U.S. patent application number 09/996634 was filed with the patent office on 2002-11-21 for mycobacterium tuberculosis dna sequences encoding immunostimulatory peptides and methods for using same.
This patent application is currently assigned to University of Victoria Innovation and Development Corporation. Invention is credited to Nano, Francis E..
Application Number | 20020172684 09/996634 |
Document ID | / |
Family ID | 26667396 |
Filed Date | 2002-11-21 |
United States Patent
Application |
20020172684 |
Kind Code |
A1 |
Nano, Francis E. |
November 21, 2002 |
Mycobacterium tuberculosis DNA sequences encoding immunostimulatory
peptides and methods for using same
Abstract
Nucleotide sequences isolated from Mycobacterium tuberculosis
are disclosed. These sequences encode immunostimulatory peptides.
Also disclosed are vaccine preparations formulated using these
peptides.
Inventors: |
Nano, Francis E.; (Victoria,
CA) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
One World Trade Center
Suite 1600
121 S.W. Salmon Street
Portland
OR
97204
US
|
Assignee: |
University of Victoria Innovation
and Development Corporation
|
Family ID: |
26667396 |
Appl. No.: |
09/996634 |
Filed: |
November 28, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09996634 |
Nov 28, 2001 |
|
|
|
09477135 |
Jan 3, 2000 |
|
|
|
09477135 |
Jan 3, 2000 |
|
|
|
08990823 |
Dec 15, 1997 |
|
|
|
09477135 |
Jan 3, 2000 |
|
|
|
PCT/US96/10375 |
Jun 14, 1996 |
|
|
|
60000254 |
Jun 15, 1995 |
|
|
|
Current U.S.
Class: |
424/190.1 ;
435/7.32; 530/350; 536/23.7 |
Current CPC
Class: |
G01N 33/5695 20130101;
G01N 2333/35 20130101; A61K 39/00 20130101; C07K 14/35
20130101 |
Class at
Publication: |
424/190.1 ;
530/350; 536/23.7; 435/7.32 |
International
Class: |
A61K 039/04; G01N
033/554; G01N 033/569; C07H 021/04; C07K 014/35 |
Claims
1. An isolated immunostimulatory peptide selected from the group
consisting of: (a) an amino acid sequence selected from the group
consisting of SEQ ID NOS: 126-138 and fragments thereof; (b) amino
acid sequences that differ from those specified in (a) by one or
more conservative amino acid substitutions; and (c) amino acid
sequence having at least 60% sequence identity to the sequences
specified in (a) or (b).
2. An isolated nucleic acid molecule, encoding an immunostimulatory
peptide according to claim 1.
3. A method of stimulating an immune response, comprising
administering to a subject one or more of the immunostimulatory
peptides of claim 1.
4. A method of detecting a Mycobacterium tuberculosis specific
binding agent, comprising: (a) contacting a sample, suspected of
containing a Mycobacterium tuberculosis specific binding agent,
with one or more of the immunostimulatory peptides of claim 1; (b)
allowing a complex comprising the immunostimulatory peptide and the
specific binding agent to form; and (c) detecting the presence of
the complex.
5. The method of claim 4, wherein the immunostimulatory peptide is
selected from the group consisting of SEQ ID NOS: 126-138, and
fragments thereof.
6. An immunostimulatory preparation, comprising one or more of the
immunostimulatory peptides of claim 1.
7. The immunostimulatory preparation of claim 6, further comprising
a pharmaceutically acceptable excipient, diluent, adjuvant, or a
mixture thereof.
8. An isolated immunostimulatory peptide, comprising an amino acid
sequence selected from the group consisting of SEQ ID NOS:
126-138.
9. A composition, comprising a Mycobacterium tuberculosis specific
binding agent that specifically binds to the isolated
immunostimulatory peptide of claim 1.
10. The composition of claim 9, wherein the Mycobacterium
tuberculosis specific binding agent further comprises at least one
polyclonal antiserum.
11. The composition of claim 10, wherein the Mycobacterium
tuberculosis specific binding agent further comprises a monoclonal
antibody.
12. A method for determining whether a subject has been previously
infected with Mycobacterium tuberculosis, the method comprising:
(a) administering to a subject one or more of the immunostimulatory
peptides of claim 1; and (b) detecting an immune response in the
subject.
Description
CROSS REFERENCE TO RELATED CASES
[0001] This application is a continuation-in-part of co-pending
U.S. application Ser. No. 08/990,823, filed Dec. 15, 1997, which is
incorporated herein by reference. The Ser. No. 08/990,823
application claims priority from PCT Application No. U.S. 96/10375,
filed Jun. 14, 1996, which claims priority from U.S. Provisional
Application No. 60/000,254, filed Jun. 15, 1995, all of which are
incorporated herein by reference.
I. BACKGROUND
[0002] A. The Rise of Tuberculosis
[0003] Over the past few years the editors of the Morbidity and
Mortality Weekly Report have chronicled the unexpected rise in
tuberculosis cases. It has been estimated that one billion people
are infected with M. tuberculosis worldwide, with 7.5 million
active cases of tuberculosis. Even in the United States,
tuberculosis continues to be a major problem especially among the
homeless, Native Americans, African-Americans, immigrants, and the
elderly. HIV-infected individuals represent the newest group to be
affected by tuberculosis. Of the 88 million new cases of
tuberculosis expected in this decade, approximately 10% will be
attributable to HIV infection.
[0004] The emergence of multi-drug resistant strains of M.
tuberculosis has complicated matters further and even raises the
possibility of a new tuberculosis epidemic. In the U.S. about 14%
of M. tuberculosis isolates are resistant to at least one drug, and
approximately 3% are resistant to at least two drugs. M.
tuberculosis strains have even been isolated that are resistant to
all seven drugs in the repertoire of drugs commonly used to combat
tuberculosis. Resistant strains make treatment of tuberculosis
extremely difficult: for example, infection with M. tuberculosis
strains resistant to isoniazid and rifampin leads to mortality
rates of approximately 90% among HIV-infected individuals. The mean
time to death after diagnosis in this population is 4-16 weeks. One
study reported that, of nine immunocompetent health care workers
and prison guards infected with drug-resistant M. tuberculosis,
five died. The expected mortality rate for infection with
drug-sensitive M tuberculosis is 0%.
[0005] The unrelenting persistence of mycobacterial disease
worldwide, the emergence of a new, highly susceptible population,
and the recent appearance of drug-resistant strains point to the
need for new and better prophylactic and therapeutic treatments of
mycobacterial diseases.
[0006] B. Tuberculosis and the Immune System
[0007] Infection with M. tuberculosis can take on many
manifestations. The growth in the body of M. tuberculosis and the
pathology that it induces is largely dependent on the type and
vigor of the immune response. From mouse genetic studies it is
known that innate properties of the macrophage play a large role in
containing disease, Skamene, Ref. Infect. Dis. 11:S394-S399, 1989.
Initial control of M. tuberculosis may also be influenced by
reactive T .gamma..delta. cells. However, the major immune response
responsible for containment of M. tuberculosis is via helper T
cells (Th1) and to a lesser extent cytotoxic T cells, Kaufmann,
Current Opinion in Immunology 3:465-470, 1991. Evidence suggests
that there is very little role for the humoral response. The ratio
of responding Th1 to Th2 cells has been proposed to be involved in
the phenomenon of suppression.
[0008] Th1 cells are thought to convey protection by responding to
M. tuberculosis T cell epitopes and secreting cytokines,
particularly INF-.gamma., that stimulate macrophages to kill M.
tuberculosis. While such an immune response normally clears
infections by many facultative intracellular pathogens, such as
Salmonella, Listeria, or Francisella, it is only able to contain
the growth of other pathogens such as M. tuberculosis and
Toxoplasma. Hence, it is likely that M. tuberculosis has the
ability to suppress a clearing immune response, and mycobacterial
components such as lipoarabinomannan are thought to be potential
agents of this suppression. Dormant M. tuberculosis can remain in
the body for long periods of time and can emerge to cause disease
when the immune system wanes due to age or other effects such as
infection with HIV-1.
[0009] Historically it has been thought that one needs replicating
mycobacteria in order to effect a protective immunization. An
hypothesis explaining the molecular basis for the effectiveness of
replicating mycobacteria in inducing protective immunity has been
proposed by Orme and co-workers, Orme et al., Journal of Immunology
148:189-196, 1992. These scientists suggest that antigens are
pinocytosed from the mycobacterial-laden phagosome and used in
antigen presentation. This hypothesis also explains the basis for
secreted proteins effecting a protective immune response.
[0010] Antigens that stimulate T cells from mice infected with M.
tuberculosis or from PPD-positive humans are found in both the
whole mycobacterial cells and also in the culture supernatants,
Orme et al., Journal of Immunology 148:189-196, 1992; Daugelat et
al., J. Infect. Dis. 166:186-190, 1992; Barnes et al., J. Immunol.
143:2656-2662, 1989; Collins et al., Infect. Immun. 56:1260-1266,
1988; Lamb et al., Rev. Infect. Dis. 11:S443-S447, 1989; and
Hubbard et al., Clin. exp. Immunol. 87: 94-98, 1992. Recently Pal
and Horwitz, Infect. Immun. 60:4781-4792, 1992, induced partial
protection in guinea pigs by vaccinating with M. tuberculosis
supernatant fluids. Similar results were found by Andersen using a
murine model of tuberculosis, Andersen, Infection & Immunity
62:2536, 1994. Other studies include Hubbard et al., Clin. exp.
Immunol. 87: 94-98, 1992, and Boesen et al., Infection and Immunity
63:1491-1497, 1995. Although these works are far from definitive,
they do strengthen the notion that protective epitopes can be found
among secreted proteins and that a non-living vaccine can protect
against tuberculosis.
II. SUMMARY OF THE INVENTION
[0011] For the purposes of vaccine development one needs to find
epitopes that confer protection but do not contribute to pathology.
An ideal vaccine would contain a cocktail of T-cell epitopes that
preferentially stimulate Th1 cells and are bound by different MHC
haplotypes. Although such vaccines have never been made, there is
at least one example of a synthetic T-cell epitope inducing
protection against an intracellular pathogen, Jardim et al., J.
Exp. Med. 172:645-648, 1990.
[0012] It is an object of this invention to provide M. tuberculosis
DNA sequences that encode bacterial peptides having an
immunostimulatory activity. Such immunostimulatory peptides will be
useful in the treatment, diagnosis, and prevention of
tuberculosis.
[0013] The present invention provides inter alia, DNA sequences
isolated from Mycobacterium tuberculosis. Peptides encoded by these
DNA sequences stimulate the production of the
macrophage-stimulating cytokine, gamma interferon ("INF-.gamma."),
in mice. Critically, the production of INF-.gamma. by CD4 cells in
mice correlates with maximum expression of protective immunity
against tuberculosis, Orme et al., J. Immunology 151:518-525, 1993.
Furthermore, in human patients with active "minimal" or "contained"
tuberculosis, it appears that the containment of the disease may be
attributable, at least in part, to the production of CD4 Th-1-like
lymphocytes that release INF-.gamma., Boesen et al., Infection and
Immunity 63:1491-1497, 1995.
[0014] Hence, the DNA sequences provided by this invention encode
peptides that can of stimulate T-cells to produce INF-.gamma.. That
is, these peptides act as epitopes for CD4 T-cells in the immune
system. Studies have demonstrated that peptides isolated from an
infectious agent and which are shown to be T-cell epitopes can
protect against the disease caused by that agent when administered
as a vaccine, Mougneau et al., Science 268:536-566, 1995 and Jardim
et al., J. Exp. Med. 172:645-648, 1990. For example, T-cell
epitopes from the parasite Leishmania major have been shown to be
effective when administered as a vaccine, Jardim et al., J. Exp.
Med. 172:645-648, 1990; Mougneau et al., Science 268:536-566, 1995;
and Yang et al., J. Immunology 145:2281-2285, 1990. Therefore, the
immunostimulatory peptides (T-cell epitopes) encoded by the DNA
sequences according to the invention may be used, in purified form,
as a vaccine against tuberculosis.
[0015] As noted, the nucleotide sequences of the present invention
encode immunostimulatory peptides. In a number of instances, these
nucleotide sequences are only a part of a larger open reading frame
(ORF) of an M. tuberculosis operon. The present invention enables
the cloning of the complete ORF using standard molecular biology
techniques, based on the nucleotide sequences provided herein.
Thus, the present invention encompasses both the nucleotide
sequences disclosed herein and the complete M. tuberculosis ORFs to
which they correspond. However, it is noted that since each of the
nucleotide sequences disclosed herein encodes an immunostimulatory
peptide, the use of larger peptides encoded by the complete ORFs is
not necessary for the practice of the invention. Indeed, it is
anticipated that, in some instances, proteins encoded by the
corresponding ORFs may be less immunostimulatory than the peptides
encoded by the nucleotide sequences provided herein.
[0016] According to one aspect of the present invention,
immunostimulatory preparations are provided comprising at least one
peptide encoded by the DNA sequences presented herein. Such a
preparation may include the purified peptide or peptides and one or
more pharmaceutically acceptable adjuvants, diluents, and/or
excipients.
[0017] According to another aspect of the invention, vaccines are
provided comprising one or more peptides encoded by nucleotide
sequences provided herein. Such a vaccine may include one or more
pharmaceutically acceptable excipients, adjuvants, and/or
diluents.
[0018] According to another aspect of the present invention,
antibodies are provided that are specific for immunostimulatory
peptides encoded by a nucleotide sequence according to the present
invention. Such antibodies may be used to detect the presence of M.
tuberculosis antigens in medical specimens, such as blood or
sputum. Thus, these antigens may be used to diagnose tuberculosis
infections.
[0019] The present invention also encompasses the diagnostic use of
purified peptides encoded by nucleotide sequences according to the
present invention. Thus, the peptides may be used in a diagnostic
assay to detect the presence of antibodies in a medical specimen,
which antibodies bind to the M. tuberculosis peptide and indicate
that the subject from which the specimen was removed was previously
exposed to M. tuberculosis.
[0020] The present invention also provides improved methods of
performing the tuberculin skin test to diagnose exposure of an
individual to M. tuberculosis. In this improved skin test, purified
immunostimulatory peptides encoded by the nucleotide sequences of
this invention are employed. Preferably, this skin test is
performed with one set of the immunostimulatory peptides, while
another set of the immunostimulatory peptides is used to formulate
vaccine preparations. In this way, the tuberculin skin test will be
useful in distinguishing between subjects infected with
tuberculosis and subjects who have simply been vaccinated. In this
manner, the present invention may overcome a serious limitation
inherent in the present BCG vaccine/tuberculin skin test
combination.
[0021] Other aspects of the present invention include the use of
probes and primers derived from the nucleotide sequences disclosed
herein to detect the presence of M. tuberculosis nucleic acids in
medical specimens.
[0022] A further aspect of the present invention is the discovery
that a significant proportion of the immunostimulatory peptides is
homologous to proteins known to be located in bacterial
cell-surface membranes. This discovery suggests that membrane-bound
peptides, particularly those from M. tuberculosis, may be a new
source of antigens for use in vaccine preparations.
III. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 shows the deduced amino acid sequence of the
full-length MTB2-92 protein. The nucleic acid sequence is contained
within SEQ ID NO: 67, the amino acid sequence is shown in SEQ ID
NO: 113.
IV. DESCRIPTION OF THE INVENTION
[0024] A. Definitions
[0025] Particular terms and phrases used herein have the meanings
set forth below.
[0026] "Specific binding agent." An agent that binds substantially
only to a defined target. Thus, a Mycobacterium tuberculosis
specific binding agent binds substantially only cellular components
derived from Mycobacterium tuberculosis. These cellular components
include both extracellular and intracellular, proteins,
glycoproteins, sugars, and lipids, that are found in Mycobacterium
tuberculosis isolates. As used herein, the term "Mycobacterium
tuberculosis specific binding agent" can be an anti-Mycobacterium
tuberculosis antibody or other agent that binds substantially only
to Mycobacterium tuberculosis.
[0027] The term "anti-Mycobacterium tuberculosis antibodies"
encompasses monoclonal and polyclonal antibodies that are specific
for Mycobacterium tuberculosis, i.e., which bind substantially only
to Mycobacterium tuberculosis when assessed using the methods
described below, as well as immunologically effective portions
("fragments") of such antibodies. Immunologically effective
portions of the antibodies include Fab, Fab', F(ab').sub.2, Fabc,
and Fv portions (for a review, see Better and Horowitz, Methods
Enzymol., 178:476-496, 1989). Anti-Mycobacterium tuberculosis
antibodies may also be produced using standard procedures described
in a number of texts, including Harlow and Lane, Antibodies, A
Laboratory Manual, Cold Spring Harbor Laboratory, 1988.
[0028] "Sequence Identity." The similarity between two nucleic acid
sequences, or two amino acid sequences is expressed in terms of the
level of sequence identity shared between the sequences. Sequence
identity is typically expressed in terms of percentage identity;
the higher the percentage, the more similar the two sequences
are.
[0029] Methods of alignment of sequences for comparison are well
known in the art. Various programs and alignment algorithms are
described in: Smith & Waterman, Adv. Appl. Math., 2:482, 1981;
Needleman & Wunsch, J. Mol. Biol., 48:443, 1970; Pearson &
Lipman, Proc. Natl. Acad. Sci. USA, 85:2444, 1988; Higgins &
Sharp, Gene, 73:237-244, 1988; Higgins & Sharp, CABIOS,
5:151-153, 1989; Corpet et al., Nucleic Acids Research,
16:10881-10890, 1988; Huang, et al., Computer Applications in the
Biosciences, 8:155-165, 1992; and Pearson et al., Methods in
Molecular Biology, 24:307-331, 1994. Altschul et al., J. Mol.
Biol., 215:403-410, 1990, presents a detailed consideration of
sequence alignment methods and homology calculations.
[0030] The NCBI Basic Local Alignment Search Tool (BLAST.TM.
Altschul et al. J. Mol. Biol., 215:403-410, 1990) is available from
several sources, including the National Center for Biotechnology
Information (NCBI, Bethesda, Md.) and on the Internet, for use in
connection with the sequence analysis programs blastp, blastn,
blastx, tblastn and tblastx. It can be accessed at
http//www.ncbi.nlm.nih.gov/BLAST/. A description of how to
determine sequence identity using this program is available at
http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html.
[0031] For comparisons of amino acid sequences of greater than
about 30 amino acids, the "Blast 2 sequences" function in the BLAST
program is employed using the default BLOSUM62 matrix set to
default parameters, (gap existence cost of 11, and a per-residue
gap cost of 1). When aligning short peptides (fewer than about 30
amino acids), the alignment should be performed using the Blast 2
sequences function, employing the PAM30 matrix set to default
parameters (open gap 9, extension gap 1 penalties). Proteins with
even greater similarity to the reference sequences will show
increasing percentage identities when assessed by this method, such
as at least 45%, at least 50%, at least 60%, at least 80%, at least
85%, at least 90%, or at least 95% sequence identity.
[0032] "Isolated." An "isolated" nucleic acid has been
substantially separated or purified away from other nucleic acid
sequences in the cell of the organism in which the nucleic acid
naturally occurs, i.e., other chromosomal and extrachromosomal DNA
and RNA. The term "isolated" thus encompasses nucleic acids
purified by standard nucleic acid purification methods. The term
also embraces nucleic acids prepared by recombinant expression in a
host cell as well as chemically synthesized nucleic acids.
[0033] The nucleic acids of the present invention comprise at least
a minimum length able to hybridize specifically with a target
nucleic acid (or a sequence complementary thereto) under stringent
conditions as defined below. The length of a nucleic acid of the
present invention is preferably 15 nucleotides or greater in
length, although a shorter nucleic acid may be employed as a probe
or primer if it is shown to specifically hybridize under stringent
conditions with a target nucleic acid by methods well known in the
art. The phrase a "peptide of the present invention" means a
peptide encoded by a nucleic acid molecule as defined in this
paragraph.
[0034] "Probes" and "primers." Nucleic acid probes and primers may
be readily prepared based on the nucleic acid sequences provided by
this invention. A "probe" comprises an isolated nucleic acid
attached to a detectable label or reporter molecule. Typical labels
include radioactive isotopes, ligands, chemiluminescent agents, and
enzymes. Methods for labeling and guidance in the choice of labels
appropriate for various purposes are discussed, e.g., in, Sambrook
et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd ed., vol.
1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989, and Ausubel et al. (ed.); Current Protocols in Molecular
Biology, Greene Publishing and Wiley-Interscience, New York (with
periodic updates), 1987.
[0035] "Primers." Primers are short nucleic acids, preferably DNA
oligonucleotides 15 nucleotides or more in length, that are
annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target
DNA strand, then extended along the target DNA strand by a DNA
polymerase enzyme. Primer pairs can be used for amplification of a
nucleic acid sequence, e.g., by the polymerase chain reaction (PCR)
or other nucleic-acid amplification methods known in the art.
[0036] As noted, probes and primers are preferably 15 nucleotides
or more in length, but, to enhance specificity, probes and primers
of 20 or more nucleotides may be preferred.
[0037] Methods for preparing and using probes and primers are
described, for example, in Sambrook et al. (ed.), Molecular
Cloning: A Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989; Ausubel et al.
(ed.), Current Protocols in Molecular Biology, Greene Publishing
and Wiley-Interscience, New York (with periodic updates), 1987; and
Innis et al., PCR Protocols: A Guide to Methods and Applications,
Academic Press: San Diego, 1990. PCR primer pairs can be derived
from a known sequence, for example, by using computer programs
intended for that purpose such as Primer (Version 0.5, .COPYRGT.
1991, Whitehead Institute for Biomedical Research, Cambridge,
Mass.).
[0038] "Substantial similarity." A first nucleic acid is
"substantially similar" to a second nucleic acid if, when optimally
aligned (with appropriate nucleotide insertions or deletions) with
the second nucleic acid (or its complementary strand), there is
nucleotide sequence identity in at least about 75%-90% of the
nucleotide bases, and preferably greater than 90% of the nucleotide
bases. ("Substantial sequence complementarity" requires a similar
degree of sequence complementarity.) Sequence similarity can be
determined by comparing the nucleotide sequences of two nucleic
acids using sequence analysis software such as the Sequence
Analysis Software Package of the Genetics Computer Group,
University of Wisconsin Biotechnology Center, Madison, Wis.
[0039] "Operably linked." A first nucleic acid sequence is
"operably" linked with a second nucleic acid sequence whenever the
first nucleic acid sequence is placed in a functional relationship
with the nucleic acid sequence. For instance, a promoter is
operably linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally,
operably linked DNA sequences are contiguous and, where necessary
to join two protein-coding regions, in the same reading frame.
[0040] "Recombinant." A "recombinant" nucleic acid has a sequence
that is not naturally occurring or has a sequence that is made by
an artificial combination of two otherwise separated segments of
sequence. This artificial combination is often accomplished by
chemical synthesis or, more commonly, by the artificial
manipulation of isolated segments of nucleic acids, e.g., by
genetic engineering techniques.
[0041] "Stringent Conditions" and "Specific." The nucleic acid
probes and primers of the present invention hybridize under
stringent conditions to a target DNA sequence, e.g., to a full
length Mycobacterium tuberculosis gene that encodes an
immunostimulatory peptide.
[0042] The term "stringent conditions" is functionally defined with
regard to the hybridization of a nucleic-acid probe to a target
nucleic acid (i.e., to a particular nucleic acid sequence of
interest) by the hybridization procedure discussed in Sambrook et
al. (ed.), Molecular Cloning: A Laboratory Manual 2nd ed., vol.
1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989, at pages 9.52-9.55, 9.47-9.52 and 9.56-9.58; Kanehisa, Nuc.
Acids Res. 12:203-213, 1984; and Wetmur et al., J. Mol. Biol.
31:349-370, 1968.
[0043] Nucleic-acid hybridization is affected by such conditions as
salt concentration, temperature, or organic solvents, in addition
to the base composition, length of the complementary strands, and
the number of nucleotide-base mismatches between the hybridizing
nucleic acids, as will be appreciated readily by those skilled in
the art.
[0044] In preferred embodiments of the present invention, stringent
conditions are those under which DNA molecules with more than 25%
sequence variation (also termed "mismatch") will not hybridize.
Such conditions are also referred to as conditions of 75%
stringency (since hybridization will occur only between molecules
with 75% sequence identity or greater). In more preferred
embodiments, stringent conditions are those under which DNA
molecules with more than 15% mismatch will not hybridize
(conditions of 85% stringency). In most preferred embodiments,
stringent conditions are those under which DNA molecules with more
that 10% mismatch will not hybridize (i.e., conditions of 90%
stringency).
[0045] When referring to a probe or primer, the term "specific for
(a target sequence)" indicates that the probe or primer hybridizes
under stringent conditions substantially only to the target
sequence in a given sample comprising the target sequence.
[0046] "Purified." A "purified" peptide is a peptide that has been
extracted from the cellular environment and separated from
substantially all other cellular peptides. As used herein, the term
"peptide" includes peptides, polypeptides and proteins. In
preferred embodiments, a "purified" peptide is a preparation in
which the subject peptide comprises 80% or more of the protein
content of the preparation. For certain uses, such as vaccine
preparations, even greater purity may be necessary.
[0047] "Immunostimulatory." The phrase "immunostimulatory peptide"
as used herein refers to a peptide that is capable of stimulating
INF-.gamma. production in the assay described in section B.5.
below. In preferred embodiments, an immunostimulatory peptide is
capable of inducing greater than twice the background level of this
assay determined using T-cells stimulated with no antigens or
negative control antigens. Preferably, the immunostimulatory
peptides are capable of inducing more than 0.01 ng/mL of
INF-.gamma. in this assay system. In more preferred embodiments, an
immunostimulatory peptide is one capable of inducing greater than
10 ng/mL of INF-.gamma. in this assay system.
[0048] B. Materials and Methods
[0049] 1. Standard Methodologies
[0050] The present invention utilizes standard laboratory practices
for the cloning, manipulation, and sequencing of nucleic acids,
purification and analysis of proteins, and other molecular
biological and biochemical techniques, unless otherwise stipulated.
Such techniques are explained in detail in standard laboratory
manuals such as Sambrook et al. (ed.), Molecular Cloning: A
Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989, and Ausubel et al. (ed.),
Current Protocols in Molecular Biology, Greene Publishing and
Wiley-Interscience, New York (with periodic updates), 1987.
[0051] Methods for chemical synthesis of nucleic acids are
discussed, for example, in Beaucage et al., Tetra. Letts.
22:1859-1862, 1981, and Matteucci et al., J. Am. Chem. Soc.
103:3185, 1981. Chemical synthesis of nucleic acids can be
performed, for example, on commercial automated oligonucleotide
synthesizers.
[0052] 2. Isolation of Mycobacterium tuberculosis DNA Sequences
Encoding Immunostimulatory Proteins
[0053] Mycobacterium tuberculosis DNA was obtained by the method of
Jacobs et al., Methods In Enzymology 204:537-555, 1991. Samples of
the isolated DNA were partially digested with one of the following
restriction enzymes HinPI, HpaII, AciI, TaqI, BsaHI, and NarI.
Digested fragments of 2-5 kb were purified from agarose gels and
then ligated into the BstBI site in front of the truncated phoA
gene in one or more of the three phagemid vectors pJDT1, pJDT2, and
pJDT3.
[0054] A schematic representation of the phagemid vector pJDT2 is
provided in Mdluli et al., Gene 155:133-134, 1995. The pJDT vectors
were specifically designed for cloning and selecting genes encoding
cell wall-associated, cytoplasmic membrane associated, periplasmic,
or secreted proteins (and especially for cloning such genes from
GC-rich genomes, such as the Mycobacterium tuberculosis genome).
The vectors have a BstBI cloning site in frame with the bacterial
alkaline phosphatase gene (phoA) such that cloning of an in-frame
sequence into the cloning site will result in the production of a
fusion protein. The phoA gene encodes a version of the alkaline
phosphatase that lacks a signal sequence; hence, only if the DNA
cloned into the BstBI site includes a signal sequence or a
transmembrane sequence can the fusion protein be secreted to the
medium or inserted into cytoplasmic membrane, periplasm, or cell
wall. Those clones encoding such fusion proteins may be detected by
plating clones on agar plates containing the indicator
5-bromo-4-chloro-3-indolyl phosphate (XP). Alkaline phosphatase
cleaves XP to release a blue-colored product. Hence, those clones
containing alkaline phosphatase fusion proteins with the enzymatic
portion lying outside the cytoplasmic membrane will produce the
blue color.
[0055] The three vectors in this series (pJDT1, pJDT2, and pJDT3)
have the BstBI restriction sites located in different reading
frames with respect to the phoA gene. This increases the likelihood
of cloning any particular gene in the correct orientation and
reading frame for expression by a factor of three. Mdluli et al.,
Gene 155:133-134, 1995, describes pJDT vectors in detail.
[0056] 3. Selection of Secreted Fusion Proteins
[0057] The recombinant clones described above were transformed into
E. coli and plated on agar plates containing the indicator
5-bromo-4-chloro-3-indolyl phosphate. Production of blue
pigmentation, produced as a result of the action of alkaline
phosphatase on the indicator, indicated the presence of secreted
cytoplasmic membrane periplasmic, cell wall-associated, or outer
membrane fusion proteins (because the bacterial alkaline
phosphatase gene in the vector lacks a signal sequence and could
not otherwise escape the bacterial cell). A similar technique has
been used to identify M. tuberculosis genes encoding exported
proteins by Lim et al., J. Bact. 177:59-65, 1995.
[0058] Those clones producing blue pigmentation were picked and
grown in liquid culture to facilitate the purification of the
alkaline phosphatase fusion proteins. These recombinant clones were
designated according to the restriction enzyme used to digest the
Mycobacterium tuberculosis DNA (thus, clones designated A#2-1,
A#2-2, etc., were produced using Mycobacterium tuberculosis DNA
digested with AciI).
[0059] 4. Purification of Secreted Fusion Proteins
[0060] PhoA fusion proteins were extracted from the selected E.
coli clones by cell lysis and purified by SDS polyacrylamide gel
electrophoresis. Essentially, individual E. coli clones were grown
overnight at 30.degree. C. with shaking in 2 mL LB broth containing
ampicillin, kanamycin, and IPTG. The cells were precipitated by
centrifugation and resuspended in 100 .mu.L Tris-EDTA buffer. To
this mixture was added 100 .mu.L lysis buffer (1% SDS, 1 mMEDTA, 25
mM DTT, 10% glycerol and 50 mM tris-HCl, pH 7.5). DNA released from
the cells was sheared by passing the mixture through a small-gauge
syringe needle. The sample was then heated for 5 minutes at
100.degree. C. and loaded onto an SDS PAGE gel (12 cm.times.14
cm.times.1.5 mm, made with 4% (w/v) acrylamide in the stacking
section and 10% (w/v) acrylamide in the separating section).
Several samples from each clone were loaded onto each gel.
[0061] The samples were electrophoresed by application of 200 volts
to the gel for 4 hours. Subsequently, the proteins were transferred
to a nitrocellulose membrane by Western blotting. A strip of
nitrocellulose was cut off to be processed with antibody, and the
remainder of the nitrocellulose was set aside for eventual elution
of the protein. The strip was incubated with blocking buffer and
then with anti-alkaline phosphatase primary antibody, followed by
incubation with anti-mouse antibody conjugated with horseradish
peroxidase. Finally, the strip was developed with the NEN DuPont
Renaissance.TM. kit to generate a luminescent signal. The migratory
position of the PhoA fusion protein, as indicated by the
luminescent label, was measured with a ruler, and the corresponding
region of the undeveloped nitrocellulose blot was excised.
[0062] This region of nitrocellulose containing the PhoA fusion
protein was then incubated in 1 mL 20% acetronitrile at 37.degree.
C. for 3 hours. Subsequently, the mixture was centrifuged to remove
the nitrocellulose, and the liquid was transferred to a new test
tube and lyophilized. The resulting protein pellet was dissolved in
100 .mu.L of endotoxin-free, sterile water and precipitated with
acetone at -20.degree. C. After centrifugation the bulk of the
acetone was removed and the residual acetone was allowed to
evaporate. The protein pellet was re-dissolved in 100 .mu.L of
sterile phosphate buffered saline.
[0063] This procedure can be scaled up by modification to include
IPTG induction 2 hours prior to cell harvesting, washing
nitrocellulose membranes with PBS prior to acetonitrile extraction,
and lyophilization of acetonitrile-extracted and
acetone-precipitated protein samples.
[0064] 5. Determination of Immunostimulatory Capacity in Mice
[0065] The purified alkaline phosphatase-Mycobacterium tuberculosis
fusion peptides encoded by the recombinant clones were then tested
for their ability to stimulate INF-.gamma. production in mice. The
test used to determine INF-.gamma. stimulation was essentially as
described by Orme et al., J. Immunology 151:518-525, 1993.
[0066] Essentially, the assay method is as follows: The virulent
strain M. tuberculosis Erdman is grown in Proskauer Beck medium to
mid-log phase, then aliquoted and frozen at -70.degree. C. for use
as an inoculant. Cultures of this bacterium are grown and
harvested, and mice are inoculated with 1.times.10.sup.5 viable
bacteria suspended in 200 .mu.L sterile saline via a lateral tail
vein on the first day of the test.
[0067] Bone marrow-derived macrophages are used in the test to
present the bacterial alkaline phosphatase-Mycobacterium
tuberculosis fusion protein antigens. These macrophages are
obtained by harvesting cells from mouse femurs and culturing the
cells in Dulbecco's modified Eagle medium as described by Orme et
al., J. Immunology 151:518-525, 1993. Eight to ten days later, up
to ten .mu.g of the fusion peptide to be tested is added to the
macrophages, and the cells are incubated for 24 hours.
[0068] The CD4 cells are obtained by harvesting spleen cells from
the infected mice and then pooling and enriching for CD4 cells by
removal of adherent cells by incubation on plastic Petri dishes,
followed by incubation for 60 minutes at 37.degree. C. with a
mixture of J11d.2, Lyt-2.43, and GL4 monoclonal antibody (mAb) in
the presence of rabbit complement to deplete B cells and immature T
cells, CD8 cells, and .gamma..delta. cells, respectively. The
macrophages are overlaid with 10.sup.6 of these CD4 cells, and the
medium is supplemented with 5 U interleukin-2 (IL-2) to promote
continued T cell proliferation and cytokine secretion. After 72
hours, cell supernatants are harvested from sets of triplicate
wells and assayed for cytokine content.
[0069] Cytokine levels in harvested supernatants are assayed by
sandwich ELISA as described by Orme et al., J. Immunology
151:518-525, 1993.
[0070] 6. Determination of Immunostimulatory Capacity in Humans
[0071] The purified alkaline phosphatase-Mycobacterium tuberculosis
fusion peptides encoded by the recombinant clones or by synthetic
peptides are tested for their ability to induce INF-.gamma.
production by human T cells in the following manner.
[0072] Blood from tuberculin-positive people (producing a
tuberculin-positive skin test) is collected in EDTA-coated tubes to
prevent clotting. Mononuclear cells are isolated using a modified
version of the separation procedure provided with the NycoPrep.TM.
1.077 solution (Nycomed Pharma AS, Oslo, Norway). Briefly, the
blood is diluted in an equal volume of a physiologic solution, such
as Hanks Balanced Salt solution (HBSS), and then gently layered
atop the Nycoprep solution in a 2-to-1 ratio in 50 mL tubes. The
tubes are centrifuged at 800.times.g for 20 minutes, and the
mononuclear cells are then removed from the interface between the
Nycoprep solution and the sample layer. The plasma is removed from
the top of the tube and filtered through a 0.2-micron filter. The
plasma is then added to the tissue culture media. The mononuclear
cells are washed twice by a procedure in which the cells are
diluted in a physiologic solution, such as HBSS or RPMI 1640, and
centrifuged at 400.times.g for 10 minutes. The mononuclear cells
are then resuspended to the desired concentration in tissue culture
media (RPMI 1640 containing 10% autologous serum, HEPES,
non-essential amino acids, antibiotics and polymixin B). The
mononuclear cells are then cultured in 96-well microtitre
plates.
[0073] Peptides or PhoA fusion proteins are then added to
individual wells in the 96-well plate, and cells are then placed in
an incubator (37.degree. C., 5% CO.sub.2). Samples of the
supernatants (tissue culture media from the wells containing the
cells) are collected at various time points (from 3 to 8 days)
after the addition of the peptides or PhoA fusion proteins. The
immune responsiveness of T cells to the peptides and PhoA fusion
proteins is assessed by measuring the production of cytokines
(including INF-.gamma.).
[0074] Cytokines are measured using an Enzyme Linked Immunosorbent
Assay (ELISA), the details of which are described in the Cytokine
ELISA Protocol in the PharMingen catalog (PharMingen, San Diego,
Calif.). To measure the presence of human INF-.gamma., wells of a
96-well microtitre plate are coated with a "capture antibody"
(e.g., anti-human INF-.gamma. antibody). The sample supernatants
are then added to individual wells. Any INF-.gamma. present in the
sample binds to the capture antibody. The wells are then washed. A
"detection antibody" (e.g., anti-human INF-.gamma. antibody),
conjugated to biotin, is added to each well, and binds to any
INF-.gamma. bound to the capture antibody. Any unbound detection
antibody is washed away. An avidin-linked horseradish peroxidase
enzyme is added to each well (avidin binds tightly to the biotin on
the detection antibody). Any excess unbound enzyme is washed away.
Finally, a chromogenic substrate for the enzyme is added and the
intensity of the colour reaction that occurs is quantified using an
ELISA plate reader. The amount of the INF-.gamma. in the sample
supernatants is determined by comparison with a standard curve
using known amounts of human INF-.gamma..
[0075] Measurement of other cytokines, such as IL-2 and
interleukin-4 (IL-4), can be determined using the same protocols
with the appropriate substitution of reagents (monoclonal
antibodies and standards).
[0076] 7. DNA Sequencing
[0077] The sequencing of the alkaline phosphatase fusion clones was
undertaken using the AmpliCycle.TM. thermal sequencing kit (Perkin
Elmer, Applied Biosystems Division, 850 Lincoln Centre Drive,
Foster City, Calif. 94404, U.S.A.), using a primer designed to read
out of the alkaline phosphatase gene into the Mycobacterium
tuberculosis DNA insert, or primers specific to the cloned
sequences.
[0078] C. Results
[0079] 1. Immunostimulatory Capacity
[0080] More than 300 fusion clones were tested for their ability to
stimulate INF-.gamma. production. Of these, 80 clones initially
were designated to have some ability to stimulate INF-.gamma.
production. Tables 1 and 2 show the data obtained for these 80
clones. Clones listed in Table 1 showed the greatest ability to
stimulate INF-.gamma. production (greater than 10 ng/mL of
INF-.gamma.), while clones listed in Table 2 stimulated the
production of between 2 ng/mL and 10 ng/mL of INF-.gamma..
Background levels of INF-.gamma. production (i.e., levels produced
without any added M. tuberculosis antigen) were subtracted from the
levels produced by the fusions to obtain the figures shown in these
tables.
1TABLE 1 Immunostimulatory AP-fusion clones SEQ ID NO: Name INF
Sanger ID of Mtb gene Functional Identification 2 AciI#1-152
>40,000 MTCY16By.09 glycerol-3-phosphate binding periplasmic
protein precursor 4 AciI#1-247 >40,000 MTCI364.18 fatty acid
transport protein 65, 66 AciI#1-264 >40,000 MTCY78.03c unknown
62 AciI#1-435 >40,000 MTCY13D12.28 EmbA 75 HinP#1-27 >20,000
MTV023.04c 67 HinP#2-92 >20,000 MTCY190.11c cytochrome c oxidase
subunit II 110 HinP#2-145 >20,000 MTV018.38c 52 HinP#2-150
>20,000 MTCY190.11c COXII (same as 2-92) 48 HinP#1-200
>20,000 MTV003.08 54 HinP#3-30 >20,000 MTCY19H5.30c 6
AciI#2-2 >20,000 MTV003.10c lipoprotein, penicillin binding
protein 7 AciI#2-23 >20,000 MTCY13E10.15c 11 AciI#2-506
>20,000 MTCY253.27c glutamyl transpeptidase precursor 13
AciI#2-511 >20,000 MTCY50.08c unknown 15 AciI#2-639 >20,000
MTCY02B12.02 unknown 16 AciI#2-822 >20,000 MTV004.48 unknown 68
AciI#2-823 >20,000 MTCY77.20 unknown membrane protein 61
AciI#2-825 >20,000 MTCY31.03c 71 AciI#2-827 >20,000
MTCY01B2.15c cytochrome d (ubiquinol) oxidase (appC) 22 AciI#2-898
>20,000 MTV005.02 27 AciI#2-1084 >20,000 MTV023.03c 34
AciI#3-47 >20,000 MTCY50.02 oppA-like 36 AciI#3-133 >20,000
MTCY22G8 complement of ORF designated 38 AciI#3-166 >20,000
MTCY20H10.03 unknown/contains potential membrane spanning region 39
AciI#3-167 >20,000 MTCI28.14 unknown 41 AciI#3-206 >20,000
MTCY270.17 ftsQ 69 HinP#1-31 14,638 MTV025.111 19kDa Antigen 47
HinP#1-144 13,546 MTCI28.11 unknown 70 HinP#1-3 11,550 MTV023.04c
same as HinP1-27 111 AciI#1-486 11,416 MTCY13D12.26 embC (LysR
family) 5 AciI#1-426 11,135 MTV025.013c dppB (peptide transport
permease) 23 AciI#2-916 10,865 MTCY21D4.03c unknown (signal
peptide) Abbreviations: INF: pg/mL of INF-.gamma. produced using
fusion to stimulate immune T-cells. Sanger/TGIR ID of M
tuberculosis gene: matches produced from BLAST search of TIGR and
Sanger Center databases. For Sanger matches, the information prior
to the decimal point (e.g., MTCY21D4) identifies the cosmid clone
and the numbers after the decimal point (e.g., .03) indicate the
matching ORF within that cosmid; "C": indicates that the clone
matched with the complement of that cosmid ORF sequence.
[0081]
2TABLE 2 Immunostimulatory AP-fusion clones SEQ ID NO: Clone Name
INF Sanger/TIGR ID of Mtb gene Functional Identification 1
AciI#1-62 3,126 MTCY190.11c COXII(same as 2-92) 8 AciI#2-26 3,089
MTV023.02c 9 AciI#2-35 3,907 MTV023.05c 76 AciI#2-147 5,464 same as
H2-147 or H1-200 12 AciI#2-508 7,052 MTCY20G9.23 14 AciI#2-523
2,479 MTCY427.10c unknown 72 AciI#2-834 5,942 MTV016.33c 17
AciI#2-854 5,560 MTCY339.08c unknown 18 AciI#2-872 2,361
MTCY22D7.18c cstA - like 73 AciI#2-874 2,171 MTCY190.20 membrane
protein 19 AciI#2-884D 2,729 MTCY21D4.03c 21 AciI#2-894 3,396
MTV002.33c PPE family 24 AciI#2-1014 6,302 MTCY21D4.03C same as
2-916 74 AciI#2-1018 4,642 MTCY270.11 MURF 25 AciI#2-1025 3,582
MTCY359.10 unknown membrane protein 26 AciI#2-1035 3,454
MTCY04D9.11c similar to penicillin binding proteins 28 AciI#2-1089
8,974 MTCY39.39 mpt 64 29 AciI#2-1090 7,449 MTCY04C12.18c unknown
membrane protein 30 AciI#2-1104 5,148 MTCY359.13 Precursor of Apa
wag43 locus 31 AciI#3-9 3,160 MTCY164.01 Unknown 32 AciI#3-12 3,891
MTV003.10c penicillin binding protein 33 AciI#3-15 4,019
MTCY20H10.03 35 AciI#3-78 2,905 MTCI28.14 same as A3-167 37
AciI#3-134 3,895 MTCY22G8.04 same as A3-133 40 AciI#3-204 4,774
MTCY50.02 same as A3-47 42 AciI#3-214 7,333 MTCY33.38 unknown 112
AciI#3-243 2,857 MTCY50.02 43 AciI#3-281 2,943 MTCY19H5.32c 44 Bsa
HI#1-21 8,122 M. bovis clone 45 HinP#1-12 2,905 MTCY49.31c unknown
49 HinP#2-23 2,339 MTCY0033.38 same as A30214 46 HinP#1-142 6,258
MTCY02B10.27c unknown 50 HinP#2-143 3,689 MTCY274.09c unknown,
thioredoxin-like 51 HinP#2-145A 2,314 53 HinP#3-28 2,980 MTV009.03c
LppS 55 HinP#3-34 2,564 MTCY25D10.07 unknown 56 HinP#3-41 3,296
P31953 Antigen 85c, 85b & 85a precursor P31952 P17944 57
HpaII#1-3 2,360 MTCY190.11c COXII 58 HpaII#1-8 2,048 MTCY432
unknown 59 HpaII#1-10 4,178 MTCY39.39 same as A2-1089 60 HpaII#1-13
3,714 MTCY16B7.47 unknown partial ORF Abbreviations: INF: pg/mL of
INF-.gamma. produced using fusion to stimulate immune T-cells.
Sanger/TGIR ID of M. tuberculosis gene: matches produced from BLAST
search of TIGR and Sanger Center databases. For Sanger matches, the
information prior to the decimal point (e.g., MTCY21D4) identifies
the cosmid clone and the numbers after the decimal point (e.g.,
.03) indicate the matching ORF within that cosmid; "c" indicates
that the clone matched with the complement of that cosmid ORF
sequence.
[0082] 2. DNA Sequencing and Determination of Open Reading
Frames
[0083] DNA sequence data for the sequences of the Mycobacterium
tuberculosis DNA present in the clones shown in Tables 1 and 2 are
shown in the accompanying Sequence Listing. The sequences are
believed to represent the respective coding strands of the
Mycobacterium DNA. In most instances, these sequences represent
only partial sequences of the respective immunostimulatory peptides
and, in turn, only partial sequences of respective Mycobacterium
tuberculosis genes. However, each of the clones from which these
sequences were derived encodes, by itself, at least one
immunostimulatory T-cell epitope. As discussed in part V, below,
one of ordinary skill in the art, given the information provided
herein, readily can obtain the immunostimulatory peptides and
corresponding full-length M. tuberculosis genes using standard
techniques. Accordingly, the nucleotide sequences of the present
invention encompass not only those respective sequences presented
in the sequence listings, but also the respective complete
nucleotide sequence encoding the respective immunostimulatory
peptides as well as the corresponding M. tuberculosis genes. The
nucleotide abbreviations employed in the sequence listings are as
follows in Table 3:
3TABLE 3 Symbol Meaning A A, adenine C C, cytosine G G, guanine T
T, thymine U U; uracil M A or C R A or G W A or T/U S C or G Y C or
T/U K G or T/U V A or C or G; not T/U H A or C or T/U; not G D A or
g or T/U; not C B C or g or T/U; not A N (A or C or g or T/U) or
(unknown or other or no base) -- indeterminate (indicates an
unreadable sequence compression)
[0084] The DNA sequences obtained were then analyzed with respect
to the G+C content as a function of codon position over a window of
120 codons using the `FRAME` computer program, Bibb et al., Gene
30: 157-166, 1984. This program uses the bias of these nucleotides
for each of the codon positions to identify the correct reading
frame. As shown in Tables 1 and 2, the sequences were also analyzed
using the BLAST.TM. program on the TIGR.TM. database at the NCBI
website (http://www.ncbi.gov/cgi-bin/BLAST/- nph-tigrb1) and the
Sanger Center website database (http:/www/sanger.ac.uk-
/Projects/M.sub.--tuberculosis/blast_server.shtml). These sequence
comparisons permitted identification of matches with reported
sequences to be identified and, for matches on the Sanger database,
the identification of the open reading frame.
[0085] The sequence information revealed that a number of the
clones contained an number of potentially overlapping sequences or
sequences from the same gene, as noted below:
4 Clone Overlapping Sequence(s) HinP#1-27 HinP#1-3 HinP#2-92
HinP#2-150, Aci#1-62, HpaII#1-3 HinP#1-200 AciI#2-147, H#2-147
AciI#2-639 AciI#2-676 AciI#3-47 AciI#3-204, AciI#3-243 AciI#3-133
AciI#3-134 AciI#3-166 AciI#3-15 AeiI#3-167 AciI#3-78 AciI#2-916
AciI#2-1014 AciI#2-1089 HpaII#1-10 AciI#3-243 AciI#3-47, AciI#3-204
Hinp#2-23 AciI #3-214
[0086] 3. Identification of T Cell Epitopes in the
Immunostimulatory Peptides
[0087] The "T-Site" program, by Feller, D. C. and de la Cruz, V.
F., MedImmune Inc., 19 Firstfield Rd., Gaithersburg, Md. 20878,
U.S.A., was used to predict T-cell epitopes from the determined
coding sequences. The program uses a series of four predictive
algorithms. In particular, peptides were designed against regions
indicated by the algorithm "A" motif which predicts alpha-helical
periodicity, Margalit et al., J. Immunol. 138:2213, 1987, and
amphipathicity. Peptides were also designed against regions
indicated by the algorithm "R" motif which identifies segments that
display a similarity to motifs known to be recognized by MHC class
I and class II molecules, Rothbard and Taylor, EMBO J. 7:93, 1988.
The other two algorithms identify classes of T-cell epitopes
recognized in mice.
[0088] 4. Synthesis of Synthetic Peptides Containing T Cell
Epitopes in Identified Immunostimulatory Peptides
[0089] A series of staggered peptides were designed to overlap
regions indicated by the T-site analysis. These were synthesized by
Chiron Mimotopes Pty. Ltd. (11055 Roselle St., San Diego, Calif.
92121, U.S.A.).
[0090] Peptides designed from sequences described in this
application include:
5 Peptide Sequence Peptide Name SEQ ID NO:. HinP#1-200 (6 peptides)
VHLATGMAETVASFSPS HPI1-200/2 77 REVVHLATGMAETVASF HPI1-200/3 78
RDSREVVHLATGMAETV HPI1-200/4 79 DFNRDSREVVHLATGMA HPI1-200/5 80
ISAAVVTGYLRWTTPDR HPI1-200/6 81 AVVFLCAAAISAAVVTG HPI1-200/7 82
AciI2-827 (14 peptides) VTDNPAWYRLTKFFGKL CD-2/1/96/1 83
AWYRLTKFFGKLFLINF CD-2/1/96/2 84 KFFGKLFLINFAIGVAT CD-2/1/96/3 85
FLINFAIGVATGIVQEF CD-2/1/96/4 86 AIGVATGIVQEFQFGMN CD-2/1/96/5 87
TGIVQEFEFGMNWSEYS CD-2/1/96/6 88 EFQFGMNWSEYSRFVGD CD-2/1/96/7 89
MNWSEYSRFVGDVFGAP CD-2/1/96/8 90 WSEYSRFVGDVFGAPLA CD-2/1/96/9 91
EYSRFVGDVFGAPLAME CD-2/1/96/10 92 SRFVGDVFGAPLAMESL CD-2/1/96/11 93
WIFGWNRLPRLVHLACI CD-2/1/96/12 94 WNRLPRLVHLACIWIVA CD-2/1/96/13 95
GRAELSSIVVLLTNNTA CD-2/1/96/14 96 HinP#1-3 (2 peptides)
GKTYDAYFTDAGGITPG HPI1-3/2 97 YDAYFTDAGGITPGNSV HPI1-3/3 98
HinP#1-3 / HinP#1-200 combined peptides WPQGKTYDAYFTDAGGI
(HinP#1-3) HPI1-3/1 (combined) 99 ATGMAETVASFSPSEGS (HinP#1-200)
100 AciI#2-823 (1 peptide) GWERRLRHAVSPKDPAQ AI2-823/1 101
HinP#1-31 (4 peptides) TGSGETTTAAGTTASPG HPI1-31/1 102
GAAILVAGLSGCSSNKS HPI1-31/2 103 AVAGAAILVAGLSGCSS HPI1-31/3 104
LTVAVAGAAILVAGLSG HPI1-31/4 105
[0091] These synthetic peptides were resuspended in
phosphate-buffered saline to be tested to confirm their ability to
function as T cell epitopes using the procedure described in part
IV(B)(6), above.
[0092] 5. Confirmation of Immunostimulatory Capacity Using T Cells
from Tuberculosis Patients
[0093] The synthetic peptides described above, along with a number
of the PhoA fusion proteins shown to be immunostimulatory in mice,
were tested for their ability to stimulate production of
INF-.gamma. in T-cells from tuberculin-positive people using the
methods described in part IV(B)(6), above. For each assay,
5.times.10.sup.5 mononuclear cells were stimulated with up to 1
.mu.g/mL M. tuberculosis peptide or up to 50 ng/mL PhoA fusion
protein. M. tuberculosis filtrate proteins, Con A and PHA, were
employed as positive controls. An assay was run with medium alone
to determine background levels, and PhoA protein was employed as a
negative control.
[0094] The results, shown in Table 4 below, indicate that all of
the peptides tested stimulated INF-.gamma. production from T-cells
of a particular subject.
6TABLE 4 Concentration of Concentration of INF-.gamma. Peptide or
PhoA INF-.gamma. minus background Fusion Protein Name (pg/mL)
(pg/mL) CD-2/1/96/1 256.6 153.3 CD-2/1/96/9 187.6 84.3 CD-2/1/96/10
134.0 30.7 CD-2/1/96/11 141.6 38.3 CD-2/1/96/14 310.2 206.9
HPI1-3/2 136.3 23.0 HPI1-3/3 264.2 160.9 AciI 2-898 134.0 30.7 AciI
3-47 386.8 283.5 M. tuberculosis filtrate 256.6 153.3 proteins (10
.mu.g/mL) M. tuberculosis filtrate proteins (5 .mu.g/mL) 134.0 30.7
Con A(10 .mu.g/mL) 2839 2735.7 PHA(1%) 10378 10274.7 PhoA control
26.7 0 (10 .mu.g/mL) Background 103.3 0
V. CLONING OF FULL-LENGTH MYCOBACTERIUM TUBERCULOSIS ORFs
CONTAINING T-CELL EPITOPES
[0095] Most the sequences presented represent only part of a larger
M. tuberculosis ORF. If desired, the full-length M. tuberculosis
ORFs that include these provided nucleotide sequences can be
readily obtained by one of ordinary skill in the art, based on the
sequence data provided herein.
[0096] A. General Methodologies
[0097] Methods for obtaining full-length genes based on partial
sequence information are standard in the art and are particularly
simple for prokaryotic genomes. By way of example, the full-length
ORFs corresponding to the DNA sequences presented herein may be
obtained by creating a library of Mycobacterium tuberculosis DNA in
a plasmid, bacteriophage, or phagemid vector and screening this
library with a hybridization probe using standard colony
hybridization techniques. The hybridization probe consists of an
oligonucleotide derived from a DNA sequence according to the
present invention labeled with a suitable marker to enable
detection of hybridizing clones. Suitable markers include radio
nucleotides, such as .sup.32P and non-radioactive markers such as
biotin-avidin enzyme linked systems. Methods for constructing
suitable libraries, production and labeling of oligonucleotide
probes, and colony hybridization are standard laboratory procedures
and are described in standard laboratory manuals such as in
Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd
ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989, and Ausubel et al. (ed.), Current Protocols in
Molecular Biology, Greene Publishing and Wiley-Interscience, New
York (with periodic updates), 1987.
[0098] Having identified a clone that hybridizes with the
oligonucleotide, the clone is identified and sequenced using
standard methods such as described in Chapter 13 of reference
Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd
ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989. Determination of the translation-initiation
point of the DNA sequence enables the ORF to be located.
[0099] An alternative approach to cloning the full-length ORFs
corresponding to the DNA sequences provided herein is the use of
the polymerase chain reaction (PCR). In particular, the inverse
polymerase chain reaction (IPCR) is useful to isolate DNA sequences
flanking a known sequence. Methods for amplifying of flanking
sequences by IPCR are described in Chapter 27 of Innis et al., PCR
Protocols: A Guide to Methods and Applications, Academic Press, San
Diego, 1990, and in Earp et al., Nucleic Acids Research
18:3721-3729, 1990.
[0100] Accordingly, the present invention encompasses small
oligonucleotides included in the DNA sequences presented in the
respective Sequence Listings. These small oligonucleotides are
useful as hybridization probes and PCR primers that can be employed
to clone the corresponding full-length Mycobacterium tuberculosis
ORFs. In preferred embodiments, these oligonucleotides will
comprise at least 15 contiguous nucleotides of a DNA sequence set
forth in the Sequence Listing, and in more preferred embodiments,
such oligonucleotides will comprise at least 20 contiguous
nucleotides of a DNA sequence as set forth in the respective
Sequence Listing.
[0101] One skilled in the art will appreciate that hybridization
probes and PCR primers are not required to exactly match the target
gene sequence to which they anneal. Therefore, in another
embodiment, the oligonucleotides can comprise a sequence of at
least 15 nucleotides and preferably at least 20 nucleotides, the
oligonucleotide sequence being substantially similar to a
respective DNA sequence set forth in the respective Sequence
Listing. Preferably, such oligonucleotides will share at least
about 75%-90% sequence identity with a respective DNA sequence set
forth in the respective Sequence Listing and more preferably the
shared sequence identity will be greater than 90%.
[0102] B. Example--Closing of the Full-Length Orf Corresponding to
Clone HinP #2-92
[0103] Using the techniques described below, the full-length gene
corresponding to the clone HinP #2-92 was obtained. This gene,
herein termed mtb2-92, includes an open-reading frame of 1089 bp
(identified based on the G+C content relating to codon position).
The alternative `GTG` start codon was used, and this was preceded
(8 base pairs upstream) by a Shine-Dalgarno motif. The gene mtb2-92
encodes a protein (termed MTB2-92) containing 363 amino acid
residues with a predicted molecular weight of 40,436 Da.
[0104] Sequence homology comparisons of the predicted amino acid
sequence of MTB2-92 with known proteins in the database indicated
similarity to the cytochrome c oxidase subunit II of many different
organisms. Cytochrome c oxidase is part of the electron transport
chain, in which the subunits I and II form the functional core of
the enzyme complex.
[0105] 1. Cloning the Full-Length Gene Corresponding to HinP
#2-92
[0106] The plasmid pHin2-92 was restricted with either BamH1 or
EcoRI and then subcloned into the vector M13. The inserted DNA
fragments were sequenced under the direction of M13 universal
sequencing primers, Yanisch-Perron et al., Gene 33:103-119, 1985,
using the AmpliCycle.TM. thermal sequencing kit (Perkin Elmer,
Applied Biosystems Division, 850 Lincoln Centre Drive, Foster City,
Calif. 94404, U.S.A.). The 5'-partial MTB2-92 DNA sequence was
aligned using a GeneWorks.TM. (Intelligenetics, Mountain View,
Calif., U.S.A.) program. Based on the sequence data obtained, two
oligomers were synthesized. These oligonucleotides (5'
CCCAGCTTGTGATACAGGAGG 3' (SEQ ID NO: 106) and 5'
GGCCTCAGCGCGGCTCCGGAGG 3' (SEQ ID NO: 107)) represented sequences
upstream and downstream, over an 0.8-kb distance, of the sequence
encoding the partial MTB2-92 protein in the alkaline phosphatase
fusion.
[0107] A Mycobacterium tuberculosis genomic cosmid DNA library was
screened using PCR, Sambrook et al. (ed.), Molecular Cloning: A
Laboratory Manual, 2nd ed., vol. 1-3, ed. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989, in order to
obtain the full-length gene encoding the MTB2-92 protein. Two
hundred and ninety-four bacterial colonies containing the cosmid
library were pooled into 10 groups in 100-.mu.L aliqots of
distilled water and boiled for 5 min. The samples were spun in a
microfuge at maximal speed for 5 min. The supernatants were
decanted and stored on ice prior to PCR analysis. The 100-.mu.L PCR
reaction contained: 10 .mu.L supernatant containing cosmid DNA, 10
.mu.L of 10.times.PCR buffer, 250 .mu.M dNTPs, 300 nM downstream
and upstream primers, and 1 unit Taq DNA polymerase.
[0108] The reactions were heated at 95.degree. C. for 2 min, and 40
cycles of DNA synthesis were performed (95.degree. C. for 30 s,
65.degree. C. for 1 min, 72.degree. C. for 2 min). The PCR products
were loaded into a 1% agarose gel in TAE buffer, Sambrook et al.
(ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989, for analysis.
[0109] The supernatant, which produced 800-bp PCR products, was
then further divided into 10 samples and the PCR reactions were
performed again. The colony that resulted in the correctly sized
PCR product was then picked. The cosmid DNA from the positive clone
(pG3) was prepared using the Wizard.TM. Mini-Prep Kit (Promega
Corp, Madison, Wis., U.S.A.). The cosmid DNA was further sequenced
using specific oligonucleotide primers. The deduced amino acid
sequence encoded by the MTB2-92 protein is shown in FIG. 1.
[0110] 2. Expression of the Full-Length Gene
[0111] To conveniently purify the recombinant protein, a
histidine-tag coding sequence was engineered immediately upstream
of the start codon of mtb2-92 using PCR. Two unique restriction
enzyme sites for XbaI and HindIII were added to both ends of the
PCR product for convenient subcloning. Two oligomers were used to
direct the PCR reaction: (5'TCTAGACACCACCACCACCACCACGTGACACCT
CGCGGGCCAGGTC 3' (SEQ ID NO: 108) and 5'AAGCTTCGCCATGC
CGCCGGTAAGCGCC 3' (SEQ ID NO: 109)).
[0112] The 100-.mu.L PCR reaction contained: 1 .mu.g pG3 template
DNA, 250 nM dNTP's 300 nM of each primer, 10 .mu.L of 10.times.PCR
buffer, and 1 unit Taq DNA polymerase. The PCR DNA synthesis cycle
was performed as described above.
[0113] The 1.4-kb PCR products were purified and ligated into the
cloning vector pGEM-T (Promega). Inserts were removed by digestion
using both Xba I and HindIII and the 1.4-kb fragment was
directionally subcloned into the Xba I and Hind III sites of
pMAL-c2 vector (New England Bio-Labs Ltd., 3397 American Drive,
Unit 12, Mississauga, Ontario, L4V 1T8, Canada). The gene encoding
MTB2-92 was fused, in frame, downstream of the maltose binding
protein (MBP). This expression vector was named pMAL-MTB2-92.
[0114] 3. Purification of the Encoded Protein
[0115] The plasmid pMAL-MTB2-92 was transformed into competent E.
coli JM109 cells and a 1-liter culture was grown up in LB broth at
37.degree. C. to an OD.sub.550 of 0.5 to 0.6. The expression of the
gene was induced by the addition of IPTG (0.5 mM) to the culture
medium, after which the culture was grown for another 3 hours at
37.degree. C. with vigorous shaking. Cultures were spun in the
centrifuge at 10,000.times.g for 30 min and the cell pellet was
harvested. The cell pellet was re-suspended in 50 mL of 20 mM
Tris-HCl, pH 7.2, 200 mM NaCl, 1 mM EDTA supplemented with 10 mM
.beta.-mercaptoethanol and stored at -20.degree. C.
[0116] The frozen bacterial suspension was thawed in cold water
(0.degree. C.), placed in an ice bath, and sonicated. The resulting
cell lysate was then centrifuged at 10,000.times.g and 4.degree. C.
for 30 min, the supernatant retained, diluted with 5 volumes of
buffer A (20 mM Tris-HCl, pH 7.2, 200 mM NaCl, and 1 mM EDTA) and
applied to an amylose-resin column (New England Bio-Labs Ltd., 3397
American Drive, Unit 12, Mississauga, Ontario, L4V 1T8, Canada)
that had been pre-equilibrated with buffer A. The column was then
washed with buffer A until the eluate reached an A.sub.280 of
0.001, at which point the bound MBP-MTB2-92 fusion protein was
eluted with buffer A containing 10 mM maltose. The protein purified
by the amylose-resin affinity column was about 84 kDa which
corresponded to the expected size of the fusion protein (MBP: 42
kDa, MTB2-92 plus the histidine tag: 42 kDa).
[0117] The eluted MBP-MTB2-92 fusion protein was then cleaved with
factor Xa to remove the MBP from the MTB2-92 protein. One mL of
fusion protein (1 mg/mL) was mixed with 100 .mu.L of Factor Xa (200
.mu.g/mL) and kept at room temperature overnight. The mixture was
diluted with 10 mL of buffer B (5 mM imidazole, 0.5 M NaCl, 20 mM
Tris-HCl, pH 7.9, 6 M urea) and urea was added to the sample to a
final concentration of 6 M urea. The sample was loaded onto the
Ni-NTA column (QIAGEN, 9600 De Soto Ave., Chatsworth, Calif. 91311,
U.S.A.) pre-equilibrated with buffer B. The column was washed with
10 volumes of buffer B and 6 volumes of buffer C (60 mM imidazole,
0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 6 M urea). The bound protein
was eluted with 6 volumes of buffer D (1 M imidazole, 0.5 M NaCl,
20 mM Tris-HCl, pH 7.9, 6 M urea).
[0118] At each stage of the protein purification, a sample was
analyzed by SDS polyacylamide gel electrophoresis, Laemmli, Nature
(London) 227:680-685, 1970.
[0119] C. Correction of Sequence Errors
[0120] Some of the sequences presented in the Sequence Listing may
contain sequence ambiguities. Sequence ambiguities occur when the
results from the sequencing reaction do not clearly distinguish
between the individual base pairs. Therefore, substitute
abbreviations denoting multiple base pairs are provided in Table 3,
supra. These abbreviations denote which of the four bases could
possibly be at a position that was found not to give a clear
experimental result. Naturally, in order to ensure that the
immunostimulatory function is maintained, one would utilize a
sequence without such ambiguities. For those sequences containing
ambiguities, one would therefore utilize the sequence data provided
in the Sequence Listing to design primers corresponding to each
terminal of the provided sequence and, using these primers in
conjunction with the polymerase chain reaction, synthesize the
desired DNA molecule using M. tuberculosis genomic DNA as a
template. Standard PCR methodologies, such as those described
above, may be used to accomplish this.
[0121] D. Additional Examples of Cloning of Full-Length Mtb-PhoA
Fusion Proteins
[0122] Selected mtb-phoA fusions were sequenced using the
Taq-Track.TM. sequencing system (Promega Corp.), and sequencing was
directed from a primer located 48 bp upstream of the junction
between the M. tuberculosis and phoA DNA. Sequences were compared
to the databases of the M. tuberculosis genome projects, Cole et
al., Nature 393:537-544, 1998, and the National Centre of
Biotechnology Information at the National Library of Medicine
(Bethesda, Md.) using the "BLASTX", "BLASTN", and "TBLAST"
programs, Atschul et al., Nucleic Acids 25:3389-3402, 1997. A
determination of signal peptide determination was made using the
SignalP neural network trained on Gram-positive data, Neilson et
al., Protein Eng. 10:1-6, 1997.
[0123] Whenever the upstream DNA sequence matched the raw sequence
from the database of the M. tuberculosis genome projects, the
extent of the reading frame and direction of translation were
ascertained using a G+C analysis package, Bibb et al., Gene
30:157-166, 1984. A verification was made of whether the mtb-phoA
fusion was in the same reading frame as the predicted ORF. In some
cases, the extent of the ORF had already been assigned, and the
assessment of the genome project was used for the fusion
construction.
[0124] PCR was used to amplify the complete predicted ORFs encoding
the proteins identified in the immunogenicity study.
Oligodeoxynucleotide primers were designed with restriction sites
in order to clone the amplified fragments into expression vectors.
Table 5 provides a description the primer sequences used. All PCR
reactions were conducted in 20 .mu.L using a 6:1 Taq polymerase:
Pfu polymerase enzyme combination. The reaction mixes contained
either 1 .mu.L DMSO or 4 .mu.L of Q solution (proprietary solution
available from Qiagen, Dusseldorf, Germany, for denaturation in
PCR) as a denaturant. A manual hot start was used for all PCR
reactions which consisted of an initial denaturization (95.degree.
C., 4 min.) followed by a final extension (72.degree. C., 4 min.).
Standard protocols were followed for cloning, Sambrook et al.
(ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989, and expression of the Mycobacterium tuberculosis proteins as
fusions in commercial expression vectors. The different expression
vectors used included pMAL-c2 (New England Biolabs, Beverly,
Mass.), pGEX-4T3 (Pharmacia, Piscataway, N.J.), and pET-17xb
(Novagen, Madison, Wis.). Respectively, these expression vectors
enabled the N-terminal fusion of the maltose binding protein (MBP),
glutathione S-transferase (GST) or the 260 amino acid T7 gene 10
product (PET) containing the T7.circle-solid.Tag.RTM. (Novagen,
Madison, Wis.) to the products of the cloned DNA.
7TABLE 5 Oligonucleotide Primers Used for PCR Amplification SEQ ID
Clone Primer Sequence 5' to 3' NO: GST- 1-152F
GTCAAGGATCCGGCATGGACCCGCTGAACCGCCGAC 142 152 1-152R
ATGTCGGGATCCAAGCTTTCGACGGTCGGCGCGTCGGCGCCGGG 143 MBP- 1-264F
GCAGATGCATCTAATGGGATCCGCGGAGTATATCTCC 144 264 1-264R
GGCGCCGTGGGTGTCAGCGAAGCTTACCTGGTTGTTG 145 PET- 2-23F
GGTGCCGAATTCGCGCCGATGCTGGACGCGG 146 23 2-23R
ACCCGAATTCCCAAGCTTGCTGCTCAAACCACTGTTCC 147 MBP- 2-506F
GCGCCCAAGGGATCCCCGGCTACCATGCCTTCG 148 506 2-506R
CTCGAAGGGATCCGCGTTCGTTTGGCCGCCCGC 149 GST- 2-511F
GGCAGTGGGATCCGTAGCGGTGCGGCGTAAGGTGCGG 150 511 2-511R
GACTTCGTGGATCCGGTCAAGACAAGCTTTGCGGTGATCAAGGCGGC 151 PET- 2-639F
CATGAATGAAGTTCATCTCACAAGCGTGCGGCTCCCACCGACCC 152 639 2-639R
CCTTGGCGAAGTTCTCAAAGGAAAGCTTCGAAGGCGG 153 GST- 2-822F
GGAGTTCGGATCCATCGCCATGCAACTCTCCTCCCGG 154 822 2-822R
GGGCAGTGGATCCGTGGTCAGCAAGCTTTCCCTAGAGTTTCGTGCG 155 MBP- 2-825F
GTGGCGCCGAAGTTCAAGCGCGGTGTCGCAACGCTG 156 825 2-825R
CGCTTAAGCGCGAAGCTTCGTCGAGCCGCG 157 PET- 2-916F
GACCGGAATTCATGATCCAGATCGCGCGCACCTGGCGG 158 916 2-916R
AACATGAATTCAAGCTTCGAGGCCGCCGACGAATCCGCTCACCG 159 PET- 2-1084F
CGGGTCGCCGAATTCACGCGGAGCCGGGGATTGCGC 160 1084 2-1084R
GGCGGAATTCAAGCTTCGGTTCATCCGCCGCCCCCATGC 161 GST- 3-206F
CCCCGGGGATCCGGGGGTGCTGGGATGACGG 162 206 3-206R
ACGACGGATCCTAAGCTTGCAGGCGCGCCGATACGCGGC 163 GST- 2-827F
TCTCCGGGGATCCCAGATGAATGTCGTCGACATTTC 164 827 2-827R
GGGTCTCCGGATCCCCCATACCGACATG 165 GST- 1-247F
CCGACTCGAGCGGCGGCGCACACACAACGGTC 166 247 1-247R
AATCCTCGAGCCCTGCGGTCGCCTTCCGAGCG 167 PET- 3-47F
ATCCGGCCCGAATTCGCTGACCGTGGCCAGCGACGA 168 47 3-47R
GATCGGGGAGAATTCCGCCGACTTAAGCTTCAGCTGAGCTGG 169
[0125] The different expression vectors used included pMAL-c2 (New
England Biolabs), pGEX-4T3 (Pharmacia, Piscataway, N.J.), and
pET-17xb (Novagen, Madison, Wis.). These expression vectors enabled
the N-terminal fusion of the maltose binding protein (MBP),
glutathione S-transferase (GST), or the 260 amino acid T7 gene 10
product (PET) containing the T7.circle-solid.Tag.RTM. (Novagen,
Madison, Wis.) to be added to the products of the cloned DNA. Table
6 provides a summary of the results from cloning the PCR products
into the various vectors described above.
8TABLE 6 Recombinant Plasmids for Cloning and Expression of the
Full-length Proteins Plasmid Expression Cloning Fusion Predicted Mr
Construct Vector Sites Sanger ID Product (kDa) pAM23E pET-17xb E
MTCY13E10.15c PET-23 124 pAM47E pET-17xb E MTCY50.02 PET-47 94
pAM152E pGEX-4T3 B MTCY16B7.09 GST-152 70 pAM206E pGEX-4T3 B
MTCY270.17 GST-206 60 pAM247E pGEX-4T3 E MTC1364.18 GST-247 78
pAM264E pMAL-c2 B, H MTCY78.03c MBP-264 68 pAM506E pMAL-c2 B
MTCY253.27c MBP-506 105 pAM511E pGEX-4T3 B MTCY50.08c GST-511 46
pAM639E pET-17xb E MTCY02B12.02 PET-639 56 pAM822E pGEX-4T3 B
MTV004.48 GST-822 50 pAM825E pMAL-c2 E, H MTCY31.03c MBP-825 60
pAM827E pGEX-4T3 B MTCY01B2.15c GST-827 80 pAM916E pET-17xb E
MTCY21D4.03c PET-916 61 pAM1084E pET-17xb E MTV023.03c PET-1084 76
Abbreviations: E: EcoRI; B: BamHI; H: HindIII; X: XhoI; c:
complementary direction
[0126] SDS-PAGE and Western Blotting were used to identify the
novel antigens expressed by the clones. Sodium dodecyl sulphate
polyacrylamide gel electrophoresis (SDS-PAGE) was carried out using
10% slab gels in a continuous buffer system, Laemmli, Nature
(London) 227:680-685, 1970. Proteins were electrophoretically
transferred from the gel to a nitrocellulose membrane using
standard protocols, Sambrook et al. (ed.), Molecular Cloning: A
Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989. Western blots for the GST
(Pharmacia), T7 gene 10 (Invitrogen), and MBP (NEB) tagged fusion
proteins were conducted as per the suppliers' instructions. The
chemiluminescent Renaissance.TM. system (DuPont NEN Renaissance,
NEL-201) was used to image bound antibody.
[0127] Subsequently, the following fusion proteins were
over-expressed in E. coli BL21 plysS: MBP-264 (SEQ ID NO: 114),
PET-23 (SEQ ID NO: 117), MBP-506 (SEQ ID NO: 115), MPB-825 (SEQ ID
NO: 116), PET-639 (SEQ ID NO: 119), PET-916 (SEQ ID NO: 120),
PET-1084 (SEQ ID NO: 121), PET-47 (SEQ ID NO: 118); in E. coli
BL21: GST-152 (SEQ ID NO: 122), GST-822 (SEQ ID NO: 124); and in E.
coli SURE: GST-206 (SEQ ID NO: 125). The recombinant fusion
proteins MBP-506 (SEQ ID NO: 115), MBP-825 (SEQ ID NO: 116),
GST-152 (SEQ ID NO: 122), GST-822 (SEQ ID NO: 124) GST-827 (SEQ ID
NO: 126), PET-639 (SEQ ID NO: 119), PET-1084 (SEQ ID NO: 121)
formed inclusion bodies that were harvested from the pellet
following centrifugation of the bacterial sonicate. The fusion
proteins PET-916 and GST-206 were found primarily in the
supernatant and underwent considerable breakdown in culture.
Protein fractions were checked by SDS-PAGE using Coomassie Blue
staining and approximate concentrations were determined by Western
blotting.
[0128] An additional fusion protein, GST-247 (SEQ ID NO: 127), was
constructed using a different cloning strategy. The PCR product
resulting from a reaction using the primers described in Table 5
and the entire MTCI364.18 cds was digested with EcoR1. The
resulting fragment was then cloned into pGEX-4T3, with the
C-terminus adjacent to the GST sequence. The resulting protein
fragment included amino acid 43 to amino acid 514 of the 597 amino
acid protein predicted by the genome project.
[0129] The amino acid sequences encoded by nucleic acid sequences
described above are also shown in the sequence listing. These amino
acid sequences are SEQ ID NOS: 128-141, which correspond to the
nucleic acid sequences shown in SEQ ID NOS: 114-127,
respectively.
VI. EXPRESSION AND PURIFICATION OF THE CLONED PEPTIDES
[0130] The DNA sequences disclosed herein that encode Mycobacterium
tuberculosis peptides having an immunostimulatory activity, as well
as the corresponding full-length Mycobacterium tuberculosis genes,
enable one of ordinary skill in the art to express and purify the
peptides encoded by these sequences. Methods for expressing
proteins by recombinant means in compatible prokaryotic or
eukaryotic host cells are well known in the art and are discussed,
for example, in Sambrook et al. (ed.), Molecular Cloning: A
Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989, and Ausubel et al. (ed.),
Current Protocols in Molecular Biology, Greene Publishing and
Wiley-Interscience, New York (with periodic updates), 1987.
Peptides expressed by the nucleotide sequences disclosed herein are
useful for preparing vaccines effective against M. tuberculosis
infection, for use in diagnostic assays, and for raising antibodies
that specifically recognize M. tuberculosis proteins. One method of
purifying the peptides is that presented in part V(B) above.
[0131] The most commonly used prokaryotic host cells for expressing
prokaryotic peptides are strains of Escherichia coli, although
other prokaryotes, such as Bacillus subtilis, Streptomyces, or
Pseudomonas may also be used, as is well known in the art. Partial
or full-length DNA sequences, encoding an immunostimulatory peptide
according to the present invention, may be ligated into bacterial
expression vectors. One aspect of the present invention is thus a
recombinant DNA vector including a nucleic acid molecule provided
by the present invention. Another aspect is a transformed cell
containing such a vector.
[0132] Methods for expressing large amounts of protein from a
cloned gene introduced into Escherichia coli (E. coli) may be
utilized for the purification of the Mycobacterium tuberculosis
peptides. Methods and plasmid vectors for producing fusion proteins
and intact native proteins in bacteria are described in Sambrook et
al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol.
1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989. Such fusion proteins may be made in large amounts, are
relatively simple to purify, and can be used to produce antibodies.
Native proteins can be produced in bacteria by placing a strong,
regulated promoter and an efficient ribosome binding site upstream
of the cloned gene. If low levels of protein are produced,
additional steps may be taken to increase protein production; if
high levels of protein are produced, purification is relatively
easy.
[0133] Often, proteins expressed at high levels are found in
insoluble inclusion bodies. Methods for extracting proteins from
these aggregates are described in Sambrook et al. (ed.), Molecular
Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989. Vector systems
suitable for the expression of lacZ fusion genes include the pUR
series of vectors, Ruther et al., EMBO J. 2:1791, 1983; pEX1-3,
Stanley and Luzio, EMBO J. 3:1429, 1984; and pMR100, Gray et al.,
Proc. Natl. Acad. Sci. USA 79:6598, 1982. Vectors suitable for the
production of intact native proteins include pKC30, Shimatake and
Rosenberg, Nature 292:128, 1981; pKK177-3, Amann and Brosius, Gene
40:183, 1985; and pET-3, Studiar and Moffatt, J. Mol. Biol.
189:113, 1986. Fusion proteins may be isolated from protein gels,
lyophilized, ground into a powder, and used as antigen
preparations.
[0134] Mammalian or other eukaryotic host cells, such as those of
yeast, filamentous fungi, plant, insect, amphibian, or avian
species, may also be used for protein expression, as is well known
in the art. Examples of commonly used mammalian host cell lines are
VERO and HeLa cells, Chinese hamster ovary (CHO) cells, and WI38,
BHK, and COS cell lines, although it will be appreciated by the
skilled practitioner that other prokaryotic and eukaryotic cells
and cell lines may be appropriate for a variety of purposes, e.g.,
to provide higher expression, desirable glycosylation patterns, or
other features.
[0135] Additionally, peptides, particularly shorter peptides, may
be chemically synthesized, avoiding the need for purification from
cells or culture media. It is known that peptides as short as 5
amino acids can act as an antigenic determinant for stimulating an
immune response. Such peptides may be administered as vaccines in
ISCOMs (Immune Stimulatory Complexes) as described by Janeway &
Travers, Immunobiology: The Immune System In Health and Disease
13.21, Garland Publishing, Inc., New York, 1997. Accordingly, one
aspect of the present invention includes small peptides encoded by
the nucleic acid molecules disclosed herein. Such peptides include
at least 5, and preferably 10 or more, contiguous amino acids of
the peptides encoded by the disclosed nucleic acid molecules.
VII. SEQUENCE VARIANTS
[0136] It will be apparent to one skilled in the art that the
immunostimulatory activity of the peptides encoded by the DNA
sequences disclosed herein lies not in the precise nucleotide
sequence of the DNA sequences, but rather in the epitopes inherent
in the amino acid sequences encoded by the DNA sequences. It will
therefore also be apparent that it is possible to recreate the
immunostimulatory activity of one of these peptides by recreating
the epitope without necessarily recreating the exact DNA sequence.
This can be achieved either by directly synthesizing the peptide
(thereby circumventing the need to use the DNA sequences) or,
alternatively, by designing a nucleic acid sequence that encodes
the epitope, but which differs, by reason of the redundancy of the
genetic code, from the sequences disclosed herein.
[0137] Accordingly, the degeneracy of the genetic code further
widens the scope of the present invention as it enables major
variations in the nucleotide sequence of a DNA molecule while
maintaining the amino acid sequence of the encoded protein. The
genetic code and variations in nucleotide codons for particular
amino acids are presented in Tables 7 and 8, respectively. Based
upon the degeneracy of the genetic code, variant DNA molecules may
be derived from the DNA sequences disclosed herein using standard
DNA mutagenesis techniques, or by synthesis of DNA sequences.
9TABLE 7 The Genetic Code First Second Pos'n Third Pos'n T C A G
Pos'n T Phe Ser Tyr Cys T Phe Ser Tyr Cys C Leu Ser Stop (och) Stop
A Leu Ser Stop (amb) Trp G C Leu Pro His Arg T Leu Pro His Arg C
Leu Pro Gln Arg A Leu Pro Gln Arg G A Ile Thr Asn Ser T Ile Thr Asn
Ser C Ile Thr Lys Arg A Met Thr Lys Arg G G Val Ala Asp Gly T Val
Ala Asp Gly C Val Ala Glu Gly A Val (Met) Ala Glu Gly G "Stop
(och)" stands for the ochre termination triplet, and "Stop (amb)"
for the amber. ATG is the most common initiator codon; GTG usually
codes for valine, but it can also code for methionine to initiate
an mRNA chain.
[0138]
10TABLE 8 The Degeneracy of the Genetic Code Number of Total
Synonymous Number of Codons Amino Acid Codons 6 Leu, Ser, Arg 18 4
Gly, Pro, Ala, Val, Thr 20 3 Ile 3 2 Phe, Tyr, Cys, His, Gln, 18
Glu, Asn, Asp, Lys 1 Met, Trp 2 Total number of codons for amino
acids 61 Number of codons for termination 3 Total number of codons
in genetic code 64
[0139] Additionally, standard mutagenesis techniques may be used to
produce peptides that vary in amino acid sequence from the peptides
encoded by the DNA molecules disclosed herein. However, such
peptides will retain the essential characteristic of the peptides
encoded by the DNA molecules disclosed herein, i.e., the ability to
stimulate INF-.gamma. production. This characteristic can be
readily determined by the assay technique described above. Such
variant peptides include those with variations in amino acid
sequence including minor deletions, additions, and
substitutions.
[0140] While the site for introducing an amino acid sequence
variation is predetermined, the mutation per se need not be
predetermined. For example, in order to optimize the performance of
a mutation at a given site, random mutagenesis may be conducted at
the target codon or region and the expressed protein variants
screened for the optimal combination of desired activity.
Techniques for making substitution mutations at predetermined sites
in DNA having a known sequence as described above are well
known.
[0141] In order to maintain the functional epitope, preferred
peptide variants will differ by only a small number of amino acids
from the peptides encoded by the DNA sequences disclosed herein.
Preferably, such variants will be amino acid substitutions of
single residues. Substitutional variants are those in which at
least one residue in the amino acid sequence has been removed and a
different residue inserted in its place. Such substitutions
generally are made in accordance with the following Table 9 when it
is desired to finely modulate the characteristics of the protein.
Table 9 shows amino acids that may be substituted for an original
amino acid in a protein and that are regarded as conservative
substitutions. As noted, all such peptide variants are tested to
confirm that they retain the ability to stimulate INF-.gamma.
production.
11TABLE 9 Original Residue Conservative Substitutions Ala ser Arg
lys Asn gln, his Asp glu Cys ser Gln asn Glu asp Gly pro His asn;
gln Ile leu, val Leu ile; val Lys arg; gln; glu Met leu; ile Phe
met; leu; tyr Ser thr Thr ser Trp tyr Tyr trp; phe Val ile; leu
[0142] Substantial changes in immunological identity are made by
selecting substitutions that are less conservative than those in
Table 9, i.e., selecting residues that differ more significantly in
their effect on maintaining: (a) the structure of the polypeptide
backbone in the area of the substitution, for example, as a sheet
or helical conformation, (b) the charge or hydrophobicity of the
molecule at the target site, or (c) the bulk of the side chain. The
substitutions that, in general, are expected to produce the
greatest changes in protein properties are those in which: (a) a
hydrophilic residue, e.g., seryl or threonyl, is substituted for
(or by) a hydrophobic residue, e.g., leucyl, isoleucyl,
phenylalanyl, valyl or alanyl; (b) a cysteine or proline is
substituted for (or by) any other residue; (c) a residue having an
electropositive side chain, e.g., lysyl, arginyl, or histadyl, is
substituted for (or by) an electronegative residue, e.g., glutamyl
or aspartyl; or (d) a residue having a bulky side chain, e.g.,
phenylalanine, is substituted for (or by) one not having a side
chain, e.g., glycine. However, such variants must retain the
ability to stimulate INF-.gamma. production.
VIII. USE OF CLONED MYCOBACTERIUM SEQUENCES TO PRODUCE VACCINES
[0143] A. Overview
[0144] The purified peptides encoded by the nucleotide sequences of
the present invention may be used directly as immunogens for
vaccination. The conventional tuberculosis vaccine is the BCG
(Bacillus Calmette-Gurin) vaccine, which is a live vaccine
comprising attenuated Mycobacterium bovis bacteria. However, the
use of this vaccine in a number of countries, including the U.S.,
has been limited because administration of the vaccine interferes
with the use of the tuberculin skin test to detect infected
individuals, Wyngaarden et al. (eds.), Cecil Textbook of Medicine,
19.sup.th ed., W. B. Saunders, Philadelphia, Pa., pages 1733-1742,
1992, and section VIII (2) below.
[0145] The present invention provides a possible solution to the
problems inherent in the use of the BCG vaccine in conjunction with
the tuberculin skin test. The solution is based upon the use of one
or more of the immunostimulatory M. tuberculosis peptides disclosed
herein as a vaccine and one or more different immunostimulatory M.
tuberculosis peptides disclosed herein in the tuberculosis skin
test (see section IX (2) below). If the immune system is primed
with such a vaccine, the system will be able to resist an infection
by M. tuberculosis. However, exposure to the vaccine peptides alone
will not induce an immune response to those peptides that are
reserved for use in the tuberculin skin test. Thus, the present
invention would allow the clinician to distinguish between a
vaccinated individual and an infected individual.
[0146] Methods for using purified peptides as vaccines are well
known in the art and are described in the following publications:
Pal et al., Infect. Immun. 60:4781-4792, 1992 (describing
immunization with extra-cellular proteins of Mycobacterium
tuberculosis); Yang et al., Immunology 72:3-9, 1991 (vaccination
with synthetic peptides corresponding to the amino acid sequence of
a surface glycoprotein from Leishmania major); Andersen, Infection
& Immunity 62:2536, 1994 (vaccination using short-term culture
filtrate containing proteins secreted by Mycobacterium
tuberculosis); and Jardim et al., J. Exp. Med. 172:645-648, 1990
(vaccination with synthetic T-cell epitopes derived from Leishmania
parasite). Methods for preparing vaccines that contain immunogenic
peptide sequences are also disclosed in U.S. Pat. Nos. 4,608,251,
4,601,903, 4,599,231, 4,5995230, 4,596,792 and 4,578,770. The
formulation of peptide-based vaccines employing M. tuberculosis
peptides is also discussed extensively in International Patent
Application No. WO 95/01441.
[0147] As is well known in the art, adjuvants such as Complete
Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA) may
be used in formulations of purified peptides as vaccines.
Accordingly, one embodiment of the present invention is a vaccine
comprising one or more immunostimulatory M. tuberculosis peptides
encoded by genes including a sequence shown in the attached
sequence listing, together with a pharmaceutically acceptable
adjuvant.
[0148] Additionally, the vaccines may be formulated using a peptide
according to the present invention together with a pharmaceutically
acceptable excipient such as water, saline, dextrose, or glycerol.
The vaccines may also include auxiliary substances such as
emulsifying agents and pH buffers.
[0149] It will be appreciated by one of ordinary skill in the art
that vaccines formulated as described above may be administered in
a number of ways including subcutaneously, intramuscularly, and by
intra-venous injection. Doses of the vaccine administered will vary
depending on the antigenicity of the particular peptide or peptide
combination employed in the vaccine, and characteristics of the
animal or human patient to be vaccinated. While the determination
of individual doses will be within the skill of the administering
physician, it is anticipated that doses of between 1 microgram and
1 milligram will be employed.
[0150] As with many vaccines, the vaccines of the present invention
may routinely be administered several times over the course of a
number of weeks to ensure that an effective immune response is
triggered. As described in International Patent Application No. WO
95/01441, up to six doses of the vaccine may be administered over a
course of several weeks, but more typically between one and four
doses are administered. Where such multiple doses are administered,
they will normally be administered at from two to twelve-week
intervals, more usually from three to five-week intervals. Periodic
boosters at intervals of 1-5 years, usually three years, will be
desirable to maintain the desired levels of protective
immunity.
[0151] As described in WO 95/01441, the course of the immunization
may be followed by in vitro proliferation assays of PBL (peripheral
blood lymphocytes) co-cultured with ESAT6 or ST-CF, and especially
by measuring the levels of IFN-released from the primed
lymphocytes. The assays are well known and are widely described in
the literature, including in U.S. Pat. Nos. 3,791,932; 4,174,384
and 3,949,064.
[0152] To ensure an effective immune response against tuberculosis
infection, vaccines according to the present invention may be
formulated with more than one immunostimulatory peptide encoded by
the nucleotide sequences disclosed herein. In such cases, the
amount of each purified peptide incorporated into the vaccine will
be adjusted accordingly.
[0153] Alternatively, multiple immunostimulatory peptides may also
be administered by expressing the nucleic acids encoding the
peptides in a nonpathogenic microorganism, and using the
transformed nonpathogenic microorganism as a vaccine. As described
in International Patent Application No. WO 95/01441, Mycobacterium
bovis BCG may be employed for this purpose although this approach
would destroy the advantage outlined above to be gained from using
separate classes of the peptides as vaccines and in the skin test.
As disclosed in WO 95/01441, an immunostimulatory peptide of M.
tuberculosis can be expressed in the BCG bacterium by transforming
the BCG bacterium with a nucleotide sequence encoding the M.
tuberculosis peptide. Thereafter, the BCG bacteria can be
administered in the same manner as a conventional BCG vaccine. In
particular embodiments, multiple copies of the M. tuberculosis
sequence are transformed into the BCG bacteria to enhance the
amount of M. tuberculosis peptide produced in the vaccine
strain.
[0154] Finally, a recent development in the field of vaccines is
the direct injection of nucleic acid molecules encoding peptide
antigens, as described in Janeway & Travers, Immunobiology: The
Immune System In Health and Disease, page 13.25, Garland
Publishing, Inc., New York, 1997; and McDonnell & Askari, N.
Engl. J. Med. 334:42-45, 1996. Thus, plasmids that include nucleic
acid molecules described herein, or that include nucleic acid
sequences encoding peptides according to the present invention, may
be utilized in such DNA vaccination methods.
[0155] B. Pool of 12 M. tuberculosis Proteins Confers Immunity
[0156] A guinea pig protection study was undertaken to compare
three candidate vaccine preparations with BCG. These included the
Antigen 85 complex with IL-2 (Ag 85), a fusion-protein pool of
twelve M. tuberculosis proteins in combination with IL-2 (FPP), and
a control containing the adjuvant monophosphoryl lipid A (MPL).
[0157] 1. Materials and Methods
[0158] The following fusion proteins were identified and cloned
into expression vectors as described supra and then were
over-expressed in E. coli BL21 (DE3) plysS (Novagen, Madison,
Wis.): MBP-264 (SEQ ID NO: 114), MBP-506 (SEQ ID NO: 115), MBP-825
(SEQ ID NO: 116), PET-23 (SEQ ID NO: 117), PET-47 (SEQ ID NO: 118),
PET-639 (SEQ ID NO: 119), PET-916 (SEQ ID NO: 120), PET-1084 (SEQ
ID NO: 121); in E. coli BL21: GST-152 (SEQ ID NO: 122), GST-511
(SEQ ID NO: 123), GST-822 (SEQ ID NO: 124); and in E. coli SURE
(Stratagene, La Jolla, Calif.): GST-206 (SEQ ID NO: 125).
[0159] The Antigen 85 complex was kindly provided by Dr. John
Belisle (Colorado State University, Fort Collins, Co.) through the
TB research materials and vaccine testing contract (NIH, NIAID NOI
AI-75320) (Belisle Science 276:1420-1422, 1997).
[0160] Animals. Outbred female Hartley guinea pigs, that were
specifically pathogen-free (Charles River Laboratories, North
Willmington, Mass.) were held under barrier conditions in an ANL-3
biohazard laboratory. Owing to expense, experimental groups were
limited to between three and five animals. They were housed one to
a cage and given free access to water and guinea pig chow.
Following aerogenic infection with M. tuberculosis H37Rv, the
guinea pigs were monitored over a period of 27 weeks. After the
first four weeks, the animals were weighed weekly, with the
exception of a two-week period, and any animals demonstrating
sudden significant weight loss were euthanised.
[0161] Bacterial infection. Guinea pigs were aerogenically infected
with between 20 and 50 bacilli of M. tuberculosis H37Rv using a
calibrated aerosol generation device (Glas-Col, Terre Haute, Ind.)
that delivered the inoculum to each lung.
[0162] Vaccinations. Guinea pigs were immunized subcutaneously two
times at a three-week interval using 100 .mu.g of AG85 complex with
20 .mu.g Proleukin-PEG IL-2 (Chiron, Emeryville, Calif.) and
emulsified in 100 .mu.g Monophosphoryl Lipid A (MPL; Ribi
ImmunoChem Research, Inc., Hamilton, Mont.) adjuvant that had been
solubilized in 0.02% triethanolamine and 0.4% dextrose by
sonication (MPL-TeoA); and 100 .mu.g of fusion proteins that had
been pooled in equivalent concentrations with 20 .mu.g PEG IL-2
(Chiron) in 100 .mu.g MPL-TeoA adjuvant. The positive control, BCG
Copenhagen, was injected once intradermally (10.sup.3
bacilli/guinea pig), corresponding to the second set of
injections.
[0163] Necropsy. Guinea pigs were euthanized by the intraperitoneal
injection of 1-3 mL of sodium pentobarbital (Sleepaway, Ft. Dodge,
Iowa). The abdominal and thoracic cavities were opened aseptically
and the spleen and right lower lung lobe were homogenised
separately in sterile Teflon-glass homogenisers in 4.5 mL of
sterile physiological saline. The number of viable M. tuberculosis
organisms was determined by inoculating appropriate dilutions onto
Middlebrook.TM. 7H10 agar plates (Hardy Diagnostics, Santa Maria,
Calif.). The colonies were counted after three weeks' incubation at
37.degree. C. Data were expressed as mean log.sub.10 number of
viable organisms per portion of tissue.
[0164] Histological analysis. Sagital tissue sections were made
through the middle of the left lower lobe. The tissue sections were
fixed in 10% neutral buffered formalin and stained with hematoxylin
and eosin. Prepared tissues were coded prior to evaluation by a
board-certified pathologist.
[0165] 2. Results
[0166] Long-term survival assay. The survival of test groups after
aerosol infection and their respective weight gain or loss are
summarized in Table 10.
12TABLE 10 Total Weight Change, Survival Length and Bacterial Loads
in The Lung and Spleen For Individual Guinea Pigs within Different
Vaccination Groups, After Aerogenic Infection with M. tuberculosis.
Wt. Bacterial Bacterial Survival Change Load Load Group No (wks)
(g) Log.sub.10 Lung Log.sub.10 Spleen BCG 117 27 159 3.65 4.93 121
27 99 4.13 3.95 130 27 151 4.13 3.65 mean 27.0 .+-. 0.0136 136 .+-.
3.97 .+-. 0.16 4.18 .+-. 0.39 33 Ag85 155 25 -25 156 20 -48 158 27
86 5.91 3.65 162 27 75 5.19 4.19 167 27 86 5.94 3.83 mean 25.2 .+-.
1.4 35 .+-. 5.68 .+-. 0.24 3.89 .+-. 0.16 66 MPL 170 27 81 5.31
4.95 171 12 -205 >7.0 >7.0 172 9 -231 6.51 6.49 mean 16.0
.+-. 5.6 -118 .+-. 6.27 .+-. 0.87 6.15 .+-. 1.07 173 FPP 157 15 17
6.58 5.23 166 27 82 5.48 2.65 169 27 133 5.26 0.0* mean 23.0 .+-.
4.0 77 .+-. 5.77 .+-. 0.41 2.63 .+-. 1.51 58 *minimal number of
detectable organisms = 225
[0167] All positive-control animals vaccinated with BCG exhibited
consistent weight gain and were healthy when the experiment was
curtailed after 27 weeks.
[0168] Three out of five guinea pigs immunized with Ag85 survived
to 27 weeks, as did 2 out of 3 guinea pigs vaccinated with the
fusion protein mixture. All of these surviving animals showed
reasonable weight gain. In contrast, 2 of 3 negative controls
exhibited precipitous weight loss and died within the first 17
weeks of the experiment. That animal experienced dramatic weight
loss throughout the latter few weeks of the experiment.
[0169] Bacterial Loads. Table 9 shows the individual bacterial
loads found in the lung and spleen. Subsequent assessment of
bacterial loads indicated that only BCG dramatically reduced
bacterial numbers in the lungs. Approximately one-half log
reduction in counts were observed in mice administered Ag85 of the
fusion protein mixture.
[0170] Dissemination of bacteria to the spleen was reduced in all
groups relative to the negative control and the fusion protein pool
effected the greatest control on dissemination.
[0171] Comparative Histology. Guinea pigs immunized with BCG
exhibited a few discrete granulomas in the lungs with a diffuse
interstitial mononuclear cell infiltrate affecting approximately
70% of the lung parenchyma, with no evidence of necrosis, caseation
or mineralization. In contrast, guinea pigs in the negative control
group had a moderate to severe, multi-focal granulomatous pneumonia
with extensive caseation and necrosis throughout the lung
parenchyma.
[0172] A mixed response was seen in guinea pigs administered Ag85.
In two animals that died before 27 weeks (at 20 and 25 weeks,
respectively) a moderate, multi-focal, necrosuppurative
granulomatous pneumonia was seen, with scattered aggregates of
lymphocytes and areas of mineralization and fibrosis. In the three
surviving animals the pathology was less severe, with increased
numbers of aggregations of lymphocytes being evident and the
granulomatous pneumonia scored as mild to moderate. A similar
histological appearance was seen in the lungs of two guinea pigs
immunized with fusion proteins that were still alive at 27
weeks.
IX. USE OF CLONED MYCOBACTERIUM SEQUENCES IN DIAGNOSTIC ASSAYS
[0173] Another aspect of the present invention is a composition for
diagnosing tuberculosis infection. The composition includes
peptides encoded by one or more of the nucleotide sequences of the
present invention. The invention also encompasses methods and
compositions for detecting the presence of anti-tuberculosis
antibodies, tuberculosis peptides, and tuberculosis nucleic acid
sequences in body samples. Three examples typify the various
techniques that may be used to diagnose tuberculosis infection
using the present invention: an in vitro ELISA assay, an in vivo
skin test assay, and a nucleic acid amplification assay.
[0174] A. In Vitro ELISA Assay
[0175] One aspect of the invention is an ELISA that detects
anti-tuberculosis mycobacterial antibodies in a medical specimen.
An immunostimulatory peptide encoded by a nucleotide sequence of
the present invention is employed as an antigen and is preferably
bound to a solid matrix such as a crosslinked dextran such as
SEPHADEX.RTM. (Pharmacia, Piscataway, N.J.), agarose, polystyrene,
or the wells of a microtiter plate. The polypeptide is admixed with
the specimen, such as human sputum, and the admixture is incubated
for a sufficient time to allow antimycobacterial antibodies present
in the sample to immunoreact with the polypeptide. The presence of
the immunopositive immunoreaction is then determined using
ELISA.
[0176] In a preferred embodiment, the solid support to which the
polypeptide is attached is the wall of a microtiter assay plate.
After attachment of the polypeptide, any nonspecific binding sites
on the microtiter well walls are blocked with a protein such as
bovine serum albumin (BSA). Excess BSA is removed by rinsing and
the medical specimen is admixed with the polypeptide in the
microtiter wells. After a sufficient incubation time, the
microtiter wells are rinsed to remove excess sample and then a
solution of a second antibody, capable of detecting human
antibodies, is added to the wells. This second antibody is
typically linked to an enzyme such as peroxidase, alkaline
phosphatase, or glucose oxidase. For example, the second antibody
may be a peroxidase-labeled goat anti-human antibody. After further
incubation, excess amounts of the second antibody are removed by
rinsing and a solution containing a substrate for the enzyme label
(such as hydrogen peroxide for the peroxidase enzyme) and a
color-forming dye precursor, such as o-phenylenediamine, is added.
The combination of mycobacterium peptide (bound to the wall of the
well), the human anti-mycobacterial antibodies (from the specimen),
the enzyme-conjugated anti-human antibody, and the color substrate
produces a color than can be read using an instrument that
determines optical density, such as a spectrophotometer. These
readings can be compared to a control incubated with water in place
of the human body sample, or, preferably, a human body sample known
to be free of antimycobacterial antibodies. Positive readings
indicate the presence of anti-mycobacterial antibodies in the
specimen, which in turn indicate a prior exposure of the patient to
tuberculosis.
[0177] B. Example of ELISA Using Eight Full-Length Clones
[0178] The following fusion proteins were over-expressed in E. coli
BL21 plysS: MBP-506 (SEQ ID NO: 115), MPB-825 (SEQ ID NO: 116),
PET-639 (SEQ ID NO: 119), PET-916 (SEQ ID NO: 120), PET-1084 (SEQ
ID NO: 121); in E. coli BL21: GST-152 (SEQ ID NO: 122), GST-822
(SEQ ID NO: 124); and in E. coli SURE: GST-206 (SEQ ID NO: 125).
The recombinant fusion proteins MBP-506 (SEQ ID NO: 115), MBP-825
(SEQ ID NO: 116), GST-152 (SEQ ID NO: 122), GST-822 (SEQ ID NO:
124), PET-639 (SEQ ID NO: 119), PET-1084 (SEQ ID NO: 121) formed
inclusion bodies that were harvested from the pellet following
centrifugation of the bacterial sonicate. The fusion proteins
PET-916 and GST-206 were found primarily in the supernatant and
underwent considerable breakdown in culture. Protein fractions were
checked by SDS-PAGE using Coomassie Blue staining and approximate
concentrations determined by Western blotting.
[0179] ELISA sera were obtained from 38 Brazilian individuals with
pulmonary tuberculosis and that were HIV positive (TBH), from 20
individuals with extrapulmonary tuberculosis and that were HIV
negative (EP-TB), and from 17 healthy volunteers. Wells were coated
with 200 ng of antigen in 50 .mu.L of coating buffer (15 mM
Na.sub.2CO.sub.3, 35 mM NaHCO.sub.3 adjusted to pH 9.6) and
incubated for 1 hour. Plates were then aspirated, 250 .mu.L of
blocking buffer (0.5% BSA and 0.1% Thimerosal (Aldrich, Milwaukee,
Wis.) in phosphate-buffered saline at pH 7.4) were added to each
well, and the plates were incubated for a further 2 hours. Plates
were washed six times with 350 .mu.L/well of washing solution (2
mL/L Tween 20 in PBS at pH 7.4) and serum was added at a 1:100
dilution in serum diluting buffer (blocking buffer with 2 mL/L
Tween 20). Plates were incubated for 30 minutes and washed as
before. 50 .mu.L of a 1:50,000 dilution of HRP-Protein A (ZYMED,
VWR) were added to each well. The plates were then incubated for 30
minutes and washed as before. 100 .mu.L/well of TMB Microwell
Peroxidase Substrate (Kirkegaard & Perry Laboratories) was
added and the plates were incubated for 15 minutes in the dark. The
reaction was stopped with 100 .mu.L of 0.5 M H.sub.2SO.sub.4 and
the plates were read immediately at 450 nm. The mean and standard
deviations (SD) were calculated from the sera of uninfected control
subjects (n=17) and the cut-off for positive results was calculated
as greater than the mean plus 3 SD, and for high level responses,
as the mean plus 6 SD.
[0180] Table 11 shows the overall seropositivity results for the
nine full-length fusion proteins. When individual sera were
considered, in the EP-TB group, 71% of sera contained antibodies
against at least one antigen (or 82% if the TB lysate individuals
are included) and in the TBH group, 66% of sera contained
antibodies against at least one antigen (or 84% if the TB lysate
individuals are included). Thus, specific antibody responses can be
identified in the majority of the individual sera.
[0181] Measurement of the serum antibodies provides a way to
determine the antigen reactivity. For the two groups, the number of
serum samples that reacted positively to each antigen, and those
which reacted at a high level, are presented in Table 11. For
patients with EP-TB, antibodies against GST-822 were found in 60%
of individual sera and a third of these were high-level responses.
Specific antibody responses to three other antigens (PET-639,
MBP-825, and MBP-506) of between 35% and 45% were also found in the
EP-TB group. The other five antigens, as well as the M.
tuberculosis lysate, elicited responses in fewer sera from EP-TB
patients (35% or less).
[0182] For patients with TBH, antibodies against MBP-506 were found
in 61% of individual sera and over two thirds of these were
high-level responses. GST-822 was recognized in 42% of sera and
almost two-thirds of the specific antibody responses were at a high
level. The other six antigens, as well as the M. tuberculosis
lysate, elicited responses in fewer sera from EP-TB patients (35%
or less).
[0183] This study demonstrated that most of the patients infected
with M. tuberculosis produced serum antibodies to a variety of
antigens. As has been seen for individuals with pulmonary TB,
Lyashchenko et al., Infect. Immun. 66:3936-3940, 1998, sera
responses confirm that antigen recognition and strength of response
were heterogeneous in both EP-TB and TBH groups. Encouragingly, the
majority of sera contained specific antibodies to the small set of
antigens tested. This finding suggests that, for these two groups
previously considered refractory to serodiagnosis, the combination
of only a few well-recognized antigens might greatly improve
diagnostic success. MBP-506 and GST-822, the two highly reactive
and most frequently recognized antigens identified in this study,
are potentially valuable candidates for inclusion in a
serodiagnostic test.
13TABLE 11 Antigen Recognition by Serum Antibodies in TB Patients
Number (%) of responders EP-TB HIV +, TB+ Antigen Total.sup.a High
level.sup.b Total.sup.a High level.sup.b TB lysate 5 (25%) 4 20%)
13 34%) 6 (30%) PET-1084 0 (0%) 0 (0%) 4 11%) 1 (3%) PET-47 5 (25%)
1 (5%) 8 21%) 3 (8%) PET-916 3 (15%) 3 15%) 11 29%) 4 (11%) PET-639
8 (40%) 2 10%) 5 13%) 4 (11%) MBP-825 7 (35%) 1 (5%) 10 26%) 5
(13%) MBP-506 9 (45%) 3 15%) 23 61%) 16 (42%) GST-822 12 (60%) 4
20%) 16 42%) 10 (26%) GST-206 3 (15%) 2 10%) 5 13%) 3 (8%) GST-152
2 (10%) 1 (5%) 2 (5%) 0 (0%) .sup.aTB patients having antibody
levels greater or equal to cut-off, determined from negative
control sera. .sup.bTB patients having antibody levels greater or
equal to cut-off plus 3 SD, determined from negative control
sera.
[0184] C. Skin Test Assay
[0185] Alternatively, the presence of tuberculosis antibodies in a
patient's body may be detected using an improved form of the
tuberculin skin test, employing immunostimulatory peptides of the
present invention. Conventionally, this test produces a positive
result in one of the following conditions: the current presence of
M. tuberculosis in the patient's body after exposure of the patient
to M. tuberculosis and prior BCG vaccination. As noted above, if
one group of immunostimulatory peptides is reserved for use in
vaccine preparations, and another group reserved for use in the
improved skin test, then the skin test will not produce a positive
response in individuals whose only exposure to tuberculosis
antigens was via the vaccine. Accordingly, the improved skin test
would be able to properly distinguish between infected individuals
and vaccinated individuals.
[0186] The tuberculin skin test consists of an injection of
proteins from M. tuberculosis that are injected intradermally. The
test is described in detail in Wyngaarden et al. (eds.), Cecil
Textbook of Medicine, W. B. Saunders, Philadelphia, Pa., 1992. If
the subject has reactive T-cells to the injected protein, then the
cells will migrate to the site of injection and cause a local
inflammation. This inflammation, which is generally known as
delayed type hypersensitivity (DTH) is indicative of circulating M.
tuberculosis antibodies in the patient. Purified immunostimulatory
peptides according to the present invention may be employed in the
tuberculin skin test using the methods described in Wyngaarden et
al. (eds.), Cecil Textbook of Medicine, W. B. Saunders,
Philadelphia, Pa., 1992.
[0187] D. Nucleic Acid Amplification
[0188] One aspect of the invention includes nucleic acid primers
and probes derived from the sequences set forth in the attached
sequence listing, as well as primers and probes derived from the
full-length genes that can be obtained using these sequences. These
primers and probes can be used to detect the presence of M.
tuberculosis nucleic acids in body samples and thus to diagnose
infection. Methods for making primers and probes based on these
sequences are described in section V, above.
[0189] The detection of specific nucleic acid sequences of a
pathogen in human body samples by polymerase chain reaction (PCR)
amplification is discussed in detail in Innis et al., PCR
Protocols: A Guide to Methods and Applications, Academic Press: San
Diego, 1990, in particular, part four of that reference. To detect
M. tuberculosis sequences, primers based on the sequences disclosed
herein would be synthesized, such that PCR amplification of a
sample containing M. tuberculosis DNA would result in an amplified
fragment of a predicted size. If necessary, the presence of this
fragment following amplification of the sample nucleic acid can be
detected by dot blot analysis (see chapter 48 of Innis et al., PCR
Protocols: A Guide to Methods and Applications, Academic Press: San
Diego, 1990). PCR amplification employing primers based on the
sequences disclosed herein may also be employed to quantify the
amount of M. tuberculosis nucleic acid present in a particular
sample (see chapters 8 and 9 of Innis et al., PCR Protocols: A
Guide to Methods and Applications, Academic Press: San Diego,
1990). Reverse-transcription PCR using these primers may also be
utilized to detect the presence of M. tuberculosis RNA, indicative
of an active infection.
[0190] Alternatively, probes based on the nucleic acid sequences
described herein may be labeled with suitable labels (such as
.sup.32P or biotin-avidin enzyme linked systems) and used in
hybridization assays to detect the presence of M. tuberculosis
nucleic acid in provided samples.
X. USE OF CLONED MYCOBACTERIUM SEQUENCES TO RAISE ANTIBODIES
[0191] Monoclonal antibodies may be produced to the purified M.
tuberculosis peptides for diagnostic purposes. Substantially pure
M. tuberculosis peptide suitable for use as an immunogen is
isolated from transfected or transformed cells as described above.
The concentration of protein in the final preparation is adjusted,
for example, by concentration on an Amicon filter device, to the
level of a few milligrams per milliliter. Monoclonal antibody to
the protein can then be prepared as described below.
[0192] A. Monoclonal Antibody Production by Hybridoma Fusion
[0193] Monoclonal antibody to epitopes of the M. tuberculosis
peptides identified and isolated as described herein can be
prepared from murine hybridomas according to the classical method
of Kohler and Milstein, Nature, 256:495, 1975, or derivative
methods thereof. Briefly, a mouse is repetitively inoculated with a
few micrograms of the selected purified protein over a period of a
few weeks. The mouse is then sacrificed, and the antibody-producing
cells of the spleen isolated. The spleen cells are fused with mouse
myeloma cells by means of polyethylene glycol, and the excess
unfused cells are destroyed by growth of the system on selective
media comprising aminopterin (HAT media). The successfully fused
cells are diluted and aliquots of the dilution placed in wells of a
microtiter plate where growth of the culture is continued.
Antibody-producing clones are identified by detection of antibody
in the supernatant fluid of the wells by immunoassay procedures,
such as ELISA, as originally described by Engvall, Enzymol,.
70:419, 1980, and derivative methods thereof. Selected positive
clones can be expanded and their monoclonal antibody product
harvested for use. Detailed procedures for monoclonal antibody
production are described in Harlow and Lane, Antibodies, A
Laboratory Manual, Cold Spring Harbor Laboratory, New York,
1988.
[0194] B. Antibodies Raised Against Synthetic Peptides
[0195] An alternative approach to raising antibodies against the M.
tuberculosis peptides is to use synthetic peptides synthesized on a
commercially available peptide synthesizer based upon the amino
acid sequence of the peptides predicted from nucleotide sequence
data.
[0196] In a preferred embodiment of the present invention,
monoclonal antibodies that recognize a specific M. tuberculosis
peptide are produced. Optimally, monoclonal antibodies will be
specific to each peptide, i.e., such antibodies recognize and bind
one M. tuberculosis peptide and do not substantially recognize or
bind to other proteins, including those found in healthy human
cells.
[0197] The determination that an antibody specifically detects a
particular M. tuberculosis peptide is made by any one of a number
of standard immunoassay methods; for instance, the Western blotting
technique, Sambrook et al. (ed.), Molecular Cloning: A Laboratory
Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y., 1989. To determine that a given antibody
preparation (such as one produced in a mouse) specifically detects
one M. tuberculosis peptide by Western blotting, total cellular
protein is extracted from a sample of human sputum from a healthy
patient and from sputum from a patient suffering from tuberculosis.
As a positive control, total cellular protein is also extracted
from M. tuberculosis cells grown in vitro. These protein
preparations are then electrophoresed on a sodium dodecyl sulfate
polyacrylamide gel. Thereafter, the proteins are transferred to a
membrane (for example, nitrocellulose) by Western blotting, and the
antibody preparation is incubated with the membrane. After washing
the membrane to remove non-specifically bound antibodies, the
presence of specifically bound antibodies is detected by the use of
an anti-mouse antibody conjugated to an enzyme such as alkaline
phosphatase. Application of the substrate
5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results
in the production of a dense blue compound by immuno-localized
alkaline phosphatase. Antibodies that specifically detect the M.
tuberculosis protein will, by this technique, be shown to bind to
the M. tuberculosis-extracted sample at a particular protein band
(which will be localized at a given position on the gel determined
by its molecular weight) and to the proteins extracted from the
sputum from the tuberculosis patient. No significant binding will
be detected to proteins from the healthy patient sputum.
Non-specific binding of the antibody to other proteins may occur
and may be detectable as a weak signal on the Western blot. The
non-specific nature of this binding will be recognized by one
skilled in the art by the weak signal obtained on the Western blot
relative to the strong primary signal arising from the specific
antibody-tuberculosis protein binding. Preferably, no antibody
would be found to bind to proteins extracted from healthy donor
sputum.
[0198] Antibodies that specifically recognize a M. tuberculosis
peptide encoded by the nucleotide sequences disclosed herein are
useful in diagnosing the presence of tuberculosis antigens in
patients.
[0199] All publications and published patent documents cited in
this specification are incorporated herein by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0200] Having illustrated and described the principles of the
invention in multiple embodiments and examples, it should be
apparent to those skilled in the art that the invention can be
modified in arrangement and detail without departing from such
principles. Therefore, the invention encompasses all modifications
coming within the spirit and scope of the following claims.
Sequence CWU 1
1
169 1 267 DNA Mycobacterium tuberculosis 1 acgcggacct cgaagttcat
catcgagtga tacgtgccac acatctcggc gcagtggccc 60 acgaatgctc
cggtcttggt gatttcttcg atctggaaga cgttgaccga gttgtttgcc 120
accgggttag gcatcacgtc acgcttgaac aagaactccg gcacccagaa tgcgtgtatc
180 acatcggctg aggccatttg gaattcgata cgcttgccgg acggcagcac
cagcaccgga 240 atttcggtgc tggtgcccaa cgtctcg 267 2 487 DNA
Mycobacterium tuberculosis misc_feature (1)..(487) n is a, c, g, or
t/u. 2 ctgatacgac gccggcaagg actacgacga ggtggcacag aattcaatgc
ggcgctcatc 60 ggaaccgacg tgcccgacgt cgttttgctc gacgacngat
ggtggttcca tttcgccntc 120 agcggtgttc tgactgccct tgacgacctg
ttcggccaag ttggggtgga cacaacggat 180 tacgtcgatt cgctgctggc
cgactatgag ttcaacggcc gccattacgc tgtgccgtat 240 gctcgctcga
cgccgctgtt ctactacaac aaggcggcgt ggcaacaggc cggcctaccc 300
gaccgcggac cgcaatcctg gtcagagttc gacgagtggg gtccggagtt acagcgcgtg
360 gtcggcgccg gtcgatcggc gcacggctgc gntaacgccg acctcatctc
gtggacgttt 420 cagggaccga actgggcatt cggcggtgcc tactccgaca
agtggacatt gacattgacc 480 gagcccg 487 3 511 DNA Mycobacterium
tuberculosis misc_feature (1)..(511) n is a, c, g, or t/u. 3
ggcggccaga cngtcnggaa ctcgcnggcc attggtgtgg tgggaaccgc gatcctcgac
60 gcaccgcttc gcggtcttgc agtgttcgat gccaatctgc cggccgggac
gctgccggat 120 ggcggcccgt tcaccgaggc tggtgacaag acctggcgtg
tcgttccggg cactactccc 180 caggtcggtc aaggcaccgt caaagtgttc
aggtataccg tcgagatcga gaacggtctt 240 gatcccacaa tgtacggcgg
tgacaacgca ttcgcccaga tggtcgacca gacgttgacc 300 aatcccaagg
gctggaccca caatccgcaa ttcgcgttcg tgcggatcga cagcggaaaa 360
cccgacttcc ggatttcgct ggtgtcgccg acgacagtgc gcggggggtg tggctacgaa
420 ttccggctcg agacgtcctg ctacaacccg tcgttcggcg gcatggatcg
ccaatcgcgg 480 gtgttcatca acgaggcgcg ctgggtacgc g 511 4 512 DNA
Mycobacterium tuberculosis misc_feature (1)..(512) n is a, c, g, or
t/u. 4 gtgtgcaacc agtgtgtgtn cgtgtgcgaa ccagtgtgta gtggtaacca
ggaccacgtt 60 gcaaaccagt gttggagtgc agtgttgcgt gcnagtgttg
cncgttgcag tgttngncga 120 gccgagattg gaagttnccg acattaccgt
tgccgacgtt gccctcgccg acgttcgcca 180 agcccaggtt gcggacacgc
cggtgattgt gcgtggggca atgancgggc tgctggcccg 240 gccgaattcc
aaggcgtcga tcggcacggt gttccaggac cgggccgctc gctacggtga 300
ccgagtcttc ctgaaattcg gcgatcagca gctgacctac cgcgacgcta acgccaccgc
360 caaccggtac gccgcggtgt tggccgcccg cggcgtcggc cccggcgacg
tcgttggcat 420 catgttgcgt aactcaccca gcacagtctt ggcgatgctg
gccacggtca agtgcggcgc 480 tatcgccggc atgctcaact accaccagcg cg 512 5
456 DNA Mycobacterium tuberculosis misc_feature (1)..(456) n is a,
c, g, or t/u. 5 gcaacggaga ggtggactat gccggaccgg caccgcgaag
gggttggtgc cggcccgggt 60 ggtgacggtg cacattctgc gcaattcgct
gagttccggt ggtgaccttc ctgggcgcgg 120 agtctgggcg cgctgatggc
ggagcgaktg tgaccgaagg aantcngttc aacatccacg 180 gcgtcggggg
cgtgctgtat caagcggtca ccgtcaggag acgccgacgg tggtgtcgat 240
cgtgacggtg ctggtgctga tctacctgat caccaatctg ttggtggatc tgctgtatgc
300 ggccctggac gccgnngatn cgctatggct gagcacacgg ggttctggct
cgatgcctng 360 cgcgggttgc gccggcgtcc taaantcgtg atcgcgcggc
gctgakcctg ctgattcttg 420 tcgtggcggc gtttccgtcg ttgtttaccg cagccg
456 6 172 DNA Mycobacterium tuberculosis misc_feature (1)..(172) n
is a, c, g, or t/u. 6 tcncttatcg cttcagctgg catctgccca aggaccgaat
ctggacctat gacggccagc 60 tgaagatggc ccgcgacgaa gggcgttggc
acgttcgctg gaccaccagc gggttgcatc 120 ccaagctagg cgaacatcaa
aggttcgcgc tacgagccga cccgccgcgg cg 172 7 232 DNA Mycobacterium
tuberculosis misc_feature (1)..(232) n is a, c, g, or t/u. 7
cttctcgcgc cagcncgtcc cgctgtccgg gatgncgcta ccggtcgtca gcgccaagac
60 ggtgcagctc aacgacggcg ggttggtgcg cacggtgcac ttgccggccc
ccaatgtcgc 120 ggggctgctg agtgcggccn gcgtgccgct gttgcaaagc
gaccacgtgg tgcccgccgc 180 gacggccccg atcgtcgaag gcatgcagat
ccaggtgacc cgcaaatcgg at 232 8 173 DNA Mycobacterium tuberculosis
misc_feature (1)..(173) n is a, c, g, or t/u. 8 gttcgncgcg
ctcaaaaggt tgacgatggt cacgtcgcac gtgctggccg agaccaaggt 60
ggatttcggt gaagacctca aaganctcta ctcgnatcgt caaggccctc aacgacgacc
120 gaaaggattt cgtcacctcg ctgcagctgt tgctgacgtt cccatttccc aac 173
9 223 DNA Mycobacterium tuberculosis misc_feature (1)..(223) n is
a, c, g, or t/u. 9 cctgttncaa cggtncnttc ncggaacgga cgacttctga
tncgnnctcg gncgttccct 60 cgcaccggtc gatggtgatc aaggtcagcg
tcttcgcggt ggtcatgctg ctggtggccg 120 ccggtctggt ggtggtattc
ggggacttcc ggtttggtcc cacaaccgtc taccacgcca 180 ccttcaccga
cncgtngcgg ctgaangcag gccagaaggt tcg 223 10 120 DNA Mycobacterium
tuberculosis 10 caacgagatc gcacccgtga ttaggaggtg acggtggcag
cgccgacccc gtcgaatcgg 60 atcgaagtaa cgctccgtag acgccagctc
gtccgcgccg atgccgacct gccacccgtg 120 11 162 DNA Mycobacterium
tuberculosis misc_feature (1)..(162) n is a, c, g, or t/u. 11
cggcttccag cgggtgcgcc aagcacggcc ggtccgtgcg agatcgtccc caatggcacg
60 ccggcgccca agacaccccc ggntaccgtg ccttcgtcgc gcaacctcgc
gaccaacccc 120 gagatcgcca ccnnctacng ccgggacatg accgtggtgc gg 162
12 133 DNA Mycobacterium tuberculosis misc_feature (1)..(133) n is
a, c, g, or t; y is t/u or c; h is a, c or t/u. 12 gactggnccc
gaygytgtgn ccgghncgth ggncghgchg cantcgaycc tggccgttgc 60
ttcggtgccg ggttgttcat cgccttcgac cagttgtggc gctggaacag catagtggcg
120 ctagtgctat cgg 133 13 395 DNA Mycobacterium tuberculosis 13
gcgcacactg cgcatgctgc cgtacccgcg ccaggcatga gtcttaggcc gaaatgcctg
60 gttaactggc gtgtcgtggt tgacccgcgg gcgtgcggct acagtgcatg
ctgtgatcgg 120 cagtgggaga ggtagcggtg cggcgtaagg tgcggaggtt
gactctggcg gtgtcggcgt 180 tggtggcttt gttcccggcg gtcgcggggt
gctccgattc cggcgacaac aaaccgggag 240 cgacgatccc gtcgacaccg
gcaaacgctg agggccggca cggacccttc ttcccgcaat 300 gtggcggcgt
cagcgatcag acggtgaccg agctgacaag ggtgaccggg ctggtcaaca 360
ccgccaagaa gtcggtgggc tgccaatggc tggcg 395 14 175 DNA Mycobacterium
tuberculosis misc_feature (1)..(175) n is a, c, g, or t/u; y is t/u
or c; k is g or t/u. 14 ccagnccncc naacntgtyn cgntctcayy tcgccgtcgc
tgccggtncg tgtgtgcacc 60 atctgcaccg acccgtgkaa cytcgatcac
ganactggna gagntcaggc atnaaagccg 120 gagtggcaca gcaacggtcg
ctactggaat tggcgaagct ggatgctgag ctgac 175 15 265 DNA Mycobacterium
tuberculosis misc_feature (1)..(265) n is a, c, g, or t/u. 15
gggctggatt cgaggctcng tgcatgccgt acgactaggg gtagcgccca gctgctcaat
60 accatcggtt ggataacaaa ggctgaacat gaatggcttg atctcacaag
cgtgcggctc 120 ccaccgaccc cggcgcccct cgagcctggg ggctgtcgcg
atcctgatcg cggcgacact 180 tttcgcgact gtcgttgcgg ggtgcgggaa
aaaaccgacc acggcgagct ccccgagtcc 240 cgggtcgccg tcgccggaag cccac
265 16 170 DNA Mycobacterium tuberculosis misc_feature (1)..(170) n
is a, c, g, or t/u; m is a or c. 16 cgccatgncg aagcgmaccc
cggtccggaa ggcctgcaca gttctagccg tgctcgccgc 60 gacgctactc
ctcgcctgcg gcggtcccac gcagccacgc agcatcacct tgacctttat 120
ncgcaacgcg caatcccagg ccaacgccga cgggatcatc gacaccgaca 170 17 181
DNA Mycobacterium tuberculosis misc_feature (1)..(181) n is a, c,
g, or t/u; b is g, c or t/u. 17 accngttccc gccggnctna cncncggtgc
cgttgcaccg gccanctgca gcctgccccg 60 acgccgaagt ggtgttcgcn
ccgcggccgc ttcgaaccgc ccgggattgg cacggtcggc 120 aabgcattcg
tcagcnntgc gctcgaaggt caacaagaat gtcggggtct acgcggtgaa 180 a 181 18
95 DNA Mycobacterium tuberculosis misc_feature (1)..(95) w is a or
t/u; k is g or t/u; y is t/u or c. 18 aggtkacggt ggcagcgccg
accccgtcga atcggwtcga agaaygctcc gkacacgcca 60 gctgcgtccg
ygccgatgcc gacctgccac ccgtg 95 19 283 DNA Mycobacterium
tuberculosis misc_feature (1)..(283) n is a, c, g, or t/u; r is g
or a. 19 gcgcatgcgc aaccacttgg aatccgttga caatcgcatc ggtggccggc
ccgtcggtga 60 ccgcntgcaa cagcgcggtg gtcaccnaca gcgaaaccag
gtncttgtcg gctccggagg 120 tggcgatgac gtggcgccgg gaggtgttga
gggtcatgtc gttttcgcgn taggtgccct 180 cgatgattga tgacggaaag
cnncgtngaa anttggcnat agcggcgttt gtggtctgcn 240 atncgagcra
ttnctgnctg tcagtgtagn cgtgtgtgat ggc 283 20 156 DNA Mycobacterium
tuberculosis misc_feature (1)..(156) n is a, c, g, or t/u; w is a
or t/u; b is g, c or t/u; r is g or a. 20 tcttctacaa ggacgccttc
gccaagcacc aggagctgtt cgacgacttg gncgtcaacg 60 tcaacaatgg
cttgtccgat ctgtacragc aagwtcgagt cgctgccgnb cgcaacgcga 120
cgagatcatc gaggacctac accgttgcca cgaaca 156 21 123 DNA
Mycobacterium tuberculosis misc_feature (1)..(123) n is a, c, g, or
t/u. 21 atnccgttcc actnccgcgg cagcagctgg ntttgcgcac acggtgaccc
agtggcgntt 60 ggtggggcct cgctgacggc gagtntggnc gagcgtcctc
ggtcggtgnc ctntcntccc 120 gcc 123 22 823 DNA Mycobacterium
tuberculosis misc_feature (1)..(823) n is a, c, g, or t/u; k is g
or t/u. 22 cggtcacgca attgatggcc gcgcgcaagg scgcatggtg gagatgncca
accacaccac 60 cggctgggtc cgcatggact tcgtggttcc cagtcgcggc
ctgattgggt ggcgcaccga 120 cttcctcacc gagacccgtg gctccggtgt
cgggcatgcg gtgttcgacg gatnaccggc 180 catgggcggg ggagkccggg
cccgnccaca ccggttctct ggtatcggac cgggccggcg 240 ccatcacacc
gttcgcgttg ctgcaactcg ccgatcgggg gcagttcttc gtcgagcccg 300
gccaacagan ccntacgagg ncantggctg ctgggatcaa cccccgtccg gaggacctcg
360 acatcaatgt cacccggagn agnangctga ccnaacatgc gctcatcgac
cgcggatgtc 420 atcgagacgg tngccaagcc gctgcagctg gatctcgagc
gcgccatgga gttatgtgcg 480 cccgacgaat gcgtcgaggt gaccccggag
atcgtgcgga tccgcaaagt cgagctggcc 540 gccgccgccc gggctcgcag
ccgggcgcgc accaaggcgc gtggctagca acttggcgcg 600 ctggccgcgc
gagcgtaacg ccactgcgaa atccagcccg gcttttcgca gccgggttac 660
gctcgtgggg gtactggata gcctgatggg cgtgcccagc ccagtccgcc gcgtctgtgt
720 gacggtcggc gcgttggtcg cgctggcgtg tatggtgttg gccgggtgca
cggtcagccc 780 gccgccggca ccccagagca ctgatacgcc gcgcagcaca ccg 823
23 103 DNA Mycobacterium tuberculosis 23 cttccggcgg gacaacaaca
ggtctcaccg gcgccacacc ctgacacctg atcgcgtctg 60 ccgatcccgg
tcggagcacc cgggttccac cgctgtgccc ccc 103 24 207 DNA Mycobacterium
tuberculosis misc_feature (1)..(207) n is a, c, g, or t/u; w is a
or t/u; y is c or t/u; h is a, c or t/u. 24 gccaccggtt catcgcgtgg
tgctggtcac cgccnggaan gcctcagcgg atcccctgct 60 gccaccgccg
cctatccctg ccccagtctc ggcgccggca acagtcccgy ccgtgcagaa 120
cctcacggct ncthccgggc gggagcagca acaggttctc accggygccw ngyacccgca
180 ccgatcgcgt cgccgattcc ggtcgga 207 25 204 DNA Mycobacterium
tuberculosis misc_feature (1)..(204) n is a, c, g, or t/u; y is c
or t/u; s is g or c; k is g or t/u. 25 ttncgcannc gttcatccag
gtccactggt gtcgcanctc tcnntgatgc accggttccg 60 gatatatgtc
nacatcnccs tcstcgtcct ggtgctggta ctnacgaacc tgatcgcgca 120
tttcaccaca ccgtgngcga gcatcgccac cgtcccggcc gccygcggtc ggactggtga
180 tcttggtkcg gagtagaggc ctgg 204 26 207 DNA Mycobacterium
tuberculosis misc_feature (1)..(207) n is a, c, g, or t/u; h is a,
c or t/u; r is g or a. 26 ataccngtca tccngcacat ngtcaacctn
gagtcggtnc tcacctacga ggcacgcccg 60 agatgcatca ctggtgctcg
rtcagncctt cacggcttgg ccgccttccg gtaggaccgt 120 hgcatgcccg
tcttcggcgc ctcgggtgtt cggtcctggc tctcgggctg ctggccnctg 180
cgccccaccc cgcaccgggc cggcttc 207 27 289 DNA Mycobacterium
tuberculosis misc_feature (1)..(289) n is a, c, g, or t/u; s is g
or c. 27 ccgtgatngg ccggnncgnc atgttacggg nagccgggna ttgcgntacg
ccacggtgat 60 cgcgctggtg gccgcgctgg tggncngcgt gtacgtgctc
tcgtccaccg gtaataagcg 120 caccatcgtg ggctacttca cctctgctgt
cgggctctat cccggtgacc aggtccgcgt 180 cctgggcgtc ccggtgggtg
agatcgacat gatcgagccg cggtcgtccg acgtcaagat 240 cactatgtcg
gtgtccaagg acgtcaaggt gcccgtgsac gtgcaggcc 289 28 198 DNA
Mycobacterium tuberculosis misc_feature (1)..(198) n is a, c, g, or
t/u; y is c or t/u. 28 ttgnaccang cctatcgcaa gccaatcacc tatgacacgc
tgtggcaggc tgacaccgat 60 ccgctgccag tcgtcttccc cattgtgcaa
ggtgaactga gcaangcaga ccggacaaca 120 ggtatcgata gcgccgaatg
ccggcttgga cccggtgaat tatcagaact tygcagtcac 180 gaacgacggg gtgatttt
198 29 149 DNA Mycobacterium tuberculosis misc_feature (1)..(149) n
is a, c, g, or t/u; w is a or t/u; m is c or a; r is g or a. 29
tcacganggt rynacmgcaa cwcgaccgcc acgtcasgcc gccgcgcacg aagatcaccg
60 tgcctgcncg atgggtcgtg aacggaatag aaygcagcgg tgaggtcaan
ygcgaagccg 120 ggaaccaaat ccggtgaccg cgtcggcat 149 30 210 DNA
Mycobacterium tuberculosis 30 ggacccgcca agcatcagcc ggtcaacagc
cgccgccggt ggccaaagtt cgagcagccg 60 ccggtatcgt gctcggcccg
gctagaccaa aaactttacg ccagcgcccg aagccacccg 120 actccaaggc
ctcggcccgg ttgggttcgc acatgggtga gttctatatg ccctacccgg 180
gcacccggtt caaccaggaa accgtctcgc 210 31 255 DNA Mycobacterium
tuberculosis misc_feature (1)..(255) n is a, c, g, or t/u. 31
cagnccgctg ncccggaact gttccagcag ctacaagacc ttcgacaacg tngcgcgtca
60 acctgcantc gagcgcaacc tctcggtggc gctcaacgag tgttcgccgg
cttcaacccg 120 ctggacccgc gaaacctcga cgtgtccccg ctgccttcgc
tggccaagcg cgccgccgac 180 atcctgcgcc aggacgtggg cgggcaggtc
gacattttcg atgtcaatgt gcccaccatc 240 cagtacgacc agagc 255 32 164
DNA Mycobacterium tuberculosis misc_feature (1)..(164) n is a, c,
g, or t/u; m is a or c; r is g or a, y is t/u or c. 32 aaynccnggc
crtcgacggt nccggttcnc rccaccggtc tatatccacc cgggtcnrca 60
ttmanantga ntmnccgccg gtgcggccgt cgagcgtgac ctggcatccc ctgagacgct
120 gctgggttgc cccggggagn tcgamantcg ggcatcgcac catc 164 33 237 DNA
Mycobacterium tuberculosis misc_feature (1)..(237) n is a, c, g, or
t/u; s is g or c. 33 acggacggca acgggatgcg acccgatccc accggtcgcc
acgagggacg ctacttcgtc 60 gccgggcagc cganccgacc gtcngttcng
cganggcgac ngccgaagcc gttgacccac 120 nttggtcagc agcagctgga
tsagtcaggt gccgttggtg tttcgccgtc agcggtgtcg 180 gggtgggtgc
gttctgggca ccgtcgactg tggtgggcgc tngcgggcgn tggtggc 237 34 371 DNA
Mycobacterium tuberculosis misc_feature (1)..(371) n is a, c, g, or
t/u. 34 cggatgctcg gcctccggta cccaactcga actcgcgccc acngcggacn
gcagggccgc 60 ggttggcacc accagcgaca tcaatcangc aggatcccgc
cacgttgcaa gacggcggca 120 atcttcgcct gtcgctcacc gactttccgc
ccaacttcaa catcttgcac atcgacggca 180 acaacgccga ggtcgcggcg
atgatgaaag ccaccttgcc gcgcgcgttc atcatcggac 240 cggacggctc
gacgacggtc gacaccaact acttcaccag catcgagctg accaggaccg 300
ccccgcaggt ggtcacctac accatcaatc ccgaggcggt gtggtccgac gggaccccga
360 tcacctggcc g 371 35 26 DNA Mycobacterium tuberculosis
misc_feature (1)..(26) n is a, c, g, or t/u. 35 gagaactccg
ggccganttt tggaca 26 36 202 DNA Mycobacterium tuberculosis 36
tgtcggtagc gttcgcgtcc atgattgctc ttgcaacgct gttgacgctt atcaatcaag
60 tcgtcggcac tccgtatatt cccggtggcg attctcccgc cgggaccgac
tgctcggagc 120 tggcttcgtg ggtatcgaat gcggcgacgg ccaggccggt
tttcggagat aggttcaaca 180 ccggcaacga ggaagcgcct tg 202 37 319 DNA
Mycobacterium tuberculosis misc_feature (1)..(319) n is a, c, g, or
t/u; y is t/u or c. 37 ctanttttag aytnngtcgt gacatatccg ctgtacgcgt
gggacggncc attattggat 60 aatgcgtgat aagcaccaca agaantgatt
ncctatggat attgtcggta ncgttcgcgt 120 ccatgattgc tcttgcaacg
ctgttgacgc ttatcaatca agtcgtcggc actccgtata 180 ttcccggtgg
cgattctccc gccgggaccg actgctcgga gctggcttcg tgggtatcga 240
atgcggcgac ggccaggccg gttttcggag ataggttcaa caccggcaac gaggaagcng
300 ccttggcggc tcggggctt 319 38 263 DNA Mycobacterium tuberculosis
38 ggtacttgtc gtcgatggac tcccggtctc gattcaggaa cagcgtcccg
acgacaccgg 60 ctcccaccag cccgagaaac gccaccacgc cgcgagcgcc
caccacagtc gacggtgcca 120 gaacgcacca cccgacacgt gacggcgaaa
caccaacggc acctgactga tgccagctgc 180 tgctgaccaa gtgggcacgc
tcggcgcgcc tcggaacgag tcgtcgctgc cgcgacgaag 240 acgcctcggc
gacgtggatc ggg 263 39 841 DNA Mycobacterium tuberculosis
misc_feature (1)..(841) n is a, c, g, or t/u. 39 gcgttgcgcg
ccctcgagca gtcnnttggc ggcgatcccg agacaatgat tcccgacatc 60
cggtacacac cgaaccccaa cgatgcgccg ggcggcccgc tggtagaaag gggaaatcgc
120 cagtgctgac tcgcttcatc cgacgccagt tgatcctttt tgcgatcgtc
tccgtagtgg 180 caatcgtcgt attgggctgg tactacctgc gaattccgag
tctggtgggt atcgggcagt 240 acaccttgaa ggccgacttg cccgcatcgg
gtggcctgta tccgacggcc aatgtgacct 300 accgcggtat caccattggc
aaggttactg ccgtcgagcc caccgaccag ggcgcacgag 360 tgacgatgag
catcgccagc aactacaaaa tccccgtcga tgcctcggcg aacgtgcatt 420
cggtgtcagc ggtgggcgag cagtacatcg acctggtgtc caccggtgct ccgggtaaat
480 acttctcctc cggacagacc atcaccaagg gcaccgttcc cagtgagatc
gggccggcgc 540 tggacaattc caatcgcggg ttggccgcat tgcccacgga
gaagatcggc ttgctgctcg 600 acgagaccgc gcaagcggtg ggtgggctgg
gacccgcgtt gcaacggttg gtcgattcca 660 ctcaagcgat cgtcggtgac
ttcaaaacca acattggcga cgtcaacgac atcatcgaga 720 actccgggcc
gattttggac agccaggtca acacgggtga tcagatcgac ngctgggcgc 780
gcaaattgaa caatctggcc gcacagaccg cgaccaggga tcagaacgtg cgaagcatcc
840 t 841 40 209 DNA Mycobacterium tuberculosis misc_feature
(1)..(209) n is a, c, g, or t/u; b is g, c or t/u; d is g, t/u or
a. 40 gcggttggca ccaccagcga naatcagcag gndcccgcca cgttgcaaga
cggcggcaat 60 cttcgcctgt cgctcaccga ctttccgccc aacttcaaca
tcttgcacat cgacggcaab 120 aabgccgagg tcgcggcgat gatgaaagcc
accttgccgc gcgcgttcat catcggaccg 180 gacggctcga cgacggtcga
caccaacta 209 41 167 DNA Mycobacterium tuberculosis misc_feature
(1)..(167) n is a, c, g, or t/u. 41 agatcgtcag
tgagcagaac cccgccaaac cggccgcccg aggtgttgtt cgagggctga 60
aggcgctgct cgcgacggtc gntgctggcc gtcgtcggga tcgggcttng gctcgcgctg
120 tacttcacgc cggcgatgtc ggcccgcgag atcgtgnatc atcggga 167 42 221
DNA Mycobacterium tuberculosis misc_feature (1)..(221) n is a, c,
g, or t/u; k is g or t/u. 42 ccagntcctc nnatatcgac accctcnacn
aagaccgctt cgcgagatca acnctcagat 60 atncnnacta tcnccnntnc
acgcacacct caacatnana naatngaact atngncttcg 120 cctcaccacc
aaggttcagg ttancggctg ncgtttkctc tkcgccggct cgaacacgcc 180
atcgtgcgcc ggkacacccg gatgtttgac gacccgctgc a 221 43 117 DNA
Mycobacterium tuberculosis misc_feature (1)..(117) n is a, c, g, or
t/u; y is t/u or c; h is a, c or t/u. 43 cggyccgnnc aayyygncgc
gchncggygy agaggtcgny aaggtcgcca aggtaacgct 60 gatcgayggg
nacangcaag tattggtgna cttcaccgtg ghthgcthgc tgtyagc 117 44 385 DNA
Mycobacterium tuberculosis 44 gaacctcctc gcccgcgctt ggcctagcat
taatcgactg gcacgacagt tgcccgactg 60 ggtacacggc atggacgcaa
cgcgaatgaa tgtgagttag ctcactcatt aggcacccca 120 ggcgttgaca
ctttatgctt ccggctcgtg tagttgtgtg ggaattgtgg agcggataac 180
aatttcgacg acgaggaaac agctgtagac atggattgac gaatttgaat acgactcact
240 ataggaattc gagctcggta cccggggatc ctctagagtc cttcgccgcg
ggtcgccacc 300 atcagggcca gtgcgatcgc aagcgcgggg taccgggcgc
catagtcttc agcatcggcg 360 tgttgaccgc agagaccgga cgggg 385 45 285
DNA Mycobacterium tuberculosis misc_feature (1)..(285) n is a, c,
g, or t/u. 45 cccgcagcag tacccgcagn cccacacccg ctatncgcag
cccgaacagt tcggtgcaca 60 gcccacccna gctcggcgtg cccggtcagt
acggccaata ccagcagccg ggccaatatg 120 nccagccggn acagtnacgn
ccagcccggc cagtacgcna ccgcccggtc agtaccccgg 180 gcaatacggc
ccgtatgncc agtcgggtca ggggtcgaag cgttcggttg cggtgatcgg 240
cggcgtgatc gccgtgatgg ccgtgctgtt catcggcgcg gttct 285 46 186 DNA
Mycobacterium tuberculosis misc_feature (1)..(186) n is a, c, g, or
t/u. 46 gcncgtgncc gtgccgcccg gttgaacgtg agcngctgnc natngcccca
gccgagacga 60 gaacgtcccc gaggagtatg cagactggga agacgccgaa
gactatgacg actatgacga 120 ctatgaggcc gcagaccagg aggccgcacg
gtcggcatcc tggcgacggc ggttgcgggt 180 ncggtt 186 47 409 DNA
Mycobacterium tuberculosis misc_feature (1)..(409) n is a, c, g, or
t/u. 47 gtcgctgaat gtgttgtcgg agaccgtnga tcagacctat ccgcacctga
gcgccgccnt 60 cgacgggntg gctaagttct ccgacaccat cggcaagcgc
gacgagcaga ntcacgcacc 120 tactagccca ggccaaccag gtggccagca
tcctgggtga tcgcagtgag caggtcgacc 180 gcctattggt caacgctaag
accctgatcg ccgcgttcaa cgagcgcggc cgcgcggtcg 240 acgccctgct
ggggaacatc tccgctttct cgncccaggt gcaaaacctt natcaacgac 300
aacccgaacc tgaaccatgt gctcgnnnag ctgcgcatcc tcancgacct gttggtcgac
360 cgcaaggagg atttggctga aaccctgacg atcttgggca gattcagcg 409 48
464 DNA Mycobacterium tuberculosis misc_feature (1)..(464) n is a,
c, g, or t/u. 48 agnccgtgca ctggaacttc ggctcgatgt ctccgatgtg
gacggcaagc tgatgatctc 60 ccggttggan gtcgattcga tgasaaatgn
cttggcggct ggtggtgttc gatgncctgg 120 caccactggc cacgatcgcc
gccntggccg cgatcggcgn cttngctcgg ctggcccctg 180 tggtgggttt
cgacgtgctc ggtgttggtg ctgctggtgg tcgaaggtgt ggcaatcaac 240
nttctggctg ttgcgtcgtg attcggtaac cgtcggtacc gacgacgatg cgcccgggct
300 gcgactggcc gttgtcttcc tgtgcgccgc cgcgatctcg gcggcggtgg
tgactgggta 360 cctgcgctgg acgacaccgg accgcgactt caatcgggat
tcccgggaag tggtgcatct 420 tgccacgggg atggccgaga cggtcgcgtc
attctccccg agcg 464 49 423 DNA Mycobacterium tuberculosis
misc_feature (1)..(423) n is a, c, g, or t/u; k is t/u or g. 49
gtccaaggcc gtagcccacc tcctggaagt cgtaccacgt cgactcgacc aggacggctg
60 cantcagcna cttcgtcaac ccggcgatca tcaacntgca cctacggcag
tgtgnacgca 120 ccccggacca tcgcactggc cggggnttca cacgccgaac
actgnctgac cgcactggat 180 ctgctnggtc gcatgcacca cttcaaggtg
gtgacgtacc tcaaaatggg ttkcccgttg 240 tccaccgagg aagtcccgct
gatncatggg caataacgct ccctatccgc agtgtcacca 300 gtgggtgcaa
gcggcgatgg ccaagttggt cgctgaccac cccgactacg ttttcacaac 360
ctcgactcga ccgtggaaca tcaaacccgg cgatgtgatg ccagcaacct atgtcgggat
420 ctg 423 50 279 DNA Mycobacterium tuberculosis 50 cggtcgagcc
gatgaacgtc tgcagttcac cgcaaccacg ctcagcggtg ctcccttcga 60
tgcgcaagcc tgcaaggcaa tgccgcggtg ttgtggttct ggacgccgtg gtgcccgttc
120 tgcaactgtc agaagccccc agccgcagcc aggtagcggc cgctaatccg
gcggtcacct 180 tcgtcggaat cgccacccgc gccgacgtcg gggcgatgca
gagctttgtc tcgaagtaca 240 acctgaattt caccaacctc aatgacgccg
atggtgtga 279 51 331 DNA Mycobacterium tuberculosis misc_feature
(1)..(331) n is a, c, g, or t/u; m is a or c. 51 cggcccgscg
gcgccntggt gaagcttggm gmmtgggtgn agcgcagctg cccaccacac 60
ggraccnngg tgcggacgcg gntgacgcgc ctggtggtca gcatcgtggc cggtctgctg
120 ttgtatgcca gcttcccgcc gcgcaactgc tggtnggcgg cggtggttgs
gctncgcatt 180 gctggcctgg gtgctgaccc accgcgcgac gacaccggtg
ggtgggctgg gctacggcct 240 gctattcggc ctggtgttct acgtctcgtt
gttgccgtgg atcggcgagc tggtgnnccc 300 cgggccctgg ttggcactgg
cgacgacgtg c 331 52 507 DNA Mycobacterium tuberculosis 52
tgtattcccg tcgatgcgtt gctgcaggta ggccttgaaa tcgttggggg tcacgacgcg
60 gacctcgaag ttcatcatcg agtgatacgt gccacacatc tcggcgcagt
ggcccacgaa 120 tgctccggtc ttggtgattt cttcgatctg gaagacgttg
accgagttgt ttgccaccgg 180 gttaggcatc acgtcacgct tgaacaagaa
ctccggcacc cagaatgcgt gtatcacatc 240 ggctgaggcc atttggaatt
cgatacgctt gccggacggc agcaccagca ccggaatttc 300 ggtgctggtg
cccaacgtct cgaccttgtc gaaattcagg taggtccggt cctcggtgtt 360
gagcccgcgc accggcccga ccagctcttc gccgtacttg tccttgccct ctggcttgga
420 aaccatggcg cgcttgcgct ccggatcggc accatcatag gtcagtgtgc
cgtctttgaa 480 gttcaccctt tgatagccaa acttcca 507 53 293 DNA
Mycobacterium tuberculosis 53 ccacacaaca caaatctacg tcgtaatgca
gtcgtaagtc catccgacgt cgatggcaag 60 gacagcaccc gacggccaac
ggcatataca tcgtcggctc gccggtcaca agcacatcat 120 catggactcg
tccactacgg cgtacccgtc aactcgccca acggatatcg caccgatgtc 180
gactggccac ccagatctcc tacagcggtg tcttcgtgca ctcagcgccg tggtcggtgg
240 gggctcaggg ccacaccaac accagccatg gctgcctgaa cgtcagcccg agc 293
54 820 DNA Mycobacterium tuberculosis misc_feature (1)..(820) n is
a, c, g, or t/u. 54 cgccgccggc gngcgctacc ggtgcgggag ggtacaccca
agcantccgg gaccggccgt 60 cycgccggga acgccgtgct cctacacacc
ggcggcgggc gcgttgccac ggcccgacac 120 cccactaccc tgncgcgggc
gccaccgttg gcccgttcgg tggacccgac ttcccggcac 180 cgctcgatgt
ccagccgtcg ccgcctaatc ccgatgggcc gccgccgacg ccgggcatcc 240
taagtgctgg gcggccgggc gagccggctc cggctgttcc ggncataccg atgccsctgc
300 cgccgaacnn nnnnnnnnnt gcacgcaccc aaccgcttga gccgtttcct
gacgggacgg 360 gaggtagcaa ccaatgagca ccatcttcga catccgsagc
ctgcgactgy cgaaactgtc 420 tgcaaaggta gtggtcgtcg gcgggttggt
ggtggtcttg gcggtcgtgg ccgctgcggc 480 cggcgcgcgg ctctaccgga
aactgactac cactaccgtg gtcgcrtatt tnctstgagg 540 cgctcgcgct
gtacccagga gacaaagtcc agatcatggg tgtgcgggtc ggttctatcg 600
acaagatcga gccggccggc gacaagatgc gagtcacgtt gcactacagc aacaaatacc
660 aggtgccggc cacgnctacc gcgtcgatcc tcaaccccag cctggtggcc
tcgcgcacca 720 tccagctgtc accgccgtac accggcggcc cggtcttgca
agacggcgcg gtgatcccaa 780 tcgagcgcac ccaggtgccc gtcgagtggg
atcagttgcg 820 55 117 DNA Mycobacterium tuberculosis 55 cagccacctc
gttcgccgcc gacatcgact atcagccgac ccggccactg ctgacctgat 60
cgccaacagc tggaggccct accggctgca gttcaattca cccgctgcgg gtcggcg 117
56 242 DNA Mycobacterium tuberculosis 56 aggtgtcgtg cttcatgcct
ggcgcccaat ccagtttcta caccgactgg tatcaccctt 60 cgcagacaaa
cggccagaac tacacctaca agtgggagac cttccttacc acacagatgc 120
ccgcctggct acaggccaac aaggcgtgtc ccccacaggc aacgcggcgg tgggtctttc
180 gatctcgggc ggttccgcgc tgaccctggc cgcgtactac ccgcagcagt
tcccgtacgc 240 cg 242 57 345 DNA Mycobacterium tuberculosis 57
tgctgcagat agccaaggat cccgaggtcg tgattgatat cacgtctttc cagtggaatt
60 ggaagtttgg ctatcaaagg gtgaacttca aagacggcac actgacctat
gatggtgccg 120 atccggagcg caagcgcgcc atggtttcca agccagaggg
caaggacaag tacggcgaag 180 agctggtcgg gccggtgcgc gggctcaaca
ccgaggaccg gacctacctg aatttcgaca 240 aggtcgagac gttgggcacc
agcaccgaaa ttccggtgct ggtgctgccg tccggcaagc 300 gtatcgaatt
ccaaatggcc tcagccgatg tgatacacgc attct 345 58 262 DNA Mycobacterium
tuberculosis misc_feature (1)..(262) n is a, c, g, or t/u. 58
cngactccaa cnagtgcgnt caancngntg tnccngacaa gaaggttcct acatccgcaa
60 ntcggtgnaa ngccactgtg gatgcctacg acggaacggt cacgctgtac
caacaggacg 120 naaaaggatc cggtgctcaa ggcctggatg caggtcttcc
ccggcacggt aaagcctaag 180 agcgacattg cgccggagct tgccgagcan
ctgcggtatc ccgaggacct gttcaaggtg 240 cagcgcatgt tgttggccaa at 262
59 241 DNA Mycobacterium tuberculosis misc_feature (1)..(241) n is
a, c, g, or t/u; r is g or a. 59 ccaccannna acrrcacagc tccggccrrc
cgtncgcagg ccacccgcan cgtagtgctc 60 aaattcttcc aggacctcgg
tggggyacat ccgtccacct ggtacaaggc cttcaactac 120 aacctcgcga
cctcgcagcc catcaccttc gacacgttgt tcgtgcccgg caccacgcca 180
ctggacagca tctaccccat cgttcagcgc gagctggcac gtcagaccgg tttcggtgcc
240 g 241 60 243 DNA Mycobacterium tuberculosis misc_feature
(1)..(243) n is a, c, g, or t/u. 60 ccggcggatc tgcgtgacga
ntgtatncca cggnactacc cgcggtcctt cctcnantnc 60 cgccggncca
gncgcagnct ncngatgtcc ngctataacc tgcgcgatcg ccgccgggct 120
gcccgacaac acggtgngcg ccgccgctgc ttccgccaat tctgggtgnc ggcatnccgg
180 cagcgcccgg cccagcactg agagggggac gttgatgcgg tggccgacgg
cgtggctgct 240 ggc 243 61 2348 DNA Mycobacterium tuberculosis
misc_feature (1)..(2348) n is a, c, g, or t/u; m is a or c. 61
gcgctgtcat tcggacttcg gaccgcgttg gcggtggtgc tgatcatgaa nctacgacgg
60 cgccaccggc agcttcccgt catgggtgct ctatccctgt gcgctggcca
tgatggtgtt 120 ctcgaagtcg ttcagcgtgc tgcgcagcgc agtgacaccg
agggtgatgc cgccaaccat 180 cgacttggtc cgggtcaact cacggctgac
cgtgttcggc ctgctcggcg gcaccatcgc 240 tggtggcgcg attgcggccg
gagtcgaatt cgtctgcacc cacctgttcc agctgccggg 300 cgcgttgttc
gtcgtcgtcg cgatcaccat cgctggcgct tcgctgtcga tgcgcattcc 360
gcgctgggtc gaggtgacca gcggtgaggt cccggccaca ttgagctacc accgggatag
420 gggcagacta cggcgacngc tggccggagg aagtcaagaa cctcggcgga
acactccgac 480 aaccgttggg ccgcaacatc attacctccc tgtggggtaa
ctgcaccatc aaggtgatgg 540 tcggctttct gttcttgtat ccggcgtttg
tcgccaaggc gcacgaagcc aacgggtggg 600 tgcaattggg catgctgggc
ctgatcggcg cggcggccgc ggtcggcaac ttcgccggca 660 atttcaccag
cgcacgcctg cagctaggca ggccagctgt gctggtngtg cgctgcaccg 720
tgctagttac cgtgttagcc atcgcggccg cggtggccgg cagcctggca gcgacagcga
780 ttgccaccct gatcacggca gggtccagtg ccattgctaa agcctcgctg
gacgcctcgt 840 tgcagcacga cctgcccgag gagtcgcggg catcggggtt
tgggcgttcc gagtcgactc 900 ttcagctggc ctgggtgctg ggcggcgcgg
tgggcgtgtt ggtgtacacc gagctgtggg 960 tgggcttcac tgcggtgagc
gcgctgctga tcctgggtct ggctcagacc atcgtcagct 1020 tccgcggcga
ttcgctgatc cctggcctgg gcggtaatcg gcccgtgatg gccgagcaag 1080
aaaccacccg tcgtggtgcg gcggtggcgc cgnagtgaag cgcggtgtcg caacgctgcc
1140 ggtgatcctg gtgattctgc tctcggtggc ggccggggcc ggtgcatggc
tgctagtacg 1200 cggacacggt ccgcagcaac ccgagatcag cgcttactcg
cacgggcacc tgacccgcgt 1260 ggggccctat ttgtactgca acgtggtcga
cctcgacgac tgtcagaccc cgcangcgca 1320 gggcgaattg ccggtaagcg
aacgctatcc cgtgcagctc tcggtacccg aagtcatttc 1380 ccgggcgccg
tggcgtttgc tgcaggtata ccaggacccc gccaacacca ccagcacctt 1440
gtttcggccg gacacccggt tggcggtcac catccccact gtcgacccgc agcgcgggcg
1500 gctgaccggg attgtcgtgc agttgctgac gttggtggtc gaccactcgg
gtgaactacg 1560 cgacgntccg cacgcggaat ggtcggtgcg ccttatcttt
tgacgaggcc gcggctcgac 1620 gggacgctta agcgcggtcg gcgccaacgg
tccgaagagc cgccgacacc cggggcacat 1680 cggcgcatca tggaactgtg
cggatcggag tcggggtttg caccacgccc gacgcgcggc 1740 aggccgcggt
ggaggctgcg ggccaggcgc gcgacgagct ggcgggtgag gcgccgtcgc 1800
tggcggtgtt gcttggatcg cgtgcacaca ccgaccgggc tgccgacgtc ctgagcgcgg
1860 tgctgcagat gatcgayccg cccgcgcttg tcggttgcat cgcccaggcc
atcgtcgccg 1920 gccgccacga gatcgaggac gagcccgcgg tggtggtgtg
gctggcgtcc ggcttggccg 1980 ccgagacatt ccagctggac tttgtccgta
ccggctcggg tgccctgatc accggttatc 2040 ggttcgaccg caccgcccgg
gatctgcatc tgctgctgcc ggacccgtac acattcccgt 2100 cgaacctgct
catcgagcac cccaacaccg acctgccggg caccgccgtc gtgggcggcg 2160
ntggtgagcg gcgggcgccg gcggggcgac acccggctgt tccgcgatca cgacgtgctc
2220 acctccggcg tcgtcggcgt gcgcctgccc gggatgcgcg gtgtmccggt
cgtgtcgcag 2280 ggttgccggc cgatcggcta cccatacatc gtcaccggcg
cggacggcat actgatcacc 2340 gagctcgg 2348 62 821 DNA Mycobacterium
tuberculosis misc_feature (1)..(821) n is a, c, g, or t/u. 62
cgttacccgc tttacaccac cgccaaggcc aacctgaccg cgctcagcac cgggctgtcc
60 agctgtgcga tggccgacga cgtgctggcc gagcccgacc ccaatgccgg
catgctgcaa 120 ccggttccgg gccaggcgtt cggaccggac ggacgctggg
cggtatcagt cccgtcggct 180 tcaaacccga gggcgtgggc gaggacctca
agtccgancc cggtggtctc caaacccggg 240 ctggtcaact ccgatgcgtc
gcccaacaaa cccaacgccg ccatcaccga ctccgcgggc 300 accgccggag
ggaagggccc ggntcgggat ncaacgggtt gcnacgcggc gctgccgttc 360
nggattggac ccggcacgta ccccggtgat gggcagctac ggggagaaca acctggccgc
420 cacggccacc tcggcctggt accagttacc gccccgcagc ccggaccggc
cgctggtggt 480 ggtttccgcg gccggcgcca tctggtccta caaggaggac
ggcgatttca tctacggcca 540 gtccctgaaa ctgcagtggg gcgtcaccgg
cccggacggc cgcatccagc cactggggca 600 ggtatttccg atcgacatcg
gaccgcaacc cgcgtggcgc aatctgcggt ttccgctggc 660 ctgggcgccg
ccggaggccg acgtggcgcg cattgtcgcc tatgacccga acctgagccc 720
tgagcaatgg ttcgccttca ccccgccccg ggttccggtg ctggaatctc tgcagcggtt
780 gatcgggtca gcgacaccgg tgttgatgga catcgcgacc g 821 63 479 DNA
Mycobacterium tuberculosis misc_feature (1)..(479) n is a, c, g, or
t/u; s is g or c. 63 gccagccgtg atcggctgay cggncagntg atcaccaacc
tcaacgtggt gctgggcntc 60 gctggncgct cacacngatc ggttggacca
gscggtgacg tcgctatcag cgttgattca 120 ccggctcgcg caacgcaaga
ccgacatctc caacgccgtg gcctacacca acgcgccgcc 180 ggctcggtcg
ccgatctnct gtcgcaggct cgcgcnncgt tggcgaangt ggttcgcgag 240
accgatcggg tggccggcat cgcggccgcc gaccacgact acctcgacaa tctgctcaac
300 acgctgccgg acaaatacca ggcgctggtc cgccagggta tgtacggcga
cttcttcgcc 360 ttctacctgt gcgacgtcgt gctcaaggtc aacggcaagg
gcggccagcc ggtgtacatc 420 aagctggccg gtcaggacan gcnggcggtg
cgcgccgaaa tgaaatcctt cgccgaacg 479 64 481 DNA Mycobacterium
tuberculosis misc_feature (1)..(481) n is a, c, g, or t/u; k is t/u
or g. 64 kgtctcgcgn ccttaacatc cggtcgcccc ancggtaatc tgcctgtgga
tgccgtccgg 60 aantataagc aaatggccag gagtgcgtga cgcagttatg
gctcggtata gttccgttnt 120 tgccccggac tgggggcgtg aggtggaact
aatggcggtg tcgggtgata tttccgacgg 180 caagcgacca tataggtgga
tcgacggcaa taaasacacg ctctggccac gtttcttggc 240 ggggaaaggg
gtgatgctat cggagccaat ggtatcgcga caacacttgc agatgccgcc 300
aaggccgatc acgctaatga cggattcggg gccacaaacg ttccccgttc tggcggtttt
360 ctctgactac acctcagatc aaggtgtgat tttgatggat cgcgccagtt
atcgggccca 420 ttggcaggat gatgacgtga cgaccatgtt tctttttttg
gcnatncggg tgcgaatagc 480 g 481 65 469 DNA Mycobacterium
tuberculosis misc_feature (1)..(469) n is a, c, g, or t/u. 65
ggcgaggtca gtgaagccga ggaagcggaa aggagcgccc aatacggaac cgcctctccc
60 cgcgcgttgg ccgattcatt aaatgcagct ggcacgacag gtttcccgac
tggaamgcgg 120 gcagtgagcg caasgcaatt aatgtgagtt agctcactca
ttaggcaccc caggctttac 180 actttatgct tccggctcgt atgttgtgtg
gaattgtgag cggataacaa tttcacacag 240 gaaacagcta tgacatgatt
acgaatttaa tacgactcac tatagggaat tcgagctcgg 300 tacccgggga
tcctctagag tcgcttcggt tggcggcgac cagcagtgga tccacggtgg 360
ccgcccgcgc ggcdtcatac accgccgcgg cctccttggc ctgtgcggcc sgcttagcgc
420 gcgtgttgct gccgtgctta gccanctggc atagggggct gccgcgcgc 469 66
291 DNA Mycobacterium tuberculosis misc_feature (1)..(291) n is a,
c, g, or t/u; r is g or a. 66 caggttcgac tgatctagct gnrrrccara
ccggcacnag ncgacantta ccantacctg 60 acanacagnc cgntcnagcc
aanccgnann naggangcag nagnaacagg cagatgcatc 120 taatgatacc
cgcggagtat atctccaacg tgatatatga aggtccgcgt gctgactcat 180
tgtatgccgc cgaccagcga ttgcgacaat tagctgactc agttagaacg actgccgagt
240 cgctcaacac cacgctcgac gagctgcacg agaactggaa aggtagtttc a 291 67
1306 DNA Mycobacterium tuberculosis 67 gtgatacagg aggcgccaac
agtgacacct cgcgggccag gtcgtttgca acgcttgtcg 60 cagtgcaggc
ctcagcgcgg ctccggaggg cctgcccgtg gtcttcgaca gctggcgctc 120
gcagcaatgc tgggggcatt ggccgtcacc gtcagtggat gcagctggtc ggaagccctg
180 ggcatcggtt ggccggaggg cattaccccg gaggcacacc tcaatcgaga
actgtggatc 240 ggggcggtga tcgcctccct ggcggttggg gtaatcgtgt
ggggtctcat cttctggtcc 300 gcggtatttc accggaagaa gaacaccgac
actgagttgc cccgccagtt cggctacaac 360 atgccgctag agctggttct
caccgtcata ccgttcctca tcatctcggt gctgttttat 420 ttcaccgtcg
tggtgcagga gaagatgctg cagatagcca aggatcccga ggtcgtgatt 480
gatatcacgt ctttccagtg gaattggaag tttggctatc aaagggtgaa cttcaaagac
540 ggcacactga cctatgatgg tgccgatccg gagcgcaagc gcgccatggt
ttccaagcca 600 gagggcaagg acaagtacgg cgaagagctg gtcgggccgg
tgcgcgggct caacaccgag 660 gaccggacct acctgaattt cgacaaggtc
gagacgttgg gcaccagcac cgaaattccg 720 gtgctggtgc tgccgtccgg
caagcgtatc gaattccaaa tggcctcagc cgatgtgata 780 cacgcattct
gggtgccgga gttcttgttc aagcgtgacg tgatgcctaa cccggtggca 840
aacaactcgg tcaacgtctt ccagatcgaa gaaatcacca agaccggagc attcgtgggc
900 cactgcgccg agatgtgtgg cacgtatcac tcgatgatga acttcgaggt
ccgcgtcgtg 960 acccccaacg atttcaaggc ctacctgcag caacgcatcg
acgggaakac aaacgccgag 1020 gccctgcggg cgatcaacca gccgcccctt
gcggtgacca cccacccgtt tgatactcgc 1080 cgcggtgaat tggccccgca
gcccgtaggt taggacgctc atgcatatcg aagcccgact 1140 gtttgagttt
gtcgccgcgt tcttcgtggt gacggcggtg ctgtacggcg tgttgacctc 1200
gatgttcgcc accggtggtg tcgagtgggc tggcaccact gcgctggcgc ttaccggcgg
1260 catggcgttg atcgtcgcca ccttcttccg gtttgtggcc gcggat 1306 68 728
DNA
Mycobacterium tuberculosis misc_feature (1)..(728) n is a, c, g, or
t/u. 68 ggtgcctgcc atcggttcgc tggccacgct ggcatctttg gtctgttaga
ggtatccgcg 60 cggatggcca gtcctgttgg cggggnttgt cgccacgatt
gccgcccgcg ctgaancccg 120 acgacgccga tgccctgccc accacggatc
ggctgaccac ccgagcgaac cgtgcagatg 180 cttggttgac gagcctgctg
gcgnccttcg cggcctcggc gaccatcggt gccatcggaa 240 ccgccgtcgc
aacccacggc atccacagst ccagcatngg cggtatcgcg ttggccgncg 300
tcaccggtgc gctgctgctg ctacgagcac gttcagcaga caccagaagg tcactggtgt
360 ttgccatctg tggaatcacc accgttgcaa cggcattnta ccgtcgccgc
ggatcgggct 420 ctggaacacg ggccgtggat tgccgcgctg accgccatgc
tggnccgccg tggcaatgtt 480 tttgggcttc gtcgctcccg cgttgtcgct
ctcgcccgtc acgtaccgca ccatcgaatt 540 gctggagtgt ctggcgctga
tcgcaatggt tccattgacc gcttggstat gcggcgccta 600 caggcgcgtt
cgccacctcg acctgacatg gacatgacca cngtcccgta ccctgcgcct 660
gctggtggta tcagcgctcg cgacgctgtc tgggttggga acgccggttg cgccacgcgg
720 tttcgccg 728 69 1028 DNA Mycobacterium tuberculosis
misc_feature (1)..(1028) n is a, c, g, or t/u; k is t/u or g; s is
g or c. 69 gktcncggtg atgtcgaccg tcggcacgac gagcgaaacc tcaccggtcg
acagtgtctg 60 cccgaggccg cagccgacgt gcccccggag accgcgcgcc
aacacggtgc cgtacatgta 120 gcccgcacgg cgcatcatcg ccgagccggc
gtagatgttt tcctgcacgg cgtgcgcggt 180 gaacccntcc ggcgccagca
ccgccacctt tcccgcgtcc acgtcggcct gggtggtgac 240 gccgagcacc
ccaccgaaat gatcgacatg gctgtgggtg tagatgaccg scgaccacgg 300
ggcggtcggc tccgcggtgg gcgcgataca agtccagcgc ggcggcggcc acctcggtgg
360 acaccaacgg gtcgatgacg atcagcccag tgtcaccctc aacgaagctg
atattggaga 420 tatcgaatcc gcggacctga tagatgcccg gcaccacctg
gtagaggccc tgtttcgcgg 480 tcagctggga ttgccgccac aggctgggat
gcaccgatgt cggcgcggca ccgtcgagaa 540 acgagtacgc gtcgttgtcc
cacaccacgc gaccatcggc agccttgatc acacacgggg 600 acagcgcggc
aatgaatccg cgatcggcgt cgtcgaaatc cgttgtgtca tgcaacggta 660
acgagtgttc accgtgtgcc gcctggatga cggcagtngg gaggtttgtg ttccatcggc
720 actacattgc cactactacg gtgcacgccg gtagatgccg ttggcgaacc
acgctaccga 780 ccagaaagag agaattttcc gccgcaccta gacctcgggc
cctcntaacg cgcatactgc 840 cgaagcggtc ctcaatgccg atggaccgct
acgacaggca aaggagcaca gggtgaagcg 900 tggactgacg gtcgcggtag
ccggagccgc cattctggtc gcaggtcttt ccggatgttc 960 aagcaacaag
tcgactacag gaagcggtga gaccacgacc gcgngcaggc acgacgcaag 1020
ccccggcg 1028 70 780 DNA Mycobacterium tuberculosis misc_feature
(1)..(780) n is a, c, g, or t/u; y is t/u or c. 70 agatcaacac
catcaccagt gcggtcatcg agttgctgca gggcnagggt ggtccgttgg 60
cgaacgtgct cgccgcyacc ggtgccttct cggcggcgct gggcgcacgc gaccagctga
120 tcggcgaggt aatcaccaac ctcaacgcgg tgctggcgac cgtcgatgca
aagagcgcgc 180 aatttntcgg ccagtgtcga ccagctgcag cagctggtca
gcggcctggc caagaaccgg 240 gatccgatcg cgggcgccat ttcgccgctg
gcgtcgacga cgacggatct tacggaactg 300 ttgcggaatt cgcgccggcc
gctgcaaggc atcctggaaa acgcccggcc gctggctacc 360 gagctggaca
accgaaaggc cgaggtcaas aacgacatcg agcagctcgg cgaggactac 420
ctgcgcctgt ccgcgctggg cagttacgga gcattcnttc aacatctact tctgctcggt
480 gacgatcaag atcaacggac cggccggcag cgacatcctg ctgccgatcg
gcggccagcc 540 ggatcccagc aaggggaggt gcgcctttgc taaataggaa
gccaagtagc aaacacgaac 600 gcgacccgnt ccgcaccggc atcttcggcc
tggtgctggt gatctgcgtc gtcctgatcg 660 cattcggcta cagcgggttg
cctttctggc cacagggcaa aacctacgac gcgtatttca 720 ccgacgccgg
tgggatcacc cccggtaact cggtttatgt ctcgggcctc aaggtgggcg 780 71 689
DNA Mycobacterium tuberculosis misc_feature (1)..(689) n is a, c,
g, or t/u. 71 ctatccgcaa ggcttcgcag acgctcggct gnaccgcaga
atcgcggtgc acccacgatt 60 gccagtagcg cgggcccact cgtgcctact
acacttcgtc gtagccaaat catcggcccc 120 gtagtatctc cggagatgac
agatgaatgt cgtcgacatt tcgcggtggc agttcggtat 180 caccaccgtc
tatcacttca ttttcgtnac cgctgaccat cggcctggcc ccngctgatc 240
gcggtcatgc aaactgctgt nggtcgtcac cgataacccc gcctggtatc gcctcaccaa
300 attcttcggc aaattgttcc tgatcaactt tgccatcggc gtggcgaccg
gaatcgtgca 360 ggaatttcag ttcggcatga actggagcga gtactcccga
ttcgtcggcg atgtcttcgg 420 cgccccgctg gccatggagg gcctggcggc
cttcttcttc gaatccacct tcatcgggtt 480 gtggatcttc ggctggaaca
ggctgccccg gctggtgcat ctggcctgca tctggatcgt 540 cgcaatcgcg
gtcaacgtgt ccgcgttctt catcatcgng gcaaactcct tcatgcagca 600
tccggtcggc gcgcactaca acccgaccac cgggcgtgcc gagttgagca gcatcgtcgt
660 gcctgctgac caacaacacc gcacaggcg 689 72 274 DNA Mycobacterium
tuberculosis 72 ccgcagcacc gaggcaagca tcgcacccgt cgattcccgc
catcccggcg acatgatggt 60 catgtccgac accgacgccc gcacctcgct
tcccgagttg accgcgctgc gcgtggacgc 120 cgcaacggat gcgtcggttc
attcgatccc ggctcgaaat tggccatggc gaacgcatct 180 tgctgtgatg
gttcgggcag tagatctcca ctgccgcact gataaactcg ggtcatggtc 240
gtcgtgaggc ggacagggta gaggcgcatg accg 274 73 252 DNA Mycobacterium
tuberculosis 73 gtgatgcctt ccagcattgg attggtcgtc ggttcgatgc
tgtggcgaca gataaaccgc 60 ctgttcgggg tgcgtggcct ctgctgggca
gcgcactgct caacgccgct ctgcgctgct 120 gtgcatggtg gccgagtcgt
gtgggcagtg ggttcacgcc tgggcgtact tcacggcgtt 180 cctgctggct
acggtggccg ctcaaacggt ggtcgccgca tcgatatcgt ggatcagcgt 240
cctcgcgccc ga 252 74 160 DNA Mycobacterium tuberculosis 74
ggcgccgccg tcgtgctggc cgcccggccc ggtgggggtg ccggccagcg tggttccgcc
60 agtggccgcg ccgaacgtat tggccggcgt cctcgagcac gacaacgacg
ggtcgggggc 120 ggcggtgctg gccgcgctgg ccaagctgcc acccggtggt 160 75
401 DNA Mycobacterium tuberculosis misc_feature (1)..(401) n is a,
c, g, or t/u; w is t/u or a. 75 atcagccgcg ggtcgacgcc gccgatgacc
tcgacgtcgt cgtcgtcgct gccggtactc 60 aatccaatca ccatcctctt
acgcaccttc taggagtgtg ttgctgcggc agtgccgngc 120 cattcgtaga
ttcgggcctc gccgttgtcg tagatcttcg cccacgacct cgatgtctct 180
aacgacacta gtccgtccgg cacngcaaan ccccgcaccg tcggagtgct ggtcaggnta
240 tagncggtac aggnggactt ggwwggcctc gagtanccga ggwwcgntct
ncccgttgcg 300 gncataggcc agaagatgaa ccggtgtaga ccgggcctgt
tgcgagggtc gtagtcgtag 360 gtcccagagg tgtcggacgc ccaggttaat
acacagcgtg c 401 76 248 DNA Mycobacterium tuberculosis 76
gcagacctct ggccgctggt ggtgctgggt acctgcgctg gcgacaccgg accgcagacc
60 gtcaatcggg actcccggga acgtggtgcc atcttgccac ggggatggcc
gacgcggctc 120 gtcattctcc ccgagcgcac cggccgccgc tgttgaccgg
gccgcggcga ctgatggtgc 180 ccgcacacgc gggcgggttc aaggagcaat
acgccaagtc cagcgccgct ctcgcacggc 240 gcggtgtt 248 77 17 PRT
Mycobacterium tuberculosis 77 Val His Leu Ala Thr Gly Met Ala Glu
Thr Val Ala Ser Phe Ser Pro 1 5 10 15 Ser 78 17 PRT Mycobacterium
tuberculosis 78 Arg Glu Val Val His Leu Ala Thr Gly Met Ala Glu Thr
Val Ala Ser 1 5 10 15 Phe 79 17 PRT Mycobacterium tuberculosis 79
Arg Asp Ser Arg Glu Val Val His Leu Ala Thr Gly Met Ala Glu Thr 1 5
10 15 Val 80 17 PRT Mycobacterium tuberculosis 80 Asp Phe Asn Arg
Asp Ser Arg Glu Val Val His Leu Ala Thr Gly Met 1 5 10 15 Ala 81 17
PRT Mycobacterium tuberculosis 81 Ile Ser Ala Ala Val Val Thr Gly
Tyr Leu Arg Trp Thr Thr Pro Asp 1 5 10 15 Arg 82 17 PRT
Mycobacterium tuberculosis 82 Ala Val Val Phe Leu Cys Ala Ala Ala
Ile Ser Ala Ala Val Val Thr 1 5 10 15 Gly 83 17 PRT Mycobacterium
tuberculosis 83 Val Thr Asp Asn Pro Ala Trp Tyr Arg Leu Thr Lys Phe
Phe Gly Lys 1 5 10 15 Leu 84 17 PRT Mycobacterium tuberculosis 84
Ala Trp Tyr Arg Leu Thr Lys Phe Phe Gly Lys Leu Phe Leu Ile Asn 1 5
10 15 Phe 85 17 PRT Mycobacterium tuberculosis 85 Lys Phe Phe Gly
Lys Leu Phe Leu Ile Asn Phe Ala Ile Gly Val Ala 1 5 10 15 Thr 86 17
PRT Mycobacterium tuberculosis 86 Phe Leu Ile Asn Phe Ala Ile Gly
Val Ala Thr Gly Ile Val Gln Glu 1 5 10 15 Phe 87 17 PRT
Mycobacterium tuberculosis 87 Ala Ile Gly Val Ala Thr Gly Ile Val
Gln Glu Phe Gln Phe Gly Met 1 5 10 15 Asn 88 17 PRT Mycobacterium
tuberculosis 88 Thr Gly Ile Val Gln Glu Phe Glu Phe Gly Met Asn Trp
Ser Glu Tyr 1 5 10 15 Ser 89 17 PRT Mycobacterium tuberculosis 89
Glu Phe Gln Phe Gly Met Asn Trp Ser Glu Tyr Ser Arg Phe Val Gly 1 5
10 15 Asp 90 17 PRT Mycobacterium tuberculosis 90 Met Asn Trp Ser
Glu Tyr Ser Arg Phe Val Gly Asp Val Phe Gly Ala 1 5 10 15 Pro 91 17
PRT Mycobacterium tuberculosis 91 Trp Ser Glu Tyr Ser Arg Phe Val
Gly Asp Val Phe Gly Ala Pro Leu 1 5 10 15 Ala 92 17 PRT
Mycobacterium tuberculosis 92 Glu Tyr Ser Arg Phe Val Gly Asp Val
Phe Gly Ala Pro Leu Ala Met 1 5 10 15 Glu 93 17 PRT Mycobacterium
tuberculosis 93 Ser Arg Phe Val Gly Asp Val Phe Gly Ala Pro Leu Ala
Met Glu Ser 1 5 10 15 Leu 94 17 PRT Mycobacterium tuberculosis 94
Trp Ile Phe Gly Trp Asn Arg Leu Pro Arg Leu Val His Leu Ala Cys 1 5
10 15 Ile 95 17 PRT Mycobacterium tuberculosis 95 Trp Asn Arg Leu
Pro Arg Leu Val His Leu Ala Cys Ile Trp Ile Val 1 5 10 15 Ala 96 17
PRT Mycobacterium tuberculosis 96 Gly Arg Ala Glu Leu Ser Ser Ile
Val Val Leu Leu Thr Asn Asn Thr 1 5 10 15 Ala 97 17 PRT
Mycobacterium tuberculosis 97 Gly Lys Thr Tyr Asp Ala Tyr Phe Thr
Asp Ala Gly Gly Ile Thr Pro 1 5 10 15 Gly 98 17 PRT Mycobacterium
tuberculosis 98 Tyr Asp Ala Tyr Phe Thr Asp Ala Gly Gly Ile Thr Pro
Gly Asn Ser 1 5 10 15 Val 99 17 PRT Mycobacterium tuberculosis 99
Trp Pro Gln Gly Lys Thr Tyr Asp Ala Tyr Phe Thr Asp Ala Gly Gly 1 5
10 15 Ile 100 17 PRT Mycobacterium tuberculosis 100 Ala Thr Gly Met
Ala Glu Thr Val Ala Ser Phe Ser Pro Ser Glu Gly 1 5 10 15 Ser 101
17 PRT Mycobacterium tuberculosis 101 Gly Trp Glu Arg Arg Leu Arg
His Ala Val Ser Pro Lys Asp Pro Ala 1 5 10 15 Gln 102 17 PRT
Mycobacterium tuberculosis 102 Thr Gly Ser Gly Glu Thr Thr Thr Ala
Ala Gly Thr Thr Ala Ser Pro 1 5 10 15 Gly 103 17 PRT Mycobacterium
tuberculosis 103 Gly Ala Ala Ile Leu Val Ala Gly Leu Ser Gly Cys
Ser Ser Asn Lys 1 5 10 15 Ser 104 17 PRT Mycobacterium tuberculosis
104 Ala Val Ala Gly Ala Ala Ile Leu Val Ala Gly Leu Ser Gly Cys Ser
1 5 10 15 Ser 105 17 PRT Mycobacterium tuberculosis 105 Leu Thr Val
Ala Val Ala Gly Ala Ala Ile Leu Val Ala Gly Leu Ser 1 5 10 15 Gly
106 21 DNA Mycobacterium tuberculosis Description of Artificial
SequencePCR Primer 106 cccagcttgt gatacaggag g 21 107 22 DNA
Mycobacterium tuberculosis Description of Artificial SequencePCR
Primer 107 ggcctcagcg cggctccgga gg 22 108 46 DNA Mycobacterium
tuberculosis Description of Artificial SequencePCR Primer 108
tctagacacc accaccacca ccacgtgaca cctcgcgggc caggtc 46 109 28 DNA
Mycobacterium tuberculosis Description of Artificial SequencePCR
Primer 109 aagcttcgcc atgccgccgg taagcgcc 28 110 330 DNA
Mycobacterium tuberculosis misc_feature (1)..(330) n is a, c, g, or
t/u; k is t/u or g; s is c or g. 110 gcacgtcgtc gccagtgcca
accagggccc ggggcnnacc agctcgccga tccacggcaa 60 caacgagacg
tagaacacca ggccgaatag caggccgtag cccagcccac ccaccggtgt 120
cgtcgcgcgg tgggtcagca cccaggccag caatgcgnag cccaaccacc gccgnccacc
180 agcagttgcg cggcgggaag ctggcataca acagcagacc ggccacgatg
ctgaccacca 240 ggcgcgtcan ccgcgtccgc accgngtccc gtgtggtggg
cagctgcgct ncacccakkc 300 kccaagcttc accanggcgc cgscgggccg 330 111
431 DNA Mycobacterium tuberculosis misc_feature (1)..(431) n is a,
c, g, or t/u. 111 tgtcccgcat ggtagtcggg ctggnccngg tgatcgcttg
cagctttngc cgtggatgtg 60 agaaaggaat atgttggtga tcaccatgtt
tcgtgtactc gtggcgcgga tgacggcgct 120 ggcggtcgac gangtcgggc
atgtccaccg tggaatacgc catcggtacc atcgcggcgg 180 ctgcnttcgg
tgcgatcctc tacacggtcg tcaccgggga ttccattgtg tcggcgctca 240
accgcatcat cggtcgcgcg ctcagcacca aggtttagcg tcgtgtgcgg gtgcgagcac
300 cgtggaagcg gcgttggcga tcgccaccct ggtgctggtg ctggtgctgt
gcctggcggg 360 cgtcaccgcg gtatcaatgc aggtgcgctg tatcgacgcg
gcccgcgagg ccgctcgatt 420 ggccgcgcgc g 431 112 143 PRT
Mycobacterium tuberculosis 112 Ala Gly Gly Cys Gly Ala Cys Gly Gly
Thr Thr Gly Gly Cys Ala Cys 1 5 10 15 Cys Ala Cys Cys Ala Cys Gly
Ala Gly Thr Gly Ala Gly Thr Cys Ala 20 25 30 Gly Gly Cys Ala Gly
Gly Ala Gly Cys Cys Cys Cys Gly Cys Cys Ala 35 40 45 Cys Gly Thr
Thr Gly Cys Gly Gly Ala Cys Gly Gly Cys Gly Cys Gly 50 55 60 Ala
Ala Thr Cys Thr Thr Cys Gly Cys Cys Thr Gly Thr Gly Gly Cys 65 70
75 80 Thr Cys Ala Cys Cys Gly Ala Cys Thr Thr Thr Cys Cys Gly Cys
Cys 85 90 95 Cys Ala Ala Cys Thr Thr Cys Ala Ala Cys Gly Ala Thr
Cys Thr Thr 100 105 110 Gly Cys Ala Cys Ala Thr Gly Gly Ala Cys Gly
Gly Cys Ala Ala Gly 115 120 125 Ala Ala Cys Gly Cys Cys Gly Ala Gly
Gly Thr Cys Gly Cys Gly 130 135 140 113 363 PRT Mycobacterium
tuberculosis 113 Met Thr Pro Arg Gly Pro Gly Arg Leu Gln Arg Leu
Ser Gln Cys Arg 1 5 10 15 Pro Gln Arg Gly Ser Gly Gly Pro Ala Arg
Gly Leu Arg Gln Leu Ala 20 25 30 Leu Ala Ala Met Leu Gly Ala Leu
Ala Val Thr Val Ser Gly Cys Ser 35 40 45 Trp Ser Glu Ala Leu Gly
Ile Gly Trp Pro Glu Gly Ile Thr Pro Glu 50 55 60 Ala His Leu Asn
Arg Glu Leu Trp Ile Gly Ala Val Ile Ala Ser Leu 65 70 75 80 Ala Val
Gly Val Ile Val Trp Gly Leu Ile Phe Trp Ser Ala Val Phe 85 90 95
His Arg Lys Lys Asn Thr Asp Thr Glu Leu Pro Arg Gln Phe Gly Tyr 100
105 110 Asn Met Pro Leu Glu Leu Val Leu Thr Val Ile Pro Phe Leu Ile
Ile 115 120 125 Ser Val Leu Phe Tyr Phe Thr Val Val Val Gln Glu Lys
Met Leu Gln 130 135 140 Ile Ala Lys Asp Pro Glu Val Val Ile Asp Ile
Thr Ser Phe Gln Trp 145 150 155 160 Asn Trp Lys Phe Gly Tyr Gln Arg
Val Asn Phe Lys Asp Gly Thr Leu 165 170 175 Thr Tyr Asp Gly Ala Asp
Pro Glu Arg Lys Arg Ala Met Val Ser Lys 180 185 190 Pro Glu Gly Lys
Asp Lys Tyr Gly Glu Glu Leu Val Gly Pro Val Arg 195 200 205 Gly Leu
Asn Thr Glu Asp Arg Thr Tyr Leu Asn Phe Asp Lys Val Glu 210 215 220
Thr Leu Gly Thr Ser Thr Glu Ile Pro Val Leu Val Leu Pro Ser Gly 225
230 235 240 Lys Arg Ile Glu Phe Gln Met Ala Ser Ala Asp Val Ile His
Ala Phe 245 250 255 Trp Val Pro Glu Phe Leu Phe Lys Arg Asp Val Met
Pro Asn Pro Val 260 265 270 Ala Asn Asn Ser Val Asn Val Phe Gln Ile
Glu Glu Ile Thr Lys Thr 275 280 285 Gly Ala Phe Val Gly His Cys Ala
Glu Met Cys Gly Thr Tyr His Ser 290 295 300 Met Met Asn Phe Glu Val
Arg Val Val Thr Pro Asn Asp Phe Lys Ala 305 310 315 320 Tyr Leu Gln
Gln Arg Ile Asp Gly Asn Thr Asn Ala Glu Ala Leu Arg 325 330 335 Ala
Ile Asn Gln Pro Pro Leu Ala Val Thr Thr His Pro Phe Asp Thr 340 345
350 Arg Arg Gly Glu Leu Ala Pro Gln Pro Val Gly 355 360 114 709 DNA
Mycobacterium tuberculosis 114 ggatccgcgg agtatatctc caacgtaata
tatgaaggtc cgcgtgctga ctcattgtat 60 gccgccgacc agcgattgcg
acaattagct gactcagtta gaacgactgc cgagtcgctc 120 aacaccacgc
tcgacgagct gcacgagaac tggaaaggta gttcatcgga atggatggcc 180
gacgcggctt tgcggtatct cgactggctg tctaaacact cccgtcagat tttgcgaacc
240 gcccgcgtga tcgaatccct cgtaatggcc tatgaggaga cacttctgag
ggtggtaccc 300 ccggcgacta tcgccaacaa ccgcgaggag gtgcgcaggc
tgatcgcgag caacgtggcc 360 gggggtaaac actccagcaa tcgcagacct
cgaggcacaa tacgagcagt accgggccga 420 aaatatccaa gcaatggacc
gctatctaag ttggacccga tttgcgctat cgaagctgcc 480 ccgatggcgg
gagccgccgc agatccacag gagcgggtag gtccaagagg ccggcgcggt 540
cttgcaggcc agcaacaatg ccgcggtcga ccaggcccat cgcttcgctg ctcgcacgac
600 acaccgcggt ttcagatgaa tcaggcgttt cacaccatgg tgaacatgtt
gctgacgtgt 660 tttgcatgtc aggagaaacc gagatgacga tcaacaacca
ggtaagctt 709 115 1831 DNA
Mycobacterium tuberculosis 115 ggatccccgg ctaccatgcc ttcgtcgcgc
aacctcgcga ccaaccccga gatcgccacc 60 ggctaccgcc gggacatgac
cgtggtgcgg accgcccact atgcggcagc caccgccaat 120 ccgctggcca
ctcaggtggc ctgccgagta ttgcgcgacg gtggtaccgc cgccgatgcc 180
gtcgtggccg cccaggcggt gctggggttg gtcgaaccgc aatcctccgg gatcggcggc
240 ggcggatatc tggtgtactt cgacgcccgc acgggctcag tgcaggccta
cgacggccgt 300 gaggtggccc cagcggccgc caccgagaac taccttcgct
gggtcagcga cgtcgaccgc 360 agcgcgccca ggcccaacgc ccgagcctcg
ggacggtcga tcggagtacc gggcatcctg 420 cgaatgctgg agatggtgca
caacgagcac gggcgcacac cctggcgcga cctcttcggc 480 cccgcggtaa
cgctggccga tggcggtttt gacatcagcg ccaggatggg cgcggccatc 540
tccgacgctg cgccgcaact gcgagacgac ccggaggctc gcaagtattt cctcaatccc
600 gacggcagcc cgaaacccgc gggaacccgg ctgacgaacc ccgcgtactc
aaaaaccctg 660 tccgccatcg cctccgccgg cgccaacgcc ttctattccg
gcgacattgc ccacgacatc 720 gtggcggcgg cgagcgacac atcgaatggc
cgcacgccgg gcctgttgac cattgaggac 780 ctggcgggtt acctcgccaa
gagacgccaa ccgttgtgca cgacctatcg cggccgggag 840 atctgcggca
tgccatcgtc gggtggcgtc gccgtggccg caaccttggg catcctcgag 900
cacttcccga tgagcgacta cgcgcccagc aaggtcgacc tcaacggcgg tcgcccgacc
960 gtgatggggg ttcacctgat agcggaggcc gaacggctgg cctatgccga
ccgcgaccaa 1020 tatatcgctg acgtcgattt tgtccggctg cccggcggct
cgctcaccac gctggttgac 1080 ccgggctact tggcagcacg cgccgcgcta
atctcgccgc aacacagcat gggcagcgcc 1140 agaccggggg acttcggcgc
accgacggcc gtcgccccgc cagtgcctga gcatggcacc 1200 agccacctca
gcgtcgtcga ttcgtacggc aatgcggcca cgttgacgac gacggtggaa 1260
tcttcgttcg gctcctacca cctggtggac ggattcatcc tcaacaacca gctgagcgat
1320 ttcagcgccg agccacacgc tactgacgga tcaccggtgg ctaaccgggt
cgagcctggg 1380 aagcgaccgc gcagttcgat ggcaccgacg ttggtgttcg
atcactcgtc ggcggggcgc 1440 ggtgcgctgt acgcggtgct cggttctccg
ggcggctcca tgatcatcca gttcgtcgtg 1500 aaaacacttg tggcgatgct
ggattggggt ctgaatccgc agcaggcggt ttccctggtc 1560 gatttcggcg
ccgcgaactc gccgcacact aacctcggcg gtgagaatcc cgagatcaac 1620
acttccgacg atggtgatca tgacccgctg gtgcaaggcc tgcgcgcgct ggggcatcga
1680 gttaatcttg ccgagcaatc cagtgggctc tcggcgatca cccgcagcga
ggcgggttgg 1740 gccggcggcg ccgacccacg ccgcgaaggc gcggtcatgg
gcgacgatgc ctgagccgtt 1800 cgccggcggg cggccaaacg aacgcggatc c 1831
116 516 DNA Mycobacterium tuberculosis 116 gaattcaagc gcggtgtcgc
aacgctgccg gtgatcctgg tgattctgct ctcggtggcg 60 gccggggccg
gtgcatggct gctagtacgc ggacacggtc cgcagcaacc cgagatcagc 120
gcttactcgc acgggcacct gacccgcgtg gggccctatt tgtactgcaa cgtggtcgac
180 ctcgacgact gtcagacccc gcaggcgcag ggcgaattgc cggtaagcga
acgctatccc 240 gtgcagctct cggtacccga agtcatttcc cgggcgccgt
ggcgtttgct gcaggtatac 300 caggaccccg ccaacaccac cagcaccttg
tttcggccgg acacccggtt ggcggtcacc 360 atccccactg tcgacccgca
gcgcgggcgg ctgaccggga ttgtcgtgca gttgctgacg 420 ttggtggtcg
accactcggg tgaactacgc gacgttccgc acgcggaatg gtcggtgcgc 480
cttatctttt gacgaggccg cggctcgacg aagctt 516 117 2831 DNA
Mycobacterium tuberculosis 117 gaattcgcgc cgatgctgga cgcggcggcc
gcttgggatg gactggccga cgaattgggt 60 tcggccgcgg cctcgttttc
ggcggtgacg gcggggctgg caggttcctc gtggctgggc 120 gcggcgtcga
cggcgatgac gggagcggcc gccccctatc tgggctggtt gagcgcggcg 180
gcggcgcagg cccagcaggc ggccacccaa acccggctgg cggcggccgc cttcgaggca
240 gccctggcgg cgacggtaca tccggcgatc atctcggcca accgggcact
gttcgtgtcg 300 ctggtggtct cgaacctgct gggccaaaac gccccggcga
tcgcggccac cgaggccgcc 360 tacgagcaga tgtgggccca ggacgtggcg
gcgatgtttg gctaccatgc cggggcttcg 420 gcggccgtct cggcgttgac
accgttcggc caggcgctgc cgaccgtggc gggcggcggt 480 gcgctggtca
gcgcggccgc ggctcaggtg accacgcggg tcttccgcaa cctgggcttg 540
gcgaacgtcg gcgagggcaa cgtcggcaac ggtaatgtcg ggaacttcaa tctcggctcg
600 gccaacatcg gcaacggcaa catcggcagc ggcaacatcg gcagctccaa
catcgggttt 660 ggcaacgtgg gtcctgggtt gaccgcagcg ctgaacaaca
tcggtttcgg caacaccggc 720 agcaacaaca tcgggtttgg caacaccggc
agcaacaaca tcggcttcgg caataccgga 780 gacggcaacc gaggtatcgg
gctcacgggt agcggtttgt tggggttcgg cggcctgaac 840 tcgggcaccg
gcaacatcgg tctgttcaac tcgggcaccg gaaacgtcgg catcggcaac 900
tcgggtaccg ggaactgggg cattggcaac tcgggcaaca gctacaacac cggttttggc
960 aactccggcg acgccaacac gggcttcttc aactccggaa tagccaacac
cggcgtcggc 1020 aacgccggca actacaacac cggtagctac aacccgggca
acagcaatac cggcggcttc 1080 aacatgggcc agtacaacac gggctacctg
aacagcggca actacaacac cggcttggca 1140 aactccggca atgtcaacac
cggcgccttc attactggca acttcaacaa cggcttcttg 1200 tggcgcggcg
accaccaagg cctgattttc gggagccccg gcttcttcaa ctcgaccagt 1260
gcgccgtcgt cgggattctt caacagcggt gccggtagcg cgtccggctt cctgaactcc
1320 ggtgccaaca attctggctt cttcaactct tcgtcggggg ccatcggtaa
ctccggcctg 1380 gcaaacgcgg gcgtgctggt atcgggcgtg atcaactcgg
gcaacaccgt atcgggtttg 1440 ttcaacatga gcctggtggc catcacaacg
ccggccttga tctcgggctt cttcaacacc 1500 ggaagcaaca tgtcgggatt
tttcggtggc ccaccggtct tcaatctcgg cctggcaaac 1560 cggggcgtcg
tgaacattct cggcaacgcc aacatcggca attacaacat tctcggcagc 1620
ggaaacgtcg gtgacttcaa catccttggc agcggcaacc tcggcagcca aaacatcttg
1680 ggcagcggca acgtcggcag cttcaatatc ggcagtggaa acatcggagt
attcaatgtc 1740 ggttccggaa gcctgggaaa ctacaacatc ggatccggaa
acctcgggat ctacaacatc 1800 ggttttggaa acgtcggcga ctacaacgtc
ggcttcggga acgcgggcga cttcaaccaa 1860 ggctttgcca acaccggcaa
caacaacatc gggttcgcca acaccggcaa caacaacatc 1920 ggcatcgggc
tgtccggcga caaccagcag ggcttcaata ttgctagcgg ctggaactcg 1980
ggcaccggca acagcggcct gttcaattcg ggcaccaata acgttggcat cttcaacgcg
2040 ggcaccggaa acgtcggcat cgcaaactcg ggcaccggga actggggtat
cgggaacccg 2100 ggtaccgaca ataccggcat cctcaatgct ggcagctaca
acacgggcat cctcaacgcc 2160 ggcgacttca acacgggctt ctacaacacg
ggcagctaca acaccggcgg cttcaacgtc 2220 ggtaacacca acaccggcaa
cttcaacgtg ggtgacacca ataccggcag ctataacccg 2280 ggtgacacca
acaccggctt cttcaatccc ggcaacgtca ataccggcgc tttcgacacg 2340
ggcgacttca acaatggctt cttggtggcg ggcgataacc agggccagat tgccatcgat
2400 ctctcggtca ccactccatt catccccata aacgagcaga tggtcattga
cgtacacaac 2460 gtaatgacct tcggcggcaa catgatcacg gtcaccgagg
cctcgaccgt tttcccccaa 2520 accttctatc tgagcggttt gttcttcttc
ggcccggtca atctcagcgc atccacgctg 2580 accgttccga cgatcaccct
caccatcggc ggaccgacgg tgaccgtccc catcagcatt 2640 gtcggtgctc
tggagagccg cacgattacc ttcctcaaga tcgatccggc gccgggcatc 2700
ggaaattcga ccaccaaccc ctcgtccggc ttcttcaact cgggcaccgg tggcacatct
2760 ggcttccaaa acgtcggcgg cggcagttca ggcgtctgga acagtggttt
gagcagcaag 2820 cttgggaatt c 2831 118 1823 DNA Mycobacterium
tuberculosis 118 gaattcgctg accgtggcca gcgacgaggc tgcgccccgg
gcatcgcgtc tgcgctcagg 60 gcgtcgtttc aggggaaatc cagaccctgg
acgcagactc gatattgggc tttcgcgtta 120 ttaacaccgc tcgtcgtggc
tatggtgctc accggatgct cggcctccgg tacccaactc 180 gaactcgcgc
ccactgcgga ccgcagggcc gcggttggca ccaccagcga catcaatcag 240
caggatcccg ccacgttgca agacggcggc aatcttcgcc tgtcgctcac cgactttccg
300 cccaacttca acatcttgca catcgacggc aacaacgccg aggtcgcggc
gatgatgaaa 360 gccaccttgc cgcgcgcgtt catcatcgga ccggacggct
cgacgacggt cgacaccaac 420 tacttcacca gcatcgagct gaccaggacc
gccccgcagg tggtcaccta caccatcaat 480 cccgaggcgg tgtggtccga
cgggaccccg atcacctggc gggacatcgc cagccagatt 540 catgcgatca
gcggcgccga caaggcattc gagatcgctt ctagcagcgg cgccgagcgt 600
gtggcgtcgg taaccagagg ggtcgacgac cggcaggccg tggtgacgtt cgccaagccg
660 tacgcggagt ggcgcggtat gttcgcgggc aacggcatgc tgctgccggc
cagtatgacc 720 gccacacccg aggcattcaa taagggtcaa ctcgatgggc
ccggtccgtc ggcgggtccg 780 ttcgtcgtgt ctgccctgga ccgcaccgcg
cagcgaatcg tgttgacccg taacccgaga 840 tggtgggggg cacggccacg
cctggacagc atcacatacc tggtgctcga tgatgccgcc 900 cggctgccgg
cgctgcagaa caacacaatc gacgccaccg gcgtcggcac actggaccag 960
ctgaccatcg cggcgcgcac caagggcatc tcgatccggc gcgcccccgg gcccagctgg
1020 tatcacttca ccctcaacgg tgcgcctggg tcgatcctcg ccgacaaggc
gctgcgcctg 1080 gcgatcgcca agggcatcga ccgatacacc atcgccaggg
tcgcccaata cggcctcacc 1140 agcgacccgg tgccactgaa caaccacgtc
ttcgtcgccg gccaagacgg ctaccaggac 1200 aacagcggcg ttgtcgccta
caacccggaa caagcgaaac gggagctgga cgccctgggc 1260 tggaggcgaa
gcggcgcgtt ccgggagaag gacggtcgcc agctcgtcat ccgcgatctg 1320
ttctacgacg cacaaagcac ccggcagttc gcccagatcg cccaacacac cctggcgcag
1380 atcggcgtca aactcgaact tcaggccaag tccggcagcg gtttcttcag
cgactacgtc 1440 aacgtggggg ctttcgacat cgcacagttc ggctgggtgg
gcgacgcgtt tccgctgtca 1500 tcgctcaccc agatctacgc ttcggacggg
gaaagcaact tcggcaagat cggtagcccg 1560 caaatcgacg ccgcgatcga
gcgaacgctg gcagaactcg atcccggcaa ggcgagggcc 1620 ttggccaacc
aggtcgacga gctgatctgg gccgaaggat tcagcctgcc gcttacccag 1680
tcgcccggca ccgttgcggt ccgcagcacg ctggccaact tcggcgcgac gggtctggca
1740 gacctggact acaccgccat cgggttcatg cgacgctgag ccggcggcga
ccagctcagc 1800 tgaagcttaa gtcggcggaa ttc 1823 119 886 DNA
Mycobacterium tuberculosis 119 gaattcatct cacaagcgtg cggctcccac
cgaccccggc gcccctcgag cctgggggct 60 gtcgcgatcc tgatcgcggc
gacacttttc gcgactgtcg ttgcggggtg cgggaaaaaa 120 ccgaccacgg
cgagctcccc gagtcccggg tcgccgtcgc cggaagccca gcagatcctg 180
caagacagtt ccaaggcgac gaagggcctg cattccgtcc acgtggtggt gacggtaaac
240 aatctctcga ccctcccgtt tgagagcgtc gatgccgacg tgaccaacca
accgcagggc 300 aatggccagg cggtgggcaa cgccaaggtc agaatgaagc
ccaacacccc ggtggtggcc 360 accgagttcc tggtcacgaa caagaccatg
tacacgaagc ggggcggcga ctatgtctcg 420 gtgggtccgg cggagaagat
ctatgacccg ggcatcatcc tggacaagga ccgggggctg 480 ggcgcggtcg
tcgggcaagt gcaaaacccg acaatccagg gacgtgacgc catcgacggc 540
ctggccaccg tcaaggtgtc cgggaccatc gacgccgcgg tgatcgatcc gatcgtgcct
600 cagctaggta agggtggggg caggctcccg ataaccttgt ggatcgtcga
caccaacgcc 660 tcaacgccgg cacccgccgc gaacctggtg cggatggtca
ttgacaagga ccaaggcaac 720 gtcgacatca cgctgtccaa ttggggtgcg
ccggtcacca tcccgaaccc ggcgggataa 780 caggcgcgaa ccggcccggt
ccagccccat cgctggtcga tggcctggcc ggtccggtac 840 tcgtccgcgg
gcggaggccg ccttcgaaga aatcctttga gaattc 886 120 1020 DNA
Mycobacterium tuberculosis 120 gaattcatga tccagatcgc gcgcacctgg
cgggtcttcg caggcggcat ggccaccggt 60 ttcatcggcg tggtgctggt
caccgccggg aaggcctcag cggatcccct gctgccaccg 120 ccgcctatcc
ctgccccagt ctcggcgccg gcaacagtcc cgcccgtgca gaacctcacg 180
gcgcttccgg gcgggagcag caacaggttc tcaccggcgc cagcacccgc accgatcgcg
240 tcgccgattc cggtcggagc acccgggtcc accgctgtgc ccccgctgcc
gccgccagtg 300 actcccgcga tcagcggcac acttcgggac cacctccggg
agaagggcgt caagctggag 360 gcacagcgac cgcacggatt caaggcgctc
gacatcacac tgcccatgcc gccgcgctgg 420 actcaggtgc ccgaccccaa
cgtgcccgac gcgttcgtgg tgatcgccga ccggttgggc 480 aacagcgtct
acacgtcgaa tgcgcagctg gtggtgtata ggctgatcgg tgacttcgat 540
cccgctgagg ccatcacaca cggctacatt gacagccaga aattgctcgc atggcagacc
600 acaaacgcct cgatggccaa tttcgacggc tttccgtcat caatcatcga
gggcacctac 660 cgcgaaaacg acatgaccct caacacctcc cggcgccacg
tcatcgccac ctccggagcc 720 gacaagtacc tggtttcgct gtcggtgacc
accgcgctgt cgcaggcggt caccgacggg 780 ccggccaccg atgcgattgt
caacggattc caagtggttg cgcatgcggc gcccgctcag 840 gcgcctgccc
cggcacccgg ttcggcaccg gtgggactac ccgggcaggc gcctgggtat 900
ccgcccgcgg gcaccctgac accagtcccg ccgcgctagg tcgcgatgag gccgagcaga
960 aacacgggcc cgcatggagc tcggtgagcg gattcgtcgg cggcctcgaa
gcttgaattc 1020 121 1354 DNA Mycobacterium tuberculosis 121
gaattcacgc ggagccgggg attgcgctac gccacggtga tcgcgctggt ggccgcgctg
60 gtgggcggcg tgtacgtgct ctcgtccacc ggtaataagc gcaccatcgt
gggctacttc 120 acctctgctg tcgggctcta tcccggtgac caggtccgcg
tcctgggcgt cccggtgggt 180 gagatcgaca tgatcgagcc gcggtcgtcc
gacgtcaaga tcactatgtc ggtgtccaag 240 gacgtcaagg tgcccgtgga
cgtgcaggcc gtgatcatgt cgccgaattt ggtggcggcg 300 cgcttcattc
agctcacccc ggtgtatacc ggcggggcgg tactgcccga caacggtcgg 360
atcgatctgg atcgcaccgc ggtgccggtg gaatgggacg aggtgaaaga ggggctcacc
420 cggttggccg ccgacctgag tccggcggcg ggcgagctgc aggggccgct
gggcgcggcg 480 atcaaccagg ccgcggacac ccttgacggc aacggagact
cgttacacaa cgcgttgcgc 540 gagcttgcgc aggtcgccgg gcggctgggg
gattcgcgcg gcgacatctt cggcaccgtc 600 aagaacctgc aggtactggt
cgacgcgcta tcggagagcg acgagcagat tgtgcagttc 660 gccggccacg
tggcatcggt gtcgcaggtg ctcgccgaca gctcggccaa tctggaccag 720
accctgggca cgctcaacca ggcgctgtcc gacatcaggg ggttcttgcg cgagaacaac
780 tcgacgctga tcgaaacggt gaatcagctc aacgactttg cgcagacgtt
gagtgaccag 840 agcgagaaca tcgagcaagt gctgcacgtg gctgggccgg
ggatcaccaa cttctacaac 900 atctatgacc ctgcgcaagg caccctcaac
ggtctgttgt cgatacccaa cttcgctaac 960 ccggtgcagt tcatctgcgg
cggttccttc gataccgccg cgggcccgtc ggcgccggac 1020 tactaccggc
gcgccgagat ctgccgtgag cggctggggc cggtgctgcg ccggctcacg 1080
gtgaattacc cgccgatcat gttccacccg cttaacacga tcacggcgta caagggccag
1140 atcatctacg acaccccggc caccgaggcc aagtcggaga cgccggttcc
ggaattgact 1200 tgggtacccg cgggaggagg agcgcctgtg ggcaaccccg
cggatctgca gagcctactc 1260 gtcccaccgg cgcccggtcc ggcaccggcc
ccgccggcgc cgggggcagg accgggcgag 1320 catgggggcg gcggatgaac
cgaagcttga attc 1354 122 1326 DNA Mycobacterium tuberculosis 122
ggcatggacc cgctgaaccg ccgacaattc ctcgcgctgg ccgctgccgc cgccggcgtg
60 accgccggct gcgccgggat gggcggcggc ggttcggtga agtccggttc
cggcccaatc 120 gacttctggt ccagtcatcc cggccaatcc agcgcggcgg
aacgggagct gatcggtcgt 180 ttccaggacc gattccccac tctgtcggtc
aagctgatcg acgccggcaa ggactacgac 240 gaggtggcac agaaattcaa
tgcggcgctc atcggaaccg acgtgcccga cgtcgttttg 300 ctcgacgacc
gatggtggtt ccatttcgcc ctcagcggtg ttctcactgc ccttgacgac 360
ctgttcggcc aagttggggt ggacacaacg gattacgtcg attcgctgct ggccgactat
420 gagttcaacg gccgccatta cgctgtgccg tatgctcgct cgacgccgct
gttctactac 480 aacaaggcgg cgtggcaaca ggccggccta cccgaccgcg
gaccgcaatc ctggtcagag 540 ttcgacgagt ggggtccgga gttacagcgc
gtggtcggcg ccggtcgatc ggcgcacggc 600 tgggctaacg ccgacctcat
ctcgtggacg tttcagggac cgaactgggc attcggcggt 660 gcctactccg
acaagtggac attgacattg accgagcccg ccacgatcgc ggccggcaac 720
ttctatcgga actccatcca tggcaagggt tatgcggcgg tcgccaacga tattgccaac
780 gagttcgcca ccggaatcct ggcctcggcc gtggcatcca ccggctcgct
ggccggcatc 840 accgcatctg cccgattcga cttcggcgcc gcaccgctgc
ccacgggccc ggacgcagcg 900 cccgcctgtc cgacgggcgg tgcggggctg
gcgataccgg ccaagctctc cgaggagcga 960 aaagtcaacg cgctcaagtt
catcgcattc gtcaccaacc cgacgaacac cgcctacttc 1020 agccagcaaa
ccggctatct gccggtgcgc aagtccgccg tcgacgatgc cagcgaacgg 1080
cactatctgg cggacaatcc ccgtgcgcgg gtggcgctcg accagctgcc acacacccgg
1140 acacaagact acgcacgggt tttcctgccc ggtggtgacc ggatcatctc
cgccggcctg 1200 gaatccatcg ggctgcgcgg agccgacgtg accaagacct
tcacgaacat ccaaaaacgg 1260 ttgcaggtca tcctggatcg gcagatcatg
cggaagctgg cggggcatgg ctaacgttca 1320 ggatcc 1326 123 629 DNA
Mycobacterium tuberculosis 123 ggatccgtag cggtgcggcg taaggtgcgg
aggttgactc tggcggtgtc ggcgttggtg 60 gctttgttcc cggcggtcgc
ggggtgctcc gattccggcg acaacaaacc gggagcgacg 120 atcccgtcga
caccggcaaa cgctgagggc cggcacggac ccttcttccc gcaatgtggc 180
ggcgtcagcg atcagacggt gaccgagctg acaagggtga ccgggctggt caacaccgcc
240 aagaattcgg tgggctgcca atggctggcg ggcggcggta tcttgggccc
gcacttctcc 300 ttctcctggt accgcggcag cccgatcggg cgggaacgca
agaccgagga gttgtcgcgc 360 gcgagtgtcg aggacatcaa catcgacggc
cacagcggtt tcatcgccat cggtaacgag 420 cccagtttgg gtgactcact
gtgtgaagtc ggaatccagt tctccgacga cttcatcgaa 480 tggtcggtga
gtttcagcca gaagccgttc ccgctgccgt gcgacatcgc caaagaactg 540
acccgccaat cgattgcgaa ttcgaaatga gacgtgtcct ggtcggtgcg gccgccttga
600 tcaccgcaaa gcttgtcttg accggatcc 629 124 692 DNA Mycobacterium
tuberculosis 124 ggatccatcg ccatgcaact ctcctcccgg ttggaaaatc
atcgcaagcc cttcccccgg 60 acggtatcga cagggcaggc tatcgccatg
gcgaagcgca ccccggtccg gaaggcctgc 120 acagttctag ccgtgctcgc
cgcgacgcta ctcctcggcg cctgcggcgg tcccacgcag 180 ccacgcagca
tcaccttgac ctttatccgc aacgcgcaat cccaggccaa cgccgacggg 240
atcatcgaca ccgacatgcc cggttccggc ctcagcgccg acggcaaagc agaggcgcag
300 caggtcgcgc accaggtttc ccgcagagat gtcgacagca tctattcctc
ccccatggcg 360 gccgaccagc agaccgccgg gccgttggcc ggcgaacttg
gcaagcaagt cgagattctt 420 ccgggcctgc aagcgatcaa cgccggctgg
ttcaacggca aacccgaatc aatggccaac 480 tcaacatata tgctggcacc
ggcagactgg ctggccggcg atgttcacaa cactattccg 540 gggtcgatca
gcggcaccga attcaattcc cagttcagcg ccgccgtccg caagatctac 600
gacagcggcc acaatacgcc ggtcgtgttc tcgcaggggg tagcgatcat gatctggacg
660 ctgatgaacg cacgaaactc tagggaaagc tt 692 125 1004 DNA
Mycobacterium tuberculosis 125 ggatccgggg gtgctgggat gacggaacac
aacgaggacc cacagatcga gcgcgtggcc 60 gacgacgccg ccgacgagga
ggcggttacg gagccgttgg ccaccgaatc gaaggacgaa 120 ccggccgagc
acccagaatt cgaagggccg cgtcggcgcg cccgccgcga acgtgccgaa 180
cgtcgcgccg cgcaggctcg agctaccgcg atcgagcagg ctcgccgcgc ggccaaacgg
240 cgagcccgcg ggcagatcgt cagtgagcag aaccccgcca aaccggccgc
ccgaggtgtt 300 gttcgagggc tgaaggcgct gctcgcgacg gtcgtgctgg
ccgtcgtcgg gatcgggctt 360 gggctcgcgc tgtacttcac gccggcgatg
tcggcccgcg agatcgtgat catcgggatc 420 ggggcggtga gccgcgagga
ggttctcgac gccgccagag tgcggccggc aacgccgttg 480 ctgcagatcg
acacccaaca ggttgctgac cgagtggcca cgatccggcg ggtggccagt 540
gcgcgggtgc agcggcagta cccgtcggcc ttgcggatca ccatcgtcga gcgggtcccg
600 gtggtggtca aggatttttc ggacggcccg cacctttttg accgcgacgg
cgtcgacttc 660 gcgaccgatc cgccaccgcc ggcgttgcct tatttcgatg
tggacaatcc cggtcctagc 720 gatccgacga ccaaggcggc gctgcaggtg
ttgaccgcgc tgcatcctga agttgcaagc 780 caggtggggc ggatcgcggc
cccgtcggtg gcctcgatca ccctgacgtt ggccgatggc 840 cgcgtggtga
tctggggaac caccgaccgc tgcgaagaga aggccgaaaa gctggcggcg 900
ctgttgaccc agccaggcag aacgtacgac gtgtccagcc ccgacctgcc gaccgtgaaa
960 tagccgaaaa aatgcccgcc gcgtatcggc gcgcctgcaa gctt 1004 126 1624
DNA Mycobacterium tuberculosis 126 ggatcccaga tgaatgtcgt cgacatttcg
cggtggcagt tcggtatcac caccgtctat 60 cacttcattt tcgtaccgct
gaccatcggc ctggccccgc tgatcgcggt catgcaaacg 120 ctgtgggtcg
tcaccgataa ccccgcctgg tatcgcctca ccaaattctt cggcaaattg 180
ttcctgatca actttgccat cggcgtggcg accggaatcg tgcaggaatt tcagttcggc
240 atgaactgga gcgagtactc ccgattcgtc ggcgatgtct tcggcgcccc
gctggccatg 300 gagggcctgg cggccttctt cttcgaatcc accttcatcg
ggttgtggat cttcggctgg 360 aacaggctgc
cccggctggt gcatctggcc tgcatctgga tcgtcgcaat cgcggtcaac 420
gtgtccgcgt tcttcatcat cgcggcaaac tccttcatgc agcatccggt cggcgcgcac
480 tacaacccga ccaccgggcg tgccgagttg agcagcatcg tcgtgctgct
gaccaacaac 540 accgcacagg cggcgtttac ccacactgtc agcggtgcgc
tgctgaccgc cgggaccttc 600 gtcgccgcgg tgagcgcctg gtggctggtc
cgttcgagca ccacgcacgc cgactcagat 660 acccaagcca tgtatcgtcc
cgcgaccatc ctggggtgtt gggttgcgtt ggccgccacg 720 gccgggttgt
tgttcaccgg cgaccaccaa ggcaagctga tgttccagca gcagccgatg 780
aagatggcgt cggccgaatc gttgtgcgat acccagacag atccaaactt ctctgtcctg
840 acggtcggcc ggcaaaacaa ctgcgacagc ctcacccgtg tcatcgaagt
gccctatgtg 900 ttgccgttcc tcgccgaggg ccggatcagc ggtgtgacgt
tgcagggtat ccgcgatctg 960 cagcaggaat accagcagcg cttcggacca
aacgactacc ggcccaacct cttcgtcacc 1020 tactggtcat ttcgcatgat
gatcgggttg atggcgatcc cggtgctgtt cgcactgatt 1080 gcgctctggc
tcacccgtgg cggccagatc cccaatcaac gctggttctc ctggctggcg 1140
ctgctaacca tgcccgcccc gttcctggcc aacagcgccg gatgggtgtt caccgagatg
1200 gggcgccagc cctgggtcgt cgtccctaac ccgaccggtg atcagctggt
tcgactcacc 1260 gtcaaagcag gcgtctcgga tcactccgcc accgtggtcg
ccacgtcttt gctgatgttc 1320 accttggtct acgcggtact tgcggtcatc
tggtgctggc tgctcaagcg ttacatcgtc 1380 gaaggccccc tggaacacga
cgcggaaccg gctgcgcacg gggcaccccg cgacgacgag 1440 gtagcaccat
tgtcgtttgc ttactgaggc caactgaccc cggaaaggag cagccggtgg 1500
tactccaaga attgtggttc ggtgtcatcg cagcgctgtt cctcggtttc ttcatcctag
1560 aagggttcga cttcggcgtg ggcatgctga tggcgccgtt cgctcatgtc
ggtatggggg 1620 atcc 1624 127 1414 DNA Mycobacterium tuberculosis
127 gaattccaag gcgtcgatcg gcacggtgtt ccaggaccgg gccgctcgct
acggtgaccg 60 agtcttcctg aaattcggcg atcagcagct gacctaccgc
gacgctaacg ccaccgccaa 120 ccggtacgcc gcggtgttgg ccgcccgcgg
cgtcggcccc ggcgacgtcg ttggcatcat 180 gttgcgtaac tcacccagca
cagtcttggc gatgctggcc acggtcaagt gcggcgctat 240 cgccggcatg
ctcaactacc accagcgcgg cgaggtgttg gcgcacagcc tgggtctgct 300
ggacgcgaag gtactgatcg cagagtccga cttggtcagc gccgtcgccg aatgcggcgc
360 ctcgcgcggc cgggtagcgg gcgacgtgct gaccgtcgag gacgtggagc
gattcgccac 420 aacggcgccc gccaccaacc cggcgtcggc gtcggcggtg
caagccaaag acaccgcgtt 480 ctacatcttc acctcgggca ccaccggatt
tcccaaggcc agtgtcatga cgcatcatcg 540 gtggctgcgg gcgctggccg
tcttcggagg gatggggctg cggctgaagg gttccgacac 600 gctctacagc
tgcctgccgc tgtaccacaa caacgcgtta acggtcgcgg tgtcgtcggt 660
gatcaattct ggggcgaccc tggcgctggg taagtcgttt tcggcgtcgc ggttctggga
720 tgaggtgatt gccaaccggg cgacggcgtt cgtctacatc ggcgaaatct
gccgttatct 780 gctcaaccag ccggccaagc cgaccgaccg tgcccaccag
gtgcgggtga tctgcggtaa 840 cgggctgcgg ccggagatct gggatgagtt
caccacccgc ttcggggtcg cgcgggtgtg 900 cgagttctac gccgccagcg
aaggcaactc ggcctttatc aacatcttca acgtgcccag 960 gaccgccggg
gtatcgccga tgccgcttgc ctttgtggaa tacgacctgg acaccggcga 1020
tccgctgcgg gatgcgagcg ggcgagtgcg tcgggtaccc gacggtgaac ccggcctgtt
1080 gcttagccgg gtcaaccggc tgcagccgtt cgacggctac accgacccgg
ttgccagcga 1140 aaagaagttg gtgcgcaacg cttttcgaga tggcgactgt
tggttcaaca ccggtgacgt 1200 gatgagcccg cagggcatgg gccatgccgc
cttcgtcgat cggctgggcg acaccttccg 1260 ctggaagggc gagaatgtcg
ccaccactca ggtcgaagcg gcactggcct ccgaccagac 1320 cgtcgaggag
tgcacggtct acggcgtcca gattccgcgc accggcgggc gcgccggaat 1380
ggccgcgatc acactgcgcg ctggcgccga attc 1414 128 228 PRT
Mycobacterium tuberculosis 128 Gly Ser Ala Glu Tyr Ile Ser Asn Val
Ile Tyr Glu Gly Pro Arg Ala 1 5 10 15 Asp Ser Leu Tyr Ala Ala Asp
Gln Arg Leu Arg Gln Leu Ala Asp Ser 20 25 30 Val Arg Thr Thr Ala
Glu Ser Leu Asn Thr Thr Leu Asp Glu Leu His 35 40 45 Glu Asn Trp
Lys Gly Ser Ser Ser Glu Trp Met Ala Asp Ala Ala Leu 50 55 60 Arg
Tyr Leu Asp Trp Leu Ser Lys His Ser Arg Gln Ile Leu Arg Thr 65 70
75 80 Ala Arg Val Ile Glu Ser Leu Val Met Ala Tyr Glu Glu Thr Leu
Leu 85 90 95 Arg Val Val Pro Pro Ala Thr Ile Ala Asn Asn Arg Glu
Glu Val Arg 100 105 110 Arg Leu Ile Ala Ser Asn Val Ala Gly Gly Lys
His Ser Ser Asn Arg 115 120 125 Arg Pro Arg Gly Thr Ile Arg Ala Val
Pro Gly Arg Lys Tyr Pro Ser 130 135 140 Asn Gly Pro Leu Ser Lys Leu
Asp Pro Ile Cys Ala Ile Glu Ala Ala 145 150 155 160 Pro Met Ala Gly
Ala Ala Ala Asp Pro Gln Glu Arg Val Gly Pro Arg 165 170 175 Gly Arg
Arg Gly Leu Ala Gly Gln Gln Gln Cys Arg Gly Arg Pro Gly 180 185 190
Pro Ser Leu Arg Cys Ser His Asp Thr Pro Arg Phe Gln Met Asn Gln 195
200 205 Ala Phe His Thr Met Val Asn Met Leu Leu Thr Cys Phe Ala Cys
Gln 210 215 220 Glu Lys Pro Arg 225 129 597 PRT Mycobacterium
tuberculosis 129 Gly Ser Pro Ala Thr Met Pro Ser Ser Arg Asn Leu
Ala Thr Asn Pro 1 5 10 15 Glu Ile Ala Thr Gly Tyr Arg Arg Asp Met
Thr Val Val Arg Thr Ala 20 25 30 His Tyr Ala Ala Ala Thr Ala Asn
Pro Leu Ala Thr Gln Val Ala Cys 35 40 45 Arg Val Leu Arg Asp Gly
Gly Thr Ala Ala Asp Ala Val Val Ala Ala 50 55 60 Gln Ala Val Leu
Gly Leu Val Glu Pro Gln Ser Ser Gly Ile Gly Gly 65 70 75 80 Gly Gly
Tyr Leu Val Tyr Phe Asp Ala Arg Thr Gly Ser Val Gln Ala 85 90 95
Tyr Asp Gly Arg Glu Val Ala Pro Ala Ala Ala Thr Glu Asn Tyr Leu 100
105 110 Arg Trp Val Ser Asp Val Asp Arg Ser Ala Pro Arg Pro Asn Ala
Arg 115 120 125 Ala Ser Gly Arg Ser Ile Gly Val Pro Gly Ile Leu Arg
Met Leu Glu 130 135 140 Met Val His Asn Glu His Gly Arg Thr Pro Trp
Arg Asp Leu Phe Gly 145 150 155 160 Pro Ala Val Thr Leu Ala Asp Gly
Gly Phe Asp Ile Ser Ala Arg Met 165 170 175 Gly Ala Ala Ile Ser Asp
Ala Ala Pro Gln Leu Arg Asp Asp Pro Glu 180 185 190 Ala Arg Lys Tyr
Phe Leu Asn Pro Asp Gly Ser Pro Lys Pro Ala Gly 195 200 205 Thr Arg
Leu Thr Asn Pro Ala Tyr Ser Lys Thr Leu Ser Ala Ile Ala 210 215 220
Ser Ala Gly Ala Asn Ala Phe Tyr Ser Gly Asp Ile Ala His Asp Ile 225
230 235 240 Val Ala Ala Ala Ser Asp Thr Ser Asn Gly Arg Thr Pro Gly
Leu Leu 245 250 255 Thr Ile Glu Asp Leu Ala Gly Tyr Leu Ala Lys Arg
Arg Gln Pro Leu 260 265 270 Cys Thr Thr Tyr Arg Gly Arg Glu Ile Cys
Gly Met Pro Ser Ser Gly 275 280 285 Gly Val Ala Val Ala Ala Thr Leu
Gly Ile Leu Glu His Phe Pro Met 290 295 300 Ser Asp Tyr Ala Pro Ser
Lys Val Asp Leu Asn Gly Gly Arg Pro Thr 305 310 315 320 Val Met Gly
Val His Leu Ile Ala Glu Ala Glu Arg Leu Ala Tyr Ala 325 330 335 Asp
Arg Asp Gln Tyr Ile Ala Asp Val Asp Phe Val Arg Leu Pro Gly 340 345
350 Gly Ser Leu Thr Thr Leu Val Asp Pro Gly Tyr Leu Ala Ala Arg Ala
355 360 365 Ala Leu Ile Ser Pro Gln His Ser Met Gly Ser Ala Arg Pro
Gly Asp 370 375 380 Phe Gly Ala Pro Thr Ala Val Ala Pro Pro Val Pro
Glu His Gly Thr 385 390 395 400 Ser His Leu Ser Val Val Asp Ser Tyr
Gly Asn Ala Ala Thr Leu Thr 405 410 415 Thr Thr Val Glu Ser Ser Phe
Gly Ser Tyr His Leu Val Asp Gly Phe 420 425 430 Ile Leu Asn Asn Gln
Leu Ser Asp Phe Ser Ala Glu Pro His Ala Thr 435 440 445 Asp Gly Ser
Pro Val Ala Asn Arg Val Glu Pro Gly Lys Arg Pro Arg 450 455 460 Ser
Ser Met Ala Pro Thr Leu Val Phe Asp His Ser Ser Ala Gly Arg 465 470
475 480 Gly Ala Leu Tyr Ala Val Leu Gly Ser Pro Gly Gly Ser Met Ile
Ile 485 490 495 Gln Phe Val Val Lys Thr Leu Val Ala Met Leu Asp Trp
Gly Leu Asn 500 505 510 Pro Gln Gln Ala Val Ser Leu Val Asp Phe Gly
Ala Ala Asn Ser Pro 515 520 525 His Thr Asn Leu Gly Gly Glu Asn Pro
Glu Ile Asn Thr Ser Asp Asp 530 535 540 Gly Asp His Asp Pro Leu Val
Gln Gly Leu Arg Ala Leu Gly His Arg 545 550 555 560 Val Asn Leu Ala
Glu Gln Ser Ser Gly Leu Ser Ala Ile Thr Arg Ser 565 570 575 Glu Ala
Gly Trp Ala Gly Gly Ala Asp Pro Arg Arg Glu Gly Ala Val 580 585 590
Met Gly Asp Asp Ala 595 130 163 PRT Mycobacterium tuberculosis 130
Glu Phe Lys Arg Gly Val Ala Thr Leu Pro Val Ile Leu Val Ile Leu 1 5
10 15 Leu Ser Val Ala Ala Gly Ala Gly Ala Trp Leu Leu Val Arg Gly
His 20 25 30 Gly Pro Gln Gln Pro Glu Ile Ser Ala Tyr Ser His Gly
His Leu Thr 35 40 45 Arg Val Gly Pro Tyr Leu Tyr Cys Asn Val Val
Asp Leu Asp Asp Cys 50 55 60 Gln Thr Pro Gln Ala Gln Gly Glu Leu
Pro Val Ser Glu Arg Tyr Pro 65 70 75 80 Val Gln Leu Ser Val Pro Glu
Val Ile Ser Arg Ala Pro Trp Arg Leu 85 90 95 Leu Gln Val Tyr Gln
Asp Pro Ala Asn Thr Thr Ser Thr Leu Phe Arg 100 105 110 Pro Asp Thr
Arg Leu Ala Val Thr Ile Pro Thr Val Asp Pro Gln Arg 115 120 125 Gly
Arg Leu Thr Gly Ile Val Val Gln Leu Leu Thr Leu Val Val Asp 130 135
140 His Ser Gly Glu Leu Arg Asp Val Pro His Ala Glu Trp Ser Val Arg
145 150 155 160 Leu Ile Phe 131 943 PRT Mycobacterium tuberculosis
131 Glu Phe Ala Pro Met Leu Asp Ala Ala Ala Ala Trp Asp Gly Leu Ala
1 5 10 15 Asp Glu Leu Gly Ser Ala Ala Ala Ser Phe Ser Ala Val Thr
Ala Gly 20 25 30 Leu Ala Gly Ser Ser Trp Leu Gly Ala Ala Ser Thr
Ala Met Thr Gly 35 40 45 Ala Ala Ala Pro Tyr Leu Gly Trp Leu Ser
Ala Ala Ala Ala Gln Ala 50 55 60 Gln Gln Ala Ala Thr Gln Thr Arg
Leu Ala Ala Ala Ala Phe Glu Ala 65 70 75 80 Ala Leu Ala Ala Thr Val
His Pro Ala Ile Ile Ser Ala Asn Arg Ala 85 90 95 Leu Phe Val Ser
Leu Val Val Ser Asn Leu Leu Gly Gln Asn Ala Pro 100 105 110 Ala Ile
Ala Ala Thr Glu Ala Ala Tyr Glu Gln Met Trp Ala Gln Asp 115 120 125
Val Ala Ala Met Phe Gly Tyr His Ala Gly Ala Ser Ala Ala Val Ser 130
135 140 Ala Leu Thr Pro Phe Gly Gln Ala Leu Pro Thr Val Ala Gly Gly
Gly 145 150 155 160 Ala Leu Val Ser Ala Ala Ala Ala Gln Val Thr Thr
Arg Val Phe Arg 165 170 175 Asn Leu Gly Leu Ala Asn Val Gly Glu Gly
Asn Val Gly Asn Gly Asn 180 185 190 Val Gly Asn Phe Asn Leu Gly Ser
Ala Asn Ile Gly Asn Gly Asn Ile 195 200 205 Gly Ser Gly Asn Ile Gly
Ser Ser Asn Ile Gly Phe Gly Asn Val Gly 210 215 220 Pro Gly Leu Thr
Ala Ala Leu Asn Asn Ile Gly Phe Gly Asn Thr Gly 225 230 235 240 Ser
Asn Asn Ile Gly Phe Gly Asn Thr Gly Ser Asn Asn Ile Gly Phe 245 250
255 Gly Asn Thr Gly Asp Gly Asn Arg Gly Ile Gly Leu Thr Gly Ser Gly
260 265 270 Leu Leu Gly Phe Gly Gly Leu Asn Ser Gly Thr Gly Asn Ile
Gly Leu 275 280 285 Phe Asn Ser Gly Thr Gly Asn Val Gly Ile Gly Asn
Ser Gly Thr Gly 290 295 300 Asn Trp Gly Ile Gly Asn Ser Gly Asn Ser
Tyr Asn Thr Gly Phe Gly 305 310 315 320 Asn Ser Gly Asp Ala Asn Thr
Gly Phe Phe Asn Ser Gly Ile Ala Asn 325 330 335 Thr Gly Val Gly Asn
Ala Gly Asn Tyr Asn Thr Gly Ser Tyr Asn Pro 340 345 350 Gly Asn Ser
Asn Thr Gly Gly Phe Asn Met Gly Gln Tyr Asn Thr Gly 355 360 365 Tyr
Leu Asn Ser Gly Asn Tyr Asn Thr Gly Leu Ala Asn Ser Gly Asn 370 375
380 Val Asn Thr Gly Ala Phe Ile Thr Gly Asn Phe Asn Asn Gly Phe Leu
385 390 395 400 Trp Arg Gly Asp His Gln Gly Leu Ile Phe Gly Ser Pro
Gly Phe Phe 405 410 415 Asn Ser Thr Ser Ala Pro Ser Ser Gly Phe Phe
Asn Ser Gly Ala Gly 420 425 430 Ser Ala Ser Gly Phe Leu Asn Ser Gly
Ala Asn Asn Ser Gly Phe Phe 435 440 445 Asn Ser Ser Ser Gly Ala Ile
Gly Asn Ser Gly Leu Ala Asn Ala Gly 450 455 460 Val Leu Val Ser Gly
Val Ile Asn Ser Gly Asn Thr Val Ser Gly Leu 465 470 475 480 Phe Asn
Met Ser Leu Val Ala Ile Thr Thr Pro Ala Leu Ile Ser Gly 485 490 495
Phe Phe Asn Thr Gly Ser Asn Met Ser Gly Phe Phe Gly Gly Pro Pro 500
505 510 Val Phe Asn Leu Gly Leu Ala Asn Arg Gly Val Val Asn Ile Leu
Gly 515 520 525 Asn Ala Asn Ile Gly Asn Tyr Asn Ile Leu Gly Ser Gly
Asn Val Gly 530 535 540 Asp Phe Asn Ile Leu Gly Ser Gly Asn Leu Gly
Ser Gln Asn Ile Leu 545 550 555 560 Gly Ser Gly Asn Val Gly Ser Phe
Asn Ile Gly Ser Gly Asn Ile Gly 565 570 575 Val Phe Asn Val Gly Ser
Gly Ser Leu Gly Asn Tyr Asn Ile Gly Ser 580 585 590 Gly Asn Leu Gly
Ile Tyr Asn Ile Gly Phe Gly Asn Val Gly Asp Tyr 595 600 605 Asn Val
Gly Phe Gly Asn Ala Gly Asp Phe Asn Gln Gly Phe Ala Asn 610 615 620
Thr Gly Asn Asn Asn Ile Gly Phe Ala Asn Thr Gly Asn Asn Asn Ile 625
630 635 640 Gly Ile Gly Leu Ser Gly Asp Asn Gln Gln Gly Phe Asn Ile
Ala Ser 645 650 655 Gly Trp Asn Ser Gly Thr Gly Asn Ser Gly Leu Phe
Asn Ser Gly Thr 660 665 670 Asn Asn Val Gly Ile Phe Asn Ala Gly Thr
Gly Asn Val Gly Ile Ala 675 680 685 Asn Ser Gly Thr Gly Asn Trp Gly
Ile Gly Asn Pro Gly Thr Asp Asn 690 695 700 Thr Gly Ile Leu Asn Ala
Gly Ser Tyr Asn Thr Gly Ile Leu Asn Ala 705 710 715 720 Gly Asp Phe
Asn Thr Gly Phe Tyr Asn Thr Gly Ser Tyr Asn Thr Gly 725 730 735 Gly
Phe Asn Val Gly Asn Thr Asn Thr Gly Asn Phe Asn Val Gly Asp 740 745
750 Thr Asn Thr Gly Ser Tyr Asn Pro Gly Asp Thr Asn Thr Gly Phe Phe
755 760 765 Asn Pro Gly Asn Val Asn Thr Gly Ala Phe Asp Thr Gly Asp
Phe Asn 770 775 780 Asn Gly Phe Leu Val Ala Gly Asp Asn Gln Gly Gln
Ile Ala Ile Asp 785 790 795 800 Leu Ser Val Thr Thr Pro Phe Ile Pro
Ile Asn Glu Gln Met Val Ile 805 810 815 Asp Val His Asn Val Met Thr
Phe Gly Gly Asn Met Ile Thr Val Thr 820 825 830 Glu Ala Ser Thr Val
Phe Pro Gln Thr Phe Tyr Leu Ser Gly Leu Phe 835 840 845 Phe Phe Gly
Pro Val Asn Leu Ser Ala Ser Thr Leu Thr Val Pro Thr 850 855 860 Ile
Thr Leu Thr Ile Gly Gly Pro Thr Val Thr Val Pro Ile Ser Ile 865 870
875 880 Val Gly Ala Leu Glu Ser Arg Thr Ile Thr Phe Leu Lys Ile Asp
Pro 885 890 895 Ala Pro Gly Ile Gly Asn Ser Thr Thr Asn Pro Ser Ser
Gly Phe Phe 900 905 910 Asn Ser Gly Thr Gly Gly Thr Ser Gly Phe Gln
Asn Val Gly Gly Gly 915 920 925 Ser Ser Gly Val Trp Asn Ser Gly Leu
Ser Ser Lys Leu Gly Asn 930 935 940 132 592 PRT Mycobacterium
tuberculosis 132 Glu Phe Ala Asp Arg Gly Gln Arg Arg Gly Cys Ala
Pro Gly Ile Ala 1 5 10 15 Ser Ala Leu Arg Ala Ser Phe Gln Gly Lys
Ser Arg Pro Trp Thr Gln 20 25 30 Thr Arg Tyr Trp Ala Phe Ala Leu
Leu Thr Pro Leu Val Val
Ala Met 35 40 45 Val Leu Thr Gly Cys Ser Ala Ser Gly Thr Gln Leu
Glu Leu Ala Pro 50 55 60 Thr Ala Asp Arg Arg Ala Ala Val Gly Thr
Thr Ser Asp Ile Asn Gln 65 70 75 80 Gln Asp Pro Ala Thr Leu Gln Asp
Gly Gly Asn Leu Arg Leu Ser Leu 85 90 95 Thr Asp Phe Pro Pro Asn
Phe Asn Ile Leu His Ile Asp Gly Asn Asn 100 105 110 Ala Glu Val Ala
Ala Met Met Lys Ala Thr Leu Pro Arg Ala Phe Ile 115 120 125 Ile Gly
Pro Asp Gly Ser Thr Thr Val Asp Thr Asn Tyr Phe Thr Ser 130 135 140
Ile Glu Leu Thr Arg Thr Ala Pro Gln Val Val Thr Tyr Thr Ile Asn 145
150 155 160 Pro Glu Ala Val Trp Ser Asp Gly Thr Pro Ile Thr Trp Arg
Asp Ile 165 170 175 Ala Ser Gln Ile His Ala Ile Ser Gly Ala Asp Lys
Ala Phe Glu Ile 180 185 190 Ala Ser Ser Ser Gly Ala Glu Arg Val Ala
Ser Val Thr Arg Gly Val 195 200 205 Asp Asp Arg Gln Ala Val Val Thr
Phe Ala Lys Pro Tyr Ala Glu Trp 210 215 220 Arg Gly Met Phe Ala Gly
Asn Gly Met Leu Leu Pro Ala Ser Met Thr 225 230 235 240 Ala Thr Pro
Glu Ala Phe Asn Lys Gly Gln Leu Asp Gly Pro Gly Pro 245 250 255 Ser
Ala Gly Pro Phe Val Val Ser Ala Leu Asp Arg Thr Ala Gln Arg 260 265
270 Ile Val Leu Thr Arg Asn Pro Arg Trp Trp Gly Ala Arg Pro Arg Leu
275 280 285 Asp Ser Ile Thr Tyr Leu Val Leu Asp Asp Ala Ala Arg Leu
Pro Ala 290 295 300 Leu Gln Asn Asn Thr Ile Asp Ala Thr Gly Val Gly
Thr Leu Asp Gln 305 310 315 320 Leu Thr Ile Ala Ala Arg Thr Lys Gly
Ile Ser Ile Arg Arg Ala Pro 325 330 335 Gly Pro Ser Trp Tyr His Phe
Thr Leu Asn Gly Ala Pro Gly Ser Ile 340 345 350 Leu Ala Asp Lys Ala
Leu Arg Leu Ala Ile Ala Lys Gly Ile Asp Arg 355 360 365 Tyr Thr Ile
Ala Arg Val Ala Gln Tyr Gly Leu Thr Ser Asp Pro Val 370 375 380 Pro
Leu Asn Asn His Val Phe Val Ala Gly Gln Asp Gly Tyr Gln Asp 385 390
395 400 Asn Ser Gly Val Val Ala Tyr Asn Pro Glu Gln Ala Lys Arg Glu
Leu 405 410 415 Asp Ala Leu Gly Trp Arg Arg Ser Gly Ala Phe Arg Glu
Lys Asp Gly 420 425 430 Arg Gln Leu Val Ile Arg Asp Leu Phe Tyr Asp
Ala Gln Ser Thr Arg 435 440 445 Gln Phe Ala Gln Ile Ala Gln His Thr
Leu Ala Gln Ile Gly Val Lys 450 455 460 Leu Glu Leu Gln Ala Lys Ser
Gly Ser Gly Phe Phe Ser Asp Tyr Val 465 470 475 480 Asn Val Gly Ala
Phe Asp Ile Ala Gln Phe Gly Trp Val Gly Asp Ala 485 490 495 Phe Pro
Leu Ser Ser Leu Thr Gln Ile Tyr Ala Ser Asp Gly Glu Ser 500 505 510
Asn Phe Gly Lys Ile Gly Ser Pro Gln Ile Asp Ala Ala Ile Glu Arg 515
520 525 Thr Leu Ala Glu Leu Asp Pro Gly Lys Ala Arg Ala Leu Ala Asn
Gln 530 535 540 Val Asp Glu Leu Ile Trp Ala Glu Gly Phe Ser Leu Pro
Leu Thr Gln 545 550 555 560 Ser Pro Gly Thr Val Ala Val Arg Ser Thr
Leu Ala Asn Phe Gly Ala 565 570 575 Thr Gly Leu Ala Asp Leu Asp Tyr
Thr Ala Ile Gly Phe Met Arg Arg 580 585 590 133 259 PRT
Mycobacterium tuberculosis 133 Glu Phe Ile Ser Gln Ala Cys Gly Ser
His Arg Pro Arg Arg Pro Ser 1 5 10 15 Ser Leu Gly Ala Val Ala Ile
Leu Ile Ala Ala Thr Leu Phe Ala Thr 20 25 30 Val Val Ala Gly Cys
Gly Lys Lys Pro Thr Thr Ala Ser Ser Pro Ser 35 40 45 Pro Gly Ser
Pro Ser Pro Glu Ala Gln Gln Ile Leu Gln Asp Ser Ser 50 55 60 Lys
Ala Thr Lys Gly Leu His Ser Val His Val Val Val Thr Val Asn 65 70
75 80 Asn Leu Ser Thr Leu Pro Phe Glu Ser Val Asp Ala Asp Val Thr
Asn 85 90 95 Gln Pro Gln Gly Asn Gly Gln Ala Val Gly Asn Ala Lys
Val Arg Met 100 105 110 Lys Pro Asn Thr Pro Val Val Ala Thr Glu Phe
Leu Val Thr Asn Lys 115 120 125 Thr Met Tyr Thr Lys Arg Gly Gly Asp
Tyr Val Ser Val Gly Pro Ala 130 135 140 Glu Lys Ile Tyr Asp Pro Gly
Ile Ile Leu Asp Lys Asp Arg Gly Leu 145 150 155 160 Gly Ala Val Val
Gly Gln Val Gln Asn Pro Thr Ile Gln Gly Arg Asp 165 170 175 Ala Ile
Asp Gly Leu Ala Thr Val Lys Val Ser Gly Thr Ile Asp Ala 180 185 190
Ala Val Ile Asp Pro Ile Val Pro Gln Leu Gly Lys Gly Gly Gly Arg 195
200 205 Leu Pro Ile Thr Leu Trp Ile Val Asp Thr Asn Ala Ser Thr Pro
Ala 210 215 220 Pro Ala Ala Asn Leu Val Arg Met Val Ile Asp Lys Asp
Gln Gly Asn 225 230 235 240 Val Asp Ile Thr Leu Ser Asn Trp Gly Ala
Pro Val Thr Ile Pro Asn 245 250 255 Pro Ala Gly 134 312 PRT
Mycobacterium tuberculosis 134 Glu Phe Met Ile Gln Ile Ala Arg Thr
Trp Arg Val Phe Ala Gly Gly 1 5 10 15 Met Ala Thr Gly Phe Ile Gly
Val Val Leu Val Thr Ala Gly Lys Ala 20 25 30 Ser Ala Asp Pro Leu
Leu Pro Pro Pro Pro Ile Pro Ala Pro Val Ser 35 40 45 Ala Pro Ala
Thr Val Pro Pro Val Gln Asn Leu Thr Ala Leu Pro Gly 50 55 60 Gly
Ser Ser Asn Arg Phe Ser Pro Ala Pro Ala Pro Ala Pro Ile Ala 65 70
75 80 Ser Pro Ile Pro Val Gly Ala Pro Gly Ser Thr Ala Val Pro Pro
Leu 85 90 95 Pro Pro Pro Val Thr Pro Ala Ile Ser Gly Thr Leu Arg
Asp His Leu 100 105 110 Arg Glu Lys Gly Val Lys Leu Glu Ala Gln Arg
Pro His Gly Phe Lys 115 120 125 Ala Leu Asp Ile Thr Leu Pro Met Pro
Pro Arg Trp Thr Gln Val Pro 130 135 140 Asp Pro Asn Val Pro Asp Ala
Phe Val Val Ile Ala Asp Arg Leu Gly 145 150 155 160 Asn Ser Val Tyr
Thr Ser Asn Ala Gln Leu Val Val Tyr Arg Leu Ile 165 170 175 Gly Asp
Phe Asp Pro Ala Glu Ala Ile Thr His Gly Tyr Ile Asp Ser 180 185 190
Gln Lys Leu Leu Ala Trp Gln Thr Thr Asn Ala Ser Met Ala Asn Phe 195
200 205 Asp Gly Phe Pro Ser Ser Ile Ile Glu Gly Thr Tyr Arg Glu Asn
Asp 210 215 220 Met Thr Leu Asn Thr Ser Arg Arg His Val Ile Ala Thr
Ser Gly Ala 225 230 235 240 Asp Lys Tyr Leu Val Ser Leu Ser Val Thr
Thr Ala Leu Ser Gln Ala 245 250 255 Val Thr Asp Gly Pro Ala Thr Asp
Ala Ile Val Asn Gly Phe Gln Val 260 265 270 Val Ala His Ala Ala Pro
Ala Gln Ala Pro Ala Pro Ala Pro Gly Ser 275 280 285 Ala Pro Val Gly
Leu Pro Gly Gln Ala Pro Gly Tyr Pro Pro Ala Gly 290 295 300 Thr Leu
Thr Pro Val Pro Pro Arg 305 310 135 445 PRT Mycobacterium
tuberculosis 135 Glu Phe Thr Arg Ser Arg Gly Leu Arg Tyr Ala Thr
Val Ile Ala Leu 1 5 10 15 Val Ala Ala Leu Val Gly Gly Val Tyr Val
Leu Ser Ser Thr Gly Asn 20 25 30 Lys Arg Thr Ile Val Gly Tyr Phe
Thr Ser Ala Val Gly Leu Tyr Pro 35 40 45 Gly Asp Gln Val Arg Val
Leu Gly Val Pro Val Gly Glu Ile Asp Met 50 55 60 Ile Glu Pro Arg
Ser Ser Asp Val Lys Ile Thr Met Ser Val Ser Lys 65 70 75 80 Asp Val
Lys Val Pro Val Asp Val Gln Ala Val Ile Met Ser Pro Asn 85 90 95
Leu Val Ala Ala Arg Phe Ile Gln Leu Thr Pro Val Tyr Thr Gly Gly 100
105 110 Ala Val Leu Pro Asp Asn Gly Arg Ile Asp Leu Asp Arg Thr Ala
Val 115 120 125 Pro Val Glu Trp Asp Glu Val Lys Glu Gly Leu Thr Arg
Leu Ala Ala 130 135 140 Asp Leu Ser Pro Ala Ala Gly Glu Leu Gln Gly
Pro Leu Gly Ala Ala 145 150 155 160 Ile Asn Gln Ala Ala Asp Thr Leu
Asp Gly Asn Gly Asp Ser Leu His 165 170 175 Asn Ala Leu Arg Glu Leu
Ala Gln Val Ala Gly Arg Leu Gly Asp Ser 180 185 190 Arg Gly Asp Ile
Phe Gly Thr Val Lys Asn Leu Gln Val Leu Val Asp 195 200 205 Ala Leu
Ser Glu Ser Asp Glu Gln Ile Val Gln Phe Ala Gly His Val 210 215 220
Ala Ser Val Ser Gln Val Leu Ala Asp Ser Ser Ala Asn Leu Asp Gln 225
230 235 240 Thr Leu Gly Thr Leu Asn Gln Ala Leu Ser Asp Ile Arg Gly
Phe Leu 245 250 255 Arg Glu Asn Asn Ser Thr Leu Ile Glu Thr Val Asn
Gln Leu Asn Asp 260 265 270 Phe Ala Gln Thr Leu Ser Asp Gln Ser Glu
Asn Ile Glu Gln Val Leu 275 280 285 His Val Ala Gly Pro Gly Ile Thr
Asn Phe Tyr Asn Ile Tyr Asp Pro 290 295 300 Ala Gln Gly Thr Leu Asn
Gly Leu Leu Ser Ile Pro Asn Phe Ala Asn 305 310 315 320 Pro Val Gln
Phe Ile Cys Gly Gly Ser Phe Asp Thr Ala Ala Gly Pro 325 330 335 Ser
Ala Pro Asp Tyr Tyr Arg Arg Ala Glu Ile Cys Arg Glu Arg Leu 340 345
350 Gly Pro Val Leu Arg Arg Leu Thr Val Asn Tyr Pro Pro Ile Met Phe
355 360 365 His Pro Leu Asn Thr Ile Thr Ala Tyr Lys Gly Gln Ile Ile
Tyr Asp 370 375 380 Thr Pro Ala Thr Glu Ala Lys Ser Glu Thr Pro Val
Pro Glu Leu Thr 385 390 395 400 Trp Val Pro Ala Gly Gly Gly Ala Pro
Val Gly Asn Pro Ala Asp Leu 405 410 415 Gln Ser Leu Leu Val Pro Pro
Ala Pro Gly Pro Ala Pro Ala Pro Pro 420 425 430 Ala Pro Gly Ala Gly
Pro Gly Glu His Gly Gly Gly Gly 435 440 445 136 437 PRT
Mycobacterium tuberculosis 136 Gly Met Asp Pro Leu Asn Arg Arg Gln
Phe Leu Ala Leu Ala Ala Ala 1 5 10 15 Ala Ala Gly Val Thr Ala Gly
Cys Ala Gly Met Gly Gly Gly Gly Ser 20 25 30 Val Lys Ser Gly Ser
Gly Pro Ile Asp Phe Trp Ser Ser His Pro Gly 35 40 45 Gln Ser Ser
Ala Ala Glu Arg Glu Leu Ile Gly Arg Phe Gln Asp Arg 50 55 60 Phe
Pro Thr Leu Ser Val Lys Leu Ile Asp Ala Gly Lys Asp Tyr Asp 65 70
75 80 Glu Val Ala Gln Lys Phe Asn Ala Ala Leu Ile Gly Thr Asp Val
Pro 85 90 95 Asp Val Val Leu Leu Asp Asp Arg Trp Trp Phe His Phe
Ala Leu Ser 100 105 110 Gly Val Leu Thr Ala Leu Asp Asp Leu Phe Gly
Gln Val Gly Val Asp 115 120 125 Thr Thr Asp Tyr Val Asp Ser Leu Leu
Ala Asp Tyr Glu Phe Asn Gly 130 135 140 Arg His Tyr Ala Val Pro Tyr
Ala Arg Ser Thr Pro Leu Phe Tyr Tyr 145 150 155 160 Asn Lys Ala Ala
Trp Gln Gln Ala Gly Leu Pro Asp Arg Gly Pro Gln 165 170 175 Ser Trp
Ser Glu Phe Asp Glu Trp Gly Pro Glu Leu Gln Arg Val Val 180 185 190
Gly Ala Gly Arg Ser Ala His Gly Trp Ala Asn Ala Asp Leu Ile Ser 195
200 205 Trp Thr Phe Gln Gly Pro Asn Trp Ala Phe Gly Gly Ala Tyr Ser
Asp 210 215 220 Lys Trp Thr Leu Thr Leu Thr Glu Pro Ala Thr Ile Ala
Ala Gly Asn 225 230 235 240 Phe Tyr Arg Asn Ser Ile His Gly Lys Gly
Tyr Ala Ala Val Ala Asn 245 250 255 Asp Ile Ala Asn Glu Phe Ala Thr
Gly Ile Leu Ala Ser Ala Val Ala 260 265 270 Ser Thr Gly Ser Leu Ala
Gly Ile Thr Ala Ser Ala Arg Phe Asp Phe 275 280 285 Gly Ala Ala Pro
Leu Pro Thr Gly Pro Asp Ala Ala Pro Ala Cys Pro 290 295 300 Thr Gly
Gly Ala Gly Leu Ala Ile Pro Ala Lys Leu Ser Glu Glu Arg 305 310 315
320 Lys Val Asn Ala Leu Lys Phe Ile Ala Phe Val Thr Asn Pro Thr Asn
325 330 335 Thr Ala Tyr Phe Ser Gln Gln Thr Gly Tyr Leu Pro Val Arg
Lys Ser 340 345 350 Ala Val Asp Asp Ala Ser Glu Arg His Tyr Leu Ala
Asp Asn Pro Arg 355 360 365 Ala Arg Val Ala Leu Asp Gln Leu Pro His
Thr Arg Thr Gln Asp Tyr 370 375 380 Ala Arg Val Phe Leu Pro Gly Gly
Asp Arg Ile Ile Ser Ala Gly Leu 385 390 395 400 Glu Ser Ile Gly Leu
Arg Gly Ala Asp Val Thr Lys Thr Phe Thr Asn 405 410 415 Ile Gln Lys
Arg Leu Gln Val Ile Leu Asp Arg Gln Ile Met Arg Lys 420 425 430 Leu
Ala Gly His Gly 435 137 189 PRT Mycobacterium tuberculosis 137 Gly
Ser Val Ala Val Arg Arg Lys Val Arg Arg Leu Thr Leu Ala Val 1 5 10
15 Ser Ala Leu Val Ala Leu Phe Pro Ala Val Ala Gly Cys Ser Asp Ser
20 25 30 Gly Asp Asn Lys Pro Gly Ala Thr Ile Pro Ser Thr Pro Ala
Asn Ala 35 40 45 Glu Gly Arg His Gly Pro Phe Phe Pro Gln Cys Gly
Gly Val Ser Asp 50 55 60 Gln Thr Val Thr Glu Leu Thr Arg Val Thr
Gly Leu Val Asn Thr Ala 65 70 75 80 Lys Asn Ser Val Gly Cys Gln Trp
Leu Ala Gly Gly Gly Ile Leu Gly 85 90 95 Pro His Phe Ser Phe Ser
Trp Tyr Arg Gly Ser Pro Ile Gly Arg Glu 100 105 110 Arg Lys Thr Glu
Glu Leu Ser Arg Ala Ser Val Glu Asp Ile Asn Ile 115 120 125 Asp Gly
His Ser Gly Phe Ile Ala Ile Gly Asn Glu Pro Ser Leu Gly 130 135 140
Asp Ser Leu Cys Glu Val Gly Ile Gln Phe Ser Asp Asp Phe Ile Glu 145
150 155 160 Trp Ser Val Ser Phe Ser Gln Lys Pro Phe Pro Leu Pro Cys
Asp Ile 165 170 175 Ala Lys Glu Leu Thr Arg Gln Ser Ile Ala Asn Ser
Lys 180 185 138 230 PRT Mycobacterium tuberculosis 138 Gly Ser Ile
Ala Met Gln Leu Ser Ser Arg Leu Glu Asn His Arg Lys 1 5 10 15 Pro
Phe Pro Arg Thr Val Ser Thr Gly Gln Ala Ile Ala Met Ala Lys 20 25
30 Arg Thr Pro Val Arg Lys Ala Cys Thr Val Leu Ala Val Leu Ala Ala
35 40 45 Thr Leu Leu Leu Gly Ala Cys Gly Gly Pro Thr Gln Pro Arg
Ser Ile 50 55 60 Thr Leu Thr Phe Ile Arg Asn Ala Gln Ser Gln Ala
Asn Ala Asp Gly 65 70 75 80 Ile Ile Asp Thr Asp Met Pro Gly Ser Gly
Leu Ser Ala Asp Gly Lys 85 90 95 Ala Glu Ala Gln Gln Val Ala His
Gln Val Ser Arg Arg Asp Val Asp 100 105 110 Ser Ile Tyr Ser Ser Pro
Met Ala Ala Asp Gln Gln Thr Ala Gly Pro 115 120 125 Leu Ala Gly Glu
Leu Gly Lys Gln Val Glu Ile Leu Pro Gly Leu Gln 130 135 140 Ala Ile
Asn Ala Gly Trp Phe Asn Gly Lys Pro Glu Ser Met Ala Asn 145 150 155
160 Ser Thr Tyr Met Leu Ala Pro Ala Asp Trp Leu Ala Gly Asp Val His
165 170 175 Asn Thr Ile Pro Gly Ser Ile Ser Gly Thr Glu Phe Asn Ser
Gln Phe 180 185 190 Ser Ala Ala Val Arg Lys Ile Tyr Asp Ser Gly His
Asn Thr Pro Val 195 200 205 Val Phe Ser Gln Gly Val Ala Ile Met Ile
Trp Thr Leu Met Asn Ala 210
215 220 Arg Asn Ser Arg Glu Ser 225 230 139 320 PRT Mycobacterium
tuberculosis 139 Gly Ser Gly Gly Ala Gly Met Thr Glu His Asn Glu
Asp Pro Gln Ile 1 5 10 15 Glu Arg Val Ala Asp Asp Ala Ala Asp Glu
Glu Ala Val Thr Glu Pro 20 25 30 Leu Ala Thr Glu Ser Lys Asp Glu
Pro Ala Glu His Pro Glu Phe Glu 35 40 45 Gly Pro Arg Arg Arg Ala
Arg Arg Glu Arg Ala Glu Arg Arg Ala Ala 50 55 60 Gln Ala Arg Ala
Thr Ala Ile Glu Gln Ala Arg Arg Ala Ala Lys Arg 65 70 75 80 Arg Ala
Arg Gly Gln Ile Val Ser Glu Gln Asn Pro Ala Lys Pro Ala 85 90 95
Ala Arg Gly Val Val Arg Gly Leu Lys Ala Leu Leu Ala Thr Val Val 100
105 110 Leu Ala Val Val Gly Ile Gly Leu Gly Leu Ala Leu Tyr Phe Thr
Pro 115 120 125 Ala Met Ser Ala Arg Glu Ile Val Ile Ile Gly Ile Gly
Ala Val Ser 130 135 140 Arg Glu Glu Val Leu Asp Ala Ala Arg Val Arg
Pro Ala Thr Pro Leu 145 150 155 160 Leu Gln Ile Asp Thr Gln Gln Val
Ala Asp Arg Val Ala Thr Ile Arg 165 170 175 Arg Val Ala Ser Ala Arg
Val Gln Arg Gln Tyr Pro Ser Ala Leu Arg 180 185 190 Ile Thr Ile Val
Glu Arg Val Pro Val Val Val Lys Asp Phe Ser Asp 195 200 205 Gly Pro
His Leu Phe Asp Arg Asp Gly Val Asp Phe Ala Thr Asp Pro 210 215 220
Pro Pro Pro Ala Leu Pro Tyr Phe Asp Val Asp Asn Pro Gly Pro Ser 225
230 235 240 Asp Pro Thr Thr Lys Ala Ala Leu Gln Val Leu Thr Ala Leu
His Pro 245 250 255 Glu Val Ala Ser Gln Val Gly Arg Ile Ala Ala Pro
Ser Val Ala Ser 260 265 270 Ile Thr Leu Thr Leu Ala Asp Gly Arg Val
Val Ile Trp Gly Thr Thr 275 280 285 Asp Arg Cys Glu Glu Lys Ala Glu
Lys Leu Ala Ala Leu Leu Thr Gln 290 295 300 Pro Gly Arg Thr Tyr Asp
Val Ser Ser Pro Asp Leu Pro Thr Val Lys 305 310 315 320 140 488 PRT
Mycobacterium tuberculosis 140 Gly Ser Gln Met Asn Val Val Asp Ile
Ser Arg Trp Gln Phe Gly Ile 1 5 10 15 Thr Thr Val Tyr His Phe Ile
Phe Val Pro Leu Thr Ile Gly Leu Ala 20 25 30 Pro Leu Ile Ala Val
Met Gln Thr Leu Trp Val Val Thr Asp Asn Pro 35 40 45 Ala Trp Tyr
Arg Leu Thr Lys Phe Phe Gly Lys Leu Phe Leu Ile Asn 50 55 60 Phe
Ala Ile Gly Val Ala Thr Gly Ile Val Gln Glu Phe Gln Phe Gly 65 70
75 80 Met Asn Trp Ser Glu Tyr Ser Arg Phe Val Gly Asp Val Phe Gly
Ala 85 90 95 Pro Leu Ala Met Glu Gly Leu Ala Ala Phe Phe Phe Glu
Ser Thr Phe 100 105 110 Ile Gly Leu Trp Ile Phe Gly Trp Asn Arg Leu
Pro Arg Leu Val His 115 120 125 Leu Ala Cys Ile Trp Ile Val Ala Ile
Ala Val Asn Val Ser Ala Phe 130 135 140 Phe Ile Ile Ala Ala Asn Ser
Phe Met Gln His Pro Val Gly Ala His 145 150 155 160 Tyr Asn Pro Thr
Thr Gly Arg Ala Glu Leu Ser Ser Ile Val Val Leu 165 170 175 Leu Thr
Asn Asn Thr Ala Gln Ala Ala Phe Thr His Thr Val Ser Gly 180 185 190
Ala Leu Leu Thr Ala Gly Thr Phe Val Ala Ala Val Ser Ala Trp Trp 195
200 205 Leu Val Arg Ser Ser Thr Thr His Ala Asp Ser Asp Thr Gln Ala
Met 210 215 220 Tyr Arg Pro Ala Thr Ile Leu Gly Cys Trp Val Ala Leu
Ala Ala Thr 225 230 235 240 Ala Gly Leu Leu Phe Thr Gly Asp His Gln
Gly Lys Leu Met Phe Gln 245 250 255 Gln Gln Pro Met Lys Met Ala Ser
Ala Glu Ser Leu Cys Asp Thr Gln 260 265 270 Thr Asp Pro Asn Phe Ser
Val Leu Thr Val Gly Arg Gln Asn Asn Cys 275 280 285 Asp Ser Leu Thr
Arg Val Ile Glu Val Pro Tyr Val Leu Pro Phe Leu 290 295 300 Ala Glu
Gly Arg Ile Ser Gly Val Thr Leu Gln Gly Ile Arg Asp Leu 305 310 315
320 Gln Gln Glu Tyr Gln Gln Arg Phe Gly Pro Asn Asp Tyr Arg Pro Asn
325 330 335 Leu Phe Val Thr Tyr Trp Ser Phe Arg Met Met Ile Gly Leu
Met Ala 340 345 350 Ile Pro Val Leu Phe Ala Leu Ile Ala Leu Trp Leu
Thr Arg Gly Gly 355 360 365 Gln Ile Pro Asn Gln Arg Trp Phe Ser Trp
Leu Ala Leu Leu Thr Met 370 375 380 Pro Ala Pro Phe Leu Ala Asn Ser
Ala Gly Trp Val Phe Thr Glu Met 385 390 395 400 Gly Arg Gln Pro Trp
Val Val Val Pro Asn Pro Thr Gly Asp Gln Leu 405 410 415 Val Arg Leu
Thr Val Lys Ala Gly Val Ser Asp His Ser Ala Thr Val 420 425 430 Val
Ala Thr Ser Leu Leu Met Phe Thr Leu Val Tyr Ala Val Leu Ala 435 440
445 Val Ile Trp Cys Trp Leu Leu Lys Arg Tyr Ile Val Glu Gly Pro Leu
450 455 460 Glu His Asp Ala Glu Pro Ala Ala His Gly Ala Pro Arg Asp
Asp Glu 465 470 475 480 Val Ala Pro Leu Ser Phe Ala Tyr 485 141 471
PRT Mycobacterium tuberculosis 141 Asn Ser Lys Ala Ser Ile Gly Thr
Val Phe Gln Asp Arg Ala Ala Arg 1 5 10 15 Tyr Gly Asp Arg Val Phe
Leu Lys Phe Gly Asp Gln Gln Leu Thr Tyr 20 25 30 Arg Asp Ala Asn
Ala Thr Ala Asn Arg Tyr Ala Ala Val Leu Ala Ala 35 40 45 Arg Gly
Val Gly Pro Gly Asp Val Val Gly Ile Met Leu Arg Asn Ser 50 55 60
Pro Ser Thr Val Leu Ala Met Leu Ala Thr Val Lys Cys Gly Ala Ile 65
70 75 80 Ala Gly Met Leu Asn Tyr His Gln Arg Gly Glu Val Leu Ala
His Ser 85 90 95 Leu Gly Leu Leu Asp Ala Lys Val Leu Ile Ala Glu
Ser Asp Leu Val 100 105 110 Ser Ala Val Ala Glu Cys Gly Ala Ser Arg
Gly Arg Val Ala Gly Asp 115 120 125 Val Leu Thr Val Glu Asp Val Glu
Arg Phe Ala Thr Thr Ala Pro Ala 130 135 140 Thr Asn Pro Ala Ser Ala
Ser Ala Val Gln Ala Lys Asp Thr Ala Phe 145 150 155 160 Tyr Ile Phe
Thr Ser Gly Thr Thr Gly Phe Pro Lys Ala Ser Val Met 165 170 175 Thr
His His Arg Trp Leu Arg Ala Leu Ala Val Phe Gly Gly Met Gly 180 185
190 Leu Arg Leu Lys Gly Ser Asp Thr Leu Tyr Ser Cys Leu Pro Leu Tyr
195 200 205 His Asn Asn Ala Leu Thr Val Ala Val Ser Ser Val Ile Asn
Ser Gly 210 215 220 Ala Thr Leu Ala Leu Gly Lys Ser Phe Ser Ala Ser
Arg Phe Trp Asp 225 230 235 240 Glu Val Ile Ala Asn Arg Ala Thr Ala
Phe Val Tyr Ile Gly Glu Ile 245 250 255 Cys Arg Tyr Leu Leu Asn Gln
Pro Ala Lys Pro Thr Asp Arg Ala His 260 265 270 Gln Val Arg Val Ile
Cys Gly Asn Gly Leu Arg Pro Glu Ile Trp Asp 275 280 285 Glu Phe Thr
Thr Arg Phe Gly Val Ala Arg Val Cys Glu Phe Tyr Ala 290 295 300 Ala
Ser Glu Gly Asn Ser Ala Phe Ile Asn Ile Phe Asn Val Pro Arg 305 310
315 320 Thr Ala Gly Val Ser Pro Met Pro Leu Ala Phe Val Glu Tyr Asp
Leu 325 330 335 Asp Thr Gly Asp Pro Leu Arg Asp Ala Ser Gly Arg Val
Arg Arg Val 340 345 350 Pro Asp Gly Glu Pro Gly Leu Leu Leu Ser Arg
Val Asn Arg Leu Gln 355 360 365 Pro Phe Asp Gly Tyr Thr Asp Pro Val
Ala Ser Glu Lys Lys Leu Val 370 375 380 Arg Asn Ala Phe Arg Asp Gly
Asp Cys Trp Phe Asn Thr Gly Asp Val 385 390 395 400 Met Ser Pro Gln
Gly Met Gly His Ala Ala Phe Val Asp Arg Leu Gly 405 410 415 Asp Thr
Phe Arg Trp Lys Gly Glu Asn Val Ala Thr Thr Gln Val Glu 420 425 430
Ala Ala Leu Ala Ser Asp Gln Thr Val Glu Glu Cys Thr Val Tyr Gly 435
440 445 Val Gln Ile Pro Arg Thr Gly Gly Arg Ala Gly Met Ala Ala Ile
Thr 450 455 460 Leu Arg Ala Gly Ala Glu Phe 465 470 142 36 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
142 gtcaaggatc cggcatggac ccgctgaacc gccgac 36 143 44 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
143 atgtcgggat ccaagctttc gacggtcggc gcgtcggcgc cggg 44 144 37 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
144 gcagatgcat ctaatgggat ccgcggagta tatctcc 37 145 37 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
145 ggcgccgtgg gtgtcagcga agcttacctg gttgttg 37 146 31 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
146 ggtgccgaat tcgcgccgat gctggacgcg g 31 147 38 DNA Artificial
Sequence Description of Artificial SequencePCR Primer 147
acccgaattc ccaagcttgc tgctcaaacc actgttcc 38 148 33 DNA Artificial
Sequence Description of Artificial SequencePCR Primer 148
gcgcccaagg gatccccggc taccatgcct tcg 33 149 33 DNA Artificial
Sequence Description of Artificial SequencePCR Primer 149
ctcgaaggga tccgcgttcg tttggccgcc cgc 33 150 37 DNA Artificial
Sequence Description of Artificial SequencePCR Primer 150
ggcagtggga tccgtagcgg tgcggcgtaa ggtgcgg 37 151 48 DNA Artificial
Sequence Description of Artificial SequencePCR Primer 151
gacttcgtgg atccggtcaa gacaagcttt gcggtgatca aggcggcc 48 152 43 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
152 catgaatgaa ttcatctcac aagcgtgcgg ctcccaccga ccc 43 153 36 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
153 ccttggcgaa ttctcaaagg aaagcttcga aggcgg 36 154 37 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
154 ggagttcgga tccatcgcca tgcaactctc ctcccgg 37 155 46 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
155 gggcagtgga tccgtggtca gcaagctttc cctagagttt cgtgcg 46 156 35
DNA Artificial Sequence Description of Artificial SequencePCR
Primer 156 gtggcgccga attcaagcgc ggtgtcgcaa cgctg 35 157 30 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
157 cgcttaagcg cgaagcttcg tcgagccgcg 30 158 38 DNA Artificial
Sequence Description of Artificial SequencePCR Primer 158
gaccggaatt catgatccag atcgcgcgca cctggcgg 38 159 44 DNA Artificial
Sequence Description of Artificial SequencePCR Primer 159
aacatgaatt caagcttcga ggccgccgac gaatccgctc accg 44 160 36 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
160 cgggtcgccg aattcacgcg gagccgggga ttgcgc 36 161 39 DNA
Artificial Sequence Description of Artificial SequencePCR Primer
161 ggcggaattc aagcttcggt tcatccgccg cccccatgc 39 162 31 DNA
Artificial Sequence Description of Artificial Sequence PCR primer
162 ccccggggat ccgggggtgc tgggatgacg g 31 163 39 DNA Artificial
Sequence Description of Artificial Sequence PCR primer 163
acgacggatc ctaagcttgc aggcgcgccg atacgcggc 39 164 36 DNA Artificial
Sequence Description of Artificial Sequence PCR primer 164
tctccgggga tcccagatga atgtcgtcga catttc 36 165 28 DNA Artificial
Sequence Description of Artificial Sequence PCR primer 165
gggtctccgg atcccccata ccgacatg 28 166 32 DNA Artificial Sequence
Description of Artificial Sequence PCR primer 166 ccgactcgag
cggcggcgca cacacaacgg tc 32 167 32 DNA Artificial Sequence
Description of Artificial Sequence PCR primer 167 aatcctcgag
ccctgcggtc gccttccgag cg 32 168 36 DNA Artificial Sequence
Description of Artificial Sequence PCR primer 168 atccggcccg
aattcgctga ccgtggccag cgacga 36 169 42 DNA Artificial Sequence
Description of Artificial Sequence PCR primer 169 gatcggggag
aattccgccg acttaagctt cagctgagct gg 42
* * * * *
References