U.S. patent application number 10/062447 was filed with the patent office on 2002-11-07 for expression of active human factor ix in mammary tissue of transgenic animals.
This patent application is currently assigned to AMERICAN CROSS & VIRGINIA TECH INTELLECTUAL PROPERTIES, INC.. Invention is credited to Drohan, William N., Johnson, John L., Johnson, Mary Ann H., Lubon, Henryk, Velander, William H..
Application Number | 20020166130 10/062447 |
Document ID | / |
Family ID | 21892688 |
Filed Date | 2002-11-07 |
United States Patent
Application |
20020166130 |
Kind Code |
A1 |
Velander, William H. ; et
al. |
November 7, 2002 |
Expression of active human factor IX in mammary tissue of
transgenic animals
Abstract
Recombinant Factor IX characterized by a high percentage of
active protein can be obtained in the milk of transgenic animals
that incorporate chimeric DNA molecules according to the present
invention. Transgenic animals of the present invention are produced
by introducing into developing embryos DNA that encodes Factor IX,
such that the foreign DNA is stably incorporated in the DNA of germ
line cells of the mature animal. Particularly efficient expression
was accomplished using a chimeric construct comprising a mammary
gland specific promoter, Factor IX cDNA that lacked the complete or
any portion of the 5'-untranslated and 3'-untranslated region,
which is substituted with a 5-' and 3'- end of the mouse whey
acidic protein gene. In vitro cell cultures of cells explanted from
the transgenic mammal of the invention and methods of producing
Factor IX from such said culture and methods of treating hemophilia
B are also described.
Inventors: |
Velander, William H.;
(Blacksburg, VA) ; Drohan, William N.;
(Springfield, VA) ; Lubon, Henryk; (Rockville,
MD) ; Johnson, John L.; (Blacksburg, VA) ;
Johnson, Mary Ann H.; (Blacksburg, VA) |
Correspondence
Address: |
FOLEY AND LARDNER
SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
AMERICAN CROSS & VIRGINIA TECH
INTELLECTUAL PROPERTIES, INC.
|
Family ID: |
21892688 |
Appl. No.: |
10/062447 |
Filed: |
February 5, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10062447 |
Feb 5, 2002 |
|
|
|
09367087 |
Sep 15, 1999 |
|
|
|
6344596 |
|
|
|
|
09367087 |
Sep 15, 1999 |
|
|
|
PCT/US98/02638 |
Feb 13, 1998 |
|
|
|
60037145 |
Feb 14, 1997 |
|
|
|
Current U.S.
Class: |
800/7 ; 514/14.2;
514/15.3; 530/384 |
Current CPC
Class: |
A01K 67/0278 20130101;
A61P 7/04 20180101; A01K 2217/00 20130101; A61P 43/00 20180101;
A01K 2227/108 20130101; A01K 2267/01 20130101; C12Y 304/21022
20130101; A01K 2267/03 20130101; C12N 9/644 20130101; A61K 38/36
20130101; A01K 2227/105 20130101; A61P 7/00 20180101; C12N 15/8509
20130101; A01K 67/0275 20130101; A01K 2207/15 20130101; A01K
2217/05 20130101 |
Class at
Publication: |
800/7 ; 514/12;
530/384 |
International
Class: |
A61K 038/37; C12P
021/00 |
Claims
What is claimed is:
1. A method of treating a patient having hemophilia B comprising
administering to said patients a hemophilia B symptom preventing or
ameliorating amount of Factor IX produced by the non-human
transgenic mammal and a pharmaceutically acceptable carrier.
2. A method of claim 1, wherein said Factor IX is biologically
active human Factor IX.
3. A method of claim 1, wherein said non-human transgenic mammal is
selected from the group consisting of mice, rats, rabbits, pigs,
sheep, goats and cows.
4. A method of claim 3, wherein said non-human transgenic mammal is
a pig and secretes biologically active human Factor IX per
milliliter of milk.
5. A method of claim 2, wherein said biologically active human
Factor IX has a specific activity that is at least about 5-200%
greater than the specific activity of human Factor IX isolated from
human plasma.
6. A method of claim 5, wherein said non-human transgenic mammal is
a pig.
7. A method of claim 2, wherein said amount of said human Factor IX
that is administered comprises about 18-30 IU/kg administered once
a week.
8. A method of claim 2, wherein said administration of said human
Factor IX raises Factor IX levels 20% or greater in the blood.
9. A biologically active human Factor IX produced in a non-human
transgenic mammal, said Factor IX comprising a specific activity
that is at least about 5-200% greater than the specific activity of
human Factor IX isolated from human plasma.
10. A biologically active human Factor IX of claim 9, wherein said
non-human transgenic mammal is a pig.
Description
CROSS-REFERENCE TO RELATED PATENT APPLICATIONS
[0001] This application is a division of application No.
09/367,087, filed Sep. 15, 1999, now pending, which is a 371 of
PCT/US98/02638, filed Feb. 13, 1998, which claims benefit of
60/037,145 filed Feb. 14, 1997. This application claims only
subject matter disclosed in the parent application and therefore
presents no new matter.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to the production of natural
and modified forms of Factor IX. In particular, the invention
relates to a transgenic animal containing, stably incorporated in
its genomic DNA, an exogenous Factor IX gene that is expressed
specifically in mammary tissue, such that Factor IX is secreted
into milk produced by the animal. In particular, the invention
relates to the production of human Factor IX in the milk of a
transgenic non-human mammal using a DNA molecule that comprises a
whey acidic protein promoter gene, 5' regulatory sequences
containing the promoter, human Factor IX cDNA that lacks at least a
portion of the complete or any portion of or the complete the
3'-untranslated region of the native human Factor IX gene, but
contains the 5' and 3'-untranslated region of the mouse whey acidic
protein. gene.
[0004] 2. Background
[0005] Human Factor IX, or "Christmas factor," is encoded by a
single-copy gene residing on the X-chromosome at q27.1. For a
review of Factor IX gene structure and expression, see High et al.,
"Factor IX," in MOLECULAR BASIS OF THROMBOSIS AND HEMOSTASIS, High
(ed.), pages 215-237 (Dekker 1995); Kurachi et al., Thromb.
Haemost. 73:333 (1995). The Factor IX gene is at least 34 kilobase
(kb) pairs in size, and it is composed of eight exons. The major
transcription start site of the Factor IX gene in human liver is
located at about nucleotide-176. The human Factor IX mRNA is
composed of 205 bases for the 5' untranslated region, 1383 bases
for the prepro Factor IX, a stop codon and 1392 bases for the 3'
untranslated region.
[0006] Factor IX is synthesized as a prepropolypetide chain
composed of three domains: a signal peptide of 29 amino acids, a
propeptide of 17 amino acids, which is required for
.gamma.-carboxylation of glutamic acid residues, and a mature
Factor IX protein of 415 amino acid residues. The Factor IX zymogen
undergoes three types of post-translational modifications before it
is secreted into the blood: a vitamin K-dependent conversion of
glutamic acid residues to carboxyglutamic acids, addition of
hydrocarbon chains, and .beta.-hydroxylation of an aspartic acid.
Mature Factor IX protein contains 12 .gamma.-carboxylated glutamic
acid (Gla) residues. Due to the requirement of vitamin K by
.gamma.-carboxylase, Factor IX is one of several vitamin
K-dependent blood coagulation factors.
[0007] The activation of Factor IX is achieved by a two-step
removal of the activation peptide (Ala.sup.146-Arg.sup.180) from
the molecule. Bajaj et al., "Human factor IX and factor IXa," in
METHODS IN ENZYMOLOGY (1993). The first cleavage is made at the
Arg.sup.145-Ala.sup.146 site by either Factor XIa or Factor
VIIa/tissue factor. The second, and rate limiting cleavage is made
at Arg.sup.180-Val.sup.181. The activation pathways involving
Factor XIa and Factor VIIa/tissue factor are both
calcium-dependent. However, the Factor VIIa/tissue factor pathway
requires tissue factor that is released from damaged endothelial
cells. Activated human Factor IX thus exists as a disulfide linked
heterodimer of the heavy chain and light chain. For full biological
activity, human Factor IX must also have the propeptide removed and
must be fully .gamma.-carboxylated. Kurachi et al., Blood
Coagulation and Fibrinolysis 4:953 (1993).
[0008] Factor IX is the precursor of a serine protease required for
blood clotting by the intrinsic clotting pathway. Defects in Factor
IX synthesis result in hemophilia B (or Christmas disease), an
X-linked disorder that occurs in about one in 30,000 males.
Patients with hemophilia B are treated with Factor IX obtained from
pooled plasma from normal individuals. Martinowitz et al., Acta
Haematol 94(Suppl. 1):35 (1995). Such Factor IX preparations,
however, may be pyrogenic and may be contaminated with pathogenic
agents or viruses. Accordingly, it would be advantageous to develop
a means to prepare purified Factor IX that did not require
extraction from human plasma.
[0009] In the past, therapeutic proteins have been produced in E.
coli. However, limitations in secretion and post-translational
modification which occur in all living cells has rendered
recombinant protein production a highly species, tissue and cell
specific phenomena. In an example of recombinant FIX expression in
mammalian cells, the populations of recombinant FIX produced in
baby hamster kidney cells are not the same protein products as FIX
produced in Chinese hamster ovary cells (Busby et al., Nature
316:684-686 (1985); Kaufman et al., J. Biol. Chem. 261: 9622-9628
(1986)). These proteins have profound differences in
.gamma.-carboxylation and propeptide removal and these differences
have been established as being very important in determining
biological activity. Most importantly, only less than about 40
milliunits/hr/ml of active rFIX were detected in CHO cells even
after coexpression of the propeptide cleaving enzyme PACE,
coexpression of the carboxylase enzyme, and extensive gene
amplification with methotrexate in an attempt to increase
expression level and activity (Wasley et al.J. Biol. Chem. 268:
8458-8465 (1993); Rehemtulla et al., Proc. Natl. Acad. Sci. (USA),
90: 4611-4615 (1993)). Researchers concluded that multiple
limitations in the secretion of active rFIX exist in mammalian
cells (Rehemtulla et al., 1993) and that the problem of gene
transcription was secondary and indeed trivial with respect to
post-translational processing of biologically active rFIX in
mammalian cells. Thus, FIX mRNA splicing is a species specific
effect occurring in mice and perhaps sheep, but not pigs. Although
one might hypothesize that a FIX could be expressed, one could not
predict with any certainty whether such product would be a
clinically acceptable, practical, recombinant therapeutic FIX
product for a given hemophiliac indication.
[0010] Production of recombinant Factor IX in mammalian cell
culture (HepG2, mouse fibroblast, mouse hepatoma, rat hepatoma,
BHK, CHO cells) repeatedly has been shown to be recalcitrant and
cell-system specific with respect to intracellular restrictions on
secretion and proteolytic processing, post-translational
modification, expression levels, biological activity, downstream
recovery from production media, and substantiation of circulation
half-life (Busby et al., (1985); de la Salle et al. Nature 316:
268-270 (1985); Anson et al., Nature 315: 684-686 (1985);
Rehemtulla et al., 1993; Wasley, et al., (1993); Kaufman et al.,
(1986); Jallat et al., EMBO J. 9: 3295-3301 (1990)). Importantly,
the aforementioned works concluded that nontrivial improvements in
these combined criteria are needed if a practical prophylactic FIX
therapeutic product is to be made available from any recombinant
mammalian cell production source. For example, attempts to increase
the specific activity of rFIX produced by CHO cells by rectifying
problems with under-carboxylation by co-expression of the vitamin
K-dependent carboxylase enzyme resulted in no improvement in
.gamma.-carboxylation or biological activity (Rehemtulla et al.,
(1993), implying that multiple rate limitations in this
post-translational modification exist.
[0011] Similar difficulties in the production of significant
amounts of biologically active rFIX in the mammary epithelial cells
of transgenic animals also has been documented in the literature.
Although WO-A-90/05188 and WO-A-91-08216 predict that production of
rFIX should be possible in their production systems, no data are
presented in WO-A-91-08216, and only very low levels of secreted
rFIX (25 ng/ml) with no biological activity were reported in
transgenic sheep in WO-A 90/05188 and in related publications
(Clark et al., Bio/Technology 7: 487-4992 (1989)). Higher
expression levels have recently been reported in the milk of sheep
(5 .mu.g/ml), but again, the product had no biological activity
(Colman, IBC Third International Symposium on Exploiting Transgenic
Technology for Commercial Development, San Diego, Calif. (1995)).
This demonstrates that the polypeptides produced in WO-A-90/05188,
Clark et al. (1989), and Colman (1995) were a different species
than native human FIX with dissimilar biological activity to human
FIX, and could never be used for therapeutic purposes. Work by
Clark et al. (1992) stated that problems in synthesis of rFIX in
the mammary gland of transgenic mice was the result of aberrant
splicing of the rFIX MRNA in the 3' untranslated region. Correction
of the aberrant splicing in transgenic mice has been demonstrated
(Yull et al. Proc. Natl. Acad. Sci. USA 92: 10899-10903 (1995);
Clark, et al. (1989), WO 95/30000)), resulting in higher expression
levels (up to 61 .mu.g/ml) with about 40% biological active
material. However, this aberrant splicing phenomenon appears to be
species- and tissue-specific in the mouse mammary gland; other
reports with the 3' UTR sequences in CHO cell lines and in the
liver of transgenic mice specifically show no evidence of aberrant
splicing (Kaufinan et al., (1986); Jallat et al., (1990)). In
addition, no evidence was reported for aberrant MRNA splicing of
FIX transcripts with 3' UTR sequences in a human hepatoma cell line
(de la Salle et al., (1985)), a mouse fibroblast cell line (de la
Salle et al., (1985)), a rat hepatoma cell line (Anson et al.,
1985)), or a BHK cell line (Busby et al., (1985)). No data are
presented to justify the prediction that the altered transgene of
WO95/30000 will necessarily improve the secretion and biological
activity of rFIX in the milk of transgenic livestock or any other
cell line. Therefore the claims presented in WO 95/30000 are purely
speculative and are limited to the mammary gland of transgenic
mice.
[0012] The stability of the rFIX product in the milk of transgenic
livestock during upstream and downstream processing is a critical
issue for the production of a practical therapeutic. Data presented
in Clark et al. (1989) showed that Clark's method of downstream
recovery of what little rFIX was in the milk of their transgenic
sheep was not reproducible: in one of the preparations, a
significant amount of rFIX was proteolytically activated. The
infusion of activated FIX (FIXa) into a patient is fatal (Kingdon
et al., Thrombosis, Diathes. Haemorrh. (Stuttg.) 33: 617 (1975)).
FIX can be activated by FXI and/or FVIIa/Tissue factor complex in
the presence of calcium and phospholipids (Kurachi et al., Blood
Coagulation and Fibrinolysis 4: 953-974 (1993)). Milk is a medium
containing calcium and phospholipid surfaces. In addition, there is
extensively conserved homology between mammalian blood coagulation
factors, especially between porcine FXI and human FXI (Mashiko and
Takahashi, Biol. Chem. Hoppe-Seyler 375: 481-484 (1994)).
Detectable levels of porcine FVII(a) and FXI(a) in the milk of
nontransgenic pigs, and elevated levels of FVII(a) and FXI(a) in
the milk of a pig with mastitic milk have been measured. Thus, one
could predict that the recovery of a useful unactivated rFIX
produced in the milk of transgenic livestock will be very sensitive
to the health of the mammary gland (i.e., no subclinical or
clinical mastitis), to the milking procedure (i.e., no tissue
damage), to pretreatment of the milk immediately after collection,
to storage of the milk before processing, and to the purification
and formulation process itself. One would also predict that the
undesirable in vivo activation of rFIX also can be minimized by the
coexpression of inhibitors to FVIIa/TF such as the Tissue Factor
Pathway Inhibitor (TFPI) protein, also called LACI, or the hybrid
protein FX-LACI which is also a known inhibitor to FVIIa/TF.
Although specific inhibitors of FXIa have not been identified, a
similar approach can be made for neutralizing FXIa activation by
coexpression of analogues of polypeptide substrates of FXIa similar
to those that are commercially available for amidolytic assays. Yet
another strategy may be to overexpress rFIX at very high levels
(>1 g/l milk) such that the FIX activating enzyme is extremely
limiting. Otherwise, steps must be taken immediately after milk
collection to minimize activation. These include, but are not
limited to, chelation of calcium (e.g., addition of EDTA),
phospholipid removal, adjustment of pH, storage in ultra-low
freezers, controlled thawing procedures, addition of protease
inhibitors, and purification procedures that maintain minimal
activation conduciveness. If activated rFIX still persists in the
purified product, removal can be facilitated by lectin
chromatography(N-linked carbohydrate moieties exist only in the
activation peptide), immunoaffmity chromatography using a Mab
directed to the activation peptide, or by metal ion induced
precipitation techniques that can select for the differences in
molecular stability of unactivated vs. activated FIX. Because of
these inherent difficulties in production of active FIX at
sufficiently high levels in mammalian cells and transgenic
livestock, gene therapy has been cited as perhaps a more practical
way of achieving a prophylactic therapeutic rather than recombinant
technology (Kurachi et al., (1993); Kay et al., Proc. Natl. Acad.
Sci. USA 91: 2353-2357 (1994)); Fallaux et al., Thromb-Haemost. 74:
266-73 (1995)). This is certainly a profound reality because it
specifically teaches a product suitable for FIX prophylaxis has not
yet been found using recombinant production in mammalian cells,
even those that have been shown to express active FIX, albeit at
low levels. The best recombinant FIX cell production system made
from CHO cells is produced at low secretion levels (Rehemtulla et
al., (1993)) and is in fact not suitable for prophylaxis.
Furthermore, the data have shown that the homologous plasma
proteins FIX and protein C all have very different, cell-specific
restrictions on post-translational processing, proteolytic
processing, and secretion which preclude on a protein-specific
basis the predictability of high expression levels, biological
activity, downstream recovery from production media, and
predictable circulation half-life (Grinnell et al., "Native and
Modified recombinant human protein C: function, secretion, and
postranslational modifications," In Protein C and Related
Anticoagulants, eds. D. F. Bruley and Drohan 29-63, Gulf Publishing
Co., Houston, Tex. (1990); Yan et al., Trends in Biochem. Sci.
(1989); Busby et al., (1985)).
[0013] Therefore, a need still exists for a means to obtain
significant amounts of purified Factor IX from a source other than
human plasma. A need also exists for a practical means for
producing in mammalian cells rFIX, which is suitable as a treatment
for hemophilia B.
SUMMARY OF THE INVENTION
[0014] Accordingly, it is an object of the present invention to
provide a method for producing a transgenic animal that secretes
biologically human active Factor IX into its milk.
[0015] It is a further object of this invention to provide a
transgenic animal that produces at least 100 .mu.g of human Factor
IX per milliliter of milk.
[0016] These and other objects are achieved, in accordance with one
embodiment of the present invention by the provision of a
transgenic non-human mammal containing an exogenous DNA molecule
stably integrated in its genome.
[0017] A non-human transgenic mammal containing an exogenous DNA
molecule stably integrated in its genome, wherein said exogenous
DNA molecule comprises:
[0018] (a) 5' regulatory sequences of a mammary gland-specific gene
including a promoter;
[0019] (b) a Factor IX-encoding DNA sequence that encodes a signal
sequence, a Factor IX pro-sequence and a Factor IX sequence in a 5'
to 3' direction, wherein said signal sequence is effective in
directing the secretion of said Factor IX into the milk of said
transgenic mammal and wherein said Factor IX sequence lacks at
least a portion of the complete or the complete 5'-untranslated and
3'-untranslated regions of the Factor IX gene.; and
[0020] (c) 3' regulatory sequences from a mammary gland-specific
gene or 3' regulatory sequences active in a mammary gland;
[0021] wherein said 5' and said 3' regulatory sequences are
operatively linked to said Factor IX-encoding DNA sequence.
[0022] Mammary gland-specific promoters that are useful in the
present invention are selected from the group consisting of short
whey acidic protein (WAP) promoter, long WAP promoter, short
.alpha.-casein promoter, short .beta.-casein promoter, short
kappa-casein promoter, long .alpha.-casein promoter, long
.beta.-casein promoter, long kappa-casein promoter,
.alpha.-lactalbumin promoter and .beta.-lactoglobulin promoter.
[0023] Non-human transgenic mammals which are contemplated by the
present invention are selected from the group consisting of mice,
rats, rabbits, pigs, sheep, goats and cows.
[0024] It is a further object to provide a process for producing
Factor IX by providing a non-human transgenic mammal having
integrated into its genome an exogenous DNA molecule, wherein said
exogenous DNA molecule comprises:
[0025] (a) providing a non-human transgenic mammal having
integrated into its genome an exogenous DNA molecule, wherein said
exogenous DNA molecule comprises: (1) 5' regulatory sequences of a
mammary gland-specific gene including a promoter; (2) a Factor
IX-encoding DNA sequence that encodes a signal sequence, a Factor
IX pro-sequence and a Factor IX sequence in a 5' to 3' direction,
wherein said signal sequence is effective in directing the
secretion of said Factor IX into the milk of said transgenic mammal
and wherein said Factor IX sequence lacks at least a portion of the
complete or the complete 5'-untranslated and 3'-untranslated
regions of the Factor IX gene.; and (3) 3' regulatory sequences
from a mammary gland-specific gene or 3' regulatory sequences
active in a mammary gland;
[0026] wherein said 5' and said 3' regulatory sequences are
operatively linked to said Factor IX-encoding DNA sequence;
[0027] (b) allowing said DNA sequences encoding said Factor IX to
be expressed and said Factor IX to be secreted into the milk of
said transgenic mammal;
[0028] (c) collecting said milk from said mammal; and
[0029] (d) isolating said Factor IX from said milk.
[0030] It is a further object to provide a method of treating
hemophilia B using the Factor IX produced by the transgenic mammal,
described above. Treating involves administration of the Factor IX
of the invention and a pharmaceutically acceptable carrier to a
hemophilia B patient.
[0031] It is a further object of the invention to provide an in
vitro culture of mammary gland cells that produce Factor IX.
Another object of the invention is to provide a method of treating
hemophilia B by implanting such Factor IX mammary gland cells into
a patient.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIGS. 1A-1D schematically depict the construction of a
chimeric Factor IX construct. Specifically, FIG. 1A shows the
construction of pWAP4. FIG. 1B shows the production of pUCFIX. FIG.
1C shows the introduction of human FIX cDNA into pWAP4. FIG. 1D
shows the production of pUCWAPFIX. FIX cDNA was modified by PCR in
order to introduce KpnI sites on the 3' and 5' ends. Using FIX cDNA
as a template, PCR primers humFIX5'KpnI and humFIX3'KpnI, as shown
in Table 1, below, were used to produce FIX cDNA with KpnI sites on
both ends. Modified cDNA may be easily into a "cassette vector" for
constructing a chimeric gene.
[0033] FIG. 2 shows the detection of recombinant Factor IX in
transgenic pig milk using western blot analysis.
[0034] FIGS. 3A-3C show the production of the pUCWAP6 "cassette
vector." Specifically, FIG. 3A shows the production of pUCNotI.
FIG. 3B shows the production of of pUCWAP5 and the production of a
fragment that contains the pUCNotI vector sequence flanked by
mWAP3'UTR. FIG. 3C shows the production of pUCWAP6.
[0035] FIG. 4 shows the production of plasmid pUCWAP6FIX.
DETAILED DESCRIPTION
[0036] 1. Overview
[0037] As discussed above, a method for producing significant
quantities of Factor IX in transgenic animals has been elusive.
Yull et al., Proc. Nat'l Acad. Sci. USA 92:10899 (1995), showed
that correction of a cryptic RNA splice site increases the amount
of Factor IX synthesized by transgenic animals. In these studies,
one transgenic mouse line produced about 27 .mu.g of biologically
active Factor IX per milliliter of milk, although, Factor IX levels
of individual mice of the line varied. Yull et al. speculated that
the variation was probably due to epigenetic instability.
[0038] In contrast, the studies presented herein show that
transgenic pigs can synthesize and secrete high levels (100-200
.mu.g/ml milk) of biologically active recombinant human Factor IX
in milk. Based on reduced and nonreduced SDS PAGE, the majority of
the recombinant human Factor IX population appears to be a single
chain polypeptide having a post-translationally modified structure
similar to human Factor IX. The recombinant human Factor IX
secreted into pig milk is biologically active and is able to
initiate clotting in Factor IX-deficient human plasma. This is the
first reported production of high levels of fully active,
sufficiently .gamma.-carboxylated, recombinant human Factor IX in
the milk of transgenic livestock.
[0039] 2. Methods for Producing Transgenic Animals
[0040] Notwithstanding past failures to express recombinant human
Factor IX with suitably high activity in several different
expression systems, the present invention provides methods for
obtaining recombinant Factor IX characterized by a high percentage
of active protein from the milk of transgenic animals. As used
herein, the term "animal" denotes all mammalian animals except
humans. It also includes an individual animal in all stages of
development, including embryonic and fetal stages. A "transgenic"
animal is any animal with cells that contain genetic information
received, directly or indirectly, by deliberate genetic
manipulation at the subcellular level, such as by microinjection or
infection with recombinant virus.
[0041] The genetic information to be introduced into the animal is
preferably foreign to the species of animal to which the recipient
belongs (i.e., "heterologous"), but the information may also be
foreign only to the particular individual recipient, or genetic
information already possessed by the recipient. In the last case,
the introduced gene may be differently expressed than is the
naturally occurring, or "native," gene.
[0042] The language "germ cell line transgenic animal" refers to a
transgenic animal in which foreign DNA has been incorporated into a
germ line cell, therefore conferring the ability to transfer the
information to offspring. If such offspring, in fact, possess some
or all of that information, then they, too, are transgenic
animals.
[0043] The transgenic animals of this invention are other than
human, including, but not limited to farm animals (pigs, goats,
sheep, cows, horses, rabbits and the like), rodents (such as mice),
and domestic pets (for example, cats and dogs). Livestock animals
such as pigs, sheep, goats and cows, are particularly
preferred.
[0044] Preferably, a transgenic animal of the present invention is
produced by introducing into single cell embryos appropriate
polynucleotides that encode human Factor IX, or fragments or
modified products thereof, in a manner such that these
polynucleotides are stably integrated into the DNA of germ line
cells of the mature animal, and are inherited in normal Mendelian
fashion.
[0045] In accordance with the invention, DNA molecules can be
introduced into embryos by a variety of means to produce transgenic
animals. For instance, totipotent or pluripotent stem cells can be
transformed by microinjection, calcium phosphate mediated
precipitation, liposome fusion, retroviral infection or by other
means. The transformed cells can then be introduced into embryos
and incorporated therein to form transgenic animals. In a preferred
method, developing embryos can be infected with retroviral vectors
and transgenic animals can be formed from the infected embryos. In
the most preferred method, however, the DNA molecules of the
invention are injected into embryos, preferably at the single-cell
stage, which are allowed to develop into mature transgenic animals.
However, the present invention is not limited to this preferred
method but other methods of making transgenic animals can be used
as described, for example, in Transgenic Animal Generation and Use
by L. M. Houdebine, Harwood Academic Press, 1997. Transgenic
animals also can be generated using methods of nuclear transfer or
cloning using embryonic or adult cell lines as described for
example in Campbell et al., Nature 380: 64-66 (1996) and Wilmut et
al., Nature 385: 810-813 (1997). Further a technique utilizing
cytoplasmic injection of DNA can be used as described in U.S. Pat.
No. 5,523,222.
[0046] Factor IX-producing transgenic animals can be obtained by
introducing a chimeric construct comprising Factor IX-encoding
sequences. An alternative method of producing transgenic animals is
to introduce a Factor IX chimeric construct with a second construct
that may provide higher expression more frequently than that
observed with the use of Factor IX constructs alone. As described
herein, such doubly-transgenic, or "bigenic," animals have native
WAP genomic sequences that are injected as separate constructs to
be concatenated in vivo as additional flanking sequences to the
target Factor IX cDNA construct.
[0047] Methods for obtaining transgenic animals are well-known.
See, for example, Hogan et al., MANIPULATING THE MOUSE EMBRYO,
(Cold Spring Harbor Press 1986); Krimpenfort et al., Bio/Technology
9:88 (1991); Palmiter et al., Cell 41:343 (1985); Kraemer et al.,
GENETIC MANIPULATION OF THE EARLY MAMMALIAN EMBRYO, (Cold Spring
Harbor Laboratory Press 1985); Hammer et al., Nature 315:680
(1985); Wagner et al., U.S. Pat. No. 5,175,385; Krimpenfort et al.,
U.S. Pat. No. 5,175,384, Janne et al., Ann. Med. 24:273 (1992),
Brem et al., Chim. Oggi. 11:21 (1993), Clark et al., U.S. Pat. No.
5,476,995, hereby incorporated by reference.
[0048] 3. Construction of Chimeric Genes
[0049] Suitable Factor IX-encoding DNA used for producing
transgenic animals can be obtained using human liver tissue as a
source for cloning the human Factor IX gene. The DNA coding for
Factor IX can be fused, in proper reading frame, with appropriate
regulatory signals, as described in greater detail below, to
produce a chimeric construct which is then amplified, for example,
by propagation in a bacterial vector, according to conventional
practice.
[0050] The amplified construct is thereafter excised from the
vector and purified for use in microinjection. The purification is
preferably accomplished by means of high performance liquid
chromatography (HPLC), which removes contamination of the bacterial
vector and from polysaccharides typically present when other
techniques, such as conventional agarose electroelution, are used.
The preferred HPLC method entails sorbing the construct onto an
anion-exchange HPLC support and selectively eluting the construct
from the support, preferably with an aqueous sodium chloride
solution, thereby to eliminate contamination from the vector.
Elution also may be effected by other means, such as a pH
gradient.
[0051] Alternatively, the excised construct can be purified by
ultracentrifugation through an aqueous sucrose or sodium chloride
gradient, gel electroelution followed by agarose treatment and
ethanol precipitation, or low pressure chromatography.
[0052] Since it is preferable that the construct have the minimum
amount of impurities, more than one cycle of HPLC or other
purification is advantageous. In particular, the use of
HPLC-purified DNA for microinjection, as described above, allows
for remarkably high transformation frequencies, on the order of 20%
or more, for example, in mice and pigs.
[0053] DNA constructs useful in the present invention provide a DNA
sequence encoding Factor IX, preferably human Factor IX, operably
linked to all the cis-acting signals necessary for mammary tissue
specific expression of Factor IX, post-translational modification
of Factor IX, secretion of Factor IX into milk, and full biological
activity of Factor IX. Although the present invention preferably
entails the use of DNA constructs that produce the desired or
native human Factor IX per se, the desired protein also may be
produced as a fusion protein containing another protein. For
example, the desired recombinant protein of this invention may be
produced as part of a larger recombinant protein in order to
stabilize the desired protein or to make its purification from milk
faster and easier. The fusion partners then are separated
chemically or enzymatically, and the desired protein isolated.
[0054] Methods for obtaining human, Factor IX-encoding DNA
molecules and nucleotide sequences of human Factor IX gene and cDNA
are provided, for example, by Kurachi et al., Proc. Nat'l Acad.
Sci. USA 79:6461 (1982), Choo et al., Nature 299:178 (1982), Anson
et al., EMBO J. 3:1053 (1984), Brownlee et al., international
publication No. WO 84/00560, Yull et al., Proc. Nat'l Acad. Sci.
USA 92: 10899 (1995), Clark, international publication No. WO
95/30000, and Meulien, U.S. Pat. No. 5,521,070 (1996). Human Factor
IX probes also can be obtained from the American Type Culture
Collection, Rockville, Md. (e.g., ATCC Nos. 61385, 79588, 79602, or
79610).
[0055] Alternatively, Factor IX-encoding DNA molecules may be
obtained by synthesizing the genes with mutually priming long
oligonucleotides. See, for example, Ausubel et al., supra, at pages
8.2.8 to 8.2.13; Wosnick et al., Gene 60:115 (1987). Moreover, the
polymerase chain reaction can be used to synthesize DNA fragments
as large as 1.8 kilobases in length. Bambot et al., PCR Methods and
Applications 2:266 (1993).
[0056] Suitable Factor IX-encoding DNA molecules include genomic or
complementary DNA molecules that encode naturally occurring Factor
IX. In a preferred embodiment, DNA molecules encoding human Factor
IX are employed, including cDNA and genomic DNA molecules. However,
the present invention discloses that a cDNA based construct as
described herein can be successfully used for the expression of
human Factor IX at commercially useful levels. Particularly a cDNA
based construct containing 5' regulatory sequences of a mammary
gland specific gene including a promoter, a Factor IX-encoding DNA
sequence as described herein, and 3' regulatory sequences from a
mammary gland-specific gene or 3' regulatory sequences active in a
mammary gland is preferred. Factor IX-encoding DNA molecules from
other species may also be used, such as the Factor IX encoded by
rats, pigs, sheep, cows and chimpanzees.
[0057] It also will be appreciated that the Factor IX cDNA fragment
described herein can be modified using recombinant DNA techniques
to obtain functionally equivalent molecules. For example, 3' or 5'
portions of the Factor IX gene can be added, or completely deleted,
or a few bases at either end may be removed. Introns can be removed
or added, or portions of one or more introns can be deleted.
Additional nucleotide sequences can be inserted into them. The
sequences of the introns can be altered. Exons can be modified in
accordance with the discussion of modified Factor IX molecules set
forth below. Most modified forms of the preferred Factor IX cDNA
fragment will not be significantly changed in their ability in
transgenic animals to engender the production of milk-born Factor
IX. In one embodiment, the Factor IX encoding portion of the gene
lacks the complete 5'-untranslated and 3'-untranslated regions of
the native Factor IX gene. Thus, these substantially similar
fragments will be equivalent in the invention to the particularly
disclosed Factor IX cDNA fragment.
[0058] A 5'-untranslated region that is not the 5'-untranslated
region of the Factor IX gene can be included in the present DNA
Factor IX constructs, particularly the 5'-untranslated region of
the mouse WAP gene. Likewise a 3'-untranslated region that is not
the 3'-untranslated region of the Factor IX gene, particularly the
3'-untranslated region of the mouse WAP gene.
[0059] Further, the Factor IX-encoding DNA molecule can also
comprise a 5'-untranslated region located 5' from the signal
sequence DNA, and a 3'-untranslated region located 3' from the
Factor IX coding sequence.
[0060] Additional useful modifications of Factor IX include those
that alter post-translational modifications, size or active site,
or that fuse this protein or portions thereof to another protein.
Such modifications can be introduced into the protein by techniques
well known in this art, such as by synthesizing modified genes by
ligation of overlapping oligonucleotide or introducing mutations
into the cloned genes by, for example, oligonucleotide-mediated
mutagenesis. See, generally, Ausubel et al. (eds.), CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY, pages 8.0.3-8.5.9 (1990); McPherson
(ed.), DIRECTED MUTAGENESIS: A PRACTICAL APPROACH, IRL Press
(1991).
[0061] The examples described herein demonstrate that a transgenic
animal can be produced that synthesizes a sufficiently
.gamma.-carboxylated, biologically active Factor IX in mammary
tissue. Accordingly, the basic methods of the present application
can be used to obtain transgenic animals that produce other vitamin
K-dependent blood coagulation factors, such as Factor II, Factor
VII, Factor X, or the anticoagulation protein, Protein S. DNA
molecules encoding these proteins can be obtained by standard
methods. See, for example, Pollak et al., J. Biol. Chem. 271: 1738
(1996), which describes the characterization of the Factor VII
gene, which is located on chromosome 13 just 2.8 kilobase pairs 5'
to the Factor X gene.
[0062] The cis-acting regulatory regions useful in the invention
include the promoter that drives expression of the Factor IX gene.
Promoters particularly useful in the invention are "active" in
mammary tissue in that the promoters are more active in mammary
tissue than in other tissues under physiological conditions where
milk is synthesized. Most preferred are promoters that are both
specific to and efficient in mammary tissue. By "efficient" it is
meant that the promoters are strong promoters in mammary tissue
that can support the synthesis of large amounts of protein for
secretion into milk. Among such promoters, highly preferred are the
short and long whey acidic protein (WAP), short and long .alpha.,
.beta. and kappa casein, .alpha.-lactalbumin and
.beta.-lactoglobulin ("BLG") promoters.
[0063] Promoters may be selected on the basis of the protein
compositions of milk from various species. For example, the WAP and
BLG promoters are particularly useful with transgenic rodents, pigs
and sheep. The rodent WAP short and long promoters have been used
to express the rat WAP gene, the human tissue-type plasminogen
activator gene and the CD4 gene, while the sheep BLG promoter has
been used to express the sheep BLG gene, the human
alpha-l-antitrypsin gene and the human Factor IX gene. See, for
example, Paleyanda et al., 1991, above, and Clark et al., TIBTECH
5: 20 (1987). Preferred promoters include the rodent casein and WAP
promoters, and the casein, (.alpha.-lactalbumin and BLG promoters
from porcine, bovine, equine and ovine (pigs, sheep, goats, cows,
horses), rabbits, rodents and domestic pets (dogs and cats). The
genes for these promoters have been isolated and their nucleotide
sequences have been published. See, for example, Clark et al.
(1987), above, and Henninghausen, Protein Expression and
Purification 41: 3 (1990).
[0064] A useful promoter may be isolated by carrying out
conventional restriction endonuclease and subcloning steps. A mouse
WAP promoter, isolated as a 2.6 kb EcoRI-KpnI fragment immediately
5' to the WAP signal sequence, is preferred, although the "long"
WAP promoter (the 5' 4:2 kb Sau3A-KpnI promoter of the mouse WAP
gene, or a fragment thereof) is also suitable for carrying out this
invention. The publication of Paleyanda et al., Transgenic Research
3: 335 (1994), for example, provides examples of a suitable short
mouse WAP promoter ("2.5 kb mWAP promoter") and a long mouse WAP
promoter ("4.1 kb mWAP promoter"). Pages 336-339 of the Paleyanda
publication are incorporated by reference. Also see, for example,
Gordon et al., Bio/Technology 5: 1183 (1987); McKnight et al., "The
Whey Acidic Protein," in GENES, ONCOGENES, AND HORMONES: ADVANCES
IN CELLULAR AND MOLECULAR BIOLOGY OF BREAST CANCER, Dickson et al.
(eds.), pages 399-412 (Kluwer Academic Publishers 1991). Additional
regulatory sequences direct secretion of proteins into milk and/or
other body fluids of the transgenic animal. In this regard, both
homologous and heterologous regulatory sequences are useful in the
invention. Generally, regulatory sequences known to direct the
secretion of milk proteins, such as either signal peptides from
milk or the nascent target polypeptide, can be used, although
signal sequences can also be used in accordance with this invention
that direct the secretion of expressed proteins into other body
fluids, particularly blood and urine. Examples of such sequences
include the signal peptides of secreted coagulation factors
including signal peptides of Factor IX, protein C, and tissue-type
plasminogen activator.
[0065] Among the useful sequences that regulate transcription, in
addition to the promoters discussed above, are enhancers, splice
signals, transcription termination signals, polyadenylation sites,
buffering sequences, RNA processing sequences and other sequences
which regulate the expression of transgenes. Particularly useful in
this regard are those sequences that increase the efficiency of the
transcription of the genes for Factor IX in the mammary gland or
other cells of the transgenic animals listed above. Preferred are
transcription regulatory sequences for proteins highly expressed in
the mammary gland cells.
[0066] Preferably, the expression system or construct of this
invention also includes a 3' untranslated region downstream of the
DNA sequence encoding the desired recombinant protein, or the 3'
untranslated region of the milk protein gene or the milk protein
gene with its 3' untranslated region, any of which can be used for
regulation. This region can increase expression of the transgene.
This region apparently stabilizes the RNA transcript of the
expression system and thus increases the yield of the desired
protein. Among the 3' untranslated regions useful in this regard
are sequences that provide a poly A signal.
[0067] For expression of Factor IX, it is preferred that the 3'
untranslated region is not obtained from the native human Factor IX
gene. Suitable heterologous 3'-untranslated sequences can be
derived, for example, from the SV40 small t antigen, the casein 3'
untranslated region, or other 3' untranslated sequences well known
in this art. Preferably, the 3' untranslated region is derived from
a milk-specific protein, such as the WAP protein. The stabilizing
effect of this region's poly A transcript is important in
stabilizing the mRNA of the expression sequence. Ribosome binding
sites are also important in increasing the efficiency of expression
of Factor IX. Likewise, sequences that regulate the
post-translational modification of Factor IX are useful in the
invention.
[0068] In a particularly preferred embodiment, the transgenes of
the invention generally consist of WAP milk protein regulatory
sequences upstream and downstream flanking the Factor IX
cDNA/signal peptide sequences. A native 5'-WAP regulatory sequence
ending in an accessible restriction site immediately before/at the
ATG codon may be ligated to the restriction sites that occur at the
ATG of translatable sequences with no linker sequences derived from
the chains of human Factor IX. Each of the combined 5'-regulatory
and Factor IX translatable sequences ending in a particular
restriction site may then be ligated to a corresponding restriction
site which occurs at the beginning of the 3'-untranslated region of
WAP and adjoining WAP 3'-flanking region. This construction motif
enables native 5'-regulatory and 3'-untranslated region of the milk
protein genes to be immediately juxtaposed without intervening
sequences. Particular restriction sites at the ends of all
constructs may be selected in order to facilitate concatenation of
constructs into a single domain within the animal genome.
[0069] Thus, in accordance with the present invention a DNA
molecule that encodes Factor IX is operably linked to cis-acting
regulatory sequences which allow for efficient expression of Factor
IX in milk. The resulting chimeric DNA is introduced into a
mammalian embryo, where it integrates into the embryonic genome and
becomes part of the heritable genetic endowment of all the cells,
including the germ line cells, of the adult which develops from the
embryo. The Factor IX which is expressed in the mammary tissue and
secreted into the milk of a transgenic mammal obtained in this
manner displays a surprisingly high percentage of active protein,
as measured by enzymatic and coagulation-inhibition assays which
are conventionally employed to detect Factor IX activity, such as
ELISAs, chromogenic activity assays and coagulation inhibition
assays.
[0070] 4. Isolation of Factor IX from the Milk of Transgenic
Animals
[0071] Obtaining milk from a transgenic animal according to the
present invention is accomplished by conventional means. See, for
example, McBurney et al., J. Lab. Clin. Med. 64:485 (1964);
Velander et al., Proc Nat'l Acad. Sci. USA 89:12003 (1992). Factor
IX, or fragments thereof, can be isolated and purified from milk or
urine by conventional means without deleteriously affecting
activity. A preferred method of isolation from milk consists of a
combination of anion exchange and immunochromatography,
cryoprecipitations, zinc ion-induced precipitation of either whole
milk or milk whey (defatted milk) proteins. See, for example,
Bringe et al., J. Dairy Res. 56:543 (1989).
[0072] Milk is known to contain a number of proteases that have the
potential to degrade foreign proteins. These include an alkaline
protease with tryptic and chymotryptic activities, a serine
protease, a chymotrypsin-like enzyme, an aminopeptidase and an acid
protease. Clark et al. (1987) above. It may be desirable,
therefore, to protect newly secreted Factor IX, or fragments
thereof, against proteolytic degradation. Such precautions include
rapid processing of the milk after collection and addition to the
milk of well known inhibitors of proteolysis, such as are listed in
SIGMA CHEMICAL CO. CATALOG (1993 edition) at page 850.
[0073] Thus, in one embodiment, the transgenic mammal of the
present invention produces active human Factor IX. For instance, in
one embodiment wherein said mammal is a pig, such pig secretes from
about 100 to about 220 .mu.g of active human Factor IX per
milliliter milk. In another embodiment, such pig secretes from
about 100 to about 185 .mu.g of active human Factor IX per
milliliter milk, from about 100 to about 170 .mu.g of active human
Factor IX per milliliter of milk, from about 135 to about 220 .mu.g
of active human Factor IX per milliliter of milk or from about 145
to about 220 .mu.g of active human Factor IX per milliliter of
milk, as set forth below.
[0074] Factor IX produced from the transgenic mammal according to
the invention has a specific activity which is at least about 5 to
200 percent greater than the specific activity of human Factor IX
isolated from human plasma, as determined by an activated partial
thromboplastin clotting time assay. In another embodiment, the
specific activity of Factor IX produced by the transgenic mammal of
the invention is at least about 10 to 100 percent greater, at least
about 15 to 50 percent greater or at least about 15 to about 46
percent greater than the specific activity of human Factor IX
isolated from human plasma.
[0075] In another embodiment, the invention relates to an in vitro
culture of mammary gland cells explanted from the transgenic mammal
of the invention. Such cells are explanted and cultured in vitro,
according to methods well known to the skilled artisan. See e.g.,
U.S. Pat. No. 5,580,781. In another embodiment, Factor IX is
isolated and purified from the in vitro cell culture, according to
methods well known to the skilled artisan.
[0076] 5. Treatment Methods
[0077] In another embodiment, the present invention relates to a
method of treating hemophilia B using Factor IX produced by the
transgenic mammal of the invention. Specifically, treatment
includes the prevention or amelioration of the symptoms of
hemophilia B in hemophilia B patients. Symptoms of hemophilia B
include excessive bleeding upon injury, spontaneous bleeding,
especially into weight-bearing joints, soft tissues and mucous
membranes. Repeated bleeding into joints results in hemarthroses,
which causes painful crippling arthropathy that necessitates joint
replacement. Hematomas in soft tissues may result in "pseudo"
tumors composed of necrotic coagulated blood. Such blood can
obstruct, compress or rupture into adjacent organs and can lead to
infection. Bleeding into gastrointestinal tract, central nervous
system, intracranium or airway/retroperitoneal space can lead to
death if not detected. This, treatment according to the present
invention includes the prevention or amelioration of bleeding and
the related side effects found in hemophilia B patients. This
method involves administering to a patient having hemophilia B
symptom, a hemophilia B symptom preventing or ameliorating amount
of Factor IX produced by the transgenic mammal of the present
invention. Administration may be accomplished by any method known
to the skilled artisan. For instance, the treatment of the above
described symptoms may consist of intravenous replacement therapy
with Factor IX concentrates. Treatment of major bleeding episodes
may be by bolus injection of concentrate. However, as described
above, tissue damage may remain even after prompt detection and
treatment. Prophylactic treatment is recommended to prevent pain
and debilitation. Upon injection, 50% of Factor IX, according to
the invention, is immediately bound to vascular endothelial cells
and/or diffuses into the extravascular space. The remaining 50% has
a half life in circulation of approximately 24 hours. These
infusion kinetics result in the need for injections about once to
twice per week to maintain minimal therapeutic levels in the
plasma.
[0078] Another embodiment of the invention relates to
pharmaceutical compositions comprising the Factor IX of the present
invention. Such pharmaceutical composition preferably is Factor IX
produced by the above described transgenic animal and a
pharmaceutically acceptable carrier. For instance, such
pharmaceutical composition may be a stable liquid formulation of
the Factor IX of the invention that can be administered by
continuous infusion to provide a constant circulating level of the
coagulation factor.
[0079] The Factor IX produced by the transgenic animal of the
present invention may be concentrated and sold in lyophilized form,
according to methods well known to the skilled artisan. For
instance, the Factor IX of the present invention which has been
lyophilized may be reconstituted with sterile water for injection
(WFI) and delivered in a composition of: 0.01 moles/liter
histidine, pH 7.05; 0.066 moles/liter sodium chloride; 3% mannitol.
In another embodiment, lyophilized Factor IX is reconstituted in
sterile WFI and delivered in a composition that includes: 0.04
units heparin/unit FIX; 1 milligram dextrose/unit Factor IX. To
avoid repeated invasive treatments as is found with the current
therapies for prophylaxis, stabilities of at least 30 days at
37.degree. C. and at least 365 days at 4.degree. C. are preferred.
The present invention provides significant stability over that of
these preparations reconstituted.
[0080] This skilled artisan would know of other suitable
formulations for the Factor IX of the present invention. See, for
instance, AlphaNine by Therapeutic Corporation, Los Angeles,
Calif., and Bebulin VH, by Immuno, Vienna, Austria. Of course, any
formulations according to the present invention are highly purified
and free of viruses, prions, blood-group antibodies, immune
complexes and phospholipids.
[0081] Dosages or amounts that prevent or ameliorate the symptoms
of hemophilia B are necessarily dictated by the clinical picture
and severity of the disease. Because there is so much variability
between patients and their clinical conditions, monitoring of
coagulation function is essential in during any therapy using the
Factor IX of the invention. As a rule, on initial treatment, one
unit of Factor IX per kg body weight gives a mean rise in Factor IX
activity of about 0.5-1%, on continuation therapy, the mean rise is
about 1-1.5% Examples of dosages for long term prophylaxis of
symptoms of hemophilia B are about 18-30 IU/kg (1.times. weekly) or
about 9-15 IU/kg (2.times. weekly). Dosages also will vary
depending upon the purpose of the treatment. For instance, where a
hemophilia B patient has had surgery, it may be desirable to raise
Factor IX levels in such patients by 30 to 50% following the week
of surgery. For dental extractions, the Factor IX levels may need
to be raised to 50% immediately prior to the surgery. Mild to
moderate hemorrhages may be treated with a single administration of
the Factor IX of the invention to raise Factor IX levels to 20 to
30%. In the even to more serious hemorrhages, it may be desirable
to raise Factor IX levels to 30 to 50% and infusions may be
required daily. Again, those of skill in the art would know how to
adjust the amount and frequency of dosages of the Factor IX of the
present invention depending upon the patient and the clinical
setting.
[0082] In yet another embodiment, the invention relates to a method
of treating hemophilia B using Factor IX-producing cells that are
explanted from the transgenic mammal of the present invention. Such
mammary gland cells express Factor IX in vivo, thereby preventing
or ameliorating the symptoms of hemophilia B. This method is
accomplished by using known techniques for gene therapy. See e.g.,
Debs, R. Proc. Natl' Acad. Sci. (USA) 89: 11277-11281 (1992),
Legendre et al., Pharmaceutical Res. 9: 1235-42 (1992). In one
embodiment, Factor IX-producing cells removed from the transgenic
mammal according to the invention are cultured in an in vitro
culture system prior to transplantation into a human. Such culture
systems are well known to the skilled artisan. See e.g. U.S. Pat.
No. 5,580,781. The cells are treated and then transplanted into the
patient in a manner so as to avoid rejection by the recipient. Such
methods are known to the skilled artisan. See, for instance, U.S.
Pat. No. 5,573,934, which teaches a method of encapsulating
biological material for use in vivo. Other techniques known to the
skilled artisan involve placing the biological material in a
chamber of an immunoisolation apparatus and for enhancing the
vascular support for the implanted material using immunomodulatory
agents. See, U.S. Pat. No. 5,569,462.
[0083] The present invention, thus generally described, will be
understood more readily by reference to the following examples,
which are provided by way of illustration and are not intended to
be limiting of the present invention.
EXAMPLE 1
Preparation of a Human Factor IX Expression Vector for Production
of Transgenic Pigs
[0084] Generally, the entire murine WAP gene including 2.5 kb of 5'
untranslated sequence and 3' untranslated regions was cloned by
standard methods. See Campbell et al., Nucleic Acids Res. 12:8685
(1984). A cDNA fragment encoding human Factor IX was obtained and
the 3' untranslated region was deleted. Using standard methods, an
expression vector was constructed that contained a mouse WAP
promoter, isolated as a 2.6 kb EcoRI-KpnI fragment immediately 5'
to the WAP signal sequence, the human Factor IX cDNA sequence
lacking a 3' untranslated region, and a 1.6 kb fragment of the 3'
untranslated region of the WAP gene. A second expression vector
contained a 7.2 kb mouse WAP gene (EcoRI-EcoRI) fragment.
Expression vectors were amplified by bacterial transformation and
purified from bacterial cultures using standard methods. Routine
recombinant DNA techniques can be found, for example, in Sambrook
et al., MOLECULAR CLONING, A LABORATORY MANUAL, Vol. 1-3 (Cold
Spring Harbor Press 1989).
[0085] More specifically, a chimeric Factor IX construct was
prepared, as follows:
[0086] 1. Preparation of a Chimeric Factor IX Construct Production
of pWAP4 "cassette vector"
[0087] Regulatory 5' and 3' flanking sequences of the mouse WAP
gene were used for mammary specific expression. Specifically, a
cassette vector containing a mouse WAP promoter, defined as a 2.6.
kb EcoRI-KpnI fragment immediately 5' to the WAP signal sequence
and a 1.5 kb fragment of the 3' untranslated region of the WAP gene
was prepared. These regulatory sequences do not include coding and
intragenic untranslated sequences (introns) of the WAP gene.
[0088] The vector designated pWAP4 was derived from pWAPPC3 (C.
Russell, dissertation "Improvement of Expression of Recombinant
Human Protein C in the Milk of Transgenic Mammal Using a Novel
Transgenic Construct," Virginia Technology Institute, Blacksburg,
Va. (December 1993)) and was developed as follows: Using WAPPC3 as
a template, PCR primers WAP3'S2 (which contains a 5'KpnI site and
is homologous to endogenous WAP right after the stop signal) and
WAP3'Al, as shown in Table 1, below, were used to produce a segment
with KpnI and BanmHI sites on either end. This segment was digested
with KpnI/BamHI and ligated with the vector containing the fragment
from KpnI.backslash.BamHI digested pWAPPC3. The ligation mixture
was used to transform E. coli DH5.alpha. cells by electroportation
with resultant colonies grown on LB ampicillin plates. Picked
colonies were grown up in TB ampicillin broth, plasmids isolated
and cut with KpnI, BamHI or both and subjected to gel
electrophoresis. Sequencing was performed using WAP3'A1 primer and
judged as being correct. See FIG. 1A.
[0089] Production of modified (Kpn I) FIX cDNA
[0090] The FIX cDNA (containing Kpn I sites located immediately
before the start sequence and after the stop sequence) was
generated as a PCR fragment. Fragment production protocol is as
follows: 100 .mu.l total volume containing 200 .mu.M dNTP's, 0.5
.mu.M of each primer (humFIX5'KpnI and humFIX3'KpnI, as shown in
Table 1), 2.5 units Pfu polymerase and 30 ng of plasmid template
(pMCDSFIX obtained from Prof. Darryl Stafford, Department of
Biology, University of North Carolina, Chapel Hill, N.C., USA),
reaction mixture was subjected to 30 cycles of denaturation at
95.degree. C. for 20 sec, annealing at 50.degree. C. for 1 min and
elongation at 75.degree. C. for 5 min 45 sec. After cycling, the
reaction mixture was subjected to blunting with T4 DNA polymerase
for 10 min, EDTA concentration brought up to 25 mM, heated to
65.degree. C. for 15 min, and extracted with Phenol: Chloroform
(1:1), precipitated with equal volumes of 95% ethanol, aspirated,
and suspended in H.sub.2O.
[0091] Ligation, Transformation and Sequencing
[0092] As is shown in FIG. 1B, the plasmid designated pUCFIX
containing the modified (Kpn I ends) FIX cDNA was produced by
digestion of both pUC18 and the modified cDNA with Kpn I (per
manufacturers instructions, Stratagene, La Jolla, Calif.)
purification of digestion products by CHCl.sub.3: Phenol (1:1)
extraction, precipitation with equal volumes of 95% ethanol,
aspiration and suspension in H.sub.2O. Ligation of plasmid and cDNA
was per manufacturers instructions (Stratagene) using 125 ng of Kpn
I digested pUC18 and 125 ng of Kpn I digested modified cDNA. E.
coli JM109 was transformed by electroportation using ligation
mixture and plated on LB ampicillin plates. Selected colonies were
grown up in TB ampicillin broth. Plasmid preparations from these
colonies were analyzed by restriction enzyme digestion (Kpn I) and
gel electrophoresis. The entire sense strand of the cDNA was
sequenced and found to be correct as compared with FIXA sequences
located in Genebank.
[0093] Introduction of FIX cDNA into pWAP4 "cassette vector" to
produce pWAPFIX
[0094] As shown in FIG. 1C, both pWAP4 and pUCFIX were digested
with Kpn I in separate reactions, subjected to gel electrophoresis
and the appropriate plasmid fragments removed from the gel and
ligated. E. coli JM109 was transformed by electroportation using
ligation mixture and plated on LB ampicillin plates. Selected
colonies were grown up in TB ampicillin broth. Plasmid preparations
from these colonies were analyzed by restriction enzyme digestion
(Kpn I) then gel electrophoresis. Clones positive for the insert
were subjected to PCR analysis using primers FIXS 1 and WAP3'A1 to
determine the correct orientation of the insert.
[0095] Production of pUCWAPFIX
[0096] As shown in FIG. 1D, the insert containing WAP promoter,
cDNA and 3'WAP UTR was released from pWAPFIX by EcoRI digestion,
subjected to gel electrophoresis, removed from the gel and
purified. This fragment was ligated with Kpn I digested pUC18 and
the reaction mixture used to transform E. coli JM109 by
electroportation. After electroportation, cells were plated on LB
ampicillin plates with picked colonies grown in TB ampicillin
broth. Plasmids from picked colonies were purified and subjected to
EcoRI enzyme digestion and electrophoresis. After insert
confirmation, large scale purification was undertaken, according to
methods well known to the skilled artisan.
[0097] 2. Preparation of Factor IX-Encoding DNA for
Microinjection
[0098] Chimeric constructs containing either the 7.2 kb mouse WAP
gene, or containing the WAP promoter, human Factor IX gene and 3'
WAP sequence were excised from pUCWAPFIX by EcoRI restriction
digest and purified for microinjection using low melting point
agarose electrophoresis. The DNA: agarose band was cut from the gel
slab. The agarose band was then treated with agarase to degrade and
remove agarose contamination.
[0099] After digestion, the solution containing the cDNA was
brought to 10 mM Mg2+, 20 mM EDTA and 0.1% SDS and then extracted
with phenol/chloroform. DNA was precipitated from the aqueous layer
with 2.5 volumes of ethanol in the presence of 0.3 M sodium acetate
ate -20 degrees centigrade overnight. After centrifugation, the
pellet was washed with 70% ethanol, dried, and each of the
constructs was resuspended and dissolved in Brinsters
microinjection buffer to a concentration of 1.4 or 7 .mu.g/ml (for
mice), 14 .mu.g/ml (for pigs).
[0100] According to another protocol, extracted DNA was purified by
HPLC, as follows. After cleaving a chimeric gene from its vector,
the solution was brought to 10 mM magnesium, 20 mM EDTA and 0.1%
SDS and then extracted with phenol/chloroform. DNA was precipitated
from the aqueous layer with 2.5 volumes of ethanol in the presence
of 0.3 M sodium acetate at -20.degree. C. overnight. After
centrifugation, the pellet was washed with 70% ethanol, dried, and
resuspended in sterile distilled water.
[0101] The digested DNA was precipitated with isopropanol and then
dissolved in TE buffer at 0.3 .mu.g/ml. Fragments were purified by
HPLC using a Waters GEN FAX PAC HPLC column. The column was run
isocratically using a buffer consisting of 25 mM Tris-HCl (pH 7.5),
1 mM sodium EDTA, and 0.63 M NaCl. About 15 .mu.g of digested DNA
was loaded on the column at a time. DNA samples from all of the
chromatographic runs were then pooled, reprecipitated, and run
through the column a second time.
[0102] DNA concentrations were determined by agarose gel
electrophoresis by staining with ethidium bromide and comparing the
fluorescent intensity of an aliquot of the DNA with the intensity
of standards. Samples were then adjusted to 10 .mu.g/ml and stored
at -20.degree. C., prior to microinjection.
EXAMPLE 2
Production of Transgenic Pigs That Express the Human Factor IX
Gene
[0103] Pig embryos were recovered from the oviduct, and were placed
into a 1.5 ml microfuge tube containing approximately 0.5 ml embryo
transfer media (Beltsville Embryo Culture Medium). Embryos were
centrifuged for 12 minutes at 16,000.times.g RCF (13,450 RPM) in a
microcentrifuge (Hermle, model Z231). The embryos were then removed
from the microfuge tube with a drawn and polished Pasteur pipette
and placed into a 35 mm petri dish for examination. If the
cytoplasm was still opaque with lipid such that pronuclei were not
visible, the embryos were centrifuged again for 15 minutes. Embryos
were then placed into a microdrop of media (approximately 100
.mu.l) in the center of the lid of a 100 mm petri dish, and
silicone oil was used to cover the microdrop and fill the lid to
prevent media from evaporating. The petri dish lid containing the
embryos was set onto an inverted microscope (Carl Zeiss) equipped
with both a heated stage and Hoffmuan Modulation Contrast optics
(200.times.final magnification). A finely drawn (Kopf Vertical
Pipette Puller, model 720) and polished (Narishige microforge,
model MF-35) micropipette was used to stabilize the embryos while
about 1-2 picoliters of HPLC-purified DNA solution containing
approximately 200-500 copies of a mixture of the two chimeric
constructs was delivered into the male pronucleus with another
finely drawn micropipette. Embryos surviving the microinjection
process as judged by morphological observation were loaded into a
polypropylene tube (2 mm ID) for transfer into the recipient
pig.
EXAMPLE 3
Production of pUCWAP6 "Cassette Vector" and plasmid pUCWAP6FIX
Production of pUCWAP6 "cassette vector"
[0104] Generally, the entire murine WAP gene was cloned by standard
methods, as described above in Example 1, and regulatory 5' and 3'
flanking sequences of the mouse WAP gene were used for mammary
specific expression. Specifically, a cassette vector containing a
mouse WAP promoter, defined as a 4.1 kb NotI-KpnI fragment
immediately 5' to the WAP signal sequence and a 1.6 kb fragment of
the 3' untranslated region of the WAP gene was prepared. These
regulatory sequences do not include coding and intragenic
untranslated sequences (introns) of the WAP gene.
[0105] The vector designated pUCWAP6 was derived from genetic
elements from the following plasmids as starting material: pUC18,
pWAP4 and p227.6, which were provided by the American Red Cross.
The development of pUCWAP6 is as follows: The pUC18 vector was cut
with the enzymes EcoRI and Hind III to remove the multiple cloning
site of the vector, blunted with exonuclease and ligated with NotI
linkers. The linearized plasmid was then cut with NotI and ligated.
Ligation mixture was used to transform E. coli DH5.alpha. cells on
LB ampicillin plates, picked colonies were grown in TB ampicillin
broth, plasmids were isolated and cut with NotI then subjected to
gel electrophoresis. Plasmid was judged to be correct and
designated as pUCNotI (See FIG. 3A). The vector pWAP4 was cut with
EcoRI and the fragment containing the WAP 5' 2.6 kbp and 3' genetic
elements were separated by gel electrophoresis and purified. The
ends of the fragment were modified by blunting with exonuclease and
NotI linkers were ligated on. The fragment was cut with NotI and
ligated into the NotI restriction site of pUCNotI then used to
transform E. coli DH5.alpha. cells on ampicillin plates picked
colonies were grown in TB ampicillin broth. Isolated plasmid was
verified to be correct by NotI digestion with the plasmid being
designated pUCWAP5. The pUC WAP5 plasmid was subjected to KpnI
digestion and a partial NotI digestion producing a fragment that
contained the pUCNotI vector sequence flanked by the mWAP 3'UTR
(See FIG. 3B). This fragment was ligated with the 4.1 kb 5' WAP
promoter produced from digestion of p227.6 with NotI, KpnI and Hind
III. The ligation mixture was then used to transform E. coli JM109
cells that were grown on LB ampicillin plates picked colonies were
grown in TB ampicillin broth, plasmids isolated were cut with Not
I, and NotI/KpnI and judged to be correct. The plasmid was then
designated pUCWAP6 (See FIG. 3C).
[0106] Production of pUCWAP6FIX
[0107] As shown in FIG. 4, the plasmid pUCWAP6FIX was produced by
digestion of pUCWAPFIX with KpnI and isolating the FIX cDNA by gel
electrophoresis. This fragment was inserted into the KpnI site of
pUCWAP6 after KpnI digestion and both fragments were then subjected
to ligation. The ligation mixture was then used to transform E.
coli JM109 cells that were then plated on LB ampicillin plates.
Picked colonies were grown in TB ampicillin broth and plasmids were
isolated. Isolated plasmids were digested with NsiI to verify
orientation of the cDNA insert. Plasmids that contained the insert
in the correct orientation were designated pUCWAP6FIX. After insert
confirmation, large scale purification was undertaken, according to
methods well known in the art. DNA was prepared for microinjection
as described above.
EXAMPLE 4
Production of Transgenic Mice That Express the Human Factor IX
Gene
[0108] Transgenic mice were produced essentially as described by
Hogan et al., Manipulating the Mouse Embryo, Cold Spring Harbor
Press, (1986), which is hereby incorporated by reference. That is,
glass needles for micro-injection were prepared using a micropipet
puller and microforge. Injections were performed using a Nikon
microscope having Hoffman Modulation Contrast optics, with
Narashigi micromanipulators and a pico-injector driven by N2
(Narashigi).
[0109] Fertilized mouse embryos were surgically removed from
oviducts of superovulated female CD-1 mice and placed into M2
medium. Cumulus cells were removed from the embryos with
hyaluronidase at 300 .mu.g/ml. The embryos were then rinsed in new
M2 medium, and transferred into M15 medium for storage at 37
degrees centigrade prior to injection.
[0110] Stock solutions containing about 1.4 .mu.g/ml of the above
described DNA were prepared and microinjected into the pronuclei of
1 cell mouse embryos. In addition, stock solutions containing about
7 .mu.g/ml total DNA were prepared and microinjected into the
pronuclei of mouse embryos.
[0111] After injecting the DNA solution into the male pronucleus,
embryos were implanted into avertin-anesthesized CU-1 recipient
females made pseudo-pregnant by mating with vasectomized males.
About 25-30 microinjected mouse embryos per recipient were
transferred into pseudopregnant females. Embryos were allowed to
come to term and the newborn mice were analyzed for the presence of
the transgene by PCR using the primers FIXS1 and FIXA1 described in
Table 1, below.
EXAMPLE 5
Preparation of DNA from Transgenic Animals
[0112] DNA can be prepared from tissue of a transgenic animal of
any species by the method exemplified below for mice. Marmur., J.
Mol. Biol. 3: 208 (1961), incorporated herein by reference.
[0113] A 5 mm piece of mouse tail was removed from young,
potentially transgenic mice at weaning (3 weeks) age, and frozen in
liquid nitrogen. To the frozen tissue was added 840 .mu.l of Lysing
Solution (8 mM EDTA-0.8% 2-mercaptoethanol-80 .mu.g/ml Proteinase
K-1 M sodium chlorate in 40 mM TRIS buffer) pH 8.0 and 120 mM NaCl,
and the mixture incubated at 50 degrees centigrade. The mixture was
then extracted with 250 .mu.l of phenol/chloroform-/isoamyl alcohol
(25:24:1) for 10-15 seconds, then centrifuged for 10 minutes. The
supernatant fluid (about 830 .mu.l) was removed to a fresh tube,
and a DNA clot produced by vortexing the solution with 0.6 vols. of
isopropanol. The mother liquor was decanted, and the DNA clot
rinsed twice with 80% ethanol. The DNA clot was isolated by 5
minutes or centrifugation, aspiration of the supernatant fluid, and
air drying of the clot with a stream of air for 10 minutes.
[0114] The DNA clot was dissolved in 250 ml of the TE buffer (10 mM
Tris. HCl, pH 7.0-1 mM EDTA, and the solution treated with 10 .mu.l
of RNase (1 mg/ml RNase A and 4,0000 units/ml RNAse T1) for 1 hour
at 37 degrees centigrade. This mixture was shaken with 50 .mu.l of
a 24:1 (v/v) solution of chloroform-isoamyl alcohol for 5-10
seconds, centrifuged, and the supernatant fluid transferred to a
fresh tube.
[0115] The recovered supernatant fluid above was mixed sequentially
with 25 .mu.l of 3M sodium acetate and 0.5ml of 95% ethanol. The
supernatant fluid above was mixed sequentially with 25 .mu.l of 3M
sodium acetate and 0.5 ml of 95% ethanol. The supernatant fluid was
decanted from the precipitated DNA, and the precipitate washed with
80% ethanol. The purified DNA was isolated by centrifugation, air
dried, then dissolved in 150 .mu.l of TE.
[0116] Essentially the same technique was used to prepare DNA from
pigs, and the same or similar techniques can be used to prepare DNA
from other animals. Such DNA can be analyzed to determine whether
transgenic animals carried recombinant structures.
EXAMPLE 6
Analysis of DNA Derived From Tissue
[0117] To determine whether test animals carried the recombinant
constructs, tissue samples were removed from transgenic animals and
treated with proteinase K and SDS at 37.degree. C. overnight. The
mixture was then incubated with DNase-free RNase at 37.degree. C.
for 1-2 hours. DNA was precipitated from the mixture with sodium
acetate and ethanol at -20.degree. C. overnight, collected by
centrifugation, washed in 70% ethanol and dried. The dried DNA
pellet was used directly for polymerase chain reaction (PCR). In
some cases, the mixture was extracted extensively with
phenol/chloroform prior to ethanol precipitation.
[0118] Oligonucleotide pairs were used to prime polymerase chain
reactions that detected the presence of the WAP gene or the Factor
IX gene in the transgenic animals. See Table 1, below. Reactions
were performed using an annealing temperature of 58.degree. C., a
denaturation temperature of 94.degree. C., and an extension
temperature of 72.degree. C., using 100 ng of oligo primers and 50
ng of (genomic) template DNA per reaction, and cycling through the
temperatures 40 times using an automatic temperature cycler (M. J.
Research). PCR reactions were analyzed by running 20% of the
reaction products on agarose gels and identifying fragment sizes by
comparison with marker DNA fragments.
[0119] Two founder transgenic pigs (one male and one female)
contained a 2.6 kb mouse WAP promoter-Factor IX cDNA-1.6 kb WAP
gene 3-'end construct that had been coinjected with the 7.2 kb
mouse WAP gene (EcoRI-EcoRI) fragment. As shown in Table 2, the
male, 57-7, did not transmit the transgene. In contrast, founder
58-1 has produced one female offspring having the Factor IX cDNA
transgene. Founder 58-1 has produced six additional offspring,
three females and three males, from her second litter. The three
females were not transgenic. Two of the males from the second
litter tested positive for the Factor IX transgene.
1TABLE 1 Primer Sequences humFIX5'KpnI (SEQ ID
5'gcta.backslash.ggtacc.backslash.atgcagcgcg NO: 1) humFIX3'KpnI
(SEQ ID 5'gtca.backslash.ggtacc.backs- lash.ttaagtgagct NO: 2)
FIXS1 (SEQ ID 5'ggataacatcactcaaagcac NO: 3) WAP3'A1 (SEQ ID
5'tagcagcagattgaaagcattatg NO: 4) FIXA1 (SEQ ID 5'gtgaactttgtagatc
NO: 5)
[0120]
2TABLE 2 Transgenic Pigs Containing Recombinant Human Factor IX DNA
Pig ID Construct Sex Comments 57-7 WAP/FIX Male Founder, PCR*
positive for WAP and FIX 58-1 WAP/FIX Female Founder, PCR positive
for WAP and FIX 63-1 WAP/FIX Female G.sup.1 from 58-1, positive for
WAP and FIX 63-2 WAP/FIX Female G.sup.1 from 58-1, positive for WAP
and FIX (dead) litter#10 WAP/FIX 3 Female, 2 transgenic males to
58-1 3 Male
[0121] WAP: Whey acid protein; FIX: Factor IX;
[0122] *Detection of human Factor IX transgene carried out by the
PCR method.
EXAMPLE 7
Expression of Human Factor IX in the Milk of Transgenic Pigs
[0123] Daily expression levels of recombinant human Factor IX in
the milk of transgenic pig 58-1 were determined as follows.
Lactating sows were injected intramuscularly with 30-60 IU of
oxytocin (Vedco Inc., St. Joseph, Mo.) to stimulate milk let-down.
Letdown occurred two to five minutes after injection. Pigs were
milked by hand during the course of this study. Immediately after
collection the milk was diluted 1:1 with 200 mM EDTA, pH 7.0 to
solubilize the caseins and then frozen. Small aliquots (about one
milliliter) of the milk/EDTA mixture were taken and centrifuged for
approximately 30 minutes at 16000.times.g at 4.degree. C. The fat
layer was separated from the diluted whey fraction, and the diluted
whey fraction was used for all further assays. In this study, all
concentration values reported for milk were obtained from diluted
whey samples that were multiplied by a factor of 1.9 to account for
dilution with EDTA and subsequent removal of milk fat.
[0124] Amounts of Factor IX in milk were measured by polyclonal
ELISA. Briefly, Immulon II microtiter plates (Fisher Scientific,
Pittsburgh) were coated overnight with 100 .mu.l/well of 1:1000
rabbit anti-human Factor IX (Dako) in 0.1 M NaHCO.sub.3, 0.1 M
NaCl, pH 9.6 at 4.degree. C. The wells were washed with TBS-Tween
(TBST, 25 mM Tris, 50 mM NaCl, 0.2% Tween 20, pH 7.2), and then
blocked for 30 minutes with TBS/0.1% BSA at room temperature.
Samples and human Factor IX standard (a gift from the American Red
Cross) in the TBS-BSA dilution buffer were added in triplicate to
the wells (100 .mu.l/well) and incubated at 37.degree. C. for 30
minutes. The wells were then washed and blocked for another 10
minutes at room temperature. Goat anti-human Factor IX (American
Diagnostica, Greenwich, Conn.), 1:1000 in TBS-BSA, was then
incubated in the wells for 30 minutes at 37.degree. C., followed by
anti-goat IgG/HRP (Sigma, St. Louis). Bound chromophore was
detected with OPD substrate (Abbott, Chicago) at 490 nm using an
EL308 Bio-Tek Microplate reader.
[0125] As shown in Table 3, daily expression levels of 100-220
.mu.g/ml milk were maintained throughout the 10 day lactation.
3TABLE 3 Recombinant Factor IX Levels in Milk of Transgenic Pig
58-1, First Lactation rhFIX Day of Level.sup.2 Lactation [.mu.g/ml]
3 160 .+-. 26 4 145 .+-. 20 5 100 .+-. 25 6 135 .+-. 15 7 220 .+-.
30 9 170 .+-. 35 10 185 .+-. 50
[0126] .sup.2Recombinant human Factor IX (rhFIX) levels were
determined by ELISA on daily samples of EDTA-diluted whey.
EXAMPLE 8
Western Analysis of Human Factor IX Produced by Transgenic Pigs
[0127] Recombinant human Factor IX also was examined using Western
analysis. Daily samples of EDTA-diluted whey from 58-1 were
electrophoresed on 8-16% SDS gels (Novex, San Diego). Aproximately
125 ng of recombinant human Factor IX (as determined by polyclonal
ELISA) and human Factor IX standard (American Red Cross), were
loaded in each lane. Total of 25 .mu.g of total protein from a pool
of non-transgenic (NTG) whey was loaded on gels. After
electrophoresis, proteins were transferred overnight to PVDF
membranes (bio Rad). The membranes were washed for 30 minutes in
TBST, blocked with TBS/0.05% Tween 20/0:5% Casein (TBST-Casein).
The membranes were developed with rabbit anti-Factor IX (Dako)
(1:1000 in TBST-Casein for 45 minutes at 37.degree. C.), followed
by anti-rabbit IgG/HRP (Sigma) (1:1000 in TBST-Casein for 45
minutes at 37.degree. C.), and DAB metal enhanced staining
(Pierce). Molecular weight markers were purchased from Bio Rad.
[0128] Western analyses revealed the presence of three
sub-populations of recombinant human Factor X: the major population
migrated at a Mr of about 60-65 kDa, which is a slightly lower
M.sub.r than human Factor IX, and minor sub-populations migrated at
about 40-45 kDa, and at about 25 kDa. Plasma human Factor IX also
possessed a subpolution at about 45-50 kDa.
[0129] In yet another study, whole milk from transgenic pig 58-1
was diluted 1:1 with 200 mM EDTA, pH 7.0 to dissociate casein
micelles. Milk was skimmed of fat by centrifugation at 4000.times.g
for 30 min, at 2.degree. C. 100 .mu.gs of milk protein were loaded
per lane of a 4%/10% SDS-PAGE gel and resolved at 15 mA/hr for one
hour and 30 mA/hr for 2 hours. Proteins were transferred onto
nitrocellulose paper (Amersham), at 24 V/h, 4.degree. C. and
western blotted to detect rFIX in milk, using an HRP-conjugated
goat anti-FIX antibody (Affinity Biologicals) at 0.9 .mu.g/ml
concentration. The results of this study are set forth in FIG. 1,
wherein lanes 1-8 represent milk from day 3, 4, 5, 6, 7, 9, 10, 11
of lactation; lane 9, purified recombinant FIX, 1.0 .mu.g; and lane
10, human FIX purified from plasma, 0.5 .mu.g. The positions of
broad range molecular weight markers (BioRad) are indicated on the
left.
EXAMPLE 9
Purification of Human Factor IX from Milk of Transgenic Pigs
[0130] Recombinant human Factor IX was purified from a pool of the
first lactation from the milk of 58-1 using ion exchange
chromatography followed by metal-dependent immunoaffinity
chromatography (MAb 1H5). In these studies, all columns and buffers
were kept at 4.degree. C. A pool of daily EDTA-expanded whey
samples was diluted to OD 280 nm of 5.0 with TBS, pH 7.2, then
loaded at 1 cm/min on DEAE FF Sepharose. The column was washed with
TBS, pH 7.2, and then eluted with 0.25 M NaCl in TBS. This fraction
was diluted 1:1 with 40 mM MgCl.sub.2 in TBS to a final
concentration of 20 mM MgCl.sub.2 and loaded on a 1H5 MAb column.
The column was washed with TBS containing 20 mM MgCl.sub.2, and the
product was eluted with 20 mM citrate, 0.15 M NaCl, pH 6.8. The
product was dialyzed overnight against 10 mM imidazole, pH 7.2.
[0131] The yields from the anion exchange and immunoaffinity steps
were quantitative, and no recombinant human Factor IX was detected
in the flow-through chromatographic fractions by polyclonal ELISA.
This two-step chromatographic procedure isolated the recombinant
human Factor IX to about 80-90% purity.
EXAMPLE 10
The Biological Activity of Purified Recombinant Human Factor IX
[0132] The biological activity of the purified recombinant human
Factor IX from 58-1 was measured using a one-stage activated
partial thromboplastin clotting time assay (APTT) clotting assay
following a protocol given by the American Red Cross Plasma
Derivatives Laboratory (Procedure for Factor. IX Coagulation Assay,
March 1992). Briefly, each well of a plastic Coag-a-mate tray
received 90 .mu.l of Factor IX-deficient plasma plus 10 .mu.l of a
Factor IX standard or sample, diluted with Tris/saline/BSA. The
tray was then placed on an automated analyzer (APTT mode, 240
second activation). The run was started, which automatically
performed the addition of 100 .mu.l of APTT reagent and 100 .mu.l
of 0.025 M CaCl.sub.2. Data obtained using a standard Factor IX
preparation were fitted to the equation y-ax+b where y=clotting
time and x=Factor IX, which was then used to determine the amount
of Factor IX in a sample. The Standards of normal plasma reference
pool (Sigma) and human Factor IX (American Red Cross Plasma
Derivatives Laboratory) were used in the assay. Duplicates of 58-1
recombinant human Factor IX, human Factor IX, and normal plasma
reference pool samples were run at each dilution.
[0133] As shown in Table 4, the immunopurified recombinant human
Factor IX had a specific activity of 337 U/mg, which is comparable
to the immunopurified human Factor IX from plasma which had a
specific activity of 230 U/mg, and the normal plasma reference pool
activity of 250 U/mg.
4TABLE 4 Specific Activity of Recombinant Human Factor IX Purified
from the Milk of a Transgenic Pig Slope Activity Specific Sample
Slope Ratio Equation (%) Activity NPRP 0.094 1.0 y = 0.094 .times.
-3.7 100% 250 U/mg hFIX 0.086 0.92 y = 0.086 .times. -3.6 92% 230
U/mg rhFIX 0.127 1.35 y = 0.127 .times. -3.4 135% 337 U/mg
[0134] NPRP: normal plasma reference pool
[0135] hFIX: human Factor IX standard
[0136] rhFIX: Factor IX isolated from the transgenic pig
[0137] Although the foregoing refers to particular preferred
embodiments, it will be understood that the present invention is
not so limited. It will occur to those of ordinary skill in the art
that various modifications may be made to the disclosed embodiments
and that such modifications are intended to be within the scope of
the present invention, which is defined by the following
claims.
[0138] All publications and patent applications mentioned in this
specification are indicative of the level of skill of those in the
art to which the invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application were
specifically and individually indicated to be incorporated by
reference in its entirety.
Sequence CWU 1
1
5 1 20 DNA Homo sapiens 1 gctaggtacc atgcagcgcg 20 2 21 DNA Homo
sapiens 2 gtcaggtacc ttaagtgagc t 21 3 21 DNA Homo sapiens 3
ggataacatc actcaaagca c 21 4 24 DNA Murine 4 tagcagcaga ttgaaagcat
tatg 24 5 16 DNA Homo sapiens 5 gtgaactttg tagatc 16
* * * * *