U.S. patent application number 09/879461 was filed with the patent office on 2002-12-19 for recombinant il4 antibodies useful in treatment of il4 mediated disorders.
This patent application is currently assigned to SmithKline Beecham p.l.c.. Invention is credited to Gross, Mitchell Stuart, Holmes, Stephen Dudley, Sylvester, Daniel R..
Application Number | 20020193575 09/879461 |
Document ID | / |
Family ID | 27494135 |
Filed Date | 2002-12-19 |
United States Patent
Application |
20020193575 |
Kind Code |
A1 |
Holmes, Stephen Dudley ; et
al. |
December 19, 2002 |
Recombinant IL4 antibodies useful in treatment of IL4 mediated
disorders
Abstract
Chimeric and humanized IL4 MAbs derived from affinity MAbs,
pharmaceutical compositions containing same, and methods of
treatment are provided.
Inventors: |
Holmes, Stephen Dudley;
(Surrey, GB) ; Gross, Mitchell Stuart; (Wayne,
PA) ; Sylvester, Daniel R.; (Phoenixville,
PA) |
Correspondence
Address: |
GLAXOSMITHKLINE
Corporate Intellectual Property - UW2220
P.O. Box 1539
King of Prussia
PA
19406-0939
US
|
Assignee: |
SmithKline Beecham p.l.c.
|
Family ID: |
27494135 |
Appl. No.: |
09/879461 |
Filed: |
June 12, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09879461 |
Jun 12, 2001 |
|
|
|
09426814 |
Oct 22, 1999 |
|
|
|
09426814 |
Oct 22, 1999 |
|
|
|
08612929 |
Apr 30, 1996 |
|
|
|
08612929 |
Apr 30, 1996 |
|
|
|
PCT/US94/10308 |
Sep 7, 1994 |
|
|
|
PCT/US94/10308 |
Sep 7, 1994 |
|
|
|
08136783 |
Oct 14, 1993 |
|
|
|
08136783 |
Oct 14, 1993 |
|
|
|
08117366 |
Sep 7, 1993 |
|
|
|
Current U.S.
Class: |
530/389.1 ;
435/320.1; 435/326; 435/69.7; 536/23.5 |
Current CPC
Class: |
C07K 2317/55 20130101;
G01N 33/6869 20130101; C07K 2317/24 20130101; C07K 2317/76
20130101; A61K 38/00 20130101; A61K 2039/505 20130101; C07K 2317/73
20130101; C07K 2317/92 20130101; C07K 2319/00 20130101; C07K
2317/565 20130101; C07K 16/247 20130101; C07K 2317/56 20130101 |
Class at
Publication: |
530/389.1 ;
536/23.5; 435/69.7; 435/326; 435/320.1 |
International
Class: |
C07K 016/46; C07H
021/04; C12P 021/04; C12N 005/06 |
Claims
What is claimed is:
1. A fusion protein having binding specificity for human
interleukin-4 (IL4) which comprises complementarity determining
regions (CDRs) derived from a non-human neutralizing monoclonal
antibody characterized by a dissociation constant equal to or less
than 2.times.10.sup.-10 M for human IL4, and a first fusion
partner.
2. The fusion protein according to claim 1 which is operatively
linked to a second fusion partner.
3. The fusion protein according to claim 1 wherein said non-human
neutralizing monoclonal antibody is selected from the group
consisting of 3B9 and 6A1.
4. The fusion protein according to claim 2 wherein said second
fusion partner comprises all or part of an immunoglobulin constant
heavy chain or immunoglobulin constant light chain, or both.
5. The fusion protein according to claim 1 wherein said first
fusion partner sequence is the heavy chain sequence of amino acids
21-50, 56-71, 88-119, and 131-141 of SEQ ID NO: 12.
6. The fusion protein according to claim 1 wherein said first
fusion partner sequence is the light chain sequence of: amino acids
20-42, 58-72, 88-111, and 121-131 of SEQ ID NO: 14.
7. The fusion protein according to claim 1 wherein said amino acid
sequences of the complementarity determining regions for the heavy
chain are:
9 (a) ThrSerGlyMetGlyValSer: SEQ ID NO:22, (b)
HisIleTyrTrpAspAspAspLysArgTyrAsnPro- SEQ ID NO:24, SerLeuLysSer:
or (c) ArgGluThrValPheTyrTrpPheAspVal: SEQ ID NO:26.
8. The fusion protein according to claim 1 wherein said amino acid
sequences of the complementarity determining regions for the light
chain are:
10 (a) LeuAlaSerGlnSerValAspTyrAspGlyAspSerTyrMetAsn: SEQ ID NO:16,
(b) AlaAlaSerAsnLeuGluSer: SEQ ID NO:18, or (c)
GlnGlnSerAsnGluAspProProArg: SEQ ID NO:28.
9. The fusion protein according to claim 1 wherein said amino acid
sequences of the complementarity determining regions for the light
chain are:
11 (a) LysAlaSerGlnSerValAspTyrAspGlyAspSerTyrMetAsn: SEQ ID NO:16,
(b) AlaAlaSerAsnLeuGluSer: SEQ ID NO:18, or (c)
GlnGlnSerAsnGluAspProProThr: SEQ ID NO:20.
10. An immunoglobulin heavy chain complementarity determining
region (CDR), the amino acid sequence of which is selected from the
group consisting of:
12 (a) ThrSerGlyMetGlyValSer: SEQ ID NO: 22, (b)
HisIleTyrTrpAspAspAspbysArgTyrAsnPro- SEQ ID NO: 24, SerLeuLysSer:
and (c) ArgGluThrValPheTyrTrpPheAspVal: SEQ ID NO: 26.
11. An immunoglobulin light chain complementarity determining
region (CDR), the amino acid sequence of which is selected from the
group consisting of:
13 (a) LeuAlaSerGlnSerValAspTyrAspGlyAspSerTyrMetAsn: SEQ ID NO:16,
(b) AlaAlaSerAsnLeuGluSer: SEQ ID NO:18, (c)
GlnGlnSerAsnGluAspProProArg: SEQ ID NO:28; and (d)
GlnGlnSerAsnGluAspProProThr: SEQ ID NO:20.
12. A nucleic acid molecule encoding an immunoglobulin heavy chain
complementarity determining region (CDR), the sequence of which is
selected from the group consisting of:
14 (a) ACT TCT GGT ATG GGT GTG AGC: SEQ ID NO:21, (b) CAC ATT TAC
TGG GAT GAT GAC AAG CGC TAT SEQ ID NO:23, AACCCATCCCTGAAGAGC: (c)
AGA GAG ACT GTG TTC TAC TGG TAC TTC GAT SEQ ID NO:25, GTC: (d) ACC
TCC GGT ATG GGT GTT TCC: SEQ ID NO:54, (e) CAC ATC TAC TGG GAC GAC
GAC AAA CGT TAC AAC CCG SEQ ID NO:55, and AGC CTG AAA TCC: (f) CGC
GAA ACC GTT TTC TAC TGG TAC TTC GAC GTT: SEQ ID NO:56.
13. A nucleic acid molecule encoding an immunoglobulin light chain
complementarity determining region (CDR), the sequence of which is
selected from the group consisting of:
15 (a) AAG GCC AGC CAA AGT GTT GAT TAT GAT GGT SEQ ID NO:15, GAT
AGT TAT ATG AAC: (b) AAG GCC TCC CAA AGT GTT GAT TAT GAT GGT GAT
AGT SEQ ID NO:53, TAT ATG AAC: (c) GCT GCA TCC AAT CTA GAA TCT: SEQ
ID NQ:17, (d) CAG CAA AGT AAT GAG GAT CCT CCG ACG: SEQ ID NO:19,
and (e) CAG CAA AGT AAT GAG GAT CCT CCG AGG: SEQ ID NO:27.
14. A humanized antibody comprising a heavy chain and a light
chain, said antibody characterized by a dissociation constant equal
to or less than about 2.times.10.sup.-10 M for human IL4, wherein
the framework regions of said heavy and light chains are derived
from at least one selected human antibody and the amino acid
sequences of the complementarity determining regions of each said
chain are derived from a non-human neutralizing monoclonal antibody
specific for human IL4 characterized by a dissociation constant
equal to or less than about 2.times.10.sup.-10 M for human IL4.
15. The antibody according to claim 14 wherein said antibody is
optionally linked to an effector agent selected from the group
consisting of a non-protein carrier molecule, polystyrene, and
plastic beads.
16. A chimeric antibody comprising a heavy chain and a light chain,
said antibody characterized by a dissociation constant equal to or
less than about 2.times.10.sup.-10 M for human IL4, wherein the
amino acid sequences of the complementarity determining regions of
said heavy chain and said light chain are derived from a non-human
neutralizing monoclonal antibody specific for human IL4
characterized by a dissociation constant equal to or less than
about 2.times.10.sup.-10 M for human IL4.
17. A pharmaceutical composition comprising the fusion protein of
claim 1 and a pharmaceutically acceptable carrier.
18. A method of treating allergies and other conditions associated
with excess IgE production in a human comprising the step of
administering to said human in need thereof an effective amount of
the fusion protein of claim 1.
19. An isolated nucleic acid sequence which is selected from the
group consisting of: (a) a nucleic acid sequence encoding the
fusion protein of claim 1; (b) a nucleic acid sequence
complementary to (a); (c) a nucleic acid sequence of 18 or more
nucleotides capable of hybridizing to (a) or (b) under stringent
conditions; and (d) a fragment or analog of (a), (b), or (c) which
encodes a protein characterized by having specificity for human
interleukin-4; wherein said sequence optionally contains a
restriction site.
20. The isolated nucleic acid sequence according to claim 19,
wherein the sequence encoding the fusion protein comprises the
nucleic acid sequence of FIG. 5, SEQ ID NO:13.
21. The isolated nucleic acid sequence according to claim 19,
wherein the sequence encoding the fusion protein comprises the
nucleic acid sequence of FIG. 4, SEQ ID NO:11.
22. An isolated nucleic acid sequence which is selected from the
group consisting of: (a) a nucleic acid sequence encoding a
complementarity determining region (CDR) wherein said CDR is
obtained from a neutralizing murine monoclonal antibody specific
for human interleukin-4 and having a dissociation constant equal to
or less than about 2.times.10.sup.-10 M; (b) a nucleic acid
sequence complementary to (a); (c) a nucleic acid sequence of 18 or
more nucleotides capable of hybridizing under stringment conditions
to (a) or (b); and (d) a fragment or analog of (a), (b) or (c)
which encodes a protein characterized by having specificity for
human interleukin-4.
23. The isolated nucleic acid sequence according to claim 22,
wherein said sequence is selected from the group of heavy chain
complementarity determining region-encoding sequences consisting
of:
16 (a) ACT TCT GGT ATG GGT GTG AGC: SEQ ID NO:21, (b) CAC ATT TAC
TGG GAT GAT GAC AAG CGC TAT SEQ ID NO:23, AAC CCA TCC CTG AAG AGC:
(c) AGA GAG ACT GTG TTC TAC TGG TAC TTC GAT SEQ ID NO:25, GTC: (d)
ACC TCC GGT ATG GGT GTT TCC: SEQ ID NO:54, (e) CAC ATC TAC TGG GAC
GAC GAC AAA CGT TAC AAC CCG SEQ ID NO:55, and AGC CTG AAA TCC: (f)
CGC GAA ACC GTT TTC TAC TGG TAC TTC GAC GTT: SEQ ID NO:56.
24. The isolated nucleic acid sequence according to claim 22,
wherein said sequence is selected from the group of light chain
complementarity determining region-encoding sequences consisting
of:
17 (a) AAG GCC AGC CAA AGT GTT GAT TAT GAT GGT SEQ ID NO:15, GAT
AGT TAT ATG AAC: (b) AAG GCC TCC CAA AGT GTT GAT TAT GAT GGT GAT
AGT SEQ ID NO:53, TAT ATG AAC: (c) GCT GCA TCC AAT CTA GAA TCT: SEQ
ID NO:17, (d) CAG CAA AGT AAT GAG GAT CCT CCG ACG: SEQ ID NO:19,
and (e) CAG CAA AGT AAT GAG GAT CCT CCG AGG: SEQ ID NO:27.
25. A recombinant plasmid comprising the nucleic acid sequence of
claim 19.
26. A recombinant plasmid comprising the nucleic acid sequence of
claim 22.
27. A host cell transfected with the recombinant plasmid of claim
25.
28. A host cell transfected with the recombinant plasmid of claim
26.
29. A process for producing a humanized antibody specific for human
interleukin-4 comprising culturing a cell line transfected with the
recombinant plasmid of claim 25 under the control of selected
regulatory sequences capable of directing the expression thereof in
said cells.
30. A method for diagnosing allergies and other conditions
associated with excess immunoglobulin E production in a human which
comprises contacting a sample of biological fluid with a high titer
monoclonal antibody for human IL4 and assaying for the occurrence
of binding between said monoclonal antibody and human interleukin
4.
31. A method for screening monoclonal antibodies which have a high
titer for human interleukin 4 which comprises: a) preparing a
hybridoma cell line characterized by secretion of a monoclonal
antibody to human interleukin 4; and b) screening said hybridoma
cell line with aldehyde-coupled human interleukin-4 or biotinylated
human interleukin-4.
32. A neutralizing monoclonal antibody having a high titer for
human interleukin-4, a Fab fragment or a F(ab').sub.2 fragment
thereof, produced by screening a library of hydridoma products with
aldehyde-coupled human interleukin-4 or biotinylated human
interleukin-4.
33. A rodent neutralizing monoclonal antibody specific for human
interleukin-4 and having a binding affinity characterized by a
dissociation constant equal to or less than about
2.times.10.sup.-10 M.
34. The monoclonal antibody according to claim 33 wherein said
rodent is a mouse.
35. The monoclonal antibody according to claim 34, which comprises
the light chain amino acid sequence of SEQ D NO: 2, and the heavy
chain amino acid sequence of SEQ D NO: 4.
36. The monoclonal antibody according to claim 33, wherein said
rodent is a rat.
37. The monoclonal antibody according to claim 36 having the
identifying characteristics of 6A1.
38. A hybridoma having the identifying characteristics of cell line
3426A11C1B9.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/136,783 filed Oct. 14, 1993 which is a continuation of U.S. Ser.
No. 08/117,366 filed Sep. 7, 1993 both of which are hereby
incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates generally to the field of
fusion proteins, and to proteins useful in treatment and diagnosis
of conditions mediated by IL4 and excess IgE production, and more
specifically to chimeric and humanized IL4 antibodies.
BACKGROUND OF THE INVENTION
[0003] Atopic allergic diseases range from the relatively minor,
such as seasonal rhinitis and conjunctivitis, to the more serious,
such as atopic dermatitis and atopic asthma, and life threatening,
such as anaphylactic shock. Linking these conditions is the immune
response of the body to allergens, which response involves the
production of immunoglobulin E (IgE) antibodies in genetically
predisposed individuals (atopy). Inhibition of IgE production has
long been a goal in specific immunotherapy of allergic disease
using desensitization vaccines. However, in recent years the safety
and efficacy of vaccine therapy have been questioned, but the
desire to reduce IgE levels has not waned.
[0004] Interleukin 4 (IL4) is a protein mediator in the lymphoid
system. Studies of lymphocytes from atopic individuals have
revealed the presence of higher than normal numbers of T
lymphocytes with the ability to secrete IL4 in response to
stimulation, and larger quantities of IL4 secreted following
stimulation.
[0005] Anti-IL4 antibody has been found to inhibit IgE, but not
IgG.sub.1 or IgG.sub.2a [Finkelman et al, Ann. Rev. Immunol., 8:303
(1990)], and the production of IL5 secreting T cells [Maggi et al,
J. Immunol., 148:2142 (1992)]. Further, recent data suggests that
IL4 may affect eosinophil accumulation in tissues. See, e.g. Tepper
et al, Cell, 62:457 (1990); Tepper et al, Cell, 57:503 (1989).
[0006] There remains a need in the art for a high affinity IL4
antagonist, which would reduce eosinophil inflammation both by
reducing the proliferation of IL5 secreting cells, and by
inhibiting an adherence mechanism whereby eosinophils may be
accumulating in tissues, and can be used to treat, prevent or
diagnose allergic reactions.
SUMMARY OF THE INVENTION
[0007] In a first aspect, the present invention provides a fusion
protein having a binding affinity for human interleukin-4 which
comprises complementarity determining regions (CDRs) derived from a
non-human neutralizing monoclonal antibody (MAb) characterized by a
dissociation constant equal to or less than 2.times.10.sup.-10 M
for human IL4, and a first fusion partner in which at least one,
and preferably all complementarity determining regions (CDRs) of
the first fusion partner are replaced by CDRs from the non-human
monoclonal antibody (MAb). The non-human neutralizing monoclonal
antibody may be selected from the group consisting of 3B9 and 6A1
as described more fully in the Detailed Description. Preferably,
the fusion protein is operatively linked to a second fusion protein
as, well, which comprises all or a part of an immunoglobulin
constant chain.
[0008] In a related aspect, the present invention provides CDRs
derived from non-human neutralizing monoclonal antibodies (MAb)
characterized by a dissociation constant equal to or less than
2.times.10.sup.-10 M for human IL4, and nucleic acid molecules
encoding such CDRs.
[0009] In another aspect, the invention provides humanized
antibodies having at least one, and preferably six, complementarity
determining regions (CDRs) derived from non-human neutralizing
monoclonal antibodies (MAb) characterized by a dissociation
constant equal to or less than 2.times.10.sup.-10 M for human
IL4.
[0010] In still another aspect, there is provided a chimeric
antibody containing human heavy and light chain constant regions
and heavy and light chain variable regions derived from non-human
neutralizing monoclonal antibodies (MAb) characterized by a
dissociation constant equal to or less than 2.times.10.sup.-10 M
for human IL4.
[0011] In still another aspect, the present invention provides a
pharmaceutical composition which contains one (or more) of the
above-described fusion proteins or MAbs (e.g., humanized, chimeric,
etc.) and a pharmaceutically acceptable carrier.
[0012] In a further aspect, the present invention provides a method
for treating and/or preventing allergic conditions in humans by
administering to said human an effective amount of pharmaceutical
composition of the invention.
[0013] In yet another aspect, the present invention provides
methods for, and components useful in, the recombinant production
of the fusion proteins, MAbs (e.g., humanized, chimeric, etc.),
CDRs thereof, a Fab, or F(ab).sub.2, or analog thereof which is
derived from non-human neutralizing monoclonal antibodies (MAb)
characterized by a dissociation constant equal to or less than
2.times.10.sup.-10 M for human IL4. These components include
isolated nucleic acid sequences encoding same, recombinant plasmids
containing the nucleic acid sequences under the control of selected
regulatory sequences capable of directing the expression thereof in
host cells, and host cells (preferably mammalian) transfected with
the recombinant plasmids. The production method involves culturing
a transfected host cell line of the present invention under
conditions such that an antibody, preferably a humanized antibody,
is expressed in said cells and isolating the expressed product
therefrom.
[0014] In yet another aspect of the invention is a method to
diagnose allergies and other conditions associated with excess
immunoglobulin E production in a human which comprises contacting a
sample of biological fluid with the fusion proteins, MAbs (e.g.,
humanized, chimeric, etc.) and Fabs of the instant invention and
assaying for the occurrence of binding between said fusion protein,
MAb or Fab and human interleukin 4.
[0015] In another related aspect is provided a method for screening
monoclonal antibodies which have a high titer for human interleukin
4 which comprises: (a) preparing a hybridoma cell line
characterized by secretion of a monoclonal antibody to human
interleukin 4; and (b) screening said hybridoma cell line with
aldehyde-coupled human interleukin-4 or biotinylated human
interleukin-4. Preferably, the hybridoma cell line is screened with
biotinylated human interleukin-4.
[0016] Also provided is a neutralizing MAb having high affinity for
IL4, a Fab fragment or a F(ab').sub.2 fragment thereof, produced by
screening a library of hydridoma products with aldehyde-coupled
human interleukin-4 or biotinylated human IL4.
[0017] In another aspect, the present invention provides rodent
neutralizing monoclonal antibodies specific for human interleukin-4
and having a binding affinity characterized by a dissociation
constant equal to or less than about 2.times.10.sup.-10 M.
Exemplary of such monoclonal antibodies is the murine MAb, 3B9, and
the rat MAb, 6A1 and other MAbs have the same identifying
characteristics (i.e., binds to the same epitope(s) as 3B9 or 6A1
with a specificity for human IL4 and a dissociation constant equal
to or less than about 2.times.10.sup.-10 M). Another aspect of the
invention is hybridoma 3426A11C1B9.
[0018] Other aspects and advantages of the present invention are
described further in the following detailed description of the
preferred embodiments thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 [SEQ ID NOS: 1 and 2] illustrates the light chain
variable region (amino acids 21-132) for the murine IL4 antibody
3B9, and the human/murine 3B9 chimeric antibody as well as the
native signal sequence (amino acids 1-20). The underlined portions
indicate the CDRs [SEQ ID NOS: 15 and 16; SEQ ID NOS: 17 and 18;
and SEQ ID NOS: 19 and 20].
[0020] FIG. 2 [SEQ ID NOS: 3 and 4] illustrates the heavy chain
variable region (amino acids 20-140) of the murine 3B9, and the
native signal sequence (amino acids 1-19). The underlined portions
indicate the CDRs [SEQ ID NOS: 21 and 22; SEQ ID NOS: 23 and 24;
and SEQ ID NOS: 25 and 26].
[0021] FIG. 3 [SEQ ID NOS: 9 and 10] illustrates the heavy chain
variable region (amino acids 21-141) of the human/murine 3B9
chimeric antibody and its signal sequence (amino acids 1-19: SEQ ID
NOS: 5 and 6). The underlined portions indicate the CDRs derived
from 3B9 [SEQ ID NOS: 21 and 22; SEQ ID NOS: 23 and 24; and SEQ ID
NOS: 25 and 26].
[0022] FIG. 4 [SEQ ID NOS: 11 and 12] illustrates the heavy chain
variable region (amino acids 20-141) of the humanized 3B9 antibody
and a signal sequence (amino acids 1-19: SEQ ID NOS: 5 and 6). The
underlined portions indicate the CDRs derived from 3B9 [SEQ ID NOS:
54 and 22; SEQ ID NOS: 55 and 24; and SEQ ID NOS: 56 and 26].
[0023] FIG. 5 [SEQ ID NOS: 13 and 14] illustrates the light chain
variable region (amino acids 21-131) of the humanized 3B9 antibody
and a signal sequence (amino acids 1-20; SEQ ID NOS: 7 and 8). The
underlined portions indicate the CDRs derived from 3B9 [SEQ ID NOS:
53 and 16; SEQ ID NOS: 17 and 18; and SEQ ID NOS: 27 and 28].
[0024] FIG. 6A [SEQ ID NOS: 5 and 6] is a heavy chain signal
sequence used in Example 4 below.
[0025] FIG. 6B [SEQ ID NOS: 7 and 8] is a light chain signal
sequence used in Example 4 below.
[0026] FIG. 7 is a schematic drawing of plasmid pIL4chhc3-pcd
employed to express a chimeric IL4 heavy chain in mammalian cells.
The plasmid contains a beta lactamase gene (BETA LAC), an SV-40
origin of replication (SV40), a cytomegalovirus promoter sequence
(CMV), a signal sequence, the chimeric variable heavy chain of SEQ
ID NOS: 9 and 10, a human heavy chain constant region, a poly A
signal from bovine growth hormone (BGH), a betaglobin promoter
(beta glopro), a dihydrofolate reductase gene (DHFR), and another
BGH sequence poly A signal in a pUC19 background.
[0027] FIG. 8 is a schematic drawing of plasmid pIL4chlc-pcdn
employed to express the chimeric IL4 light chain variable region of
SEQ ID NOS: 1 and 2 in mammalian cells. The plasmid differs from
that of FIG. 7 by containing a chimeric light chain variable region
rather than that of the chimeric heavy chain, a human light chain
constant region and a neomycin gene (Neo) in addition to DHFR.
[0028] FIG. 9 is a schematic drawing of plasmid pIL4hzhc-1-pcd
employed to express the synthetic IL4 heavy chain variable region
of SEQ ID NOS: 11 and 12 in mammalian cells. The plasmid differs
from that of FIG. 7 by containing a humanized heavy chain variable
region rather than that of the chimeric heavy chain.
[0029] FIG. 10 is a schematic drawing of plasmid pIL4hzlc1-0-Pcn
employed to express the humanized IL4 light chain variable region
of SEQ ID NOS: 13 and 14 in mammalian cells. The plasmid differs
from that of FIG. 8 by containing a humanized light chain variable
region rather than that of the chimeric light chain and does not
encode the DHFR gene.
DETAILED DESCRIPTION OF THE INVENTION
[0030] The present invention provides a variety of antibodies,
fragments thereof, and fusion proteins particularly humanized
antibodies, which are characterized by human IL4 binding
specificity, neutralizing activity, and high affinity for human IL4
as exemplified in murine MAb 3B9 or the rat MAb 6A1. These products
are useful in therapeutic and pharmaceutical compositions for
treating IL4-mediated and IgE-mediated allergic reactions. These
products are also useful in the diagnosis of an IL4 mediated
condition by measurement (e.g., by enzyme linked immunosobent assay
(ELISA)) of circulating, endogenous IL4 levels in humans.
[0031] I. Definitions
[0032] "Fusion protein" refers to a protein encoded by a fusion
molecule, which may be obtained by expression in a selected host
cell. Such fusion proteins are engineered antibodies, e.g.,
chimeric or humanized antibodies, or antibody fragments lacking all
or part of an immunoglobulin constant region, e.g., Fv, Fab, or
F(ab).sub.2 and the like.
[0033] "Fusion molecule" refers to a nucleic acid sequence encoding
the complementarity determining regions (CDRs) from a non-human
immunoglobulin that are inserted into a first fusion partner
comprising human variable framework sequences. Optionally, the
first fusion partner is operatively linked to a second fusion
partner.
[0034] "First fusion partner" refers to a nucleic acid sequence
encoding a human framework or human immunoglobulin variable region
in which the native (or naturally-occuring) CDRs are replaced by
the CDRs of a donor antibody. The human variable region can be an
imumunoglobulin heavy chain, a light chain (or both chains), an
analog or functional fragments thereof. Such CDRs or CDR regions,
located within the variable region of antibodies (immunoglobulins)
can be determined by known methods in the art. For example Kabat et
al, [Sequences of Proteins of Immunological Interest, 4th Ed, U.S.
Department of Health and Human Services, National Institues of
Health (1987)], disclose rules for locating CDRs. In addition,
computer programs are known which are useful for identifying CDR
regions/structures.
[0035] The term "high titer" refers to an antibody having a binding
affinity characterized by a K.sub.4 equal to or less than
2.times.10.sup.-10 M for human IL4.
[0036] By "binding specificity for human IL4" is meant a high titer
(or affinity) for human, not bovine or murine, IL4.
[0037] "Second fusion partner" refers to another nucleotide
sequence encoding a protein or peptide to which the first fusion
partner is fused in frame or by means of an optional conventional
linker sequence (i.e., operatively linked). Preferably it is an
immunoglobulin. The second fusion partner may include a nucleic
acid sequence encoding the entire constant region for the same
(i.e., homologous--the first and second fusion proteins are derived
from the sane source) or an additional (i.e., heterologous)
antibody of interest. It may be an immunoglobulin heavy chain or
light chain (or both chains as part of a single polypeptide). The
second fusion partner is not limited to a particular immunoglobulin
class or isotype. In addition, the second fusion partner may
comprise part of an immunoglobulin constant region, such as found
in a Fab, or F(ab).sub.2 (i.e., a discrete part of an appropriate
human constant region or framework region). Such second fusion
partner may also comprise a sequence encoding an integral membrane
protein exposed on the outer surface of a host cell, e.g., as part
of a phage display library, or a sequence encoding a protein for
analytical or diagnostic detection, e.g., horseradish peroxidase,
.beta.-galactosidase, etc.
[0038] The terms Fv, Fc, Fab, or F(ab).sub.2 are used with their
standard meanings (see, e.g., Harlow et al., Antibodies A
Laboratory Manual, Cold Spring Harbor Laboratory, (1988)).
[0039] As used herein, an "engineered antibody" describes a type of
fusion protein, i.e., a synthetic antibody (e.g., a chimeric or
humanized antibody) in which a portion of the light and/or heavy
chain variable domains of a selected acceptor antibody are replaced
by analogous parts from one or more donor antibodies which have
specificity for the selected epitope. For example, such molecules
may include antibodies characterized by a humanized heavy chain
associated with an unmodified light chain (or chimeric light
chain), or vice versa. Engineered antibodies may also be
characterized by alteration of the nucleic acid sequences encoding
the acceptor antibody light and/or heavy variable domain framework
regions in order to retain donor antibody binding specificity.
These antibodies can comprise replacement of one or more CDRs
(preferably all) from the acceptor antibody with CDRs from a donor
antibody described herein.
[0040] A "chimeric antibody" refers to a type of engineered
antibody which contains naturally-occurring variable region (light
chain and heavy chains) derived from a donor antibody in
association with light and heavy chain constant regions derived
from an acceptor antibody.
[0041] A "humanized antibody" refers to a type of engineered
antibody having its CDRs derived from a non-human donor
immunoglobulin, the remaining immunoglobulin-derived parts of the
molecule being derived from one (or more) human immunoglobulin. In
addition, framework support residues may be altered to preserve
binding affininty (see, e.g., Queen et al., Proc. Natl Acad Sci
USA, 86:10029-10032 (1989), Hodgson et al., Bio/Technology, 9:421
(1991)).
[0042] The term "donor antibody" refers to an antibody (polyclonal,
monoclonal, or recombinant) which contributes the nucleic acid
sequences of its variable regions, CDRs, or other functional
fragments or analogs thereof to a first fusion partner, so as to
provide the fusion molecule and resulting expressed fusion protein
with the antigenic specificity and neutralizing activity
characteristic of the donor antibody. One donor antibody suitable
for use in this invention is a non-human neutralizing monoclonal
antibody (i.e., murine) designated as 3B9. The antibody 3B9 is
defined as a high titer, human-IL4 specific (i.e., does not
recognize bovine or murine IL4), neutralizing antibody of isotype
IgG.sub.1 having the variable light chain DNA and amino acid
sequences of SEQ ID NOS: 1 and 2, and the variable heavy chain DNA
and amino acid sequences of SEQ ID NOS: 3 and 4 on a suitable
murine IgG constant region.
[0043] The term "acceptor antibody" refers to an antibody
(polyclonal, monoclonal, or recombinant) heterologous to the donor
antibody, which contributes all (or any portion, but preferably
all) of the nucleic acid sequences encoding its heavy and/or light
chain framework regions and/or its heavy and/or light chain
constant regions to the second fusion partner. Preferably a human
antibody is the acceptor antibody.
[0044] "CDRs" are defined as the complementarity determining region
amino acid sequences of an antibody which are the hypervariable
regions of immunoglobulin heavy and light chains. See, e.g., Kabat
et al., Sequences of Proteins of Immunological Interest, 4th Ed.,
U.S. Department of Health and Human Services, National Institues of
Health (1987). There are three heavy chain and three light chain
CDRs (or CDR regions) in the varible portion of an immunoglobulin.
Thus, "CDRs" as used herein refers to all three heavy chain CDRs,
or all three light chain CDRs (or both all heavy and all light
chain CDRs, if appropriate).
[0045] CDRs provide the majority of contact residues for the
binding of the antibody to the antigen or epitope. CDRs of interest
in this invention arm derived from donor antibody variable heavy
and light chain sequences, and include analogs of the naturally
occurring CDRs, which analogs also share or retain the same antigen
binding specificity and/or neutralizing ability as the donor
antibody from which they were derived.
[0046] By `sharing the antigen binding specificity or neutralizing
ability` is meant, for example, that although MAb 3B9 may be
characterized by a certain level of antigen affinity, and a CDR
encoded by a nucleic acid sequence of 3B9 in an appropriate
structural environment may have a lower or higher affinity, it is
expected that CDRs of 3B9 in such environments will nevertheless
recognize the same epitope(s) as 3B9. Exemplary heavy chain CDRs of
3B9 include SEQ ID NO: 22; SEQ ID NO: 24; SEQ ID NO: 26; and
exemplary light chain CDRs of 3B9 include SEQ ID NO: 16; SEQ ID NO:
18; and SEQ ID NO: 20.
[0047] A "functional fragment" is a partial heavy or light chain
variable sequence (e.g., minor deletions at the amino or carboxy
terminus of the immunogloblin variable region) which retains the
same antigen binding specificity and/or neutralizing ability as the
antibody from which the fragment was derived.
[0048] An "analog" is an amino acid sequence modified by at least
one amino acid, wherein said modification can be chemical or a
substitution or a rearangement of a few amino acids (i.e., no more
than 10), which modification permits the amino acid sequence to
retain the biological characteristics, e.g., antigen specificity
and high titer or affinity, of the unmodified sequence. For
example, silent mutations can be constructed, via substitions, to
create endonuclease restriction sites within or surrounding CDR
regions.
[0049] Analogs may also arise as allelic variations. An "allelic
variation or modification" is an alteration in the nucleic acid
sequence encoding the amino acid or peptide sequences of the
invention. Such variations or modifications may be due to
degeneracies in the genetic code or may be deliberately engineered
to provide desired characteristics. These variations or
modifications may or may nor result in alterations in any encoded
amino acid sequence. For example, the amino acid sequences of the
light chain CDR SEQ ID NO: 16 are identical for the native murine
and humanized 3B9 antibody. However, this CDR sequence is encoded
by both SEQ ID NO: 15 and SEQ ID NO: 53. Similarly, CDR SEQ ID NO:
22 is encoded both by SEQ ID NO: 21 and SEQ ID NO: 54; CDR SEQ ID
NO: 24 is encoded both by SEQ ID NO: 23 and SEQ ID NO: 55; and CDR
SEQ ID NO: 26 is encoded both by SEQ ID NO: 25 and SEQ ID NO:
56.
[0050] The term "effector agents" refers to non-protein carrier
molecules to which the fusion proteins, and/or natural or synthetic
light or heavy chain of the donor antibody or other fragments of
the donor antibody may be associated by conventional means. Such
non-protein carriers can include conventional carriers used in the
diagnostic field, e.g., polystyrene or other plastic beads,
polysaccharides, e.g., as used in the BIAcore [Pharmacia] system,
or other non-protein substances useful in the medical field and
safe for administration to humans and animals. Other effector
agents may include a macrocycle, for chelating a heavy metal atom,
or radioisotopes. Such effector agents may also be useful to
increase the half-life of the fusion proteins, e.g., polyethylene
glycol.
[0051] II. High Affinity IL4 Monoclonal Antibodies
[0052] For use in constructing the antibodies, fragments and fusion
proteins of this invention, a non-human species (for example,
bovine, ovine, primate, rodent (e.g., murine and rat), etc.) may be
employed to generate a desirable immunoglobulin upon presentment
with native human IL4 or a peptide epitope therefrom. Conventional
hybridoma techniques are employed to provide a hybridoma cell line
secreting a non-human MAb to IL4. Such hybridomas are then screened
using IL4 covalently attached to 96-well plates or alternatively
with biotinylated IL4 for use in a screening assay, as described in
detail in Example 2 below. Thus one feature of the instant
invention is a method to detect MAbs for human IL4 in which the
assay systems avoid denaturing of IL4. In such a manner, it was
discovered that high titer (or high affinity) MAbs to human IL4 can
be detected.
[0053] As one example, the production of a high titer, neutralizing
MAb from a murine donor is disclosed for the first time. MAb 3B9,
which is a desirable murine (donor) antibody for use in developing
a chimeric or humanized antibody, is described in detail in Example
1 below. The 3B9 MAb is characterized by an antigen binding
specificity for human IL4, with a K.sub.4 of less than
2.0.times.10.sup.-10 M (about 1.8.times.10.sup.-10 M) for IL4. The
K.sub.4 for IL4 of a Fab fragment of this 3B9 is less than about
3.times.10.sup.-10 M. The epitope of this antibody could not be
mapped to IL4 with linear peptides, and hence the epitope is
considered to bind to a non-contiguous epitope. The pattern of
binding suggests a binding site at the B-C loop (residues
60-69).fwdarw.C helix (residues 70-93) region. These regions refer
to the map designations provided in Cook et al, J. Mol. Biol.,
218:675-678 (1991), Walter et al, J. Biol, Chem., 267:20371-20376
(1992), Wlodaver et al, FEBS Lett., 309:59-64 (1992), Redfield et
al, Biochem., 30:11029-11035 (1991), Smith et al, J. Mol. Biol.,
224:899-904 (1992), Garrett et al, (1992), and Powers et al,
Biochem., 31:4334-4346 (1992) and Science, 256:1673-1677 (1992),
incorporated by reference herein.
[0054] Another desirable donor antibody is the rat MAb, 6A1. The
production of this MAb is provided below in Example 7. This MAb is
characterized by being isotype IgG2a, and having a dissociation
constant for hIL4 of less than 2.0.times.10.sup.-10 M (about
1.6.times.10.sup.-10 M). As with 3B9, the target epitope of this
6A1 does not map with IL4 linear peptides, and the epitope is
therefore considered to be non-contiguous and three dimensional.
The pattern of binding to IL4 muteins and its biological activity
indicates binding in the D helix region of human IL4 (amino acid
residues 109-127), most likely around the tyrosine at amino acid
residue #124.
[0055] This invention is not limited to the use of the 3B9 MAb, the
6A1 MAb, or its hypervariable (i.e., CDR) sequences. Any other
appropriate high titer IL4 antibodies characterized by a
dissociation constant equal or less than 2.0.times.10.sup.-10 M for
human IL4 and corresponding anti-IL4 CDRs may be substituted
therefor. Wherever in the following description the donor antibody
is identified as 3B9 or 6A1, this designation is made for
illustration and simplicity of description only.
[0056] III. Antibody Fragments
[0057] The present invention also includes the use of Fab fragments
or F(ab').sub.2 fragments derived from MAbs directed against human
IL4. These fragments are useful as agents protective in vivo
against IL4- and IgE- mediated conditions or in vitro as part of an
IL4 diagnostic. A Fab fragment contains the entire light chain and
amino terminal portion of the heavy chain; and an F(ab').sub.2
fragment is the fragment formed by two Fab fragments bound by
disulfide bonds. MAbs 3B9, 6A 1, and other similar high affinity,
IL4 binding antibodies, provide sources of Fab fragments and
F(ab').sub.2 fragments which can be obtained by conventional means,
e.g., cleavage of the MAb with the appropriate proteolytic enzymes,
papain and/or pepsin, or by recombinant rods. These Fab and
F(ab').sub.2 fragments are useful themselves as therapeutic,
prophylactic or diagnostic agents, and as donors of sequences
including the variable regions and CDR sequences useful in the
formation of recombinant or humanized antibodies as described
herein.
[0058] IV. Anti-IL4 Amino Acid and Nucleotide Sequences of
Interest
[0059] The MAb 3B9 or other antibodies described above may
contribute sequences, such as variable heavy and/or light chain
peptide sequences, framework sequences, CDR sequences, functional
fragments, and analogs thereof, and the nucleic acid sequences
encoding them, useful in designing and obtaining various fusion
proteins (including engineered antibodies) which are characterized
by the antigen binding specifity of the donor antibody.
[0060] As one example, the present invention thus provides variable
light chain and variable heavy chain sequences from the IL4 murine
antibody 3B9 and sequences derived therefrom. The heavy chain
variable region of 3B9 is characterized by amino acid residues 20
to 140 of SEQ ID NO: 4. The CDR regions are indicated by
underlining in FIG. 2 and are provided in SEQ ID NO: 22; SEQ ID NO:
24; and SEQ ID NO: 26. The light chain clone variable region of 3B9
is characterized by amino acid residues 21 to 132 of FIG. 1 [SEQ ID
NO: 2]. The CDR regions are from amino acid residues 44-58 [SEQ ID
NO: 16]; 74-80 [SEQ ID NO: 18]; and 113-121 [SEQ ID NO: 20].
[0061] Chimeric heavy chain variable region and signal nucleotide
and amino acid sequences are provided. These sequences are
identical to the 3B9 heavy chain with the exception of the signal
sequence. The chimeric heavy chain signal sequence is provided in
SEQ ID NOS: 5 and 6. The CDR regions are indicated by underlining
in FIG. 3 and are identical in amino acid sequence to the native
murine CDRs [SEQ ID NOS: 21-26]. The chimeric light chain variable
region nucleotide and amino acid sequences are identical to the
unmodified 3B9 sequences (amino acid residues 21-132 of SEQ ID NO:
2), making use of the natural mouse signal sequences (amino acid
residues 1-20 of SEQ ID NO: 2).
[0062] A humanized heavy chain variable region and signal sequences
are illustrated in FIG. 4 [SEQ ID NO: 11 and 12]. The signal
sequence is also provided in SEQ ID NO: 5 and 6. Other suitable
signal sequences, known to those of skill in the art, may be
substituted for the signal sequences exemplified herein. The CDR
amino acid sequences of this construct are identical to the native
murine and chimeric heavy chain CDRs and are provided by SEQ ID NO:
22 (encoded by SEQ ID NO: 54), SEQ ID NO: 24 (encoded by SEQ ID NO:
55), and SEQ ID NO: 56 (encodes SEQ ID NO: 26).
[0063] An exemplary (synthetic) humanized light chain variable
sequence is illustrated in FIG. 5 [SEQ ID NOS: 13 and 14]. The
signal sequence spans amino acid residues 1 to 19 of SEQ ID NO: 8.
The CDR sequences of this figure are designated by underlining and
differ from the CDR of the native murine CDR by a single amino acid
of SEQ ID NO: 20. Thus, the CDRs of the humanized light chain are
provided by SEQ ID NO: 53 and 16, SEQ ID NO: 17 and 18, and SEQ ID
NO: 27 and 28. This difference is described in detail in Example
3.
[0064] The nucleic acid sequences of this invention, or fragments
thereof, encoding the variable light chain and heavy chain peptide
sequences are used in unmodified form or are synthesized to
introduce desirable modifications, e.g., restriction sites. The
isolated naturally-occurring or alternatively synthetic nucleic
acid sequences, which are derived from MAb 3B9 or from other
desired high titer IL4 antibodies may optionally contain
restriction sites to facilitate insertion or ligation into a
suitable nucleic acid sequence such as encoding a desired antibody
framework region, ligation with mutagenized CDRs or fusion with a
nucleic acid sequence encoding a selected second fusion
partner.
[0065] Taking into account the degeneracy of the genetic code,
various coding sequences may be constructed which encode the
variable heavy and light chain amino acid sequences, and CDR
sequences of the invention as well as functional fragments and
analogs thereof which share the antigen specificity of the donor
antibody. The isolated nucleic acid sequences of this invention, or
fragments thereof, encoding the variable chain peptide sequences or
CDRs can be used to produce fusion proteins, chimeric or humanized
antibodies, or other engineered antibodies of this invention when
operatively combined with a second fusion partner.
[0066] These sequences are also useful for mutagenic introduction
of specific changes within the nucleic acid sequences encoding the
CDRs or framework regions, and for incorporation of the resulting
modified or fusion nucleic acid sequence into a plasmid for
expression. For example, silent substitutions in the nucleotide
sequence of the framework and CDR-encoding regions were used to
create restriction enzyme sites which facilitated insertion of
mutagenized CDR (and/or framework) regions. These CDR regions were
used in the construction of a humanized antibody of this
invention.
[0067] It should be noted that in addition to isolated nucleic acid
sequences encoding portions of the fusion protein and antibodies
described herein, other such nucleic acid sequences may be
employed, such as those complementary to the native sequences.
Useful DNA sequences include those sequences which hybridize under
stringent hybridization conditions [see, T. Maniatis et al,
Molecular Cloning (A Laboratory Manual), Cold Spring Harbor
Laboratory (1982), pages 387 to 389] to the DNA sequences. An
example of one such stringent hybridization condition is
hybridization at 4.times.SSC at 65.degree. C., followed by a
washing in 0.1.times.SSC at 65.degree. C. for an hour.
Alternatively an exemplary stringent hybridization condition is in
50% formamide, 4.times.SSC at 42.degree. C. Preferably, these
hybridizing DNA sequences are at least about 18 nucleotides in
length, i.e., about the size of a CDR.
[0068] V. Fusion Molecules and Fusion Proteins
[0069] Fusion molecules can encode fusion proteins which includes
engineered antibodies such as, chimeric antibodies, and humanized
antibodies. A desired fusion molecule contains CDR sequences
encoding peptides having the antigen specificity of an IL4
antibody, preferably a high affinity antibody such as is provided
by the present invention inserted into a first fusion partner (a
human framework or human immunoglobulin variable region).
[0070] Preferably, the first fusion partner is operatively linked
to a second fusion partner. The second fusion partner is defined
above, and may include a sequence encoding a second antibody region
of interest, for example an Fc region. Second fusion partners may
also include sequences encoding another immunoglobulins to which
the light or heavy chain constant region is fused in frame or by
means of a linker sequence. Engineered antibodies directed against
functional fragments or analogs of IL4 may be designed to elicit
enhanced binding with the same antibody.
[0071] The second fusion partner may also be associated with
effector agents as defined above, including non-protein carrier
molecules, to which the second fusion partner may be operatively
linked by conventional means.
[0072] Fusion or linkage between the second fusion partners, e.g.,
antibody sequences, and the effector agent may be by any suitable
means, e.g., by conventional covalent or ionic bonds, protein
fusions, or hetero-bifunctional cross-linkers, e.g., carbodiimide,
glutaraldehyde, and the like. Such techniques are known in the art
and readily described in conventional chemistry and biochemistry
texts.
[0073] Additionally, conventional linker sequences which simply
provide for a desired amount of space between the second fusion
partner and the effector agent may also be constructed into the
fusion molecule. The design of such linkers is well known to those
of skill in the art.
[0074] In addition, signal sequences for the molecules of the
invention may be modified to enhance expression. As one example a
desired fusion protein having an amino acid sequence of the murine
heavy chain sequence, which is identical to the chimeric variable
heavy chain (V.sub.H) of FIG. 2 [SEQ ID NO: 4], had the original
signal peptide replaced with another signal sequence (amino acid
residues 1-20) [SEQ ID NO: 6].
[0075] An exemplary fusion protein contains a variable heavy and/or
light chain peptide or protein sequence having the antigen
specificity of MAb 3B9, e.g., the V.sub.H [amino acid residues
21-141 of SEQ ID NO: 9 and 10] and V.sub.L chains [amino acid
residues 21-132 of SEQ ID NOS: 1 and 2]. Still another desirable
fusion protein of this invention is characterized by the amino acid
sequence containing at least one, and preferably all of the CDRs of
the variable region of the heavy and/or light chains of the murine
antibody molecule 3B9 with the remaining sequences being derived
from a human source, or a functional fragment or analog thereof.
See, e.g., the humanized V.sub.H and V.sub.L regions of SEQ ID NOS:
11 and 12 and SEQ ID NOS: 13 and 14 (FIGS. 4 and 5).
[0076] In still a further embodiment, the engineered antibody of
the invention may have attached to it an additional agent. For
example, the procedure of recombinant DNA technology may be used to
produce an engineered antibody of the invention in which the Fc
fragment or CH3 domain of a complete antibody molecule has been
replaced by an enzyme or other detectable molecule. (ie., a
polypeptide effector or reporter molecule)
[0077] The second fusion partner may also be operatively linked to
a non-immunoglobulin peptide, protein or fragment thereof
heterologous to the CDR-containing sequence having the antigen
specificity of murine 3B9. The resulting protein may exhibit both
anti-IL4 antigen specificity and characteristics of the
non-immunoglobulin upon expression. That fusion partner
characteristic may be, e.g., a functional characteristic such as
another binding or receptor domain, or a therapeutic characteristic
if the fusion partner is itself a therapeutic protein, or
additional antigenic characteristics.
[0078] Another desirable protein of this invention may comprise a
complete antibody molecule, having full length heavy and light
chains, or any discrete fragment thereof, such as the Fab or
F(ab').sub.2 fragments, a heavy chain dimer, or any minimal
recombinant fragments thereof such as an F.sub.v or a single-chain
antibody (SCA) or any other molecule with the same specificity as
the selected donor MAb, e.g., MAb 3B9 or 6A1. Such protein may be
used in the form of a fusion protein, or may be used in its unfused
form.
[0079] Whenever the second fusion partner is derived from another
antibody, e.g., any isotype or class of immunoglobulin framework or
constant region, an engineered antibody results. Engineered
antibodies can comprise immunoglobulin (Ig) constant regions and
variable framework regions from one source, e.g., the acceptor
antibody, and one or more (preferably all) CDRs from the donor
antibody, e.g., the anti-IL4 antibody described herein. In
addition, alterations, e.g., deletions, substitutions, or
additions, of the acceptor MAb light and/or heavy variable domain
framework region at the nucleic acid or amino acid levels, or the
donor CDR regions may be made in order to retain donor antibody
antigen binding specificity.
[0080] Such engineered antibodies are designed to employ one (or
both) of the variable heavy and/or light chains of the IL4 MAb
(optionally modified as described) or one or more of the
below-identified heavy or light chain CDRs (see Example 3). The
engineered antibodies of the invention are neutralizing, i.e. they
desirably block binding to the receptor of the IL4 protein. For
example, the engineered antibody derived from MAb 3B9 is directed
against a specific tertiary protein epitope of human IL4 believed
to be at the B-C loop.fwdarw.C helix region, as described
above.
[0081] Such engineered antibodies may include a humanized antibody
containing the framework regions of a selected human immunoglobulin
or subtype, or a chimeric antibody containing the human heavy and
light chain constant regions fused to the IL4 antibody functional
fragments. A suitable human (or other animal) acceptor antibody may
be one selected from a conventional database, e.g. the KABAT.RTM.
database, Los Alamos database, and Swiss Protein database, by
homology to the nucleotide and amino acid sequences of the donor
antibody. A human antibody characterized by a homology to the
framework regions of the donor antibody (on an amino acid basis)
may be suitable to provide a heavy chain constant region and/or a
heavy chain variable framework region for insertion of the donor
CDRs. A suitable acceptor antibody capable of donating light chain
constant or variable framework regions may be selected in a similar
manner. It should be noted that the acceptor antibody heavy and
light chains are not required to originate from the same acceptor
antibody.
[0082] Desirably the heterologous framework and constant regions
are selected from human immunoglobulin classes and isotypes, such
as IgG (subtypes 1 through 4), IgM, IgA, and IgF. However, the
acceptor antibody need not comprise only human immunoglobulin
protein sequences. For instance a gene may be constructed in which
a DNA sequence encoding part of a human immunoglobulin chain is
fused to a DNA sequence encoding a non-immunoglobulin amino acid
sequence such as a polypeptide effector or reporter molecule.
[0083] One example of a particularly desirable humanized antibody
contains CDRs of 3B9 inserted onto the framework regions of a
selected human antibody sequence. For neutralizing humanized
antibodies one, two or preferably three CDRs from the IL4 antibody
heavy chain and/or light chain variable regions are inserted into
the framework regions of the selected human antibody sequence,
replacing the native CDRs of the latter antibody.
[0084] Preferably, in a humanized antibody, the variable domains in
both human heavy and light chains have been engineered by one or
more CDR replacements. It is possible to use all six CDRs, or
various combinations of less than the six CDRs. Preferably all six
CDRs are replaced. It is possible to replace the CDRs only in the
human heavy chain, using as light chain the unmodified light chain
from the human acceptor antibody. Still alternatively, a compatible
light chain may be selected from another human antibody by recourse
to the conventional antibody databases. The remainder of the
engineered antibody may be derived from any suitable acceptor human
immunoglobulin.
[0085] The engineered humanized antibody thus preferably has the
structure of a natural human antibody or a fragment thereof, and
possesses the combination of properties required for effective
therapeutic use, e.g., treatment of IL4 mediated inflammatory
diseases in man, or for diagnostic uses.
[0086] As another example, an engineered antibody may contain three
CDRs of the variable light chain region of 3B9 [SEQ ID NO: 16, 18,
20 and 28] and three CDRs of the variable heavy chain region of 3B9
[SEQ ID NO: 22, 24 and 26]. The resulting humanized antibody is
characterized by the antigen binding specificity and high affinity
of MAb 3B9.
[0087] It will be understood by those skilled in the art that an
engineered antibody may be further modified by changes in variable
domain amino acids without necessarily affecting the specificity
and high affinity of the donor antibody (i.e., an analog). For
example, humanized monoclonal antibodies have been constructed
wherein the light chain amino acid residue at position 120 was an
arginine [SEQ ID NO:13 and 14] or threonine [SEQ ID NOS:57 and 58].
It is anticipated that heavy and light chain amino acids may be
substituted by other amino acids either in the variable domain
frameworks or CDRs or both.
[0088] In addition, the constant region may be altered to enhance
or decrease selective properties of the molecules of the instant
invention. For example, dimerization, binding to Fc receptors, or
the ability to bind and activate complement (see, e.g., Angal et
al., Mol. Immunnol, 30:105-108 (1993), Xu et al., J. Biol. Chem,
269:3469-3474 (1994), Winter et al., EP 307,434B).
[0089] A fusion protein which is a chimeric antibody differs from
the humanized antibodies described above by providing the entire
non-human donor antibody heavy chain and light chain variable
regions, including framework regions, in association with human
immunoglobulin constant regions for both chains. It is anticipated
that chimeric antibodies which retain additional non-human sequence
relative to humanized antibodies of this invention may elicit a
significant immune response in humans.
[0090] Such antibodies are useful in the prevention and treatment
of IL4 mediated allergic disorders, as discussed below.
[0091] VI. Production of Fusion Proteins and Engineered
Antibodies
[0092] Preferably, the variable light and/or heavy chain sequences
and the CDRs of MAb 3B9 [SEQ ID NO: 16, 18, 20, 22, 24 and 26] or
other suitable donor MAbs (e.g., 6A1), and their encoding nucleic
acid sequences, are utilized in the construction of fusion proteins
and engineered antibodies, preferably humanized antibodies, of this
invention, by the following process. The same or similar techniques
may also be employed to generate other embodiments of this
invention.
[0093] A hybridoma producing a selected donor MAb, e.g., the murine
antibody 3B9, is conventionally cloned, and the DNA of its heavy
and light chain variable regions obtained by techniques known to
one of skill in the art, e.g., the techniques described in Sambrook
et al., Molecular Cloning (A Laboratory Manual), 2nd edition, Cold
Spring Harbor laboratory (1989). The variable heavy and light
regions of 3B9 containing at least the CDRs and those portions of
the acceptor MAb light and/or heavy variable domain framework
region required in order to retain donor MAb binding specificity,
as well as the remaining immunoglobulin-derived parts of the
antibody chain derived from a human immunoglobulin are obtained
using polynucleotide primers and reverse transcriptase. The CDRs
are identified using a known database and by comparison to other
antibodies.
[0094] A mouse/human chimeric antibody may then be prepared and
assayed for binding ability. Such a chimeric antibody contains the
entire non-human donor antibody V.sub.H and V.sub.L regions, in
association with human Ig constant regions for both chains.
[0095] Homologous framework regions of a heavy chain variable
region from a human antibody were identified using computerized
databases, e.g., KABAT.RTM., and a human antibody having homology
to 3B9 was selected as the acceptor antibody. The sequences of
synthetic heavy chain variable regions containing the 3B9 CDRs
within the human antibody frameworks were designed with optional
nucleotide replacements in the framework regions to incorporate
restriction sites. This designed sequence is then synthesized by
overlapping oligonucleotides, amplified by polymerase chain
reaction (PCR), and corrected for errors.
[0096] A suitable light chain variable framework region was
designed in a similar manner.
[0097] A humanized antibody may be derived from the chimeric
antibody, or preferably, made synthetically by inserting the donor
MAb CDRs from the heavy and light chains appropriately within the
selected heavy and light chain framework. Alternatively, a
humanized antibody of the invention made be prepared using standard
mutagenesis techniques. Thus, the resulting humanized antibody
contains human framework regions and donor MAb CDRs. There may be
subsequent manipulation of framework residues. The resulting
humanized antibody can be expressed in recombinant host cells,
e.g., COS or CHO cells. Additional details of this procedure are
provided in Example 4. Other humanized antibodies may be prepared
using this technique on other suitable IL4-specific, neutralizing,
high titer, non-human antibodies.
[0098] A conventional expression vector or recombinant plasmid is
produced by placing these coding sequences for the fusion protein
in operative association with conventional regulatory control
sequences capable of controlling the replication and expression in,
and/or secretion from, a host cell. Regulatory sequences include
promoter sequences, e.g., CMV promoter, and signal sequences, which
can be derived from other known antibodies. Similarly, a second
expression vector is produced having a DNA sequence which encodes a
complementary antibody light or heavy chain. Preferably this second
expression vector is identical to the first except insofar as the
coding sequences and selectable markers are concerned so to ensure
as far as possible that each polypeptide chain is functionally
expressed.
[0099] A selected host cell is co-transfected by conventional
techniques with both the first and second vectors or simply
transfected by a single vector to create the transfected host cell
of the invention comprising both the recombinant or synthetic light
and heavy chains. The transfected cell is then cultured by
conventional techniques to produce the engineered antibody of the
invention. The humanized antibody which includes the association of
both the recombinant heavy chain and/or light chain is screened
from culture by appropriate assay, such as ELISA or RIA. Similar
conventional techniques may be employed to construct other fusion
proteins and molecules of this invention.
[0100] Suitable vectors for the cloning and subcloning steps
employed in the methods and construction of the compositions of
this invention may be selected by one of skill in the art. For
example, the conventional pUC series of cloning vectors, may be
used. One vector used is pUC19, which is commercially available
from supply houses, such as Amersham (Buckinghamshire, United
Kingdom) or Pharmacia (Uppsala, Sweden). Additionally, any vector
which is capable of replicating readily, has an abundance of
cloning sites and marker genes, and is easily manipulated may be
used for cloning. Thus, the selection of the cloning vector is not
a limiting factor in this invention.
[0101] Similarly, the vectors employed for expression of the
engineered antibodies according to this invention may be selected
by one of skill in the art from any conventional vector. The
vectors also contain selected regulatory sequences which are in
operative association with the DNA coding sequences of the
immunoglobulin regions and capable of directing the replication and
expression of heterologous DNA sequences in selected host cells,
such as CMV promoters. These vectors contain the above described
DNA sequences which code for the engineered antibody or fusion
molecule. Alternatively, the vectors may incorporate the selected
immunoglobulin sequences modified by the insertion of desirable
restriction sites for ready manipulation.
[0102] The expression vectors may also be characterized by marker
genes suitable for amplifying expression of the heterologous DNA
sequences, e.g. the mammalian dihydrofolate reductase gene (HFR) or
neomycin resistance gene (neo.sup.R). Other preferable vector
sequences include a poly A signal sequence, such as from bovine
growth hormone (BGH) and the betaglobin promoter sequence
(betaglopro). The expression vectors useful herein may be
synthesized by techniques well known to those skilled in this
art.
[0103] The components of such vectors, e.g. replicons, selection
genes, enhancers, promoters, signal sequences and the like, may be
obtained from natural sources or synthesized by known procedures
for use in directing the expression and/or secretion of the product
of the recombinant DNA in a selected host. Other appropriate
expression vectors of which numerous types are known in the art for
mammalian, bacterial, insect, yeast, and fungal expression may also
be selected for this purpose.
[0104] The present invention also encompasses a cell line
transfected with a recombinant plasmid containing the coding
sequences of the engineered antibodies or fusion molecules hereof.
Host cells useful for the cloning and other manipulations of these
cloning vectors are also conventional. However, most desirably,
cells from various strains of E. coli are used for replication of
the cloning vectors and other steps in the construction of fusion
proteins of this invention.
[0105] Suitable host cells or cell lines for the expression of the
engineered antibody or fusion protein of the invention are
preferably a eukaryotic cell such as CHO, COS, a fibroblast cell
(e.g. 3T3), and myeloid cells among others, and most preferably a
mammalian cell, such as a CHO cell or a myeloid cell. Human cells
may be used, thus enabling the molecule to be modified with human
glycosylation patterns. Alternatively, other eukaryotic cell lines
may be employed. The selection of suitable mammalian host cells and
methods for transformation, culture, amplification, screening and
product production and purification are known in the art. See,
e.g., Sambrook et al., cited above.
[0106] Bacterial cells may prove useful as host cells suitable for
the expression of the recombinant MAbs of the present invention.
However, due to the tendency of proteins expressed in bacterial
cells to be in an unfolded or improperly folded form or in a
non-glycosylated form, any recombinant MAb produced in a bacterial
cell would have to be screened for retention of antigen binding
ability. If the molecule expressed by the bacterial cell was
produced in a properly folded form, that bacterial cell would be a
desirable host. For example, various strains of E. coli used for
expression are well-known as host cells in the field of
biotechnology. Various strains of B. subtiis, Streptomyces, other
bacilli and the like may also be employed in this method
[0107] Where desired, strains of yeast cells known to those skilled
in the art are also available as host cells, as well as insect
cells, e.g. Drosophila and Lepidoptera and viral expression
systems. See, e.g. Miller et al., Genetic Engineering, 8:277-298,
Plenum Press (1986) and references cited therein.
[0108] The general methods by which the vectors of the invention
may be constructed, transfection methods required to produce the
host cells of the invention, and culture methods necessary to
produce the fusion protein or engineered antibody of the invention
from such host cell are all conventional techniques. Likewise, once
produced, the fusion proteins or engineered antibodies of the
invention may be purified from the cell culture contents according
to standard procedures of the art, including ammonium sulfate
precipitation, affinity columns, column chromatography, gel
electrophoresis and the like. Such techniques are within the skill
of the art and do not limit this invention.
[0109] Yet another method of expression of the humanized antibodies
may utilize expression in a transgenic animal, such as described in
U.S. Pat. No. 4,873,316. This relates to an expression system using
the animal's casein promoter which when transgenically incorporated
into a mammal permits the female to produce the desired recombinant
protein in its milk.
[0110] Once expressed by the desired method, the engineered
antibody is then examined for in vitro activity by use of an
appropriate assay. Presently conventional ELISA assay formats are
employed to assess qualitative and quantitative binding of the
engineered antibody to an IL4 epitope. Additionally, other in vitro
assays, e.g. BIAcore [Pharmacia], may also be used to verify
neutralizing efficacy prior to subsequent human clinical studies
performed to evaluate the persistence of the engineered antibody in
the body despite the usual clearance mechanisms.
[0111] Following the procedures described for humanized antibodies
prepared from 3B9, one of skill in the art may also construct
humanized antibodies from other donor IL4 antibodies, variable
region sequences and CDR peptides described herein. Engineered
antibodies can be produced with variable region frameworks
potentially recognized as "self" by recipients of the engineered
antibody. Minor modifications to the variable region frameworks can
be implemented to effect large increases in antigen binding without
appreciable increased immunogenicity for the recipient. Such
engineered antibodies can effectively treat a human for IL4
mediated conditions. Such antibodies may also be useful in the
diagnosis of such conditions.
[0112] VII. Therapeutic/Prophylactic Uses
[0113] This invention also relates to a method of treating humans
experiencing an allergic disorder which comprises administering an
effective dose of antibodies including one or more of the
engineered antibodies or fusion proteins described herein, or
fragments thereof.
[0114] The therapeutic response induced by the use of the molecules
of this invention is produced by the binding to human IL4 and thus
subsequently blocking IgE release. Thus, the molecules of the
present invention, when in preparations and formulations
appropriate for therapeutic use, are highly desirable for those
persons experiencing an allergic response, such as an allergic
rhinitis, conjunctivitis, atopic dermatitis, atopic asthma, and
anaphylactic shock.
[0115] The fusion proteins, antibodies, engineered antibodies or
fragments thereof of this invention may also be used in conjunction
with other antibodies, particularly human MAbs reactive with other
markers (epitopes) responsible for the condition against which the
engineered antibody of the invention is directed. Similarly MAbs
reactive with epitopes responsible for the condition in a selected
animal against which the antibody of the invention is directed may
also be employed in veterinary compositions.
[0116] The therapeutic agents of this invention are believed to be
desirable for treatment of allergic conditions for from about 2
days to about 3 weeks, or as needed. For example, longer treatments
may be desirable when treating seasonal rhinitis or the like. This
represents a considerable advance over the currently used infusion
protocol with prior art treatments of IL4 mediated disorders. The
dose and duration of treatment relates to the relative duration of
the molecules of the present invention in the human circulation,
and can be adjusted by one of skill in the art depending upon the
condition being treated and the general health of the patient.
[0117] The mode of administration of the therapeutic agent of the
invention may be any suitable route which delivers the agent to the
host. The fusion proteins, antibodies, engineered antibodies, and
fragments thereof, and pharmaceutical compositions of the invention
are particularly useful for parenteral administration, i.e.,
subcutaneously, intramuscularly, intravenously, or
intranasally.
[0118] Therapeutic agents of the invention may be prepared as
pharmaceutical compositions containing an effective amount of the
engineered (e.g., humanized) antibody of the invention as an active
ingredient in a pharmaceutically acceptable carrier. In the
prophylactic agent of the invention, an aqueous suspension or
solution containing the engineered antibody, preferably buffered at
physiological pH, in a form ready for injection is preferred. The
compositions for parenteral administration will commonly comprise a
solution of the engineered antibody of the invention or a cocktail
thereof dissolved in an pharmaceutically acceptable carrier,
preferably an aqueous carrier. A variety of aqueous carriers may be
employed, e.g., 0.4% saline, 0.3% glycine, and the like. These
solutions are sterile and generally free of particulate matter.
These solutions may be sterilized by conventional, well known
sterilization techniques (e.g., filtration). The compositions may
contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions such as pH
adjusting and buffering agents, etc. The concentration of the
antibody, of the invention in such pharmaceutical formulation can
vary widely, i.e., from less than about 0.5%, usually at or at
least about 1% to as much as 15 or 20% by weight and will be
selected primarily based on fluid volumes, viscosities, etc.,
according to the particular mode of administration selected.
[0119] Thus, a pharmaceutical composition of the invention for
intramuscular injection could be prepared to contain 1 mL sterile
buffered water, and between about 1 ng to about 100 mg, e.g. about
50 ng to about 30 mg or more preferably, about 5 mg to about 25 mg,
of an engineered antibody of the invention. Similarly, a
pharmaceutical composition of the invention for intravenous
infusion could be made up to contain about 250 ml of sterile
Ringer's solution, and about 1 to about 30 and preferably 5 mg to
about 25 mg of an engineered antibody of the invention. Actual
methods for preparing parenterally administrable compositions are
well known or will be apparent to those skilled in the art and are
described in more detail in, for example, Remington's
Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton,
Pa.
[0120] It is preferred that the therapeutic agent of the invention,
when in a pharmaceutical preparation, be present in unit dose
forms. The appropriate therapeutically effective dose can be
determined readily by those of skill in the art. To effectively
treat an inflammatory disorder in a human or other animal, one dose
of approximately 0.1 mg to approximately 20 mg per 70 kg body
weight of a protein or an antibody of this invention should be
administered parenterally, preferably i.m. (intramuscularly). Such
dose may, if necessary, be repeated at appropriate time intervals
selected as appropriate by a physician during the inflammatory
response.
[0121] The invention also encompasses the administration of the IL4
fusion proteins of this invention concurrently or sequentially with
other antibodies or fusion proteins characterized by anti-IL4
activity, such as anti-tumor necrosis factor activity or other
pharmaceutical activities compatible with the IL4 receptor binding
ability of the fusion proteins of this invention. Such other
antibodies are available commercially or can be designed in a
manner similar to that described herein.
[0122] The fusion proteins and engineered antibodies of this
invention may also be used in diagnostic regimens, such as for the
determination of IL4 mediated disorders or tracking progress of
treatment of such disorders. As diagnostic reagents, these fusion
proteins may be conventionally labelled for use in ELISA's and
other conventional assay formats for the measurement of IL4 levels
in serum, plasma or other appropriate tissue. The nature of the
assay in which the fusion proteins are used are conventional and do
not limit this disclosure.
[0123] The antibodies, engineered antibodies or fragments thereof
described herein can be lyophilized for storage and reconstituted
in a suitable carrier prior to use. This technique has been shown
to be effective with conventional immunoglobulins and art-known
lyophilization and reconstitution techniques can be employed.
[0124] The following examples illustrate various aspects of this
invention including the construction of exemplary engineered
antibodies and expression thereof in suitable vectors and host
cells, and are not to be construed as limiting the scope of this
invention. All amino acids are identified by conventional three
letter or single letter codes. All necessary restriction enzymes,
plasmids, and other reagents and materials were obtained from
commercial sources unless otherwise indicated. All general cloning
ligation and other recombinant DNA methodology were as performed in
T. Maniatis et al., cited above, or the second edition thereof
(1989), eds. Sambrook et al., by the same publisher ("Sambrook et
al.").
EXAMPLE 1
[0125] Production of MAb 389
[0126] A. Immunization Procedure
[0127] Four mice (F1 hybrids of Balb/c and C57BL/6) were immunized
subcutaneously with 50 .mu.g recombinant E. coli human IL4 in
Freunds complete adjuvant and 4 weeks later boosted
intraperitoneally (i.p.) with 50 .mu.g IL4 in Freunds incomplete
adjuvant. On the basis of a good serum antibody titre to IL4 one
mouse received further immunizations of 200 .mu.g IL4 (i.p. in
saline) at 8 weeks, two days later with 100 .mu.g IL4 (i.p. in
saline) and two days later with 50 .mu.g IL4 (i.p. in saline). Two
days following the final immunization a splenectomy was
performed.
[0128] B. Fusion Procedure and Screening System
[0129] Mouse spleen cells were used to prepare hydridomas (by
standard procedures, e.g. as described by Kohler et al, Nature,
256:495 (1975)) from which >250 clones of cells were screened
for secretion of antibody to IL4, using the commercially available
BIAcore system, and ELISA assays as described below, for IL4
binding. Five wells gave a positive response. Only 1 clone from
mice, 3B9, was strongly positive. All secondary clones derived from
3B9 were positive.
EXAMPLE 2
[0130] ELISA Assays and Affinity Constants
[0131] A. ELISA
[0132] The screening assay, performed as follows, was designed to
measure affinity for native human IL4. For experiment 1 aldehyde
activated 96-well plates were coated with IL4 at 1 .mu.g/mL, 100
.mu.l/well in 0.1 M borate buffer, pH 8.5, and incubated overnight
at RT. The hIL4 was covalently attached to the plate. IL4 solution
was aspirated and non-specific binding (NSB) sites were blocked
with 1% bovine serum albumin (BSA) in TBS buffer (50 mM Tris, 150
mM NaCl, 1 mM MgCl.sub.2, 0.02% NaN.sub.3, pH 7.4) for 60 minutes
at 37.degree. C. Following this and each of the following steps,
the plate was washed 4 times in wash buffer (10 mM Tris, 150 mM
NaCl, 0.05% Tween 20, 0.02% NaN.sub.3, pH 7.4). Following this, 50
.mu.L hybridoma medium (or purified 3B9 or Fab fragments) and 50
.mu.L assay buffer (0.5% bovine gamma globulin in TBS buffer) was
added and the plates were incubated for 60 minutes at 37.degree. C.
One hundred .mu.L of biotinylated anti-mouse antibody was added per
well in assay buffer and incubated as above. One hundred .mu.l of
alkaline phosphatase conjugated streptavidin was added per well and
incubated (30 minutes at 37.degree. C.). One hundred .mu.L/well PNP
substrate was added and incubated 30 minutes at 37.degree. C.
Readings were taken at an optical density of 405 nm.
[0133] For experiment 2, streptavidin-coated plates (100
.mu.L/well, 1 .mu.g/mL in phosphate buffered saline (PBS)) were
incubated overnight at 4.degree. C. and were assayed as follows.
Strepavidin solution was aspirated, NSB sites blocked with 1% BSA
in TBS buffer (60 minutes at 37.degree. C.). Following this step,
and each of the steps which follow, the plates were washed four
times in wash buffer. Fifty .mu.L biotinylated IL4 was added with
50 .mu.L assay buffer and incubated for 30 minutes at 37.degree. C.
Following this, 50 .mu.L purified 3B9 IgG or Fab fragment (or
hybridoma medium) plus 50 .mu.L assay buffer was added, incubated
60 minutes at 37.degree. C. One hundred .mu.L anti-mouse IgG
alkaline phosphatase conjugate was added and incubated for 60
minutes at 37.degree. C. One hundred .mu.L PNP substrate was added
and incubated 30 minutes at 37.degree. C. The readings were taken
as above.
[0134] B. Calculation of 3B9 Affinity for IL-4
[0135] Using the results of the experiments described above, and
summarized as follows, the K.sub.4 for 3B9 was calculated as
described in Beatty et al, J. Immunol Methods 100:173-179 (1987): 1
K aff = 1 2 ( 2 [ Ab * ] - [ Ab ] )
[0136] Ab*=concentration of Ab bound at 150 ng/ml biotinylated
hIL4
[0137] Ab=concentration of Ab bound at 300 ng/ml biotinylated
hIL4
[0138] Dissociation constants, K.sub.d, were calculated from the
relationship: 2 K d = 1 K aff
[0139] Experiment 1: ELISA assay on a streptavidin coated 96-well
plate (100 ng/well). K.sub.d=2.2.times.10.sup.-10 M (3B9 Fab)
[0140] Experiment 2: ELISA assay on a streptavidin coated 96-well
plate (100 ng/well). K.sub.d=1.4.times.10.sup.-10 M (3B9 IgG)
[0141] C. Specificity
[0142] MAb 3B9 recognizes human IL4, but does not recognize bovine
or murine IL4. One way to determine this is as follows. An ELISA
can be performed using a 96 well plate coated with anti-mouse IgG,
and subsequently blocked with bovine serum albumin, upon which 50
.mu.L 3B9 (100 ng/mL), 25 .mu.L of non-human IL4, and 25 .mu.L
biotin-IL4 were incubated for 60 minutes at 37.degree. C., followed
by a wash, streptavidin conjugated alkaline phosphatase and
PNP.
[0143] Similarly, MAb 6A1 was found not to recognize bovine or
murine IL4.
EXAMPLE 3
[0144] Humanized Antibody
[0145] One humanized antibody was designed to contain murine CDRs
within a human antibody framework. This humanized version of the
IL4 specific mouse antibody 3B9, was prepared by performing the
following manipulations.
[0146] A. cDNA Cloning
[0147] cDNA clones were made of the 3B9 heavy and light chains from
mRNA extracted out of the 3B9 hybridoma cell line [Example 1] using
a Boehringer Mannheim kit Primers specific for either the mouse
hinge region or kappa constant region were used for first stand
synthesis.
1 The kappa chain primer is [SEQ ID NO: 29]:
5'-CTAACACTCATTCCTGTTGAAGCTCTTGACAATGGG-3' The gamma heavy chain
primer is [SEQ ID NO: 30]: 5'GTACATATGCAAGGCTTACAACCACAATC-3'.
[0148] The double stranded cDNA was cloned directly into plasmids
pGEM7f+[Promega] that were then transformed into E. coli
DH5-.alpha.[Bethesda Research Labs].
[0149] B. DNA Sequencing
[0150] Eight heavy and one light chain murine cDNA clones from Part
A above were sequenced. The results of sequencing of the variable
regions of these clones are shown in SEQ ID NO: 1 and 2 and 3 and
4. Each clone contained amino acids known to be conserved among
mouse heavy chain variable regions or light chain variable regions,
and murine signal sequences. The CDR amino acid sequences are
listed below.
[0151] The CDR regions for the heavy chain are SEQ ID NO: 22, 24
and 26, (amino acids 50-56, 71-86 and 119-129 of SEQ ID NO: 4). See
FIG. 2. These sequences are encoded by SEQ ID NO: 21, SEQ ID NO:
23, and SEQ ID NO: 25, respectively. The CDR regions for the light
chain are SEQ ID NO: 16, 18 and 20 (amino acids 45-58, 74-80, and
113-121 of SEQ ID NO: 2). See FIG. 1. These sequences are encoded
by SEQ ID NO: 15, 17, and 19, respectively.
[0152] C. Selection of Human Frameworks
[0153] Following the cloning of 3B9, the amino acid sequences of
the variable region (amino acids 21-132 of SEQ ID NO: 2 and amino
acids 20 to 140 of SEQ ID NO: 4) were compared with the human
immunoglobulin sequence database using the KABAT.RTM. and the SWISS
databases in order to identify a human framework for both the heavy
and light chains which would most closely match the murine parent
in sequence homology. In addition to these searches for sequence
homology, the heavy and light chains were also evaluated against a
positional database generated from structural models of the Fab
domain to assess potential conflicts due to amino acid
substitutions which might influence CDR presentation. For the
present case, no obvious conflicts were detected in the structural
search; hence, the DNA coding deduced from the amino acid sequence
homology searches was used.
[0154] The heavy chain framework regions of an antibody obtained
from a human myeloma immunoglobulin (COR) was used [E. M. Press and
N. M. Hogg, Biochem. J., 117:641-660 (1970)]. This sequence was
found to be approximately 77% homologous (69.4% identity) to the
3B9 variable chain region at the amino acid level.
[0155] For a suitable light chain variable framework region, the
light chain variable framework sequence of the human antibody
identified in H. G. Klobeck et al, Nucl. Acids Res., 13:6515-6529
(1985) was used. The human antibody sequence was found to be
approximately 80.2% homologous (72.0% identity) to the murine 3B9
variable light chain region at the amino acid level.
[0156] Given the murine 3B9 CDRs [SEQ ID NO: 15-26] and the
sequence of the human antibody, a synthetic heavy chain was made
and PCR performed to fill in and amplify the DNA. These sequences
were synthesized by the following overlapping oligonucleotides and
amplified by PCR. SEQ ID NO: 31-37 provides five overlapping oligos
and 2 PCR primers. Oligo 1 [SEQ ID NO: 31] is found spanning bases
5-121. Oligo 2 [SEQ ID NO: 32] is found spanning bases 122-241, and
oligo 3 [SEQ ID NO: 33] is found spanning bases 242-361. The two
bottom strand primers SEQ ID NO: 34 and SEQ ID NO: 35 span bases
134-110 and bases 253-230. Any errors in the mapped sequence which
were inserted by PCR were corrected. PCR was again performed using
as the 5' primer nucleotides 1-25 SEQ ID NO: 36 and as the 3'
primer nucleotides 361-341 SEQ ID NO: 37.
[0157] The synthetic variable region was ligated into the
expression vector pCD along with the synthetic signal sequence SEQ
ID NO: 5 and 6 from the chimeric heavy chain construction along
with an IgG.sub.1 human constant region. The synthetic V.sub.H and
signal sequence nucleotide and amino acid sequences are provided in
FIG. 4 [SEQ ID NOS: 11 and 12]. The amino acid sequences of the
CDRs [SEQ ID NOS: 22, 24 and 26] are identical to the murine 3B9
CDRs. However, the coding sequences for these CDRs [SEQ ID NOS: 54,
55 and 56] differ from the murine 3B9 coding sequences [SEQ ID NOS:
21, 23 and 25]. The resulting expression vector, IL4hzhc1-l-Pcd is
shown in FIG. 9.
[0158] The CDR gene regions of a pre-existing light chain framework
were restriction digest removed and replaced with the following
synthetic IL-4 CDR genes, which were synthetically made.
2 For CDR1: SEQ ID NO: 38: 5'CTAGCTGTGTCTCTGGGCGAGAGG- GCCACCATCAAC
TGCAAGG 3' SEQ ID NO: 39: CCTTGCAGTTGATGGTGGCCCTCTCGCCCAGAGACACAG
SEQ ID NO: 40: TCGAGAGGCCTCCCAAAGTGTTGATTATGATGGTGATAG
TTATATGAACTGGTATCAGCAGAAAC- CC SEQ ID NO: 41:
GGGTTTCTGCTGATACCAGTTCATATAACTATCACCATCATA ATCAACACTTTGGGAGGCCTC
For CDR2: SEQ ID NO: 44: GGGCAGCCTCCTAAGTTGCTCATTTACGCTGCATCCAATCTA
GAATCTGGGGTAC SEQ ID NO: 45:
CCCAGATTCTAGATTGGATGCAGCGTAAATGAGCAACTTAGG AGGCTGCCC For CDR3: SEQ
ID NO: 42: ATACTACTGTCAGCAAAGTAATGAGGATCCTCCGAGGTTCGG CGGAGGGAC SEQ
ID NO: 43: CTTGGTCCCTCCGCCGAACCTCGGAGGATCCTCATTACTTTG
CTGACAGTAGT
[0159] The synthetic V.sub.L and signal sequence nucleotide and
amino acid sequences are provided in FIG. 5 [SEQ ID NOS: 13 and
14]. The amino acid sequences of the first two CDRs [SEQ ID NOS: 16
and 18] are identical to the corresponding murine 3B9 CDRs.
However, the coding sequence for the first CDR [SEQ ID NO: 53]
differs from the murine 3B9 coding sequence [SEQ ID NO: 15].
Further, in the last CDR, two humanized constructs of the 3B9 amino
acid sequence were constructed. One, [SEQ ID NO: 28], differs by a
single amino acid [SEQ ID NO: 20] from the native murine 3B9
sequence. SEQ ID NO: 28 is encoded by SEQ ID NO: 27. The synthetic
variable light regions were ligated into the expression vector
along with the signal sequence [SEQ ID NOS: 7 and 8]. One of the
resulting expression vectors, IL4hzlc1-O-Pcn is illustrated in FIG.
10.
[0160] These synthetic variable light and/or heavy chain sequences
are employed in the construction of a humanized antibody.
EXAMPLE 4
[0161] Expression of Humanized MAb in COS and CHO cells
[0162] pUC18 subclones for the V.sub.H were made to add a signal
sequence originally obtained from a human antibody SEQ ID NO: 5.
For the V.sub.L, pUC18 subclones were made to add a signal sequence
SEQ ID NO: 7.
[0163] The humanized heavy chain, derived from an IgGl.sub.1
isotype, exhibits 89.3% homology (84.3% identity) at the amino acid
level with the murine heavy chain from 3B9. This synthetic V.sub.H
is provided in amino acids 20-141 of SEQ ID NOS: 11 and 12.
[0164] The humanized light chain, a human kappa chain, shows 92.0%
homology (86.6% identity) with 3B9 at the amino acid level. This
synthetic V.sub.L [amino acids 21 to 131 of SEQ ID NOS: 13 and 14]
containing the 3B9 CDRs was designed and synthesized as described
above for the synthetic heavy chains.
[0165] The DNA fragments containing their respective signal linked
to either the humanized heavy or light variable regions were
inserted into pUC19-based mammalian cell expression plasmids
containing CMV promoters and the human heavy chain or human light
chain constant regions of the chimera produced in Example 5 below,
by conventional methods [Maniatis et al., cited above] to yield the
plasmids IL4hzhc1-lPcd (heavy chain) [FIG. 9] and
IL4hzlc1-o-Pcn)(light chain) [FIG. 10]. The HZHC and HZLC plasmids
are cotransfected into COS cells and supernatants assayed by the
ELISA described immediately above for the presence of humanized
antibody after three and five days. Another humanized antibody was
constructed but with an IgG4 isotype.
[0166] The above example describes the preparation of an exemplary
engineered antibody. Similar procedures may be followed for the
development of other engineered antibodies, using other anti-IL4
antibodies (e.g., 6A1-Example 7) developed by conventional
means.
EXAMPLE 5
[0167] Construction of Chimeric Antibody
[0168] A. A chimeric heavy chain was constructed by isolating the
murine variable heavy chain region from the original mouse MAb 3B9
as an EcoRI-BstEII restriction fragment. A small DNA oligomer was
designed and synthesized to link the mouse variable region with the
human IgG1 constant region (BstEII-ApaI):
3 5'primer: SEQ ID GTCACCGTCTCCTCAGCTAGCACCAAGGGGC NO: 50:
3'primer: SEQ ID CTTGGTGCTAGCTGAGGAGACG NO: 51:
[0169] These two fragments were ligated into plasmid pCD (See FIG.
7)(digested with EcoRI and Apa1) that already encodes the human
IgG1 constant region. This clone did not express; therefore, the
wild-type 5'UTR and signal sequence were deleted and replaced with
SEQ ID NO:5 and 6.
[0170] Because a convenient restriction endonuclease site was not
available at the 3' end of the signal sequence, a BstEII site was
introduced (i.e., a silent mutation) via PCR. The following PCR
primers were used:
4 SEQ ID NO: 48: 5'primer: 5'CAGGTTACCCTGAAAGAGTC 3' SEQ ID NO: 49:
3'primer: 5'GAAGTAGTCCTTGACCAG 3'
[0171] A BstEII-PstI restriction fragment was then isolated from
this plasmid. A new signal sequence and 5'UTR were then designed
and synthesized having EcoRI and BstEII ends.
5 SEQ ID NO: 46: 5'primer: AATTCGAGGACGCCAGCAACATGGT-
GTTGCAGACCCAGGTCTTCATTTCT- CTGTTGCTCTGGACTCTGGTGCCTA- CGGGCAG SEQ
ID NO: 47: 3'primer: GTAACCTGCCCGTAGGCACCAGAGA-
TCCAGAGCAACAGAGAAATGAAGAC- CTGGGTCTGCAACACCATGTTGCTG- GCGTCCTCG
[0172] The chimeric light chain was constructed by applying the PCR
technique to the original murine 3B9 light chain that was cloned
into pGEM72f(+) [Promega]. The primers utilized were the
commercially available pUC18 universal reverse primer at the 5' end
(EcoRI) and a 3' primer that introduces a NarI site
[5'CATCTAGATGGCG CCGCCACAGTACGTTTGATCTCCAGCTTGGTCCC3' SEQ ID NO:
52], used to fuse the mouse variable region to the human constant
region. This variable region was then ligated into the expression
vector pCDN (EcoRI NarI) (FIG. 8) that already contains the human
kappa region.
[0173] Media supernatants were collected three and five days later
and assayed by the ELISA described as follows: ELISA plates were
coated with 0.1 .mu.g of a goat antibody specific for the Fc region
of human antibodies. The media supernatants were added for one
hour. A horseradish peroxidase conjugated goat antibody specific
for an entire human IgG antibody was added. This was followed by
addition of ABTS peroxidase substrate (Kirkegaard & Perry
Laboratories Inc., Gaithersburg, Md.) for one hour. Expression of
the chimeric antibody was detected. In a second ELISA the COS cell
supernatants containing the chimeric antibody bound specifically to
recombinant human IL4 protein. This result confirmed that genes
coding for an antibody specific for IL4 had been cloned.
[0174] B. A humanized heavy chain can also be obtained from this
chimeric heavy chain. The humanized heavy chain was designed from
by inserting the murine CDRs into a human framework. The chosen
human framework was as described above, the most homologous protein
sequence in the Swiss protein data based to the murine 3B9 V.sub.H
(amino acids 20-140 of SEQ ID NO: 4). This humanized heavy chain
sequence (EcoRI ApaI) was made synthetically and PCR performed to
fill in and amplify DNA as described above. This synthetic variable
region was ligated into the the expression vector pCD (EcoRI ApaI)
together with the synthetic signal sequence SEQ ID NOS: 5 and 6
from the chimeric heavy chain construction and an IgG.sub.1 human
constant region.
[0175] Similarly, a humanized light chain can be derived from the
chimeric light chain as described for the heavy chain. This gene
(EcoRV NarI) was also made synthetically. The humanized V.sub.L was
ligated into the expression vector pCN, digested with EcoRI NarI,
along with a signal sequence (EcoRI EcoRV). The expression vector
provided the human kappa constant region.
EXAMPLE 6
[0176] Purification and Thermodynamics--Humanized MAb
[0177] Purification of CHO expressed chimeric and humanized 3B9 can
be achieved by conventional protein A (or G) affinity
chromatography followed by ion exchange and molecular sieve
chromatography. Similar processes have been successfully employed
for the purification to >95% purity of other MAbs (e.g., to
respiratory syncytial virus and malaria circumsporozoite
antigens).
[0178] The affinity and detailed thermodynamics of IL4 binding to
humanized MAb 3B9 and murine 3B9 (Example 1) were determined by
titration microcalorimetry. This method measures binding reactions
by virtue of their intrisic heats of reaction (see, e.g., Wiseman
et al., Anal. Biochem, 179:131-137 (1989). The affinity of both
MAbs was found to be too tight to measure directly at ambient
temperature. Thus, a thermodynamic approach was taken: i) the
affinity was measured at 60.degree. C., where it is weak enough to
be measured directly; and (ii) the temperature-dependence of the
binding enthalpy was measured from 30-60.degree. C. Together, these
data allow calculation of the affinity over a wide range of
temperautes using the Gibbs-Helmholz equation.
[0179] A summary of the IL4 binding thermodynamics of the humanized
and murine 3B9 antibodies are presented in Table 1. Based upon the
changes in free energy, enthalpy, entropy and heat capacity of the
two MAbs, the binding thermodymanics are indistinguishable.
6TABLE 1 Thermodynamics of hIL-4 binding to Humanzied 3B9 and
Murine 3B9 at pH 7.4, 150 mM NaCl, and 25.degree. C.. .DELTA.G
.DELTA.H -T.DELTA.S .DELTA.C K.sub.d kcal/ kcal/ kcal/ cal/mol mAB
picomolar mol IL4 mol IL4 mol IL4 IL4/.degree. K. human- 11 -13.6
.+-. 0.6 -21.8 .+-. 2 8.2 .+-. 2.1 -580 .+-. 160 ized 3B9 murine 19
-13.3 .+-. 0.6 -20.5 .+-. 1 7.2 .+-. 1.2 -660 .+-. 200 3B9 IL-4
affinities of humanzied 3B9 and murine 3B9 were measured in
quadruplicate and duplicate, respectively.
EXAMPLE 7
[0180] Production and Characterization of Rat MAb
[0181] MAb 6A1, chosen for high affinity binding, was derived from
an immunized rat, using the same immunization protocol as described
for the mouse in Example 1. 6A1 was selected from hybridomas
(specifically, hybridoma 3426A11C1B9) prepared from rats immunized
with human IL4.
[0182] The K.sub.d for 6A1 was calculated as described in Beatty et
al J. Immunol. Methods, 100:173-179 (1987) to be 2.times.10.sup.-10
M.
[0183] Hybridoma 3426A11C1B9 was deposited Oct. 6, 1993 with the
European Collection of Animal Cell Cultures (ECACC), Public Health
Laboratory Service Centre for Applied Microbiology & Research,
Porton Down, Salisbury, Wiltshire, SP4 0JG, United Kingdom, under
accession number 93100620, and has been accepted as a patent
deposit, in accordance with the Budapest Treaty of 1977 governing
the deposit of microorganisms for the purposes of patent
procedure.
EXAMPLE 8
[0184] Biological Activity of MAbs: 3B9 (humanized), 3B9 (Murine)
and 6A1
[0185] The following assays were performed using the procedures
described below.
[0186] A. Binding to Glycosylated rhIL4
[0187] The above-identified antibodies were raised to
non-glycosylated recombinant human IL4 (rhIL4) which was produced
in E. coli. Because native human IL4 is glycosylated, it was
important to confirm binding to material secreted by a mammalian
cell line. 3B9 binds equally well to both glycosylated and
non-glycosylated human recombinant IL4, and is not therefore
directed to an epitope that would be masked on natural human
IL4.
[0188] B. Inhibition of IL4 Binding to Receptor
[0189] The ability of 3B9 to inhibit the binding of IL4 to its
receptor was studied using .sup.125I-rhIL4 binding to the gibbon
cell line, MLA [ATCC TIB201], that bears approximately 6000
receptors per cell, MLA cells were incubated with .sup.125I-IL4 for
30 minutes at 37.degree. C. Uptake of radioactivity was determined
in a gamma counter after separation of cell bound .sup.125I-IL4 by
centrifugation through an oil-gradient. Non-sic binding was
determined by incubating in the presence of a 100-fold molar excess
of unlabelled IL4 [Park et al, J. Exp. Med., 166:476-488 (1987)].
The IC.sub.50 value for unlabeled IL4 in this assay was 22 pM when
the amount of (added) IL4 was 83 pM. For intact murine (IgG) 3B9
the IC.sub.50 was 63 pM, and 93 pM for the Fab fragment. At another
concentration of IL4 (218 pM), the assay amount for murine (IgG)
3B9 was 109 pM.
[0190] C. Inhibition of Lymphocyte Proliferation
[0191] Using the method described in Spits et al, J. Immunol.,
139:1142-1147 (1987), human peripheral blood lymphocytes are
incubated for three days with phytohemagglutinin, a T cell mitogen,
to upregulate the IL4 receptor. The resultant blast cells are then
stimulated for three days further with IL4. Proliferation is
measured by the incorporation of .sup.3H thymidine. B cell
proliferation was measured by the assay of Callard et al, in
Lymphokines and Interferons, A Practical Approach, Ch. 19, p. 345,
modified as follows. Purified human tonsillar B cells are
stimulated for 3 days with IL4 and immobilized anti-IgM.
Proliferation is measured by the incorporation of .sup.3H
thymidine.
[0192] 3B9 (murine) inhibited .sup.3H-thymidine incorporation by
human peripheral blood T lymphocytes stimulated with 133 pM IL4 and
human tonsillar B lymphocytes stimulated by 167 pM IL4.
IL2-stimulated T lymphocytes were not affected. The IC.sub.50 for
inhibition of T cell proliferation was 30 pM, and for B cell
proliferation 103 pM. The corresponding values for the Fab fragment
of 3B9 (murine) were 108 and 393 pM.
[0193] D. Inhibition of CD23 Induction
[0194] CD23 is the low affinity receptor for IgE (FcERII) and is
induced on the membrane of resting B lymphocytes by low
concentrations of IL4 as a necessary prerequisite for IgE
production. Purified human tonsillar B cells are stimulated for 2
days with IL4. The percentage of cells expressing the CD23 receptor
are determined by flow cytometry [Defrance et al, J. Exp. Med.,
165:1459-1467 (1987)]. 3B9 (murine) inhibited CD23 expression on
human tonsil B lymphocytes stimulated with 8.3 pM IL4 with an
IC.sub.50 value of 136 pM.
[0195] E. Inhibition of IgE Secretion
[0196] Unlike other assays where IL4 was added at EC.sub.50
concentrations [Pere et al, Proc. Natl. Acad. Sci., 85:6880-6884
(1989)], IgE secretion was investigated in the presence of
concentrations of IL4 giving maximal secretion in order to reduce
the variability inherent in this system. T cell proliferation was
measured as follows. Human peripheral blood lymphocytes are
incubated with IL4 for between 10-18, preferably 12, days. The
concentration of IgE in the culture supernatant is determined by
ELISA.
[0197] IgE secretion was inhibited by 3B9 (murine), and the Fab
fragment of 3B9, in the presence of 1.7 nM IL4 giving IC.sub.50
values of 1.9 and 5.0 nM respectively. The experiment was repeated
using a lower concentration of IL4, 667 pM, which reduced the
IC.sub.50 value to 0.65 nM for 3B9 (murine). The molar ratio of
antibody (IgG) to IL4 remained unchanged (1:1) over the
concentration ranges examined.
[0198] F. Summary and Interpretation of Data
[0199] The molar ratios of IL4 to various MAbs required for 50%
inhibition of function in bioassays is given in Table 2.
7TABLE 2 Comparative activity of mAbs 3B9, 6A1 and Humanized 3B9
[IgG1 and IgG4 variants] in IL-4 dependent bioassays IC50 (pM)
[range] .sub.n Murine Humanized Murine 3B9 3B9 Assay 3B9 (Fab) Rat
6A1 IgG1 IgG4* RBA 63 93 >50000 [17-109].sub.2 T cell 30 108 87
44 [30-56].sub.3 40 [10-40].sub.4 B cell 103 393 187 47
[10-80].sub.3 79 [79-120].sub.3 CD23 136 216 80 333 induc-
[53-272].sub.4 tion IgE 658 1170 623 [412-833].sub.2 54
[35-83].sub.3 406 synthe- [370-1070].sub.6 sis n = number of
separte tests carried out. *The IgG1 and IgG4 variants were assayed
at different times.
[0200] In all assays, except IgE secretion, IL4 was added at
approximate ED.sub.50 concentrations. The molar ratios of antibody
to IL-4 required for 50% inhibition were similar for humanized 3B9,
murine 3B9, and 6A1 in the two lymphocyte proliferation assays, but
higher for humanized 3B9 in the CD23 induction assay. The latter is
a particularly sensitive assay apparently requiring very low
(.about.5%) receptor occupancy (Kruse et al., EMBO J, 12:5121 1993)
and, as is evident from the results obtained with murine 3B9,
subject to inter assay variation.
[0201] A comparison of the activities of rat 6A1 and murine 3B9
demonstrated a similar profile of functional effects, but an
unexpected failure of 6A1 to fully inhibit the binding of
radioiodinated IL4 to its receptor. The radioiodinated IL4 used in
the receptor binding assay is thought to be iodinated at the
accessible tyrosine, residue 124. When the ability of 6A1 to
inhibit CD23 expression induced by either unlabelled or iodinated
IL4 was compared, it was found that inhibition was less efficient
against iodinated ligand. These results indicate that 6A1 binds to
IL4 in the region of, but not specifically to, tyrosine 124.
[0202] Thus on current data, 6A1 is a neutralizing antibody of high
affinity, binding to a very different region of IL4 than 3B9.
EXAMPLE 9
[0203] Pharmacokinetics
[0204] The pharmacokinetics of humanized 3B9 was investigated in
the male Sprague Dawley rat. Humanized 3B9 was administered to four
animals as an iv bolus dose at 1 mg/kg, blood sampling was
continued for 5 weeks post dosing. Plasma humanized 3B9
concentrations were determined using an IL4/anti-human IgG sandwich
ELISA designed to confirm not only the presence of circulating
human IgG but also its ability to bind to recombinant human
IL4.
[0205] Results from this study are summarized in Table 3.
8TABLE 3 Pharmacokinetics of Humanized 3B9 in male Sprague-Dawley
Rats (dose: 1 mg/kg iv bolus) Clp (mL/h/kg) Rat 1 0.442 Rat 2 0.655
Rat 3 0.555 Rat 4 0.447 Mean 0.525 SD 0.101 Abbreviation of the
pharmacokinetic parameter is as follows: Clp, apparent plasma
clearance.
[0206] Data indicated that inter-animal variability was relatively
small and disappearance of humanized 3B9 from plasma appeared to be
biphasic. The apparent plasma clearance was low (0.5 mL/h/kg). The
half-life appeared to be 11 days. Thus, the pharmacokinetic
characteristics of the CHO cell-derived humanized 3B9 are
consistent with other humanized monoclonal antibodies in rats. The
long circulating half life of humanized 3B9 in the rat also
suggests that when administered to man, humanized 3B9 is likely to
be effective over an extended period of time.
[0207] Numerous modifications and variations of the present
invention are included in the above-identified specification and
are expected to be obvious to one of skill in the art. For example,
human framework legions or modifications thereof, other than the
exemplary antibodies described above, may be used in the
construction of humanized antibodies. Such modifications and
alterations to the compositions and processes of the present
invention are believed to be encompassed in the scope of the claims
appended hereto.
Sequence CWU 1
1
* * * * *