U.S. patent application number 10/136139 was filed with the patent office on 2002-11-07 for means and methods for nucleic acid delivery vehicle design and nucleic acid transfer.
Invention is credited to Bout, Abraham, Fallaux, Frits J., Hoeben, Robert C., Schouten, Govert, Valerio, Domenico, van der Eb, Alex J..
Application Number | 20020164802 10/136139 |
Document ID | / |
Family ID | 26139401 |
Filed Date | 2002-11-07 |
United States Patent
Application |
20020164802 |
Kind Code |
A1 |
Fallaux, Frits J. ; et
al. |
November 7, 2002 |
Means and methods for nucleic acid delivery vehicle design and
nucleic acid transfer
Abstract
Cells capable of at least, in part, complementing adenovirus E2A
function of an adenovirus defective in E2A function. Such cells
include a nucleic acid encoding adenovirus E2A or a functional
part, derivative and/or analogue thereof, integrated into the
cell's genome. The cell may have E2A nucleic acid derived from a
temperature sensitive adenovirus. Methods for producing an
adenovirus particle containing an adenovirus vector with a
functional deletion of E2A are also disclosed. Such methods involve
providing a cell with the functionally deleted adenovirus vector,
culturing the cell, and harvesting viral particle. The functional
deletion can comprise a deletion of nucleic acid encoding E2A. In
such a method, the nucleic acid encoding adenovirus E2A in the
cell's genome has no sequence overlap with the vector leading to
replication competent adenovirus and/or to the formation of an
adenovirus vector comprising E2A function. In the method, the
adenovirus vector may further include a functional deletion of
E1-region encoding nucleic acid. Methods for providing cells of an
individual with a nucleic acid of interest, without risk of
administering simultaneously a replication competent adenovirus
vector, comprising administering the individual one of the
previously described preparations are also disclosed.
Inventors: |
Fallaux, Frits J.; (Be
Leiderdorp, NL) ; Hoeben, Robert C.; (Ex Leiden,
NL) ; Bout, Abraham; (Ar Moerkapelle, NL) ;
Valerio, Domenico; (Leiden, NL) ; van der Eb, Alex
J.; (Tw Oegstgeest, NL) ; Schouten, Govert;
(Leiden, NL) |
Correspondence
Address: |
TRASK BRITT
P.O. BOX 2550
SALT LAKE CITY
UT
84110
US
|
Family ID: |
26139401 |
Appl. No.: |
10/136139 |
Filed: |
May 1, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10136139 |
May 1, 2002 |
|
|
|
09298745 |
Apr 23, 1999 |
|
|
|
6395519 |
|
|
|
|
09298745 |
Apr 23, 1999 |
|
|
|
08793170 |
Mar 25, 1997 |
|
|
|
5994128 |
|
|
|
|
08793170 |
Mar 25, 1997 |
|
|
|
PCT/NL96/00244 |
Jun 14, 1996 |
|
|
|
Current U.S.
Class: |
435/456 ;
435/235.1; 435/325 |
Current CPC
Class: |
C12N 2830/00 20130101;
C12N 2830/60 20130101; A61K 48/00 20130101; C12N 2830/15 20130101;
C12N 2710/10321 20130101; C12N 2710/10351 20130101; C12N 2830/42
20130101; C12N 2710/10343 20130101; C12N 7/00 20130101; A61P 43/00
20180101; C12N 15/86 20130101; C12N 2710/10352 20130101 |
Class at
Publication: |
435/456 ;
435/235.1; 435/325 |
International
Class: |
C12N 015/861; C12N
007/00; C12N 005/06 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 15, 1995 |
EP |
95201611.1 |
Jun 26, 1995 |
EP |
95201728.3 |
Claims
What is claimed is:
1. A cell capable of at least in part complementing adenovirus E2A
function of an adenovirus defective in E2A function, said cell
comprising a nucleic acid encoding adenovirus E2A or a functional
part thereof, derivative thereof, analogue thereof, or mixture of
any of these.
2. The cell of claim 1 wherein said nucleic acid encoding
adenovirus E2A is a temperature sensitive adenovirus.
3. The cell of claim 2 wherein said nucleic acid encoding
adenovirus E2A is of adenovirus ts125 origin.
4. The cell of claim 1, claim 2, or claim 3 further comprising a
nucleic acid encoding adenovirus E1-region proteins or a functional
part, derivative thereof, analogue thereof, or mixture of any
thereof.
5. The cell of claim 4 wherein said cell is of PER.C6 (ECACC
deposit number 96022940) origin.
6. A method for producing an adenoviral particle containing an
adenovirus vector with a functional deletion of E2A, said method
comprising: providing a cell according to claim 1, claim 2, claim
3, claim 4, or claim 5 with said adenovirus vector, culturing said
cell, and harvesting said adenoviral particle.
7. The method for producing an adenoviral particle containing an
adenovirus vector with a functional deletion of E2A according to
claim 6 wherein said functional deletion comprises a deletion of at
least part of the nucleic acid encoding E2A.
8. The method for producing an adenoviral particle containing an
adenovirus vector with a functional deletion of E2A according to
claim 6 wherein said nucleic acid encoding adenovirus E2A in said
cell's genome does not comprise sequence overlap with said vector
which leads to replication competent adenovirus and/or to the
formation of an adenovirus vector comprising E2A function.
9. The method for producing an adenoviral particle according to
claim 6, said method further comprising: providing an adenovirus
vector further comprising a functional deletion of E1-region
encoding nucleic acid said adenovirus vector to said cell, said
cell further characterized in: being capable of at least in part
complementing adenovirus E2A function of an adenovirus defective in
E2A function, comprising a nucleic acid encoding adenovirus E2A or
a functional part thereof, derivative thereof, and/or analogue
thereof, and further comprising a nucleic acid sequence encoding
adenovirus E1-region proteins or a functional part, derivative
thereof, and/or analogue thereof, culturing said cell, and
harvesting said virus particle.
10. The method according to claim 9 wherein said nucleic acid
encoding adenovirus E1-region has no sequence overlap with said
vector which leads to replication competent adenovirus and/or to
the formation of an adenovirus vector comprising an E1
function.
11. A method according to claim 6, claim 7, claim 8, claim 9, or
claim 10 wherein said adenovirus vector further comprises at least
one nucleic acid of interest.
12. An adenovirus vector comprising a functional deletion of
adenovirus E2A.
13. The adenovirus vector of claim 12 wherein said vector comprises
a deletion of at least part of the nucleic acid encoding E2A.
14. The adenovirus vector of claim 13 wherein said deletion
encompasses at least the entire coding region of E2A.
15. The adenovirus vector of claim 14 further comprising a deletion
corresponding to a deletion of nucleotides 22443 to 24032 in
adenovirus 5.
16. The adenovirus vector of claim 12, claim 13, claim 14, or claim
15 further comprising a deletion of nucleic acid encoding E1-region
proteins or parts, derivatives and/or analogues thereof.
17. The adenovirus vector of claim 12, claim 13, claim 14, claim
15, or claim 16 wherein said deletion of nucleic acid encoding
E1-region proteins comprises a deletion corresponding to a deletion
of nucleotides 459 to 3510 in adenovirus 5.
18. The adenovirus vector of claim 12, claim 13, claim 14, claim
15, claim 16, or claim 17 further comprising at least one nucleic
acid of interest.
19. A preparation of adenovirus vector containing adenovirus
particles wherein said adenovirus vector comprises a functional
deletion of E2A.
20. The preparation of claim 19 wherein said adenovirus vector
further comprises a deletion of nucleic acid encoding E1-region
proteins or parts, derivatives and/or analogues thereof.
21. The preparation of claim 19 or claim 20 free of adenovirus
vectors comprising E2A function.
22. The preparation of claim 21, said preparation characterized in
being free of adenovirus vectors comprising nucleic acid encoding a
functional E2A, or a functional part, derivative and/or analogue
thereof.
23. The preparation according to claim 21 or claim 22 free of
adenovirus vectors comprising nucleic acid encoding E1-region
proteins or parts, derivatives and/or analogues thereof.
24. A method for providing cells of an individual with a nucleic
acid of interest, without risk of administering simultaneously a
replication competent adenovirus vector, comprising administering
said individual a preparation according to claim 19, claim 20,
claim 21, claim 22, or claim 23.
25. The method of claim 24 wherein said preparation is
characterized in being free of adenovirus vectors comprising
nucleic acid encoding a functional E2A, or a functional part,
derivative and/or analogue thereof.
26. The method of claim 24 or claim 25 wherein said preparation is
free of adenovirus vectors comprising nucleic acid encoding
E1-region proteins or parts, derivatives and/or analogues
thereof.
27. An adenovirus vector comprising at least a deletion of a region
which in adenovirus 5 corresponds to nucleotides 22443-24032.
28. An adenovirus vector comprising at least a deletion of a region
which in adenovirus 5 corresponds to nucleotides 22418-24037.
29. An adenovirus vector comprising at least a deletion of a region
which in adenovirus 5 corresponds to nucleotides 22348-24060.
30. An adenovirus vector according to claim 27, claim 28, or claim
29 further comprising at leastnucleic acidwhichin adenovirus 5
corresponds to nucleotides 3534-22347 and/ornucleotides 24061 until
the right ITR.
31. An adenovirus vector according to claim 27 or claim 28 further
comprising at least nucleic acid which in adenovirus 5 corresponds
to nucleotides 3534-22417 and/ornucleotides 24038 until the right
ITR.
32. An adenovirus vector according to claim 27 further comprising
at least nucleic acid which in adenovirus 5 corresponds to
nucleotides 3534-22442 and/or nucleotides 24033 until the right
ITR.
33. An adenovirus vector according to claim 27 further comprising
at least nucleic acid which in adenovirus 5 corresponds to
nucleotides 3534-22442 and/or nucleotides 24033 until the right
ITR.
34. The cell of claim 1 wherein said nucleic acid is integrated
into said cell's genome.
35. The cell of claim 4 wherein said cell is derived from cell line
293.
36. The method according to claim 9 wherein said nucleic acid is
integrated into said cell's genome.
37. A cell capable of at least in part complementing adenovirus E2A
function of an adenovirus defective in E2A function, said cell
comprising a nucleic acid encoding adenovirus E2A or a functional
part thereof.
38. The cell of claim 37, said cell further comprising a nucleic
acid encoding adenovirus E1-region proteins or a functional part
thereof.
39. The cell of claim 38, wherein said nucleic acid encoding
adenovirus E2A encodes a temperature sensitive E2A mutant.
40. The cell of claim 39, wherein said temperature sensitive E2A
mutant is an E2A mutant encoded by adenovirus ts125.
41. The cell of claim 38, wherein said cell is of cell line 293
origin.
42. The cell of claim 39, wherein said cell is of cell line 293
origin.
43. The cell of claim 40, wherein said cell is of cell line 293
origin.
44. A method for producing an adenoviral particle containing an
adenovirus vector with a functional deletion of E2A, said method
comprising: providing a cell according to any one of claims 37-43
with said adenovirus vector, culturing said cell, and harvesting
said adenoviral particle.
45. The method according to claim 44, wherein said functional
deletion comprises a deletion of at least part of the nucleic acid
encoding E2A.
46. The method according to claim 45, wherein said nucleic acid
encoding adenovirus E2A in said cell's genome does not comprise
sequence overlap with said vector which leads to replication
competent adenovirus and/or to the formation of an adenovirus
vector comprising E2A function.
47. The method according to claim 45, said method further
comprising: providing an adenovirus vector further comprising a
functional deletion of E1-region encoding nucleic acid said
adenovirus vector to said cell, said cell further characterized by:
being capable of at least in part complementing adenovirus E2A
function of an adenovirus defective in E2A function, comprising a
nucleic acid encoding adenovirus E2A or a functional part thereof,
derivative thereof, and/or analogue thereof, and further comprising
a nucleic acid sequence encoding adenovirus E1-region proteins or a
functional part, derivative thereof, and/or analogue thereof,
culturing said cell, and harvesting said virus particle.
48. An adenovirus vector comprising a functional deletion of
adenovirus E2A.
49. The adenovirus vector of claim 48 wherein said vector comprises
a deletion of at least part of the nucleic acid encoding E2A.
50. The adenovirus vector of claim 49 wherein said deletion
encompasses at least the entire coding region of E2A.
51. The adenovirus vector of claim 48, further having a deletion of
nucleic acid encoding E1-region proteins or parts, derivatives
and/or analogues thereof.
52. The adenovirus vector of claim 49, further having a deletion of
nucleic acid encoding E1-region proteins or parts, derivatives
and/or analogues thereof.
53. The adenovirus vector of claim 50 further having a deletion of
nucleic acid encoding E1-region proteins or parts, derivatives
and/or analogues thereof.
54. A preparation of adenovirus vector containing adenovirus
particles wherein said adenovirus vector has a functional deletion
of E2A.
55. The preparation of claim 54 wherein said adenovirus vector
further has a deletion of nucleic acid encoding E1-region proteins
or parts, derivatives and/or analogues thereof.
56. The preparation of claim 54 free of adenovirus vectors
comprising E2A function.
57. The preparation of claim 55 free of adenovirus vectors
comprising E2A function.
58. The preparation of claim 56, said preparation characterized in
being free of adenovirus vectors comprising nucleic acid encoding a
functional E2A, or a functional part, derivative and/or analogue
thereof.
59. The preparation of claim 57, said preparation characterized in
being free of adenovirus vectors comprising nucleic acid encoding a
functional E2A, or a functional part, derivative and/or analogue
thereof.
60. The preparation of claim 56, free of adenovirus vectors
comprising nucleic acid encoding E1-region proteins or parts,
derivatives and/or analogues thereof.
61. The preparation of claim 57, free of adenovirus vectors
comprising nucleic acid encoding E1-region proteins or parts,
derivatives and/or analogues thereof.
62. The preparation of claim 58, free of adenovirus vectors
comprising nucleic acid encoding E1-region proteins or parts,
derivatives and/or analogues thereof.
63. The preparation of claim 59 free of adenovirus vectors
comprising nucleic acid encoding E1-region proteins or parts,
derivatives and/or analogues thereof.
64. A method for providing cells of a subject with a nucleic acid
of interest, with a decreased risk of administering simultaneously
a replication competent adenovirus vector, said method comprising
administering to the subject's cells the preparation of any one of
claims 54-63.
65. An adenovirus vector comprising at least a deletion of a region
which in adenovirus 5 corresponds to nucleotides 22443-24032, or
nucleotides 22418-24037, or nucleotides 22348-24060, further
comprising at least nucleic acid which in adenovirus 5 corresponds
to nucleotides 3534-22347 and/or nucleotides 24061 until the right
ITR.
66. The method according to claim 44, wherein said nucleic acid is
integrated into said cell's genome.
67. The method according to claim 45, wherein said nucleic acid is
integrated into said cell's genome.
68. The method according to of claim 46, wherein said nucleic acid
is integrated into said cell's genome.
69. The method according to claim 47, wherein said nucleic acid is
integrated into said cell's genome.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
09/298,745, now U.S. Pat. No. ______, incorporated by reference,
which is a continuation-in-part of U.S. patent application No.
08/793,170 filed Mar. 25, 1997, pending, incorporated herein by
reference, which is the national stage filing of PCT/NL96/00244
filed Jun. 14, 1996, incorporated herein by reference, claiming
priority from EP 95201611.1 filed June 15, 1995 and EP 95201728.3
filed Jun. 26, 1995, all of which are incorporated herein by
reference.
TECHNICAL FIELD
[0002] The present invention relates to the field of recombinant
DNA technology, more in particular to the field of gene therapy.
Specifically, the present invention relates to gene therapy using
materials derived from adenovirus, in particular human recombinant
adenovirus, and relates to novel virus derived vectors and novel
packaging cell lines for vectors based on adenoviruses.
Furthermore, this invention also pertains to the screening of
replication-competent and revertant E1 and/or E2A adenoviruses from
recombinant adenoviruses used in gene therapy.
BACKGROUND
[0003] The current generation of adenoviral vectors for gene
therapy contains deletions of the early region 1 ("E1"), where new
genetic information can be introduced. The E1 deletion renders the
recombinant virus replication defective. It was generally thought
that E1-deleted vectors would not express any other adenoviral
genes, because E1 is reported to trigger the transcription of the
other adenoviral genes. It has been shown by us and others that
these vectors express several early (e.g., E2A) and late genes
(e.g., fiber and penton-base) in the absence of E1. This means that
delivery of a therapeutic gene using E1-deleted adenoviral vectors
will result in expression of the therapeutic protein and adenoviral
proteins. A cytotoxic immune response is evoked against such
transduced cells. It has been shown that cytotoxic T-lymphocytes
("CTLs") directed against both the transgene product and products
encoded by the vector are activated, following vector
administration into immunocompetent animals (Song et al., Hum. Gene
Ther. 8: 1207, 1997; Yang et al., J. Virol. 70: 7209, 1996).
Activated CTLs subsequently eradicate transduced cells from the
recipient. Consistent with this, the longevity of transgene
expression is significantly extended in immuno-deficient and
immuno-compromised animals.
[0004] Expression of at least some adenoviral genes in a target
cell is at least in part due to background replication of the
recombinant adenoviral vector genome and/or background activity of
promoters driving the respective adenoviral genes (Yang et al.,
Nature Genet. 7: 362, 1994; Lusky et al., J. Virol. 72: 2022,
1998). As a result of the expression of at least some adenovirus
proteins in a target cell in a recipient, an immune response may be
mounted against transduced cells. Such an immune response is often
not desired, especially when long-term expression of a transgene is
aimed for. One mechanism by which adenovirus proteins in a target
cell in a recipient may cause the immune system of the recipient to
remove the target cell is the following. Proteins encoded by
expressed adenovirus genes can be processed into small peptides in
a proteosome of the target cell. Peptides produced during this
processing can subsequently be presented at the cell surface of the
transduced cells in the complex of MHC class-I and
.beta.2-microglobulin molecules. Finally, one or more of the
peptides may be recognized as non-self peptides by circulating CTLs
whereupon transduced cells can be eradicated from the recipient
(reviewed in Ploegh, Science 280: 248, 1998).
DISCLOSURE OF THE INVENTION
[0005] In one aspect the present invention provides at least in
part a solution to the problem of undesired removal of target cells
in a recipient.
[0006] The present invention also provides, at least in part, a
solution for the immune response against viral proteins. To this
end, the invention provides improved recombinant adenoviral vectors
that, in addition to deletion of E1, are also deleted for the
adenoviral early 2A gene ("E2A gene" or "E2A"). The protein encoded
by E2A is expressed from recombinant E1-deleted adenoviral vectors.
In addition to that, residual expression of E2A from E1-deleted
recombinant adenoviral vectors induces the expression of the viral
late genes, since DNA binding protein ("DBP") has a positive
regulatory effect on the adenovirus major late promoter ("MLP")
and, therefore, on the expression of the late genes (Chang et al.,
J Virol. 64: 2103, 1990). Deletion of the E2A gene from the
recombinant adenoviral genome will therefore improve the
characteristics of recombinant adenoviral vectors. First, deletion
of E2A will eliminate the synthesis of DBP. Second, it will inhibit
the background replication of the recombinant adenoviral backbone.
Third, it will reduce the residual expression of the late genes.
Finally, it will increase the capacity of the vector to harbor
larger and/or multiple transgenes.
[0007] The E2A gene encodes the 72-kDa protein single stranded DBP
whose activity is pivotal for the adenovirus DNA replication
(reviewed in The Molecular Repertoire of Adenoviruses II,
Springer-Verlag 1995). Therefore, manufacturing of vectors that are
deleted for E2A requires a cell line that complements for the
deletion of E2A in the recombinant adenoviral vector. Major hurdles
in this approach are:
[0008] a) that E2A should be expressed to very high levels and
[0009] b) that constitutive expression of E2A is toxic for cells
and, therefore, impossible to achieve (Klessig et al., Mol. Cell
Biol. 4: 1354, 1984).
[0010] The current invention, therefore, involves the use of a
temperature sensitive mutant of E2A derived from a temperature
sensitive adenovirus under control of strong viral enhancer
sequences, e.g., the cytomegalovirus enhancer for the generation of
E2A complementing cell lines. DBP (ts125E2A) from hAd5ts125 is
inactive at 39.degree. C., but is fully active at 32.degree. C.
High levels of this protein can be maintained in the new
complementing cells of the invention at the non-permissive
temperature, until the switch is made to the permissive
temperature. The invention also provides means and methods to use
the complementing cell line, comprising E2A, tsE2A, or both E1 and
tsE2A, for the generation of E2A- or E1- and E2A-deleted adenoviral
vectors. The invention also involves inducible expression of E2A or
tsE2A.
[0011] The invention also provides new cell lines that complement
for E2A or for both the E1 and the E2A deletion in the vector. The
invention also provides new recombinant adenoviral vectors deleted
for E2A or both E1 and E2A.
BRIEF DESCRIPTION OF THE FIGURES
[0012] FIG. 1 depicts the temperature dependent growth of PER.C6.
PER.C6 cells were cultured in Dulbecco's Modified Eagle Medium
supplemented with 10% Fetal Bovine Serum (FBS, Gibco BRL) and 10 mM
MgCl.sub.2 in a 10% CO.sub.2 atmosphere at either 32.degree. C.,
37.degree. C. or 39.degree. C. At a total of 1.times.10.sup.6
PER.C6 cells were seeded per 25 cm.sup.2 tissue culture flask
(Nunc) and the cells were cultured at either 32.degree. C.,
37.degree. C. or 39.degree. C. At each of days 1-8, cells were
counted. The growth rate and the final cell density of the PER.C6
culture at 39.degree. C. are comparable to that at 37.degree. C.
The growth rate and final density of the PER.C6 culture at
32.degree. C. were slightly reduced as compared to that at
37.degree. C. or 39.degree. C.
[0013] FIG. 2 depicts DBP levels in PER.C6 cells transfected with
pcDNA3, pcDNA3wtE2A or pcDNA3ts125E2A. Equal amounts of whole-cell
extract were fractionated by SDS-PAGE on 10% gels. Proteins were
transferred onto Immobilon-P membranes and DBP protein was
visualized using the aDBP monoclonal B6 in an ECL detection system.
All of the cell lines derived from the pcDNA3ts 125E2A transfection
express the 72-kDa E2A-encoded DBP protein (left panel, lanes 4-14;
middle panel, lanes 1-13; right panel, lanes 1-12). In contrast,
the only cell line derived from the pcDNAwtE2A transfection did not
express the DBP protein (left panel, lane 2). No DBP protein was
detected in extract from a cell line derived from the pcDNA3
transfection (left panel, lane 1), which serves as a negative
control. Extract from PER.C6 cells transiently transfected with
pcDNA3ts125 (left panel, lane 3) served as a positive control for
the Western blot procedure. These data confirm that constitutive
expression of wtE2A is toxic for cells and that using the ts125
mutant of E2A can circumvent this toxicity.
[0014] FIG. 3 depicts DBP expression in pcDNA3ts125E2A transfected
293 cells. Equal amounts of whole-cell extract were fractionated by
SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P
membranes and DBP protein was visualized using the aDBP monoclonal
B6 in an ECL detection system. Clone 20 (lane 8) from the
pcDNA3ts125E2A transfected 293 cells expressed the full-length
ts125E2A encoded 72-kDa DBP. No E2A encoded DBP was detected in the
extract from a cell line (clone 4) derived from the pcDNA3
transfected 293 cells (lane 1), which serves as a negative control.
Extract from PER.C6 cells stably expressing ts125E2A encoded DBP
(polyclonal cell line 5) (lane 2) served as a positive control for
the Western blot procedure. The other 293 clones either did not
express ts125E2A encoded DBP (clones 21 and 22, lanes 9 and 10
respectively) or expressed aberrant products running with a faster
(clones 3, 12, 16 and 18, lanes 4-7) or slower (clone 2, lane 3)
mobility in SDS/PAGE.
[0015] FIG. 4 depicts suspension growth of PER.C6ts125E2A cell line
c5-9. PER.C6ts125E2Ac5-9 cells were seeded in a 125ml tissue
culture Erlenmeyer at a seeding density of 3.times.10.sup.5 cells
per ml in a total volume of 20 ml serum-free medium. Cells were
further cultured at 125 RPM on an orbital shaker at 39.degree. C.
in a 10% CO.sub.2 atmosphere. Cells were counted at each of days
1-6. The mean growth curve from 8 cultures is shown.
PER.C6ts125E2Ac5-9 performs well in serum-free suspension culture.
The maximum cell density of approximately 2.times.10.sup.6 cells
per ml is reached within 5 days of culture.
[0016] FIG. 5 depicts growth curve PER.C6 and PER.C6tsE2A. PER.C6
cells or PER.C6ts125E2A (c8-4) cells were cultured at 37.degree. C.
or 39.degree. C., respectively. At day 0, a total of
1.times.10.sup.6 cells was seeded per 25 cm.sup.2 tissue culture
flask. At the indicated time points, cells were counted. The growth
of PER.C6 cells at 37.degree. C. is comparable to the growth of
PER.C6ts125E2A c8-4 at 39.degree. C. This shows that constitutive
over-expression of ts125E2A has no adverse effect on the growth of
cells at the non-permissive temperature of 39.degree. C.
[0017] FIG. 6 depicts stability of PER.C6ts125E2A. For several
passages, the PER.C6ts125E2A cell line clone 8-4 was cultured at
39.degree. C. in medium without G418. Equal amounts of whole-cell
extract from different passage numbers were fractionated by
SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P
membranes and DBP protein was visualized using the aDBP monoclonal
B6 in an ECL detection system. The expression of ts125E2A encoded
DBP is stable for at least 16 passages, which is equivalent to
approximately 40 cell doublings. No decrease in DBP levels was
observed during this culture period, indicating that the expression
of ts125E2A is stable, even in the absence of G418 selection
pressure.
[0018] FIG. 7 depicts revertant-free manufacturing of DE1/E2A
vectors. The recombinant adenoviral vector DNA was screened for
reversion of the E2A deleted phenotype by PCR. As shown in the left
panel, E2A sequences were amplified from the DNA samples (+) and
control samples (-) spiked with both 1, 10 and 40 molecules using
primer set A, as evidenced by the amplification of a 260 base pair
("bp") DNA fragment. In contrast, no E2A sequences were amplified
from the non-spiked samples, showing that reversion of the
E2A-deleted did not occur. As shown in the right panel, the PCR
reactions with primer set B yielded the expected DNA fragment of
169 bp in the samples containing the recombinant adenoviral vector
DNA (+). From the negative control samples containing the water
instead of DNA (-), no DNA fragment of 169 bp was amplified. These
data show that elimination of overlap between adenoviral sequences
in the vector and cell line prevents reversion of the E2A-deleted
phenotype.
[0019] FIG. 8 depicts transduction of HeLa cells with
IG.Ad/CMV.LacZ and IG.Ad/CMV.LacZDE2A. HeLa cells were infected
with a multiplicity of infection ("m.o.i.") of either 0, 10, 100 or
1000 viral particles IG.Ad/CMV.LacZ or IG.Ad/CMV.LacZDE2A per cell.
Forty-eight hours post infection, cells were stained with X-gal
solution. IG.Ad/CMV.LacZDE2A transduced HeLa cells stained at least
as good as did IG.Ad/CMV.LacZ, at all m.o.i.'s.
[0020] FIG. 9 depicts luciferase activity in infected A549 and HeLa
cells. HeLa and A549 cells were infected with a m.o.i. of either 0,
10, 100, 1,000 or 10,000 virus particles ("vp") IG.Ad/CLIP.Luc or
IG.Ad/CLIP.LucDE2A per cell. Two days post infection, cells were
lysed and the luciferase activity was determined. Both the
IG.Ad/CLIP.LucDE2A infected HeLa and A549 cells produce more
luciferase enzyme than the IG.Ad/CLIP.Luc infected HeLa and A549
and HeLa cells, at all m.o.i.'s tested.
[0021] FIG. 10 depicts the expression of DBP, Penton and Fiber.
A549 cells were infected with a m.o.i. of either 0, 100, 1,000 or
10,000 vp/cell IG.Ad/CLIP or IG.Ad.CLIPDE2A. Seventy-two hours post
infection, cell extracts were prepared and equal amounts of whole
cell extract were fractionated by SDS-PAGE on 10% gels. The
proteins were visualized with the aDBP monoclonal B6, the
polyclonal a-Penton base Ad2-Pb571 or the polyclonal a-knob domain
of fiber E641/3, using an ECL detection system. Cells infected with
IG.Ad.CLIP express both E2A encoded DBP, Penton base and Fiber
proteins. The proteins co-migrate with the respective proteins in
the positive control (lane P, extract from PER.C6 cells infected
with IG.Ad.CLIP harvested at starting CPE). In contrast, no DBP,
penton-base or fiber was detected in the non-infected A549 cells or
cells infected with IG.Ad.CLIPDE2A. These data show that deletion
of the E2A gene did not only eliminate residual DBP expression, but
also the residual expression of the late adenoviral proteins
penton-base and fiber.
Best Mode of The Invention
[0022] According to a presently preferred embodiment of the
invention, a cell according to the invention is capable of at
least, in part, complementing adenovirus E2A function of an
adenovirus defective in E2A function. Such a cell includes a
nucleic acid encoding adenovirus E2A or a functional part,
derivative and/or analogue thereof, integrated into the genome of
the cell. Preferably, the cell has E2A nucleic acid derived from a
temperature sensitive adenovirus such as but not limited to
adenovirus ts125. More preferably, such a cell further includes a
nucleic acid encoding adenovirus E1-region proteins or a functional
part, derivative and/or analogue thereof. Such a cell could be
derived from the "PER.C6" cell line (commercially available from
IntroGene, by, and deposited, under ECACC deposit accession number
96022940 under the provisions of the Budapest Treaty with the
Centre for Applied Microbiology and Research Authority (European
Collection of Animal Cell Cultures), Porton Down, Salisbury,
Wiltshire SP4, OJG, United Kingdom, an International Depository
Authority, in accordance with the Budapest Treaty, on Feb. 29,
1996.
[0023] The invention also includes a method for producing an
adenovirus particle containing an adenovirus vector with a
functional deletion of E2A. Such a method involves providing a cell
as previously described with the functionally deleted adenovirus
vector, culturing the cell, and harvesting the virus particle. In
such a method, the functional deletion can comprise a deletion of
at least part of the nucleic acid encoding E2A. In such a method,
the nucleic acid encoding adenovirus E2A in the genome of the cell
preferably has no sequence overlap with the vector which leads to
replication competent adenovirus and/or to the formation of an
adenovirus vector comprising E2A function. In the method, the
adenovirus vector preferably further comprises a functional
deletion of E1-region encoding nucleic acid, comprising providing
one of the previously described cells with the adenovirus vector,
culturing the cell and harvesting the virus particle. In such a
method, the nucleic acid encoding adenovirus E1-region preferably
does not comprise sequence overlap with the vector which leads to
replication competent adenovirus and/or to the formation of an
adenovirus vector comprising an E1 function. Furthermore, in the
method, the adenovirus vector further comprises at least one
nucleic acid of interest.
[0024] The invention also includes an adenovirus vector comprising
a functional deletion of adenovirus E2A. Such a functional deletion
is preferably a deletion of at least part of the nucleic acid
encoding E2A. The deletion may encompass the entire coding region
of E2A. Such an adenovirus vector preferably includes a deletion
corresponding to a deletion of nucleotides 22443 to 24032 in
adenovirus 5. The deletion can include a deletion of nucleic acid
encoding E1-region proteins. The deletion of nucleic acid encoding
E1-region proteins can comprise a deletion corresponding to a
deletion of nucleotides 459 to 3510 in adenovirus 5. Again, the
adenovirus vector preferably further includes at least one nucleic
acid of interest.
[0025] An adenovirus vector according to the invention can, but
does not necessarily, also comprise at least a deletion of a region
which in adenovirus 5 corresponds to nucleotides 22418-24037 or a
deletion of a region which in adenovirus 5 corresponds to
nucleotides 22443-24032. Such vectors can further comprise at least
nucleic acid which in adenovirus 5 corresponds to nucleotides
3534-22347 and/or nucleotides 24060 until the right ITR or at least
3534-22417 and/or 24038 until the right ITR or at least nucleic
acid which in adenovirus 5 corresponds to nucleotides 3534-22442
and/or nucleotides 24033 until the right ITR.
[0026] The invention also includes preparations of adenovirus
vector containing adenovirus particles wherein the adenovirus
vector comprises a functional deletion of E2A. Such an adenovirus
vector preferably further includes a deletion of nucleic acid
encoding E1-region proteins, and may be free of adenovirus vectors
comprising E2A function. In such a case, the preparation may be
free of adenovirus vectors comprising nucleic acid encoding a
functional E2A, or a functional part, derivative and/or analogue
thereof. The preparation is preferably free of adenovirus vectors
comprising nucleic acid encoding E1-region proteins or parts,
derivatives and/or analogues thereof.
[0027] The invention also includes a method for providing cells of
an individual with a nucleic acid of interest, without risk of
administering simultaneously a replication competent adenovirus
vector, comprising administering the individual one of the
previously described preparations.
[0028] The invention is further described by the use of the
following illustrative Examples.
EXAMPLE I
[0029] Generation of producer cell lines for the production of
recombinant adenoviral vectors deleted in E1 and E2A or E1 and
E2A
[0030] Here is described the generation of cell lines for the
production of recombinant adenoviral vectors that are deleted in E1
and E2A. The producer cell lines complement for the E1 and E2A
deletion from recombinant adenoviral vectors in trans by
constitutive expression of the E1 and E2A genes, respectively. The
pre-established Ad5-E1 transformed human embryo retinoblast cell
line PER.C6 (commercially available from IntroGene, by (now
Crucell, NV) of Leiden, NL, see also, International Patent Appln.
WO 97/00326) and Ad5 transformed human embryo kidney cell line 293
(Graham et al., J Gen. Virol. 36: 59, 1977) were further equipped
with E2A expression cassettes.
[0031] The adenoviral E2A gene encodes a 72 kDa DBP which has a
high affinity for single stranded DNA. Because of its function,
constitutive expression of DBP is toxic for cells. The ts125E2A
mutant encodes a DBP which has a Pro.fwdarw.Ser substitution of
amino acid 413 (van der Vliet, J Virol. 15: 348, 1975). Due to this
mutation, the ts125E2A encoded DBP is fully active at the
permissive temperature of 32.degree. C., but does not bind to ssDNA
at the non-permissive temperature of 39.degree. C. This allows the
generation of cell lines that constitutively express E2A, which is
not functional and is not toxic at the non-permissive temperature
of 39.degree. C. Temperature sensitive E2A gradually becomes
functional upon temperature decrease and becomes fully functional
at a temperature of 32.degree. C., the permissive temperature.
[0032] A. Generation of Plasmids Expressing the Wild Type E2A--or
Temperature Sensitive ts125E2A Gene.
[0033] pcDNA3wtE2A: The complete wild-type E2A coding region was
amplified from the plasmid pBR/Ad.Bam-rITR (ECACC deposit
P97082122) with the primers DBPpcr1 and DBPpcr2 using the
Expand.TM. Long Template PCR system according to the standard
protocol of the supplier (Boehringer Mannheim). The PCR was
performed on a Biometra TRIO THERMOBLOCK, using the following
amplification program: 94.degree. C. for 2 minutes, 1 cycle;
94.degree. C. for 10 seconds+51.degree. C. for 30
seconds+68.degree. C. for 2 minutes, 1 cycle; 94.degree. C. for 10
seconds+58.degree. C. for 30 seconds+68.degree. C. for 2 minutes,
10 cycles; 94.degree. C. for 10 seconds+58.degree. C. for 30
seconds+68.degree. C. for 2 minutes with 10 seconds extension per
cycle, 20 cycles; 68.degree. C. for 5 minutes, 1 cycle. The primer
DBPpcr1: CGG GAT CCG CCA CCA TGG CCA GTC GGG AAG AGG AG (5' to 3')
(SEQ ID NO:1) contains a unique BamHI restriction site (underlined)
5' of the Kozak sequence (italic) and start codon of the E2A coding
sequence. The primer DBPpcr2: CGG AAT TCT TAA AAA TCA AAG GGG TTC
TGC CGC (5' to 3') (SEQ ID NO:2) contains a unique EcoRI
restriction site (underlined) 3 ' of the stop codon of the E2A
coding sequence. The bold characters refer to sequences derived
from the E2A coding region. The PCR fragment was digested with
BamHI/EcoRI and cloned into BamHI/EcoRI digested pcDNA3
(Invitrogen), giving rise to pcDNA3wtE2A.
[0034] pcDNA3tsE2A: The complete ts125E2A-coding region was
amplified from DNA isolated from the temperature sensitive
adenovirus mutant H5ts125 (Ensinger et al., J. Virol. 10: 328,
1972; van der Vliet et al., J Virol. 15: 348, 1975). The PCR
amplification procedure was identical to that for the amplification
of wtE2A. The PCR fragment was digested with BamHI/EcoRI and cloned
into BamHI/EcoRI digested pcDNA3 (Invitrogen), giving rise to
pcDNA3tsE2A. The integrity of the coding sequence of wtE2A and
tsE2A was confirmed by sequencing.
[0035] B. Growth Characteristics of Producer Cells for the
Production of Recombinant Adenoviral Vectors Cultured at
32.degree., 37.degree. and 39.degree. C.
[0036] PER.C6 cells were cultured in Dulbecco's Modified Eagle
Medium ("DMEM", Gibco BRL) supplemented with 10% FBS and 10 mM
MgCl.sub.2 in a 10% CO.sub.2 atmosphere at either 32.degree. C.,
37.degree. C. or 39.degree. C. At day 0, a total of
1.times.10.sup.6 PER.C6 cells were seeded per 25 cm.sup.2 tissue
culture flask (Nunc) and the cells were cultured at either
32.degree. C., 37.degree. C. or 39.degree. C. At each of days 1-8,
cells were counted. FIG. 1 shows that the growth rate and the final
cell density of the PER.C6 culture at 39.degree. C. are comparable
to that at 37.degree. C. The growth rate and final density of the
PER.C6 culture at 32.degree. C. were slightly reduced as compared
to that at 37.degree. C or 39.degree. C. No significant cell death
was observed at any of the incubation temperatures. Thus PER.C6
performs very well both at 32.degree. C. and 39.degree. C., the
permissive and non-permissive temperature for ts125E2A,
respectively.
[0037] C. Transfection of PER.C6 and 293 With E2A Expression
Vectors; Colony Formation and Generation of Cell Lines.
[0038] One day prior to transfection, 2.times.10.sup.6 PER.C6 cells
were seeded per 6 cm tissue culture dish (Greiner) in DMEM,
supplemented with 10% FBS and 10 mM MgCl.sub.2 and incubated at
37.degree. C. in a 10% CO.sub.2 atmosphere. The next day, the cells
were transfected with 3, 5 or 8.mu.g of either pcDNA3, pcDNA3wtE2A
or pcDNA3tsE2A plasmid DNA per dish, using the LipofectAMINE
PLUS.TM. Reagent Kit according to the standard protocol of the
supplier (Gibco BRL), except that the cells were transfected at
39.degree. C. in a 10% CO.sub.2 atmosphere. After the transfection,
the cells were constantly kept at 39.degree. C., the non-permissive
temperature for ts125E2A. Three days later, the cells were put on
DMEM, supplemented with 10% FBS, 10 mM MgCl.sub.2 and 0.25 mg/ml
G418 (Gibco BRL) and the first G418 resistant colonies appeared at
10 days post transfection. As shown in Table 1, there was a
dramatic difference between the total number of colonies obtained
after transfection of pcDNA3 (.about.200 colonies) or pcDNA3tsE2A
(.about.100 colonies) and pcDNA3wtE2A (only 4 colonies). These
results indicate that the constitutive expression of E2A is toxic
and the toxicity of constitutively expressed E2A can be overcome by
using a temperature sensitive mutant of E2A (ts125E2A) and
culturing of the cells at the non-permissive temperature of
39.degree. C.
1TABLE 1 Number of colonies after transfection of PER.C6 with E2A
expression vectors: plasmid number of colonies cell lines
established pcDNA3 .about.200 4/4 PcDNA3wtE2A 4 1/4 PcDNA3tsE2A
.about.100 37/45
[0039] PER.C6 cells were transfected with either pcDNA3,
pcDNA3wtE2A or pcDNA3wtE2A and cultured in selection medium
containing 0.25 mg/ml G418 at 39.degree. C. All colonies (4/4)
picked from the pcDNA3 transfection and 82% (37/45) of the colonies
from the pcDNA3tsE2A transfection were established to stable cell
lines. In contrast, only 25% (1/4) of the colonies from the
pcDNA3wtE2A transfection could be established to a cell line.
[0040] From each transfection, a number of colonies was picked by
scraping the cells from the dish with a pipette. The detached cells
were subsequently put into 24 well tissue culture dishes (Greiner)
and cultured further at 39.degree. C. in a 10% CO.sub.2 atmosphere
in DMEM, supplemented with 10% FBS, 10 mM MgCl.sub.2 and 0.25mg/ml
G418. As shown in Table 1, 100% of the pcDNA3 transfected colonies
(4/4) and 82% of the pcDNA3tsE2A transfected colonies (37/45) were
established to stable cell lines (the remaining 8 pcDNA3tsE2A
transfected colonies grew slowly and were discarded). In contrast,
only 1 pcDNA3wtE2A-transfected colony could be established. The
other 3 died directly after picking.
[0041] Next, the E2A expression levels in the different cell lines
were determined by Western blotting. The cell lines were seeded on
6 well tissue culture dishes and sub-confluent cultures were washed
twice with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5%
sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM
phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor).
After 15 minutes incubation on ice, the lysates were cleared by
centrifugation. Protein concentrations were determined by the
Bio-Rad protein assay, according to standard procedures of the
supplier(BioRad). Equal amounts of whole-cell extractwere
fractionated by SDS-PAGE on 10% gels. Proteins were transferred
onto Immobilon-P membranes (Millipore) and incubated with the aDBP
monoclonal antibody B6 (Reich et al., Virology 128: 480, 1983). The
secondary antibody was a horseradish-peroxidase-conjugated goat
anti mouse antibody (BioRad). The Western blotting procedure and
incubations were performed according to the protocol provided by
Millipore. The complexes were visualized with the ECL detection
system according to the manufacturer's protocol (Amersham). FIG. 2
shows that all of the cell lines derived from the pcDNA3tsE2A
transfection express the 72-kDa E2A protein (left panel, lanes
4-14; middle panel, lanes 1- 13; right panel, lanes 1- 12). In
contrast, the only cell line derived from the pcDNAwtE2A
transfection did not express the E2A protein (left panel, lane 2).
No E2A protein was detected in extract from a cell line derived
from the pcDNA3 transfection (left panel, lane 1), which serves as
a negative control. Extract from PER.C6 cells transiently
transfected with pcDNA3ts125 (left panel, lane 3) served as a
positive control for the Western blot procedure. These data confirm
that constitutive expression of wtE2A is toxic for cells and that
using the ts125 mutant of E2A can circumvent this toxicity.
[0042] In contrast to PER.C6 cells, the culturing of 293 cells at
39.degree. C. is troublesome. Therefore, the transfection of 293
cells with either pcDNA3, pcDNA3wtE2A or pcDNA3tsE2A was performed
at 37.degree. C. in an atmosphere of 10% CO.sub.2, a
semi-permissive temperature for ts125E2A encoded DBP. A day prior
to transfection, 293 cells were seeded in DMEM, supplemented with
10% FBS and 10 MM MgCl.sub.2, at a density of 3.6.times.10.sup.5
cells per 6 cm tissue culture dish (Greiner). Five hours before
transfection, cells received fresh medium. Cells were transfected
with 7.2 .mu.g of either pcDNA3, pcDNA3wtE2A or pcDNA3tsE2A plasmid
DNA using the Calcium Phosphate Transfection System according to
the standard protocol of the supplier (Gibco BRL). Two days post
transfection, cells were put on selection medium, i.e., DMEM
supplemented with 10% FBS, 10 mM MgCl.sub.2 and 0.1 mg/ml G418. The
first colonies appeared at day 12 post transfection. As shown in
Table 2, the total number of colonies obtained after transfection
of pcDNA3 (18 100 colonies) or pcDNA3tsE2A (.about.25 colonies) was
significantly higher than that obtained after transfection of
pcDNA3wtE2A (only 2 colonies). A total of 22 clones from the
pcDNA3tsE2A transfection were picked by scraping the cells from the
dish with a pipette. The detached cells were subsequently put into
96 well tissue culture dishes (Greiner) and cultured further at
37.degree. C. in a 10% CO.sub.2 atmosphere in DMEM, supplemented
with 10% FBS, 10 mM MgCl.sub.2 and 0.1 mg/ml G418. Sixteen out of
the 22 picked colonies could be established as cell lines (the 6
remaining colonies grew badly and were discarded).
2TABLE 2 Number of colonies after transfection of 293 with E2A
expression vectors: plasmid number of colonies pcDNA3 .about.100
PcDNA3wtE2A 2 PcDNA3tsE2A 25
[0043] Selection of colonies derived from 293 cells transfected
with E2A expression cassettes. Cell line 293 was transfected with
either pcDNA3, pcDNA3wtE2A or pcDNA3wtE2A and cultured in selection
medium containing 0.1 mg/ml G418 at 37.degree. C.
[0044] Next, the E2A expression level in 8 different cell lines was
determined by Western blotting. The cell lines were seeded on 6
well tissue culture dishes and sub-confluent cultures were washed
twice with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5%
sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM
phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor).
After 15 minutes incubation on ice, the lysates were cleared by
centrifugation. Protein concentrations were determined by the
BioRad protein assay, according to standard procedures of the
supplier (BioRad). Equal amounts of whole-cell extract were
fractionated by SDS-PAGE on 10% gels. Proteins were transferred
onto Immobilon-P membranes (Millipore) and incubated with the aDBP
monoclonal antibody B6 (Reich et al., Virology 128: 480, 1983). The
secondary antibody was a horseradish-peroxidase-conjugated goat
anti mouse antibody (BioRad). The Western blotting procedure and
incubations were performed according to the protocol provided by
Millipore. The complexes were visualized with the ECL detection
system according to the manufacturer's protocol (Amersham). FIG. 3
shows, that, in contrast to the PER.C6tsE2A cell lines, only clone
20 (lane 8) from the pcDNA3tsE2A transfected 293 cells expressed
the full-length ts125E2A encoded 72-kDa DBP. No E2A encoded DBP was
detected in extract from a cell line (clone 4) derived from the
pcDNA3 transfected 293 cells (lane 1), which serves as a negative
control. Extract from PER.C6 cells stably expressing ts125E2A
encoded DBP (polyclonal cell line 5) (lane 2) served as a positive
control for the Western blot procedure. The other 293 clones either
did not express ts125E2A encoded DBP (clones 21 and 22, lanes 9 and
10 respectively) or expressed aberrant products running with a
faster (clones 3, 12, 16 and 18 lanes 4-7) or slower (clone 2, lane
3) mobility in SDS/PAGE. These results show that generation of E2A
complementing cell line by using temperature sensitive mutants of
E2A is not specific for PER.C6 cells, but that it applies to
eukaryotic cells in general (e.g., 293 cells). In addition, the 293
data show that keeping the temperature sensitive E2A encoded DBP as
inactive as possible is crucial for easy generation of such cell
lines. The 293 cell lines were generated at an intermediate
temperature of 37.degree. C., a temperature at which ts125E2A
encoded DBP is only partially inactivated. This explains the high
number of cell lines expressing aberrant DBP products.
[0045] D. Complementation of E2A Deletion in Adenoviral Vectors on
PER.C6- and 293 Cells Constitutively Expressing Full-length
ts125E2A Encoded DBP.
[0046] The adenovirus Ad5.dl802 is an Ad 5 derived vector deleted
for the major part of the E2A coding region and does not produce
functional DBP (Rice et al., J Virol. 56: 767, 1985). Ad5.dl802 was
used to test the E2A trans-complementing activity of PER.C6 cells
constitutively expressing ts125E2A. Parental PER.C6 cells or
PER.C6tsE2A clone 3-9 were cultured in DMEM, supplemented with 10%
FBS and 1 mM MgCl.sub.2 at 39.degree. C. . d 10% CO.sub.2 in 25
cm.sup.2 flasks and either mock infected or infected with Ad5.dl802
at an m.o.i. of 5. Subsequently, the infected cells were cultured
at 32.degree. C. and cells were screened for the appearance of a
cytopathic effect (CPE) as determined by changes in cell morphology
and detachment of the cells from the flask. Table 3 shows that full
CPE appeared in the Ad5.dl802 infrected PER.C6tsE2A clone 3-9
within 2 days. No CPE appeared in the Ad5.dl802 infected PER.C6
cells or the mock infected cells. These data show that PER.C6 cells
constitutively expresing ts125E2A complement in trans for the E2A
deletion in the Ad5.dl802 vector at the permissive temperature of
32.degree. C.
[0047] These cells are therefore suitable for production of
recombinant adenoviral vector that are deficient for functional
E2A.
3TABLE 3 Complementation of E2A deletion in adenoviral vectors on
PER.C6 cells and PER.C6 cells constitutively expressing temperature
sensitive E2A. 32.degree. C. day 2 PER.C6 mock -- PER.C6 d1802 --
PER.C6ts125c3-9 mock -- PER.C6ts125c3-9 d1802 Full CPE
[0048] Parental PER.C6 cells or PER.C6ts125E2A clone 3-9 were
infected with Ad5.dl802, an Ad5 adenovirus deleted for the E2A
gene, at m.o.i. of 5. Subsequently, the infected cells were
cultured at 32.degree. C. and cells were screened for the
appearance of a cytopathic effect (CPE) as determined by changes in
cell morphology and detachment of the cells from the flask.
[0049] The 293tsE2A clones c2, c16, c18 and c20 and the
293pcDNA3-clone c4 were tested for their E2A trans-complementing
activity as follows. The cell lines were cultured in DMEM,
supplemented with 10% FBS and 10 mM MgCl.sub.2 at 39.degree. C. and
10% CO.sub.2 in 6 well plates and either mock infected or infected
with IG.Ad.CLIP.Luc (see below) at an m.o.i. of 10. Subsequently,
the infected cells were cultured at either 32.degree. C. or
39.degree. C. and cells were screened for the appearance of a
cytopathic effect (CPE) 3 days post infection, as determined by
changes in cell morphology and detachment of the cells from the
flask. Table 4 shows that no CPE appeared in the control cell line
293pcDNA3-c4. Moreover, the cell lines expressing aberrant forms of
DBP either failed to complement this vector (clones 16 and 18) or
were intermediate in the trans-complementing ability (clone 2).
Only the 293 cell line expressing full-length ts125E2A encoded DBP
(i. e., clone 20) fully complemented for the E2A deletion in the
vector IG.Ad.CLIP.Luc at the permissive temperature of 32.degree.
C. No CPE appeared at the non-permissive temperature of 39.degree.
C.
4TABLE 4 Complementation of E2A deletion in adenoviral vectors on
293 cells and 293 cells constitutively expressing temperature
sensitive E2A. Cell line CPE at 32.degree. C. CPE at 39.degree. C.
293pcDNA3-c4 - - 293ts125E2A-c2 +/- - 293ts125E2A-c16 - -
293ts125E2A-c18 - - 293ts125E2A-c20 + -
[0050] The 293ts125E2A clones c2, c16, c18 and c20 and the
293pcDNA3-clone c4 were tested for their E2A trans-complementing
activity as follows. The cell lines were either mock infected or
infected with IG.Ad.CLIP.Luc at an m.o.i. of 10. Subsequently, the
infected cells were cultured at either 32.degree. C. or 39.degree.
C. and cells were screened for the appearance of a cytopathic
effect (CPE) 3 days post infection, as determined by changes in
cell morphology and detachment of the cells from the flask.
[0051] E. Serum-free Suspension Culture of PER.C6tsE2A Cell
Lines.
[0052] Large-scale production of recombinant adenoviral vectors for
human gene therapy requires an easy and scalable culturing method
for the producer cell line, preferably a suspension culture in
medium devoid of any human or animal constituents. To that end, the
cell line PER.C6tsE2A c5-9 (designated c5-9) was cultured at
39.degree. C. and 10% CO.sub.2 in a 175 cm.sup.2 tissue culture
flask (Nunc) in DMEM, supplemented with 10% FBS and 10mM
MgCl.sub.2. At sub-confluency (70-80% confluent), the cells were
washed with PBS (NPBI) and the medium was replaced by 25 ml serum
free suspension medium Ex-cell.TM. 525 (JRH) supplemented with
1.times.L-Glutamin (Gibco BRL), hereafter designated SFM. Two days
later, cells were detached from the flask by flicking and the cells
were centrifuged at 1000 rpm for 5 minutes. The cell pellet was
re-suspended in 5 ml SFM and 0.5 ml cell suspension was transferred
to an 80 cm.sup.2 tissue culture flask (Nunc), together with 12 ml
fresh SFM. After 2 days, cells were harvested (all cells are in
suspension) and counted in a Burker cell counter. Next, the cells
were seeded in a 125 ml tissue culture Erlenmeyer (Corning) at a
seeding density of 3.times.10.sup.5 cells per ml in a total volume
of 20 ml SFM. Cells were further cultured at 125 RPM on an orbital
shaker (GFL) at 39.degree. C. in a 10% CO.sub.2 atmosphere. Cells
were counted at day 1-6 in a Burker cell counter. In FIG. 4, the
mean growth curve from 8 cultures is shown. PER.C6tsE2A c5-9
performs well in serum free suspension culture. The maximum cell
density of approximately 2.times.10.sup.6 cells per ml is reached
within 5 days of culture.
[0053] F. Growth Characteristics of PER.C6 and PER.C6/E2A at
37.degree. C. and 39.degree. C.
[0054] PER.C6 cells or PER.C6ts125E2A (c8-4) cells were cultured in
DMEM supplemented with 10% FBS and 10 mM MgCl.sub.2in a 10%
CO.sub.2 atmosphere at either 37.degree. C. (PER.C6) or 39.degree.
C. (PER.C6ts125E2A c8-4). At day 0, a total of 1.times.10.sup.6
cells were seeded per 25 cm.sup.2 tissue culture flask (Nunc) and
the cells were cultured at the respective temperatures. At the
indicated time points, cells were counted. FIG. 5 shows that the
growth of PER.C6 cells at 37.degree. C. is comparable to the growth
of PER.C6ts125E2A c8-4 at 39.degree. C. This shows that
constitutive expression of ts125E2A encoded DBP has no adverse
effect on the growth of cells at the non-permissive temperature of
39.degree. C.
[0055] G. Stability of PER. C6ts125E2A.
[0056] For several passages, the PER.C6ts125E2A cell line clone 8-4
was cultured at 39.degree. C. and 10% CO.sub.2 in a 25 cm.sup.2
tissue culture flask (Nunc) in DMEM, supplemented with 10% FBS and
10 mM MgCl.sub.2 in the absence of selection pressure (G418). At
sub-confluency (70-80% confluent), the cells were washed with PBS
(NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium
deoxycholate and 0.1 % SDS in PBS, supplemented with 1 mM
phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor).
After 15 minutes incubation on ice, the lysates were cleared by
centrifugation. Protein concentrations were determined by the
BioRad protein assay, according to standard procedures of the
supplier (BioRad). Equal amounts of whole-cell extract were
fractionated by SDS-PAGE on 10% gels. Proteins were transferred
onto Immobilon-P membranes (Millipore) and incubated with the aDBP
monoclonal antibody B6 (Reich et al., Virology 128: 480, 1983). The
secondary antibody was a horseradish-peroxidase-conjugated goat
anti mouse antibody (BioRad). The Western blotting procedure and
incubations were performed according to the protocol provided by
Millipore. The complexes were visualized with the ECL detection
system according to the manufacturer's protocol (Amersham). FIG. 6
shows that the expression of ts125E2A encoded DBP is stable for at
least 16 passages, which is equivalent to approximately 40 cell
doublings. No decrease in DBP levels was observed during this
culture period, indicating that the expression of ts125E2A is
stable, even in the absence of G418 selection pressure.
EXAMPLE II
[0057] Plasmid based system for the generation of recombinant
adenoviral vectors deleted in E1 and E2A
[0058] A. Generation of pBr/Ad.Bam-rITR (ECACC deposit
P97082122).
[0059] In order to facilitate blunt end cloning of the inverted
terminal repeat ("ITR") sequences, wild-type human adenovirus type
5 (Ad5) DNA was treated with Klenow enzyme in the presence of
excess dNTPs. After inactivation of the Klenow enzyme and
purification by phenol/chloroform extraction followed by ethanol
precipitation, the DNA was digested with BamHI. This DNA
preparation was used without further purification in a ligation
reaction with pBr322 derived vector DNA prepared as follows: pBr322
DNA was digested with EcoRV and BamHI, de-phosphorylated by
treatment with TSAP enzyme (Life Technologies) and purified on LMP
agarose gel (SeaPlaque GTG). After transformation into competent
E.coli nDH5a (Life Techn.) and analysis of ampicillin resistant
colonies, one clone was selected that showed a digestion pattern as
expected for an insert extending from the BamHI site in Ad5 to the
right ITR.
[0060] Sequence analysis of the cloning border at the right ITR
revealed that the most 3'G residue of the ITR was missing, the
remainder of the ITR was found to be correct. The missing G residue
is complemented by the other ITR during replication.
[0061] B. Generation of pBr/Ad.Sal-rITR (ECACC Deposit
P97082119).
[0062] pBr/Ad.Bam-rITR was digested with BamHI and SalI. The vector
fragment including the adenovirus insert was isolated in LMP
agarose (SeaPlaque GTG) and ligated to a 4.8 kb SalI-BamHI fragment
obtained from wt Ad5 DNA and purified with the Geneclean II kit
(Bio 101, Inc.). One clone was chosen and the integrity of the Ad5
sequences was determined by restriction enzyme analysis. Clone
pBr/Ad.Sal-rITR contains adeno type 5 sequences from the SalI site
at bp 16746 up to and including the rITR (missing the most 3' G
residue).
[0063] C. pBr/Ad.Cla-Bam (ECACC Deposit P97082117).
[0064] wt Adeno type 5 DNA was digested with ClaI and BamHI, and
the 20.6-kb fragment was isolated from gel by electro-elution.
pBr322 was digested with the same enzymes and purified from agarose
gel by Geneclean. Both fragments were ligated and transformed into
competent DH5a. The resulting clone pBr/Ad.Cla-Bam was analyzed by
restriction enzyme digestion and shown to contain an insert with
adenovirus sequences from bp 919 to 21566.
[0065] D. Generation of pBr/Ad.AflII-Bam (ECACC Deposit
P97082114).
[0066] Clone pBr/Ad.Cla-Bam was linearized with EcoRi (in pBr322)
and partially digested with AflII. After heat inactivation of AflII
for 20 minutes at 65.degree. C., the fragment ends were filled in
with Klenow enzyme. The DNA was then ligated to a blunt double
stranded oligo linker containing a PacI site
(5'-AATTGTCTTAATTAACCGCTTAA-3' (SEQ ID NO:3)). This linker was made
by annealing the following two oligonucleotides:
5'-AATTGTCTTAATTAACCGC-3' (SEQ ID NO:4) and
5'-AATTGCGGTTAATTAAGAC-3 ' (SEQ ID NO:5), followed by blunting with
Klenow enzyme. After precipitation of the ligated DNA to change
buffer, the ligations were digested with an excess PacI enzyme to
remove concatemers of the oligo. The 22016 bp partial fragment
containing Ad5 sequences from bp 3534 up to 21566 and the vector
sequences was isolated in LMP agarose (SeaPlaque GTG), re-ligated
and transformed into competent DH5a. One clone that was found to
contain the PacI site and that had retained the large adeno
fragment was selected and sequenced at the 5' end to verify correct
insertion of the PacI linker in the (lost) AflII site.
[0067] E. Generation of pBr/Ad.Bam-rITRpac#2 (ECACC Deposit
P97082120) and pBr/Ad.Bam-rITR#8 (ECACC Deposit P97082121).
[0068] To allow insertion of a PacI site near the ITR of Ad5 in
clone pBr/Ad.Bam-rITR, about 190 nucleotides were removed between
the ClaI site in the pBr322 backbone and the start of the ITR
sequences. This was done as follows: pBr/Ad.Bam-rITR was digested
with ClaI and treated with nuclease Bal31 for varying lengths of
time (2 minutes, 5 minutes, 10 minutes and 15 minutes). The extent
of nucleotide removal was followed by separate reactions on pBr322
DNA (also digested at the ClaI site), using identical buffers and
conditions. Bal31 enzyme was inactivated by incubation at
75.degree. C. for 10 minutes, and the DNA was precipitated and
re-suspended in a smaller volume TE buffer. To ensure blunt ends,
DNA's were further treated with T4 DNA polymerase in the presence
of excess dNTPs. After digestion of the (control) pBr322 DNA with
SalI, satisfactory degradation (.about.150 bp) was observed in the
samples treated for 10 minutes or 15 minutes. The 10 minutes or 15
minutes treated pBr/Ad.Bam-rITR samples were then ligated to the
above-described blunted PacI linkers (See pBr/Ad.AflII-Bam).
Ligations were purified by precipitation, digested with excess PacI
and separated from the linkers on an LMP agarose gel. After
re-ligation, DNA's were transformed into competent DH5a and
colonies analyzed. Ten clones were selected that showed a deletion
of approximately the desired length and these were further analyzed
by T-track sequencing (T7 sequencing kit, Pharmacia Biotech). Two
clones were found with the PacI linker inserted just downstream of
the rITR. After digestion with PacI, clone #2 has 28 bp and clone
#8 has 27 bp attached to the ITR.
[0069] F. Generation of pWE/Ad.AflII-rITR (ECACC Deposit
P97082116).
[0070] Cosmid vector pWE15 (Clontech) was used to clone larger Ad5
inserts. First, a linker containing a unique PacI site was inserted
in the EcoRI sites of pWE 15 creating pWE.pac. To this end, the
double stranded PacI oligo as described for pBr/Ad.AflII-BamHI was
used but now with its EcoRI protruding ends. The following
fragments were then isolated by electro-elution from agarose gel:
pWE.pac digested with PacI, pBr/AflII-Bam digested with PacI and
BamHI and pBr/Ad.Bam-rITR#2 digested with Bam-HI and PacI. These
fragments were ligated together and packaged using 1 phage
packaging extracts (Stratagene) according to the manufacturer's
protocol. After infection into host bacteria, colonies were grown
on plates and analyzed for presence of the complete insert.
pWE/Ad.AflII-rITR contains all adenovirus type 5 sequences from bp
3534 (AflII site) up to and including the right ITR (missing the
most 3'G residue).
[0071] G. Generation of pWE/Ad.AflII-EcoRI.
[0072] pWE.pac was digested with ClaI and 5' protruding ends were
filled using Klenow enzyme. The DNA was then digested with PacI and
isolated from agarose gel. pWE/AflII-rITR was digested with EcoRI
and after treatment with Klenow enzyme digested with PacI. The
large 24-kb fragment containing the adenoviral sequences was
isolated from agarose gel and ligated to the ClaI-digested and
blunted pWE.pac vector using the Ligation Express.TM. kit from
Clontech. After transformation of Ultra-competent XL10-Gold cells
from Stratagene, clones were identified that contained the expected
insert. pWE/AflII-EcoRI contains Ad5 sequences from bp
3534-27336.
[0073] H. Generation of pWE/Ad.AflII-rITRDE2A:
[0074] Deletion of the E2A coding sequences from pWE/Ad.AflII-rITR
(ECACC deposit P97082116) has been accomplished as follows. The
adenoviral sequences flanking the E2A coding region at the left and
the right site were amplified from the plasmid pBr/Ad.Sal.rITR
(ECACC deposit P97082119) in a PCR reaction with the Expand PCR
system (Boehringer) according to the manufacturer's protocol. The
following primers were used: Right flanking sequences
(corresponding Ad5 nucleotides 24033 to 25180):
[0075] DE2A.SnaBI: 5'-GGC GTA CGT AGC CCT GTC GAA AG-3' (SEQ ID
NO:6)
[0076] DE2A.DBP-start: 5'-CCA ATG CAT TCG AAG TAC TTC CTT CTC CTA
TAG GC-3' (SEQ ID NO:7).
[0077] The amplified DNA fragment was digested with SnaBI and NsiI
(NsiI site is generated in the primer DE2A.DBP-start, underlined).
In addition, a unique BstBI site is generated in this primer
(italics).
[0078] Left flanking sequences (corresponding Ad5 nucleotides 21557
to 22442):
[0079] DE2A.DBP-stop: 5'-CCA ATG CAT ACG GCG CAG ACG G-3' (SEQ ID
NO:8)
[0080] DE2A.BamHI: 5'-GAG GTG GAT CCC ATG GAC GAG-3' (SEQ ID
NO:9)
[0081] The amplified DNA was digested with BamHI and NsiI (NsiI
site is generated in the primer DE2A.DBP-stop, underlined).
Subsequently, the digested DNA fragments were ligated into
SnaBI/BamHI digested pBr/Ad.Sal-rITR. Sequencing confirmed the
exact replacement of the DBP coding region with a unique NsiI site
and BstBI site in plasmid pBr/Ad.Sal-rITRDE2A. The unique NsiI site
and BstBI site can be used to introduce an expression cassette for
a gene to be transduced by the recombinant vector.
[0082] The deletion of the E2A coding sequences was performed such
that the splice acceptor sites of the 100K encoding L4-gene at
position 24048 in the top strand was left intact. In addition, the
polyadenylation signals of the original E2A-RNA and L3-RNAs at the
left-hand site of the E2A coding sequences were left intact. This
ensures proper expression of the L3-genes and the gene encoding the
100K L4-protein during the adenovirus life cycle.
[0083] Next, the plasmid pWE/Ad.AflII-rITRDE2A was generated. The
plasmid pBr/Ad.Sal-rITRDE2A was digested with BamHI and Spel. The
3.9-Kb fragment in which the E2A coding region was replaced by the
unique NsiI site and BstBI site was isolated. The pWE/Ad.AflII-rITR
was digested with BamHil and SpeI. The 35 Kb DNA fragment, from
which the BamHI/SpeI fragment containing the E2A coding sequence
was removed, was isolated. The fragments were ligated and packaged
using 1 phage-packaging extracts according to the manufacturer
protocol (Stratagene), yielding the plasmid pWE/Ad.AflII-rITRDE2A.
Note that there is no sequence overlap between the adenoviral
sequences present in pWE/Ad.AflII-rITRDE2A and the E2A sequences
present in the expression vectors pcDNA3tsE2A and pcDNAwtE2A or the
cell lines derived from this vector.
[0084] I. Generation of the Adapter Plasmids.
[0085] Adapter plasmid pMLP.TK (European patent application no. EP
95202213) was modified as follows: SV40 polyA sequences were
amplified with primer SV40-1 (introduces a BamHI site) and SV40-2
(introduces a BglII site). In addition, Ad5 sequences present in
this construct (from nt. 2496 to nt. 2779; Ad5 sequences nt. 3511
to 3794) were amplified with primers Ad5-1 (introduces a BglII
site) and Ad5-2.
[0086] SV40-1: 5'-GGGGGATCCGAACTTGTTTATTGCAGC-3' (SEQ ID NO:
10).
[0087] SV40-2: 5'-GGGAGATCTAGACATGATAAGATAC-3' (SEQ ID NO:11).
[0088] Ad5-1: 5'-GGGAGATCTGTACTGAAATGTGTGGGC-3' (SEQ ID NO:12).
[0089] Ad5-2:5'-GGAGGCTGCAGTCTCCAACGGCGT-3' (SEQ ID NO: 13).
[0090] Both PCR fragments were digested with BglII and ligated. The
ligation product was amplified with primers SV40-1 and Ad5-2 and
digested with BamHI and AflII. The digested fragment was then
ligated into pMLP.TK predigested with the same enzymes. The
resulting construct, named pMLPI.TK, contains a deletion in
adenovirus E1 sequences from nt. 459 to nt. 3510.
[0091] This plasmid was used as the starting material to make a new
vector in which nucleic acid molecules comprising specific promoter
and gene sequences can be easily exchanged. First, a PCR fragment
was generated from pZipDMo+PyF101(N.sup.-) template DNA (described
in PCT/NL96/00195) with the following primers: LTR-1: 5'-CTG TAC
GTA CCA GTG CAC TGG CCT AGG CAT GGA AAA ATA CAT AAC TG-3' (SEQ ID
NO:14) and LTR-2: 5'-GCG GAT CCT TCG AAC CAT GGT AAG CTT GGT ACC
GCT AGC GTT AAC CGG GCG ACT CAG TCA ATC G-3' (SEQ ID NO: 15). Pwo
DNA polymerase (Boehringer Mannheim) was used according to
manufacturer's protocol with the following temperature cycles: once
5 minutes at 95.degree. C.; 3 minutes at 55.degree. C.; and 1
minute at 72.degree. C., and 30 cycles of 1 minute at 95.degree.
C., 1 minute at 60.degree. C., 1 minute at 72.degree. C., followed
by once for 10 minutes at 72.degree. C. The PCR product was then
digested with BamHI and ligated into pMLP10 (Levrero et al., 1991;
Gene 101, 195-202) digested with PvuII and BamHI, thereby
generating vector pLTR10. This vector contains adenoviral sequences
from bp 1 up to bp 454 followed by a promoter consisting of apart
of the Mo-MuLV LTR having its wild-type enhancer sequences replaced
by the enhancer from a mutant polyoma virus (PyF101). The promoter
fragment was designated L420. Sequencing confirmed correct
amplification of the LTR fragment; however, most 5' bases in the
PCR fragment were missing so that the PvuII site was not restored.
Next, the coding region of the murine HSA gene was inserted. pLTR10
was digested with BstBI followed by Klenow treatment and digestion
withNcoI. The HSA gene was obtained by PCR amplification on pUC
18-HSA (Kay et al., 1990; J. Immunol. 145, 1952-1959) using the
following primers: HSA1, 5'-GCG CCA CCA TGG GCA GAG CGA TGG TGG
C-3' (SEQ ID NO: 16) and HSA2, 5'-GTT AGA TCT AAG CTT GTC GAC ATC
GAT CTA CTA ACA GTA GAG ATG TAG AA-3' (SEQ ID NO:17). The 269
bp-amplified fragment was sub-cloned in a shuttle vector using the
NcoI and BglII sites. Sequencing confirmed incorporation of the
correct coding sequence of the HSA gene, but with an extra TAG
insertion directly following the TAG stop codon. The coding region
of the HSA gene, including the TAG duplication, was then excised as
a NcoI (sticky)-SalI (blunt) fragment and cloned into the 3.5 kb
NcoI (sticky)/BstBI (blunt) fragment from pLTR10, resulting in
pLTR-HSA10.
[0092] Finally, pLTR-HSA10 was digested with EcoRI and BamHI after
which the fragment containing the left ITR, packaging signal, L420
promoter and HSA gene was inserted into vector pMLPI.TK digested
with the same enzymes and thereby replacing the promoter and gene
sequences. This resulted in the new adapter plasmid pAd5/L420-HSA
that contains convenient recognition sites for various restriction
enzymes around the promoter and gene sequences. SnaBI and AvrII can
be combined with HpaI, NheI, KpnI, and HindIII to exchange promoter
sequences, while the latter sites can be combined with the ClaI or
BamHI sites 3' from HSA coding region to replace genes in this
construct.
[0093] Another adapter plasmid that was designed to allow easy
exchange of nucleic acid molecules was made by replacing the
promoter, gene and polyA sequences in pAd5/L420-HSA with the CMV
promoter, a multiple cloning site, an intron and a polyA signal.
For this purpose, pAd/L420-HSA was digested with AvrII and BglII
followed by treatment with Klenow to obtain blunt ends. The 5.1 kb
fragment with pBr322 vector and adenoviral sequences was isolated
and ligated to a blunt 1570 bp fragment from pcDNA 1/amp
(Invitrogen) obtained by digestion with HhaI and AvrII followed by
treatment with T4 DNA polymerase. This adapter plasmid was named
pAd5/Clip.
[0094] The adapter plasmid pCMV.LacZ was generated as follows: The
plasmid pCMV.TK (EP 95-202 213) was digested with HindIII, blunted
with Klenow and dNTPs and subsequently digested with SalI. The DNA
fragment containing the CMV promoter was isolated. The plasmid
pMLP.nlsLacZ (EP 95-202 213) was digested with KpnI, blunted with
T4 DNA polymerase and subsequently digested with SalI. The DNA
fragment containing the LacZ gene and adjacent adenoviral sequences
was isolated. Next, the two DNA fragments were ligated with T4 DNA
ligase in the presence of ATP, giving rise to pCMV.nlsLacZ.
[0095] The adapter plasmid pAd5/CLIP.LacZwas generated as follows:
The E.coli LacZ gene was amplified from the plasmid pMLP.nlsLacZ
(EP 95-202 213) by PCR with the primers
5'GGGGTGGCCAGGGTACCTCTAGGCTTTTGCAA (SEQ ID NO:18) and
5'GGGGGGATCCATAAACAAGTTCAGAATCC (SEQ ID NO:19). The PCR reaction
was performed Ex Taq (Takara) according to the suppliers protocol
at the following amplification program: 5 minutes 94.degree. C., 1
cycle; 45 seconds 94.degree. C. and 30 seconds 60.degree. C. and 2
minutes 72.degree. C.,5 cycles; 45 seconds 94.degree. C. and 30
seconds 65.degree. C. and 2 minutes 72.degree. C., 25 cycles; 10
minutes 72.degree. C., 1 cycle; 45 seconds 94.degree. C. and 30
seconds 60.degree. C. and 2 minutes 72.degree. C., 5 cycles, 1
cycle. The PCR product was subsequently digested with Kpn1 and
BamHI and the digested DNA fragment was ligated into KpnI/BamHI
digested pcDNA3 (Invitrogen), giving rise to pcDNA3.nlsLacZ. Next,
the plasmid pAd/CLIP was digested with Spel. The large fragment
containing part of the 5' part CMV promoter and the adenoviral
sequences was isolated. The plasmid pcDNA3.nlsLacZ was digested
with SpeI and the fragment containing the 3' part of the CMV
promoter and the LacZ gene was isolated. Subsequently, the
fragments were ligated, giving rise to pAd/CLIP.LacZ. The
reconstitution of the CMV promoter was confirmed by restriction
digestion.
[0096] The adapter plasmid pAd5/CLIP.Luc was generated as follows:
The plasmid pCMV.Luc (EP 95-202 213) was digested with HindIII and
BamHI. The DNA fragment containing the luciferase gene was
isolated. The adapter plasmid pAd/CLIP was digested with HindIII
and BamHI, and the large fragment was isolated. Next, the isolated
DNA fragments were ligated, giving rise to pAdS/CLIP.Luc.
EXAMPLE III
[0097] Generation of Recombinant Adenoviruses
[0098] A. E1-deleted Recombinant Adenoviruses With wt E3
Sequences.
[0099] To generate E1 deleted recombinant adenoviruses with the
plasmid-based system, the following constructs are prepared:
[0100] a) An adapter construct containing the expression cassette
with the gene of interest linearized with a restriction enzyme that
cuts at the 3' side of the overlapping adenoviral genome fragment,
preferably not containing any pBr322 vector sequences, and
[0101] b) A complementing adenoviral genome construct
pWE/Ad.AflII-rITR digested with PacI. These two DNA molecules are
further purified by phenol/chloroform extraction and ethanol
precipitation. Co-transfection of these plasmids into an adenovirus
packaging cell line, preferably a cell line according to the
invention, generates recombinant replication deficient adenoviruses
by a one-step homologous recombination between the adapter and the
complementing construct.
[0102] A general protocol as outlined hereinafter and meant as a
non-limiting example of the present invention has been performed to
produce several recombinant adenoviruses using various adapter
plasmids and the Ad.AflII-rITR fragment. Adenovirus packaging cells
(PER.C6) were seeded in .about.25 cm.sup.2 flasks and the next day,
when they were at .about.80% confluency, transfected with a mixture
of DNA and lipofectamine agent (Life Techn.) as described by the
manufacturer. Routinely, 40.mu.l lipofectamine, 4 .mu.g adapter
plasmid and 4 .mu.g of the complementing adenovirus genome fragment
AflII-rITR (or 2 .mu.g of all three plasmids for the double
homologous recombination) are used. Under these conditions,
transient transfection efficiencies of .about.50% (48 hrs post
transfection) are obtained as determined with control transfections
using a pAd/CMV-LacZ adapter. Two days later, cells are passaged to
.about.80 cm.sup.2 flasks and further cultured. Approximately five
(for the single homologous recombination) to eleven days (for the
double homologous recombination) later a cytopathic effect (CPE) is
seen, indicating that functional adenovirus has formed. Cells and
medium are harvested upon full CPE and recombinant virus is
released by freeze-thawing. An extra amplification step in a 80
cm.sup.2 flask is routinely performed to increase the yield since
at the initial stage the titers are found to be variable despite
the occurrence of full CPE. After amplification, viruses are
harvested and plaque purified on PER.C6 cells. Individual plaques
are tested for viruses with active trans-genes.
[0103] Several different recombinant adenoviruses, comprising the
luciferase gene (IG.Ad.CLIP.Luc), the bacterial LacZ gene
(IG.Ad.CLIP.LacZ and IG.Ad.CMV.LacZ) or an empty CLIP cassette
(IG.Ad.CLIP) have been produced using this protocol. In all cases,
functional adenovirus was formed and all isolated plaques contained
viruses with the expected expression cassettes.
[0104] B. Generation of Recombinant Adenoviruses Deleted for E1 and
E2A.
[0105] Besides replacements in the E1 region, it is possible to
delete or replace the E2A region in the adenovirus. This creates
the opportunity to use a larger insert or to insert more than one
gene without exceeding the maximum packagable size (approximately
105% of wt genome length).
[0106] Recombinant viruses that are both E1 and E2A deleted are
generated by a homologous recombination procedure as described
above for E1-replacement vectors using a plasmid-based system
consisting of:
[0107] a) An adapter plasmid for E1 replacement according to the
invention, with or without insertion of a first gene of
interest.
[0108] b) The pWE/Ad.AflII-rITRDE2A fragment, with or without
insertion of a second gene of interest.
[0109] Generation and propagation of such viruses, e.g.,
IG.Ad.CMV.LacZDE2A, IG.Ad.CLIP.LacZDE2A, IG.Ad.CLIPDE2A or
IG.Ad.CLIP.LucDE2A, requires a complementing cell line for
complementation of both E1 and E2A proteins in trans, as previously
described herein.
[0110] In addition to replacements in the E1 and E2A region, it is
also possible to delete or replace (part of) the E3 region in the
E1-deleted adenoviral vector, because E3 functions are not
necessary for the replication, packaging and infection of the
(recombinant) virus. This creates the opportunity to use larger
inserts or to insert more than one gene without exceeding the
maximum packagable size (approximately 105% of wt genome length).
This can be done, e.g., by deleting part of the E3 region in the
pBr/Ad.Bam-rITR clone by digestion with XbaI and re-ligation. This
removes Ad5 wt sequences 28592-30470 including all known E3 coding
regions. Another example is the precise replacement of the coding
region of gp19K in the E3 region with a polylinker allowing
insertion of new sequences. This 1) leaves all other coding regions
intact and 2) obviates the need for a heterologous promoter since
the transgene is driven by the E3 promoter and pA sequences,
leaving more space for coding sequences.
[0111] To this end, the 2.7-kb EcoRI fragment from wt Ad5
containing the 5' part of the E3 region was cloned into the EcoRI
site of pBluescript (KS-) (Stratagene). Next, the HindIll site in
the polylinker was removed by digestion with EcoRV and HincIl and
subsequent re-ligation. The resulting clone pBS.Eco-Eco/ad5DHII was
used to delete the gp 19K-coding region. Primers 1 (5'-GGG TAT TAG
GCC AAA GGC GCA-3' (SEQ ID NO:20)) and 2 (5'-GAT CCC ATG GAA GCT
TGG GTG GCG ACC CCA GCG-3' (SEQ ID NO:21)) were used to amplify a
sequence from pBS.Eco-Eco/ad5DHIII corresponding to sequences 28511
to 28734 in wt Ad5 DNA. Primers 3 (5'-GAT CCC ATG GGG ATC CTT TAC
TAA GTT ACA AAG CTA-3' (SEQ ID NO:22)) and 4 (5'-GTC GCT GTA GTT
GGA CTG G-3' (SEQ ID NO:23)) were used on the same DNA to amplify
Ad5 sequences from 29217 to 29476. The two resulting PCR fragments
were ligated together by virtue of the new introduced NcoI site and
subsequently digested with XbaI and MunI. This fragment was then
ligated into the pBS.Eco-Eco/ad5DHIII vector that was digested with
XbaI (partially) and MunI generating pBS.Eco-Eco/ad5DHIII.Dgp19K.
To allow insertion of foreign genes into the HindIII and BamiHI
site, an XbaI deletion was made in pBS.Eco-Eco/ad5DHIII.Dgp19K to
remove the BamHI site in the Bluescript polylinker. The resulting
plasmid pBS.Eco-Eco/ad5DHIII.Dgp19KDXbaI, contains unique HindIII
and BamHI sites corresponding to sequences 28733 (HindIII) and
29218 (BamHI) in Ad5. After introduction of a foreign gene into
these sites, either the deleted XbaI fragment is re-introduced, or
the insert is re-cloned into pBS.Eco-Eco/ad5DHIII.Dgp19K using
HindIII and, for example, MunI. Using this procedure, we have
generated plasmids expressing HSV-TK, hIL-la, rat IL-3, luciferase
or LacZ. The unique SrfI and NotI sites in the
pBS.Eco-Eco/ad5DHIII.Dgp19K plasmid (with orwithout inserted gene
of interest) are used to transfer the region comprising the gene of
interest into the corresponding region of pBr/Ad.Bam-rITR, yielding
construct pBr/Ad.Bam-rITRDgp19K (with or without inserted gene of
interest). This construct is used as described supra to produce
recombinant adenoviruses. In the viral context, expression of
inserted genes is driven by the adenovirus E3 promoter.
[0112] Recombinant viruses that are both E1 and E3 deleted are
generated by a double homologous recombination procedure for
E1-replacement vectors using a plasmid-based system consisting
of:
[0113] a) an adapter plasmid for E1 replacement according to the
invention, with or without insertion of a first gene of
interest,
[0114] b) the pWE/Ad.AflII-EcoRI fragment, and
[0115] c) the pBr/Ad.Bam-rITRDgp19K plasmid with or without
insertion of a second gene of interest.
[0116] In addition to manipulations in the E3 region, changes of
(parts of) the E4 region can be accomplished easily in
pBr/Ad.Bam-rITR. Moreover, combinations of manipulations in the E3
and/or E2A and/or E4 region can be made. Generation and propagation
of such vectors, however, demands packaging cell lines that
complement for E1 and/or E2A and/or E4 in trans.
EXAMPLE IV
[0117] E2A Revertant-free Manufacturing of E1/E2A Deleted Vectors
on PER.C6/E2A Cells
[0118] The cell lines and E1/E2A deleted vectors described
hereinbefore are developed such that overlap between sequences in
the recombinant adenoviral genome and E2A sequences in the
complementing cell lines is avoided. This eliminates reversion of
the E2A-deleted phenotype in the E1/E2A deleted recombinant
adenoviral vectors due to homologous recombination. The occurrence
of reversion of the E2A deleted phenotype was studied in a PCR
assay.
[0119] PER. C6tsE2A clone 3-9 cells were cultured in DMEM
supplemented with 10% FBS and 10 mM MgCl.sub.2in a 10% CO.sub.2
atmosphere at 39.degree. C. in a 25 cm.sup.2 tissue culture flask.
At 50% confluency, cells were infected with the recombinant
adenoviral vector IG.Ad.CMV.LacZDE2A and the cells were put at
32.degree. C. Four days post infection CPE appeared and the cells
were harvested by flicking the flask. Cells were pelleted by
centrifugation and the cell pellet was re-suspended in 1 ml/10 mM
phosphate buffer (18 ml 0.2M Na.sub.2HPO.sub.4 (Baker) and 7 ml
0.2M NaH.sub.2PO.sub.4 (Merck) in 500 ml H.sub.2O pH=7.2). Next,
200 .mu.l 5% sodium deoxycholate (Sigma) was added. The mixture was
incubated for 30 minutes at 37.degree. C. and 50 .mu.l 1M
MgCl.sub.2 and 10 .mu.l DNase (1 MU/ml; ICN) was added. The mixture
was incubated for another half hour at 37.degree. C. and than
cleared by centrifugation. The supernatant was put into a new tube
and 100 .mu.l 10% SDS (Baker) and 5 .mu.l Proteinase K (20 mg/ml;
Boehringer) were added. The mixture was incubated for 30 minutes at
37.degree. C. and subsequently for 15 minutes at 65.degree. C.
Next, 1 ml phenol (Sigma) was added and the mixture was tumbled for
1 hour and centrifuged. One ml of supernatant was put into a fresh
tube and 1 ml chloroform (Baker) was added. The mixture was tumbled
for another 30 minutes and centrifuged. The supernatant was put
into a fresh tube and mixed with 1 ml 2-Propanol (Baker) and the
DNA was pelleted by centrifugation. The DNA was washed in 70%
Ethanol (Baker) and re-suspended in 200 .mu.l TE and 1 .mu.l RNase
(10 mg/ml; Boehringer). The DNA concentration was determined at a
spectrophotometer.
[0120] The recombinant adenoviral vector DNA was screened for
reversion of the E2A deleted phenotype by PCR. Two PCR reactions
were performed (FIG. 7). The first was a nested PCR reaction for
the detection of E2A sequences in the DNA sample. Two primer sets
were designed. Set A contains the primers
551:5'CCGGCAAGTCTTGCGGCATG (SEQ ID NO :24) and 556:
5'TAGCAGGTCGGGCGCCGATAT (SEQ ID NO:25) and the nested primers 553:
5'GGCTCAGGTGGCTTTTAAGCAG (SEQ ID NO:26) and 554:
5'GAGTTGCGATACACAGGGTTGC (SEQ ID NO:27). The PCR reaction was
performed using the eLONGase enzyme mix (Gibco) according to the
manufacturer's protocol. DNA from 1.times.10.sup.9 viral particles
(+), which is equivalent to .about.40 ng, or water (-) was added as
template. The PCR reactions were either not spiked, or spiked with
1, 10 and 40 molecules pBR/Ad.Sal-rITR, respectively, as indicated
in FIG. 7. The following amplification program for the PCR reaction
with primers 551 and 556 was used: 30 seconds at 94.degree. C., 1
cycle; 30 seconds 94.degree. C. and 30 seconds at 66.degree. C. and
90 seconds at 68.degree. C., 35 cycles; 10 minutes 68.degree. C., 1
cycle. One .mu.l of this reaction was put into a nested PCR with
primers 553 and 554 at the following amplification program: 30
seconds at 94.degree. C., 1 cycle; 30 seconds 94.degree. C. and 30
seconds at 66.degree. C. and 90 seconds at 68.degree. C., 35
cycles; 10 minutes 68.degree. C., 1 cycle. This reaction yields a
DNA fragment of 260 bp.
[0121] In the second PCR reaction, a set of primers (Set B) was
used that flank the E2A gene in the adenoviral genome on the left-
and the right-hand site. This PCR reaction amplifies a DNA fragment
spanning the site from which the E2A gene was deleted (FIG. 6).
Primer set B comprises primer 731 5'AGTGCGCAGATTAGGAGCGC (SEQ ID
NO:28) and primer 734 5'TCTGCCTATAGGAGAAGGAA (SEQ ID NO:29). The
PCR reaction was performed using the eLONGase enzyme mix (Gibco)
according to the manufacturer protocol. DNA from 1.times.10.sup.9
viral particles (+), which is equivalent to .about.40 ng, or water
(-) was added as template. The PCR reactions were either not
spiked, or spiked with 1, 10 and 40 molecules pBR/Ad.Sal-rITR,
respectively, as indicated in FIG. 7. The following amplification
program was used: 30 seconds at 94.degree. C., 1 cycle; 30 seconds
94.degree. C. and 30 seconds at 50.degree. C. and 90 seconds at
68.degree. C., 35 cycles; 10 minutes 68.degree. C., 1 cycle. This
PCR reaction yields a DNA fragment of 169 bp.
[0122] As shown in FIG. 7, left panel (set A), E2A sequences were
amplified from the DNA samples (+) and control samples (-) spiked
with both 1, 10 and 40 molecules, as evidenced by the amplification
of a 260 bp DNA fragment. In contrast, no E2A sequences were
amplified from the non-spiked samples. This shows that reversion of
the E2A-deleted does not occur. The PCR reactions with primers
731/734 yielded the expected DNA fragment of 169 bp in the samples
containing the recombinant adenoviral vector DNA (+). From the
negative control samples containing the water instead of DNA (-),
no DNA fragment of 169 bp was amplified. These data show that
elimination of overlap between adenoviral sequences in the vector
and cell line prevents reversion of the E2A-deleted phenotype.
EXAMPLE V
[0123] Transduction Capacity of and Residual Expression of
Adenoviral Genes from E1-deleted and E1/E2A-deleted Recombinant
Adenoviral Vectors
[0124] The transduction capacity of E1/E2A deleted vectors was
compared to E1 deleted vectors. HeLa cells were seeded at
5.times.10.sup.5 cells/well in 6 well plates (Greiner) in DMEM
supplemented with 10% FBS in a 10% CO.sub.2 atmosphere at
37.degree. C. The next day, cells were infected with a m.o.i. of
either 0, 10, 100 or 1000 viral particles IG.Ad/CMV.LacZ or
IG.Ad/CMV.LacZDE2A per cell. Forty-eight hours post infection,
cells were washed with PBS (NPBI) and fixed for 8 minutes in 0.25%
glutaraldehyde (Sigma) in PBS (NPBI). Subsequently, the cells were
washed twice with PBS and stained for 8 hours with X-gal solution
(1 mg/ml X-gal in DMSO (Gibco), 2 mM MgCl.sub.2 (Merck), 5 mM
K.sub.4[Fe(CN).sub.6].3H.s- ub.2O (Merck), 5mM
K.sub.3[Fe(CN).sub.6] (Merck) in PBS. The reaction was stopped by
removal of the X-gal solution and washing of the cells with PBS.
FIG. 8 shows that IG.Ad/CMV.LacZDE2A transduced HeLa cells at least
as good as did IG.Ad/CMV.LacZ at all m.o.i.'s. Comparable results
were obtained after infection of IG.Ad.CLIP.LacZ and
IG.Ad.CLIP.LacZDE2A and after infection of A549 cells with the
respective recombinant adenoviral vectors. These data show that the
viral particle to transduction unit ratio (vp/tu) of E1/E2A deleted
vectors (e.g., IG.Ad/CMV.LacZDE2A) is at least as good as the vp/tu
of E1 deleted vectors (e.g., IG.Ad/CMV.LacZ).
[0125] Next, the vp/tu ratio of E1- and E1/E2A-deleted vectors was
determined in a more sensitive assay, i.e., a luciferase assay.
HeLa and A549 cells were seeded at 5.times.10.sup.5 cells/well in 6
well plates (Greiner) in DMEM supplemented with 10% FBS in a 10%
CO.sub.2 atmosphere at 37.degree. C. The next day, cells were
infected with a m.o.i. of either 0, 10, 100, 1,000 or 10,000
vp/cell IG.Ad/CLIP.Luc or IG.Ad/CLIP.LucDE2A per cell. Two days
post infection, cells were lysed and the luciferase activity was
determined with the Luciferase Assay System according to the
protocol of the supplier (Promega). FIG. 9 shows that both the
IG.Ad/CLIP.LucDE2A infected HeLa and A549 cells produce more
luciferase enzyme than the IG.Ad/CLIP.Luc infected HeLa and A549
and HeLa cells, at all m.o.i.'s tested. These data confirm that
E1/E2A deleted recombinant adenoviral vectors produced on
PER.C6ts125E2A cells have a vp/tu ratio that is at least as good as
the vp/tu ratio of E1 deleted vectors. The above is in contrast to
what has recently been reported by others (O'Neal et al., 1998;
Lusky et al., 1998), who found that the vp/tu ratio of E1/E2A
deleted recombinant adenoviral vectors is impaired significantly.
However, these vectors were produced on two independent 293 based
E2A complementing cell lines harboring inducible E2A genes. This
suggests that the use of temperature sensitive E2A genes, such as
ts125E2A, yields superior E2A complementing cell lines as compared
to the commonly used inducible E2A genes.
[0126] In order to test whether E1/E2A deleted vectors residually
express adenoviral proteins, the following experiment has been
performed. A549 cells were seeded on 6 well plates (Greiner) at a
density of 5.times.10.sup.5 cells/well in DMEM supplemented with
10% FBS in a 10% CO.sub.2 atmosphere at 37.degree. C. The next day,
cells were infected with a m.o.i. of either 0, 100, 1,000 or 10,000
vp/cell IG.Ad/CLIP or IG.Ad.CLIPDE2A. After 12 hours, the infection
medium was replaced by fresh DMEM supplemented with 10% FBS.
Seventy-two hours post infection, the cells were washed with PBS
(NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium
deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM
phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor).
After 15 minutes incubation on ice, the lysates were cleared by
centrifugation. Protein concentrations were determined by the
BioRad protein assay, according to standard procedures of the
supplier (BioRad). Equal amounts of whole-cell extract were
fractionated by SDS-PAGE on 10% gels in triplicate. Proteins were
transferred onto Immobilon-P membranes (Millipore) and incubated
with the aDBP monoclonal antibody B6, the polyclonal a-Penton base
antibody Ad2-Pb571 (kind gift of Dr. P. Boulanger, Montpellier,
France) and the polyclonal a-knob domain antibody of fiber E641/3
(kind gift of R. Gerard, Leuven, Belgium). The secondary antibodies
were ahorseradish-peroxidase-conjugated goat anti mouse and
ahorseradish-peroxidase-conjugated goat anti rabbit (BioRad). The
Western blotting procedure and incubations were performed according
to the protocol provided by Millipore. The complexes were
visualized with the ECL detection system according to the
manufacturer's protocol (Amersham). FIG. 10 shows that cells
infected with IG.Ad.CLIP express both E2A encoded DBP, Penton base
and Fiber proteins. The proteins co-migrated with the respective
proteins in the positive control (lane P, extract from PER.C6 cells
infected with IG.Ad.CLIP harvested at starting CPE). The residual
expression of these proteins in A549 cells was m.o.i. dependent. In
contrast, no DBP, penton-base or fiber was detected in the
non-infected A549 cells or cells infected with IG.Ad.CLIPDE2A.
These data show that deletion of the E2A gene did not only
eliminate residual DBP expression, but also the residual expression
of the late adenoviral proteins, penton-base and fiber.
[0127] In conclusion, the foregoing shows that E1/E2A deleted
vectors produced on PER.C6/tsE2A complementing cell lines have a
favorable phenotype. First, these vectors have an ideal vp/tu
ratio, which is at least as good as that of E1 deleted vectors.
Second, the E1/E2A deleted vectors do not residually express
detectable amounts of E2A encoded DBP or late gene encoded
penton-base or fiber. This favorable phenotype improves the
prospects for the use of recombinant adenoviral vectors in gene
therapy.
Sequence CWU 1
1
29 1 35 DNA Artificial Sequence Description of Artificial Sequence
primer DBPpcr1 1 cgggatccgc caccatggcc agtcgggaag aggag 35 2 33 DNA
Artificial Sequence Description of Artificial Sequence primer
DBPpcr2 2 cggaattctt aaaaatcaaa ggggttctgc cgc 33 3 23 DNA
Artificial Sequence Description of Artificial Sequence oligo-linker
containing PacI site 3 aattgtctta attaaccgct taa 23 4 19 DNA
Artificial Sequence Description of Artificial Sequence
oligonucleotide used to form oligo-linker described by SEQ. ID. NO.
3 4 aattgtctta attaaccgc 19 5 19 DNA Artificial Sequence
Description of Artificial Sequence oligonucleotide used to form
oligo-linker described by SEQ. ID. NO. 3 5 aattgcggtt aattaagac 19
6 23 DNA Artificial Sequence Description of Artificial Sequence
primer DE2A.SnaBI 6 ggcgtacgta gccctgtcga aag 23 7 35 DNA
Artificial Sequence Description of Artificial Sequence primer
DE2A.DBP-start 7 ccaatgcatt cgaagtactt ccttctccta taggc 35 8 22 DNA
Artificial Sequence Description of Artificial Sequence primer
DE2A.DBP-stop 8 ccaatgcata cggcgcagac gg 22 9 21 DNA Artificial
Sequence Description of Artificial Sequence primer DE2A.BamHI 9
gaggtggatc ccatggacga g 21 10 27 DNA Artificial Sequence
Description of Artificial Sequence primer SV40-1 10 gggggatccg
aacttgttta ttgcagc 27 11 25 DNA Artificial Sequence Description of
Artificial Sequence primer SV40-2 11 gggagatcta gacatgataa gatac 25
12 27 DNA Artificial Sequence Description of Artificial Sequence
primer Ad5-1 12 gggagatctg tactgaaatg tgtgggc 27 13 24 DNA
Artificial Sequence Description of Artificial Sequence primer Ad5-2
13 ggaggctgca gtctccaacg gcgt 24 14 47 DNA Artificial Sequence
Description of Artificial Sequence primer LTR-1 14 ctgtacgtac
cagtgcactg gcctaggcat ggaaaaatac ataactg 47 15 63 DNA Artificial
Sequence Description of Artificial Sequence primer LTR-2 15
gcggatcctt cgaaccatgg taagcttggt accgctagcg ttaaccgggc gactcagtca
60 atc 63 16 27 DNA Artificial Sequence Description of Artificial
Sequence primer HSA1 16 gcgccaccat gggcagagcg atggtgg 27 17 50 DNA
Artificial Sequence Description of Artificial Sequence primer HSA2
17 gttagatcta agcttgtcga catcgatcta ctaacagtag agatgtagaa 50 18 32
DNA Artificial Sequence Description of Artificial Sequence primer
used for amplification of E. coli LacZ 18 ggggtggcca gggtacctct
aggcttttgc aa 32 19 29 DNA Artificial Sequence Description of
Artificial Sequence primer used for amplification of E. coli LacZ
19 ggggggatcc ataaacaagt tcagaatcc 29 20 20 DNA Artificial Sequence
Description of Artificial Sequence primer 1 20 gggtattagg
ccaaaggcgc 20 21 33 DNA Artificial Sequence Description of
Artificial Sequence primer 2 21 gatcccatgg aagcttgggt ggcgacccca
gcg 33 22 36 DNA Artificial Sequence Description of Artificial
Sequence primer 3 22 gatcccatgg ggatccttta ctaagttaca aagcta 36 23
19 DNA Artificial Sequence Description of Artificial Sequence
primer 4 23 gtcgctgtag ttggactgg 19 24 20 DNA Artificial Sequence
Description of Artificial Sequence primer 551 24 ccggcaagtc
ttgcggcatg 20 25 21 DNA Artificial Sequence Description of
Artificial Sequence primer 556 25 tagcaggtcg ggcgccgata t 21 26 22
DNA Artificial Sequence Description of Artificial Sequence primer
553 26 ggctcaggtg gcttttaagc ag 22 27 22 DNA Artificial Sequence
Description of Artificial Sequence primer 554 27 gagttgcgat
acacagggtt gc 22 28 20 DNA Artificial Sequence Description of
Artificial Sequence primer 731 28 agtgcgcaga ttaggagcgc 20 29 20
DNA Artificial Sequence Description of Artificial Sequence primer
734 29 tctgcctata ggagaaggaa 20
* * * * *