U.S. patent application number 10/153902 was filed with the patent office on 2002-12-12 for vaccine delivery system.
This patent application is currently assigned to University of Maryland. Invention is credited to Stein, Daniel C., Stover, Charles K..
Application Number | 20020187160 10/153902 |
Document ID | / |
Family ID | 22165027 |
Filed Date | 2002-12-12 |
United States Patent
Application |
20020187160 |
Kind Code |
A1 |
Stein, Daniel C. ; et
al. |
December 12, 2002 |
Vaccine delivery system
Abstract
The invention relates to a hyperblebbing strain of Neisseria
gonorrhoeae which produces large amounts of blebs useful for
production of blebosomes containing antigens for use as a vaccine
delivery vehicle or as a diagnostic reagent. The invention also
relates to a method for producing high levels of a desired protein
in purified form using the hyperblebbing strain of N. gonorrhoeae,
and to vaccine delivery systems containing the blebosomes
expressing the desired antigen.
Inventors: |
Stein, Daniel C.; (Silver
Spring, MD) ; Stover, Charles K.; (Mercer Island,
WA) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX PLLC
1100 NEW YORK AVENUE, N.W., SUITE 600
WASHINGTON
DC
20005-3934
US
|
Assignee: |
University of Maryland
|
Family ID: |
22165027 |
Appl. No.: |
10/153902 |
Filed: |
May 24, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10153902 |
May 24, 2002 |
|
|
|
09705920 |
Nov 6, 2000 |
|
|
|
09705920 |
Nov 6, 2000 |
|
|
|
09081576 |
May 19, 1998 |
|
|
|
6180111 |
|
|
|
|
09081576 |
May 19, 1998 |
|
|
|
08936522 |
Sep 23, 1997 |
|
|
|
08936522 |
Sep 23, 1997 |
|
|
|
08443514 |
May 18, 1995 |
|
|
|
Current U.S.
Class: |
424/186.1 ;
424/190.1; 424/191.1 |
Current CPC
Class: |
A61P 37/04 20180101;
C07K 14/22 20130101; Y02A 50/401 20180101; A61K 39/095 20130101;
A61P 31/10 20180101; A61K 2039/55555 20130101; A61K 2039/55594
20130101; A61P 31/12 20180101; A61K 39/00 20130101; A61K 39/39
20130101; Y10S 530/812 20130101; A61P 31/04 20180101 |
Class at
Publication: |
424/186.1 ;
424/190.1; 424/191.1 |
International
Class: |
A61K 039/12; A61K
039/02; A61K 039/002 |
Goverment Interests
[0002] This work was supported by grant AI 24452 from the National
Institutes of Health. The government may have certain rights in
this application.
Claims
What is claimed as new and is desired to be secured by Letters
Patent of the United States is:
1. A vaccine for providing in a subject immunity against a disease,
said vaccine comprising blebosomes wherein an immunogenic
polypeptide specific for said disease is present in a
pharmacologically effective dose in a pharmaceutically acceptable
excipient.
2. The vaccine of claim 1, wherein the subject is human.
3. The vaccine of claim 1, wherein the subject is animal.
4. The vaccine of claim 1, wherein said disease is caused by a
microorganism.
5. The vaccine of claim 2, wherein said disease is caused by a
microorganism.
6. The vaccine of claim 3, wherein said disease is caused by a
microorganism.
7. The vaccine of claim 1, wherein said disease is caused by a
bacterium.
8. The vaccine of claim 1, wherein said disease is caused by a
virus.
9. The vaccine of claim 1, wherein said disease is caused by a
fungus.
10. The vaccine of claim 1, wherein said disease is caused by a
protozoan.
11. A pharmaceutical composition for treating a disease, comprising
a blebosome wherein a polypeptide active against said disease is
present in a pharmacologically effective does in a pharmaceutically
acceptable excipient.
12. The pharmaceutical composition of claim 11, wherein said
polypeptide is a cytokine.
13. The pharmaceutical composition of claim 11, wherein said
polypeptide is a receptor.
14. The pharmaceutical composition of claim 11, wherein said
polypeptide is an antibiotic.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The application is continuation-in-part application of
copending U.S. Ser. No. 08/443,514 filed on May 18, 1995.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention provides compositions comprising
blebosomes which express an immunogenic polypeptide specific for a
disease, methods of manufacturing the same, methods for detecting
antibodies specific for said immunogenic polypeptides and methods
for immunizing an animal using said blebosomes.
DISCUSSION OF THE BACKGROUND
[0005] Immunization is a principal feature for improving the health
of infants and young children. Despite the availability of a
variety of successful vaccines against most of the common childhood
illnesses, infectious diseases remain a leading cause of death in
children. Significant problems inherent in existing vaccines
include the need for repeated immunizations, and the
ineffectiveness of the current vaccine delivery systems for a broad
spectrum of diseases.
[0006] The number of successful approaches to vaccine development
is almost as broad as the number of infectious agents. As
technology has developed, it has become possible to define at the
molecular level the nature of the protective immunogen. In recent
years, acellular vaccines have become the method of choice for
vaccine development because they can be administered with subunits
from a variety of pathogens (i.e. multicomponent vaccines) and they
have the potential for reduced numbers of adverse reactions.
Subunit vaccines are composed of defined purified protective
antigens from pathogenic microorganisms.
[0007] Perhaps the best example of success with subunit vaccines is
the current vaccine that prevents diseases caused by H. influenzae.
A conjugate vaccine composed of H. influenzae polyribosyl ribitol
phosphate (PRP) capsular polysaccharide conjugated to an outer
membrane protein complex (OMPC) from N. meningitidis has proven to
be safe and effective in generating protective immune responses in
infants as young as 2 months of age. Covalent coupling of PRP to
OMPC results in a conjugate that effectively mediates carrier
priming and additionally provides an insoluble particulate antigen
containing lipooligosaccharides (LOS) which have adjuvant activity.
This vaccine is widely accepted as safe and effective in reducing
the incidence of morbidity and mortality associated with diseases
caused by H. influenzae (Stover, C. K. et al., Nature 351:456-460,
1991; Husson, R. N. et al., J. Bacteriol. 172: 519-524, 1990;
Jacobs, W. R. et al., Curr. Top. Microbiol. Immunol. 155:153-160,
1990; Jacobs, W. R. et al., Nature 327: 532-535, 1987. All
documents cited herein are hereby incorporated by reference).
[0008] Although there have been a few stunning successes, a small
number of subunit vaccines are currently in use. Perhaps the most
daunting reason impeding the use of subunit vaccines is the problem
of antigen delivery. For optimal antigen delivery, the antigen
needs to be delivered to the antigen presenting cells in its
biological context, or the antigen needs to be readily recognized
and taken up by phagocytes. Most antigens possess three dimensional
structures that are important for parasite-host cell interactions
and many of these structures are lost during antigen
purification.
[0009] One approach taken to circumvent most of the problems
associated with subunit vaccine production is the development of
live recombinant vaccine vehicles, based on attenuated viruses and
bacteria that have been genetically engineered to express
protective antigens in vivo (i.e. recombinant forms of vaccinia
virus, adenovirus, Salmonella and mycobacterium tuberculosis typhus
bonivur var. Bacille-Calmette-Guerin or BCG) (Snapper, S. B. et
al., Proc. Natl. Acad. Sci USA 85:6987-6991, 1988; Jackett, P. S.
et al., J. Clin. Micro. 26:2313-2318, 1988; Lamb, J. R. et al.,
Rev. Infect. Dis. 11:S443-S447, 1989; Shinnick, T. M. et al.,
Infect. Immun. 56:446-451, 1988).
[0010] Live vaccines present advantages in that the antigen is
expressed in the context of an innately immunogenic form; the live
delivery system replicates and persists in the host, restimulating
the host immune system and obviating the need for multiple doses;
live vector systems eliminate the need to purify the antigen, and
are less expensive to produce; and live vectors can be designed to
deliver multiple antigens, reducing the number of times an
individual must be vaccinated.
[0011] Investigators developing Escherichia coli and Salmonella as
live vaccine vehicles have developed export vectors utilizing
flagella, fimbriae or major outer membrane proteins (OmpA and LamB)
as carriers to export protective epitopes to the surface of the
bacterial vaccine vehicle (Stover, C. K. et al., Infect. Immun. 58:
1360-1475, 1990; Thole, J. E. R. et al., Infect. Immun.
55:1466-1475, 1988). However, the approach of grafting epitopes
into these surfaces is limited, as only small epitopes may be
inserted, and the epitopes are presented in a context of a foreign
protein that may limit its ability to assume its native
conformation.
[0012] In order to develop vaccines against pathogens that have
been recalcitrant to vaccine development, and/or to overcome the
failings of commercially available vaccines due to
underutilization, new methods of antigen presentation must be
developed which will allow for fewer immunizations, and/or fewer
side effects to the vaccine. A new vaccine delivery system is
described in this application which is based on Neisseria
gonorrhoeae as a host, a bacterium that naturally turns over its
outer membrane into easily isolated immunogenic blebs.
[0013] N. gonorrhoeae is a human pathogen of mucosal surfaces. N.
gonorrhoeae is a Gram-negative bacteria with an undulating outer
membrane which appears as a bilayered structure (Reviewed In: The
Gonococcus, P. B. Roberts (Ed.). Wiley, New York). The chromosome
of the gonococcus contains approximately 2.1.times.10.sup.6
nucleotide pairs. During log phase, the gonococcus forms cell wall
blebs which are produced by budding of the outer membrane (Schorr,
J. B. et al., Cold Spring Harbor Laboratory Press Vaccines
91:387-392, 1991). These blebs are spherical and are surrounded by
a bilayer membrane-like structure. Blebs derived from Neisseria
have a liposomal three-dimensional structure and provide immune
stimulation (adjuvant activities) to antigens covalently coupled to
them (Brandt, M. E. et al., Infect. Immun. 58:983-991, 1989).
Protein profiles from gonococcal blebs closely resemble those
proteins seen in the outer membrane of the gonococcus (Melchers, F.
et al., J. Erp. Med. 142:473-482, 1975). Gonococcal blebs contain
on their surface proteins I (Pistor, S. and G. Hobom, Wochenschr.
66:110, 1988), II (Bakker, D. et al., Microb. Path. 8:343-352,
1990), and H8 (Charbit, A. et al., EMBO 5(11):3029-3037, 1986). In
addition, they contain gonococcal lipooligosaccharide (LOS).
[0014] Much work has been done on characterizing the cell surface
antigens of the gonococcus, and many of the genes encoding the
protein antigens have been cloned and their DNA sequences
determined (Vodkin, M. H. and Williams, J. C., J. Bact.
170:1227-1234, 1988; Young, D. L. et al., Infect. Immun.
54(1):177-183, 1986; Young, D. R. et al., Proc. Natl. Acad. Sci.
U.S.A 85:4267-4270, 1998; Newton, S. M. et al., Science 244:70-244,
1989). Studies on biosynthesis and the genetics underlying the
biosynthesis of each of the LOS components are far enough along to
allow for the successful construction of strains with a defined LOS
structure and a stable cell surface. Neisseria mutants that are
deficient for LOS and other cell surface proteins have been well
described and can be easily produced. Furthermore, gonococcal blebs
are easy to isolate and vectors for the genetic manipulations of
Neisseria already exist.
[0015] Blebosomes are advantageous over liposomes as carriers of
antigens. Liposomes are artificially made and proteins of interest
are either entrapped in them or chemically conjugated to their
surface. The blebosomes of the present invention require no special
treatment, and proteins are folded naturally by native enzymes and
can be engineered to be expressed inside or outside the bleb.
[0016] The present invention provides a vaccine delivery system
comprising engineered N. gonorrhoeae wherein, said bacteria
expresses and directs any heterologous target antigen to its outer
membrane. The outer membrane with the antigenic protein is
naturally sloughed off in gonococcal blebs during cell growth. The
resulting target antigen-membrane bleb complex or blebosome is easy
to isolate and would represent a non-living but immunogenic
cell-like particle which can be used to elicit a protective immune
response.
[0017] Free blebbing, or hyperblebbing strains allow for the
necessary production of large amounts of blebosomes for use in a
vaccine. In order to commercially produce a vaccine based on
gonococcal blebs, it must be possible to produce large quantities
of blebosomes. Although all gonococcal strains produce blebs, the
yield tends to be low, and prohibitive for use as a vaccine
delivery system. A strain that hyperblebs gives the required high
yield of blebs for economic production of a vaccine. Such a
hyperblebbing strain has not yet been described in the literature.
Therefore, there is a need for a strain of N. gonorrhoeae which is
able to hyperbleb in order to economically produce quantities of
blebosomes containing the target antigens in amounts sufficient for
use as a vaccine delivery system.
SUMMARY OF THE INVENTION
[0018] The present invention is directed to a mutant of N.
gonorrhoeae strain WR302 that is defective in an unknown growth
parameter. This defect causes the gonococcus to grow abnormally and
slough off its outer membrane at a very high frequency or
hyperbleb. This strain produces many more outer membrane vesicles
(blebs) than other strains and the blebs are readily visualized by
electron microscopy.
[0019] The present invention is also directed to the production of
other N. gonorrhoeae strains with the hyperblebbing phenotype by
using a non-selective spot transformation technique. This technique
allows for easy identification of transformants of N. gonorrhoeae
in the absence of selective pressure. The technique comprises the
steps of mixing a limiting number of cells with an excess amount of
DNA, spotting the mix onto the surface of an agar plate, incubating
the mix, and re-streaking and selecting the transformed cells. The
hyperblebbing strains are altered in their expression of
lipooligosaccharide (LOS). The transformants can be identified
phenotypically based on their acquisition of new monoclonal
antibody reactivity and the diffusion of blebs away from the
colony.
[0020] By using the spot-transformation technique described above
on strains of N. gonorrhoeae with different mutations and/or
already possessing genes for different antigens, hyperblebbing
strains of N. gonorrhoeae expressing antigens for different
diseases can be produced. Blebosomes collected from these
hyperblebbing strains can be used to produce a vaccine for
immunization against these diseases. Vaccines produced in this way
have an advantage over whole cell vaccines because the antigens are
present in the absence of other cellular components. In addition,
the antigens are assembled in a natural biological membrane
allowing the antigen to form a native conformation, more closely
mimicking what is encountered in the natural organism.
[0021] These blebosomes can be used in diagnostic assays wherein
the presence of antibodies against disease can be detected in
samples from a patient suspected of having the disease.
[0022] Blebosomes can also be used as a delivery system for other
biologically made molecules, such as chemotherapeutic agents for
use in chemotherapy, or immune enhancers/suppressors.
[0023] Further, the blebosomes can be used to expedite the
purification of membrane proteins from the gonococcus (either
natural or engineered). Blebesomes are significantly enriched for
outer membrane proteins of the gonococcus since most of the cells
cytoplasmic components are absent. Isolation of blebosomes then
represents a significant purification of those gonococcal membrane
proteins. Similarly, blebosomes can be enriched for proteins which
have been engineered to be expressed in the blebosome, for example
a receptor protein, and would offer a significant improvement in
aiding in the production and purification of such proteins.
[0024] Therefore, it is an object of the present invention to
provide a hyperblebbing strain of Neisseria gonorrhoeae which
produces large amounts of blebs useful for the production of
blebosomes containing specific antigens for use as a vaccine
delivery vehicle or as a diagnostic agent.
[0025] It is another object of the present invention to provide a
method for the production of hyperblebbing strains of N.
gonorrhoeae.
[0026] It is another object of the present invention to provide a
method for the production of large amounts of a desired protein in
purified form, said method comprising introducing the desired gene
into a hyperblebbing strain of N. gonorrhoeae such that the protein
is expressed in blebosomes, and isolating said blebosomes.
[0027] It is yet another object of the present invention to provide
a vaccine delivery system comprising the blebosomes expressing an
antigen specific for said disease which would provide immunity
against said disease.
DRAWINGS
[0028] These and other features, aspects and advantages of the
present invention will become better understood with regard to the
following description, appended claims, and accompanying drawing
where:
[0029] FIG. 1 shows an immunoblot of the hyperblebbing N.
gonorrhoeae.
[0030] FIG. 2 shows partial restriction maps and depiction of
detections constructed for the S. NgoI, II, IV, V, and VII R/M
system clones. Arrows show the predicted methyltransferase (M) and
restriction endonuclease (R) open reading frames. The black boxes
represent the deleted regions on each clone. Restriction site
abbreviations are , BglI; C, ClaI; D, DraI; E, EcoRI; H, HindlII;
Hp, HpaI; N, NcoIII; P, PstI; R, RsaI; S, SalI; Sm, SmaI; Sp, SphI;
Ss, SspI; St, Styl; Su, Sau3AI; U, gonococcal uptake sequence; and
X, XhoI.
[0031] FIG. 3 illustrates the spot transformation technique.
[0032] FIG. 4 represents an autoradiogram of Southern blots
confirming the incorporation of R/M deletions into the chromosome.
The first lane of each set is DNA from FA 19 and the second lane
form JUG029. Set 1, NgoI deletion (probed with PstI-XhoI fragment
of pLJPC30); Set 2, NgoII deletion (probed with pLV155); Set 3,
NgoIV deletion (probed with pCBB49.0); Set 4, NgoV deletion (probed
with pJM5); Set 5, NgoVII deletion (probed with pF, 63). DNAs were
digested with Set 1, DraI; Set 2, Sau3AI; Set 3, SspI; Set 4, RsaI;
Set 5, EcoRI+HindIII.
[0033] FIG. 5 shows an assay for the lack of S. NgoI, II, IV, V,
and VII MTase activity in strain JUG029. The first lane of each set
is DNA isolated from FA 19 and the second lane from JUG029. Each
set is digested with its isoschizomer (or an enzyme with an
overlapping recognition sequence). Set 1, HaeII (NgoI); Set 2,
HaeIll (NgoII); Set 3, NgoMI (NgoIV); Set 4, BamHI (NgoV); Set 5;,
Fnu4HI (NgoVII). Lane M is lambda HindIII marker.
[0034] FIG. 6 shows PCR primers used to amplify the p6 and pspA
genes. FIG. 6A shows the primers used to amplify the p6 gene. FIG.
6B shows the primers used to amplify the pspA gene.
[0035] FIG. 7 shows plasmid maps of pLEE20 containing the p6 and
pspA inserts. FIG. 7A shows pLEE20-p6, which is approximately 6.6
kb. The p6 gene has its own lipoprotein sequence and is translated
from its own ATG. Erm=Erythromycin.sup.R. FIG. 7B shows
pLEE20-pspA. pspA is also translated from its own ATG.
[0036] FIG. 8 is a Coomassie Blue stained SDS-PAGE gel. A#8, #18
and #19 are pLEE20-p6 clones.
[0037] FIG. 9 is a Western blot of the SDS-PAGE gel of FIG. 8.
DESCRIPTION
[0038] Hyperblebbing Strains
[0039] The present invention relates to hyperblebbing N.
gonorrhoeae. "Hyperblebbing", as used herein, means that the mutant
strain blebs more than the parent strain from which it was
obtained. In general, hyperblebbing mutants bleb greater than 10%
more than their parent strains, preferably greater than 20%, more
preferably greater than 30%.
[0040] The hyperblebbing N. gonorrhoeae can be prepared and
selected as described in the Examples that follow. For example, two
approaches could be used to construct a hyperblebbing strain. The
most precise approach would be to identify the genetic basis of
this mutation, and clone the gene.
[0041] The second approach is the non-selective spot transformation
method which was described in the Examples that follow. Briefly,
chromosomal DNA isolated from the hyperblebbing strain are used to
transform a wild type strain. The hyperblebbing phenotype is easily
identified because strains that hyperbleb react with LOS-specific
monoclonal antibodies 2-1-L8 and 1B2 on colony blots, for example.
Monoclonal antibody 2-1-L8 can be obtained from Dr. Wendel
Zollinger, Walter Reed Army Institute for Research, Washington D.C.
Antibody 1B2 can be obtained from the American type Culture
Collection as ATCC Accession number 2199.
[0042] The hyperblebbing N. gonorrhoeae of the present invention is
exemplified by a novel strain designated WR302.sup.++, a derivative
of a nonhyperblebbing strain WR302. WR302 can be obtained from Dr.
Daniel Stein. WR302.sup.++ was deposited under the provisions of
the Budapest Treaty with the American Type Culture Collection,
12301 Parklawn Drive, Rockville Md. on Oct. 16, 1996, under
accession no. ATCC 55857.
[0043] Blebosomes can be easily isolated from non-piliated cells.
For example, blebosomes can be recovered by differential
centrifugation and filtration. Alternatively, high speed
centrifugation can be used. Please see Buchanan & Arko, 1977,
J. Infect. Dis. 135:879-887 for a general reference for bleb
isolation.
[0044] The blebosomes can be stored at 4.degree. C. prior to use,
or fixed if fixation does not interfere significantly with the
ultimate utility of the blebosome whether as a protein production
system, a diagnostic reagent, or a vaccine delivery system.
Alternatively, the N. gonorrhoeae colonies producing blebosomes
with the desired antigen can themselves be used in assays while
growing on agar. Further, the bacteria can be lyophilized and
stored for use after reconstitution.
[0045] Methods for Producing Protein Using Blebosomes
[0046] In one embodiment, the present invention relates to a method
for the production of large amounts of protein. The gene of the
desired protein can be introduced into the Neisseria using vectors
capable of replicating in the gonococcus and able to be introduced
to the gonococcus by transformation or conjugation.
[0047] The protein can be expressed either on the surface or inside
the blebosome depending upon the presence or absence of a signal
sequence functionally, cloned next to the desired protein. Suitable
signal sequence for expressing the desired protein on the surface
of the blebosome include the H8 lipoprotein signal sequence, the
PIII export sequence or the piliA import sequence.
[0048] The blebosomes expressing the desired proteins can be
collected according to methods mentioned above and either used
directly or accompanied by other agents of choice. Preferably, the
proteins can be collected by immunological precipitation using
monoclonal antibodies specific for the protein of interest.
[0049] Suitable proteins for expression include cytokines such as
interleukins 1-12, and outer membrane proteins such as OspA, P6 or
PspA. Several different antigens or proteins can be simultaneously
expressed in the same gonococcus, if desired.
[0050] Vectors for Genetic Manipulation of Neisseria
[0051] Examples of vectors which could be used in accordance with
this invention include, but are not limited to pLES2 (Stein et al.
1983, Gene 25:241-247) and pLEE10 (Sandlin et al. 1993, Infect.
Immun. 61:3360-3368).
[0052] Methods for introducing said vectors and analyzing the
transformants are known and within the skill of a person with
ordinary skill in the art.
[0053] Vaccine Delivery System Based on Blebosomes
[0054] In a further embodiment the present invention relates to the
use of blebosomes as a vaccine delivery system in human and animal
subjects, animal subjects including veterinary animals, livestock
animals, and companion pets. The ideal strain of the present
invention would possess certain characteristics some of which
include the ability to produce a truncated LOS in order to maintain
the adjuvency capability of the blebosome without having the
immunodominant component (Chamberlain et al., Infect. Immun. 57:
2872-2877, 1989); the absence of the PIII protein which, if present
in the gonococcal vaccine, has been shown to stimulate an immune
response that interferes with the immunogenicity of the other
antigens present in the vaccine (Young & Garbe, Res. Microbiol.
142: 55-65, 1991); the ability to stimulate the development of both
humoral and cellular immune responses, and provide both systemic
and mucosal immunity; the ability to grow easily and stably express
the various recombinant proteins; and finally, and most
importantly, the ability to bleb freely.
[0055] The vaccines of the present invention could be used to
develop a protective immune response against diseases caused by
bacteria such as Clostridium tetani, Streptococcus pneumoniae and
Borrelia burgdorferi.
[0056] The N. gonorrhoeae of the present invention can be
engineered to express and direct any heterologous gene of a desired
antigen which would elicit an immune response in a patient.
[0057] The N. gonorrhoeae of the present invention would produce
high numbers of blebs with said desired antigen. The blebosomes can
then be purified away from the bacterial debris and administered
with or without excipients to a patient or animal as a vaccine.
Alternatively, the antigen can be purified from the blebosome
further to provide an antigen for use as a vaccine.
[0058] Vaccines can also be constructed by conjugating mutant
Neisseria to carriers using techniques known in the art. For
example, a vaccine which employs Neisseria derived proteosomes as a
chemically conjugated carrier for the Hemophilus influenzae
capsular polysaccharide has already been approved by the U.S. Food
& Drug Administration for human use and is currently available.
In a like manner, the mutants of the present invention could be
also be conjugated to bacterial polysaccharides.
[0059] Vaccines may be prepared from one or more immunogenic
antigen or blebosome. The preparation of vaccines which contain an
immunogenic antigen(s) as an active ingredient is known to one with
ordinary skill in the art. Typically, such vaccines are prepared as
injectables, either as liquid solutions or suspensions; solid forms
suitable for solution in, or suspension in, liquid prior to
injection may also be prepared. The active immunogenic ingredients
are often mixed with excipients which are pharmaceutically
acceptable and compatible with the active ingredient. Suitable
excipients are, for example, water, saline, dextrose, glycerol, or
the like and combinations thereof. In addition, if desired, the
vaccine may contain minor amounts of auxiliary substances such as
wetting agents, pH buffering agents, and/or adjuvants which enhance
the effectiveness of the vaccine.
[0060] The vaccines are conventionally administered parenterally,
by injection, for example, either subcutaneously or
intramuscularly. Additional formulations which are suitable for
other modes of administration include suppositories and, in some
cases, oral formulations. In addition, the vaccine containing the
blebosomes or antigen(s) purified therefrom may be administered in
conjunction with other immunoregulatory agents, for example, immune
globulin.
[0061] The vaccines may be administered in a manner compatible with
the dosage formulation, and in such amount as will be
prophylactically and/or therapeutically effective. The quantity to
be administered, which is generally in the range of 5 micrograms to
250 micrograms of blebosomes or antigen purified therefrom per
dose, depends on the subject to be treated, capacity of the
subject's immune system to synthesize antibodies, and the degree of
protection desired. Precise amount of active ingredient required to
be administered may depend on the judgment of the practitioner and
may be peculiar to each subject.
[0062] Assays Using Blebosomes
[0063] In another embodiment, the present invention relates to a
method of detecting the presence of antibodies against a disease in
a sample. Using standard methodology well known in the art, a
diagnostic assay can be constructed by coating on a surface (i.e. a
solid support) for example, a microtitration plate or a membrane
(e.g. nitrocellulose membrane), all or part of a blebosome
containing the a specific antigen of the disease to be detected,
and contacting it with a sample from a person or animal suspected
of having said disease. The presence of a resulting complex formed
between the blebosome and antibodies specific therefor in the
sample can be detected by any of the known methods common in the
art, such as fluorescent antibody spectroscopy or colorimetry. This
method can be used, for example, for the diagnosis of viral
diseases such as rabies or hepatitis, bacterial diseases such as
salmonella or pneumonia, fungal diseases and parasitic
diseases.
[0064] In another embodiment, the present invention relates to a
diagnostic kit which contains blebosomes with the desired
antigen(s) and ancillary reagents that are well known in the art
and that are suitable for use in detecting the presence of
antibodies to disease, said antibodies present in samples from a
suspected patient.
EXAMPLES
[0065] The following non-limiting examples illustrate the invention
in more detail. The examples provided describe the use of the
non-selective spot transformation technique for the production of
deletion derivatives. It would not be difficult for someone with
ordinary skill to the art to apply the methodology for the
transformation of an N. gonorrhoeae strain into a hyperblebbing N.
gonorrhoeae, using the hyperblebbing phenotype for the detection of
transformants.
[0066] The following materials and methods were utilized in the
examples that follow.
[0067] Strains and Plasmids
[0068] Recombinant clones utilized in this study have been
described previously (Gunn et al., 1992, J. Bacteriol.
174:5654-5660) and are diagramed in FIG. 1. Strain FA 19 was
obtained from Dr. W. Shafer, Emory University. For clarity, the
nomenclature used for gonococcal DNA R/M systems used in this study
is shown in Table 1.
[0069] Media and Buffers
[0070] All N. gonorrhoeae cultures were grown in GCP broth (Difco;
Detroit, Mich.) plus Kellogg's supplements (Kellogg et al., 1963,
J. Bacteriol. 85:1274-1279) and sodium bicarbonate (0.042%) or on
GCK agar. E. coli cultures were grown in LB broth or on LB plates
(Miller, 1982, Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y.). Wheh needed, ampicillin (35 .mu.g/ml), kanamycin (30
.mu.g/ml), or chloramphenicol (35 .mu.g/ml) were added to the
growth medium. Nalidixic acid (1 .mu.g/ml) or erythromycin (2
.mu.g/ml) were added to N. gonorrhoeae growth medium as needed.
[0071] Chemicals, Reagents and Enzymes
[0072] Chemicals were of analytical grade or higher and were
purchased from Sigma Chemical Co., (St. Louis, Mo.). Restriction
endonucleases were purchased from New England Biolabs (Beverly,
Mass.) or Promega (Madison, Mich.) and were used with the supplied
buffers according to the manufacturer's instructions.
[0073] Genetic Transformations
[0074] E. coli transformations were accomplished via the standard
CaCl.sub.2 procedure (Sambrook et al., 1989, Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.). M13 mp18 and M13 mp19 replicative forms
were transformed into JM101 via the standard CaCl.sub.2 procedure
and plated in a 3 ml overlay containing 0.3 mM IPTG, 1 mg X-gal and
100 .mu.l of an overnight JM101 culture. N. gonorrhoeae was
transformed by one of two methods. Piliated cells were resuspended
to approximately 1.times.10.sup.8 cells/ml in GCP broth containing
10 mM MgCl.sub.2, 1.times. Kellogg's and 0.042% NaHCO.sub.3. The
cells plus DNA (1 .mu.g) were incubated with agitation for three
hours at 37.degree. C. before plating on appropriate media. In the
second method, called the spot transformation technique, piliated
cells were resuspended to moderate turbidity (Klett=35) in GCP plus
10 mM MgCl.sub.2. This culture was diluted 10.sup.-5 and 10.sup.-6
(in GCP+MgCl.sub.2), and 10 .mu.l of each dilution mixed with DNA
(100 ng of linearized or supercoiled form), and the DNA/cell
mixture was spotted onto agar plates. After overnight incubation,
individual colonies within the spot were picked and streaked for
isolation several times. Single isolated colonies were then
screened for the desired generic make-up.
[0075] Detection of ENase/MTase activity
[0076] Commercially available ENases that recognize the same site
as the gonococcal enzymes (isoschizomers) were used to determine if
a clone carried a functional MTase gene. A clone carrying a
functional MTase should be resistant to cleavage by its
corresponding ENase or isoschizomer. All systems except S.NgoVII
have isoschizomers that enable detection by this method. No perfect
isoschizomer is known for the S.NgoVII system [5'-GC(G/C)GC-3'],
but the MTase protects against R.HaeIII (5'-GGCC-3') digestion if
its recognition sequence is followed by a cytosine or preceded by a
guanine and has the appropriate base in the variable position. The
S.NgoVII MTase also protects against digestion at approximately
half of all Fnu4HI sites (5'-GCNGC-3').
[0077] Methylase activity was also detected with strain AP1-200-9
(Piekarowicz et al., 1991, Nucl. Acids Res. 19:1831-1835). This
strain contains a temperature sensitive mcrB allele that, when
activated by methylated DNA at the permissive temperature, causes
DNA damage. DNA damage then induces a chromosomal dinD::lacZ
fusion. Cells were transformed with plasmids containing a potential
MTase gene and grown on LB+Amp (100 .mu.g/ml)+X-gal (35 .mu.g/ml)
plates overnight at 42.degree. C. Plates were then shifted to 3020
C. for three hours and then re-incubated at 42.degree. C. A colony
containing a plasmid with a functional MTase gene will activate the
dinD::lacZ fusion and result in a blue colony.
[0078] The presence of ENase activity was determined by one or more
of the following methods: (1) Reduction in the EOP of Lambda phage
(ii) Reduction in the transformation efficiency of pFT180 or (iii)
Protein isolation techniques. Lambda phage harvested from
DH5.alpha.MCR was used to infect DH5.alpha.MCR harboring the vector
alone or a suspected ENase encoding clone. A reduction in the EOP
was used as a measure of ENase activity. Plasmid pFT180 (isolated
from D HS.alpha.MCR) was used to transform DH5.alpha.MCR containing
a suspected ENase clone and DH5.alpha.MCR containing the vector
alone. A reduction in transformation frequency of the experimental
vs. the control was used as an assessment of ENase activity. ENases
were purified from E. coli containing ENase genes via FPLC by the
method of Piekarowicz et al., 1988, Nucl. Acids Res.
16:5957-5972.
[0079] Southern Blot Analysis
[0080] Digested chromosomal DNAs were electrophoresed on 1% TBE
agarose gels, transferred onto Genescreen (DuPont, Wilmington,
Del.) membranes using the alkaline transfer method of Reed and Mann
(1985, Nucl. Acids Res. 13:7207-722 1), and fixed onto the membrane
by UV exposure (1.5 J/sq.cm). Hybridization and visualization
c-blots was accomplished with the use of Lumi-Phos and the Genius
kit (Boehringer Mannheim, Indianapolis, Ind.). All of the steps
followed the manufacturer's protocol except for the following:
membranes were washed with 1.times. SSC, 0.1% SDS and 0.1.times.
SSC, 0.1 SDS at 65.degree. C.; 1% non-fat dry milk was used as the
blocking agent and in the hybridization solution; and the
anti-digoxigenin antibody was diluted 1:10000 instead of 1:5000.
Colony blots were performed by the method of Sambrook et al.
(1989).
[0081] Construction of pUP1-1
[0082] Two primers were annealed, phosphorylated and ligated to
BamHI digested pUC19. Introduction of these annealed primers into
pUC19 was confirmed by DNA sequencing. The sequence of the multiple
cloning site in this vector is: 5' . . .
GAATTCGAGCTCGGTACCCGGGGATCAGAATTCAGACGGCTGATCC . . . .
TCTAGAGTCGACCTGCAGGCATGCAAGCTTGG . . . 3' (SEQ ID NO: 1 and SEQ ID
NO: 2). In the above sequence, the primer sequence is underlined
and the gonococcal uptake sequence is bolded. This primer has an
EcoRI site in it; therefore, digestion with EcoRI will result in
the loss of half of the multiple cloning site but not the
gonococcal uptake sequence.
[0083] DNA Sequencing/DNA Sequence Analysis
[0084] Genes encoding the enzymes of the S.NgoI, II, and VII R/M
systems were sequenced by the Sanger dideoxy technique using the
Sequenase kit (US Biochemicals, Cleveland, Ohio). DNA was sequenced
using a combination of single-strand M13 clones and double-strand
plasmid clones. Double-strand templates were denatured prior to
labeling by the following protocol. Denaturing solution (2 .mu.l of
N NaOH, 2 mM EDTA) was added to 1 .mu.g of plasmid DNA in a final
volume of 22 .mu.l. After a 5 min. incubation at room temperature,
8 .mu.l of 1 M Tris (pH 4.5) was added and the DNA was
precipitated. Primers obtained from The University of Maryland
Biopolymer Laboratory or Walter Reed Army Institute for Research
were used in the sequencing of S.NgoI, II, VII and VIII genes.
Sequencing reactions were electrophoresed on a 4% polyacrylamide, 8
M urea wedge gel in an LKB sequencing apparatus.
[0085] DNA sequences were analyzed with the use of the computer
programs GENEPRO (Riverside Scientific, Seattle, Wash.) and PC/GENE
(Intelligenetics).
[0086] Construction of R/M Deletion Mutations
[0087] The S.NgoII clone, pLV 155, was digested with NcoI and HpaI,
and the NcoI end was filled in with Klenow. This reaction mixture
was diluted, ligated and the DNA was transformed into strain
DH5.alpha.MCP. A transformant was identified that contained a clone
lacking the 1272 bp NcoI-HpaI fragment (pLV 156). This clone lacks
MTase and ENase activities as demonstrated by sensitivity to HaeIII
digestion and a six log increase in the efficiency of plating of
lambda phage on E. coli containing these plasmids (data not shown).
Strain FA 19 was transformed with this plasmid via the spot
technique, and the resulting colonies were picked and grown to
isolate the naturally occurring 4.2 Kb plasmid (cryptic plasmid)
found in most gonococci (cryptic plasmid). A strain was identified
whose cryptic plasmid was susceptible to HaeIII digestion (called
JUG025).
[0088] S.NgoV
[0089] The S.NgoV clone, pJM5, was digested completely with SspI
and relegated, which deleted a 722 bp region overlapping the MTase
gene and the putative ENase gene. This plasmid, pJM 10, was now
sensitive to digestion with BamHI, demonstrating the loss of MTase
activity (data not shown). Plasmid pJM10 was used to transform N.
gonorrhoeae strain JUG025. Since the gonococcal cryptic plasmid
does rot contain any S.NgoV sites, transformants that had
incorporated this deletion into the chromosome were identified by
lack of hybridization to plasmid pUCV51, which contains one of the
deleted SspI fragments. Several colonies were identified that did
not hybridize to this lasmid. One strain was chosen for further
study and is called JUG026.
[0090] S .NgoIV
[0091] The S.NgoIV clone, pCBB49.1, was digested completely with
BglI and partially with SspI. The BglI end was blunted with T4 DNA
polymerase and the DNA was ligated. Upon screening transformants, a
clone was identified that had lost the 200 bp BglI-sspI fragment
(pCBB49.17). This clone is deficient in both MTase and ENase
activities (data not shown). A NotI fragment containing the entire
insert of pCBB49.17 was cloned into p[Bluescript SK-. A KpnI-SacI
fragment of this clone, which again contained the entire insert,
was cloned into the plasmid pUP1-1 to produce plasmid pUP49.17.
This step was necessary since no gonococcal uptake sequence had
been identified on this clone. Strain JUG026 was transformed with
this construct via the spot technique. Several colonies were picked
and grown, and cryptic plasmid was isolated from these cultures. A
strain, JUG027, was identified that contained cryptic plasmid
susceptible to NgoMI digestion.
[0092] S.NgoVII
[0093] The S.NgoVII clone, pE63, was digested with SalI (the
5'extension filled in with Klenow). This DNA was partially digested
with SspI (there is one SspI site in the vector) The DNA was
ligated and a clone lacking both ENase and MTase activities was
identified that had lost the 1159 bp SalI-SspI fragment (pE640)
(data not shown). Plasmid pE640 was ligated to plasmid pUP1-1 and
an EcoRI dimer of both plasmids was identified (pPUF7). Strain
JUG027 was transformed with plasmid pPUP7, and transformants that
had incorporated the deletion were identified via colony blots by
lack of hybridization to plasmid pE641 (which contains the deleted
SalI-SspI fragment). The resulting strain was labeled JUG028.
[0094] S.NgoI
[0095] The S.NgoI clone, pUPK30, was digested with DraI. There are
three DraI sites in the insert and none in the plasmid vector
(pK18). A clone containing a partial (652 bp) DraI deletion was
identified and named pUPK32. This clone lacked MTase and ENase
activity, as demonstrated by sensitivity to HaeII digestion and a
three log decrease in the efficiency of plating of lambda phage on
E. coli containing these plasmids (data not shown). Strain JUG028
was transformed with pUPK32, and potential transformants were
screened for the incorporation of the deletion by probing colony
blots with a plasmid containing the 652 bp DraI fragment. Several
colonies were identified that did not hybridize to the probe. The
colony picked for further analysis was called JUG029.
[0096] Results
[0097] Analysis of R/M Gene Clones
[0098] Recombinant clones encoding the DNA MTases of the S.NgoI,
II, IV, V, and VII systems have been previously reported (Gunn et
al., 1992; Sullivan and Saunders, 1988; Stein et al., 1995). The
specificities of these systems are shown in Table 1. Two of these
recombinant clones, encoding the S.NgoII and S.NgoIV R/M systems,
have been characterized and sequenced (Sullivan and Saunders, 1988;
Stein et al., 1992). The expression of MTase genes of the S.NgoI,
II, IV and V systems from recombinant plasmids was verified by
demonstrating the resistance of these plasmids to digestion with an
isoschizomer of the system being examined. The detection of a
deletion in the NgoVII R/M system is indirect, because there are no
perfect isoschizomers for this enzyme. The enzyme. Fnu4HI
recognizes the sequence GGNCC. This means that 1/2 of the Fnu4HI
sites will be protected by M.NgoVII. The loss of the M.NgoVII from
the gonococcus will result in more sites being cleaved by this
enzyme. If chromosomal DNA from a strain that lacks M.NgoVII is
digested with Fnu4HI, the resulting bands will in general be of
lower molecular weight.
[0099] The location of the methylase genes on these plasmids was
determined by testing the ability of various deletion subclones to
induce a positive signal in a DNA methylase tester strain
(Piekarowicz et al., 1991). The presence of a functional ENase gene
was determined by at least one of the following procedures:
demonstrating a reduction in the efficiency of plaguing of phage
lambda by E. coli cells containing the clone; showing the ability
of cells containing the clone to restrict transforming DNA; or
isolating proteins with ENase activity from cells containing the
plasmids. Using at least one of these assays for each system, we
were able to detect both ENase and MTase activity in clones
encoding NgoI, II, IV and VII and MTase but no ENase activity for
the NgoV clone (data not shown). Using deletion and subclone
analysis, we localized the DNA encoding these genes (see FIG. 1 for
restriction maps). DNA sequence analysis showed that although the
NgoV clone lacked ENase activity, it contained a partial ORF
downstream of the MTase gene, and this ORF was positioned similarly
to the ENase gene in the other R/M systems. We believe that this
ORF represents the NgoV ENase.
[0100] Construction of Plasmid Deletions and Identification of
Gonococcal Transformants Containing Chromosomal Deletions.
[0101] In order to construct a R/M deficient gonococcal strain with
transformation techniques, the transforming DNA must contain a
gonococcal uptake sequence. Because no gonococcal uptake sequence
was identified in the DNA sequence of our clones that encoded the
NgoIV and NgoVII R/M systems (data not shown), a plasmid vector
containing a gonococcal uptake sequence was constructed (pUP1-1).
This was accomplished by inserting a linker containing this
sequence into the BamHI site of pUC19. Since pUC19 does not
replicate in the gonococcus, when the DNA deletions of interest are
cloned into this plasmid and then introduced into the gonococcus by
transformation, the deletions are either lost from the cell or
enter the chromosome via homologous recombination.
[0102] Because we wished to disrupt multiple genes, inactivation of
the desired gene by the insertion of a selectable marker was not
practical. Information from restriction mapping was used to
construct deletions that overlap the linked MTase and ENase genes
of the S.NgoI, II, IV, V, and VII systems. FIG. 1 shows the DNA
inserts of each plasmid clone and the segments that were deleted on
each insert. These deletions were specific for the predicted ENase
and MTase ORFs and ranged in size from 1.8 Kb (NgoII) to 200 bp
(NgoIV). All deletions were constructed in such a way that there
was at least 100 bp of gonococcal DNA flanking the deletions. This
is the minimum size needed for efficient recombination with
homologous regions of the chromosome (DCS, unpublished
observations).
[0103] Because there was no selection for successful recombination
of these deletions onto the chromosome, the following technique was
used to identify transformants that had acquired the desired
deletion. This procedure is based on the fact that all gonococcal
cells are competent to take up extracellular DNA. Because of this,
if a limited number of cells is incubated with an excess amount of
DNA, all cells should acquire the transforming DNA. The chance of
identifying a transformant that acquired the deletion would only be
limited by the efficiency of the gonococcus to incorporate the
deletion into its chromosome. Piliated cells were swabbed from a
plate and resuspended in GCP broth plus 10 mM MgCl.sub.2 to
moderate turbidity (Klett=35). The cells were vortexed and diluted
in GCP+MgCl.sub.2. Ten-fold dilutions of the cells were prepared, a
10 .mu.l aliquot of each dilution was mixed with approximately
0.1-0.5 .mu.g of DNA, and the DNA/cell mixture was spotted onto the
surface of an agar plate. After overnight incubation, isolated
colonies within the spot were picked and re-streaked. A single
colony was re-streaked at least twice more before testing colonies
for incorporation of the deletion. This is necessary for two
reasons: (i) a cell may have divided before acquiring the DNA,
resulting in a mixed population of cells: those that had recombined
the deletion into its chromosome, and those that had not; and (ii)
Piliated gonococci clump and most colonies are not derived from a
single cell. Using this technique, N. gonorrhoeae strain FA19 was
successively transformed with each deletion construct. This
transformation technique worked well and at least 20% of the
colonies examined in each experiment acquired the desired
deletion.
[0104] Two methods were used to verify that the desired deletion
had been introduced into the chromosome. Chromosomal DNA was
isolated from potential transformants and incubated with the
isoschizomer of the system that was being deleted. Successful
digestion of this DNA indicated loss of MTase function and
demonstrated that the deletion had been incorporated. To verify
that the loss of function was due to a deletion and not to
insertional inactivation, we probed colony blots of potential
transformants with a part of the DNA fragment that had been deleted
from the plasmid clone. Colonies that failed to hybridize to the
probe must have incorporated the deletion. All of the colonies that
were tested that no longer expressed the methylase understudy bound
the methylase-specific probe.
[0105] A Southern blot was performed to compare digestions of FA19
and the JUG029 (the strain containing deletions of the NgoI, II,
IV, V, and VII R/M systems). Each set was digested with the
appropriate enzymes, electrophoresed, and blotted. The membrane was
cut into strips and each strip was probed with DNA that traverses
the deleted region in each of the five R/M systems. Set 1 was
digested with DraI and probed with the PstI-XhoI fragment of
pUPC30. Chromosomal DNA from JUG029 was missing the 652 bp DraI
fragment. In set 2, the NgoII system was examined. JJGO29 was
missing the 1414 bp Sau3AI band that spans the deletion. The second
hybridizing band was larger than the FA19 band. Subsequent analysis
of Southern blots of chromosomal DNA digested with other enzymes
demonstrate that the deletion extends further upstream of the NCoI
site (data not shown). The NgoIV system was examined in set 3. SspI
digested chromosomal DNA showed the expected loss of the 400 bp
SspI fragment and the subsequent 250 bp increase in size of the
largest SspI fragment. In set 4, chromosomal DNA was digested with
RsaI to confirm the NgoV deletion. The deletion strain lacks the
452 bp and 684 bp fragments due to the loss of the RsaI sites at
positions 1075 and 1527. The expected increase in size of the
largest fragment can also be observed. Set 5 examined the NgoVII
deletion. Chromosomal DNA was digested with EcoRI+HindIII. The
hybridizing EcoRI-HindIII fragment is 1.2 Kb less than that of
FA19.
[0106] To demonstrate loss of biological MTase activity of the five
R/M systems that were deleted in JUG029, chromosomal DNA was
isolated and incubated with the isoschizomers of the systems that
were deleted. Successful digestion of the chromosomal DNA would
indicate the functional loss of the MTase. While FA19 chromosomal
DNA remains undigested with isoschizomers of NgoI, II, IV and V,
JUG029 digestion appears to go to completion. In analyzing the
NgoVII system, it is apparent that chromosomal DNA isolated from
JUG029 is digested to a greater extent than chromosomal DNA
isolated from FA19. Taken together, these data demonstrate that the
appropriate deletions were all successfully introduced into the
chromosome, and that JUG029 possessed the appropriate methylation
defective phenotype.
[0107] Comparison of the Transformation Frequency of FA19 vs.
JUG029
[0108] To determine if the loss of five ENases would make the
gonococcus more amenable to transformation with DNA propagated in
E. coli, JUG029 and FA19 were transformed with pSY6 and pRDL2.
Plasmid pSY6 contains DNA that encodes a mutant DNA gyrase (Stein
et al., 1991). When this mutation is introduced into the
chromosome, cells become resistant to nalidixic acid.
Transformation with this plasmid should not be affected by the
endogenous ENases because nalidixic acid resistant transformants
arise as a recombination between the linearized plasmid DNA and the
host chromosome. The data presented in Table 2 show that the
transformation frequency to Nal.sup.R with pSY6 was similar for
both strains (1.8.times.10.sup.-4 for FA19 vs. 1.7.times.10.sup.-4
for JUG029).
1TABLE 2 Examination of in vivo restriction by FA19 and JUG029
Strain pSY6 (DH5.alpha.MCR) .sup.b pRDL2 (F62) .sup.c pRDL2
(DH5.alpha.MCR) FA19 1.8 .times. 10.sup.-4 2.2 .times. 10.sup.-6
<1.6 .times. 10.sup.-9 JUG029 1.7 .times. 10.sup.-4 4.1 .times.
10.sup.-6 1.5 .times. 10.sup.-8 a N.gonorrhoeae strains were
transformed with 35 ng of pSY6 or 0.5 .mu.g of pRDL2 and incubated
for 3 hours at 37.degree. C. with shaking before being plated on,
appropriate media. Transformation frequency is the number of
transformants per CFU per ml. The frequencies presented are from a
single experiment; however, the experiment was repeated three times
with no significant differences between trials. b pSY6 contains a
mutant form of the DNA gyrase gene that, upon recombination with
the host chromosome, provides the cell with resistance to nalidixic
acid. c pRDL2 is a pLEE20 derivative (Ery.sup.R) which contains a
456 bp gonococcal DNA insert containing an uptake sequence. When
this plasmid is isolated from a fully MTase proficient gonococcal
strain (F62 in this case), it is methylated and upon
transformation, should not be subject to host restriction.
[0109] In order for a plasmid to successfully transform the
gonococcus, it must recircularize and form a functional plasmid.
Plasmid pRDL2, a pLEE20 derivative carrying a 456 bp gonococcal DNA
fragment containing one copy of the uptake sequence, can be grown
in E. coli or N. gonorrhoeae. Therefore both methylated (from N.
gonorrhoeae) and non-methylated (from E. coli) pRDL2 can be used in
the transformation assays. Methylated pRDL2 should not be
restricted upon transformation of the gonococcus, but
non-methylated pRDL2 may be subject to host restriction. The
plasmid transformation frequencies using methylated pRDL2 were
similar for FA19 and JUG029 (2.2.times.10.sup.-6 and
4.1.times.10.sup.-6, respectively). Transformation with
non-methylated pRDL2 resulted in a few transformants in JUG029
(1.5.times.10.sup.-6) but none in FA19 (<1.6.times.10.sup.-9- ).
This data demonstrates that although JUG029 is still able to
restrict transforming DNA, a measurable reduction in its
restriction ability can be detected. This indicates that at least
some of the remaining ENases are able to participate in host
mediated restriction.
REFERENCES
[0110] Biswas et al, (1977) J. Bacteriol. 129:983-992.
[0111] Biswas and Sparling, (1981) J. Bacteriol. 145:638-640.
[0112] Butler and Gotschlich, (1991) J. Bacteriol.
173:5793-5799.
[0113] Drazek et al, (1995) J. Bacteriol. ______.
[0114] Goodman and Scocca, (1988) Proc. Natl. Acad. Sci.
85:6982-6986.
[0115] Gunn et al, (1992) J. Bacteriol. 174:5654-5660.
[0116] Kellogg et al, (1963) J. Bacteriol. 85:1274-1279.
[0117] Korch et al, (1983) J. Bacteriol. 155:1324-1332.
[0118] Mathis and Scocca, (1984) J. Gen. Microbiol.
130:3165-3173.
[0119] Miller, (1982) Experiments in molecular genetics. Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
[0120] Piekarowicz et al, (1988) Nucl. Acids Res. 16:5957-5972.
[0121] Piekarowicz et al, (1991) Nucl. Acids Res. 19:1831-1835.
[0122] Reed and Mann, (1985) Nucl. Acids Res. 13:7207-7221.
[0123] Sambrook et al, (1989) Molecular cloning: a laboratory
manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.
[0124] Sandlin and Stein, (1994) J. Bacteriol. 176:2930-2937.
[0125] Sox et al, (1979) J. Bacteriol. 138:510-518.
[0126] Sparling (1966) J. Bacteriol. 124:1364-1371.
[0127]
[0128] Stein et al, (1988) Role of restriction and modification on
genetic exchange in Neisseria gonorrhoeae. In Gonococci and
Meningococci. Poolman et al (eds). 5th International Neisseria
Conference. Kluwer Academic Publishers, Dordrecht, Netherlands. pp.
323-327.
[0129] Stein et al, (1991) Antimicrob. Agents Chemother.
35:622-626.
[0130] Stein (1991) Can. J. Microbiol. 37:345-349.
[0131] Stein et al, (1992) J. Bacteriol. 174:4899-4906.
[0132] Sullivan and Saunders, (1988) Determination of the
endonuclease and methylase content of Neisseria gonorrhoeae strain
P9 and the cloning therefrom of two functional methylase genes. In
Gonococci and Meningococci. Poolman et al (eds). 5th International
Neisseria Conference. Kluwer Academic Publishers, Dordrecht,
Netherlands. pp. 329-334.
Example 2
Materials and methods
[0133] Bacterial Strains.
[0134] N. gonorrhoeae F62 was obtained from P. Frederick Sparling
(University of North Carolina, Chapel Hill, N.C.). E. coli DH5 MCR
was obtained from Bethesda Research Laboratories (Bethesda, Md.).
Gonococci were grown in GCP broth supplemented with Kellogg's
solution (White, L. A., D. S. Kellogg, Jr., 1965, Appl. Micro.
13:171-74) and 0.042% sodium bicarbonate and on GCK agar containing
erythromycin (2 .mu.g/ml), vancomycin (3 .mu.g/ml), colistin (7.5
.mu.g/ml), and nystatin (1.25 units/ml) as needed. E. coli DH5 MCR
was grown in L broth or LB agar containing ampicillin (30
.mu.g/ml), kanamycin (30 .mu.g/ml), erythromycin (300 .mu.g/ml),
and x-gal (35 .mu.g/ml) as needed.
[0135] Chemicals, Reagents, and Enzymes.
[0136] Restriction enzymes and T4 DNA ligase were purchased from
New England Biolabs (Beverly, Mass.). Chemicals used for
transformation studies were reagent grade or better and were
purchased from Sigma Chemical Co. (St. Louis, Mo.) unless otherwise
specified.
[0137] DNA Manipulations.
[0138] Plasmid DNA was isolated by the alkaline lysis procedure and
purified on cesium chloride-ethidium bromide gradients (Birnboim
& Doly, 1979, Nucl. Acids. Res. 7: 1513-1523). Plasmid DNA was
introduced into E. coli using the CaCl2 transformation method
(Sambrook, et al., 1989, In Molecular Cloning, 2nd ed. Cold Spring
Harbor Press, Cold Spring Harbor, N.Y.).
[0139] DNA Sequencing.
[0140] DNA sequencing reactions were performed by the Sanger
dideoxy method (Sanger et al., 1977, Proc. Natl. Acad. Sci. (USA)
74: 5463-5467) using the Sequenase Version II sequencing kit
(United States Biochemicals, Cleveland, Ohio) and -[35S] DATP (New
England Nuclear, DuPont, Boston, Mass.). PCR sequencing was
performed directly on the PCR products as directed using the
CircumVent thermal cycle O dideoxy DNA sequencing kit (New England
Biolabs, Beverly, Mass.). Sequencing products were separated on a
55 cm by 0.2 mm 4% acrylamide gel (7 M urea in 1.times. TBE buffer
(100 mm Tris, 0.083 M Boric acid, 1 mM EDTA)) with a 0.6 mm wedge
(maximum thickness) in the last 10 cm. The gels were fixed, dried,
and exposed to XOMAT x-ray film (Kodak) for 36 hours.
[0141] Polymerase Chain Reaction.
[0142] PCR was performed using the GeneAmp PCR kit from Perkin
Elmer Cetus (Norwalk, Conn.) under the recommended conditions. The
100 l reaction was performed with a one minute denaturation at
94.degree. C. followed by a one minute annealing at 50.degree. C.
and a one minute extension at 72.degree. C. for a total of 30
cycles. Primers used in this study for both PCR and sequence
analysis were made at MedImmune. The sequence of the primers used
to amplify H.8RS1 were: H.8-5', CCCTGAATTCAAATCATACTGAAT- TAT (SEQ
ID NO:3); H.8-3', CCGATCAGTTCAAAACTGC (SEQ ID NO:4). The sequence
of the primers used to add the SphI sites into H.8 were
GGCTGCATGCGGCGGAG and CCGCCGCATGCAGCCAAAG (SEQ ID NO:5). The
sequence of the primers used to amplify ospA were: OspA-5',
ATTCCAGTCGACAAGCAAAATGTTAGCAGC (SEQ ID NO:6); OspA-3',
ATTCCAGCATGCTTATTTTAAAGCGTTTTTAATTTC (SEQ ID NO:7).
[0143] Conjugation.
[0144] Plasmids were introduced into gonococcal strain F62 by
conjugation with E. coli S17-1 (Nassif, X., D. Puaoi, and M. So.
1991. Transposition of TN1545-3 in the pathogenic Neisseriae: a
genetic tool for mutagenesis. J. Pact. 173:2147-2154). Conjugations
were performed by filter mating and allowed to proceed for three
hours. To select for gonococcal transconjugants, the cells on the
filter were resuspended in GCP broth and plated on GCK containing
erythromycin, vancomycin, nystatin, and colistin
[0145] Blebosome Isolation
[0146] Western Blotting.
[0147] Blebosome lysates (approximately ug of total protein) were
analyzed by SDS-PAGE and Western blot with the OspA-specific mAb
H5332 (Green, B. A., T. Quinn-Dey, and G. W. Zlotnick. 1987.
Biologic activities of antibody to a peptidoglycan-asociated
lipoprotein of Haemophilus influenzae against multiple clinical
isolates of H. influenzae type b. Infect. Immun. 55:2878.).
Expression of OspA was compared to purified OspA lipoprotein,
kindly provided by Dr. L. Erdile (Connaught Laboratories, Inc.,
Swiftwater, Pa.). Protein bands reacting with H5332 were visualized
after incubation with a secondary antibody (goat anti-mouse IgG
conjugated to horseradish peroxidase) using the nehanced
chemiluminescent detection (ECL) system (Amersham Corp., Arlington
Heights, Ill.) according to the manufacturer's instructions.
[0148] Triton X-114 Fractionation.
[0149] Blebsomes were suspended in PBS, disrupted by sonication and
solubilized at 4.degree. C. by the addition of Triton X-114 (TX114)
to 2% (volume/volume) Insoluble material (cell wall-enriched
fraction) was sedimented by centrifugation at 100,000.times. g and
the supernatant was subjected to detergent phase partitioning
(Bordier, C. 1981. Phase separation of integral membrane proteins
in Triton X-114 solution, J. Biol. Chem. 265:1604.) After briefly
warming (37.degree. C.) the TX114 solution, separation of aqueous
and detergent phases was achieved by a short centrifugation. The
two phases were back-extracted three times and proteins in
representative samples were precipitated by the addition of nine
volumes of acetone. A portion of each culture supernatant was
subjected to SDS-PAGE, transferred to nitrocellulose, and blotted
with anti-OspA mAb H5332.
[0150] Immunogenicity of Blebosome Constructs.
[0151] Sear were collected from the tail vein of immunized mice at
various times after immunication and pooled for each group of mice
to monitor antibody responses by ELISA. ELISA plate (Immunolon 4)
were coated with 50 ul of whole Borrelia (strain 31) suspended in
carbonate buffer (pH 9.6) at 10 .mu.g/ml or with temperature or
overnight at 4.degree. C. The antigen solution was then removed and
plates were incubated with blocking solution (0.5% BSA and 0.5%
nonfat dry milk) in PBS with 0.1% Tween-20 (PBS-T20) for 1 h at
room temperature. Two-fold serial dilutions of serum starting at
{fraction (1/200)} were made in blocking solution and 50 ul of each
dilution was added to duplicate wells of the antigen-coated plate.
After an incubation at room temperature for 1 h., the plates were
washed with PBS-T20 and incubated with 50 ul of a 1:1000 PBS-T20
dilution of peroxidase-conjugated goat anti-mouse IgG (Kirkegaard
and Perry Laboratories, Inc., Gaithersburg, Md.) secondary antibody
for 1 h. Color was developed with
2,2'-azino-dif[3-ethyl-benzthiazoline sulfonate] substrate reagent
(Kirkegaard and Perry Laboratories, Inc.), and measured by
absorbance at 405 nm on an ELISA reader (dynatech). Endpoint titers
were defined as the highest dilution at which the A405 values were
twice the values for normal mouse sera diluted to an equivalent
concentration.
[0152] Challenge Studies.
[0153] Challenge doses were derived by expansion of a single colony
of the low-passage B. burgdorferi sh.2 strain (Schwan, T. G., W.
Burgdorfer, M. E. Crumpf, and R. H. Karstens. 1988. The urinary
bladder, a consistent source of Borrelia burgdorferi in
experimentally infected white-footed mice (Peromyscus leucopus). J.
Clin. Microbiol. Immunized mice and control mice were challenged
intradermally at the base of the tail with 10.sup.4 spirochetes.
This represented approximately 100 ID.sub.50 units of the B.
burgdorferi Sh. 2 strain. Mice were killed 13 days after challenge,
and bladder and tibiotarsal joint tissues were harvested and
cultured in BSK-II media as described previously (Erdile, L. F., M.
Brandt, D. J. Warakomski, G. J. Westrack, A. Sadziene, A. G.
Barbour, and J. P. Mays. 1993. Role of attached lipid in
immunogenicity of Borrelia burgdorferi OspA. Infect. Immu. 61:81).
Cultures were monitored for 14 days by phase contrast microscopy
for the presence of spirochetes. The presence of one or more
spirochetes per 20 high-power fields in any culture was scored as a
positive infection.
Results
[0154] Construction of Neisseria gonorrhoeae Expressing OSpA.
[0155] N. gonorrhoeae produces a lipoprotein, H.8 as one of its
normal outer membrane proteins. In order to determine if it was
possible to overexpress this protein in the outer membrane of the
gonococcus, the gene encoding this protein was cloned onto a high
copy number plasmid, pLEE20. The DNA sequence encoding this protein
was amplified via the PCR from N. gonorrhoeae strain F62, based on
sequence information published for strain R10 (Baehret al., ______,
Mol. Microbiol. 3:49-55). Primers were designed in such a way that
DNA sequences 5' of the coding sequence contained an EcoRI site,
and DNA sequences 3' of the gene contained a HinDIII site. The
amplified DNA was digested and inserted into pLEE20 that had been
digested with EcoRI and partially digested with HinDIII. The
ligated DNA was introduced into Escherichia coli DH5 MCR, and
erythromycin resistant transformants containing the amplicon were
identified. The DNA sequence was determined from one of these
clones to verify that the amplified DNA encoded H.8. The data
indicated that the cloned gene was H.8 (data not shown).
[0156] The H.8 encoding construct was introduced into E. coli
strain S17-2 by transformation. This strain was used to mobilize
the pLEE20-H.8 into N. gonorrhoeae F62 via conjugation.
Transconjugants were selected on Thayer Martin media supplemented
with erythromycin. SDS-PAGE profiles of F62(pLEE20-H.8) indicated
that this strain expressed more H.8 than seen in wild-type strains.
These experiments demonstrate that it is possible to overexpress
lipoproteins in the gonococcus.
[0157] To ensure that N. gonorrhoeae would be able to process the
Borrelia OspA signal sequence correctly, the protein was expressed
as a fusion protein. In order make this fusion, an SphI site was
introduced into the H.8 sequence at a site that corresponded to the
cysteine that serves as a lipidation signal. The DNA sequence
encoding OspA was amplified from pTRH44 (Bergstromet al., 1989,
Mol. Microbiol. 3:479-486) by PCR. Primers were designed in such a
way as to introduce an SphI site at a location that corresponded to
the cysteine that is lipidated in OspA. The primer that
corresponded to the 3 end of the gene also contained an SphI site.
The amplicon and the cloning vector were digested with SphI,
ligated and introduced into E. coli DH5 MCR. Plasmids containing
the insert were identified, and the DNA sequence of the construct
verified by DNA sequence analysis. This plasmid was introduced into
E. coli S17-2, and then introduced into the gonococcus via
conjugation, as described above.
[0158] Quantitation and Localization.
[0159] The amount of OspA expresed in blebosomes was quantified
using a quantitative Western assay in which the levels of binding
of an anti-OspA mAb to blebosomes was compared to binding to
purified OspA. The result of that analysis suggests that OspA
represents approximately 0.2% of total blebosome protein.
[0160] To determine if expression of the OspA gene from the
lipoprotein expression vector resulted in lipid acylation of
recombinant OspA, blebosomes were subjected to Triton X-114
detergent phase partitioning analysis to enrich for
membrane-associated lipoproteins (Bordier, 1981, J. Biol. Chem.
256:1604; Radolf et al., 1988, Infect. Immun. 56:490.). Expression
of the OspA protein in association with the H8 lipidation signal
sequence resulted in a product that was exclusively located in the
detergent-soluble fraction, which is highly enriched for lipophilic
proteins. This finding indicates that fusion of the H8 signal
sequence to OspA resulted in a product that was efficiently
exported and post-translationally modified in the blebosome
membrane.
[0161] Immunization Studies.
[0162] A panel of 5 different mouse strains was analyzed for
anti-OspA antibody responses following immunication with
OspA-expressing blebosomes (figure sdlfdjasllkfj). The results
suggest that both the endotoxin-resistance locus and other loci may
control immune responses to OspA-expressing blebosomes. Thus, the
C3H/HejLPS hyporesponsive strain generated substantial anti-OspA
responses following boosting with OspA blebosomes whereas the
related C3HeB/Fej LPS responsive strain did not, suggesting
involvement of the endotoxin resistance locus in responses to
blebosomes. In addition, several strains generated different
responses to blebosome-expressed OspA even though they all carried
the Lps allele, suggesting involvement of non-Lps-associated loci
in this phenomenon. Thus, BALB/c mice generated substantial OspA
responses following boosting with OspA-blebs whereas SJL/J and
C57BL/6 did not.
[0163] Challenge Studies.
[0164] The ability of OspA-expressing blebosomes to induce
protective immune responses was examined by immunizing animals and
assessing their antibody responses against OspA and Borrelia whole
cell lysate two weeks following two boosts. The results showed that
all animals immunized with OspA blebs generated detectable
anti-OspA responses, with 4/5 animals demonstrating titers greater
than {fraction (1/3200)}. These same four animals also exhibited
reactivity against a lysate prepared from whole Borrelia (the fifth
animal exhibited no detectable anti-Borrelia response). None of the
animals immunized with non-recombinant blebosomes generated
detectable anti-OspA or anti-Borrelia responses.
[0165] These animals were challenged with live Borrelia. Two weeks
after challenge, all of the animals immunized with nonrecombinant
blebosomes contained recoverable Borrelia in their bladders and
tibiotarsal joints. In contrast, recoverable Borrelia were only
obtained from 1/5 animals immunized with OspA blebosomes. In this
group, culturable Borrelia were only obtained from the animal with
the lowest anti-OspA titers.
[0166] Approximately 40% of the immunized mice achieved antibody
titers greater than 1:400. 100% of the mice with this antibody
titer were protected from the challenge.
Discussion
[0167] The data in this example demonstrate the potential use of
recombinant gonococcal blebosomes as a vaccine delivery system.
Blebosomes express many of the desirable features of both living
and nonliving delivery systems: while they avoid many of the
disadvantages associated with the use of live delivery systems in
young or immunocompromised individuals, they can be engineered to
express antigens in the context of a biologic membrane that is
easily purified without the use of extensive, potentially
denaturing purification procedures.
[0168] In the experiments presented here, a fusion protein
consisting of the OspA antigen of Borrelia burgdorferi linked to
the lipidation signal sequence of the Neisseria H8 surface antigen
was expressed. The intent of constructing this fusion protein using
an endogenous lipidation signal was to avoid any potential problems
in the transfer and/or processing of foreign signals within
Neisseria. However, the lipidated surface protein P6 from
Hemophilus influenzae has also been successfully expressed under
control of its own lipidation signal sequence, demonstrating the
localization of this antigen to the blebosome surface in a
detergent-soluble form, suggesting that Neisseria is capable of
recognizing and processing foreign bacterial lipidation
signals.
[0169] It is apparent that multiple genetic loci may be involved in
determining responsiveness to antigens presented by gonococcal
blebosomes. In a limited strain survey, both the Lps locus and
other unmapped loci appear to control responsiveness to OspA.
Because of the known adjuvant properties associated with LPS, it is
perhaps not surprising to see an effect of the Lps locus on immune
responses elicited by this construct.
[0170] In the experiments described here, OspA was used as a test
immunogen since responses to this antigen have been shown to be
protective against challenge with OspA-expressing Borrelia isolates
0. However, not all B. burgdorferi isolates express this antigen 0,
and some tick-borne isolates that initially express OspA have
recently been shown to turn off expression following a blood meal
0. Other Borrelia antigens, in combination with OspA, may induce
more broadly efficacious immune responses than OspA alone.
[0171] The results of these immunogenicity studies indicate that
IgG responses can be induced against a foreign lipoprotein
expressed on the surface of blebosomes. The ability of these
preparations to induce OspA-specific Th or CTL was not examined.
High levels of IFN-g and IL-2, but not IL-4, have been observed in
culture supernatants of Neisserial lysate-stimulated lymph node
cells from blebosome-immunized mice, suggesting that blebosomes may
stimulate strong Th1 responses. The possibility that these
preparations stimulate CTL responses awaits the cloning of antigens
encoding known CTL epitopes into Neisseria. It is likely that
blebosome-expressed antigens will be processed mainly through an
endocytic pathway and therefore presented mainly in the context of
MHC class II molecules.
[0172] The blebosomes used in these studies generated protective
antibody responses without apparent toxicity. However, doses 3-5
fold higher than those reported here resulted in significant
toxicity. Fur ruffling was associated with doses above 30 mg/animal
and certain blebosome preparations were lethal at doses of 100
mg/animal or higher, when given intraperitoneally, particularly
after boosting. These toxic effects were not diminished by giving
the antigen intranasally, or when given intraperitoneally on alum.
Future experiments will examine the effects of other routes of
administration on toxicity, as well as the influence that
modulating levels of LOS on the surface of the blebosome has on
toxicity of blebosome preparations. In this regard, a series of
Neisserial mutants has recently been generated that express varying
levels of LOS on their surface. It will be interesting to determine
whether strains expressing decreased amounts of surface LOS will
maintain immunogenicity while decreasing toxicity.
[0173] In summary, gonococcal blebosomes expressing a foreign
bacterial surface protein, OspA from Borrelia burgdorferi, are
capable of inducing immune responses that protect mice against
Borrelia challenge.
Example 3
[0174] Cloning of the P6 Gene of Haemophilus influenzae
[0175] The P6 gene of H. influenza was cloned using PCR. Briefly,
two primers, each flanked by EcoRI sites, were used to amplify a
fragment of approximately 500 bp (FIG. 6A). The amplified fragment
was cloned into pLEE20 (FIG. 7A). Clones were analyzed by
restriction analysis. Clones containing the insert in both
orientations were obtained. Expression was analyzed by reacting
colonies with polyclonal antibodies directed to P6 protein.
[0176] pLEE20-p6 was introduced into E. coli strain SB17-2.
Plasmids obtained from E. coli were introduced into N. gonorrhoeae
F62 via conjugation. Transconjugants were screened for reactivity
with antibody, and expression was verified using SDS-PAGE (FIG. 8)
and Western blot (FIG. 9).
Example 4
[0177] Cloning of the pspA Gene of Streptococcus pneumoniae
[0178] The pspA gene of S. pneumoniae was cloned using PCR.
Briefly, two primers, each flanked by EcoRI sites, were used to
amplify a fragment of approximately 1 kb (FIG. 6B). The amplified
fragment was sequenced and cloned into pLEE20 (FIG. 7B). Clones
were analyzed by restriction analysis.
[0179] pLEE20-pspA is introduced into E. coli strain SB17-2.
Plasmids obtained from E. coli are introduced into N. gonorrhoeae
F62 via conjugation. Transconjugants are screened for reactivity
with antibody, and expression is verified using SDS-PAGE and
Western blot.
[0180] This application is a continuation of U.S. Ser. No.
08/443,514, entitled "VACCINE DELIVERY SYSTEM", filed May 18, 1995
and the file wrapper continuation application thereof (Attorney
Docket No. 2747-095-27 FWC). The full text of that application is
hereby incorporated by reference.
[0181] Obviously, numerous modifications and variations of the
present invention are possible in light of the above teachings. It
is therefore to be understood that within the scope of the appended
claims, the invention may be practiced otherwise than as
specifically described herein.
* * * * *