U.S. patent application number 10/212357 was filed with the patent office on 2002-12-19 for fgf9 as a specific ligand for fgfr3.
This patent application is currently assigned to Yeda Research and Development Co., Ltd., an Israel corporation, Yeda Research and Development Co., Ltd., an Israel corporation. Invention is credited to Yayon, Avner.
Application Number | 20020193309 10/212357 |
Document ID | / |
Family ID | 21690089 |
Filed Date | 2002-12-19 |
United States Patent
Application |
20020193309 |
Kind Code |
A1 |
Yayon, Avner |
December 19, 2002 |
FGF9 as a specific ligand for FGFR3
Abstract
The present invention concerns fibroblast growth factor 9 (FGF9)
as a high affinity ligand for fibroblast growth factor receptor 3
(FGFR3) which ligand is capable of binding and activating FGFR3 in
a specific manner. The present invention is also directed to
methods for detection of FGFR3 by utilizing FGF9, as well as to
pharmaceutical compositions for modulating the activity of FGFR3
comprising as an active ingredient FGF9, antagonists thereof or FGF
binding agents which are capable of neutralizing native circulating
FGF9. The present invention further concerns novel recombinant
mouse and chicken FGF9, expression vectors comprising these
recombinant FGF9s and a transgenic animal transformed with said
expression vectors.
Inventors: |
Yayon, Avner; (Moshav
Sitria, IL) |
Correspondence
Address: |
JANIS K. FRASER, ESQ.
Fish & Richardson P.C.
225 Franklin Street
Boston
MA
02110-2804
US
|
Assignee: |
Yeda Research and Development Co.,
Ltd., an Israel corporation
|
Family ID: |
21690089 |
Appl. No.: |
10/212357 |
Filed: |
August 2, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10212357 |
Aug 2, 2002 |
|
|
|
08981030 |
May 6, 1998 |
|
|
|
6447783 |
|
|
|
|
08981030 |
May 6, 1998 |
|
|
|
PCT/IL96/00011 |
Jun 12, 1996 |
|
|
|
60000137 |
Jun 12, 1995 |
|
|
|
Current U.S.
Class: |
514/9.1 ;
435/320.1; 435/325; 435/69.1; 435/7.21; 514/16.5; 514/16.7;
514/17.1; 530/399; 536/23.5 |
Current CPC
Class: |
C07K 16/2863 20130101;
G01N 33/56966 20130101; G01N 2333/9121 20130101; A61K 2039/505
20130101; G01N 33/74 20130101; G01N 33/566 20130101; G01N 33/53
20130101; A61K 38/00 20130101; G01N 2333/50 20130101; A61P 5/00
20180101; A61P 43/00 20180101; C07K 14/50 20130101; A61P 35/00
20180101; G01N 33/6887 20130101 |
Class at
Publication: |
514/12 ;
435/7.21; 536/23.5; 530/399; 435/69.1; 435/320.1; 435/325 |
International
Class: |
G01N 033/567; C12P
021/02; C12N 005/06; A61K 038/18; C07K 014/50 |
Claims
1. A method for the detection of fibroblast growth factor receptor
3 (FGFR3) in a sample or tissue comprising: (i) contacting the
sample or tissue with fibroblast growth factor 9 (FGF9) and
allowing formation of receptor-ligand pairs; and (ii) detecting the
presence of FGFR3-FGF9 pairs, a positive detection indicating the
presence of FGFR3 in the sample or tissue.
2. A method according to claim 1, wherein the contact of sample or
tissue with FGF9 is carried out in the presence of heparin.
3. A pharmaceutical composition for modulating of the activity of
FGFR3 comprising a pharmaceutically acceptable carrier and as an
active ingredient a therapeutically effective amount of FGF9.
4. A pharmaceutical composition according to claim 3 for increasing
the activity of FGFR3.
5. A pharmaceutical composition according to claim 4 for
stimulating bone and cartilage repair.
6. A pharmaceutical composition for modulating of the activity of
FGFR3 comprising a pharmaceutically acceptable carrier and as an
active ingredient an antagonist of FGF9, or an FGF9 binding
agent.
7. A pharmaceutical composition according to claim 6, wherein the
FGF9 binding agent is an antibody against FGF9.
8. A pharmaceutical composition according to claim 6 or 7 for
decreasing the activity of FGFR3.
9. A pharmaceutical composition according to claim 8 for the
treatment of a disease or a disorder selected from the group
consisting of: multiple or solitary hereditary exostosis, hallux
vagus deformity, achondroplasia, synovial chondromatosis and
endochondromas.
10. A recombinant mouse FGF9 DNA having the nucleic acid sequence
as depicted in FIG. 1.
11. A recombinant chicken FGF9 DNA having the nucleic acid sequence
as depicted in FIG. 2.
12. A polypeptide comprising an amino acid sequence encoded by the
recombinant mouse FGF9 DNA of claim 10.
13. A polypeptide comprising an amino acid sequence encoded by the
recombinant chicken FGF9 DNA of claim 11.
14. An expression vector comprising the recombinant mouse FGF9 DNA
sequence of claim 10 or the recombinant chicken FGF9 DNA sequence
of claim 11 under the expression control of a strong promoter
and/or a cartilage/bone tissue specific promoter.
15. An expression vector according to claim 14, wherein the
promoter is collagen type-2 promoter.
16. A transgenic animal transfected with an expression vector
according to claim 14 or 15.
17. A method for the stimulation of cartilage or bone repair
comprising: administering to the site of desired repair a
therapeutically effective amount of FGF9, optionally together with
a pharmaceutically acceptable carrier.
18. A method for the therapeutical treatment of a disease or
disorder caused by an excess of FGF9 or over activity of FGFR3
comprising: administering to a subject in need of such treatment a
therapeutically effective amount of a FGF9-binding agent or an
antagonist of FGF9.
19. A method according to claim 18, wherein the FGF9-binding agent
is an antibody against FGF9.
20. A method according to claim 13 or 19, wherein the disease or
disorder is selected from the group consisting of: multiple or
solitary hereditary exostosis, hallux vagus deformity,
achondroplasia, synovial chondromatosis and endochondromas.
Description
FIELD OF THE INVENTION
[0001] The present invention concerns fibroblast growth factor 9
(FGF9), a novel high affinity ligand for fibroblast growth factor
receptor 3 (FGFR3), methods for detecting FGFR3 using said ligand
and pharmaceutical compositions for modulating FGFR3 activity
comprising FGF9, an antagonist thereof, or FGF9 binding-agents.
BACKGROUND OF THE INVENTION
[0002] Fibroblast growth factors (FGF) comprise a family of at
least nine multifunctional polypeptides involved in a variety of
biological processes including morphogenesis, angiogenesis and
tissue remodeling. They stimulate the proliferation of cells from
mesenchymal to epithelial and neuroectodermal origin. FGFs share
structural similarity, but differ in their target specificity and
spatial and temporal expression pattern. Four FGF receptor (FGFR)
genes encoding transmembrane protein tyrosine kinases, have been
cloned and identified in mammals and their homologues described in
birds, Xenopus and Drosophila (Givol and Yayon, FASEB J.,
6:33623369 (1992)). The actual number of functional receptor
proteins is however much greater since multiple variants are
generated, as cell bound or secreted forms, by alternative RNA
splicing and multiple polyadenylation sites. Beside these high
affinity receptors. FGFs bind tightly to low affinity, high
capacity binding sites identified as heparan sulfate proteoglycans
(HSPGs). These heparan sulfates modulate FGF-receptor binding and
biological activity and serve as an obligatory integral component
in the formation of a functional tertiary complex between FGF, FGFR
and the appropriate HSPG.
[0003] In light of the large number of ligand and receptor
variants, a major question regarding FGF function is their
ligand-receptor specificity. Both FGFR1 and FGFR2 bind acidic
FGF/FGF1 and basic FGF/FGF2 with similar affinity (Dionne et al.,
EMBO J., 9:2685-2692 (1990)). In fact all FGFRs tested so far bind
FGF1 and FGF4 (hst/kfgf) with moderate to high affinity,
demonstrating an apparent redundancy in the FGF system. In contrast
to FGFRs 1 and 2, FGFR3 was found to bind only FGF1 and FGF4 albeit
with moderate affinity (Ornitz and Leder, J. Biol Chem.,
267:16305-16311 (1992); Chellaiah et al., J. Biol. Chem.,
269(15):11620-11622, (1994)). No specific ligand has been
identified so far, for either of the spliced forms of this
receptor.
[0004] Recently, mutations in FGFR3 have been shown to be
responsible for achondroplasia, the most common form of genetic
dwarfism. Examination of the sequence of FGFR3 in achondroplasia
patients identified a mutation in the transmembrane domain of the
receptor.
[0005] The focus of FGFR3 as the receptor involved in
achondroplasia raised the need for a specific ligand for this
receptor, which does not substantially bind to the other three
FGFRs, both for the purpose of research and study of this disease
as well as for the purpose of developing possible medicaments for
its treatment.
[0006] A heparin-binding, glia-activating factor purified from the
culture supernatant of a human glioma cell-line was found, by a
homology search, to be the ninth member of the FGF family and was
thus termed FGF9. Human FGF9 was found to code for a 208 amino acid
protein and presents a unique spectrum of biological activity as it
stimulates the proliferation of glial cells, PC-12 cells and BALB/C
3T3 fibroblasts, but nevertheless is not mitogenic for endothelial
cells (Miyamote et al., Mol. Cell Biol., 13(7):4251-4259 (1993):
Naro et al., J. Biol. Chem., 267:16305-16311 (1993)).
SUMMARY OF THE INVENTION
[0007] The present invention is based on the surprising finding
that fibroblast growth factor 9 (FGF9) is a high affinity (kD: 0.25
nM) ligand for fibroblast growth factor receptor 3 (FGFR3) which
does not bind to FGFR1 or FGFR4 and binds to FGFR2 only at a
substantially lower affinity.
[0008] Thus, the present invention provides for the first time a
specific ligand for FGFR3 being a fibroblast growth factor 9
(FGF9). This specific FGFR3 ligand may be used both for detection
and for therapeutical treatment purposes.
[0009] This specific novel ligand for FGFR3 may be used in a method
for the detection of FGFR3 in a sample or tissue comprising:
[0010] (i) contacting the sample or tissue with FGF9 and allowing
formation of receptor-ligand pairs, and
[0011] (ii) detecting the presence of FGFR3-FGF9 pairs, a positive
detection indicating the presence of FGFR3 in the sample or
tissue.
[0012] The sample may be a sample of body fluid such as blood, in
which soluble FGFR3 is present and the tissue may be a tissue
obtained from a patient, for example by cartilage biopsy or
alternatively, may be a tissue within the body of an individual and
in such a case the detection is carried out in vivo.
[0013] Detection may be carried out for example by labelling the
FGF9 with a suitable detectable label, and then determining whether
any label is bound to proteins in the sample or to the surface of
cells in the tissue which is assayed for the presence of FGFR3.
Alternatively detection may be carried out by using labeled
antibodies against FGF9, capable of recognizing FGF9 which is bound
to FGFR3.
[0014] In accordance with the present invention, it was found that
FGF9 is a heparin-dependent ligand for FGFR3. Thus, in accordance
with the method of detection of FGFR3 by use of the FGF9 ligand, it
is preferable that heparin would also be present in the detection
medium.
[0015] In accordance with the present invention, it was further
found that FGF9 not only specifically binds to the FGFR-3, but also
specifically activates this receptor without activating the FGFR1
and FGFR4 receptors and, if appropriate concentrations are chosen,
without significantly activating FGFR2. This finding leads to the
preparation of pharmaceutical compositions comprising a
pharmaceutically acceptable carrier and as an active ingredient a
therapeutically effective amount of FGF9. Such a pharmaceutical
compositions may be used for stimulating the activity of FGFR3.
[0016] This finding also leads to the preparation of pharmaceutical
compositions comprising a pharmaceutically acceptable carrier and
as an active ingredient an antagonist of the FGF9, or an FGF9
binding agent an example being an antibody against FGF9.
[0017] Pharmaceutical compositions comprising an antagonist of FGF9
may be used to attenuate directly the activity of the FGFR3, and
pharmaceutical compositions comprising an FGF9 binding agent such
as an antibody against FGF9, may neutralize circulating native FGF9
and thus attenuate indirectly the activity of FGFR3.
[0018] Normal cartilage and bone growth and repair of damage to the
cartilage and bone requires a specific and delicate balance between
up regulation and down regulation of the activity of the FGFR3.
Without wishing to be bound by theory, it is assumed that active
FGFR3 is necessary in the initial stages of cartilage-bone
differentiation, and after differentiation is required for
cartilage-bone repair. Thus, the pharmaceutical composition
comprising as an active ingredient FGF9, which stimulates the
activity of FGFR3, may be used in order to encourage cartilage and
bone repair, for example by administration to the site of injury.
Furthermore, FGFR3 exists usually temporarily on mesenchymal stem
cells and usually disappears after differentiation. Administration
of FGF9 may serve to stabilize FGFR3 and thus prolong the period in
which it is active prior to differentiation. FGF9 has also a
chemotactic affect of FGFR3-carrying cells and can promote
migration of such FGFR3 carrying cells, typically mesenchymal stem
cells, to a desired site, for example, by injection of FGF9 to the
growth plate top of the column.
[0019] According to this theory, overactivation of FGFR3 after the
stage of initial differentiation of bone and cartilage cells, leads
to halted growth, and is probably the cause of achondroplasia.
Thus, a pharmaceutical composition comprising as an active
ingredient an antagonist of FGF9 which attenuates the activity of
FGFR3, or comprising an FGF9 binding agent (such as an antibody
against FGF9), which neutralizes native circulating FGF9, should be
used in cases of overactivity of the FGFR3 receptor in
differentiated tissues, which causes bone and cartilage growth
arrest. Such bone and cartilage growth arrest may lead to
achondroplasia dwarfism, or other abnormalities of bone and
cartilage growth, for example, multiple hereditary exostosis,
solitary hereditary exostosis, hallux valgus deformity, synovial
chondromatosis and endochondromas.
[0020] The above conditions may be treated with a pharmaceutical
composition comprising either an antagonist of FGF9, or an FGF9
binding agents capable of neutralizing native circulating FGF9,
which both serve to attenuate the activity of the FGFR3.
[0021] The present invention also concerns a novel recombinant
mouse FGF9, and a novel recombinant chicken FGF9, as well as DNA
sequences coding for these novel recombinant proteins.
[0022] The present invention still further concerns an expression
vector comprising the sequence of FGF9 under the expression control
of a strong promoter such as the CMV or SV40 or a cartilage/bone
promoter such as collagen type-2 promoter. Such an expression
vector may be used to produce a transgenic mammal, which
over-expresses FGF9, leading to overactivation of the FGFR3
receptor and thus to halted growth. Such an animal may serve as a
model for diseases and disorders resulting from halted growth, such
as genetic achondroplasia.
[0023] In the following the invention will be illustrated with
reference to some non-limiting drawings and examples.
DETAILED DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1--Nucleotide and amino acid sequences of mouse FGF9.
The nucleotide sequence of FGF9:pET-3C and deduced amino acid
sequence are shown.
[0025] FIG. 2--Nucleotide and amino acid sequences of chicken FGF9.
The nucleotide sequence of FGF9:pET-3C and deduced amino acid
sequence are shown.
[0026] FIGS. 3A, 3B, 3C shows comparison of amino acid and
nucleotide sequences of mouse, rat and human FGF9.
[0027] FIG. 4--Purification of FGF9. Partially purified FGF9 was
bound to heparin sepharose and eluted with a 0.2-2 M salt gradient,
protein amount was estimated by spectrophotometer (A). To identify
FGF9 in the clution fractions, 10 ml of each fraction were resolved
on 15% SDS PAGE, transferred to nitrocellulose and immunoblotted
with specific antibodies (anti SP32) (B). The purity of the
fractions was tested by silver staining of 5 ml of each fraction
resolved on 15% SDS PAGE (C).
[0028] FIG. 5--FGF9 binding specificity. Purified FGF9 was
immobilized on heparin sepharose beads and its ability to bind the
soluble extracellular domain of different FGFRs coupled to alkaline
phosphatase was tested (A). The amounts of FGFRs were estimated
according to alkaline phosphatase activity (B). Equal amounts of
soluble extracellular domain of FGFRs 1, 2, 2-IIIb, 3, 3-IIIb and 4
alkaline phosphatase fusion proteins, were immunoprecipitated with
anti alkaline phosphatase antibodies. Binding and cross-linking of
.sup.125I-FGF9 in the presence or absence of 0.5 .mu.g/ml heparin
and hundred fold excess unlabeled FGF9 (Ex. cold) was done as
described under materials and methods.
[0029] FIG. 6--Analysis of FGF9 binding to soluble FGFR2 and FGFR3.
Binding of increasing concentrations of .sup.125I-FGF9 to soluble
extracellular domain of FGFR2 (A) and FGFR3 (B) adsorbed to
maxisorb plate was done as described under materials and methods.
Binding results were analyzed by Scatchard analysis (inserts).
[0030] FIG. 7--Heparin dependent cross-linking of FGF9 to FGFR3
expressing CHO cells. Monolayers of FGFR3 transfected KI and A745
CHO cells were incubated at 40.degree. C. with 5 ng/ml
.sup.125I-FGF9 in the presence or absence of 1 mg/ml heparin and
100-fold excess of unlabeled FGF9 (Ex. cold) as indicated.
Cross-linking and electrophoresis separation were done as described
under materials and methods.
[0031] FIG. 8--Heparin and heparin fragments dependent FGF9 induced
DNA synthesis. Monolayers of FGFR3 transfected CHO-A745 cells were
serum starved and incubated with 10 ng/ml FGF9 and the indicated
amount of heparin (A) or 2 mg/ml of heparin fragment (B) at the
indicated number of monosaccharide units.
[0032] FIG. 9--Plasmid of FGF9 under control of collagen type-2
promoter.
DETAILED DESCRIPTION OF THE INVENTION
[0033] I. Materials and Methods
[0034] (a) Cells.
[0035] Wild type (KI) and the CHO mutant cell line A745 kindly
provided by Dr. J. D. Esko (Dept. of Biochemistry, University of
Birmingham, Ala.) were cultured in F12 medium supplemented with 10%
Fetal Calf Serum. Transfection of CHO cells with 10 .mu.g FGFR3 in
pZL plasmid that contain neomycin resistance, was done by
electroporation with Gene Pulcer (Bio-Rad) at 960 micro farads and
250 volt. Individual stable clones were selected with G418 (0.5
mg/ml).
[0036] (b) Antibodies
[0037] Polyclonal anti FGF9 antibodies were generated by injecting
New Zealand white rabbits and collecting serum after two additional
boosts. Anti FGF9 antibodies were prepared against two peptides
(SP3.1: Cys-Ser-Asn-Leu-Tyr-Lys-His-Val-Gln-Thr-Gly-Arg-Arg-Tyr,
SP32: Asp-His-Leu-Lys-Gly-Ile-Leu-Arg-Arg-Arg-Gln-Leu-Tyr-Cys)
coupled to KLH (keyhole lympet hemocyanin) by MBS. Serum obtained
was further purified on protein A sepharose (Repligen) to obtain
the IgG fraction.
[0038] (c) Radiolabeling of FGF9
[0039] Recombinant murine FGF9 was labeled with Na.sup.125I (0.5
mCi) using the Chloramine-T method and separated from free iodine
on a heparin-sepharose column. The range of specific activity was
0.5-2.times.10.sup.5 cpm/ng.
EXAMPLE 1
Cloning and Expression of the Mouse Homologue of FGF9
[0040] Total RNA extracted from a 12.5 day old mouse embryo was
used for polymerase chain reaction (PCR) based cloning of FGF9.
Primer specific for the human FGF9 (forward:
GGGAATTCCATATGGCTCCCTTAGGTGAAG; backward:
CGGGATCCTCAACFTTGGCTTAGAATATCC) were used for PCR using as a
template mouse RNA. (35 cycles of denaturation 1 min at 94.degree.
C., annealing 2 min at 56.degree. C. elongation 3 min at 72.degree.
C.). A single DNA product with an expected size of 630 bp was
obtained and was used directly for subcloning into pET-3C bacterial
expression vector (Novagene).
[0041] Sequence analysis reveals the expected 627 bp long
transcript (FIG. 1) with 93% identity to the human FGF9 cDNA. The
FGF9:pET-3C plasmid was used to transform B1-21 strain of E. coli.
At logarithmic growth phase the transformed bacteria were induced
with 1 mM IPTG for 2 hours, precipitated by centrifugation at 7000
RPM and sonicated 3.times.15" using probe sonicator (Soniprep150,
MSE) on ice. The supernatant obtained by centrifugation of the
bacterial sonicate was loaded onto a heparin-sepharose column
(Pharmacia, Upsala, Sweden) and the column was washed extensively
with 10 column volumes of 0.15 M NaCl, 0.05% Chaps, 20 mM Tris pH
7.4, and 10 column volumes of 0.7 M NaCl, 0.05% Chaps, 20 mM Tris
pH 7.4. The bound proteins were then eluted with 0.5 ml fractions
of 2 M NaCl, 0.05% Chaps, 10 mM Tris pH 7.4, diluted 1:10 with
H.sub.2O and reloaded on a pre-equilibrated 1 ml heparin-sepharose
mini FPLC column (Pharmacia, Upsala, Sweden). After extensive wash
the column was eluted with a continuous 0.2-2 M NaCl gradient and
the protein profile determined by adsorbance at 280 nM. The
fractions were tested for biological activity measured as
3H-thymidine incorporation into BALB/c-3T3 fibroblasts and for
specificity by Western blot using polyclonal antibodies generated
in rabbits against FGF9 specific peptides. A major protein band at
the expected molecular weight of 27 kDal was obtained that reacted
specifically with two different anti-peptide antibodies specific
for FGF9.
[0042] Mouse FGF9 (mFGF9) was cloned by PCR on cDNA prepared from
12.5 days mouse embryos RNA. Mouse FGF9 cDNA shares 93 and 98%
sequence homology with human and rat FGF9 respectively (FIGS.
3A-3C). The amino acid sequence of mFGF9 is identical to that of
the rat FGF9 and differs from human FGF9 in one amino acid only
having a serine at position 9 instead of an asparagine. Recombinant
mouse-FGF9 was expressed in B1-21 strain of E. coli and purified
from the bacteria lysate by two cycles on a heparin-sepharose
column. FGF9 elutes from heparin sepharose with 1.0-1.2 M NaCl as
determined by adsorbance at 280 nM (FIG. 4A). The presence of FGF9
in the fractions was tested by an immunoblot using polyclonal
antibodies directed against FGF9 specific peptides, demonstrating a
major protein band at the expected molecular weight for a
non-glycosylated protein of 27 kDal (FIG. 4B). The purity of each
preparation was further assessed by silver stain (FIG. 4C).
Recombinant mouse FGF9 is biologically active and stimulates DNA
synthesis in BALB/C 3T3 fibroblasts, in a dose dependent manner,
with half maximal 3H-Thymidine incorporation at 0.5 ng/ml (not
shown), similar to that obtained for purified human FGF9 (Nauro, et
al., J. Biol. Chem., 267:16305-16311 (1993)).
EXAMPLE 2
Cloning and Expression of the Chicken Homologue of FGF9
[0043] Cloning and expression of chicken homologue of FGF9 was
conducted as described in Example 1 with chicken-derived mRNA.
EXAMPLE 3
Cell Free Binding Assays
[0044] The extracellular region of murine FGFR1, FGFR2,
keratinocyte growth factor receptor (KGFR) and the two isoforms of
FGFR3 in the alkaline phosphatase-expression vector were previously
described (Givol D. and Yayon A., Adv. Cancer Res. 160, 1-41
(1993); (Lev et al, J. Biol. Chem., 267, 15970-15977 (1992)).
FGFR-alkaline phosphatase fusion proteins were collected from
conditioned medium of transfected NIH 3T3 cells and used directly
for binding assays. Receptor protein content was estimated by
alkaline phosphatase activity which was monitored
spectro-photometrically at 405 nm using para-nitrophenyl phosphate
as a substrate, essentially as described (Lev et al., supra). The
soluble receptor binding reaction mixture included receptor-AP
conditioned medium, radiolabeled ligand and heparin or other HSPGs.
The bound complex was immunoprecipitated with anti-alkaline
phosphatase polyclonal antibodies (Zymed) and protein A-Sepharose
(Repligen). All components are mixed at room temperature in a total
volume of 250 ml of binding buffer (DMEM supplemented with 25 mM
Hepes pH 7.4 and 0.1% bovine serum albumin). The binding reaction
was allowed to proceed for 2 h at room temperature. Bound ligand
was recovered by centrifuging for 10 s at 6000 rpm in a
microcentrifuge (-2000 g) and washing three times with a solution
of 150 nM NaCl, 0.1% Triton-X-100 and 50 mM Hepes pH 7.4 (HNTG).
.sup.125I-bound factor was determined by counting the tubes
directly in a gamma-counter. For cross-linking, after washing 0.15
mM disuccinimidyl suberate (DSS) or 1 mM
Bis(sulfosuccinimidyl)suberate (BS3) was added in phosphate
buffered saline (PBS) for 30 min at room temperature. The complexes
were washed twice with PBS, and boiled for 5 min with sample
buffer. The samples were separated by electroporation under
reducing conditions on SDS-polyacrylamide gel, the gel was dried
and exposed to Kodak (Eastman Kodak Co., Rochester, N.Y.) X-Omat AR
film.
[0045] Alternatively, 96-well maxisorb plates (Nunk) pre-coated
overnight with monoclonal anti-human placental alkaline phosphatase
antibodies (Sigma Chemicals, Israel) were reacted with receptor-AP
fusion proteins for 2 h at room temperature. After washing with
binding buffer, plates were incubated for 2 h at room temperature
with different concentrations of .sup.125I-labeled FGF9 in the
presence or absence of heparin. At the end of the incubation time,
the plates were washed twice with binding buffer, and eluted with
1.6 M NaCl in 20 mM sodium acetate pH 4.5. The acid extract was
counted in a gamma counter.
[0046] In order to elucidate the receptor binding properties of
FGF9, use was made of a series of FGF receptors' ectodomains
coupled to human placental alkaline phosphatase. As was previously
demonstrated, soluble ectodomains of FGF receptors can successfully
and specifically interact with the ligands, thereby providing an
excellent tool for the analysis of ligand-receptor specificity
(Rimion, D. L, Prof. Clin. Biol. Res. 187, 131-140 (1985), Lev et
al, supra). The interaction between FGF9 and the soluble receptors
was first analyzed with FGF9 immobilized on heparin-sepharose and
measurement of the associated alkaline phosphatase activity.
Heparin-sepharose immobilized FGF9 binds FGFR2 and FGFR3 fusion
proteins but not FGFR1 or FGFR4 (FIG. 5A). Only the IIIe isoforms
of FGFR2 and FGFR3 bind FGF9, while the IIIb isoforms of these
receptors do not show any specific binding to FGF9. The interaction
of FGF9 with the soluble receptors was further analyzed by direct
binding and covalent cross-linking of radiolabeled FGF9 (FIG. 5B).
In the presence of 0.5 mg/ml heparin, FGF9 binds only to FGFR2 and
FGFR3 but not to FGFR1 or FGFR4 and not to any of the IIIb spliced
isoforms tested. No significant binding is observed without
heparin, indicating its obligatory role in high affinity
FGF9-receptor binding. The two covalently linked complexes of FGF9
with FGFR2 and FGFR3 correspond most probably to the monomer and
dimer forms of the receptor-ligand complex. Affinity labeling of
soluble FGFR2 and FGFR3 proteins by .sup.125I-FGF9 is abolished in
the presence of a 100 fold molar excess of unlabeled ligand,
indicating that binding and labeling of these receptors is
specific.
[0047] To quantitatively characterize the binding of FGF9 to FGFR2
and FGFR3, direct binding analysis of radiolabeled FGF9 to the
soluble receptors was performed. Binding of FGF9 to both receptors
is specific and saturable (FIGS. 6A and 6B). Analyzing the results
by Scatchard analysis (FIG. 6, inserts) indicate a dissociation
constant of 2.38 nM for binding of FGFR2 and 0.78 nM for the
interaction of FGF9 with FGFR3. Two additional experiments yield
very similar results. Within every single experiment the affinity
for FGFR2 was about 3-fold lower compared to that for FGFR3. The
binding of FGF9 to FGFR1 was neither significant nor specific (not
shown).
EXAMPLE 4
High Affinity Binding and Cross-Linking of FGF9 to Cell Surface
Receptors
[0048] Confluent cultures in 24 wells dishes (Nunk) were pre-cooled
to 4.degree. C. and washed twice with binding buffer. Subsequently
they were incubated for 2 h at 4.degree. C. with different
concentrations of .sup.125I-FGF9 in binding buffer in the presence
or absence of heparin. The binding medium was discarded, and the
cells were washed twice with binding buffer and once with 0.5 M
NaCl in 25 mM Hepes pH 7.5. High affinity bound factor was
determined by cluting the bound factor with 1.6 M NaCl in 20 mM
sodium acetate pH 4.5 and counting in a gamma counter. Nonspecific
binding was considered as the value obtained for high affinity
binding in the presence of a 100-fold excess of non-labeled factor.
For cross-linking, the binding was done in PBS and after 1 h
incubation, DSS was added to a final concentration of 0.15 M for 1
h more. The cells were washed twice with PBS, scraped, and lysed in
a small volume of lysis buffer containing 150 mM NaCl, 20 mM Tris
(pH 8.0), 1 mM MgCl.sub.2, 0.1 mM ZnCl.sub.2, 0.5% NP-40, 1 mg of
aprotinin, 1 mg/ml leupeptin, and 2 mM PMSF. The cell lysates,
clarified by centrifugation, were boiled and electrophorated under
reducing conditions on SDS-polyacrylamide gel.
[0049] As mentioned above, the binding of FGF9 to both FGFR2 and
FGFR3 is strictly dependent on the presence of heparin. To compare
the specific demands for heparin in FGF9 binding to each receptor,
we first measured the heparin required for binding of FGF9 to
soluble FGFR3 and FGFR2. In cross-linking experiments only faint
complexes are observed without the addition of heparin to either
FGFR2 or FGFR3. However, at increasing heparin concentrations a
marked difference in the requirement for heparin the two receptors
is observed.
[0050] The soluble extracellular domains of FGFR2 and FGFR3 coupled
to alkaline phosphatase, were immunoprecipitated with anti-alkaline
phosphatase antibodies, and incubated with 5 ng/ml .sup.125I-FGF9
and increasing concentrations of heparin. Cross-linking and
electrophoresis separation were done as described under Example 3.
The amount of FGF9 bound to FGFR2 (FIG. 3A) and FGFR3 (FIG. 5B) was
quantitated by densitometry analysis.
[0051] Binding of FGF9 to FGFR2 is very sensitive to heparin and
addition of as little as 0.5 ng/ml heparin causes an apparent
increase in binding, with maximal receptor binding at around 5
ng/ml. Binding of FGF9 to FGFR3 however, requires about 20-fold
higher levels of free heparin, with maximal receptor binding only
at around 100 ng/ml heparin, and with a slight inhibition of
binding at heparin concentrations above 500 ng/ml.
[0052] A difference in the heparin levels required for FGF9 binding
to either FGFR2 or FGFR3, might indicate that a more specific
heparin structure, which comprises a relatively minor fraction of
the heparin mixture which was used, is required for FGFR3 binding.
To study structural requirements of heparin for promoting FGF9
binding, we analyzed the effects of a series of heparin fragments
ranging in size from 4 to 18 monosaccharide units, on FGF9 binding
to the soluble ectodomains of FGFR2 and FGFR3.
[0053] In order to address the physiological relevance of the in
vitro observed high affinity, heparin-dependent interaction of FGF9
with FGFR3, a full length mouse FGFR3 was expressed in wild type
(KI) and heparan-sulfate deficient mutant (745 pgs) CHO cells,
known to express low levels of endogenous FGFRs (Yayon, A., et al.,
Cell, 64:841-848 (1991). Whereas untransfected cells displayed
neither detectable binding of radiolabeled FGF9 nor covalently
cross-linked proteins, FGFR3 transfected CHO-KI cells show a
protein band of a 145 kDal, corresponding to a monomer of
receptor-FGF9 complex (FIG. 7). As expected, binding and
cross-linking of .sup.125I-FGF9 to wild type CHO-KI cells
expressing FGFR3 is not affected by exogenous heparin. There is
however no detectably, cross-linking of FGF9 to the mutant HS
defficient CHO-745 cells expressing FGFR3 in the absence of heparin
(FIG. 7), supporting the notion that heparin-like molecules are
required for efficient high affinity interaction of FGF9. Upon the
addition of heparin affinity labeling of the 745-FGFR3 cells with
.sup.125I-FGF9 is prominent and indistinguishable from that of wild
type cells, indicating that heparin can support high affinity
binding of FGF9 to FGFR3. The binding to both kinds of cells was
specific and saturable (in the presence of 1 mg/ml heparin) with kD
of 0.06 and 0.1 nM for CHO-KI and CHO 745 cells respectively. A
typical heparin dose dependent increase in FGF9 binding to CHO
745-FGFR3 transfected cells was obtained, with maximal specific
binding at around 500 ng/ml of heparin (data not shown).
EXAMPLE 5
DNA Synthesis Assay
[0054] Thymidine incorporation into CHO cells was measured using
confluent cultures grown in 24 well plates, in F12 medium
supplemented with 10% fetal calf serum. The cells were starved for
24 h with no serum and then incubated with or without various
concentrations of FGF9 or 10% serum as a control for an additional
14 h, after which 3H-Thymidine (0.5 mCi/ml) was added for
additional 2 h. At the end of the incubation, the cells were washed
twice with cold PBS, fixed for 20 min with ice-cold 5%
trichloroacetic acid, washed with 95% ethanol and dissolved in 0.1
M NaOH. DNA associated radioactivity was measured by liquid
scintillation counting.
[0055] To test whether activation of FGFR3 may also require
heparin, we investigated the requirement for heparin for FGF9
induced DNA synthesis in FGFR3 expressing HS-defficient CHO 745
cells. Without exogenous heparin no significant increase in
3H-Thymidine incorporation by FGF9 is observed (FIG. 5A), in
agreement with the lack of receptor binding and similar to the
strict heparin requirement for other FGFs investigated so far.
Addition of heparin at low concentrations markedly stimulated FGF9
dependent DNA synthesis and in a dose dependent manner with half
maximal and maximal effects at 100 ng/ml and 2 mg/ml respectively.
Heparin alone had no effect on DNA synthesis and FGF9 induced DNA
synthesis in CHO-KI is independent of exogenous heparin (not
shown).
[0056] To study structural requirements of heparin for promoting
FGF9 binding, we analyzed the effects of a series of heparin
fragments ranging in size from 6 to 18 monosaccharide units, on
FGF9 induced DNA synthesis. While a 6 mer heparin fragment
inhibited the effect of FGF9, induction of DNA synthesis is
observed with 8-10 mer fragments with maximal effect of FGF9 in the
presence of 14-16 mer heparin fragments (FIG. 8B). These results
indicate that a specific heparin size is required for activation of
FGFR3 by FGF9.
EXAMPLE 6
Plasmid Construct for the Expression of FGF9
[0057] For the expression of recombinant FGF9, the mouse FGF9 cDNA
was sub-cloned using the Ndel/BamH sites of the bacterial
expression vector pET-3C. After transformation of BL-21 cells and
induction with 1 mM of IPTG, the cells were lysed and FGF9 was
purified on a heparin-sepharose column.
[0058] Full length mouse FGF9 cDNA was subcloned downstream of a
splice acceptor site from the collagen IIA1 gene following the
collagen IIA1 promoter and cartilage specific enhancer. This
construct was linearized and used for injection into fertilized
mice eggs for the generation of transgenic mice.
EXAMPLE 7
Transgenic Animal with Over Expression of FGF9
[0059] Transgenic mice transformed by the vector as described above
feature an over-expression of FGF9. The phenotype of these
transgenic mice is very similar to that of transgenic mice with
FGFR3-Ach mutation (having the FGFR3 mutation of achondroplasia)
characterized by an exceptionally small body size with a short tail
and short hindlimbs. Such transgenic mice may serve as a model for
various types of dwarfism as well as a model for abnormalities
resulting from an excess of FGF9.
Sequence CWU 1
1
13 1 682 DNA Mus pahari 1 acaacggttt ccctctagaa ataattttgt
ttaactttaa gaaggagata tacatatggc 60 tcccttaggt gaagttggga
gctatttcgg tgtgcaggac gcggtaccgt tcgggaacgt 120 accggtgttg
ccggtggaca gtccggtgtt gctaagtgac cacctgggtc agtccgaagc 180
aggggggctg ccccggggcc ccgcagtcac ggacttggat catttaaagg ggattctcag
240 gcggaggcag ctgtactgca ggactggatt tcatttagag atcttcccca
acggtactat 300 ccagggaacc aggaaagacc acagccgctt cggcattctg
gaatttatca gtatagcagt 360 gggcctggtc agcattcgcg gtgtggacag
tggactctac ctcggcatga acgagaaggg 420 ggagctgtat ggatcagaaa
aactaacaca ggaatgtgtg ttcagagaac agtttgaaga 480 gaactggtac
aacacctact cttccaacct ctataaacat gtggacaccg gaaggagata 540
ctatgttgca ttaaataagg acgggactcc aagagaaggg accaggacta aacggcacca
600 gaaatttaca cattttttac ctagaccagt ggaccctgac aaagtacctg
aactatataa 660 ggatattcta agccaaagtt ga 682 2 627 DNA Mus pahari 2
atggctccct taggtgaagt tgggagctat ttcggtgtgc aggacgcggt accgttcggg
60 aacgtaccgg tgttgccggt ggacagtccg gtgttgctaa gtgaccacct
gggtcagtcc 120 gaagcagggg ggctgccccg gggccccgca gtcacggact
tggatcattt aaaggggatt 180 ctcaggcgga ggcagctgta ctgcaggact
ggatttcatt tagagatctt ccccaacggt 240 actatccagg gaaccaggaa
agaccacagc cgcttcggca ttctggaatt tatcagtata 300 gcagtgggcc
tggtcagcat tcgcggtgtg gacagtggac tctacctcgg catgaacgag 360
aagggggagc tgtatggatc agaaaaacta acacaggaat gtgtgttcag agaacagttt
420 gaagagaact ggtacaacac ctactcttcc aacctctata aacatgtgga
caccggaagg 480 agatactatg ttgcattaaa taaggacggg actccaagag
aagggaccag gactaaacgg 540 caccagaaat ttacacattt tttacctaga
ccagtggacc ctgacaaagt acctgaacta 600 tataaggata ttctaagcca aagttga
627 3 208 PRT Mus pahari 3 Met Ala Pro Leu Gly Glu Val Gly Ser Tyr
Phe Gly Val Gln Asp Ala 1 5 10 15 Val Pro Phe Gly Asn Val Pro Val
Leu Pro Val Asp Ser Pro Val Leu 20 25 30 Leu Ser Asp His Leu Gly
Gln Ser Glu Ala Gly Gly Leu Pro Arg Gly 35 40 45 Pro Ala Val Thr
Asp Leu Asp His Leu Lys Gly Ile Leu Arg Arg Arg 50 55 60 Gln Leu
Tyr Cys Arg Thr Gly Phe His Leu Glu Ile Phe Pro Asn Gly 65 70 75 80
Thr Ile Gln Gly Thr Arg Lys Asp His Ser Arg Phe Gly Ile Leu Glu 85
90 95 Phe Ile Ser Ile Ala Val Gly Leu Val Ser Ile Arg Gly Val Asp
Ser 100 105 110 Gly Leu Tyr Leu Gly Met Asn Glu Lys Gly Glu Leu Tyr
Gly Ser Glu 115 120 125 Lys Leu Thr Gln Glu Cys Val Phe Arg Glu Gln
Phe Glu Glu Asn Trp 130 135 140 Tyr Asn Thr Tyr Ser Ser Asn Leu Tyr
Lys His Val Asp Thr Gly Arg 145 150 155 160 Arg Tyr Tyr Val Ala Leu
Asn Lys Asp Gly Thr Pro Arg Glu Gly Thr 165 170 175 Arg Thr Lys Arg
His Gln Lys Phe Thr His Phe Leu Pro Arg Pro Val 180 185 190 Asp Pro
Asp Lys Val Pro Glu Leu Tyr Lys Asp Ile Leu Ser Gln Ser 195 200 205
4 660 DNA Gallus domesticus 4 ccgcgggatt gggaattcca tatggctccc
ttaggtgaag tcgggaacta tttcggtgtg 60 caggacgcgg tgccctttgg
gaacgtgccc gcgctgccgg cggacagccc ggttttgctc 120 agtgaccacc
tgggccaggc tgaggcaggt gggctgccca ggggccccgc ggtcacggac 180
ttggaccatt taaaggggat cctcaggagg aggcagcttt actgcaggac tggatttcat
240 ttagaaatct tccccaatgg tactatccag ggcaccaggc aagaccacag
ccgattcggt 300 atactggagt tcatcagtat agcagtgggc ctggtcagca
tccgaggagt agacagcgga 360 ctctaccttg gaatgaatga gaaaggggag
ctctacggct cggaaaaatt aacccaggag 420 tgtgtattca gagagcagtt
tgaagaaaac tggtataaca catattcatc aaatctatat 480 aaacacgtgg
acactggaag acgatactac gtggcgttaa ataaagatgg aactccaaga 540
gaagggacta ggactaaacg gcatcaaaaa tttacacatt tttcacctag accagtggac
600 cctgagaaag tacctgaact atataaggat attctaagcc aaagttgagg
atcccgaatc 660 5 220 PRT Gallus domesticus VARIANT (1)...(220) Xaa
= Any Amino Acid 5 Pro Arg Asp Trp Glu Phe His Met Ala Pro Leu Gly
Glu Val Gly Asn 1 5 10 15 Tyr Phe Gly Val Gln Asp Ala Val Pro Phe
Gly Asn Val Pro Ala Leu 20 25 30 Pro Ala Asp Ser Pro Val Leu Leu
Ser Asp His Leu Gly Gln Ala Glu 35 40 45 Ala Gly Gly Leu Pro Arg
Gly Pro Ala Val Thr Asp Leu Asp His Leu 50 55 60 Lys Gly Ile Leu
Arg Arg Arg Gln Leu Tyr Cys Arg Thr Gly Phe His 65 70 75 80 Leu Glu
Ile Phe Pro Asn Gly Thr Ile Gln Gly Thr Arg Gln Asp His 85 90 95
Ser Arg Phe Gly Ile Leu Glu Phe Ile Ser Ile Ala Val Gly Leu Val 100
105 110 Ser Ile Arg Gly Val Asp Ser Gly Leu Tyr Leu Gly Met Asn Glu
Lys 115 120 125 Gly Glu Leu Tyr Gly Ser Glu Lys Leu Thr Gln Glu Cys
Val Phe Arg 130 135 140 Glu Gln Phe Glu Glu Asn Trp Tyr Asn Thr Tyr
Ser Ser Asn Leu Tyr 145 150 155 160 Lys His Val Asp Thr Gly Arg Arg
Tyr Tyr Val Ala Leu Asn Lys Asp 165 170 175 Gly Thr Pro Arg Glu Gly
Thr Arg Thr Lys Arg His Gln Lys Phe Thr 180 185 190 His Phe Ser Pro
Arg Pro Val Asp Pro Glu Lys Val Pro Glu Leu Tyr 195 200 205 Lys Asp
Ile Leu Ser Gln Ser Xaa Gly Ser Arg Ile 210 215 220 6 14 PRT
Artificial Sequence Synthetically generated peptide 6 Cys Ser Asn
Leu Tyr Lys His Val Gln Thr Gly Arg Arg Tyr 1 5 10 7 14 PRT Mus
pahari 7 Asp His Leu Lys Gly Ile Leu Arg Arg Arg Gln Leu Tyr Cys 1
5 10 8 30 DNA Artificial Sequence Primer 8 gggaattcca tatggctccc
ttaggtgaag 30 9 30 DNA Artificial Sequence Primer 9 cgggatcctc
aactttggct tagaatatcc 30 10 208 PRT Rattus norvegicus 10 Met Ala
Pro Leu Gly Glu Val Gly Ser Tyr Phe Gly Val Gln Asp Ala 1 5 10 15
Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu 20
25 30 Leu Ser Asp His Leu Gly Gln Ser Glu Ala Gly Gly Leu Pro Arg
Gly 35 40 45 Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly Ile Leu
Arg Arg Arg 50 55 60 Gln Leu Tyr Cys Arg Thr Gly Phe His Leu Glu
Ile Phe Pro Asn Gly 65 70 75 80 Thr Ile Gln Gly Thr Arg Lys Asp His
Ser Arg Phe Gly Ile Leu Glu 85 90 95 Phe Ile Ser Ile Ala Val Gly
Leu Val Ser Ile Arg Gly Val Asp Ser 100 105 110 Gly Leu Tyr Leu Gly
Met Asn Glu Lys Gly Glu Leu Tyr Gly Ser Glu 115 120 125 Lys Leu Thr
Gln Glu Cys Val Phe Arg Glu Gln Phe Glu Glu Asn Trp 130 135 140 Tyr
Asn Thr Tyr Ser Ser Asn Leu Tyr Lys His Val Asp Thr Gly Arg 145 150
155 160 Arg Tyr Tyr Val Ala Leu Asn Lys Asp Gly Thr Pro Arg Glu Gly
Thr 165 170 175 Arg Thr Lys Arg His Gln Lys Phe Thr His Phe Leu Pro
Arg Pro Val 180 185 190 Asp Pro Asp Lys Val Pro Glu Leu Tyr Lys Asp
Ile Leu Ser Gln Ser 195 200 205 11 208 PRT Homo sapiens 11 Met Ala
Pro Leu Gly Glu Val Gly Asn Tyr Phe Gly Val Gln Asp Ala 1 5 10 15
Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu 20
25 30 Leu Ser Asp His Leu Gly Gln Ser Glu Ala Gly Gly Leu Pro Arg
Gly 35 40 45 Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly Ile Leu
Arg Arg Arg 50 55 60 Gln Leu Tyr Cys Arg Thr Gly Phe His Leu Glu
Ile Phe Pro Asn Gly 65 70 75 80 Thr Ile Gln Gly Thr Arg Lys Asp His
Ser Arg Phe Gly Ile Leu Glu 85 90 95 Phe Ile Ser Ile Ala Val Gly
Leu Val Ser Ile Arg Gly Val Asp Ser 100 105 110 Gly Leu Tyr Leu Gly
Met Asn Glu Lys Gly Glu Leu Tyr Gly Ser Glu 115 120 125 Lys Leu Thr
Gln Glu Cys Val Phe Arg Glu Gln Phe Glu Glu Asn Trp 130 135 140 Tyr
Asn Thr Tyr Ser Ser Asn Leu Tyr Lys His Val Asp Thr Gly Arg 145 150
155 160 Arg Tyr Tyr Val Ala Leu Asn Lys Asp Gly Thr Pro Arg Glu Gly
Thr 165 170 175 Arg Thr Lys Arg His Gln Lys Phe Thr His Phe Leu Pro
Arg Pro Val 180 185 190 Asp Pro Asp Lys Val Pro Glu Leu Tyr Lys Asp
Ile Leu Ser Gln Ser 195 200 205 12 627 DNA Rattus norvegicus 12
atggctccct taggtgaagt tgggagctat ttcggtgtgc aggacgcggt accgttcggg
60 aacgtaccgg tgttgccggt ggacagtccg gtgttgctaa gtgaccacct
gggtcagtcc 120 gaagcagggg ggctgccccg gggacccgca gtcacggact
tggatcattt aaaggggatt 180 ctcaggcgga ggcagctgta ctgcaggact
ggatttcact tagaaatctt ccccaacggt 240 actatccagg gaaccaggaa
agaccacagc cgattcggca ttctggaatt tatcagtata 300 gcagtgggcc
tggtcagcat tcgtggtgtg gacagtggac tctacctcgg catgaacgag 360
aagggggagc tgtatggatc agaaaaacta acacaggagt gcgtgttcag agaacagttt
420 gaagaaaact ggtacaacac ctactcttcc aacctgtaca agcacgtgga
caccggaagg 480 agatactatg ttgcattaaa taaggatggg actccaagag
aagggaccag gactaaacgg 540 caccagaaat ttacacattt tttacctaga
ccagtggacc ctgacaaagt acctgaacta 600 tataaggata ttctaagcca aagttga
627 13 627 DNA Homo sapiens 13 atggctccct taggtgaagt tgggaactat
ttcggtgtgc aggatgcggt accgtttggg 60 aatgtgcccg tgttgccggt
ggacagcccg gttttgttaa gtgaccacct gggtcagtcc 120 gaagcagggg
ggctccccag gggacccgca gtcacggact tggatcattt aaaggggatt 180
ctcaggcgga ggcagctata ctgcaggact ggatttcact tagaaatctt ccccaatggt
240 actatccagg gaaccaggaa agaccacagc cgatttggca ttctggaatt
tatcagtata 300 gcagtgggcc tggtcagcat tcgaggcgtg gacagtggac
tctacctcgg gatgaatgag 360 aagggggagc tgtatggatc agaaaaacta
acccaagagt gtgtattcag agaacagttc 420 gaagagaact ggtataatac
gtactcgtca aacctatata agcacgtgga cactggaagg 480 cgatactatg
ttgcattaaa taaagatggg accccgagag aagggactag gactaaacgg 540
caccagaaat tcacacattt tttacctaga ccagtggacc ccgacaaagt acctgaactg
600 tataaggata ttctaagcca aagttga 627
* * * * *