzyme
is Eam1104I.
26. A releasable oligonucleotide primer, said primer comprising a
recognition site for a releasing enzyme and an annealing region,
wherein the releasing enzyme cleaves polynucleotide substrates at a
site separate from the recognition site.
27. A releasable oligonucleotide primer according to claim 26,
wherein said releasing enzyme recognition site is a restriction
endonuclease recognition site.
28. A releasable oligonucleotide primer according to claim 27,
further comprising nucleotides located 5' and adjacent to the
restriction endonuclease recognition site.
29. A releasable oligonucleotide primer according to claim 28,
wherein the restriction endonuclease recognition site is recognized
by Eam1104I.
30. A releasable oligonucleotide primer according to claim 27,
wherein the primer is bound to a solid phase support.
31. A set of releasable synthesis primers for seamless domain
replacement comprising the first, second, third, and fourth
releasable primers of the method of claim 20.
32. A kit for seamless polynucleotide synthesis, said kit
comprising a releasing enzyme.
33. A kit according to claim 32, said kit further comprising an
inhibitory base analog nucleoside triphosphate.
34. A kit according to claim 32, said kit further comprising a
thermostable DNA polymerase.
35. A kit according to claim 33, wherein the releasing enzyme is a
type IIS restriction endonuclease.
36. A kit according to claim 35, said kit comprising
5-methylcytosine triphosphate and Eam1104I.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] The present application is a continuation-in-part of U.S.
application Ser. No. 08/592,938, filed Jan. 29, 1996, the
disclosure of which is expressly incorporated by reference
herein.
FIELD OF THE INVENTION
[0002] The invention is in the field of polynucleotide manipulation
techniques, particularly amplification and cloning techniques.
BACKGROUND OF THE INVENTION
[0003] A significant problem with many of the currently available
molecular biology techniques is their reliance upon naturally
occurring convenient restriction sites. Modifications of the
polymerase chain reaction (PCR) and other similar amplification
techniques have been developed in an attempt to overcome this
problem. In the absence of naturally occurring convenient
restriction sites, it is possible to introduce restriction sites
into the sequence of interest by using primers and PCR. However,
this technique results in the presence of extraneous
polynucleotides in the amplification products even after
restriction digestion. Such extraneous polynucleotides can be
problematic. For example, the introduction of unwanted nucleotides
often imposes design limitations on the cloned product which may
interfere with the structure and function of the desired gene
products.
[0004] One method of joining DNA without introducing extraneous
bases or relying on the presence of restriction sites is splice
overlap extension (SOE). Yon et al., 1989, Nucl. Acids Res.
17:4895. Horton et al., 1989, Gene 77:61-68. This method is based
on the hybridization of homologous 3'single-stranded overhangs to
prime synthesis of DNA using each complementary strand as template.
Although this technique can join fragments without introducing
extraneous nucleotides (in other words, seamlessly), it does not
permit the easy insertion of a DNA segment into a specific location
when seamless junctions at both ends of the segment are required.
Nor does this technique function to join fragments with a vector.
Ligation with a vector must be subsequently performed by
incorporating restriction sites onto the termini of the final SOE
fragment. Finally, this technique is particularly awkward when
trying to exchange polynucleotides encoding various domains or
mutation sites between genetic constructs encoding related
proteins,
[0005] Another commonly used genetic manipulation technique is
immobilized amplification, e.g., immobilized PCR. In techniques
involving immobilized PCR, i.e., bound PCR, polynucleotide
amplification products are immobilized on a solid phase support.
Immobilization is typically accomplished through the use of
streptavidin (or avidin) and biotinylated polynucleotides,
antibody-hapten binding interactions, or through the covalent
attachment of nucleic acids to solid supports. A serious
limitation, however, of such conventional immobilization techniques
is that the amplification products cannot be conveniently unbound
from the solid phase support for use in subsequent manipulations,
e.g., sequencing of the amplification products.
[0006] An additional problem with conventional techniques,
particularly the manipulation of amplification reaction products,
is that cleavage at certain restriction sites must be avoided in
order to obtain desired polynucleotides. Presently, however, this
can only be accomplished by cumbersome techniques such as partial
digestions and methylase protection.
[0007] Accordingly, in view of the foregoing limitations of current
recombinant DNA technology, it is of interest to provide improved
techniques for conveniently manipulating polynucleotides without
having to rely on naturally occurring convenient restriction sites.
It is also of interest to provide methods of synthesizing
polynucleotides in which some or all of the nucleotides introduced
through synthesis primers may be conveniently removed from the
final synthesis product. Additionally, it is of interest to provide
improved methods of manipulating polynucleotide synthesis products
by restriction enzymes which overcome the problems of cleavage at
internal sites within the synthesis products. Further, it is of
interest to provide an improved method of releasing amplification
products that are bound to a solid phase support. The present
invention meets these needs.
SUMMARY OF THE INVENTION
[0008] The present invention relates to improved methods of
synthesizing polynucleotides of interest. The invention is based,
in part, on the use of enzymes, referred to herein as releasing
enzymes, which cleave polynucleotide substrates. In one embodiment
of the invention, it is preferred that the site cleaved by the
releasing enzyme is different or distal from the enzyme recognition
site on the substrate. The methods of the invention employ primers
which comprise a recognition site for a releasing enzyme joined to
a region for annealing to the polynucleotide template of interest.
These primers are referred to as releasable primers. Preferably,
the recognition site for the releasing enzyme is joined 5' to the
annealing region.
[0009] In one embodiment of the invention, the releasable primers
comprise a recognition site for a type IIS restriction
endonuclease. The type IIS restriction endonuclease recognizes this
site, but then cleaves the DNA in a sequence independent manner
several base pairs 3' to the recognition site. Optionally,
releasable primers of the invention comprise additional nucleotides
located 5' and adjacent to the recognition site.
[0010] The releasable primers may be used for priming
polynucleotide synthesis reactions, including, but not limited to,
polymerase chain reactions and other amplification reactions.
[0011] The methods of the invention comprise the steps of
synthesizing a polynucleotide sequence of interest with at least
one releasable primer. The polynucleotide synthesis reaction may
be, but is not necessarily, a cyclic amplification reaction. When
polynucleotide synthesis occurs in a cyclic amplification reaction,
the polymerase chain reaction (PCR) is particularly preferred for
use. After synthesis, the synthesis product is cleaved by a
releasing enzyme capable of recognizing the recognition site on the
releasable primer. Restriction endonuclease inhibitory base analogs
may be incorporated in the synthesis product to protect against
unwanted cleavage of internal recognition sites by the releasing
enzyme, yet still permit cleavage of the desired sites introduced
by the releasable primer or primers.
[0012] In another embodiment of the invention, i.e., seamless
domain replacement, a first synthesis product is produced using a
pair of primers and a second synthesis product is produced using a
second pair of primers, wherein at least one member of each pair of
primers is a releasable primer. Both first and second syntheses
products are subsequently cleaved by releasing enzymes. The
resultant released first and second synthesis products may then be
ligated to one another so as to produce a recombinant DNA construct
that does not contain extraneous nucleotides introduced by the
synthesis primers. This method may be used to conveniently replace
one segment of a genetic construct with a similar (but different)
segment of a second genetic construct.
[0013] In another embodiment of the invention, at least one
releasable primer is bound to a solid phase support. After
synthesis of a polynucleotide of interest using the bound primer,
an immobilized synthesis product is produced. The immobilized
synthesis product may be released by means of a releasing enzyme.
Restriction endonuclease inhibitory base analogs may be
incorporated in the synthesis product to protect against unwanted
cleavage of internal restriction sites by the selected releasing
enzyme, yet still permit cleavage of the desired restriction sites
introduced by the releasable primer(s).
[0014] Another aspect of the invention is to provide releasable
primers and kits for performing the subject methods. Typically,
such kits comprise a releasing enzyme and one or more reagents for
performing polynucleotide synthesis, e.g., a cyclic amplification
reaction. Optionally, such kits further comprise nucleotide base
analogs capable of inhibiting or substantially inhibiting cleavage
by the releasing enzyme. Preferably, such inhibitory nucleotide
base analogs are in the form of nucleoside triphosphates. The kits
may also optionally comprise a polynucleotide primer comprising a
recognition site for a releasing enzyme.
[0015] The methods of the invention permit one to efficiently
synthesize and manipulate polynucleotides of interest by primer
mediated polynucleotide synthesis, e.g., PCR, without introducing
extraneous primer-derived nucleotides into the ultimate synthesis
products, i.e., seamless polynucleotide synthesis. The invention
allows the efficient directional cloning of a desired DNA sequence
into any location without the limitation of naturally occurring
convenient restriction sites. Additionally, the invention permits
DNA synthesis products to be manipulated by restriction enzymes
without problems of cleavage at undesired restriction sites.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 is a schematic diagram of an embodiment of the
invention in which two sets of releasable primers are used to
produce two different synthesis products that are subsequently
ligated to one another to produce a plasmid of interest. Part (A)
of the figure shows a first polynucleotide synthesis product
obtained by PCR. The figure shows the methods of the invention
being employed to replace the D region on the plasmid in part (B)
with the D' region on the plasmid of part (A). In part (A), PCR is
performed with releasable primers in the presence of .sup.m5IDCTP
(5-methyldCTP) thereby forming an amplification product. The
amplification product is subsequently exposed to the releasing
enzyme Eam1104I to produce a released synthesis product with
overhanging, i.e., "sticky", non-identical non-palindromic ends to
provide for directional cloning. The procedure shown in part (B) is
essentially the same as in part (A) except different primers (with
a different orientation) and a different template are used. In part
(C), the two released synthesis products are ligated together in
the presence of Eam1104I. The symbol .cndot. is used to indicate
the Eam1104I recognition sequence CTCTTC.
[0017] FIG. 2 is a schematic representation of cycles within a PCR
reaction. The diagram indicates that PCR is performed in the
presence of an inhibitory base analog. The last cycle of PCR is
performed in the absence of the inhibitory base analog. "M"
represents the inhibitory base analog, i.e., a modified base. The
products of the last cycle only have inhibitory base analogs in one
strand.
DEFINITIONS
[0018] The term "cyclic amplification reaction," as used herein,
refers to a variety of enzyme mediated polynucleotide synthesis
reactions that employ pairs of polynucleotide primers to amplify a
given polynucleotide and proceed through one or more cycles, each
cycle resulting in polynucleotide replication, i.e., synthesis. A
cyclic amplification reaction cycle typically comprises the steps
of denaturing the double-stranded template, annealing primers to
the denatured template, and synthesizing polynucleotides from the
primers. The cycle may be repeated several times so as to produce
the desired amount of newly synthesized polynucleotide product.
Guidance in performing the various steps of cyclic amplification
reactions can be obtained from reviewing literature describing the
polymerase chain reaction ("PCR") including, PCR: A Practical
Approach, M. J. McPherson, et al., IRL Press (1991), PCR Protocols:
A Guide to Methods and Applications, by Innis, et al., Academic
Press (1990), and PCR Technology: Principals and Applications of
DNA Amplification, H. A. Erlich, Stockton Press (1989). PCR is also
described in numerous U.S. patents, including U.S. Pat. Nos.
4,683,195; 4,683,202; 4,800,159; 4,965,188; 4,889,818; 5,075,216;
5,079,352; 5,104,792, 5,023,171;
[0019] 5,091,310; and 5,066,584, which are hereby incorporated by
reference. Many variations of amplification techniques are known to
the person of ordinary skill in the art of molecular biology. These
variations include rapid amplification of cDNA ends (RACE-PCR),
PLCR (a combination of polymerase chain reaction and ligase chain
reaction), ligase chain reaction (LCR), self-sustained sequence
replication (SSR), Q-beta phage amplification (as described in Shah
et al., Journal of Medical Micro. 33(6): 1435-41 (1995)), strand
displacement amplification, (SDA), splice overlap extension PCR
(SOE-PCR), 3SR amplification (as described in Stillman et al., PCR
Methods and Applications 3(6): 320-31 (1994), and the like. A
person of ordinary skill in the art may use these known methods to
design variations of the releasable primer mediated cyclic
amplification reaction based methods explicitly described in this
application.
[0020] The term "oligonucleotide," as used herein with respect to
releasable primers, is intended to be construed broadly.
Oligonucleotides include not only DNA but various analogs thereof.
Such analogs may be, depending upon the specific releasing enzyme
selected for use in a given embodiment of the invention, base
analogs and/or backbone analogs, e.g., phosphorothioates,
phosphonates, and the like. Techniques for the synthesis of
oligonucleotides, e.g., through phosphoramidite chemistry, are well
known to the person of ordinary skill in the art and are described,
among other places, in Oligonucleotides and Analogues: A Practical
Approach, ed. Eckstein, IRL Press, Oxford (1992). Preferably, the
oligonucleotides used as releasable primers are DNA molecules.
[0021] The terms "amplification", "amplification products",
"polynucleotide synthesis", and "polynucleotide synthesis products"
are used herein as a matter of convenience and should not be
interpreted to limit the subject invention to PCR or other cyclic
amplification reactions. Accordingly, one skilled in the art having
the benefit of this disclosure will appreciate that the present
invention contemplates synthesis of end products through means
other than PCR and related cyclic amplification reactions, e.g.,
DNA synthesis, DNA replication, cDNA synthesis, and the like.
DESCRIPTION OF THE DRAWINGS EMBODIMENTS
[0022] The present invention is based, in part, on the discovery
that enzymes which cleave polynucleotides at a position which is
different or distal from their recognition site may be used to
clone or modify virtually any polynucleotide sequence independent
of naturally occurring restriction sites. Accordingly, in certain
embodiments of the invention, releasable primers are used to
introduce recognition sites for enzymes which cleave
polynucleotides at a site distinct from the recognition site.
Particularly preferred are sites recognized by type IIS restriction
endonucleases. When these primers are used to amplify a
polynucleotide product, and then treated with type IIS restriction
endonucleases, the polynucleotide sequences in the synthesis
product which comprise the type IIS recognition sequence are
completely or partially removed. Thus, using the methods of the
invention, one may efficiently synthesize and manipulate
polynucleotides of interest by primer mediated polynucleotide
synthesis, e.g., PCR, without introducing some or all of the
primer-derived nucleotides into the ultimate synthesis
products.
[0023] The invention also allows directional cloning of a desired
DNA sequence into any location. Additionally, the invention permits
the treatment of polynucleotide synthesis products, including
cyclic amplification reaction products, with releasing enzymes to
produce the desired end products without cleaving internal
restriction sites. The present invention also allows for the
convenient release of polynucleotide synthesis products that are
immobilized on solid phase supports.
[0024] In one specific embodiment of the invention described merely
by way of illustrative example herein, the primers and methods of
the invention are used to switch predetermined regions of a
polynucleotide construct in a manner independent of any naturally
occurring restriction sites. This method referred to herein as
"seamless domain replacement," affords the skilled practitioner
unprecedented freedom to design, manipulate, and clone desired
polynucleotide products.
Releasable Primers and Their Cognate Releasing Enzymes
[0025] In accordance with the embodiments of the invention,
releasable primers and pairs of releasable primers, are provided.
"Releasable primers" comprise a single stranded oligonucleotide and
have two separate regions: (1) the "releasing enzyme recognition
site" and (2) the "annealing region". In a preferred embodiment of
the invention, the releasing enzyme recognition site is located 5'
to the annealing region. The releasable primer may further comprise
additional nucleotides located adjacent, preferably 5', to the
releasing enzyme recognition site.
[0026] The "releasing enzyme recognition site" of a releasable
primer may consist of the nucleotides which identify the
recognition site for a given restriction endonuclease, in other
words, a restriction endonuclease recognition site. In fact, the
recognition site may be any site that is recognized by a sequence
specific DNA binding protein. The recognition site may
alternatively be a binding site for an "artificial restriction
enzyme" which makes use of organic cleaving molecules such as those
described in U.S. Pat. No. 4,942,227 issued Jul. 17, 1990. In
certain embodiments of the invention, it is preferred that the
"recognition site" is the recognition site for a restriction
endonuclease wherein a base in one strand of the recognition site
is lacking in the other strand of the recognition site. Such
enzymes are defined herein for purposes of the invention as Class A
enzymes (see infra). Alternatively, releasing enzyme recognition
sites may be sites which are recognized by Class B or Class C
enzymes. Class B and Class C enzymes are described more fully below
in the next section.
[0027] In a preferred embodiment of the invention, the recognition
site is recognized by a type IIS restriction endonuclease wherein
one strand of the recognition sequence lacks a base that is present
on the complementary strand of the recognition sequence. A type IIS
restriction endonuclease is a restriction endonuclease that cleaves
outside of the recognition site. A review of type IIS (also
referred to as class IIS) restriction endonucleases can be found in
Szybalski et al., Gene 100:13-26 (1991). In accordance with
particularly preferred embodiments of the invention, the
recognition site is for the type IIS restriction endonuclease
Eam1104I. This recognition site is particularly preferred because
it contains three cytosine residues in one strand which are lacking
in the complementary strand of the recognition site.
[0028] Alternatively, the "releasing enzyme recognition site" of a
releasable primer may consist of a protein or polypeptide (or
biotin or other hapten) which is recognized by an enzyme capable of
cleaving a polynucleotide substrate. In this case, the releasable
primer will be a hybrid molecule comprised of protein (or biotin or
other hapten) linked to a polynucleotide. The releasing enzyme
recognizes the site on the protein portion of the releasable
primer, and then cleaves the polynucleotide portion of the
releasable primer. The cleavage may be performed by a catalytic
protein domain of the releasing enzyme, or may be performed by an
organic cleaving moiety linked to the releasing enzyme. In
embodiments of the invention in which the hybrid molecules are
comprised of biotin or other haptens, the releasing enzyme will
recognize the biotin or hapten portion of the hybrid molecule.
[0029] The "annealing region" of a releasable primer of the
invention comprises a polynucleotide sequence designed to anneal to
target polynucleotides and prime synthesis of a desired
polynucleotide at a specific location on a polynucleotide template.
Polynucleotide synthesis products produced in a synthesis reaction
employing a releasable primer may be contacted with a releasing
enzyme that cleaves within the recognition site of the releasable
primer or outside the recognition site (when the releasing enzyme
is a type IIS restriction endonuclease). The precise nucleotide
sequence of the annealing region in a specific embodiment of the
invention is dependent upon the nucleotide sequence to which the
releasable primer is designed to anneal.
[0030] Principles for designing amplification primers that anneal
to and amplify polynucleotides of interest are well known to the
person of ordinary skill in the art and may be readily applied for
use in the design of annealing regions of the releasable primers of
the invention. The annealing region hybridizes to templates for
synthesis in a manner essentially identical to the annealing of
primers in conventional PCR. The annealing region should be of
sufficient length to permit specific annealing to the targeted
sites. Preferably, the annealing region is at least nucleotides in
length, more preferably, at least 20 nucleotides in length. While
the annealing region may be 30 nucleotides in length or
significantly longer, the increased length is usually not necessary
to produce the desired synthesis products. Additionally, a
releasable primer with a long annealing region, i.e., greater than
about 30 nucleotides, may be unnecessarily difficult and expensive
to synthesize.
[0031] In certain embodiments of the invention, it may be of
interest to provide portions of the annealing region that do not
necessarily anneal to the target template, thereby providing for
the introduction of additional polynucleotide sequences into the
synthesis product These additional nucleotides may be used to
introduce site-directed mutations or to facilitate additional
sequence manipulations.
[0032] Releasable primers may further comprise additional
nucleotides located 5' and adjacent to the recognition site. These
additional nucleotides are optionally present in releasable primers
of the invention. Such additional nucleotides located 5' to the
recognition site may enhance the activity of the selected releasing
enzyme. Preferably, the additional 5' nucleotides are of minimal
length to reduce the possibility of hybridization to non-targeted
polynucleotide sequences. Nucleotide sequence information of a
polynucleotide comprising the target sequence for synthesis may be
used in designing the sequence of any additional nucleotides
located 5' to the recognition site so that the releasable primers
do not anneal to non-targeted segments of the polynucleotide for
synthesis or self-anneal to segments of the primer. In those
embodiments of the invention in which the releasing enzyme is
Eam1104I, preferably at least two additional nucleotides are
present 5' to the Eam1104I recognition site. Another aspect of the
present invention is the discovery that these two or more
additional nucleotides significantly improves Eam1104I
activity.
[0033] "Releasing enzymes" are enzymes which are capable of
cleaving polynucleotide substrates at desired sites introduced by
the releasable primer or primers of the invention and, when used in
accordance with methods of the invention, are either incapable of
or may be rendered incapable of undesired cleavage at internal
sites. Releasing enzymes useful in the present invention are
restriction endonucleases capable of recognizing the releasing
enzyme recognition site introduced by a given releasable primer.
Releasing enzymes may be naturally occurring restriction enzymes,
or may be hybrid molecules comprised of a polynucleotide binding
domain attached to a cleaving domain. For example, releasing
enzymes may include hybrid enzymes such as those described in U.S.
Pat. No. 5,436,150, issued Jul. 25, 1995, wherein the cleavage
domain of the Fok I enzyme is linked to the recognition domain of
another protein. Additionally, the recognition domain of the
releasing enzyme may be linked to a non-protein cleaving agent, for
example, an organic DNA cleaving moiety, such those described by
Oakley et al. (1994), Bioconjug. Chem. 5:242-247. Further, the
releasing enzyme may be an "artificial restriction enzyme" similar
to those described in U.S. Pat. No. 4,942,227, issued Jul. 17,
1990.
[0034] In preferred embodiments of the invention, the releasing
enzyme is a type IIS restriction endonuclease wherein the type IIS
endonuclease may also be further characterized as a Class A, B or C
enzyme (as defined herein infra.). Type IIS restriction
endonucleases of interest recognize a specific nucleotide sequence
and catalyze a double-stranded cleavage in a region outside the
specific sequence of the restriction endonuclease recognition site.
By using type IIS restriction endonucleases as releasing enzymes,
all or part of the nucleotides introduced by the releasable primers
of the invention may be removed from the polynucleotide product.
Preferred type IIS restriction endonucleases for use as releasing
enzymes cleave DNA 3' with respect to the recognition site. The
type IIS restriction endonuclease Eam1104I has been found
particularly useful in the methods of the invention, and its use is
specifically described by way of example herein. Many different
type IIS restriction endonucleases and other restriction
endonucleases are known to the person of ordinary skill in art, for
example, see Szybalski, et al., Gene 100:13-26 (1991); and Ausubel,
et al., Current Protocols in Molecular Biology, John Wiley &
Sons (1995). It will be further appreciated by a person of ordinary
skill in the art that new restriction endonucleases are continually
being discovered and may be readily adapted for use in the subject
invention.
[0035] Releasing enzymes may also include enzymes which cleave
polynucleotides but which recognize a site which is other than a
polynucleotide sequence, for example, another protein.
[0036] Examples of such releasing enzymes are, for example,
exonucleases and polymerases having exonuclease activity.
[0037] In one embodiment of the invention, a polynucleotide of
interest is synthesized in a polynucleotide synthesis reaction
employing a primer that is a releasable primer. The polynucleotide
synthesis reaction may be, but is not necessarily, a cyclic
amplification reaction. In those embodiments of the invention in
which synthesis occurs in a cyclic amplification reaction,
typically 10-30 amplification cycles are used; however, the number
of cycles may be as low as 1. Amplification reaction parameters,
e.g., temperature and time, may be determined by reference to
conventional cyclic amplification techniques such as the polymerase
chain reaction (PCR). In a cyclic amplification reaction employing
a pair of primers, at least one of the primers is a releasable
primer. In a preferred embodiment of the invention, the first and
second primers of a cyclic amplification reaction are both
releasable primers.
[0038] In accordance with the invention, the polynucleotide
synthesis reaction of the invention results in the generation of a
polynucleotide synthesis product, i.e., a double-stranded
polynucleotide, which incorporates at least one releasable primer.
After the desired synthesis product is produced, the synthesis
product is contacted with a releasing enzyme. The releasing enzyme
cleaves the synthesis product according to the sites introduced by
the releasable primer during the synthesis reaction, whereby a
released synthesis product is produced. Releasing enzymes that are
type IIS restriction endonucleases, and thus cleave outside the
releasing enzyme recognition site, may be used to produce released
synthesis products that do not contain either all or part of the
nucleotide sequences derived from the releasable primer or primers
used to generate the polynucleotide synthesis product. Pairs of
releasable primers may be used to produce released polynucleotide
synthesis products that have non-identical overhanging ends,
thereby permitting directional cloning of the released
polynucleotide synthesis product in a predetermined
orientation.
Preventing Cleavage at Internal Sites
[0039] Treatment of synthesis products with releasing enzymes may
result in the formation of undesired digestion products because of
the presence of "internal", i.e., pre-existing, restriction sites
in regions of the synthesis products not derived from the synthesis
primers. These internal restriction sites may be identified prior
to synthesis or may be cryptic because no prior sequence
information exists about the entire polynucleotide being
synthesized.
[0040] This potential problem with internal restriction sites can
be avoided by incorporating inhibitory base analogs into the
polynucleotide synthesis products to protect or substantially
protect the internal restriction sites from cleavage by the
releasing enzyme. In accordance with an aspect of the invention,
protection of internal restriction sites is accomplished by
selection of a releasing enzyme that is an analog sensitive
releasing enzyme with respect to the nucleotide base analog or
analogs selected for use.
[0041] Analog sensitive releasing enzymes are releasing enzymes
that are inhibited or substantially inhibited by a base analog at a
nucleotide or nucleotides of the recognition site and/or the
cleavage site of the restriction endonuclease. It will be
appreciated by those skilled in the art that a given analog
sensitive releasing enzyme is not inhibited or substantially
inhibited by all nucleotide base analogs. Accordingly, a given
releasing enzyme is analog sensitive with respect to a given
nucleotide base analog. Conversely, a nucleotide base analog that
inhibits or substantially inhibits the releasing enzyme is an
inhibitory base analog with respect to that releasing enzyme. An
example of an analog sensitive releasing enzyme is Eam1104I, which
is inhibited by 5-methylcytosine (5-methyl-dCTP) at the recognition
site, i.e., 5-methylcytosine is an inhibitory base analog with
respect to Eam1104I.
[0042] Synthesis of a polynucleotide of interest with inhibitory
base analogs may be accomplished by performing a polymerase
mediated polynucleotide synthesis reaction with a nucleoside
triphosphate mixture comprising the four basic nucleoside
triphosphates (deoxyadenosine triphosphate, deoxyguanosine
triphosphate, deoxycytidine triphosphate, and deoxythymidine
triphosphate) or functional equivalents thereof, wherein at least
one of the four basic nucleoside triphosphates is modified to
comprise an inhibitory base analog rather than a conventional,
i.e., non-inhibiting, nucleotide.
[0043] Examples of inhibitory base analogs include 6-methyladenine,
5-methylcytosine, 5-hydroxymethylcytosine, and the like. Inhibitory
base analogs may be in the form of deoxyribonucleotide
triphosphates (or functional equivalents thereof), in order to
provide for polymerase mediated incorporation. Inhibitory
nucleotide analogs may also be alpha-thio-deoxyribonucleotide
triphosphate analogs. The present invention contemplates the use of
any of a multitude of possible nucleotide base analogs as
inhibitory base analogs, including, but not limited to,
2'-deoxyriboinosine, 5-iodo-2'-deoxyribocytosine,
5-mecuri-2'-deoxyriboguanosine. Accordingly, those skilled in the
art will appreciate that alternative nucleotide base analogs may be
suitably utilized as inhibitory base analogs in the invention,
provided that such analogs are capable of being specifically
incorporated within and protecting or substantially protecting
double stranded DNA from cleavage by the selected releasing enzyme.
It will also be readily appreciated by persons skilled in the art
that in addition to the use of base analogs, analogs of
phosphorylated sugars, e.g., phosphorothioates may be used to
inhibit releasing enzyme activity. In a preferred embodiment of the
invention, the inhibitory base analog is a methylated base analog,
and the releasing enzyme is a methylation sensitive releasing
enzyme.
[0044] The choice of a particular inhibitory base analog or analogs
for use in a given embodiment of the invention is dependent upon
the particular releasing enzyme selected for use. Certain releasing
enzymes for use in the subject methods are inhibited or
substantially inhibited by inhibitory base analogs in the
recognition site of the restriction endonuclease. The term
"substantially inhibited" is used to indicate that the inhibition
of the enzymatic activity need not be complete. In many embodiments
of the invention, the level of inhibition may be significantly less
than complete inhibition because only partial inhibition is
necessary to produce a useful amount of the ultimately desired
released synthesis product. Inhibition of releasing enzyme cleavage
may be achieved by incorporation of the inhibitory base analog into
the recognition site and/or the restriction endonuclease cleavage
site (when the recognition site and cleavage site are separate from
one another).
[0045] The inhibitory effects of several nucleotide base analogs
(particularly, naturally occurring methylated bases) on the
activity of many restriction endonucleases is well described in the
literature of molecular biology (see for example, Ausubel et al.,
Protocols in Molecular Biology, John Wiley & Sons (1995)).
However, it may be necessary to determine whether or not a given
nucleotide base analog is an inhibitory base analog with respect to
a given restriction endonuclease. The determination of whether or
not a given nucleotide base analog is inhibitory with respect to a
given releasing enzyme may be made by techniques well known to a
person of ordinary skill in the art. For example, a polynucleotide
known to be cleaved by a given releasing enzyme can be synthesized
with a nucleotide base analog of interest using conventional
enzymatic or chemical polynucleotide synthesis techniques. After
synthesis, the polynucleotide is treated, i.e., digested, with a
restriction endonuclease for potential use as a releasing enzyme
which cleaves at the anticipated cleavage sites. The results of the
digestion are then analyzed by gel electrophoresis (or the
functional equivalent thereof) in order to determine if the
anticipated digestion products are produced.
[0046] Additionally, the choice of an inhibitory base analog for
use in a given embodiment of the invention will in part be
determined by the sequence of the restriction endonuclease
recognition site and the annealing region. The relationship of such
sequences to the nucleotide base analog inhibition sensitivities of
the releasing enzyme is an important factor in selecting the
nucleotide base analog or analogs for use in a given embodiment of
the invention. This relationship is of particular importance for
purposes of the present invention because the inhibitory base
analogs selected for use should not significantly interfere with
the ability of the selected releasing enzyme to cleave at either
the recognition site or a cleavage site within the annealing region
of the releasable primer or primers. If inhibitory base analogs
incorporated into the synthesis products at locations complementary
to the releasable primer significantly inhibit cleavage, then the
synthesis products will not be converted into the desired released
synthesis products by the releasing enzyme.
[0047] In accordance with the invention, alternative approaches may
be used to avoid potential inhibition of released synthesis product
formation. One way is to select a releasing enzyme having a
recognition sequence that is asymmetric, wherein one strand of the
recognition sequence lacks a base that is present on the
complementary strand of the recognition sequence, and modification
of that base inhibits the activity of the enzyme. These types of
enzymes are referred to herein as Class A enzymes. An example of
such a Class A releasing enzyme and inhibitory base analog
combination is Eam1104I (having a recognition site 5'-CTCTTC-3')
and 5-methylcytosine (or other cytosine derived inhibitory
analogs). Because cytosine does not base pair with the cytosine or
thymine of the recognition site of the releasable primer,
5-methylcytosine cannot be incorporated into the complementary
strand of the Eam1104I recognition site of the releasable primer.
Thus, 5-methylcytosine cannot interfere with the ability of
Eam1104I to produce released synthesis products. Therefore, when
the releasing enzyme used in the subject methods is the
particularly preferred Eam 1104I, 5-methylcytosine may be used as
the inhibitory base analog.
[0048] The problem of potential inhibition of released synthesis
product formation may also be avoided by using a releasing enzyme
that cleaves when the recognition site of the enzyme has the
selected inhibitory base analog in one strand, but is inhibited
when the inhibitory base analog is present in both strands of the
recognition site. In this embodiment of the invention, the
restriction site may be identical and symmetric on both strands, or
may be asymmetric. These enzymes, which are inhibited only when
both strands contain the inhibitory base analog, are referred to as
Class B enzymes. The desired nucleotide product is synthesized
using an appropriate inhibitory base analog and the releasable
primer (which does not itself contain an inhibitory base analog).
Since the recognition sequence in the releasable primer
incorporates inhibitory base analog in only one strand (the
synthesized complementary strand), the releasing enzyme will cleave
at the primer sequence.
[0049] Yet another way to allow for the release of synthesis
product formation, while avoiding cleavage at internal sites, is by
utilizing a primer which lacks inhibitory base analogs, and
incorporating inhibitory base analogs into polynucleotide strands
primed by the releasable primer but not incorporating the
inhibitory analogs into the strand complementary to the releasable
primer. The resultant polynucleotide does not have an inhibitory
base analog in either strand of the recognition site introduced by
the releasable primer. These polynucleotides may then be treated
with a releasing enzyme that is inhibited by inhibitory base
analogs incorporated into either one or both strands of a
restriction site. These types of releasing enzymes are referred to
as Class C enzymes. The releasing enzyme may have a symmetric
recognition site or an asymmetric site.
[0050] One method of producing polynucleotide synthesis products
that have inhibitory base analogs in only one strand of the
internal recognition sites is through cyclic amplification
reactions (see FIG. 2). Inhibitory base analogs may be present
during initial reaction cycles of the cyclic amplification
reaction, but omitted from the last synthesis step. A purification
reaction to remove unincorporated inhibitory base analogs may be
performed prior to this last synthesis step, thereby increasing the
yield of the desired hemi-modified polynucleotide synthesis
product.
[0051] Enzymes that may be used to catalyze polynucleotide
synthesis in the synthesis steps of the invention, including cyclic
amplification reactions, are well known to the person skilled in
the art and include, but are not limited to, Taq DNA polymerase,
Pfu DNA polymerase (Stratagene), phage T7 polymerase, phage T4
polymerase, E. coli DNA polymerase I, Vent.TM. (New England
Biolabs, Beverly Mass.) DNA polymerase, Deep Vent.TM. DNA
polymerase (New England Biolabs, Beverly Mass.), Moloney Murine
Leukemia Virus reverse transcriptase, and the like. In those
embodiments of the invention in which polynucleotide synthesis is
achieved by means of a cyclic amplification reaction, the enzyme
used to catalyze the polynucleotide synthesis reaction is
preferably a thermostable DNA polymerase.
[0052] When the DNA sequence for synthesis is relatively long and
synthesis is achieved by means of a cyclic amplification reaction,
it may be desirable to use a mixture of thermostable DNA
polymerases, wherein one of the DNA polymerases has 5'-3'
exonuclease activity and the other DNA polymerase lacks or
substantially lacks 5'-3' exonuclease activity. A description of
how to amplify long regions of DNA using these polymerase mixtures
can be found, among other places, in U.S. Patent No. 5,436,149,
Cheng et al., Proc. Natl. Aca. Sci. USA 91:5695-9 (1994), and
Barnes Proc. Natl. Aca. Sci. USA 91:2216-2220 (1994) and U.S.
patent applications Ser. Nos. 08/164,290, and 08/197,791.
Seamless Domain Replacement
[0053] The invention is particularly useful because it may be
applied to the convenient switching of polynucleotide sequences in
related genetic constructs either with or without the introduction
of additional nucleotides. This embodiment of the invention is
referred to herein as "seamless domain replacement." Seamless
domain replacement involves the use of seamless synthesis reactions
to produce a polynucleotide of interest by synthesizing two
different polynucleotide sequences using separate sets of primers,
cleaving the synthesis products with a releasing enzyme, and
ligating together the two sets of released synthesis products.
Either all the primers in the two synthesis reactions are
releasable primers or one of the primers in each of the two
synthesis reactions is a releasable primer. In a preferred
embodiment of the invention, all of the primers used for seamless
domain replacement are releasable primers. In a particularly
preferred embodiment of the invention, which may be used to prevent
the introduction of extraneous nucleotides, the releasing enzyme
recognition sites of the releasable primers are sites for type IIS
restriction endonucleases. The primers may be selected so as to
produce released polynucleotide synthesis products that have
non-identical overhanging ends, thereby permitting directional
cloning.
[0054] An example of an embodiment of seamless domain replacement
can be found in FIG. 1. FIG. 1 is a schematic diagram of seamless
domain replacement showing a first (A) and a second (B) cyclic
amplification reaction using releasable primers. The embodiment of
the method of the invention shown in FIG. 1 results in the
replacement of polynucleotide sequence D with polynucleotide
sequence D'. This replacement method comprises the following steps:
a polynucleotide of interest is amplified using first and second
releasable primers, thereby producing a first synthesis product.
The first synthesis product is then treated, i.e., contacted, with
a releasing enzyme to produce a first released synthesis product.
The method further comprises the step of performing a second cyclic
amplification reaction using third and fourth releasable primers to
produce a second synthesis product. The second synthesis product is
then treated with a selected releasing enzyme to produce a second
released synthesis product. The first and second released synthesis
products may then be ligated together to produce the genetic
construct of interest. Performing the ligation step in the presence
of the releasing enzyme reduces the time and steps required to
obtain the desired product.
[0055] The method of the invention can be used to directionally
clone any synthesis product by designing the releasable primers
such that the releasing enzyme or enzymes produce non-identical
sticky ends (i.e., overhanging ends as opposed to blunt ends).
Thus, to directionally clone the seamless domain replacement shown
in FIG. 1, the released synthesis products produced by the first
and second releasable primers produce a first released synthesis
product having non-identical non-palindromic sticky ends that are
ligatable (in a directed orientation) with the sticky ends of the
second released synthesis product produced from the third and
fourth releasable primers.
[0056] Another aspect of the invention is to provide releasable
primer sets suitable for carrying out seamless domain replacement
methods of the invention. The subject primer sets comprise (1) a
first primer pair consisting of first and second releasable primers
and (2) a second primer pair consisting of third and fourth
releasable primers. The releasing enzyme recognition sites of all
members of a set of releasable primers for seamless domain
replacement may be identical. The annealing regions of the
releasable primers are selected subject to the following
constraints: (1) a first released synthesis product, resulting from
treatment of the synthesis product by a releasing enzyme, has two
non-identical sticky ends, (2) a second released synthesis product,
resulting from treatment of the synthesis product by a releasing
enzyme, has two non-identical sticky ends that are homologous,
i.e., capable of being ligated, to the two non-identical sticky
ends of the first released synthesis product.
Use of The Invention To Release Polynucleotides From Solid
Supports
[0057] The present invention is also directed to methods for the
convenient release of synthesis products bound or immobilized on a
solid support. Performing cyclic amplification reactions so as to
produce a bound, i.e., immobilized, synthesis product has numerous
applications, particularly in the field of assays for a
polynucleotide of interest. Such assays may have diagnostics
applications for the detection of microorganisms or indicia of
disease. Furthermore, cyclic amplification reactions that produce
an immobilized synthesis product, particularly a releasable
synthesis product, may readily be adapted for use with automated
equipment.
[0058] Polynucleotide synthesis products may be produced in a form
attached to solid phase supports by employing the subject methods
of synthesis, wherein polynucleotide synthesis is primed by at
least one releasable primer attached to a solid phase support. The
releasable primer may be attached to the solid phase support by any
of a variety of means, including covalent and non-covalent bonds.
Methods for the attachment of polynucleotides to solid supports are
well known to the person of ordinary skill in the art. Descriptions
of methods for attachment of nucleic acids to a variety of solid
supports can be found, among other places, as follows:
nitrocellulose (Ranki et al., Gene 21:77-85 (1983), cellulose
(Goldkorn and Prockop, Nucl. Acids Res. 14:9171-9191 (1986),
polystyrene (Ruth et al., Conference of Therapeutic and Diagnostic
Applications of Synthetic Nucleic Acids. Cambridge U.K. (1987),
teflon-acrylamide (Duncan et al. Anal. Biochem 169:104-108 (1988)),
polypropylene (Polsky-Cynkin et al. Clin. Chem 31:1438-1443
(1985)), nylon (Van Ness et al., Nucl. Acids Res. 19:3345-3350
(1991)), agarose (Polsky-Cynkin et al., Clin. Chem. 31:1438-1443
(1985)), sephacryl (Langdale and Malcolm, Gene 36:201-210 (1985)),
latex (Wolf et al., Nucl. Acids Res. 15:2911-2926 (1987) and
paramagnetic beads (Albretsen et al. Anal. Biochem. 189:40-50
(1990), Lang et al. Nucl. Acids Res. 16:10861-10880 (1988)).
[0059] As the polynucleotide synthesis reaction proceeds, the
synthesis products produced are bound to a solid support.
Preferably, the polynucleotide synthesis reaction is a cyclic
amplification reaction. The synthesis product may be released by
contacting the bound synthesis products with a suitable releasing
enzyme, thereby producing released synthesis products from the
immobilized synthesis products. Released polynucleotide synthesis
products may be readily transferred from the site of synthesis and
subjected to further manipulation or analysis.
Kits for Practice of The Invention
[0060] Another aspect of the invention is to provide kits for
performing the methods of the invention. The kits of the invention
comprise one or more of the enzymes or other reagents for use in
performing the subject methods. Kits may contain reagents in
pre-measured amounts to ensure both precision and accuracy when
performing the subject methods. Preferably, kits contain written
instructions that describe how to perform the methods of the
subject invention. At a minimum, the kits of the invention comprise
a restriction endonuclease and either a nucleoside triphosphate
with a base analog inhibitory for that restriction endonuclease or
a thermostable DNA polymerase suitable for use in a cyclic
amplification reaction. The restriction endonuclease in the kit may
be a type IIS restriction endonuclease. In addition, to these
embodiments, the kits of the invention may further comprise one or
more of the following components: concentrated reaction buffer, DNA
ligase, nucleoside triphosphates, mixtures of nucleoside
triphosphates in equimolar amounts, nucleoside triphosphates having
inhibitory base analogs, mixtures of nucleoside triphosphates and
nucleoside triphosphates having inhibitory base analogs,
thermostable DNA polymerases, frozen competent cells,
positive/negative control templates, control releasable primers,
and the like. An example of a kit of the invention is a kit
comprising the restriction endonuclease Eam1104I and
5-methylcytosine triphosphate as the inhibitory base analog.
[0061] The invention having been described, the following example
is offered by way of illustrating the invention and not by way of
limitation.
EXAMPLE
Seamless Domain Replacement
[0062] Experiments were performed to use the methods of the
invention to replace a segment of a plasmid with a corresponding
segment of a second plasmid. The experiments did not rely on the
use of convenient restriction sites in either plasmid.
[0063] Two commercially available plasmids were used for the
experiments. The plasmid pBluescript.RTM. II KS contains an alpha
complementing fragment of LacZ. The plasmid pWhitescript5.7 is a
derivative of pBluescript.RTM. II KS (Stratagene) and contains a
single point mutation that introduces an ochre stop codon 22
nucleotides downstream from the lacZ ATG. This mutation prevents
expression of a functional .alpha.-complementing .beta.Gal protein,
resulting in bacterial colonies that remain white when plated on
media supplemented with XGal and IPTG. Exchanging the region that
contains the stop codon with that of the parental pBluescript II
vector was expected to restore the original blue phenotype of the
lacZ gene.
[0064] The vector backbone and each domain of interest was PCR
amplified in the presence of .sup.m5dCTP. The primers are given in
table I; the underlined segments of the polynucleotide indicate the
restriction endonuclease recognition site.
1TABLE 1 (1F) AGTTACTCTTCACCATGATTACGCCAAGCGC (SEQ ID NO: 1) (1R)
AGTTACTCTTCAGTGAGCGCGCGTAATACG (SEQ ID NO: 2) (2F)
AGTTACTCTTCACACTGGCCGTCGTTTTACAACG (SEQ ID NO: 3) (2R)
AGTTACTCTTCATGGTCATAGCTGTTTCCTGTG (SEQ ID NO: 4)
[0065] Sense and antisense primers for the plasmid backbone
(Primers 2R and 2F) were designed to amplify all but a 190-bp
region of the lacZ gene of pWhitescript5.7 that contained the point
mutation. The primer pair (1F and 1R) for the 190-bp domain of
interest was designed to amplify the fragment from pBluescript II
needed to reconstitute the complete lacZ gene. The sense primer was
engineered to lie within the lacZ gene, downstream from the
translation start site. The PCR products were digested with
Eam1104I and subsequently ligated together in the presence of the
restriction enzyme, for details see Lin and Schwartz, BioTechniques
12:28-30 (1992); Russek et al., Cell Mol. Biol. Res. 36:177-182
(1993); Weiner, M. P., BioTechniques 15:502-505 (1993). The
negative control reaction received no ligase and did not yield
colonies upon transformation.
[0066] The domain of interest was prepared by PCR amplification of
10 ng pBluescript II SK+DNA template in a 50-.mu.l reaction
containing 200 .mu.M of each dNTP/2.5 .mu. Tag DNA polymerase/2.5
.mu.TaqExtender.TM. additive/200 nM of each primer 1F and 1R/20 mM
Tris C1 pH 8.5/10 mM KC1/10 mM (NH.sub.4).sub.4SO.sub.4/2 mM
MgCl.sub.2/0.1 mg/ml BSA/0.1% Triton X-100. The reaction was
overlaid with mineral oil and amplified once at 94.degree. C. for 3
min/58.degree. C. for 2 min/72.degree. C. for 3 min/with 9
subsequent cycles at 94.degree. C. for 45s/58.degree. C. for
35s/72.degree. C. for 1 min. 5 additional cycles were performed in
the presence of .sup.m5dCTP by adding a 50 .mu.l solution of 200
.mu.M each dATP, dGTP, dTTP/1 mM .sup.m5dCTP/2.5 .mu. each Tag DNA
polymerase and TaqExtender.TM. additive(Stratagene, La Jolla,
Calif.) in the same buffer. The cycling parameters were kept
constant except for the denaturation cycle which was increased to
95.degree. C. for 1.5 min. Modification of the denaturation cycle
was required because methylated DNA has a higher melting
temperature compared to unmethylated DNA.
[0067] Subsequently, we determined that the length of the
denaturation cycle could be reduced to 45 sec. without compromising
the product yield.
[0068] The vector backbone was prepared in the same fashion as the
domain of interest, except for the following modifications. The
extension time was changed from 1 min to min to accommodate the
slower processivity of the enzyme.
[0069] The denaturation time was held constant at 45 sec The
resulting PCR products were phenol: chloroform extracted and
ethanol precipitated. Approx. 0.3 pmol of vector and 1 pmol of
insert were combined and digested with 24 units of Eam1104I in 1X
universal buffer (100 mM KoAc, 25 mM tris acetate pH 7-6, 10 mM
MgOAc, 0.5 mM .beta.-mercaptoethanol, 10 .mu.g/ml BSA) {fraction
(1/10)} of the crude digest was ligated for 30 min at 37.degree. C.
in a 20 .mu.l reaction containing 50 mM Tris-HCl/10 mM MgCl/10 mM
DTT/20 .mu.g BSA per ml/1 mM ATP/8 or 6 units Eam1104I/6 Weiss
units T4 DNA ligase.
[0070] Competent XL-1 Blue MRF'/E. coli cells were transformed with
4 .mu.l of the ligation according to the manufacturer's
instructions and plated on ampicillin selection medium supplemented
with 100 .mu.M IPTG and 10 .mu.g XGal/ml.
[0071] The data showed that 2% of the bacterial colonies remained
white, whereas 98% exhibited the blue color that was expected of
clones carrying the restored lacZ gene (data not shown). The high
percentage of blue colonies suggests that the addition of Eam1104I
to the ligation reaction provided a selection for the formation of
the desired product. The presence of the restriction endonuclease
in the ligation mixture not only maintains unmethylated vector in a
linear state, but also re-digests unwanted ligation products and
thus contributes to the assembly and maintenance of only accurately
joined insert: vector pairings, which results in higher cloning
efficiency.
Incorporation by Reference
[0072] All patents, patents applications, and publications cited
are incorporated herein by reference.
Equivalents
[0073] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. Indeed, various modifications of the above-described
methods for carrying out the invention which are obvious to those
skilled in the field of molecular biology or related fields are
intended to be within the scope of the following claims.
* * * * *