U.S. patent application number 08/545573 was filed with the patent office on 2002-12-19 for phenylalanine-free protein and dna coding therefor.
Invention is credited to CARR, NOEL G., MANN, NICHOLAS H..
Application Number | 20020192744 08/545573 |
Document ID | / |
Family ID | 10735868 |
Filed Date | 2002-12-19 |
United States Patent
Application |
20020192744 |
Kind Code |
A1 |
CARR, NOEL G. ; et
al. |
December 19, 2002 |
PHENYLALANINE-FREE PROTEIN AND DNA CODING THEREFOR
Abstract
A DNA molecule coding for a food protein, such as ovalbumin or
casein, modified so that the codons for phenylalanine have been
omitted or replaced by codons for one or more other metabolisable
amino acids. Also a modified edible protein coded for by such a DNA
molecule. Such modified proteins are useful in the nutrition of
patients suffering from phenylketonuria.
Inventors: |
CARR, NOEL G.;
(WARWICKSHIRE, GB) ; MANN, NICHOLAS H.;
(WARWICKSHIRE, GB) |
Correspondence
Address: |
TOWNWSEND & TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
8TH FLOOR
SAN FRANCISCO
CA
941113834
|
Family ID: |
10735868 |
Appl. No.: |
08/545573 |
Filed: |
January 16, 1996 |
PCT Filed: |
May 16, 1994 |
PCT NO: |
PCT/GB94/01046 |
Current U.S.
Class: |
435/69.1 ;
435/252.3; 435/320.1; 435/325; 536/23.1 |
Current CPC
Class: |
C07K 14/77 20130101;
C07K 14/4732 20130101 |
Class at
Publication: |
435/69.1 ;
435/320.1; 536/23.1; 435/325; 435/252.3 |
International
Class: |
C12P 021/06; C12N
015/00; C12N 015/09; C12N 015/63; C12N 015/70; C12N 015/74; C07H
021/02; C07H 021/04; C12N 005/02; C12N 005/00; C12N 001/20 |
Foreign Application Data
Date |
Code |
Application Number |
May 20, 1993 |
GB |
9310472.7 |
Claims
1. A DNA molecule coding for a food protein, modified in that the
codons coding for phenylalanine have been omitted or replaced by
codons coding for one or more other metabolisable amino acids.
2. An edible polypeptide which comprises a food protein modified in
that the phenylalanine residues have been omitted or have been
replaced by one or more other metabolisable amino acids.
3. A nutrient material comprising a polypeptide as defined in claim
2 and other edible substances.
4. A DNA molecule according to claim 1 wherein codons for
phenylalanine have been replaced by codons for tyrosine.
5. A nutrient material according to claim 2 obtained by
partially-purifying said edible polypeptide.
6. A nutrient material according to claim 5 wherein the
purification has been carried out to such a degree that the
material contains substantially the metabolically-required
proportion of phenylalanine.
7. An expression vector into which has been incorporated a DNA
molecule according to either of claims 1 or 4.
8. A DNA molecule according to claim 1 or 4, wherein the food
protein is ovalbumin or casein.
9. An edible polypeptide according to claim 2, wherein the food
protein is ovalbumin or casein.
10. A host transformed by an expression vector according to claim
7.
11. A host according to claim 10, which is S. cerevisiae.
12. A host according to claim 11 which is a yeast.
13. A host according to claim 12, which is S. cerevisiae or Pichia
pastoris.
14. A method of producing an edible polypeptide according to claim
2 comprising transforming a host with an expression vector
according to claim 8, culturing the transformed host, and
harvesting the edible polypeptide.
15. A method according to claim 14, wherein the edible polypeptide
is partially purified so that it still contains some
phenylalanine-containin- g proteins from the host, the proportion
of phenylalanine in the product being the metabolic amount required
by a phenylketonuria patient.
16. A nutrient material comprising a partially-purified edible
polypeptide obtained by the method of claim 15.
Description
[0001] This invention relates to an edible protein which has been
modified so that it is phenylalanine free, to DNA coding for it,
and to a method of producing it. Such a protein is a useful
nutrient in the treatment of diseases which are associated with
difficulty in metabolising phenylalanine. A particular example of
such a disease is phenylketonuria (PKU).
[0002] PKU is a genetically acquired disease that occurs in a
relatively fixed proportion of new births in a human population. A
defect in the enzyme carrying out the pterin-dependent
hydroxylation of phenylalanine to tyrosine prevents the body from
metabolizing the amino acid phenylalanine. This amino acid occurs
in varying proportions in all proteins in foodstuffs and is, in the
correct amount, essential for human protein synthesis, and
therefore for the growth and maintenance of the body. Patients with
PKU cannot remove excess phenylalanine from the blood and tissues
and the failure to achieve this control over phenylalanine levels
leads to grave neurological damage, especially in the growing
child.
[0003] PKU patients are at present fed with a synthetic diet which
contains a metabolically-correct amount of phenylalanine along with
a mixture of the other amino acids needed for growth. Such a diet
is unpalatable and is presented in liquid form only and therefore
has difficulty in achieving patient compliance.
[0004] An object of this invention is to provide an edible protein
which when pure contains no phenylalanine and which can form the
basis for a diet containing the optimal nutritional phenylalanine
content for PKU patients. This object may be achieved by taking the
gene from a known nutritional protein and modifying it so that the
codons coding for phenylalanine are deleted or are replaced by
codons coding for another amino acid.
[0005] An alternative approach is to synthesise by chemical means
DNA coding for a phenylalanine-free polypeptide, starting either
from fragments of genes coding for existing proteins, or from the
nucleotides themselves.
[0006] According to one aspect of the invention we provide a DNA
molecule coding for a food protein, modified in that the codons
coding for phenylalanine have been deleted or replaced by codons
coding for one or more other amino acids.
[0007] According to another aspect of the invention we provide an
edible polypeptide which comprises a food protein modified in that
the phenylalanine residues have been omitted or have been replaced
by one or more other amino acids also occurring in protein.
[0008] We further provide a nutrient material comprising an edible
polypeptide as defined above and other edible substances.
[0009] The food protein is preferably a common food protein such as
ovalbumin or caesin.
[0010] We also provide a nutrient material comprising an edible
protein or modified food protein as hereinbefore defined, and other
edible substances.
[0011] The protein according to the invention is phenylalanine free
when pure, but the diet of the patient must contain some
phenylalanine, i.e. the amount required for metabolism, but with
substantially no excess.
[0012] An obvious approach would be to add an appropriate
proportion of normal food proteins, which contain phenylalanine, to
a pure phenylalanine-free protein according to the invention.
[0013] On the other hand, proteins are notoriously difficult to
purify to a high level. If only partially purified, the
phenylalanine-free protein will be accompanied by other protein
products of the host organism containing their normal amounts of
phenylalanine. Thus, if the modified protein is only partly
purified (which is much easier than complete purification), a
protein mixture containing overall a reduced proportion of
phenylalanine will be obtained. By controlling the degree of
purification, a protein mixture containing a
metabolically-appropriate proportion of phenylalanine can be
produced. This invention also provides such a mixture.
[0014] Although codons for phenylalanine may simply be deleted from
the gene for a food protein, in order to preserve as far as
possible the tertiary structure of the protein the codons coding
for phenylalanine are preferably replaced by codons coding for
another amino acid, preferably those having the most similar
properties, e.g. tyrosine.
[0015] We also provide an expression vector into which has been
incorporated DNA for an edible protein or modified food protein as
described herein. The expression vector is preferably a
Saccharomyces cerevisiae expression vector because this yeast has a
long history as a human foodstuff and is amenable to genetic
manipulation. Other yeasts, e.g. Pischia pastoris, may also be
used.
[0016] We further provide a host, for example a yeast such as S.
cerevisiae or Pichia pastoris, transformed by such an expression
vector.
[0017] Ovalbumin and caesin have been selected as preferred food
proteins to be modified in accordance with this invention because
they are naturally-occurring proteins which are commonly used as
human foodstuffs, are widely acceptable, and also because the
modified proteins are likely to behave in a similar manner to the
native proteins when cooked or subjected to other food processing
steps. A wide variety of other food proteins may, however, also be
chosen.
[0018] Preferably, apart from omitting or substituting codons
coding for phenylalanine, the DNA molecule coding for the edible
protein is modified as necessary to ensure that the codon for each
amino acid is the codon of preference for the selected host, e.g.
S. cerevisiae.
[0019] DNA sequences and polypeptides embodying the invention will
now be described in more detail in non-limiting manner, with
reference to the Figures and Examples. FIGS. 1 to 11 relate to
modified chick ovalbumin and FIGS. 12 to 24 relate to modified
bovine casein.
[0020] FIG. 1 shows the sequence of cDNA for unmodified chick
ovalbumin (a copy of the Genbank entry).
[0021] FIG. 2 shows the amino acid sequence (in single letter code)
of the polypeptide coded for by the coding region of FIG. 1.
[0022] FIG. 3 shows a polypeptide corresponding to that of FIG. 2,
but from which all phenylalanine residues have been deleted.
[0023] FIG. 4 shows the amino acid sequence of a polypeptide
corresponding to FIG. 2, in which the phenylalanine residues have
been replaced by tyrosine residues.
[0024] FIG. 5 shows DNA sequence coding for the polypeptide shown
in FIG. 3, where the codons have been selected using a preferred
pattern of codon usage for S. cerevisiae.
[0025] FIG. 6 shows a DNA sequence coding for the polypeptide shown
in FIG. 4.
[0026] FIGS. 7 to 10 show, respectively, the nucleotide sequence
for the constructs pl+oval-f+3 end, pl+h6oval-f+end,
pl+Yoval-f+3nd, and pl+h6Yoval-f+3end.
[0027] FIG. 11 shows the nucleotide sequence of the synthetic
pl+oval-f+3end gene constructed from overlapping
oligonucleotides.
[0028] FIG. 12 shows the nucleotide sequence of bovine
alpha-S1-casein mRNA.
[0029] FIG. 13 shows the amino acid sequence of mature
alpha-S1-casein.
[0030] FIG. 14 shows a modified protein corresponding to that of
FIG. 13, but from which all phenylalanine residues have been
deleted.
[0031] FIG. 15. shows a DNA sequence coding for the modified
protein of FIG. 14.
[0032] FIG. 16 shows a DNA sequence corresponding to that of FIG.
15 but including the non-translated regions of alpha-S1-casein.
[0033] FIG. 17 shows the nucleotide sequences of bovine casein gene
blocks A and B, form which the whole gene was subsequentially
assembled.
[0034] FIGS. 18a and 18b show respectively the predicted and actual
DNA and protein sequences of block A.
[0035] FIGS. 19a and 19b show respectively the predicted and actual
DNA and protein sequences of block B.
[0036] FIG. 20 shows the combines DNA and protein sequences of
blocks A and B.
[0037] FIG. 21 shows the complete DNA and protein sequences of the
synthetic casein.
[0038] FIG. 22 shows the assembly of the casein gene sequences in
plasmid pMTL22.
[0039] FIG. 23 shows the construction of the E. coli yeast
expression vector pMTL8133.
[0040] FIG. 24 shows the casein gene sequence cloned into
pMTL8133.
EXAMPLE 1
[0041] The gene and downstream non-translated DNA sequence for
chick ovalbumin were based on the nucleotide sequence of the
complementary cDNA for chick ovalbumin deposited by O'Hare et al in
the GenBank database with the accession number V00383. The vector
pEMBLyex4 (see Cesareni, G and Murray, J. A. H. (1987) In `Genetic
Engineering` (Ed. Setlow, J. K.) Volume 9 Plenum Publishing
Corporation, New York, pp 135-154) was chosen for expression, as it
can be used to direct the expression of genes which lack their own
promoter. The vector harbours a hybrid promoter consisting of the
upstream activator sequence of the GAL1 promoter and the 5'
non-translated leader of the CYC1 gene, up to position -4. The
plasmid contains a translation initiation codon ATG downstream from
the GAL1-CYC1 promoter. The codon ATG is followed by a unique
HindIII site and is preceded by unique cloning sites for BamHI,
PstI, Smal and XbaI. In addition to yeast selectable markers and
origin of replication it carries ampicillin resistance and a
functional E. coli origin. The complete nucleotide sequence of the
vector is known.
[0042] The sequence of the cDNA for chick ovalbumin is shown in
FIG. 1 and a translation of the ovalbumin coding region is shown in
FIG. 2. The amino acid sequence of a polypeptide (oval-f) derived
from chick ovalbumin, but lacking any phenylalanine residues, is
shown in FIG. 3. To optimize expression of this gene when expressed
in S. cerevisiae the polypeptide sequence was `backtranslated`
using the most preferred pattern of codon usage for S. cerevisiae
(FIG. 5). A derivative of chick ovalbumin was also designed in
which the phenylalanine residues are replaced by tyrosine residues
in order to attempt to produce a protein which has as near as
possible the tertiary structure of chick ovalbumin. The amino acid
sequence of the polypeptide (Yoval-f) and its corresponding gene
produced as for the oval-f gene are shown in FIGS. 4 and 6
respectively. To further facilitate expression, cloning procedures
and protein purification the following modifications were made to
the basic gene.
[0043] 1. Addition of a sequence corresponding to the 3' end of the
mRNA from the end of the coding region to the poly A site, in order
to enhance expression.
[0044] 2. Addition of an extra TAA stop codon at the end of the
gene, in order to ensure that no translation would take place
beyond the normal coding region.
[0045] 3. In order to assist in vitro manipulation, addition at
either end of the synthetic gene of polylinkers which contained
restriction sites for PstI, BamHI, SmaI, EcoRI and HindIII. The
synthetic genes do not contain sites for these restriction enzymes.
The polylinkers have the following sequence:
1 5'CTGCAGGATCCCGGGAATTCAAGCTT 3' [ PstI ] [ SmaI ] [HindIII]
[BamHI] [EcoRI]
[0046] 4. In some versions of the synthetic gene a sequence
corresponding to 6 histidine residues was added immediately
downstream of the initiating methionine, in order to facilitate
purification of the protein by a form of affinity
chromatography.
[0047] Thus 4 basic variations on the original synthetic gene were
obtained, with the following structures:
[0048] The synthetic gene is constructed via the synthesis of
oligonucleotides each approximately 100 nucleotides long and
designed in such a way that they overlap each other and will
self-assemble by complementary base pairing into a contiguous
structure which can be ligated via the appropriate sticky ends,
generated by restriction endonuclease digestion into pEMBLyex4 or
an appropriate E. coli vector such as pBR322 or pUC19. The
sequences of the oligonucleotides and their arrangement is shown in
FIG. 11. The end points of the individual oligonucleotides are
marked by the character.
EXAMPLE 2
[0049] This example utilises bovine alpha-s1-casein. In this
illustration only one synthetic gene was designed, but the general
approach used in Example 1 can be applied to produce the other
three genes analogous to those of Example 1, (i.e. those genes
containing tyrosine replacements for phenylalanine and/or a run of
six histidine residues immediately downstream of the N-terminal
methionine).
[0050] The sequence of the mRNA for bovine alpha-s1-casein is shown
in FIG. 12 and a translation of the region coding for the mature
polypeptide is shown in FIG. 13. The modified form of the protein
lacking phenylalanine residues and with an added N-terminal
methionine (to permit translation) is shown in FIG. 14. A DNA
sequence corresponding to this modified polypeptide produced using
the most preferred pattern of codon usage for S. cerevisiae is
shown in FIG. 15. Finally, the nucleotide sequence of the complete
synthetic gene with the 3' untranslated region from the bovine
alpha-s1-casein mRNA added on as well as the polylinkers (described
in section A) is shown in FIG. 16. It should be noted that this
particular synthetic gene has an internal EcoR1 site, as well as
those present in the polylinkers and therefore EcoR1 should not be
used in any in vitro manipulations of this gene during insertion
into a vector.
EXAMPLE 3
[0051] This example concerns the construction of a bovine casein
gene modified in that the codons for phenylalamine are replaced by
codons for tyrosine.
[0052] Synthetic Gene Design
[0053] Eight C.100'mer oligonucleotides were designed, synthesised,
and purified. These oligonucleotides (casein 1-8. see FIG. 16)
formed the basis of two self-priming block assemblies in which the
two blocks (designated A and B) overlapped by about 100 bp.
[0054] Following an initial round of PCR-mediated extension of the
self-primed oligonucleotides as separate Blocks (A & B), a
second round of PCR amplification using terminal flanking c. 20'mer
primers (AL1 & AR1, BL1 & BR2; see FIG. 17 generated the
two independent c.380 bp gene blocks A and B.
[0055] As mentioned above the design of the casein 1-8 c. 100'mer
oligonucleotides was such that the encoded gene contained no
phenylalanine codons, all these being substituted with tyrosine
codons. A further feature was the incorporation of a number of
unique restriction sites to facilitate in the final assembly of the
whole gene from components of the two overlapping gene blocks. This
duplication facilitates correction of erroneous PCR-mediated DNA
synthesis.
[0056] Gene Block Synthesis
[0057] Using the 2-step PCR stategy described above both casein
gene blocks A and B were amplified as discrete c. 380 bp products
using Stratagene's native pfu DNA polymerase. Little success was
achieved with the cloned enzyme. This particular enzyme was used
because of its apparently superior fidelity properties.
[0058] Cloning and Sequencing of the Gene Blocks
[0059] Both blocks A & B were successfully cloned into
Invitrogen's PCRII-TA cloning vector. Plasmid DNA was prepared from
numerous isolates and these subjected to DNA sequence analysis
using both universal and reverse sequencing primers. For the
majority of clones full c. 380 bp reads were obtained. All these
sequences were computer aligned against the "desired" sequence and
against each other. Representative sample alignments for block A
and B are shown in FIGS. 18a and b, and 19a and b,
respectively.
[0060] PCRII-TA clones A100 and B69 were chosen as primary DNA
sources. Two mutagenic c. 60'mer mutagenic oligo nucleotides,
casein 9 and casein 10, were synthesised, purified, and used to
amplify a "corrected" c.200 bp HpaI/HindIII C-terminus. This
product was cloned into PCRII-TA vector and the sequence of several
clones analysed using universal and reverse sequence primers. No
perfect sequences were obtained but one clone (C20) which had only
one base change, a G to T conversion resulting in a single amino
acid change of trp to leu, was chosen.
[0061] The strategy taken was to assemble the gene sequence in
pMTL22 by cloning the c. 200 bp hpa/HindIII C-terminal fragment of
clone C20 next to the remainder of the gene derived from cloning of
the c.265 bp BamHI/AatII of clone A100 and the c. 270 bp AatII/KpnI
of clone B69 (See FIG. 22). This has been achieved and the final
nucleotide sequence verified yielding the "casein" gene sequence
with a TTG triplet deletion at nt. pos. 258 and a G to T base
change at nt. pos.
[0062] Cloning of the casein sequence into pMTL8133
[0063] The casein gene sequence was sub-cloned from the pMTL22
construct above into the "in house" E. coli/yeast expression vector
pMTL8133 (see FIG. 23). This vector is based on chloramphenicol
resistance and has a hybrid PGK::REP 2 promoter element which has
been shown to elicit high expression levels of other heterologous
genes in both E. coli and Saccharomyces cerevisiae. The casein
sequence was cloned as a PstI(flush-ended)/HindIII fragment into
SspI/HindIII cleaved pMTL8133 as outlined in FIG. 24, such that it
is correctly juxtaposed to the 5'-UTR sequence for elevated
expression in yeast. The correct sequence at the cloning junction
was verified by sequence analysis.
[0064] The modified gene has been clone into the E. coli/yeast
expression vector pMTL8133 which has previously been shown to
elicit expression of heterologous genes in both Escherichia coli
and Sacharomyces cerevisiae.
[0065] Casein expression studies
[0066] E. coli strain INV alpha F' (endA1, recA1, hsdR17(r-k, m+k),
suPE44, -, thi-1, gyrA, relA1, .phi.80 lacZ.alpha..DELTA.M15.DELTA.
(lacZYA-argF), deoR+, F genotype) has been transformed with the
pMTL8133-casein recombinant plasmid and cultured in the presence of
chloramphenicol (30 .mu.g ml.sup.-1) to maintain selection for the
plasmid. Sonic extracts have been prepared from this culture and
subjected to polyacrylamide gel electrophoresis alongside native
bovine alpha casein (purchased from Sigma). Blotting of this gel
onto nitrocellulose membrane followed by probing of the membrane
sequentially with rabbit anti-casein and peroxidase-conjugated goat
anti-rabbit antibody has revealed the presence of a polypeptide
equal in size to the bovine alpha casein control. This polypeptide
has a predicted molecular weight of 22 kDa. This protein product is
detectable by means of antibody probing. No product is visible in
coomassie blue stained polyacrylamide gels.
[0067] The pMTL8133-casein recombinant plasmid is used to transform
a yeast (e.g. S. cerevisiae) in order to obtain expression of the
modified casein encoded thereby.
[0068] If necessary or desirable, the base change at nt. pos. 512
can be corrected using a two-step strategy as follows. Firstly, the
major part of the casein gene, 510 bp PstII/KpnI (nt. pos. 15 to
530) fragment is sub-cloned into PstI/KpnI cleaved pMTL20 with
concomitant loss of AatII and NcoI polylinker sites. This enables
the substitution of the c. 100 bp AatII/NcoI fragment containing
the TTG triplet deletion a correct sequence derived from the
annealing of complementary c. 100 bp oligonucleotides (nt. pos. 178
to 279). Such a clone is used for the second step involving
mutagenic PCR using oligonucleotide primers AL2 and casein 15
whereby the base change at nt. pos. 512 is corrected.
Sequence CWU 1
1
* * * * *