U.S. patent application number 10/094183 was filed with the patent office on 2002-11-14 for random gene unidirectional antisense library.
This patent application is currently assigned to WELGENE, INC.. Invention is credited to Lee, Yun-Han, Moon, Ik-Jae, Park, Jong-Gu.
Application Number | 20020168631 10/094183 |
Document ID | / |
Family ID | 19706645 |
Filed Date | 2002-11-14 |
United States Patent
Application |
20020168631 |
Kind Code |
A1 |
Park, Jong-Gu ; et
al. |
November 14, 2002 |
Random gene unidirectional antisense library
Abstract
The present invention provides a high-throughput system for
functional genomics using a random gene unidirectional antisense
library comprising LC-antisense compounds. The antisense compounds
were specific and effective for the elimination of target mRNA.
Thus, the system of the present invention may be effectively used
as temporary knock-down system to unveil functions of genes
critical for diseases. The system of the present invention can be
adapted not only for functional genomics but also for effectively
validating target for antisense or other molecular therapeutics
against various malignancies, infections, and other diseases by
blocking specific genes involved in the disease.
Inventors: |
Park, Jong-Gu; (Daegu,
KR) ; Moon, Ik-Jae; (Daegu, KR) ; Lee,
Yun-Han; (Daegu, KR) |
Correspondence
Address: |
SQUIRE, SANDERS & DEMPSEY L.L.P.
14th Floor
801 S. Figueroa Street
Los Angeles
CA
90017-5554
US
|
Assignee: |
WELGENE, INC.
|
Family ID: |
19706645 |
Appl. No.: |
10/094183 |
Filed: |
March 8, 2002 |
Current U.S.
Class: |
435/5 ;
435/235.1; 435/325; 435/6.13; 536/23.1 |
Current CPC
Class: |
A61P 3/00 20180101; A61K
38/00 20130101; A61P 35/00 20180101; C12N 15/1137 20130101; C12N
2799/021 20130101; C12Y 207/11022 20130101; C12N 15/1136 20130101;
C12N 15/113 20130101; C12N 2310/111 20130101; A61P 31/12 20180101;
C12N 2310/53 20130101; C12N 15/1135 20130101; A61P 37/00
20180101 |
Class at
Publication: |
435/5 ; 435/6;
536/23.1; 435/325; 435/235.1 |
International
Class: |
C12Q 001/70; C12Q
001/68; C07H 021/04; C12N 005/02; C12N 007/00 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 8, 2001 |
KR |
2001-12061 |
Claims
What is claimed is:
1. A library of a multitude of single-stranded large circular
nucleic acids, said library comprising: a multiplicity of
compartments, each of said compartments comprising one or more
single-stranded large circular antisense molecule of bacteriophage
or phagemid vector comprising at least one unidirectional antisense
nucleic acid insert, wherein said large circular antisense molecule
is capable of being introduced into a host cell, and is capable of
specifically binding to a nucleic acid in said host cell that is
substantially complementary to said antisense nucleic acid
insert.
2. The library of claim 1, wherein the specificity of the antisense
nucleic acid insert is unknown at the time said library is first
made.
3. The library of claim 1, wherein said host cell is a eucaryotic
cell.
4. The library of claim 1, wherein each of said compartments
contains from about 0.1 .mu.M to about 1 .mu.M of said large
circular antisense molecule.
5. The library of claim 1, wherein said bacteriophage or phagemid
vector is derived from a filamentous bacteriophage.
6. The library of claim 5, wherein said filamentous bacteriophage
is M13 bacteriophages.
7. The library of claim 1, wherein the source of said nucleic acid
insert is an eucaryotic organism.
8. The library of claim 1, wherein said bacteriophage or phagemid
vector comprises more than one kind of antisense nucleic acid
insert sequence.
9. The library according to claim 1, wherein said multiplicity of
compartments comprises a multiwell format of at least 6 wells.
10. The library according to claim 1, wherein said library is
configured to be made and used in a substantially automated
process.
11. The library according to claim 9, wherein said multiplicity of
compartments comprises a multiwell format of at least 96 wells.
12. A method of making a library comprising a multitude of
single-stranded large circular nucleic acids, which comprises one
or more single-stranded bacteriophage or phagemid vector comprising
at least one unidirectional antisense nucleic acid insert,
comprising: (i) inserting a nucleic acid fragment unidirectionally
into said bacteriophage or phagemid vector by unidirectionally
cloning the nucleic fragments into said vector; (ii) preparing
bacterial transformants by introducing the vector containing the
insert into competent bacterial cells to make bacterial
transformants; and (iii) infecting said transformants with helper
phage to produce said single-stranded nucleic acid library.
13. A library of a multitude of single-stranded large circular
nucleic acids, said library comprising: a multiplicity of
compartments, each of said compartments comprising one or more
single-stranded large circular antisense molecule of bacteriophage
or phagemid vector comprising at least one unidirectional
subtracted antisense nucleic acid insert, wherein said large
circular antisense molecule is capable of being introduced into a
host cell, and is capable of specifically binding to a nucleic acid
in said host cell that is substantially complementary to said
antisense nucleic acid insert.
14. The library according to claim 13, wherein said unidirectional
subtracted antisense nucleic acid is made by hybridizing a
population of nucleic acids expressed from a first cell line or
tissue with a population of nucleic acids expressed from a second
cell line or tissue, and obtaining a nucleic acid population from
the first cell line or tissue that does not hybridize with the
nucleic acid population from said second cell line or tissue.
15. The library according to claim 14, wherein said first cell line
or tissue is abnormal such that modulation of gene expression is
beneficial in returning said first cell line or tissue to normal,
and wherein said second cell line or tissue is normal.
16. The library according to claim 15, wherein said abnormality is
cancer, viral infection, immunologic disorders or metabolic
diseases.
17. The library according to claim 16, wherein said cancer is liver
cancer, lung cancer, stomach cancer, colon cancer, leukemia,
thyroid cancer, skin cancer, prostate cancer, cervical cancer, or
breast cancer.
18. The library according to claim 16, wherein said viral infection
is caused by human papilloma virus (HPV), HIV, small pox,
mononucleosis (Epstein-Barr virus), hepatitis, or respiratory
syncytial virus (RSV).
19. The library according to claim 16, wherein said metabolic
disease is phenylketonuria (PKU), primary hypothyroidism,
galactosemia, abnormal hemoglobins, types I and II diabetes, or
obesity.
20. The library according to claim 16, wherein said immunological
disorder is Sjogren's Syndrome, antiphospholipid syndrome, immune
complex diseases, Purpura, Schoenlein-Henoch, immunologic
deficiency syndromes, systemic lupus erythematosus,
immunodeficiency, rheumatism, kidney, or liver sclerosis.
21. A method of making a library comprising a multitude of
single-stranded large circular nucleic acids, which comprises one
or more single-stranded bacteriophage or phagemid vector comprising
at least one unidirectional subtracted antisense nucleic acid
insert, comprising: (i) inserting a subtracted nucleic acid
fragment unidirectionally into said bacteriophage or phagemid
vector by unidirectionally cloning the subtracted nucleic fragments
into said vector; (ii) preparing bacterial transformants by
introducing the vector containing the insert into competent
bacterial cells to make bacterial transformants; and (iii)
infecting said transformants with helper phage to produce said
single-stranded nucleic acid library.
22. The method according to claim 21, wherein said subtracted
nucleic fragment is made by hybridizing a population of nucleic
acids expressed from a first cell line or tissue with a population
of nucleic acids expressed from a second cell line or tissue, and
obtaining a nucleic acid population from the first cell line or
tissue that does not hybridize with the nucleic acid population
from said second cell line or tissue.
23. A method for specifically inhibiting growth of liver cancer
cells, comprising administering to said cells large circular
antisense molecules targeted to EST_Human
IL3-UT0117-160301-504-H11; Apolipoprotein A-II, clone MGC:12334;
PRO2675 mRNA; clone RP11-449G13 from 16; BAC clone RP11-360H4 from
2; gene supported by AK023036 (LOC90271); or gene similar to
cytochrome b5 outer mitochondrial membrane precursor (H. sapiens)
(LOC124229).
24. A method for specifically inhibiting growth of liver cancer
cells, comprising administering to said cells large circular
antisense molecules targeted to HSPC025, clone MGC:4223
IMAGE:2959747; tissue inhibitor of metalloproteinase 1;
alpha-fetoprotein (AFP); gene encoding protein FLJ14075;
apolipoprotein A-II (APOA2); clone MGC:20176 IMAGE:3503710;
eukaryotic translation initiation factor 4A, isoform 2 (EIF4A2);
cytochrome P450, subfamily IIE (ethanol-inducible) (CYP2E); or gene
similar to serine (or cysteine) proteinase inhibitor, clade A
(alpha-1 antiproteinase, antitrypsin), member 1, clone MGC:9222
IMAGE:3859644.
25. A high throughput system for functional genomics using a random
gene unidirectional antisense library or random gene unidirectional
subtracted antisense library comprising the following steps: (i)
forming large circular antisense molecule-carrier complexes with
said unidirectional or unidirectional subtracted antisense
libraries; (ii) performing a primary gene functional analysis by
transfecting the complexes into host cells to screen for the large
circular antisense molecule that eliminates endogenously expressed
substantially complementary transcripts; (iii) identifying the
large circular antisense molecule that eliminates the endogenously
expressed transcript; and (iv) sequencing either the antisense
molecule or cDNA that corresponds to the antisense molecule.
26. The high throughput system according to claim 25, further
comprising, (v) performing further gene function analysis with the
large circular antisense molecule identified in steps (iii) and
(iv).
27. The high throughput system according to claim 25, comprising
comparing the gene sequence obtained in step (iv) with a DNA
sequence database to identify the gene.
28. The high throughput system according to claim 25, wherein the
carrier is liposomes, cationic polymers, HVJ-liposomes complexes,
peptides or viruses.
29. The high throughput system according to claim 25, wherein the
large circular antisense molecule and carrier are mixed in an
optimal ratio of about 1:3 to about 1:4 by weight.
30. The high throughput system according to claim 26, wherein the
gene function analysis is assaying for the phenotype of cell
morphology, cell proliferation, cell apoptosis, or cell reaction to
a substrate.
31. The high throughtput system according to claim 26, wherein said
gene function analysis is carried out by performing an assay,
wherein said assay is RT-PCR, Western blot analysis, immunoassay,
MTT reduction assay, [.sup.3H]-thymidine incorporation assay,
colony formation assay, DNA synthesis and chromatin activation,
analysis of apoptosis by inspection of cell morphological changes,
chromosomal condensation or fragmentation, DNA fragmentation,
quantitative assay for apoptosis, signaling mechanisms of
apoptosis, activation of cell cycle regulators, complex formation
between cell cycle regulators, or assays for changes of metabolic,
morphological, physiological and biochemical phenotypes in vitro
and in vivo.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention relates to the field of antisense
technology. The present invention also relates to using the
antisense technology in therapeutics and in gene function
identification systems. The present invention relates to a
high-throughput system for functional genomics using a random gene
unidirectional antisense library. And in particular, the present
invention relates to a system for massively screening genes for
their functions.
[0003] 2. Description of the Background
[0004] As most of the genetic information in human genome has been
deciphered, many new methods for screening genes and analyzing
their functions have been studied and developed at different
institutions in the world. These methods have provided new
information to understand the biochemical and physiological
mechanisms of cell viability and the etiology of diseases. The
molecular bases of many incurable diseases will be better
understood and concomitantly more effective therapeutic agents will
be developed.
[0005] Most human diseases are caused by abnormal gene expression.
Genetic causes of disease are manifest by a variety of ways such as
termination of gene expression by direct DNA damage, and abnormal
transcription and/or translation. Abnormal expression of
proto-oncogene expression can cause cancer (Brown et al., Proc.
Natl. Acad. Sci. USA, 87(2), 538-542 (1990); Adams et al., Proc.
Natl. Acad. Sci. USA, 80(7), 1982-1986 (1983)). It was reported
that the occurrence and progression of immune-diseases are closely
related to the overproduction or underproduction of cytokines
(Pulsatelli et al., J. Rheumatol., 26(9), 1992-2001 (1999)).
Chronic or incurable diseases, such as various type of cancer,
immune diseases, are caused by abnormal gene expression. Therefore,
it is conceivable that these diseases can be controlled by
modulation of gene expression.
[0006] It is known in the art that one way to control gene
expression is by introducing to cells antisense oligos that are
complementary to specific mRNA so that the antisense
oligonucleotide may bind to the target mRNA and thus eliminate the
target mRNA.
[0007] Antisense molecules bind to complementary sequences of mRNA
through Watson-Crick base pairing. Antisense oligonucleotides
(AS-oligos) have been valuable in the functional study of a gene by
reducing gene expression in sequence specific manner (Thompson et
al. Nature, 314, 363-366 (1985); Melani et al. Cancer Res., 51,
2897-2901 (1991); Anfossi et al. Proc. Natl. Acad. Sci. USA, 86,
3379-3383 (1989)). Intense effort has also been made to develop
antisense anticancer agents that eliminate aberrant expression of
genes involved in tumor initiation and progression (Kamano et al.
Leuk. Res., 14, 831-839 (1990); Melotti et al. Blood, 87, 2221-2234
(1996); Ferrari et al. Cell growth Differ., 1, 543-548 (1990);
Ratajczak et al. Blood, 79, 1956-1961 (1992); Kastan et al. Blood,
74, 1517-1524 (1989); Thaler et al. Proc. Natl. Acad. Sci. USA, 93,
1352-1356 (1996); Wagner Nature, 372, 333-335 (1994)). Synthetic
AS-oligos have been widely utilized for their ease of design and
synthesis as well as potential specificity to a target gene.
Antisense inhibition of gene expression is believed to be achieved
either through RNaseH activity following the formation of antisense
DNA-mRNA duplex or through steric hindrance of the mRNA movement to
bind a ribosomal complex (Dolnick Cancer Invest., 9, 185-194
(1991)). There has also been an effort to inhibit gene expression
by employing oligonucleotides that form triple helix aimed at the
promoter region of the genomic DNA. Moreover, duplexed
oligonucleotide decoys that compete with the promoter region of
genomic DNA has also been formed (Young et al. Proc. Natl. Acad.
Sc. USA, 88, 10023-10026 (1991)). Efficacy of AS-oligos has been
validated in animal models as well as several recent clinical
studies (Offensperger et al. EMBO J., 12, 1257-1262 (1993); Tomita
et al. Hypertension, 26, 131-136 (1995); Nesterova et al. Nat.
Med., 1, 528-533 (1995); Roush Science, 276, 1192-1193 (1997)). In
addition, the first antisense drug was approved for CMV retinitis
in US and Europe.
[0008] Expectations for AS-oligos have, however, frequently met
with disappointment, as results have not always been unambiguous.
Some of the problems of using AS-oligos have been inaccessibility
to a target site (Flanagan et al. Mol. Cell Biochem., 172, 213-225
(1997); Matsuda et al. Mol. Biol. Cell, 7, 1095-1106 (1996)),
instability to nucleases (Akhtar et al. Life Sci., 49, 1793-1801
(1991); Wagner et al. Science, 260, 1510-1513 (1993); Gryaznov et
al. Nucleic Acids Res., 24, 1508-1514 (1996)), lack of sequence
specificity and various side effects in vivo. The stability of
AS-oligos has improved to a certain extent by using chemically
modified oligos, which are the so-called second generation
AS-oligos (Helene Eur J Cancer, 27(11),1466-71 (1991); Baker et al.
Biochim. Biophys. Acta., 1489, 3-18 (1999)). Phosphorothioate (PS)-
and methylphosphonate (MP)-oligos, have been exhaustively studied
and are utilized mainly to augment stability to nucleases. However,
each of the modified AS-oligos exhibit both lack of sequence
specificity and insensitivity to RNaseH. Further, there has been
concern over inadvertent introduction of mutations during DNA
replication or repair caused by recycling of hydrolyzed modified
nucleotides.
[0009] A series of distinct antisense molecules with enhanced
stability, the so-called `third generation AS-oligos`, having 1) a
stem-loop structure, 2) the CMAS (Covalently-closed Multiple
Antisense) structure and 3) the RiAS (Ribbon Antisense) structure
(Moon et al. Biochem J., 346, 295-303 (2000); Matsuda et al. Mol.
Biol. Cell, 7, 1095-1106 (1996); Moon et al. J Biol Chem., 275(7),
4647-53 (2000)) have been described. Both CMAS and
RiAS-oligonucleotides exhibit enhanced stability to exonucleases
and nucleases in biologic fluids. These antisense molecules are
also efficacious in the specific reduction of target mRNA. However,
there is a need in the art to develop an antisense molecule with
greater facility and enhanced binding efficiency.
[0010] Certain bacteriophages, such as M13 bacteriophage, have a
single-stranded circular genome, which has been employed for DNA
sequencing analyses as well as mutagenesis studies. M13 phagemid,
which is a plasmid used in the construction of a recombinant
bacteriophage, can be engineered to produce a large quantity of
circular single-stranded genomic DNA that contains an antisense
sequence to a specific gene. This approach for producing antisense
DNA takes advantage of the stability to exonucleases associated
with the covalently closed structure, high sequence fidelity,
elimination of laborious target site search and easy construction
of an antisense library.
[0011] Synthetic AS-oligos are about 15 to 25 bases long, and bind
only to a single target site and eliminate substrate mRNA. However,
most chronic and end stage human diseases show multiple genetic
disorders. Thus, antisense molecules that can target multiple genes
would appear to be more effective in treating such diseases. In
order to satisfy such a need, it would be attractive to devise an
antisense molecular system with multiple targeting ability.
However, synthesizing such molecules would not be practical because
of the difficulty chemically synthesizing them.
[0012] AS-oligos have a fundamental and inherent drawback for use
in functional genomics. First, chemically modified AS-oligos cause
nonspecific binding to irrelevant mRNA and as a result, they are
less effective and often cytotoxic to cells, which of course
creates false positive results. Second, synthetic AS-oligos, due to
their short size (usually 15 to 25 bases), may not be uniformly
effective in binding to their targets because they require a search
before effectively binding to their target mRNA. Third, there is a
possibility that an error in synthesis of AS-oligos decreases the
specificity of their binding. Fourth, production cost for AS-oligo
is high. And finally, when AS-oligos are used in functional
genomics, these AS-oligos sometimes show incomplete antisense
activity against their target mRNAs, thus generating unreliable and
ambiguous data.
[0013] Current functional genomics systems using DNA chip
technology, proteomics and so on are limited to providing gene
expression profiles. However, to perform definitive functional
analysis of genes, additional assays are required to be performed
downstream of a particular gene inactivation.
[0014] Thus, there is a need in the art for a gene
functionalization system to determine directly the functions of yet
uncharacterized genes on a large scale.
SUMMARY OF THE INVENTION
[0015] The claimed invention overcomes the above-mentioned
problems, and provides antisense molecules, compositions of
antisense molecules, a method of making the antisense molecules,
and a method of using the claimed molecules and compositions which
provide the advantage of inhibiting or significantly modifying the
expression of certain targeted genes. In the case that expression
of these targeted gene(s) is responsible for causing cancer, then
administering the inventive antisense molecules to the cells
results in the ablation of the target RNA, which will inhibit
proliferation of the cells, which in turn will result in curing or
at least improving the survival associated with the cancer.
[0016] Applicants have developed large circular nucleic acid
molecules that contain at least one target-specific antisense
region by using a phagemid vector having a single-stranded circular
genome. This large circular nucleic acid molecule may be called an
LC-antisense compound. In a particular embodiment of the invention,
applicants have constructed a phage genomic antisense library using
cDNA from diseased tissue. The random gene antisense library was
constructed unidirectionally. Further, in another embodiment of the
invention, the cDNA pool was subtracted for commonly expressed
genes in control cells. The random gene unidirectional antisense
library of the invention allows screening and analysis of the
functions of genes with speed and accuracy, thus high-throughput
and massive functional genomics systems are provided. Furthermore,
the present invention may be used for validating therapeutic
antisense compounds for chronic or incurable diseases.
[0017] Thus, in one aspect, the present invention is directed to a
massive functional genomics method using LC-antisense compounds.
LC-antisense compounds provide an effective platform for
functionalization of a large number of genes with previously
unknown functions and of genes with known and additional unknown
functions. In addition, the present invention also may be used for
the development of antisense molecular therapeutics and functional
diagnostic systems.
[0018] LC-antisense compounds show superior antisense activity even
with small doses as compared with conventional AS-oligos. Since
typically, LC-antisense compounds are derived from cloned cDNAs in
a phagemid vector, large single-stranded DNAs with target-specific
antisense regions are generated. Thus, due to the large size of the
molecule, LC-antisense compounds do not require a target site
search for effective antisense activity. LC-antisense molecules are
stable to exonucleases because they are covalently closed circular
molecules. In addition, antisense libraries can be constructed
relatively easily by introducing tens of thousands of different
genes or gene fragments into phagemid vectors all at once.
Large-scale generation of bacterially produced LC-antisense
compounds can be easily obtained at low cost. Finally, the
bacteriophage genomic antisense compound as applied to the area of
massive functional genomics provides speed, low cost, and
analytical accuracy.
[0019] It is to be understood that as the LC-antisense compounds
are used therapeutically, the invention is not limited to treating
cancer. The principles of the antisense compound of the invention
may be applied to efficiently ablate any target RNA. Any phenotypic
manifestation of this chemical activity in the form of cancer
treatment, eliminating adverse effects of viral infection, treating
metabolic diseases, immunologic disorders, and so on may be the
result of antisense molecular therapy.
[0020] The LC-antisense compounds chosen from a large antisense
library may be adapted to configure an antisense macroarray system.
The antisense macroarray system may be effectively utilized for
functional comparison of the antisense compounds among different
types of cells treated with the antisense compounds. Comparative
functional diagnostics as well as understanding the underlying
molecular mechanism of a disease may be performed by employing the
antisense macroarray assembly system of the invention.
[0021] A panel of antisense compounds used in the antisense
macroarray assembly may be chosen based on the results obtained
from either a primary functional assay using an antisense library
or from conventional expression profiling or expression tracking
system, such as DNA chip, SAGE, Toga and proteomics.
[0022] The invention further includes compositions of the claimed
antisense molecules together with a pharmaceutically acceptable
carrier. In one aspect of the invention the invention is directed
to a library of a multitude of single-stranded large circular
nucleic acids, said library comprising:
[0023] a multiplicity of compartments, each of said compartments
comprising one or more single-stranded large circular antisense
molecule of bacteriophage or phagemid vector comprising at least
one unidirectional antisense nucleic acid insert,
[0024] wherein said large circular antisense molecule is capable of
being introduced into a host cell, and is capable of specifically
binding to a nucleic acid in said host cell that is substantially
complementary to said antisense nucleic acid insert.
[0025] In the library discussed above, the specificity of the
antisense nucleic acid insert may be unknown at the time said
library is first made. Further, the host cell may be a eucaryotic
cell. And each compartment may contain from about 0.1 .mu.M to
about 1 .mu.M of the large circular antisense molecule, preferably
in an aqueous medium. The bacteriophage or phagemid vector may be
derived from a filamentous bacteriophage. And the filamentous
bacteriophage may be an M13 bacteriophage. Furthermore, the
bacteriophage or phagemid vector may comprise more than one kind of
antisense nucleic acid insert sequence. In addition, in the library
discussed above, the source of the nucleic acid insert may be an
eucaryotic organism.
[0026] The library may also contain multiple compartments, wherein
the compartments may be a multiwell format of, without limitation,
6 wells, or preferably, 96 wells. The library may be also
configured to be made and used in a substantially automated
process.
[0027] In another embodiment, the invention is directed to a method
of making a library comprising a multitude of single-stranded large
circular nucleic acids, which comprises one or more single-stranded
bacteriophage or phagemid vector comprising at least one
unidirectional antisense nucleic acid insert, comprising:
[0028] (i) inserting a nucleic acid fragment unidirectionally into
said bacteriophage or phagemid vector by unidirectionally cloning
the nucleic fragments into said vector;
[0029] (ii) preparing bacterial transformants by introducing the
vector containing the insert into competent bacterial cells to make
bacterial transformants; and
[0030] (iii) infecting said transformants with helper phage to
produce said single-stranded nucleic acid library.
[0031] In yet another embodiment, the invention is directed to a
library of a multitude of single-stranded large circular nucleic
acids, said library comprising:
[0032] a multiplicity of compartments, each of said compartments
comprising one or more single-stranded large circular antisense
molecule of bacteriophage or phagemid vector comprising at least
one unidirectional subtracted antisense nucleic acid insert,
[0033] wherein said large circular antisense molecule is capable of
being introduced into a host cell, and is capable of specifically
binding to a nucleic acid in said host cell that is substantially
complementary to said antisense nucleic acid insert.
[0034] In the library above, the unidirectional subtracted
antisense nucleic acid may be made by hybridizing a population of
nucleic acids expressed from a first cell line or tissue with a
population of nucleic acids expressed from a second cell line or
tissue, and obtaining a nucleic acid population from the first cell
line or tissue that does not hybridize with the nucleic acid
population from said second cell line or tissue.
[0035] In particular, the first cell line or tissue may be abnormal
such that modulation of gene expression is beneficial in returning
said first cell line or tissue to normal, and wherein said second
cell line or tissue is normal. The abnormality may be cancer, viral
infection, immunologic disorders or metabolic diseases. And cancer
may be liver cancer, lung cancer, stomach cancer, colon cancer,
leukemia, thyroid cancer, skin cancer, prostate cancer, cervical
cancer, or breast cancer. Viral infection may becaused by human
papilloma virus (HPV), HIV, small pox, mononucleosis (Epstein-Barr
virus), hepatitis, or respiratory syncytial virus (RSV). And
metabolic disease may be phenylketonuria (PKU), primary
hypothyroidism, galactosemia, abnormal hemoglobins, types I and II
diabetes, or obesity. Also in particular, the immunological
disorder may be Sjogren's Syndrome, antiphospholipid syndrome,
immune complex diseases, Purpura, Schoenlein-Henoch, immunologic
deficiency syndromes, systemic lupus erythematosus,
immunodeficiency, rheumatism, kidney, or liver sclerosis.
[0036] In still another embodiment, the invention is directed to a
method of making a library comprising a multitude of
single-stranded large circular nucleic acids, which comprises one
or more single-stranded bacteriophage or phagemid vector comprising
at least one unidirectional subtracted antisense nucleic acid
insert, comprising:
[0037] (i) inserting a subtracted nucleic acid fragment
unidirectionally into said bacteriophage or phagemid vector by
unidirectionally cloning the subtracted nucleic fragments into said
vector;
[0038] (ii) preparing bacterial transformants by introducing the
vector containing the insert into competent bacterial cells to make
bacterial transformants; and
[0039] (iii) infecting said transformants with helper phage to
produce said single-stranded nucleic acid library.
[0040] In the method above, the subtracted nucleic fragment may be
made by hybridizing a population of nucleic acids expressed from a
first cell line or tissue with a population of nucleic acids
expressed from a second cell line or tissue, and obtaining a
nucleic acid population from the first cell line or tissue that
does not hybridize with the nucleic acid population from said
second cell line or tissue.
[0041] In a further aspect, the invention is directed to a method
for specifically inhibiting growth of liver cancer cells,
comprising administering to said cells large circular antisense
molecules targeted to EST_Human IL3-UTO117-160301-504-H11;
Apolipoprotein A-II, clone MGC:12334; PRO2675 mRNA; clone
RP11-449G13 from 16; BAC clone RP11-360H4 from 2; gene supported by
AK023036 (LOC90271); or gene similar to cytochrome b5 outer
mitochondrial membrane precursor (H. sapiens) (LOC124229).
[0042] In yet a further aspect, the invention is directed to a
method for specifically inhibiting growth of liver cancer cells,
comprising administering to said cells large circular antisense
molecules targeted to HSPC025, clone MGC:4223 IMAGE:2959747; tissue
inhibitor of metalloproteinase 1; alpha-fetoprotein (AFP); gene
encoding protein FLJ14075; apolipoprotein A-II (APOA2); clone
MGC:20176 IMAGE:3503710; eukaryotic translation initiation factor
4A, isoform 2 (EIF4A2); cytochrome P450, subfamily IIE
(ethanol-inducible) (CYP2E); or gene similar to serine (or
cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase,
antitrypsin), member 1, clone MGC:9222 IMAGE:3859644.
[0043] The invention is also directed to a high throughput system
for functional genomics using a random gene unidirectional
antisense library or random gene unidirectional subtracted
antisense library comprising the following steps:
[0044] (i) forming large circular antisense molecule-carrier
complexes with said unidirectional or unidirectional subtracted
antisense libraries;
[0045] (ii) performing a primary gene functional analysis by
transfecting the complexes into host cells to screen for the large
circular antisense molecule that eliminates endogenously expressed
substantially complementary transcripts;
[0046] (iii) identifying the large circular antisense molecule that
eliminates the endogenously expressed transcript; and
[0047] (iv) sequencing either the antisense molecule or cDNA that
corresponds to the antisense molecule.
[0048] In the high throughput system described above, the system
may further comprise step (v) of performing further gene function
analysis with the large circular antisense molecule identified in
steps (iii) and (iv). Still further, comprising comparing the gene
sequence obtained in step (iv) with a DNA sequence database to
identify the gene.
[0049] The carrier may be, without limitation, liposomes, cationic
polymers, HVJ-liposomes complexes, peptides or viruses. Further, in
a specific embodiment, the large circular antisense molecule and
carrier may be mixed in an optimal ratio of about 1:3 to about 1:4
by weight.
[0050] In a specific embodiment of the invention, the gene function
analysis may be assaying for the phenotype of cell morphology, cell
proliferation, cell apoptosis, or cell reaction to a substrate. And
in particular, the gene function analysis may be carried out by
performing an assay, wherein said assay is RT-PCR, Western blot
analysis, immunoassay, MTT reduction assay, [.sup.3H]-thymidine
incorporation assay, colony formation assay, DNA synthesis and
chromatin activation, analysis of apoptosis by inspection of cell
morphological changes, chromosomal condensation or fragmentation,
DNA fragmentation, quantitative assay for apoptosis, signaling
mechanisms of apoptosis, activation of cell cycle regulators,
complex formation between cell cycle regulators, or assays for
changes of metabolic, morphological, physiological and biochemical
phenotypes in vitro and in vivo.
[0051] These and other objects of the invention will be more fully
understood from the following description of the invention, the
referenced drawings attached hereto and the claims appended
hereto.
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] The present invention will become more fully understood from
the detailed description given herein below, and the accompanying
drawings which are given by way of illustration only, and thus are
not limitative of the present invention, and wherein;
[0053] FIG. 1 shows a schematic diagram for generating rat
TNF.alpha.-M13 antisense molecule (TNF.alpha.-M13AS).
[0054] FIG. 2 shows sequence analysis of TNF.alpha.-M13AS
confirming the antisense nature of the TNF-.alpha. insert.
[0055] FIG. 3A shows the results of treating TNF.alpha.-M13AS with
various enzymes. TNF.alpha.-M13AS was confirmed to be
single-stranded. Lane 1: Plasmid DNA containing TNF.alpha.-cDNA
(TNF.alpha.-plasmid); Lane 2: TNF.alpha.-M13AS; Lane 3:
TNF.alpha.-plasmid digested with Xho I; Lane 4: TNF.alpha.-M13AS
digested with Xho I; Lane 5: TNF.alpha.-plasmid digested with S1
nuclease; Lane 6: TNF.alpha.-M13AS digested with S1 nuclease; Lane
7: TNF.alpha.-plasmid digested with Xho I and exonuclease III; and
Lane 8: TNF.alpha.-M 13AS digested with Xho I and exonuclease
III.
[0056] FIG. 3B shows the stability of TNF.alpha.-M13AS to
nucleases. Lane 1: TNF.alpha.-plasmid; Lane 2: TNF.alpha.-M13AS;
Lane 3: TNF.alpha.-plasmid+FBS; Lane 4: TNF.alpha.-plasmid digested
with Xho I+FBS; Lane 5: TNF.alpha.-M13AS+FBS; Lane 6: TNF.alpha.-M
13AS and liposome complex+FBS; Lane 7: TNF.alpha.-plasmid+calf
serum; Lane 8: TNF.alpha.-plasmid digested with Xho I+calf serum;
Lane 9: TNF.alpha.-M13AS+calf serum; and Lane 10: TNF.alpha.-M13AS
and liposome complex+calf serum.
[0057] FIG. 4A shows the results of RT-PCR using a
TNF.alpha.-specific primer pair and a .beta.-actin specific primer
pair. Rat TNF-.alpha. expression was specifically inhibited by
TNF.alpha.-M13AS of the present invention. Lane 1: Liposome; Lane
2: TNF.alpha.-M13AS; Lane 3: TNF.alpha.-M13 sense; and Lane 4:
Single-stranded phage genomic DNA without rat TNF-A cDNA.
[0058] FIG. 4B shows the results of amplifying IL-1.beta. and GAPDH
transcripts by RT-PCR, confirming that TNF.alpha.-M13AS
specifically inhibits the expression of rat TNF-.alpha.. Lane 1:
Liposome; Lane 2: TNF.alpha.-M13AS; Lane 3: TNF.alpha.-M13 sense;
and Lane 4: Single-stranded phage genomic DNA without rat
TNF-.alpha. sequence.
[0059] FIG. 4C shows Southern blot data using rat TNF-.alpha.
specific hybridization probe, confirming that TNF.alpha.-M 13AS
specifically inhibits the expression of rat TNF-.alpha.. Lane 1:
Liposome; Lane 2: TNF.alpha.-M13AS; Lane 3: TNF.alpha.-M13 sense;
and Lane 4: Single-stranded phage genomic DNA without rat
TNF-.alpha. cDNA.
[0060] FIG. 5 shows ELISA assay data that measure the quantity of
rat TNF-.alpha. protein secreted from cells. The data show that rat
TNF-.alpha. protein expression decreases in response to
administration of TNF.alpha.-M13AS.
[0061] FIG. 6A shows RT-PCR results confirming that endogenous
NF-.kappa.B expression decreases in response to administration of
NF.kappa.B-M13AS.
[0062] FIG. 6B shows confirmatory Southern blot results using an
NF-.kappa.B specific probe. Data confirm that human NF-.kappa.B
expression decreases in response to administration of
NF.kappa.B-M13AS.
[0063] FIG. 7 shows a schematic diagram of a high-throughput system
for functional genomics using a random gene unidirectional
antisense library.
[0064] FIG. 8 shows a schematic diagram of gene functionalization
method using random gene unidirectional antisense library.
[0065] FIG. 9 shows a strategy for constructing a random gene
unidirectional antisense library.
[0066] FIG. 10 shows a strategy for constructing a random gene
unidirectional subtracted antisense library.
[0067] FIG. 11 shows the quality of the unidirectional subtracted
liver cDNA library. To determine the percentage of vectors with
cDNA inserts, 40 randomly selected recombinant phagemid clones were
purified and digested with Not I and Xho I, and electrophoresed on
a 1% agarose gel.
[0068] FIG. 12 shows sample sequence analyses of the unidirectional
subtracted liver cDNA library. The cDNA regions in pBluescript
(pBS) SK(-) were sequenced from the 5' end of the (+) strand by
employing T3 primer. Each cDNA sequence was compared with Genbank
database.
[0069] FIG. 12A shows human RBP 56/hTAF II (human RBP 56/hTAF II)
gene insert.
[0070] FIG. 12B shows the .alpha.-fetoprotein gene insert.
[0071] FIG. 12C shows Homo sapiens chromosome 17, clone hC gene
insert.
[0072] FIG. 13 shows selection of cDNA clones having insert sizes
above 500 bases by `cracking` method, which is a type of multiple
mini-scale plasmid preparation method. Recombinant phagemid with
500 bp of cDNA was used as a control.
[0073] FIG. 14 shows a random gene unidirectional subtracted liver
antisense library comprising LC-antisense compounds derived from
clones selected by the `cracking` method.
[0074] FIGS. 15A-15I show inhibition of cell proliferation of liver
cancer cells (HepG2) after transfection with LC-antisense
compound-carrier complexes. This is an example of primary
functional analysis of genes. Changes in cell proliferation were
observed by visual observation using light microscopy (original
magnification, X200) after 4th day of transfection. FIGS. 15A-15C
show negative control cells. FIGS. 15D-15I show HepG2 cells treated
with LC-antisense compounds.
[0075] FIG. 16 shows massive gene functionalization using random
gene unidirectional subtracted liver antisense library. The liver
cancer cell line (HepG2) was transfected with either an
LC-antisense compound-carrier complex or control carrier compounds
in a 96-well plate. MTT assay was carried out to observe changes in
cell proliferation. Genes related to liver cancer cell growth were
identified by calculating the percentage of growth inhibition.
[0076] FIGS. 17A-17D show massive gene functionalization using a
random clone number 1 from random gene unidirectional subtracted
liver antisense library. Measurement of cell growth inhibition of
HepG2 was performed by observation with light microscopy (FIGS. 17A
and 17C), MTT assay (FIG. 17B) and [H]-thymidine incorporation
assay (FIG. 17D).
[0077] FIGS. 18A-18D show gene functionalization using a random
clone number 2 from random gene unidirectional subtracted liver
antisense library. Measurement of cell growth inhibition of HepG2
was performed by observation with light microscopy (FIGS. 18A and
18C), MTT assay (FIG. 18B) and [.sup.3H]-thymidine incorporation
assay (FIG. 18D).
[0078] FIG. 19 shows antisense activity profile of an example of
LC-antisense compound designated clone number 3 to various kinds of
cancer cells. A macroarray comprising LC-antisense compounds to 80
identified gene clones involved in the cell growth of liver cancer
was transfected via a pharmaceutically accepted carrier into
different cancer cell lines, Hep3B (liver cancer), NCI-HI299
(non-small lung cancer), AGS (stomach cancer) and HT-29 (colon
cancer). Cell growth was measured using MTT assay on a macroarray
assembly, and data were compared to study the antisense activity
profile of these LC-antisense compounds.
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0079] The present invention is based on the discovery that a large
circular phage genomic molecule that includes a target specific
antisense region, is useful as an effective ablator of gene
expression, and as such can be used to determine the function of a
target gene. The inventive system can be used in a high-throughput
manner in a massive functional genomics protocol to determine genes
involved in various cellular physiological processes.
[0080] In particular, the present invention provides LC-antisense
compounds derived from recombinant bacteriophage genome and methods
for preparing them. The present invention also provides at least
two kinds of antisense libraries. One is unidirectional antisense
library and another is unidirectional subtracted antisense library,
both of which may be constructed using bacteriophage genome
antisense vectors. Additionally, the present invention provides a
high-throughput system for functional genomics using the antisense
libraries.
[0081] In the present application, "a" and "an" are used to refer
to both single and a plurality of objects.
[0082] As used herein, the term "antisense" means antisense nucleic
acid (DNA or RNA) and analogs thereof and refers to a range of
chemical species having a range of nucleotide base sequences that
recognize polynucleotide target sequences or sequence portions
through hydrogen bonding interactions with the nucleotide bases of
the target sequences. The target sequences may be single- or
double-stranded RNA, or single- or double-stranded DNA.
[0083] Such RNA or DNA analogs comprise but are not limited to
2'-O-alkyl sugar modifications, methylphosphonate,
phosphorothioate, phosphorodithioate, formacetal,
3'-thioformacetal, sulfone, sulfamate, and nitroxide backbone
modifications, amides, and analogs wherein the base moieties have
been modified. In addition, analogs of molecules may be polymers in
which the sugar moiety has been modified or replaced by another
suitable moiety, resulting in polymers which include, but are not
limited to, morpholino analogs and peptide nucleic acid (PNA)
analogs. Such analogs include various combinations of the
above-mentioned modifications involving linkage groups and/or
structural modifications of the sugar or base for the purpose of
improving RNaseH-mediated destruction of the targeted RNA, binding
affinity, nuclease resistance, and or target specificity.
[0084] As used herein, "antisense therapy" is a generic term, which
includes specific binding of large circular antisense molecules
that include an antisense segment for a target gene to inactivate
undesirable target DNA or RNA sequences in vitro or in vivo.
[0085] As used herein, "cell proliferation" refers to cell
division. The term "growth," as used herein, encompasses both
increased cell numbers due to faster cell division and due to
slower rates of apoptosis, i.e. cell death. Uncontrolled cell
proliferation is a marker for a cancerous or abnormal cell type.
Normal, non-cancerous cells divide regularly, at a frequency
characteristic for the particular type of cell. When a cell has
been transformed into a cancerous state, the cell divides and
proliferates uncontrollably. Inhibition of proliferation or growth
modulates the uncontrolled division of the cell.
[0086] As used herein, "chimeric large circular antisense molecule"
refers to a large circular nucleic acid molecule comprising a
plurality of antisense nucleotide segments that are substantially
complementary to a plurality of target genes. The segments of
antisense nucleotides may be connected or linked to each other
directly or indirectly by use of spacers between each segment.
[0087] As used herein, "compartment" or "compartments" refers to a
physical delineation of each member clone of the LC-antisense
molecular library. Physical delineation may be in the form of wells
such as in multiwell plates. Commonly used are 96 well plates or 96
deep well plates. Another physical barrier may be air, such as by
individual spotting on a flat sheet or membrane. In this regard,
either macroarray or microarray methods may be used. It is
understood that by compartmentalization it is meant that the clone
members are separated from each other. Other barriers may be by
encapsulation of individual clones in a membranous material, and
the like.
[0088] As used herein, "filamentous phage" is a vehicle for
producing the large circular antisense molecule of the invention.
Phages or phagemids may be used. In this instance, the desired
sequence is inserted or cloned into the vehicle so that when a
single strand is generated by the phage or phagemid, the large
circular antisense molecule is generated. DNA or RNA bacteriophage
may be used for this purpose. In particular, filamentous
bacteriophage may be used. Filamentous phages such as M13, fd, and
fl have a filamentous capsid with a circular ssDNA molecule. Their
life-cycle involves a dsDNA intermediate replicative form within
the cell which is converted to a ssDNA molecule prior to
encapsidation. This conversion provides a means to prepare ssDNA.
The bacteriophage M13 has been adapted for use as a cloning
vector.
[0089] Phagemid vectors also have filamentous phage fl Ori region.
pBluescript (Stratagene, USA), pGEM-f (Promega, USA), M13mp,
pCR2.1, pGL2, p.beta.gal and pSPORT vector and their derivatives
may be used. Preferentially, the phagemid vector of M13
bacteriophage, pBluescript SK(-), may be used. One advantage of
using a recombinant viral vector based on M13 bacteriophage is that
the vector can accomodate a variety of sizes of antisense inserts.
Because pBluescript SK(-) phagemid vector has fl(-) origin, the
entire nucleotide sequence comprising the antisense form of the
target nucleotide sequence and vector originated genes, for
example, the ampicillin resistance gene and the lacZ gene, are
expressed in a single-stranded form.
[0090] Another bacteriophage having single-stranded circular genome
and having an icosahedral shape is .PHI.DX174. However, this
cloning vector has a limitation on the insert size .
[0091] As used herein, "functional genomics" or "massive functional
genomics" refers to the scientific discipline and utility in
biotechnology in which the functions of genes are experimentally
determined and identified. If this process is performed with
rapidity, in parallel, and in great quantities, it may be termed
"high-throughput" or "massive" functional genomics.
[0092] As used herein, the terms "inhibiting" and "reducing" are
used interchangeably to indicate lowering of gene expression or
cell proliferation or any other phenotypic characteristic.
[0093] As used herein, "large circular antisense molecule
(LC-antisense molecule)" also referred to as "phage genomic
antisense molecule", or sometimes "large circular nucleic acid
molecule", is a single-stranded molecule, which includes at least
one antisense region that is substantially complementary to and
binds a target gene or RNA sequence, which inhibits or reduces
expression of the gene as well as, in some instances, its isoforms.
The circular single-stranded nucleic acid molecule may contain
either sense or antisense sequence for one or several genes, so
long as the sequence for the target gene is in the antisense
form.
[0094] Large circular nucleic acid molecule may be synthesized by
chemical methods. Typically, however, it is produced from a
filamentous phage system, which includes M13 and phagemids that are
derived from it. When the large circular nucleic acid molecule is
generated from a phage, it may also be referred to as a "phage
genomic antisense compound".
[0095] In one sense, the large circular nucleic acid molecule is
longer than a typical oligonucleotide sequence that may be about 20
to 30 nucleotides long. In contrast, the large circular nucleic
acid molecule may be at least 3,000 nucleotides long. Typically,
the range may be from about 3,000 to about 8,000 nucleotides long.
Although a length of about 3,100 to about 7,000 nucleotides may be
useful in the invention, preferred length range may be from about
3,300 to about 6,000 bases.
[0096] Alternatively, it is understood that there does not have to
be an absolute upper or lower limit to the length of the large
circular nucleic acid molecule. This is especially so when a phage
is used to generate the large circular nucleic acid molecule, in
which case the size of the phage and the size of the insert that
encodes at least a portion of the target gene may control the
length of the single-stranded nucleic acid generated. Thus, in one
embodiment, the nucleic acid molecule may be as long as a phage
such as a filamentous phage may accommodate.
[0097] The large circular nucleic acid molecule may contain both
the specific antisense sequence as well as extraneous sequence.
Extraneous sequence may include sense or antisense forms of various
other genes. Or, if a phage is used to generate the nucleic acid
molecule, the extraneous sequence may be the vector sequence. The
length of the target specific antisense region of the large
circular nucleic acid molecule may be without limitation from a bit
lower than about 100 nucleotides to over about 5,000 bases.
Typically, the range may be from about 200 to about 3,000. In
particular, the range may be about 400 to about 2,000. The target
specific antisense region may be also complementary to an entire
gene.
[0098] In another embodiment, the antisense molecule may be
generated from the genome of a bacteriophage as part of the natural
life cycle of the phage.
[0099] As used herein, "macroarray" refers to a selected set of
LC-antisense compounds, which can be employed to examine functional
profile of the antisense molecules in different types of cells or
cell lines.
[0100] As used herein, a "gene" refers either to the complete
nucleotide sequence of the gene, or to a sequence portion of the
gene.
[0101] As used herein, "substantially complementary" means an
antisense sequence having about 80% homology with an antisense
compound which itself is complementary to and specifically binds to
the target RNA. As a general matter, absolute complementarity may
not be required. Any antisense molecule having sufficient
complementarity to form a stable duplex or triplex with the target
nucleic acid is considered to be suitable. Since stable duplex
formation depends on the sequence and length of the hybridizing
antisense molecule and the degree of complementarity between the
antisense molecule and the target sequence, the system can tolerate
less fidelity in complementarity with large circular antisense
molecule.
[0102] As used herein, "unidirectional subtracted library" refers
to a library that is selectively enriched for genes that are
expressed or overexpressed in a particular tissue or cell line of
interest as compared with a control tissue or cell line.
[0103] As used herein, "target" or "targeting" refers to a
particular individual gene for which an antisense molecule is made.
In an embodiment of the invention, the antisense molecule is made
from an insert in a LC-antisense compound. In certain contexts,
"targeting" means binding or causing to be bound the antisense
molecule to the endogenously expressed transcript so that target
gene expression is eliminated. The target nucleotide sequence may
be selected from genes involved in various malignancies, including
genes involved in the initiation and progression of various
diseases such as immune diseases, infectious diseases, metabolic
diseases and hereditary diseases or any other disease caused by
abnormal expression of genes.
[0104] As used herein, "unidirectional" or "random gene
unidirectional" antisense library refers to the uniformity of
orientation of the insert genes in each member clone in the gene
library. By the term "random", it is meant to refer to a library
that contains genes of unverified sequence.
[0105] Large Circular (LC) Antisense Compounds
[0106] The present invention provides LC-antisense compounds having
enhanced stability to nucleases and specific activity, and a method
for producing the LC-antisense compounds by using recombinant
bacteriophages with single-stranded circular genome. Further, in
one embodiment of the invention, by employing the phage genomic
antisense method of the invention, the efficiency of the system as
used in massive functional genomics is superior by several hundred
fold to that of conventional AS-oligos method. Moreover, contrary
to using other indirect systems, such as DNA chip, Serial Analysis
of Gene Expression (SAGE), and TIGR Orthologous Gene Alignment
(TOGA) database proteomics, massive functional genomics employing
the inventive phage genomic antisense system employs a direct gene
functionalization system.
[0107] The LC-antisense compounds of the present invention may be
made by 1) preparing a cDNA fragment having a target nucleotide
sequence; 2) preparing a recombinant phage by cloning the cDNA
fragment in a phagemid vector that is capable of producing a
LC-antisense compound; and 3) producing the single-stranded
circular phage genome containing the target antisense sequence in a
large scale manner.
[0108] It is understood that the LC-antisense compounds may
comprise either fragments of a target sequence or the entire gene
sequence. Also, it is contemplated that several target antisense
sequences for a plurality of different genes may be inserted into
one single-stranded phage genome.
[0109] LC-antisense compounds have strong replication fidelity
because the compound is replicated by DNA polymerase in bacterial
cells. Since DNA polymerase has proof reading capabilities, the
fidelity of LC-antisense compound is greater than chemically
synthesized AS-oligos. Moreover, LC-antisense compounds of the
present invention are cheaper to make than the chemically
synthesized oligonucleotides. High cost required for the synthesis
of high quality AS-oligos has been regarded as an obstacle for
preclinical and clinical trials.
[0110] LC-antisense compounds are stable against nucleases, and are
target specific. In contrast, when chemically modified
oligonucleotides are introduced to the cells, mutations as well as
retardation of blood clotting or complement activation reaction are
induced. Additionally, when the chemically synthesized
oligonucleotides are eventually degraded, the individual
nucleotides are recycled back into the genomic DNA through DNA
replication or repair mechanisms. Incorporation of the chemically
modified nucleotides into genomic DNA will likely cause
mutations.
[0111] Without being bound by any particular theory regarding why
the LC-antisense compounds have these advantageous properties, it
is believed that when a large target-specific antisense sequence
such as the LC-antisense compound of the invention is used,
searching for an open site along the target mRNA is likely to be
easily achieved.
[0112] In exemplified embodiments of the invention, LC-antisense
compounds against TNF-.alpha. and NF-.kappa.B were prepared. Each
of these LC-antisense compounds was about 3.7 kb in size and was
stable to nuclease degradation. The TNF-.alpha. specific insert was
708 bp, and was effective in ablating TNF-.alpha. gene expression.
The NF-.kappa.B specific insert was 700 bp, and it too was
effective in ablating NF-.kappa.B gene expression. This presents a
significant advantage over using chemically synthesized
oligonucleotides, which require a careful and laborious process of
determining the effective target sites. Thus, the LC-antisense
compound is facile to use and saves time and effort associated with
searching for effective target sites.
[0113] In addition, the efficiency of the liposome mediated
delivery of LC-antisense compounds is close to that of a plasmid
because of its sufficiently long sequence, which contributes to the
excellent antisense activity associated with LC-antisense
compounds. The rate of cellular uptake of LC-antisense
compound-lipsome complex was better than the rate of uptake of
oligonucleotides.
[0114] LC-antisense compounds generally include the target
antisense sequence and either antisense or sense form of the
nucleotide sequences of the vector encoded genes such as ampicillin
resistance gene and .beta.-galactosidase gene (lacZ). However,
LC-antisense compounds did not cause any significant amount of
non-specific inhibition of gene expression. In contrast, chemically
modified synthetic oligonucleotides cause significant problems
associated with non-specific inhibition.
[0115] Regarding the size of the antisense molecule, conventional
wisdom in the field of antisense research has discouraged using
long antisense molecules because it was thought that longer
AS-oligos tend to be less specific, harder to synthesize and
inefficient in cellular uptake. Indeed, chemically modified second
generation AS-oligos such as phosphorothioate modified oligos lose
sequence specificity as the length of the AS-oligos is extended.
Furthermore, synthesis of linear AS-oligos becomes increasingly
difficult as the oligonucleotides are extended to longer sequences,
and sequence fidelity declines markedly as the length of the
AS-oligos increases. However, in contravention of this teaching,
applicants have discovered that antisense activity is dependent on
the length of the antisense sequence. If the length of the
antisense sequence is decreased, the antisense activity also
decreases. Thus, LC-antisense compounds exhibit sequence
specificity, resistance to nuclease degradation, and
non-toxicity.
[0116] Some of the significantly advantageous features of
LC-antisense compounds are as follows:
[0117] 1. LC-antisense compounds have an improved antisense
activity. Typically, without being limited by any specified amount,
which amounts are offered herein as merely being exemplary of the
practice of the invention, administration of approximately
1.times.10.sup.5 cells with 0.1 .mu.g of the antisense compound can
achieve complete ablation of the target transcript. In addition,
the antisense sequence may be less than one fifth the size of the
entire length of the transcript. LC-antisense molecule has high
antisense activity with respect to the amount of antisense compound
that is administered.
[0118] 2. LC-antisense compounds can be produced massively with
speed, accuracy and cost effectiveness from a bacterial
transformant, such as E. coli.
[0119] 3. The LC-antisense compound-carrier complex is easily
absorbed by cells.
[0120] 4. LC-antisense compounds are stable against nucleases in
serum and can form stable complexes with liposomes.
[0121] 5. LC-antisense compounds are replicated by DNA polymerase
in bacterial cells such as E. coli.
[0122] 6. Ablation of multiple target mRNA is achievable. A
chimeric LC-antisense compound may contain a plurality of
target-specific antisense sequences in a single vector. The length
of each of the antisense sequences may be typically much longer
than those of chemically modified antisense oligonucleotides.
Several distinct antisense sequences can be located in series.
Therefore, it is possible to target multiple types of transcripts
of several different genes. This property can be of use in
eliminating expression of multiple genes in incurable diseases such
as advanced types of cancer exhibiting aberrant gene expression of
multiple genes.
[0123] 7. LC-antisense compounds show low toxicity. Since
LC-antisense compounds are composed of the same base composition
found in nature, non-specificity and undesired toxic effects are
reduced when compared with chemically modified AS-oligos.
[0124] 8. A random gene or unigene unidirectional antisense library
can be easily constructed. Construction of an antisense library
with a large number of individual clones may be performed easily
and rapidly. A random gene unidirectional antisense library
specific to a particular disease can be easily constructed from
diseased cells or abnormal cells or tissue. Thus, the random gene
antisense library may comprise antisense molecules to
disease-specific genes. The member antisense compounds initially
are not individually verified for their DNA sequences, and thus,
some clones may be redundant. Meanwhile, a unigene antisense
library of the entire panel of human genes or genes of other
organisms may be rather extensive and constructed without
redundancy among its member antisense compounds. These antisense
libraries may include thousands or tens of thousands of cloned
genes that may be employed for efficiently performing massive gene
functionalization by knock-down of gene expression in particular
cell types. In contrast, a significant drawback of using synthetic
AS-oligos is the time-consuming requirement for the selection of a
target site. Another drawback to using conventionally known
AS-oligos is that its data can be misinterpreted because partial
antisense activity sometimes occurs.
[0125] Random Gene Unidirectional Antisense Library
[0126] The present invention provides methods for the construction
of a unidirectional antisense library and a random gene
unidirectional subtracted antisense library using the phage genome.
For constructing the antisense libraries, both randomly selected
genes from a cDNA library and sequence-verified `unigenes` are
available as cDNA source.
[0127] Without being limited to using any particular phage system,
in one embodiment, LC-antisense compounds are produced massively
from a bacterial culture containing recombinant bacteriophages. For
this purpose, the present inventors cloned cDNA fragments into the
multi-cloning site of the M13 phagemid. Competent bacterial cells
were then infected with helper phages to rescue LC-antisense
compounds.
[0128] A representative procedure for constructing a random gene
unidirectional antisense library is as follows, with the
understanding that specific embodiments and exemplifications are
presented without limiting the invention in any way thereby:
[0129] (1) preparing RNA from a cell of interest, in particular,
disease-related cell line or tissue;
[0130] (2) synthesizing first and second strand cDNA by reverse
transcription using the RNA as the template. The second strand cDNA
is synthesized from the first strand cDNA. The first strand cDNA is
reverse-transcribed from purified poly(A)+mRNA using an oligo-dT
primer that has a restriction enzyme site (Xho I);
[0131] (3) preparing a recombinant M13 bacteriophage by cloning the
cDNA fragment into a phagemid vector. EcoR I adaptors are connected
to the terminal region of the synthesized cDNA to introduce a
restriction enzyme site (EcoR I). The EcoR I/Xho I fragment is
produced by digesting with EcoR I and Xho I. Recombinant phages are
prepared by cloning the cDNA fragments into the dephosphorylated
pBluescript SK(-) vector. Phagemid vectors containing the F1
replication origin of the filamentous phage were employed for cDNA
cloning depending on experimental needs. These include pUC, M13mp,
pBlueScript II, pCR2.1, pGEM-f, pGL-2, p.beta.gal, pSPORT and their
derivatives;
[0132] (4) preparing bacterial transformants by introducing the
recombinant M13 phagemid into competent bacterial cells. Bacterial
cells such as Escherichia coli, and XL-10 GOLD (Stratagene) may be
used. Cells may be made competent by treatment with calcium
chloride; and
[0133] (5) constructing a random gene unidirectional antisense
library by coinfecting the transformants with helper phage,
resulting in mass production of LC-antisense compounds (FIG. 9).
All phagemid vectors with the F1 (+) or F1 (-) origin are able to
produce LC-antisense compounds. The pBluescript II SK(-) phagemid
used in the present invention can produce LC-antisense compounds by
unidirectional cloning of cDNA fragments into the cloning site cut
by EcoR I/Xho I.
[0134] Random Gene Unidirectional Subtracted Antisense Library
[0135] The present invention also provides a random gene
unidirectional subtracted antisense library employing the phage
genome. The library may be constructed according to the following
representative method, with the understanding that specific
embodiments and exemplifications are presented without limiting the
invention in any way thereby:
[0136] (1) preparing RNA from a cell of interest, and in
particular, disease-related cell line or tissue, and synthesizing
tester cDNA by reverse transcription using the RNA as template;
[0137] (2) preparing RNA from a cell of interest, and in
particular, normal cell line or tissue, and synthesizing driver
cDNA by reverse transcription using the RNA as template. The tester
and driver cDNAs are synthesized from poly (A+) RNA of diseased and
normal cells, respectively, by using oligo-dT primers with Xho I
recognition site;
[0138] (3) separating the tester cDNAs into two groups, and
ligating to the ends of the cDNAs belonging to one group an adaptor
1 double-stranded oligonucleotide containing a sequence recognized
by a restriction enzyme, and ligating to the ends of the cDNAs
belonging to the other group an adaptor 2 double-stranded
oligonucleotide containing a sequence recognized by a different
restriction enzyme;
[0139] (4) hybridizing (first hybridization) the driver cDNAs to
both groups of tester cDNAs, thus subtracting away the commonly
expressed tester cDNAs that have hybridized to the driver
cDNAs.
[0140] (5) hybridizing (second hybridization) the remaining
unhybridized tester cDNAs from both groups of the first
hybridization by mixing the cDNAs from both groups together, and
amplifying by PCR the newly hybridized cDNAs to which are bound
both adaptor 1 and adaptor 2;
[0141] (6) preparing recombinant M13 phagemid by cloning the
subtracted cDNA fragments into a phagemid vector;
[0142] (7) preparing transformants by introducing the recombinant
M13 phagemid into competent bacterial cells; and
[0143] (8) constructing a random gene unidirectional subtracted
antisense library by producing a large number of circular
single-stranded molecules containing insert antisense sequence as a
part of the phage genomic DNA (FIG. 10).
[0144] A subtractive hybridization method was used as described in
Diachenko et al., Proc. Natl. Acad. Sci., 93:6025-6030, 1996, which
reference is incorporated by reference herein in its entirety.
[0145] In one embodiment of the invention, the tester cDNAs (from
diseased cells) and driver cDNAs (from normal cells) are digested
with Rsa I, a four-base cutting restriction enzyme, to yield blunt
ends before the adaptors are ligated. For the first hybridization,
an excess of driver cDNAs is added to each group of tester cDNAs.
The samples are then heat denatured and allowed to anneal.
[0146] In the second hybridization between the tester cDNAs from
the two groups, the two first hybridization samples are mixed
together without denaturing. These new hybrids are composed of a
strand from the cDNA from each group. Therefore, these hybrids are
double-stranded tester molecules that have adaptors 1 and 2. The
entire population of molecules is then subjected to PCR to amplify
these differentially expressed sequences using primers that are
complementary to both of the adaptor sequences.
[0147] For preparing the cDNA inserts, the Not I site on adaptor 1
and the Xho I site on adaptor 2 may be used for site-specific
cloning. The amplified cDNAs are digested with Not I and Xho I and
ligated unidirectionally into pBluescript SK(-) vector.
[0148] Competent bacterial cells were transformed with the
recombinant phagemid generally by the calcium-chloride method. The
transformants were cultured and infected with helper phage to
produce LC-antisense compounds. The obtained LC-antisense compounds
were purified and then arrayed in multi-well plates to form an
antisense library. Thus, LC-antisense molecules of differentially
overexpressed genes in disease related cells were selectively
obtained.
[0149] Massive Functional Genomics
[0150] The present invention also provides a high-throughput system
for functional genomics using the random gene unidirectional
antisense library and the random gene unidirectional subtracted
antisense library discussed above. The functional genomics system
of the present invention may be used to rapidly and massively
search for gene function. Thus, the antisense library may be used
not only for analyzing gene function but it may be used also for
target validation as well as for determining the interrelationships
among different gene products.
[0151] One of the advantages of using the phage genomic library for
functional genomics is that it is not necessary to perform a
preliminary expression profiling or to use a large number of
unnecessary antisense compounds that are not specific to the type
of cells used. This means that a panel of LC-antisense compounds
that are specific for a particular type of cells may be used for
target specific knock-down of relevant gene expression at least
temporarily on a massive and parallel scale to determine genes that
are responsible for a change in phenotype that is being assayed.
Thus, effective antisense macroarray configurations are
possible.
[0152] The LC-antisense library may be applied to a single cell
type for functional assays. A panel of antisense compounds used in
an antisense macroarray may be chosen based on results obtained
from either a primary functional assay using the antisense library
or from a conventional expression profiling or expression tracking
system, such as DNA chip, SAGE, Toga or proteomics.
[0153] The LC-antisense compounds that are chosen for their
function from a large antisense library may be adapted to configure
an antisense macroarray. The antisense macroarray may be
effectively utilized for functional comparison of the antisense
compounds among different types of cells treated with the antisense
compounds. Comparative functional diagnostics as well as
understanding the underlying molecular mechanism of a disease may
be performed by employing the inventive antisense macroarray
system.
[0154] A representative massive functional genomics protocol may be
as follows, with the understanding that specific embodiments and
exemplifications are presented without limiting the invention in
any way thereby:
[0155] (1) constructing a cDNA library using a recombinant
bacteriophage vector with a single-stranded genome;
[0156] (2) identifying and selecting cDNA clones with insert sizes.
Preferably, the insert size is over 500 bases. `Cracking` method
for multiple mini-scale plasmid preparation may be used;
[0157] (3) amplifying the selected clones and constructing a random
gene unidirectional antisense library. Selected phagemid
transformants are infected with helper bacteriophages and
single-stranded phage genomic antisense compounds are subsequently
harvested from culture supernatants;
[0158] (4) forming LC-antisense compound-carrier complexes;
[0159] (5) assaying for a function (primary functional assay) by
positioning the LC antisense compound-carrier complexes in
multi-well culture plates; and
[0160] (6) characterizing the function of genes using the antisense
library and identifying the genes by DNA sequencing and
subsequently comparing the obtained sequence with a sequence
database. Further confirmation of gene function is carried out for
the genes identified from the primary functional genomics assay
(FIG. 7).
[0161] The cDNA library may be constructed in the same way as
mentioned earlier for the construction of the random gene
unidirectional and random gene unidirectional subtracted antisense
libraries. Nucleotide sequence of individual members of the phage
genomic antisense library has a poly(T) patch at the 5' end of the
antisense insert. To prevent nonspecific binding of the poly(T)
tail, masking oligos composed only of poly(A) sequences are allowed
to bind to the poly(T) tail prior to cellular uptake of the
antisense compounds. In this case, the masking oligos should have a
minimum length of 10 bases to secure stable binding and should be
phosphorothioate-capped at both ends of the molecules to improve
the stability of the oligos.
[0162] Alternatively, the cDNA clones are digested with restriction
enzymes or amplified with PCR using a pair of specific primers,
thus eliminating the poly(A) tail. The amplified cDNA fragment is
then cloned in a predetermined direction into a phagemid
vector.
[0163] Recombinant phagemid clones with inserts more than the
preferred size are selected using cracking or other multiple
mini-scale DNA preparation methods (FIG. 13). A representative
plasmid DNA preparation method may be as follows:
[0164] a) harvesting cells transformed with the clones from the
cDNA library;
[0165] b) separating recombinant phagemid DNA from the harvested
cells;
[0166] c) digesting the phagemid DNA with restriction enzymes;
and
[0167] d) electrophoresing the digested phagemid DNA and confirming
the size of the cDNA inserts.
[0168] The cells for the transfection of the antisense library may
be chosen from cells of interest or from cells of various types of
cancer, such as liver cancer, lung cancer, stomach cancer, breast
cancer, bladder cancer, rectal cancer, colon cancer, prostate
cancer, thyroid cancer, and skin cancer as well as cells of
obesity, hair follicles of baldness, auto-immune disorders, and
metabolic disorders. Cells were seeded in wells in either
suspensions or adhesive compositions depending on the cell types
and properties being assayed.
[0169] It is understood that the source of the random gene
unidirectional library or the host cells that may be tested need
not be human. According to the principles of the invention, any
source organism may be used such as, but not limited to, mammals,
plants, and fungi. The host cell may be also any organism, so long
as the LC-antisense compound is capable of penetrating the cell
membrane or cell wall.
[0170] The LC-antisense compounds may be complexed with carriers to
deliver the antisense compounds into the cells of interest. The
ratio of the antisense compounds to carriers may vary based on the
types of cells and types of antisense compounds that are used.
[0171] The carriers may be, but not limited to, liposomes, cationic
polymers, a complex formed between cationic polymer and viral
vectors, HVJ-liposomes, pronase complexes, peptides, and viral
vectors. The antisense compounds may be delivered into cells either
alone or complexed with the carrier composition. The LC-antisense
compound-carrier complexes are mixed with cells in the multi-well
plates, and the LC-antisense compounds in each well are unique in
their sequence. Thus, a specific gene of interest is targeted.
[0172] The functional genomics methods described above use a
defined set of chosen LC-antisense compounds applied to many types
of disease cells or cells of interest. Thus, the antisense
macroarray assembly is intended for functional study in a
definitive and comparative manner (FIG. 19). The macroarray
assembly may be used also for functional diagnostics, to find
candidate genes for effective gene therapy, and to examine mutual
relationships among genes in the diseased or abnormal cells by
comparing gene functions in the cells of the same, similar or
distinct lineage.
[0173] Gene functionalization assays may be performed, including
observation of the morphology, growth pattern (growth promotion or
inhibition) and death of the cells after the antisense compounds
are applied to the cells. Such assays may be used to score
parameters for the primary assays.
[0174] In addition, the present invention provides a system for
gene characterization and functionalization on a massive scale
using diverse types of cells treated with an antisense macroarray
with a limited number of antisense compounds chosen from the phage
genomic antisense library.
[0175] Cells of interest are seeded in 96-or 384-well plates and
incubated for a day in a CO.sub.2 incubator to prepare for
treatment with LC-antisense compound-carrier complexes. When the
96-well plates are used in a transfection protocol, the
LC-antisense compound to liposome ratio for complex formation can
be either 1:3 (w/w), 1:4, or any other adequate ratio depending on
the type of cells or liposomes used. In general, for the present
invention, the ratio of 1:3 (W/W) was employed for efficient
transfection.
[0176] To study the antisense activity in the transfected cells,
the cell culture extract may be conveniently used for immunologic
assays. Also, transfected cells may be used to prepare RNA, which
may be used as the template for RT-PCR and Northern blotting.
Several other properties such as cell morphology, death, growth
patterns, and substrate response may be the subject of primary
functional studies. Typically, such primary functional studies make
use of microscopic observations. See FIG. 8.
[0177] One hundred randomly selected clones were sequenced to
confirm the correct orientation of the antisense inserts. Sequence
data of all of the individual clones show that the antisense
sequences correspond to the sense strands of their respective mRNAs
(FIGS. 12A-12C). In addition, poly(A) tails were found at the 3'
end of 96% the clones sequenced. These results demonstrate that
most of the single-stranded phage genomes contain antisense
sequences and that directional antisense cloning was successfully
completed.
[0178] Based on the results of primary gene functionalization,
further assays are carried out to confirm primary function using
additional assays that utilize techniques in the fields of
molecular biology, cell biology, immunology, biochemistry, animal
experiments and the like. These results allow a more precise
understanding of the relationships among these genes.
[0179] Functional genomics can be performed using different assays
for specific genes. The following approaches may be preferably
employed without limitation:
[0180] (1) measuring antisense activities to gene expression by (a)
RT-PCR to detect mRNA levels, (b) Western blotting to detect
protein levels, and (c) other assays for enzymatic or immunologic
reactions;
[0181] (2) measuring cell growth and differentiation using MTT
assay, thymidine incorporation, and colony formation on soft
agarose. Factors associated with DNA replication, or chromatin
activation (e.g. histone acetylase) may be measured as well;
[0182] (3) measuring apoptotic cell death, which may be scored for
gene function by morphological changes, condensation of nucleus,
DNA fragmentation, quantitative analysis of apoptosis,
intracellular signaling for apoptosis and so on; and
[0183] (4) measuring cell cycle regulation, which may be scored by
flow cytometry analysis, activities of factors involved in cell
cycle progression or pause, and by complex formation between
factors involved in cell cycle.
[0184] In addition to the above methods, other methods for
functional genomics using antisense inhibition techniques include
assays using molecular biological, biochemical, and physiological
changes in vitro and in vivo.
[0185] The phage vector allows easy production of the long
single-stranded sequence that encompasses the antisense sequence
with high sequence fidelity. The new antisense molecules, even with
their unconventionally long length, exhibited good sequence
specificity in eliminating expression of target mRNA. Without being
bound by any particular theory or mechanism of action of the
antisense nucleic acid, it is thought that once a small portion of
the antisense sequence binds to its complementary sequence, the
antisense sequence zips through the entire length of the
complementary target sequence. The lengthy duplex formed between
the antisense DNA and sense RNA is then much more stably maintained
as a substrate for RNaseH activity.
[0186] Another reason for the advantageous binding of the inventive
antisense molecule may be that there may exist a higher chance for
the long antisense molecule to bind to a target site that is
structurally exposed. Messenger RNA tends to form extensive
secondary and tertiary structures within its own sequence and by
interaction with RNA binding proteins in the cell cytoplasm.
Finding an open target site for an antisense molecule is critical
for successful antisense activity. With its long length, the phage
genomic antisense molecule has to have some sequence that can
access exposed complementary sequences of target mRNA, thus
improving the chances for target mRNA ablation.
[0187] Antisense Molecular Therapy
[0188] The inventive LC-antisense compounds are effective
therapeutic agents against various types of cancer, viral
infection, immunologic disorders, metabolic disorders and other
human diseases in which modulation of gene expression can be
beneficial to intervene in disease initiation and progression.
[0189] The principles of the antisense molecules of the invention
may be applied to any target gene of interest. While TNF-.alpha.
and NF-.kappa.B specific LC-antisense compounds are disclosed as
examples of the antisense molecule of the invention, the antisense
molecule of the invention may be made against any gene of interest.
In fact, the LC-antisense compounds of the invention were
significantly more stable to nucleases and were effective in target
ablation. Exemplified sequence specific reduction of the
TNF-.alpha. and NF-.kappa.B target genes supports the broad utility
of an antisense molecular therapy method. Thus, the antisense
molecule of the invention may be used to bind to any endogenously
expressed target transcript from any source.
[0190] Antisense activity was also examined at the protein level to
ensure correlation of both target mRNA and protein elimination.
Administration of TNF.alpha.-M 13AS was found to significantly
reduce rat TNF-.alpha. secretion in cell culture media, confirming
effective antisense activity. In contrast, control phage genomic
compounds (single-stranded circular molecules without an antisense
insert) exhibited only a mild reduction in TNF-.alpha. secretion.
The slight decrease of TNF-.alpha. secretion by the addition of
control antisense molecule can be explained, in part, by the
cytotoxicity of free cationic liposomes deposited inside endosomes.
Cells treated with cationic liposomes alone exhibited lower
viability than cells with LC-antisense compound-liposome
complex.
[0191] In therapeutic applications, the large circular nucleic acid
molecules can be formulated for a variety of modes of
administration, including oral, topical or localized
administration. Techniques and formulations generally may be found
in Remington's Pharmaceutical Sciences, Mack Publishing Co.,
Easton, Pa., latest edition. The active ingredient that is the
antisense molecule is generally combined with a carrier such as a
diluent of excipient which may include fillers, extenders, binding,
wetting agents, disintegrants, surface-active agents, erodable
polymers or lubricants, depending on the nature of the mode of
administration and dosage forms. Typical dosage forms include
tablets, powders, liquid preparations including suspensions,
emulsions and solutions, granules, and capsules.
[0192] Certain of the large circular nucleic acid compounds of the
present invention may be particularly suited for oral
administration which may require exposure of the drug to acidic
conditions in the stomach for up to about 4 hours under
conventional drug delivery conditions and for up to about 12 hours
when delivered in a sustained release form. For treatment of
certain conditions it may be advantageous to formulate these
antisense compounds in a sustained release form.
[0193] Systemic administration of the large circular nucleic acid
molecules may be achieved by transmucosal or transdermal means, or
the compounds can be administered orally. For transmucosal or
transdermal administration, penetrants appropriate to the barrier
to be permeated are used in the formulation. Such penetrants are
generally known in the art, and include, for example, bile salts
and fusidic acid derivatives for transmucosal administration. In
addition, detergents may be used to facilitate permeation.
Transmucosal administration may be through use of nasal sprays, for
example, as well as formulations suitable for administration by
inhalation, or suppositories.
[0194] The large circular nucleic acid molecule of the present
invention can also be combined with a pharmaceutically acceptable
carrier for administration to a subject. Examples of suitable
pharmaceutical carriers are a variety of cationic lipids,
including, but not limited to
N-(1-2,3-dioleyloxy)propyl)-n,n,n-trimethylammonium chloride
(DOTMA) and dioleoylphosphatidyl ethanolamine (DOPE). Liposomes are
also suitable carriers for the antisense molecules of the
invention. Another suitable carrier is a slow-release gel or
polymer comprising the claimed antisense molecules.
[0195] The large circular nucleic acid molecules may be
administered to patients by any effective route, including
intravenous, intramuscular, intrathecal, intranasal,
intraperitoneal, intratumoral, subcutaneous injection, in situ
injection and oral administration. Oral administration may require
enteric coatings to protect the claimed antisense molecules and
analogs thereof from degradation along the gastrointestinal tract.
The large circular nucleic acid molecules may be mixed with an
amount of a physiologically acceptable carrier or diluent, such as
a saline solution or other suitable liquid. The antisense molecules
may also be combined with other carrier means to protect the
nucleic acid molecules or analogs thereof from degradation until
they reach their targets and/or facilitate movement of the
antisense molecules or analogs thereof across tissue barriers.
[0196] In one embodiment, the large circular nucleic acid molecules
are administered in amounts effective to inhibit cancer or
neoplastic cell growth. In other embodiments, the antisense
molecule may be used to treat viral infections, such as, but not
limited to herpes, human papilloma virus (HPV), HIV, small pox,
mononucleosis (Epstein-Barr virus), hepatitis, respiratory
syncytial virus (RSV) and so on. In addition, metabolic diseases,
such as, but not limited to, phenylketonuria (PKU), primary
hypothyroidism, galactosemia, abnormal hemoglobins, types I and II
diabetes, obesity and so on are also targets. The inventive
antisense molecule may be used to treat other diseases such as
immunologic diseases including such diseases as, but not limited
to, Sjogren's Syndrome, antiphospholipid syndrome, immune complex
diseases, Purpura, Schoenlein-Henoch, immunologic deficiency
syndromes, systemic lupus erythematosus, immunodeficiency,
rheumatism, and so on.
[0197] The actual amount of any particular large circular nucleic
acid molecule administered will depend on factors such as the type
and stage of the disease or infection, the toxicity of the
antisense molecule to other cells of the body, its rate of uptake
by the cells, and the weight and age of the individual to whom the
nucleic acid molecule is administered. An effective dosage for the
patient can be ascertained by conventional methods such as
incrementally increasing the dosage of the antisense molecule from
an amount ineffective to inhibit cell proliferation to an effective
amount. It is expected that concentrations presented to the
diseased cells may range from about 10 nM to about 30 .mu.M will be
effective to inhibit gene expression and show an assayable
phenotype. Methods for determining pharmaceutical/pharmacokinetic
parameters in chemotherapeutic applications of antisense molecules
for treatment of cancer or other indications are known in the
art.
[0198] The large circular nucleic acid molecules are administered
to the patient for at least a time sufficient to have a desired
effect. To maintain an effective level, it may be necessary to
administer the antisense nucleic acid molecules several times a
day, daily or at less frequent intervals. For cancer cells,
antisense molecules are administered until cancer cells can no
longer be detected, or have been reduced in number such that
further treatment provides no significant reduction in number, or
the cells have been reduced to a number manageable by surgery or
other treatments. The length of time that the antisense molecules
are administered will depend on factors such as the rate of uptake
of the particular molecule by cancer cells and time needed for the
cells to respond to the molecule.
[0199] The following examples are offered by way of illustration of
the present invention, and not by way of limitation.
EXAMPLES
EXAMPLE 1
Construction of LC-Antisense Compounds Using M13 Bacteriophage
[0200] Experiments were carried out to determine whether the
circular phage genome of M13 bacteriophages (phage) can harbor an
antisense sequence as a part of its genome and whether these new
antisense molecules can overcome the problems associated with
synthesized forms of antisense oligonucleotides. Production of
recombinant M13 phage was carried out by infecting M13K07 helper
phages into bacterial cells that were already transformed with
pBluescript KS (-) phagemid (Jupin et al. Nucleic Acid Res., 23,
535-536 (1995)). We utilized the F1 replication origin of the
phagemid to generate single-stranded circular phage genome
containing either antisense or sense sequence for a target gene. In
the case of the gene encoding rat TNF-.alpha., the entire cDNA of
the gene was placed into pBluescript KS (-) vector to produce the
antisense sequence (FIG. 1).
[0201] The antisense sequence in the single-stranded genomic DNA
was confirmed by DNA sequencing using T7 sequencing primers (FIG.
2). Both the 5' and 3' flanking sequences of the TNF-.alpha.
antisense insert were shown to be those of the phagemid vector. The
insert sequence corresponded with that of TNF-.alpha. mRNA,
demonstrating that the antisense sequence was present. The circular
phage genome containing the antisense sequence for TNF-.alpha. and
NF-.kappa.B were designated as TNF.alpha.-M 13AS and
NF.kappa.B-ML3AS, respectively.
[0202] 1. mRRNA Induction and Cloning of Genes Encoding Rat
TNF-.alpha. and Human NF-.kappa.B
[0203] Rat TNF-.alpha. expression was induced with
lipopolysaccharide (LPS, 30 .mu.g/ml) in WRT7/P2 cells. Cells at
1.times.10.sup.6 cells/well were seeded in each well of a 48-well
plate and were treated with LPS for 4 to 24 hours. Cells were
harvested at desired time points to examine the amounts of mRNA.
The LPS incubation time by which TNF-.alpha. expression was induced
at the highest level was chosen for further experiments. The
highest level of rat TNF-.alpha. expression was determined 6 hours
after LPS treatment.
[0204] Rat TNF-.alpha. cDNA was obtained from the amplified cDNA
fragments as described above. The RT-PCR fragment (708 bp) of
TNF-.alpha. that comprises the entire coding sequence was amplified
with a pair of PCR primers: 5'-GATCGTCGACGATGAGCACAGAAAGCATGATCC-3'
(SEQ ID NO:1), and 5-GATCGAATTCGTCACAGAGCAATGACTCCAAAG-3' (SEQ ID
NO:2). The rat TNF-.alpha. cDNA fragment was cloned into the
multiple cloning site of pBluescript KS (-) vector using Sal I and
EcoR I restriction sites in the same direction as the lacZ gene
(FIG. 1).
[0205] Similarly, cDNA fragments of the NF-.kappa.B gene was
amplified with a pair of PCR primers and cloned into the EcoRV site
of pBS-KS (+) vector after blunting the ends. Amplified cDNA
fragments were always confirmed with both restriction digestion and
DNA sequencing.
[0206] In detail, THP1 cells derived from leukocytic monocytes
which were transfected with NF.kappa.B-M13AS, NF.kappa.B-M13SE or
M13SS complexed with liposomes in a ratio of DNA to liposome ratio
of about 1:4 (w/w) and cultured. One day after lipofection, cells
were stimulated with PMA (160 nM) for 6 hours. Total RNA was
isolated and subjected to RT-PCR using a pair of primers:
5'-GATCGTCGACGCGCCACCCGGCTTCAGAATGGC-3' (SEQ ID NO:3) and
5'-GATCGAATTCGGTGAAGCTGCCAGTGCTATCCG-3' (SEQ ID NO:4). The PCR
product was used in Southern blot analysis using a 25 mer
oligonucleotide probe of 5'-CTTCCAGTGCCCCCTCCTCCACCGC-3' (SEQ ID
NO: 5).
[0207] 2. Construction of Large Circular Nucleic Acid Molecules
Employing a Phagemid Vector and the M13K07 Helper
Bacteriophages
[0208] (1) Construction of Single-Stranded Bacteriophage Genome
Harboring either Sense or Antisense Sequences
[0209] Large circular nucleic acid molecules that contain an
antisense region specific to the target genes were constructed
according to standard cloning procedure (Sambrook et al., Molecular
Cloning, 1989). Competent bacterial cells (XL-1 Blue MRF')
containing the pBS-KS (+) or (-) phagemid with the appropriate CDNA
were infected with helper bacteriophage M13K07 (NEB Nucleic Acids,
USA). The orientation of the cloned cDNA in the phagemid vector
determines which of the sense or antisense sequence will be
produced. 20% polyethylene glycol (PEG 8000) was added to the
supernatant of an overnight culture of helper phage infected cells
grown in 2.times.YT. The bacteriophage precipitate was resuspended
in TE (pH 8.0), and phage genomic DNA was isolated by phenol
extraction and ethanol precipitation.
[0210] (2) Purification of the Phage Genomic Antisense
Molecules
[0211] Purification of phage genomic antisense molecules from the
residual genomic DNA of helper bacteriophage and host bacterial
cells was carried out either with 0.8% low melting point (LMP)
agarose gel for small scale purification or with gel filtration
column chromatography (1.0.times.50 cm) for large scale
purification. The column resin for gel filtration was superfine
Sephacryl.TM. S-1000 (molecular cutoff: 20,000 bp) (Amersham
Pharmacia Biotech AB, Sweden), and was packaged and equilibrated
with 50 mM Tris-HCl buffer containing 0.2 M NaCl (pH 8.3). The
starting volume of the antisense molecules was adjusted to 5% of
the gel void volume and DNA elution was carried out with the same
buffer used for resin equilibration (flow rate: 0.3 m/min). Samples
were UV scanned at 260/280 nm with a dual UV detection system and
were collected every 5 min during elution. Sample fractions were
washed and precipitated with 70% cold ethanol and were resuspended
in distilled ultrapure water and PBS (phosphate-buffered saline)
for subsequent experiments. The purified antisense molecules were
tested for quantity and purity on a 1% agarose gel. Control sense
molecules were constructed with the TNF-.alpha. cDNA fragment
cloned in pBS-KS (+), in the opposite orientation of the lacZ gene
in the vector. Single-stranded molecules of either sense or
antisense were confirmed for sequence integrity by employing the T7
primer for sequencing. DNA sequencing was carried out with an
automated DNA sequencer (FIG. 2).
[0212] EXAMPLE 2
Structrual Analysis and Stability Test of the Phage Genomic
Circular Aantisense Molecules
[0213] 1. Single-Stranded Circular TNF-.alpha. Antisense
Molecules
[0214] The fact that the antisense molecules are single stranded,
circular and stable was tested in the following manner. 1 .mu.g
LC-antisense molecules containing antisense region targeted to the
gene encoding TNF-.alpha. were treated with Xho I (10 U/.mu.g DNA),
Exonuclease III (160 U/.mu.g DNA), or S1 nuclease (10 U/.mu.g DNA)
at 37.degree. C. for 3 hrs, and subjected to phenol extraction,
ethanol precipitation and gel electrophoresis on a 1% agarose gel
to study their stability as well as digestion patterns.
[0215] TNF.alpha.-M13AS was tested for its circular structure and
stability to nucleases. The LC-antisense molecules were expected to
be stable to exonucleases because of their closed circular
structure. When TNF.alpha.-M13AS was incubated with the
endonuclease Xho I and exonuclease III, the antisense molecules
were found to be largely intact even after a 3 hour incubation with
these nucleases (FIG. 3A). In contrast, when Xho I was added to the
double-stranded replication form of the recombinant M13 phage DNA,
the DNA was, as expected, completely digested by the combination of
the restriction enzyme and exonuclease III. The single-stranded
TNF.alpha.-M13AS was also completely digested by S1 nuclease, a
nuclease that is specific for single-stranded DNA. Thus, it was
confirmed that TNFa-M13AS was shaped as a single-stranded circular
molecule.
[0216] 2. Stability Testfor TNF.alpha.-M13AS
[0217] For the stability test, 1 .mu.g of antisense molecules was
added alone or after complex formation with liposomes in a ratio of
DNA:liposome of about 1:3 (w/w). A not heat inactivated 30% FBS
solution was added to the antisense-liposome complex and incubated
at 37.degree. C. for varying time periods for up to 48 hours. After
incubation with FBS and the nucleases, antisense DNA was extracted
with chloroform, precipitated with ethanol and electrophoresed on a
1% agarose gel.
[0218] Phage genomic antisense molecules were also found to be
stable since their structural integrity was largely preserved after
incubation with serum. When TNF.alpha.-M 13AS was combined with
cationic liposomes, a large fraction of the antisense molecules
remained intact after extended incubation in fetal bovine serum
(FBS). In fact, TNF.alpha.-M13AS remained intact even after a 24
hour incubation with 30% FBS (FIG. 3B). The results suggest that
the phage genomic antisense molecules may be further stabilized
during in vivo application by forming complexes with liposomes.
EXAMPLE 3
Effective and Specific Elimination of Rat TNF-Alpha Expression by
TNFAlpha-M13AS
[0219] The antisense activity of TNF.alpha.-M13AS was tested.
TNF.alpha.-M13AS contains a long antisense sequence that includes
nonspecific antisense phagemid vector sequences and an antisense
region specific to rat TNF-.alpha. mRNA. The fact that the phage
genomic antisense molecules have a large amount of nonspecific
sequences necessitates a thorough analysis of target specificity of
the antisense activity. In order to determine whether phage genomic
antisense molecules act specifically to eliminate target gene
expression, multiple control genes were used to compare levels of
mRNA ablation.
[0220] 1. Cell Cultures
[0221] Monocytic mouse cell line WRT7/P2 and human cell line THP-1
were maintained in either RPMI 1640 or EMEM (JBI, Korea)
supplemented with 10% heat-inactivated FBS (JBI, Korea), 100
.mu.g/ml penicillin and 100 .mu.g/ml streptomycin. Cells were
cultured in a CO.sub.2 (5%) incubator at 37.degree. C. and
carefully maintained to avoid over growth. Cell media was exchanged
with fresh culture media the day before lipofection (16 hours) and
tested for cell viability with 0.4% trypan blue staining on the day
of experiments.
[0222] 2. Transfection of TNF.alpha.-M13AS Complexed with
Liposomes
[0223] Cationic liposomes, such as Lipofectamine.TM., Lipofectamine
2000.TM. or Lipofectamine Plus.TM. (Life Technologies, USA) were
mixed with either antisense molecules or sense control molecules.
These liposome-DNA complexes were mixed with OPTI-MEM (Life
Technologies, USA), and were then added to cells according to the
protocol suggested by the manufacturer.
[0224] Lipofection details are as follows. Cells were cultured in
RPMI 1640 or EMEM supplemented with 10% FBS and were washed twice
with OPTI-MEM 30 minutes prior to lipofection. Cells were seeded in
a 48-well plate (1.times.10.sup.5 cells/well) in 200 .mu.l of
culture media. Antisense molecules were mixed with cationic
liposomes in a ratio of about 1:3 (w/w) and added to cells for
transfection. Cells were incubated for 6 hours at 37.degree. C. in
serum-free media. Following the lipofection, 2.times. FBS and
antibiotics were added to the culture medium and incubated further
for 18 hrs at 37.degree. C. Rat TNF-.alpha. expression was induced
with LPS (30 .mu.g/ml). Cells were used for the preparation of RNA,
and culture supernatant was tested for the presence of IL-10 with
Enzyme Linked Immuno-Sorbent Assay (ELISA).
[0225] 3. Detection of Transcription with RT-PCR
[0226] RNA preparation was carried out with Tri reagent.TM. (MRC,
USA) according to the protocol recommended by the manufacturer.
Cells harvested from each well were mixed with 1 ml Tri Reagent and
200 .mu.g chloroform for RNA purification. Purified RNA was
subjected to RT-PCR in a 50 .mu.g reaction volume by using the
Access.TM. RT-PCR kit (Promega, USA). In a PCR tube were added
purified RNA, a pair of primers: 5'-CATCTCCCTCCGGAAAGGACAC-3' (SEQ
ID NO:6) and 5'-CGGATGAACACGCCAGTCGC-3' (SEQ ID NO:7), AMV reverse
transcriptase (5 U/.mu.l), Tfl DNA polymerase (5 U/.mu.l), dNTP (10
mM, 1 .mu.l) and MgSO.sub.4 (25 mM, 2.5 .mu.l). Reverse
transcription and polymerase chain reaction were sequentially
carried out in a thermal cycler (Hybaid, UK). Synthesis of the
first strand cDNA was carried out at 48.degree. C. for 45 min and
subsequent DNA amplification was carried out in 30 repetitive
cycles, at 94.degree. C. for 30 sec (denaturation), 59.degree. C.
for 1 min (annealing), and 68.degree. C. for 2 min
(polymerization). PCR product was confirmed on a 1% agarose gel,
and quantitative analysis of the amplified DNA was performed with
Alphalmager 1220, a gel documentation apparatus (Alpha Inno-Tech
corporation, USA).
[0227] 4. Southern Blotting
[0228] Probes for Southern hybridization were prepared with ECL
(enhanced chemical luminescence) oligo-labeling and detection
system (Amersham Life Science, UK). RT-PCR products were run on a
1% agarose gel and transferred onto a nylon membrane in 0.4 M NaOH
solution. An oligonucleotide probe for TNF-.alpha. was a 22 mer:
5'-GATGAGAGGGAGCCCATTTGGG-3' (SEQ ID NO:8), and an oligonucleotide
probe for NF-.kappa.B was a 25 mer: 5'-CTTCCAGTGCCCCCTCCTCCACCGC-3'
SEQ ID NO:5).
[0229] Oligonucleotide probes of 100 pmol were mixed with
fluorescein-11-dUTP, cacodylate buffer and terminal transferases,
and were incubated at 37.degree. C. for 70 min for ECL labeling.
Probe hybridization to a nylon membrane with transferred DNA was
carried out in a 6 ml hybridization buffer (5.times.SSC, 0.02% SDS,
liquid block) at 42.degree. C. for 14 hrs. The nylon membrane was
washed twice in 5.times.SSC containing 0.1% SDS and once in
1.times.SSC containing 0.1% SDS, at 45.degree. C. for 15 min for
each washing. The membrane was incubated with an antibody
conjugated to HRP anti-fluorescein for 30 min, followed by
incubation with ECL detection reagent for about 5 min before
exposure to an X-ray film.
[0230] To test the specific activity of TNF.alpha.-M13AS, 0.5 .mu.g
(1.4 nM) of the antisense molecules were complexed with 1.5 .mu.g
of cationic liposome and were added to 1.times.10.sup.5 cells of a
monocytic cell line, WRT7/IP2. The cells were then induced for
TNF-.alpha. expression by LPS treatment. When the cells were
treated with TNF.alpha.-M 13AS, the induction level of TNF-.alpha.
mRNA was significantly reduced. In contrast, when cells were
treated with either TNF.alpha.-M13SE (the sense strand of
TNF-.alpha.) or M13SS (single-stranded phage genome without the
antisense insert) they did not show much reduction of TNF-.alpha.
mRNA (FIGS. 4A and 4C). RT-PCR band of TNF-.alpha. was confirmed by
Southern hybridization using a probe that binds to the middle of
the amplified DNA fragments.
[0231] TNF.alpha.-M13AS contains the rat TNF-.alpha. antisense
sequence as well as antisense sequences of the .beta.-galactosidase
(LacZ) and the .beta.-lactamase (Amp) genes, harboring a total of
3.7 kb single-stranded circular genome. The TNF-.alpha. specific
antisense portion is about 708 bases long. Thus, the TNF-.alpha.
specific antisense sequence in TNF.alpha.-M13AS is itself very long
when compared with conventional synthetic antisense molecules of
some 20 or 30 nucleotides. This is significant because it has been
generally believed in the art that as the antisense molecule is
lengthened, its sequence specificity declines. Further confirming
tests were carried out to show that the antisense activity of
TNF.alpha.-M 13AS is indeed sequence specific.
[0232] In order to demonstrate sequence specific antisense
activity, three different genes were examined for mRNA levels after
lipofection of TNF.alpha.-M13AS. These were .beta.-actin, GAPDH
(glyceraldehyde 3-phosphate dehydrogenase), and IL-1.beta.
(interleukin-1 .beta.). Expression of these genes was not affected
by lipofection of TNF.alpha.-M13AS (FIGS. 4A-4C).
[0233] Dose response of TNF.alpha.-M13AS in its antisense activity
was also examined. When TNF.alpha.-M13AS was used at a
concentration of 0.01 .mu.g (0.03 nM), TNF-.alpha.expression was
only slightly reduced. At a concentration of 0.05 .mu.g (0.14 nM),
TNF-.alpha.expression was partially eliminated. When the amount of
TNF.alpha.-M13AS was increased to 0.1 .mu.g (0.28 nM), TNF-.alpha.
mRNA was found to be completely abolished. These results show that
TNF.alpha.-M13AS is effective for the elimination of target mRNA
using a much smaller amount than conventionally used antisense
molecules.
EXAMPLE 4
Expression Patterns of Rat TNFAlpha Protein
[0234] Quantitation of target proteins after antisense treatment
was examined with either ELISA or Western blotting method. For the
ELISA assay, cell culture supernatant was diluted 50 fold and added
to an ELISA plate coated with antibody against TNF-.alpha..
Biotinylated secondary antibody to anti TNF-.alpha. was added into
each well of the ELISA plate and incubated at room temperature for
90 minutes. After three washings, streptavidin-peroxidase was
added, and incubated for 45 minutes. The plate was washed four
times to remove unbound streptavidin-peroxidase, and chromogen was
added. After a 20 min incubation for color development, optical
density was measured at 450 nm.
[0235] WRT7/P2 cells were lipofected with TNF.alpha.-M13AS, and
TNF-.alpha. secreted from the transfectants was measured using the
ELISA assay. Similar to the level of reduction of endogenous
TNF-.alpha. mRNA, TNF-.alpha. protein in the cell culture
supernatant was also reduced by more than 90% after administering
TNF.alpha.-M13AS (FIG. 5). However, neither of the control
antisense molecules, TNF.alpha.-M13SE (containing the sense strand
of the TNF-.alpha. gene) or M13SS, reduced TNF-.alpha. expression
in WRT7/P2 transfectants. These results demonstrate that
TNF.alpha.-M13AS was effective in both the elimination of
TNF-.alpha. mRNA and subsequent disappearance of TNF-.alpha. from
the transfectants.
EXAMPLE 5
Effect of NFKAPPAB-M13as on Human NFKAPPAB Transcription
[0236] Observing the effectiveness of TNF.alpha.-M13AS, experiments
were carried out to determine whether phage genomic antisense
compounds specifically directed to other genes block the expression
of another gene, such as NF-.kappa.B. LC-antisense compound to
NF-.kappa.B (NF.kappa.B-M13AS) was produced and tested in THP-1
cells for efficient antisense activity. NF.kappa.B-M13AS was also
complexed with liposomes and was added to the cells in increasing
amounts. When 0.05 .mu.g (0.14 nM) of NF.kappa.B-M13AS was added to
THP-1, NF-.kappa.B mRNA was reduced by about 70%. When the amount
of NF.kappa.B-M13AS was increased to 0.1 .mu.g (0.28 nM) and to 0.2
.mu.g (0.56 nM), NF-.kappa.B mRNA was eliminated by more than 90%.
In contrast, cells that were treated with either NF.kappa.B-M13SE
(phage genomic DNA with the sense sequence of NF-.kappa.B) or with
M13SS, NF-.kappa.B expression was not much affected (FIGS.
6A-6B).
EXAMPLE 6
Construction of Unidirectional Subtracted Liver Antisense
Library
[0237] 1. Construction Of Unidirectional Subtracted Liver cDNA
Library
[0238] To raise the efficiency for searching disease-related genes
through gene functionalization, a random antisense library was
constructed that included phage genomic antisense molecules that
contain genes that are differentially and specifically expressed or
overexpressed in cancer tissue but not in normal tissue (FIG. 10).
For differential cDNA cloning of overexpressed genes in liver
cancer, the present inventors used a subtractive hybridization
method as described in Diachenko et al., Proc. Natl. Acad. Sci.,
93: 6025-6030, 1996, which reference is incorporated herein by
reference in its entirety.
[0239] Total RNA was prepared from normal and cancerous liver
tissue using Tri Reagent.TM. (MRC, USA) according to the protocol
recommended by the manufacturer. Briefly, tissue samples were
washed in phosphate-buffered saline solution and sliced into
smaller pieces, and homogenized for 10 minutes in an optimal volume
of Tri Reagent.TM..
[0240] Poly(A)+mRNA was purified using poly(A) Quick mRNA Isolation
Kit (Stratagene, USA) according to manufacturer's instructions.
Purified poly(A)+mRNA was used as template for the synthesis of the
first strand cDNA. To clone the cDNA inserts directionally, the
Hind III recognition sequence was replaced with a Xho I recognition
sequence in the cDNA synthesis primer:
5'-TTTTGTACCTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3' (SEQ ID NO:9)
supplied with a cDNA subtraction kit (PCR-Select.TM. cDNA
Subtraction Kit, Clontech Laboratories, Inc., USA) and synthesized
the first strand cDNA followed by the second strand cDNA using the
standard protocol supplied by the manufacturer.
[0241] The tester cDNA (from cancer cells) and driver cDNA (from
normal cells) prepared by the above mentioned procedure were
digested with Rsa I, a four-base cutting restriction enzyme that
yields blunt ends. The tester cDNAs were then subdivided into two
groups, and cDNAs from each group were separately ligated to
group-specific cDNA adaptors.
[0242] Adaptor 1: 5'-ACCTGCCCGG-3' (SEQ ID NO:10), which is
complementary to a portion of 5'-CTAATACGACTCACTATAGGGCTCGAGCGG
CCGCCCGGGCAGGT-3' (SEQ ID NO:11).
[0243] Adaptor 2: 5'-ACCTCGGCCG-3' (SEQ ID NO:12), which is
complementary to a portion of 5'-CTAATACGAC TCACTATAGGGCAGCGTGGT
CGCGGCCGAGGT-3' (SEQ ID NO:13).
[0244] Two hybridization reactions were performed, which were
followed by suppression PCR to amplify differentially expressed
sequences. Differentially expressed sequences were amplified by PCR
method using a pair of primers: 5'-TCGAGCGGCCGCCCGGGCAGGT-3' (SEQ
ID NO:14) and 5'-AGCGTGGTCG CGGCCGAGGT-3' (SEQ ID NO:15). This
procedure eliminated background signal. The subtracted cDNA pool
was cloned into the multiple cloning site of pBluescript (pBS)
SK(-) vector using Not I and Aho I restriction sites in the same
direction as the LacZ gene. The CDNA plasmid library was
transformed into Epicurian Coli.RTM. XL-10 Gold Ultracompetent
Cells (Stratagene, USA) by the calcium-chloride method.
[0245] The quality of the obtained cDNA library was tested. First,
to determine the total number of primary transformants, 1 .mu.l and
10 .mu.l aliquots from 1 ml pilot transformants were plated on
LB-ampicillin agar plates, separately. Primary library size was
determined as 2.times.10.sup.4 cfu/ml.
[0246] Second, for determining the percentage of vectors with
inserts and the average size of the inserts, 40 randomly selected
recombinant phagemid clones were purified and digested. And it was
determined that 97.5% of the tested transformants had CDNA insert,
and the average insert size was approximately 300 bp (FIG. 11).
[0247] Third, to determine whether directional cloning was
successful, we sequenced 100 randomly selected clones from the 5'
end of the (+) strand of the cDNA in pBS SK(-) phagemid by
employing T3 primer, and confirmed that 96% of recombinant
phagemids had inserts in the intended orientation.
[0248] 2. Selection Of Transformants Containing Phagemids With
Inserts Of Preferred Size
[0249] Transformants containing phagemids that have cDNA inserts of
more than about 500 bases were selected by the so-called `cracking`
method.
[0250] Each single colony was seeded in each well of 96 deep well
plates and incubated in 1 ml of LB liquid media containing 50
.mu.g/ml of ampicillin for 20 hours at 37.degree. C. in a rapidly
shaking incubator. 300 .mu.l of 1 ml overnight culture was
centrifuged, and cell pellets were vortexed vigorously for 30
seconds in 40 .mu.l of gel loading buffer (0.25% bromophenol blue,
30% glycerol) and 14 .mu.l of phenol-chloroform mixture
(25:24).
[0251] After centrifugation of each sample for 10 minutes at 12,000
rpm at room temperature, 8 .mu.l of supernatant was loaded on a
1.0% agarose gel. As a control, two kinds of transformants
containing pBS SK(-) phagemid with and without a 500 bp cDNA insert
were cracked together and electrophoresed on an agarose gel
simultaneously (FIG. 13). Selected transformants containing 1,200
of 9,600 clones that had been cracked and which contained cDNA
insert larger than 500 bp were arranged in 96-well plates and
cultured. The cells were further preserved in a-70.degree. C. deep
freezer as glycerol stocks.
[0252] 3. Making Liver-Specific Unidirectional Suhtracted
LC-Antisense Compounds
[0253] Bacterial culturing and purification steps for making a
unidirectional subtracted liver antisense library were performed as
follows. Competent bacterial cells containing pBS SK(-) phagemid
with a cDNA insert were plated on LB agar plates containing 50
.mu.g/ml of ampicillin and 50 .mu.g/ml of tetracycline and
incubated at 37.degree. C. for 16 hours. Isolated single colonies
that were seeded in each well of 96-deep well plate, were
aliquotted with 1.5 ml 2.times.YT liquid media (tryptone 16 g,
yeast extract 10 g, NaCl 10 g per 1000 ml) containing 50 .mu.g/ml
ampicillin, and precultured for 7 hrs at 37.degree. C. with
vigorous shaking. To produce LC-antisense compounds from each
phagemid, 20 .mu.l of the preculture was multi-channel pipetted to
the wells prefilled with 1.4 ml 2.times.YT liquid media free of
ampicillin, but which also contained 9 .mu.l of helper
bacteriophage M13K07 (NEB Nucleic Acids, USA).
[0254] After a 1 hour incubation, 4.2 .mu.l of 50 .mu.g/ml
kanamycin was added and cultured for 12 hours under the same
conditions described above. The infection was carried out in
triplicate for each clone to maximize the yield of antisense
molecules in a single purification step.
[0255] For high-throughput massive production of single-stranded
LC-antisense molecules, 20% polyethylene glycol (PEG 8000) was
added to culture supernatant of the overnight culture using QIAprep
96 M13 Kits (Qiagen, German). Purification steps were performed
with a QIAVAC Vacumn Manifold (Qiagen, German) following
manufacturer's instructions.
[0256] Purified LC-antisense molecules were run together with
control molecules derived from pBS SK(-) phagemid without a cDNA
insert on a 1% agarose gel to test the quantity and purity of the
antisense molecules (FIG. 14).
[0257] After confirming adequate purification of the phage genomic
antisense compounds by gel electrophoresis, the random gene
subtracted liver antisense library that includes approximately 1200
member clones was arrayed in thirteen 96-well plates.
EXAMPLE 7
Lipofection of Liver-Specific Random Gene Unidirectional Subtracted
Antisense Library Into Liver Cancer Cells
[0258] This is an example of applying the antisense library to
determine genes that are involved in the disease process of a
particular cell line. By the principle that specific binding of
antisense library molecules to the complementary mRNA sequence can
inhibit the expression of the target gene, the present inventors
first screened LC-antisense compounds affecting the growth of liver
cancer cells by lipofection of the liver-specific random gene
unidirectional subtracted antisense library into a liver cancer
cell line.
[0259] A liver cancer cell line, HepG2, was obtained from Korean
cell line bank (KCLB, Korea). The cell line was maintained in DMEM
media (JBI, Korea) supplemented with 10% heat-inactivated FBS (JBI,
Korea), 100 .mu.g/ml of penicillin and 100 .mu.g/ml of
streptomycin.
[0260] After washing the cells twice with OPTI-MEM (Life
Technologies, USA), 7.times.10.sup.3 cells were seeded in each well
of the thirteen 96-well plates in 100 .mu.l of optimal culture
media supplemented with 10% FBS. The cells were incubated for 12-18
hours at 37.degree. C. in a 5% CO.sub.2 incubator. 0.1 .mu.g of
each LC-antisense molecule that was to be transferred into the
thirteen 96-well plates was complexed with 0.3 .mu.g of cationic
liposomes, and the LC-antisense compound-carrier complex was added
to the cultured cells. Cell media were changed with fresh media 24
hours after transfection and incubated for 4 more days.
[0261] To compare the effects of the LC-antisense molecules on cell
proliferation, identical quantities of carrier alone and control
DNA-carrier complexes were also added to the cells in a different
96-well plate and assayed simultaneously. Control DNA was a large
circular phage genomic DNA without a cDNA insert.
EXAMPLE 8
Screening for Genes Critical for Growth of Liver Cancer Cells
[0262] In order to screen for genes involved in the growth of liver
cancer cells, light microscopy, MTT reduction assay and
[3H]-thymidine incorporation assays were performed. Growth
inhibition of liver cancer cells using LC-antisense compounds was
first confirmed by light microscopy (original magnification,
.times.200) at 4 days after transfection with the LC-antisense
compound-carrier complex (FIGS. 15A-15I).
[0263] For the MTT reduction assay, at 4 days after the
transfection of LC-antisense compounds, cell culture media was
replaced with 50 .mu.l of fresh media. 25 .mu.l of 5 mg/ml MTT
reagent (3-(4,5-dimethylthazol-2-yl)- -2,5-diphenyltetrazolium
bromide, in phosphate-buffered saline, SIGMA, USA) was added to
each well of the 96-well plates by multi-channel pipetting,
followed by incubation at 37.degree. C. for 4 hours. 150 .mu.l of
isopropanol containing 0.1 N HCl was added to the cells and
incubated at room temperature for 1 hour. Absorbance was measured
at 570 nm with Spectramax 190.TM. (Molecular Devices, USA) to score
the amount of cells that survived.
[0264] The percentage of growth inhibition was calculated using the
following formula:
[0265] Percentage of growth inhibition=1-(Absorbance of an
experimental well/Absorbance of a control well).times.100.
[0266] The percentage of growth inhibition in the experimental
wells treated with LC-antisense compound-carrier complex, and the
control wells that were either sham treated, treated with carrier
alone, or were treated with control DNA-carrier complexes, were all
measured by optical density, and the recorded absorbance readings
compared with each other (FIGS. 16). Single-stranded DNA without an
insert that was purified from bacterial culture was used as control
DNA.
[0267] From 1,200 antisense molecules screened in this manner, 153
(.about.12.8%) independent LC-antisense molecules displayed about
30.about.90% growth-inhibition. The results indicate that these 153
functionally identified genes promote the proliferation of liver
cancer cells.
[0268] The liver cancer cell growth inhibiting activity of the
above-mentioned 153 LC-antisense compounds was confirmed by MTT
assay and [.sup.3H]-thymidine incorporation assay performed on a
configured LC-antisense compound macroarray assembly (FIGS. 17A-17D
and FIGS. 18A-18D). For the [.sup.3H]-thymidine incorporation
assay, 0.5 .mu.Ci of [.sup.3H]-thymidine (2.0 Ci/mmol, Amersham
Pharmacia Biotech) was added to cells 24 hours after transfection,
and the cells were incubated at 37.degree. C. in a CO.sub.2
incubator. After 4 days, the cells were treated with trypsin (Life
Technology, USA) and harvested on a glass microfiber filter (GF/C
Whatman, Madistone, Kent, UK). The filter was washed with cold
phosphate-buffered saline, and then treated with 5% trichloroacetic
acid and absolute alcohol, successively. [3H]-thymidine
incorporation was measured by a liquid scintillation counter in a
mixture solution containing toluene, Triton X-100,
2,5-diphenyloxazole and 1,4-bis[2-(5-phenyloxazoly)]benzene. The
percentage of growth inhibition was calculated using the following
formula:
[0269] Percentage of growth inhibition=1-(cpm of an experimental
well/cpm of a control well).times.100.
EXAMPLE 9
Identification of Genes Critical for Growth of Liver Cancer
Cells
[0270] It is possible that several copies of a particular cDNA may
be present within a random gene unidirectional subtracted antisense
library. Therefore, in order to determine the uniqueness of the
identified 153 clones, these clones were individually
sequenced.
[0271] Purified recombinant phagemids obtained by alkaline lysis
method were sequenced from the 5' end of the (+) strand of the cDNA
region by employing T3 primer. The elucidated sequence for each
clone was compared with GenBank database, and 80 unique genes
(unigenes) were identified. Table 1 shows some of the functionally
identified genes involved in the growth of liver cancer cells.
Surprisingly, 44 of the 80 unigenes were of unknown function.
EXAMPLE 10
Functional Profiling of Antisense Compounds Against Disease Cells
in a Macroarrary Configuartion
[0272] To study the antisense activity profile of the 80 genes
obtained from the unidirectional subtracted liver antisense
library, cultured cells of Hep3B (liver cancer), NCI-H1299
(non-small lung cancer), AGS (stomach cancer), HT-29 (colon cancer)
and HepG2 (liver cancer) were transfected simultaneously with an
antisense macroarray composed of the 80 selected LC-antisense
compounds.
[0273] Antisense compounds of the macroarray were mixed with
various carriers such as peptides, DOTAP, and cationic liposomes in
various ratios (w/w). The mixture was added to various amounts of
cells according to their growth characteristics. Experimental cells
treated with the LC-antisense compound-carrier complex and controls
cells treated with carrier alone were incubated for 3 to 5 days and
were subjected to MTT reduction assay twice. To examine the
activity profile, the amount of growth inhibition was calculated,
and the data were compared between the different types of cancerous
cell lines (FIG. 19). Surprisingly, it was discovered that 7
LC-antisense compounds specifically, potently and differentially
inhibited HepG2 cell growth (Table 2).
[0274] These results demonstrate that not only direct gene
functionalization, but validation of target genes for molecular
therapeutics to a particular disease can be performed
simultaneously with the high-throughput system for functional
genomics of the present invention.
[0275] All of the references cited herein are incorporated by
reference in their entirety.
[0276] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention
specifically described herein. Such equivalents are intended to be
encompassed in the scope of the claims.
1TABLE 1 Examples of Functionally Identified Genes Involved in the
Growth of Liver Cancer Cells GenBank Accession Name of the Gene
Number Homo sapiens, HSPC025, clone MGC:4223 IMAGE:2959747 BC007510
Homo sapiens, tissue inhibitor of metalloproteinase 1 XM_033878
Homo sapiens, alpha-fetoprotein (AFP) NM_001134 Homo sapiens,
hypothetical protein FLJ14075 NM_024894 Homo sapiens,
apolipoprotein A-II (APOA2) NM_001643 Homo sapiens, clone MGC:20176
IMAGE:3503710 BC018990 Homo sapiens, eukaryotic translation
initiation factor 4A, isoform 2 NM_001967 (EIF4A2) Homo sapiens,
cytochrome P450, subfamily IIE (ethanol-inducible) XM_051310
(CYP2E) Homo sapiens, Similar to serine (or cysteine) proteinase
inhibitor, BC011991 clade A (alpha-1 antiproteinase, antitrypsin),
member 1, clone MGC:9222 IMAGE:3859644
[0277]
2TABLE 2 Examples of Genes Which Specifically and Differentially
Affect Cell Growth of HepG2 GenBank Accession Name of the Gene
Number EST_Human IL3-UT0117-160301-504-H11 BI062502 Homo sapiens,
Apolipoprotein A-II, clone MGC:12334 BC005282 Homo sapiens, PRO2675
mRNA, complete cds AF119890 Homo sapiens, clone RP11-449G13 from
16, complete sequence AC020716 Homo sapiens, BAC clone RP11-360H4
from 2, complete sequence. AC019086 Homo sapiens, hypothetical gene
supported by AK023036 XM_030445 (LOC90271), mRNA Homo sapiens,
similar to cytochrome b5 outer mitochondrial XM_015216 membrane
precursor (H. sapiens) (LOC124229), mRNA
[0278]
Sequence CWU 1
1
22 1 33 DNA Artificial Sequence Artificial Sequence Synthetic
Primer 1 gatcgtcgac gatgagcaca gaaagcatga tcc 33 2 33 DNA
Artificial Sequence Artificial Sequence Synthetic Primer 2
gatcgaattc gtcacagagc aatgactcca aag 33 3 33 DNA Artificial
Sequence Artificial Sequence Synthetic Primer 3 gatcgtcgac
gcgccacccg gcttcagaat ggc 33 4 33 DNA Artificial Sequence
Artificial Sequence Synthetic Primer 4 gatcgaattc ggtgaagctg
ccagtgctat ccg 33 5 25 DNA Artificial Sequence Artificial Sequence
Synthetic Primer 5 cttccagtgc cccctcctcc accgc 25 6 22 DNA
Artificial Sequence Artificial Sequence Synthetic Primer 6
catctccctc cggaaaggac ac 22 7 20 DNA Artificial Sequence Artificial
Sequence Synthetic Primer 7 cggatgaaca cgccagtcgc 20 8 22 DNA
Artificial Sequence Artificial Sequence Synthetic Primer 8
gatgagaggg agcccatttg gg 22 9 44 DNA Artificial Sequence Artificial
Sequence Synthetic Primer 9 ttttgtacct cgagtttttt tttttttttt
tttttttttt tttt 44 10 10 DNA Artificial Sequence Artificial
Sequence Synthetic Primer 10 acctgcccgg 10 11 44 DNA Artificial
Sequence Artificial Sequence Synthetic Primer 11 ctaatacgac
tcactatagg gctcgagcgg ccgcccgggc aggt 44 12 10 DNA Artificial
Sequence Artificial Sequence Synthetic Primer 12 acctcggccg 10 13
42 DNA Artificial Sequence Artificial Sequence Synthetic Primer 13
ctaatacgac tcactatagg gcagcgtggt cgcggccgag gt 42 14 22 DNA
Artificial Sequence Artificial Sequence Synthetic Primer 14
tcgagcggcc gcccgggcag gt 22 15 20 DNA Artificial Sequence
Artificial Sequence Synthetic Primer 15 agcgtggtcg cggccgaggt 20 16
72 DNA Artificial Sequence Artificial Sequence Synthetic Primer 16
ccccctcgag gtcgacgatg agcacagaaa gcatgatccg agatgtggaa ctggcagagg
60 aggcgctccc ca 72 17 12 RNA Artificial Sequence Artificial
Sequence Synthetic Primer 17 aaaaaaaaaa aa 12 18 17 DNA Artificial
Sequence Artificial Sequence Synthetic Primer 18 tcgagttttt ttttttt
17 19 13 DNA Artificial Sequence Artificial Sequence Synthetic
Primer 19 caaaaaaaaa aaa 13 20 30 DNA Portion of Human RBP 56/hTAF
II 20 tccaccgcgg tggcggccgc ccgggccgta 30 21 63 DNA Portion of
a-fetoprotein 21 catgagcact gttgcagagg agatgtgctg gattgtctgc
gggatgggga aaaaatcatg 60 tcc 63 22 62 DNA Portion of Homo sapiens
chromosome 17, clone hC 22 ctgggcaaca agcgaaaaac tctctcaaaa
aaaagaaaag aaaagaaata gacccagaag 60 tg 62
* * * * *