U.S. patent application number 09/416579 was filed with the patent office on 2002-12-19 for deoxynucleoside kinase from insect cells for the synthesis of nucleoside monophosphates.
Invention is credited to IHLENFELDT, HANS-GEORG, MUNCH-PETERSEN, BRIGITTE, PISKUR, JURE, SONDERGAARD, LEIF.
Application Number | 20020192788 09/416579 |
Document ID | / |
Family ID | 26049448 |
Filed Date | 2002-12-19 |
United States Patent
Application |
20020192788 |
Kind Code |
A1 |
IHLENFELDT, HANS-GEORG ; et
al. |
December 19, 2002 |
DEOXYNUCLEOSIDE KINASE FROM INSECT CELLS FOR THE SYNTHESIS OF
NUCLEOSIDE MONOPHOSPHATES
Abstract
Recombinant kinase remaining stable during the synthesis of
nucleoside monophosphate without the addition of stabilizing SH
reagents, without stabilizing proteins and accepting all four
natural deoxynucleotides, obtainable from insect cells such as e.g.
Drosophila Melanogaster. In addition, the invention concerns DNA
sequences, vectors, transformed cells, a method for production of
the recombinant kinase as well as its use for preparing nucleoside
monophosphates.
Inventors: |
IHLENFELDT, HANS-GEORG;
(IFFELDORF, DE) ; MUNCH-PETERSEN, BRIGITTE;
(FARUM, DK) ; PISKUR, JURE; (COPENHAGEN, DK)
; SONDERGAARD, LEIF; (GENTOFTE, DK) |
Correspondence
Address: |
KENNETH J. WAITE
ROCHE DIAGNOSTICS CORPORATION
9115 HAGUE ROAD BLDG D
P O BOX 50457
INDIANAPOLIS
IN
46250-0457
US
|
Family ID: |
26049448 |
Appl. No.: |
09/416579 |
Filed: |
October 12, 1999 |
Current U.S.
Class: |
435/194 ;
435/320.1; 435/325; 435/69.1; 514/7.5; 536/23.2 |
Current CPC
Class: |
C12N 9/1205
20130101 |
Class at
Publication: |
435/194 ;
435/69.1; 435/320.1; 435/325; 514/12; 536/23.2 |
International
Class: |
C12N 009/12 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 12, 1998 |
DE |
198 46 838.5 |
Mar 31, 1999 |
DE |
199 14 644.6 |
Claims
1. Recombinant kinase remaining stable during the synthesis of
nucleoside monophosphate without the addition of stabilizing SH
reagents, without stabilizing proteins and accepting all four
natural deoxynucleosides, obtainable from cells of nonvertebrate
organisms.
2. Recombinant kinase as claimed in claim 1 obtainable from insect
cells.
3. Recombinant kinase as claimed in claim 1 or 2 showing--in a
purified form--a specific activity of at least 20 U/mg (1U=1
.mu.mol/min) for all 4 natural deoxynucleosides.
4. Recombinant kinase as claimed in one of the claims 1 to 3
showing a specificity constant k.sub.c/K.sub.m of >10000
M.sup.-1 s.sup.-1 for all natural deoxynucleosides.
5. Recombinant kinase as claimed in one of the claims 1 to 4 where
the kinase has a half-life of t.sub.1/2.gtoreq.50 h in Tris buffer
with 5 mM MgCl.sub.2 and of t.sub.1/2.gtoreq.25 h in water at
37.degree. C.
6. Recombinant kinase as claimed in one of the claims 1 to 5
showing a wide temperature optimum between 40 and 60.degree. C.
7. Recombinant kinase as claimed in one of the claims 1 to 6,
obtainable from Drosophila Melanogaster.
8. DNA sequence encoding a kinase from Drosophila Melanogaster as
claimed in one of the claims 1 to 7.
9. DNA sequence as claimed in claim 8 wherein primers with the
sequences SEQ ID No. 2--8 hybridize onto this DNA sequence.
10. Vector containing the DNA sequence as claimed in claim 8 or 9
and a promoter.
11. Host transformed with a vector as claimed in claim 10.
12. Method for production of a recombinant kinase as claimed in one
of the claims 1 to 7, wherein the following steps are performed: 1)
isolation of the coding sequence of Dm-dNK, 2) cloning of the
structure gene in preferred expression vectors for E. coli with
inducible promoters, 3) transformation of the expression vectors in
preferred E. coli host strains and 4) expression of the Dm-dNK gene
in E. coli by appropriate induction.
13. Use of a recombinant kinase obtainable from Drosophila
Melanogaster as claimed in one of the claims 1 to 7 for the
synthesis of the nucleoside monophosphate.
14. Method for production of a nucleoside monophosphate wherein a
recombinant kinase as claimed in claims 1 to 7 is used for the
phosphorylation of a nucleoside.
Description
[0001] The subject of the present invention is a recombinant kinase
from insect cells such as e.g. Drosophila Melanogaster, remaining
stable during the synthesis of nucleoside monophosphates without
the addition of stabilizing SH reagents, without stabilizing
proteins and detergents and accepting all four natural
deoxynucleosides. A further subject matter of the present invention
is a DNA sequence encoding the kinase according to the invention as
well as a procedure for preparation of the kinase according to the
invention and its use during the synthesis of nucleoside
monophosphates.
[0002] (Deoxy)-nucleoside kinases catalyze the phosphorylation of
nucleosides or deoxynucleosides, respectively, to the corresponding
nucleotide monophosphates and have therefore an important role in
the "salvage pathway" of the nucleotide metabolism.
[0003] The Catalyzed Reaction is: 1
[0004] The deoxynucleoside monophosphates are starting products for
the deoxynucleoside tri-phosphates which are used to a very
increasing extent as reagents for the PCR reaction.
[0005] The deoxynucleoside monophosphates are at present accessible
by three ways:
[0006] 1. from hydrolysis of fish sperm
[0007] 2. by chemical synthesis from deoxynucleosides
[0008] 3. by enzymatic synthesis from deoxynucleosides.
[0009] The hitherto known methods have a number of disadvantages.
Thus, during the hydrolysis of fish sperm all 4 monophosphates are
produced in about the same quantities; this is a fact that misses
the requirements of the market (e.g. d-UTP, partially used instead
of d-TTP is prepared from d-CTP). In addition, d-TTP, resulting
from hydrolysis, is contaminated with approx. 2% d-UTP and can,
practically, not be isolated.
[0010] Furthermore, the animal origin of the educts has to be
assessed as critical from a regulatory point of view (GMP).
Moreover, the market of monophosphates from fish sperm is very
limited.
[0011] A number of side products are produced during the chemical
synthesis which are difficult to separate by chromatographic
purification. In addition, several bases (e.g. guanosine) must be
provided with protective groups before phosphorylation which
increases the synthesis time considerably.
[0012] The disadvantages of the state of the art were overcome by
the provision of a recombinant multifunctional deoxynucleoside
kinase from insect cells such as in particular Drosophila
melanogaster (Dm-dNK) remaining stable during the synthesis of
nucleoside monophosphates without the addition of stabilizing SH
reagents, without stabilizing proteins and detergents and accepting
all four natural deoxynucleosides: thymidine (dThd), deoxycytidine
(dCyd), deoxyadenosine (dAdo) and deoxyguanosine (dGuo). In the
present invention stable means that the yield rate for the
catalyzed reaction does practically not decrease within 5 hours,
preferably 10 hours, particularly preferably within 12 hours at
37.degree. C. It is surprising that the enzyme remains stable for
such a long time without addition of stabilizers containing thiol.
This stability has not been observed in other kinases until now
(1-9). By leaving out these stabilizers when using the kinase
according to the invention in the synthesis the synthesis gets
cheaper and, above all, the product purification can be simplified
to a great extent.
[0013] Furthermore, hitherto known kinases have a considerably
higher substrate specificity; as a consequence, for the synthesis
of the individual nucleosides it is no more necessary to have the
corresponding specific kinase. Particularly advantageous is the low
specificity for the synthesis of modified nucleoside analogues,
such as dideoxynucleosides or base- or sugar-modified nucleosides.
Base-modified nucleosides are for example 7-deaza-nucleosides,
C-nucleosides and nucleotides labelled with reporter groups (dye,
digoxigenin, biotin) at the base. Sugar-modified nucleosides are
for example azathymidine, arabinosyl-thymidine. The kinetic
constants of the Drosophila kinase compared to known analogous
enzymes are listed in table 1. The specific activity kc of the
kinase according to the invention is several times higher than that
of the kinases known before. The activity of the enzyme was
measured as described in the reference: Munch-Peterson et al.
(1991) J.Biol.Chem. 266, 9032-9038. By this, a considerably lower
amount of enzyme is necessary to synthesize the dNMPs. (factor
3.5--14000, cf. Kc values in table 1). The specificity constant
(k.sub.c/K.sub.M) of the kinase according to the invention exceeds
that of the hitherto known kinases by several powers and is in the
region of the diffusion constant. This leads to the complete yield
when the kinase is added to the d-NMP synthesis. They are higher by
factor 2-6500 than the hitherto known kinases, s. FIG. 1.
[0014] Surprisingly, the enzyme according to the invention is still
stable at 60.degree. C. what is advantageous for the reaction
procedure. Preferably, the enzyme according to the invention has at
T=37.degree. C. a half-life of t.sub.1/2.gtoreq.50 h in Tris buffer
with 5 mM MgCl.sub.2 and t.sub.1/2.gtoreq.25 h in water and accepts
all natural deoxynucleosides (example 6).
[0015] A further subject matter of the invention are kinases from
other non-vertebrate organisms, in particular from other animal
species of the Hexapoda class showing comparable properties to
those of the Drosophila kinase. Particularly such kinases
essentially having the above described stability and the above
described substrate specificity. Peferred kinases are those
isolated from the subclass of Pterygota and particularly preferable
are those from the Diptera class, particularly preferable from the
Drosophilidae family.
[0016] A further subject matter of the invention is a DNA sequence
as well as functional fragments thereof coding for the kinase
according to the invention. The DNA sequence according to the
invention is characterized in that the primers listed in the
following hybridize onto the DNA sequence of the kinase according
to the invention:
1 GGGAAGTGGCAGGAGTAGCTCCCG SEQ ID No.: 2
CTCCCGTTGTAGCCGTCGCCCTTCTGG SEQ ID No.: 3
GACGACTGGCTCGGGCAGCTCTTCACCGCGTTG SEQ ID No.: 4
TTCGATTTTTATTACCTCGCGAGGTAA SEQ ID No.: 5
AGGTAAAAATCGCGAGCGATAACGAAGCAC SEQ ID No.: 6
CACCGCATGCTTGCGTAGGCCGTCGCCCGAGCAAGACTCCTC SEQ ID No.: 7
GACTACATGTTTCTAGGGTTCTTCACC SEQ ID No.: 8
[0017] A further subject matter of the invention are also such
kinases and DNA sequences onto the DNA sequence of which hybridize
oligonucleotides with the SEQ ID No.: 2, 3, 5, 7 and 8 or with the
SEQ ID No.: 2, 4, 5, 7 and 8 or with the SEQ ID No.: 2. 5, 6, 7 and
8.
[0018] The following hybridization conditions are advantageous:
[0019] Hybridization: 0.75 M NaCl, 0.15 Tris, 10 mM EDTA, 0.1%
sodium pyrophosphate, 0.1% SLS, 0.03% BSA, 0.03% Ficoll 400, 0.03%
PVP and 100 .mu.d/ml boiled calf thymus DNA at 50.degree. C. for
approx. 12 hours.
[0020] Washing: 3.times.30 minutes with 0.1.times. SET, 0.1% SDS,
0.1% sodium pyrophosphate and 0.1 M phosphate buffer at 45.degree.
C.
[0021] The kinase sequence according to the invention is given in
FIG. 5, SEQ ID No.: 1.
[0022] The DNA sequence according to the invention is obtainable
from Drosophila Melanogaster by the procedure described in the
following:
[0023] A pBluescript SK +/- phagmide containing a 1.1 kbp cDNA
insert which contains among others the presumed gene coding for the
deoxynucleoside kinase was obtained from the Berkeley Drosophila
genome sequencing project (clone LD15983). The first 600 base pairs
of the 5' end of the 1.1 kbp cDNA cloned via EcoRI and XhoI in the
multiple cloning site (MCS) of the phagmide were already sequenced
by Harvey et al., University of California, Berkeley. Based on
these sequence information new primers were designed (Dm-TK1 and
Dm-TK2/SEQ ID NO.9: 5'TCCCAATCTCACGTGCAGATC-3' and SEQ ID NO 10:
5'-TTCATCGAAGAGTCCATTCAC-3' which enabled complete sequencing of
the insert. Dm-TK1 is a 21 bp sense primer binding upstream from
the presumed translation start region. Dm-TK2 was designed as 21 bp
sense primer according to the 3' region of the cDNA part already
sequenced.
[0024] With this sequence an open reading frame including 750 bp
and coding for a protein with 250 amino acids could be identified.
The DNA sequence SEQ ID NO.1 is depicted in FIG. 5. The calculated
molecular weight of this protein was 29 kDa and corresponds
therefore to the data given by Munch-Peterson et al. 1998
indicating a weight of nearly 30 kDa for native Dm-dNK.
[0025] Starting from the sequence information the structure gene
coding for the Dm-dNK could be isolated from the 1.1 kbp cDNA
insert of the pBluescript SK +/- phagmide by the "polymerase chain
reaction" technique (PCR) (Mullis, K. B. and Faloona, F. A.,
Methods in Enzymol. 155 (1987) 335-350). For this, a specific
primer pair (see SEQ ID NO. 11:
5'-GCGCGAATTCATGGCGGAGGCAGCATCCTGTGC-3' and SEQ ID NO.12:
5'-GCGCAAGCTTATTATCTGGCGACCCTCTGGC-3') with the corresponding
endonuclease restriction site of the later insertion into
appropriate expression plasmids was synthesized. Thus, the
5'-primer (Dm-dNK3) has an EcoRI endonuclease restriction site
upstream from the coding sequence whereas the 3'-primer (Dm-dNK4)
contains a HindIII endonuclease restriction site downstream from
the coding sequence. Furthermore, the 3'-primer contains downstream
from to the coding sequence two stopcodons for safe termination of
the translation. Further, suitable primers which were optimized for
the translation initiation in E. coli were the following:
[0026] SEQ ID No.: 13 (Dm-dNK 3)
[0027] 5'-CGCGAATTCA TGGCGGAAGC GGCGAGCTGC GCGCGTAAGG GGACC-3'
[0028] SEQ ID No.: 14 (Dm-dNK 4)
[0029] 5'-CGCAAGCTTA TTAACGGGCG ACCCTCTGGC-3'
[0030] Cloning of the Structure Gene for the Dm-dNK in pUC18
[0031] The PCR preparation was applied to an agarose gel and the
750 Bp structure gene was isolated from the agarose gel. The PCR
fragment was cut with the EcoRI and HindIII restriction
endonucleases for 1 hour at 37.degree. C. Simultaneously, the pUC18
plasmid was cut with the EcoRI and HindIII restriction
endonucleases for 1 hour at 37.degree. C., the preparation was then
separated by agarose gel electrophoresis and the 2635 Bp vector
fragment isolated. Subsequently, the PCR fragment and the vector
fragment were ligated by T4-DNA-ligase. Then 1 .mu.l (20 ng) of
vector fragment and 3 .mu.l (100 ng) of PCR fragment, 1 .mu.l
10.times. ligase buffer (Maniatis et al. 1989 Molecular cloning, a
laboratory manual, Sambrok, Fritsch, Maniatis, Book 3, Section B27;
Munch-Peterson (1991) J. Biol. Chem. 266, 9032), 1 .mu.l
T4-DNA-ligase, 4 .mu.l sterile H.sub.2O bidist. were pipetted,
carefully mixed and incubated over night at 16.degree. C.
[0032] The cloned gene was checked by means of restriction analysis
and by sequencing.
[0033] Cloning of the Structure Gene for the Dm-dNK in Appropriate
Expression Vectors
[0034] For expression of the Dm-dNK the structure gene was cloned
in appropriate expression vectors in such a way that the structure
gene is inserted in the right orientation under the control of an
appropriate promoter, preferably an inducible promoter,
particularly preferably the lac-, lacUV5-, tac- or T5 promoter.
Preferred expression vectors are pUC plasmids with lac- or lacUV5
promoters or pKK plasmids.
[0035] For this, the structure gene was cut out of the plasmid pUC
18 for the Dm-dNK by means of EcoRI and HindIII, the restriction
preparation was separated by agarose gel electrophoresis and the
approx. 750 Bp fragment was isolated from the agarose gel.
Simultaneously, the expression vectors were cut with EcoRI and
HindIII, the restriction preparation was separated by agarose gel
electrophoresis and the resulting vector fragment was isolated from
the agarose gel. The resulting fragments were ligated as described.
The appropriate insertion of the gene was verified by restriction
analysis and sequencing.
[0036] Preferred expression vectors are also pUC18, pKK177-3,
pKKT5. Especially preferred is pKKT5. The expression vector pKKT5
is obtained from pKK177-3 (Kopetzki et al. 1989, Mol. Gen. Genet.
216:149-155) by exchanging the tac- promotors with the T5-promoter
derived from the plasmid pDS (Bujard et al. 1987, Methods Enzymol.
155:416-433). The EcoRI-endonuclease restriction site was removed
from the sequence of the T5-promotor by point mutation.
[0037] Transformation of the Expression Vectors in different E-coli
Expression Strains
[0038] Competent cells of different E. coli strains were prepared
according to the Hanahan method (J. Mol. Biol. 166 (1983) pp. 557).
200 .mu.l of the resulting cells were mixed with 20 ng of isolated
plasmid DNA (expression vectors). After 30 min. incubation on ice a
thermal shock (90 sec. at 42.degree. C.) was carried out.
Subsequently, the cells were transferred in 1 ml LB-medium and
incubated for phenotypical expression for 1 hour at 37.degree. C.
Aliquots of this transformation preparation were plated on LB
plates with ampicillin as a selection marker and then incubated for
15 hours at 37.degree. C.
[0039] Appropriate host cells are E. coli K12 JM83, JM101, JM105,
NM522, UT5600, TG1, RR1.DELTA.M15, E.coli HB101, E.coli B.
[0040] Expression of Dm-dNK in E.coli
[0041] For the expression of Dm-dNK clones containing plasmid were
inoculated in 3 ml Lb.sub.amp medium and incubated in the shaker at
37.degree. C. At an optical density of 0.5 at 550 nm the cells were
induced with 1 mM IPTG and incubated in the shaker for 4 hours at
37.degree. C. Subsequently, the optical density of the individual
expression clones was determined an aliquot with an OD.sub.550 of
3/ml was taken and the cells were centrifuged (10 min. at 6000 rpm,
4.degree. C.). The cells were resuspended in 400 .mu.l TE buffer
(50 mM TRIS/50 mM EDTA, pH 8.0), released by ultrasound and then
the soluble protein fraction was separated from the insoluble
protein fraction by centrifugation (10 min., 14000 rpm, 4.degree.
C.). A buffer containing SDS and .beta.-mercaptoethanol was added
to all fractions and the proteins were denatured by boiling (5 min.
at 100.degree. C.). Subsequently, each quantity of 10 .mu.l was
analyzed by means of a 15% analytical SDS gel (Laemmli U. K. (1970)
Nature 227: pp. 555-557).
[0042] A further subject matter of the invention is a method for
production of the nucleoside monophosphates which is characterized
in more detail by the following steps:
[0043] Synthesis of the nucleoside monophosphates starting from
nucleosides by enzymatic phosphorylation with a kinase according to
the invention as an enzyme
[0044] Use of a nucleotide triphosphate as a phosphate group donor
in catalytic amounts
[0045] In situ regeneration of the phosphate group donor via a
regenerating system (CK/CP; PK/PEP; acetylphosphate/acylkinase,
pyrophosphate/pyrophosphorylase)
[0046] As a nucleoside monophosphate according to the invention the
original nucleoside monophosphates, deoxynucleoside monophosphates,
dideoxynucleoside monophosphates as well as other sugar- and
base-modified nucleoside monophosphates are applicable.
[0047] A further subject matter of the present invention is the use
of the kinase according to the invention in the synthesis of the
nucleoside monophosphate.
BRIEF DESCRIPTION OF THE FIGURES
[0048] FIG. 1:
[0049] The kinetic constants of different nucleoside kinases are
listed in FIG. 1 (hTK1/2=human thymidine kinase 1/2;hdCK=human
deoxy-cytidine kinase; hdGK=human deoxy-guanosine kinase;
HSV=Herpes Simplex Virus). The data are taken from:
[0050] a) Munch Petersen et al. J. Biol. Chem. 266, 9032 (1991); J.
Biol. Chem. 268, 15621 (1993),
[0051] b) Biochem. Biophys. Acta 1250, 158 (1995),
[0052] c) Bohmann and Eriksson Biochemistry, 27 4258 (1988),
[0053] d) Wang et al. J. Biol. Chemistry 268, 22847 (1993),
[0054] e) Iwatsuki et al. J. Mol. Biol. 29, 155 (1967),
[0055] f) Black et al. J. Gen. Virology 77, 1521 (1996),
[0056] g) Ma et al. P.N.A.S. 93, 14385 (1996).
[0057] FIG. 2:
[0058] FIG. 2 shows the formation of d-CMP from cytidine under the
conditions mentioned in example 2.
[0059] FIG. 3:
[0060] FIG. 3 shows the formation of d-AMP from adenosine and d-GMP
from guanosine under the conditions mentioned in example 4.
[0061] FIG. 4:
[0062] FIG. 4 shows the formation of d-CMP from cytidine under the
conditions mentioned in example 3.
[0063] FIG. 5:
[0064] FIG. 5 shows the DNA sequence of the clone.
[0065] FIG. 6:
[0066] FIG. 6 shows the temperature optimum of the nucleoside
kinase from D. Melanogaster.
[0067] FIG. 7:
[0068] FIG. 7 shows the stability of the recombinant Dm-nucleoside
kinase compared to isolated Dm-nucleoside kinase.
[0069] FIG. 7A was determined without addition of BSA, FIG. 7B with
addition of BSA.
REFERENCES
[0070] 1. Lee, L. -S. and Y. -C. Cheng (1976) Human deoxythymidine
kinase. I. Purification and general properties of the cytoplasmic
and mitocondrial isozymes derived from blast cells of acute
myelocytic leukemia, J. Biol. Chem., 251, 2600-2604.
[0071] 2. Cheng, Y. -C. and M. Ostrander (1976) Deoxythymidine
kinase induced in HeLa TK cells by herpes simplex virus type I and
type II. II. Purification and characterization. J. Biol. Chem.,
251, 2605-2610.
[0072] 3. Ellims, P. H., T. E. Gan and L. Cosgrove (1982) Human
thymidine kinase: Purification and some properties of the TK1
isoenzyme from placenta, Mol. Cell. Biochem. 45. 113-116.
[0073] 4. Gan, T. E., J. L. Brumley and M. B. Van Der Weyden (1983)
Human thymidine kinase. Purification and properties of the
cytosolic enzyme of placenta J. Biol. Chem., 258, 7000-7004.
[0074] 5. Sherley, J. L. and T. J. Kelly (1988) Human cytosolic
thymidine kinase. Purification and physical characterization of the
enzyme from HeLa cells, J. Biol. Chem. 263, 375-382.
[0075] 6. Munch-Petersen, B. L. Cloos. G. Tyrsted and S. Eriksson
(1991) Diverging substrate specificity of pure human thymidine
kinases 1 and 2 against antiviral dideoxynucleosides, J. Biol.
Chem., 266. 9032-9038.
[0076] 7. Bohman, C. and S. Eriksson (1988) Deoxycytidine kinase
from human leukemic spleen: Preparation and characterization of the
homogenous enzyme, Biochemistry, 27, 4258-40265.
[0077] 8. Kierdaszuk, B. and S. Eriksson (1990) Selective
inactivation of the deoxyadenosine phosphorylating activity of pure
human deoxycytidine kinase: Stabilization of different forms of the
enzyme by substrates and biological detergents, Biochemistry, 29,
4109-4144.
[0078] 9. Kristensen, T. Quantification of thymidine kinase (TK1)
mRNA in normal and leukemic cells and investigation of
structure-function relationship of recombinant TK1 enzyme. 1996.
Department of Life Sciences and Chemistry, Roskilde University,
Denmark. Ref Type: Thesis/Dissertation. Available at Roskilde
University Library.
[0079] 10. Hanahan D.,(1983) J. Mol. Biol. 166: 557
[0080] 11. Sambrook J., Fritsch E. F., Maniatis T., (1989)
Molecular cloning: A Laboratory Manual second Edition, B.27 Cold
Spring Harbor Laboratory Press NY (USA)
[0081] 12. Mullis, K. B. und Faloona, F. A., (1987) Methods in
Enzymol. 155:335-350
[0082] 13. Munch-Peterson B., Piskur J. und Sondergaard L. (1998)
J. Biol. Chem. 273, 3926-3931
[0083] 14. Laemmli U. K. (1970) Nature 227: pp. 555-557
[0084] The invention is further explained by the following
examples:
EXAMPLE 1
[0085] Production and Isolation of the Recombinant Dm Kinase
[0086] An E. coli strain BL21 was transformed with a pGEX-2T vector
(Amersham Pharmacia Biotec), in which the structure gene of the Dm
kinase was cloned, by means of the CaCl.sub.2 method (Sam-brook,
Molecular cloning, 2.sup.nd ed. Cold Spring Harbor Laboratory
press). A transformed colony was suspended in 100 ml LB medium (10
mg tryptone, 5 mg yeast extract, 8 mg NaCl per 1), containing 50
.mu.g/ml ampicilline, over night at 37.degree. C. The next day, the
culture was adjusted to an OD of 0.6 in 1 l of LB medium and the
expression was induced by 100 .mu.l IPTG. The culture temperature
of 25.degree. C. was maintained over night and the cells were
gathered by centrifugation. The cells were resuspended in 100 ml of
buffer A (20 mM of potassium phosphate (pH 7.5), 5 mM MgCl.sub.2, 1
mM DTT, 10% glycerin, 1% Triton X100 and 0.1 mM
phenylsulfonylfluorides). The mixture was broken up by the French
press. The homogenized substance was centrifuged (20000 rpm/15
min.) and filtered with a 1 .mu.m Whatman glass micro filter and a
0.45 .mu.m cellulose acetate filter.
[0087] The homogenized substance was applied to a GSH column
(15.times.45 mm), equilibrated with 10 column volumes of buffer B
(140 mM NaCl, 2.7 mM KCL, 10 mM Na.sub.2HPO.sub.4, 1.8 mM
KH.sub.2PO.sub.4, 1 mM DTT, 10% glycerol, 1% Triton X100, 0.1, mM
phenylsulfonylfluoride, 5 mM benzamidine, 50 mM aminocaproic acid).
The column was washed with 50 bed volumes of buffer B and 10
volumes of buffer C (140 mM NaCl, 2.7 mM KCl, 10 mM
NaH.sub.2PO.sub.4, 1.8 mM KH.sub.2PO.sub.4) and afterwards the
fusion protein was split by recirculation of 1 column volume of
buffer C with 400 U thrombin for 2 hours. The Dm-nucleoside kinase
was then eluted with 3 column volumes of buffer C.
EXAMPLE 2
[0088] Comparison of Synthesis of d-CMP with and without Thiol
Addition
2 d-Cyt 22 mg Tris buffer pH 8.0 2 ml MgAc 10 mg ATP 66 mg d-NK
0.132 U DTT 7 mg/0 mg
[0089] The yield is determined by the integration of the peak areas
using HPLC.
[0090] The reaction is not considerably slower in the preparation
without DTT and is, above all, not terminated after 45 hours (see
FIG. 2).
EXAMPLE 3
[0091] Synthesis of d-GMP and d-AMP
3 d-Ado or d-Guo 28 mg Water 2 ml MgAc 32 mg ATP 3 mg CK 100 U d-NK
0.396 U CP (creatinphosphate) 20 mg
[0092] The reaction advances for 32 hours without slowing down, the
yield rate is above 80% and no thiols must be added. The addition
of Tris buffer is not absolutely necessary (see FIG. 3).
EXAMPLE 4
[0093] Synthesis of d-CMP
4 d-Cyt 22 mg Tris buffer pH 8.0 2 ml MgAc 32 mg ATP 3 mg CK 100 U
d-NK 0.132 U CP 20 mg
[0094] Even after 66 hours the enzyme is still active despite
lacking thiol stabilizers. The yield rate is 80% despite the use of
only catalytic ATP amounts (see FIG. 4).
EXAMPLE 5
[0095] Synthesis of NMPs, dd-NMPs and Base-Modified d-NTPs
[0096] Substrate Solution
5 CP 250 mg ATP 7 mg Mg acetate 160 mg
[0097] in 25 ml 50 mM Tris pH 8.0
[0098] An amount of each 0.5 ml of the solution is added to approx.
2.5 mg of the corresponding nucleoside. Then 50 U of the creatine
kinase and 0.32 U of d-NK are added.
6 Preparation Nucleoside Time Yield rate a) Cytidine 15 h 90% b)
dd-adenosine 70 h 40% c) Iso-guanosine 2 h 80%
EXAMPLE 6
[0099] Activity of the Kinase from D. Melanogaster at Different
Temperatures
[0100] The activity of the Dm-nucleoside kinase was determined at
different temperatures. It shows a wide optimum with a maximum at
60.degree. C. (see FIG. 6).
[0101] The activity test is described in reference No. 14.
EXAMPLE 7
[0102] Activity of the Recombinant Dm-Kinase Compared to Native
Dm-Kinase.
[0103] The activity of the recombinant Dm-kinase compared to
native, isolated Dm-kinase was determined. After different periods
of incubation in 50 mM Tris pH 7.5+2.5 mM MgCl.sub.2 at 37.degree.
C. the remaining activity was determined.
[0104] Whereas the recombinant Dm-kinase remains stable without the
addition of BSA the activity of the native kinase decreases within
50 min to <20%. By adding 2.5 mg/ml BSA the native kinase
remains stable as well (FIGS. 7A+7B).
[0105] The half-life in Tris buffer in the presence of MgCl.sub.2
is 50 h, without MgCl.sub.2 31 h and in pure water 28 h. The native
Dm-kinase has a half-life of <12 min. under the same conditions.
Sequence CWU 1
1
14 1 753 DNA Drosophila melanogaster 1 atggcggagg cagcatcctg
tgcccgaaag gggaccaagt acgccgaggg cacccagccc 60 ttcaccgtcc
tcatcgaggg caacatcggc agcgggaaga ccacgtattt gaaccacttc 120
gagaagtaca agaacgacat ttgcctgctg accgagcccg tcgagaagtg gcgcaacgtc
180 aacggggtaa atctgctgga gctgatgtac aaagatccca agaagtgggc
catgcccttt 240 cagagttatg tcacgctgac catgctgcag tcgcacaccg
ccccaaccaa caagaagcta 300 aaaataargg agcgctccat ttttagcgct
cgctattgct tcgtggagaa catgcgacga 360 aacggctcgc tggagcaggg
catgtacaat acgctggagg agtggtacaa gttcatcgaa 420 gagtccattc
acctgcaggc ggacctcatc atatatctgc gcacctcgcc ggaggtggcg 480
tacgaacgca tccggcagcg ggctcgttct gaggagagct gcgtgccgct taagtacctt
540 caggagctgc atgagttgca ccaggactgg ttgatacacc agagacgacc
gcagtcgtgc 600 aaggtcctag tcctcgatgc cgatctgaac ctggaaaaca
ttggcaccga gtaccagcgc 660 tcggagagca gcatattcga cgccatctca
agtaaccaac agccctcgcc ggttcgtgtg 720 tcgcccagca agcgccagag
ggtcgccaga taa 753 2 24 DNA Artificial sequence DNA Primer 2
gggaagtggc aggagtagct cccg 24 3 27 DNA Artificial sequence DNA
Primer 3 ctcccgttgt agccgtcgcc cttctgg 27 4 33 DNA Artificial
sequence DNA Primer 4 gacgactggc tcgggcagct cttcaccgcg ttg 33 5 27
DNA Artificial sequence DNA Primer 5 ttcgattttt attacctcgc gaggtaa
27 6 30 DNA Artificial sequence DNA Primer 6 aggtaaaaat cgcgagcgat
aacgaagcac 30 7 42 DNA Artificial sequence DNA Primer 7 caccgcatgc
ttgcgtaggc cgtcgcccga gcaagactcc tc 42 8 27 DNA Artificial sequence
DNA Primer 8 gactacatgt ttctagggtt cttcacc 27 9 21 DNA Artificial
sequence DNA Primer 9 tcccaatctc acgtgcagat c 21 10 21 DNA
Artificial sequence DNA Primer 10 ttcatcgaag agtccattca c 21 11 33
DNA Artificial sequence DNA Primer 11 gcgcgaattc atggcggagg
cagcatcctg tgc 33 12 31 DNA Artificial sequence DNA Primer 12
gcgcaagctt attatctggc gaccctctgg c 31 13 45 DNA Artificial sequence
DNA Primer 13 cgcgaattca tggcggaagc ggcgagctgc gcgcgtaagg ggacc 45
14 30 DNA Artificial sequence DNA Primer 14 cgcaagctta ttaacgggcg
accctctggc 30
* * * * *