U.S. patent application number 09/902772 was filed with the patent office on 2002-11-07 for cell calcification supressing proteins, and genes of the proteins.
This patent application is currently assigned to Chugai Seiyaku Kabushiki Kaisha. Invention is credited to Higuchi, Yoshinobu, Iwamoto, Masahiro, Pacifici, Maurizio, Rosenbloom, Joel.
Application Number | 20020164739 09/902772 |
Document ID | / |
Family ID | 25371531 |
Filed Date | 2002-11-07 |
United States Patent
Application |
20020164739 |
Kind Code |
A1 |
Iwamoto, Masahiro ; et
al. |
November 7, 2002 |
Cell calcification supressing proteins, and genes of the
proteins
Abstract
This invention provides cell-calcification inhibitory proteins
as well as genes encoding the proteins. Based on the discovery of a
novel isoform gene of the c-erg gene (herein referred to as "C-11
gene") which is an erg gene derived from chickens, the nucleotide
sequence of the gene has been determined, and then the expression
of a protein encoded by such gene (herein referred to as "C-11
protein") has been confirmed. Further, it has been discovered that
when the c-erg or C-11 gene is introduced into osteoblasts, the
calcification of the cells is inhibited.
Inventors: |
Iwamoto, Masahiro; (Osaka,
JP) ; Higuchi, Yoshinobu; (Shizuoka, JP) ;
Pacifici, Maurizio; (Philadelphia, PA) ; Rosenbloom,
Joel; (Philadelphia, PA) |
Correspondence
Address: |
MORGAN LEWIS & BOCKIUS LLP
1111 PENNSYLVANIA AVENUE NW
WASHINGTON
DC
20004
US
|
Assignee: |
Chugai Seiyaku Kabushiki
Kaisha
|
Family ID: |
25371531 |
Appl. No.: |
09/902772 |
Filed: |
July 12, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09902772 |
Jul 12, 2001 |
|
|
|
08878177 |
Jun 18, 1997 |
|
|
|
6294354 |
|
|
|
|
Current U.S.
Class: |
435/184 ;
424/94.1; 435/320.1; 435/325; 435/69.2; 536/23.2 |
Current CPC
Class: |
C07K 14/465
20130101 |
Class at
Publication: |
435/184 ;
435/320.1; 435/325; 435/69.2; 424/94.1; 536/23.2 |
International
Class: |
A61K 038/43; C12N
009/99; C07H 021/04; C12P 021/02; C12N 005/06 |
Claims
What is claimed is:
1. A C-11 protein comprising a protein selected from the group
consisting of: (a) a protein comprising an amino acid sequence
having SEQ ID NO. 2 (SEQUENCE LISTING); and (b) a protein
comprising an amino acid sequence that is derived from the amino
acid sequence having SEQ ID NO. 2 by deletion, substitution or
insertion of one or more amino acids, said protein having
cell-calcification inhibitory activity.
2. A gene encoding the protein according to claim 1.
3. A pharmaceutical composition comprising the protein according to
claim 1.
4. The pharmaceutical composition according to claim 3, wherein
said composition is intended for a cell-calcification
inhibitor.
5. A cell-calcification inhibitor comprising a c-erg protein
selected from the group consisting of: (a) a protein comprising an
amino acid sequence having SEQ ID NO. 4 (SEQUENCE LISTING); and (b)
a protein comprising an amino acid sequence that is derived from
the amino acid sequence having SEQ ID NO. 4 by deletion,
substitution or insertion of one or more amino acids, said protein
having cell-calcification inhibitory activity.
6. An antibody to the C-11 protein according to claim 1.
7. The antibody according to claim 6, wherein said antibody is a
monoclonal antibody.
8. A method for measuring the calcification of cells comprising:
measuring the expression of a C-11 gene or a c-erg gene in the
cells.
9. The method according to claim 8, wherein the expression of the
gene is measured by the amount of C-11 mRNA expressed in the cells
or the amount of c-erg mRNA expressed in the cells using a probe
against a DNA sequence specific to the C-11 gene or to the c-erg
gene.
10. The method according to claim 8, wherein the expression of the
gene is measured by the amount of expression of a C-11 protein in
the cells or the amount of expression of a c-erg protein in the
cells.
11. The method according to claim 8, wherein the expression of the
gene is measured by the amount of the C-11 protein expressed in the
cells or the amount of the c-erg protein expressed in the cells by
means of the antibody according to claims 6, or 7.
12. A method for diagnosing osteoarthritis or OPLL comprising:
measuring the cell-calcification using a method according to any of
claims 8-11.
13. A kit for measuring the cell-calcification of cells comprising
either or both of an antibody to a C-11 protein and an antibody to
a c-erg protein.
14. A method for screening a substance having cell-calcification
inhibitory blocking activity, said method comprising using cells
transformed with a gene encoding a protein selected from the group
consisting of: (a) a protein comprising an amino acid sequence
having SEQ ID NO. 2 (SEQUENCE LISTING); (b) a protein comprising an
amino acid sequence that is derived from the amino acid sequence
having SEQ ID NO. 2 by deletion, substitution or insertion of one
or more amino acids, said protein having cell-calcification
inhibitory activity; (c) a protein comprising an amino acid
sequence having SEQ ID NO. 4. (SEQUENCE LISTING); and (d) a protein
comprising an amino acid sequence that is derived from the amino
acid sequence having SEQ ID NO. 4 by deletion, substitution or
insertion of one or more amino acids, said protein having
cell-calcification inhibitory activity.
15. A pharmaceutical composition comprising an erg protein.
16. A pharmaceutical composition comprising an erg gene.
17. A pharmaceutical composition comprising a C-11 protein or a
c-erg protein.
18. A pharmaceutical composition comprising a C-11 gene or a c-erg
gene.
19. A pharmaceutical composition comprising a protein having a
consensus amino acid sequence between a c-erg protein and a C-11
protein.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] This invention relates to cell-calcification inhibitory
proteins as well as to genes encoding such proteins.
[0003] 2. Description of Related Art
[0004] Ets genes were first identified as oncogene of avian acute
leukemia virus E26. Recently, the family of Ets related genes (Ets
gene superfamily) has been found in a host ranging from human to
Drosophila. It is believed that these genes are a transcriptional
modulator which plays a basic, important role in the control of
proliferation and differentiation of cells. In contrast, the
biological functions of the Ets gene superfamily are hardly
known.
SUMMARY OF THE INVENTION
[0005] Recently, it has been reported that the Ets related genes
(erg) are specifically expressed at the sites of cartilage
formation. This indicated the possibility of erg's being involved
to some extent in skeleton formation at its initial stages. The
present inventors, based on such findings, have accomplished the
invention by introducing into osteoblasts, an erg gene derived from
chickens (herein referred to as "chicken-erg gene" or "c-erg gene")
and by successfully elucidating the functions of the c-erg
gene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0006] This application contains at least one figure in color.
Copies of a patent issuing from the application, which includes
color figures, will be available from the United States Patent and
Trademark Office upon request and payment of necessary fees.
[0007] FIG. 1 illustrates the nucleotide sequence for c-erg cDNA
and the deduced amino acid sequence for c-erg protein, were the
nucleotide sequence lacking the underlined portion of sequence in
the figure corresponds to the C-11 gene nucleotide sequence
according to this invention.
[0008] FIG. 2 illustrates the gene domain encoding the c-erg
protein, where ETA, NRT, EDB, and CTA represent an erg/ets
transcription domain, a transcription repressor domain, an erg/ets
DNA-binding domain, and a carboxyl terminal transcription domain,
respectively.
[0009] FIG. 3 illustrates an autoradiograph of the gel
electrophoresis results showing RT-PCR amplified products obtained
in Example 2-4, where a 473 bp band and a 392 bp band, correspond
to c-erg and C-11, respectively.
[0010] FIG. 4 illustrates the results comparing DNA synthesizing
abilities of Rcas (osteoblasts infected with RCAS only), c-erg-L14
(osteoblasts infected with a c-erg sense segment-introduced RCAS),
and c-erg-L44 (osteoblasts infected with a c-erg antisense
segment-introduced RCAS).
[0011] FIG. 5 illustrates the results comparing the DNA
synthesizing abilities of Rcas (the osteoblasts infected with RCAS
only) and C-11-L14 (osteoblasts infected with a C-11 sense
segment-introduced RCAS).
[0012] FIG. 6 illustrates the results comparing alkaline
phosphatase activities of Rcas (the osteoblasts infected with only
RCAS), c-erg-L14 (the osteoblasts infected with the c-erg sense
segment-introduced RCAS) and c-erg-L44 (the osteoblasts infected
with the c-erg antisense segment-introduced RCAS).
[0013] FIG. 7 illustrates the results comparing the alkaline
phosphatase activities of Rcas (the osteoblasts infected with RCAS
only) and C-11-L14 (the osteoblasts infected with the C-11 sense
segment-introduced RCAS).
[0014] FIG. 8 illustrates a photograph showing the results on
deposition of calcified products in a culture system consisting of
uninfected osteoblasts (the upper half) and the osteoblasts
infected with RCAS only (the lower half) as measured by the
Alizarin Red staining.
[0015] FIG. 9 illustrates a photograph showing the results on
deposition of calcified products in a culture system consisting of
the osteoblasts infected with c-erg-L14 RCAS (sense segment) (the
upper half) and the osteoblasts infected with c-erg-L44 RCAS
(antisense segment) (the lower half) as measured by the Alizarin
Red staining.
[0016] FIG. 10 illustrate a photograph showing the results on
deposition of calcified products in a culture system consisting of
the osteoblasts infected with RCAS only, the osteoblasts infected
with c-erg-L14 RCAS (sense segment), the osteoblasts infected with
c-erg-L44 RCAS (antisense segment), and the osteoblasts infected
with C-11-L14 RCAS (sense segment) as measured by the Alizarin Red
staining.
[0017] FIG. 11 illustrates a photograph showing the results on
deposition of calcified products within cell nuclei in a culture
system consisting of the osteoblasts infected with RCAS only, the
osteoblasts infected with c-erg-L14 RCAS (sense segment), the
osteoblasts infected with c-erg-L44 RCAS (antisense segment), and
the osteoblasts infected with C-11-L14 RCAS (sense segment) as
measured by the von Kossa staining (the right two columns) in
addition to those obtained by double-staining the cell nuclei of
the respective osteoblasts with Alum-carmine (the left column).
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0018] The present inventors have discovered a novel isoform gene
of the c-erg gene (herein referred to as "C-11 gene" or "C11 gene")
which is an erg gene derived from chicken and determined its
nucleotide sequence. Furthermore, the inventors have confirmed the
expression of a protein encoded by such gene (herein referred to as
C-11 protein or "C11 protein").
[0019] Also, the inventors have discovered that when the c-erg or
C-11 gene is introduced into osteoblasts, the calcification of the
blasts (or cells) is inhibited.
[0020] More specifically, this invention provides a C-11 protein
comprising a protein selected from the group consisting of:
[0021] (a) a protein comprising an amino acid sequence having SEQ
ID NO. 2 (SEQUENCE LISTING), and
[0022] (b) a protein comprising an amino acid sequence that is
derived from the amino acid sequence having SEQ ID NO. 2 by
deletion, substitution or insertion of one or more amino acids,
said protein having cell-calcification inhibitory activity.
[0023] Also, the invention provides a gene encoding the
aforementioned protein.
[0024] Further, the invention provides a pharmaceutical composition
comprising the aforementioned protein as well as provides a
pharmaceutical composition intended for a cell-calcification
inhibitor.
[0025] Also, the invention provides a cell-calcification inhibitor
comprising a c-erg protein selected from the group consisting
of:
[0026] (a) a protein comprising an amino acid sequence having SEQ
ID NO. 4 (SEQUENCE LISTING); and
[0027] (b) a protein comprising an amino acid sequence that is
derived from the amino acid sequence having SEQ ID NO. 4 by
deletion, substitution or insertion of one or more amino acids,
said protein having cell-calcification inhibitory activity.
[0028] Further, the invention provides an antibody to the C-11
protein as well as provides an antibody, characterized in that said
antibody is a monoclonal antibody.
[0029] Still further, the invention provides a method for measuring
the calcification of cells comprising the step of measuring the
expression of a C-11 gene or a c-erg gene in the cells.
[0030] Also, the invention provides the aforementioned method
wherein the expression of the gene is measured by the amount of
C-11 mRNA expressed in the cells or the amount of c-erg mRNA
expressed in the cells using a probe against a DNA sequence
specific to the C-11 gene or to the c-erg gene.
[0031] Also, the invention provides the aforementioned method
wherein the expression of the gene is measured by the amount of
expression of the C-11 protein in the cells or the amount of
expression of the c-erg protein in the cells.
[0032] Further, the invention provides the aforementioned method
wherein the expression of the C-11 protein or the c-erg protein in
the cells is measured by means of an antibody to the C-11 protein
or to the c-erg protein.
[0033] Also, the invention provides a method for diagnosing such
diseases as OPLL (Ossification of posterior longitudinal ligament)
and osteoarthritis which cause pathologic calcification or
ossification, said method comprising using the aforementioned
method of measurement of the cell-calcification.
[0034] In addition, the invention provides a kit for measuring the
calcification of cells, comprising either or both of an antibody to
the C-11 protein and an antibody to the c-erg protein.
[0035] Further, the invention provides a method for screening a
substance having cell-calcification inhibitory blocking activity,
said method comprising using cells transformed with a gene encoding
a protein selected from the group consisting of:
[0036] (a) a protein comprising an amino acid sequence having SEQ
ID NO. 2 (SEQUENCE LISTING);
[0037] (b) a protein comprising an amino acid sequence that is
derived from the amino acid sequence having SEQ ID NO. 2 by
deletion, substitution or insertion of one or more amino acids,
said protein having cell-calcification inhibitory activity;
[0038] (c) a protein comprising an amino acid sequence having SEQ
ID NO. 4 (SEQUENCE LISTING); and
[0039] (d) a protein comprising an amino acid sequence that is
derived from the amino acid sequence having SEQ ID NO. 4 by
deletion, substitution or insertion of one or more amino acids,
said protein having cell-calcification inhibitory activity.
[0040] Furthermore, the invention provides a pharmaceutical
composition comprising an erg protein.
[0041] Also, the invention provides a pharmaceutical composition
comprising an erg gene.
[0042] Further, the invention provides a pharmaceutical composition
comprising the C-11 protein or the c-erg protein.
[0043] In addition, the invention provides a pharmaceutical
composition comprising the C-11 gene or the c-erg gene.
[0044] Still further, the invention provides a pharmaceutical
composition comprising a protein having a consensus amino acid
sequence between the c-erg protein and the C-11 protein.
[0045] In the present specification and the accompanying drawings
where abbreviations are used to describe bases and amino acids. The
abbreviations according to the IUPAC-IUB rules or those
ascertainable in the art to which the invention pertains are used
as set forth in the following:
1 Nucleic Acid DNA Deoxyribonucleic acid cDNA Complementary DNA RNA
Ribonucleic acid mRNA Messenger RNA A Adenine C Cytosine G Guanine
T Thymine
[0046] Isolation and Identification of C-11 Gene
[0047] The novel gene according to this invention is an isoform of
the c-erg gene derived from chickens. As shown in FIG. 1, when
compared with the nucleotide sequence for the c-erg gene, the novel
gene has a nucleotide sequence lacking 81 nucleotides from
nucleotide 655 to nucleotide 735 (See, SEQ ID NO. 1 in the Sequence
Listing). The novel gene according to the invention (or C-11 gene)
can be isolated from a variety of cells by a method ordinarily
known in the art.
[0048] Specifically, total RNA is extracted from chicken embryos,
4-10 days old. After the RNA has been subjected to reverse
transcription, the entire translational region of the c-erg gene
and C-11 gene can be amplified by the PCR method.
[0049] Primers that can be used in PCR, for example, include the
following C11B and C11C which amplify both c-erg and C-11
genes:
2 C11B:5'- CACATTATGGCAAGCACTATTAAGG - 3' C11C:5'-
CACTTAGTAGTAGGTGCCAAGATGG - 3' C11A:5'- ATCTTGATCACATTATGGCAAGC -
3'
[0050] When Primers C11B and C11C are each used, two bands, 1446 bp
and 1355 bp, appear: the former band corresponds to the c-erg gene
and the latter band to the C-11 gene, respectively. When Primers
C11A and C11C are each used, two kinds of DNAs, 1454 bp (c-erg) and
1373 bp (C-11), can be amplified.
[0051] In either case, the RT-PCR conditions are as follows: 1
.mu.g of total RNA is subjected to reverse transcription and
subsequently to 30 cycles of amplification for one minute at
61.degree. C., for two minutes at 72.degree. C. and for 10 seconds
at 95.degree. C. employing 2 units of Tag polymerase to render the
products detectable.
[0052] In addition, based on the determined nucleotide sequence as
described above it is easy to prepare an oligonucleotide probe
complementary to an appropriate partial nucleotide sequence
thereof. Such probes may be used to enable detection of the C-11
gene by various techniques.
[0053] C-11 Protein
[0054] The C-11 protein which can be deduced from the nucleotide
sequence for the C-11 gene has an amino acid sequence set forth in
SEQ ID NO. 2 in the Sequence Listing.
[0055] The C-11 protein can also be expressed in suitable host
cells by incorporating the C-11 gene into viral vectors such as
adenovirus and chicken retrovirus. See Gene Transfer and
Expression: A Laboratory Manual by Michael Kriegler, W.H. Freeman
and Company, New York (1991), p29-56. Further, the amino acid
sequence of the proteins thus obtained can be directly determined
on a conventional amino acid sequencer.
[0056] Furthermore, it is possible to modify the sequence of the
C-11 gene set forth as SEQ ID NO. 1 in the Sequence Listing by
substitution, deletion or insertion of an arbitrary sequence in
said sequence using, for example, site-directed mutagenesis. The
site-directed mutagenesis can be repeated one to a few times to
prepare C-11 protein variants in which one to a few amino acids are
substituted, deleted or inserted as well as gene mutants encoding
the variants. Such variants are within the scope of the invention
insofar as they possess cell-calcification inhibitory activity.
[0057] Also, various methods known in the art may be used to detect
the C-11 protein expressed within particular cells. Specifically,
representative methods include immunostaining using an antibody to
the C-11 protein or a partial protein thereof, a method for the
detection of their localization by the use of a fluorescent
antibody technique, and a method for measuring the amount of
expression of the C-11 protein by means of a radioimmunoassay or
ELISA technique on homogenated cells.
[0058] c-erg Protein
[0059] In a manner similar to that used for the C-11 protein, it is
possible to express the c-erg protein set forth as SEQ ID NO. 4 in
the Sequence Listing.
[0060] Further, variants of the c-erg protein or mutants of their
genes can be prepared in a manner similar to that used for the C-11
protein or genes thereof, and can satisfactorily be utilized in
this invention insofar as they possess cell-calcification
inhibitory activity.
[0061] Antibody (Monoclonal Antibody) to C-11 Protein
[0062] An antibody to the C-11 protein according to the invention
may be that which reacts against either the aforementioned entire
C-11 protein or a partial oligopeptide thereof. In addition, it is
possible to use an antibody conjugated with a suitable substance
such as a protein which will impart particular properties to the
antibody.
[0063] There is no limitation concerning immunological methods in
which the aforementioned proteins etc., are used as antigens, and
any immunological techniques ordinarily known in the art may be
used. Following such methods, a serum containing polyclonal
antibodies may be obtained. Further, particular fractions such as
IgG can be obtained by purification through ammonium sulfate
fractionation or on Protein A Sepharose.
[0064] Furthermore, it is also possible to prepare monoclonal
antibodies by the cell fusion method.
[0065] Cell-Calcification Inhibitory Activity
[0066] "Cell-calcification inhibitory activity" caused by
introduction of the C-11 gene or the c-erg gene according to the
invention, into cells means the inhibition of calcification
inductive ability by osteoblasts infected with viral vectors having
the aforementioned genes cloned. In this invention the Alizarin Red
method may preferably be used to measure the amount of deposition
of calcified products which the cells have induced. Also, the von
Kossa method (also known as the Alum-carmine method) permits easy
discrimination.
[0067] Pharmaceutical Compositions and Methods for their
Administration
[0068] The pharmaceutical compositions according to the invention
are characterized by containing the erg protein, erg gene, C-11
protein, c-erg protein, C-11 gene or c-erg gene, each of which has
the function to inhibit the calcification of cells as described
above. Accordingly, by virtue of the cell-calcification inhibition,
those compositions are capable of treating various diseases, more
specifically those in which pathological calcification causes
ossification such as OPLL and osteoarthritis.
[0069] The pharmaceutical compositions provided by the invention
are those which contain the aforementioned erg protein, erg gene,
C-11 protein, c-erg protein, C-11 gene or c-erg gene. Method for
administration of those pharmaceutical compositions are not
particularly limited, and conventional administration method are
available for use. Specifically, these include local injection,
subcutaneous injection and oral administration. In addition,
intracellular microinjection or the like may be indicated.
[0070] More specifically, by introducing into the cells, the c-erg
protein or the C-11 protein in its form bound to a suitable hormone
or the like, or in its form as a fused protein, it is possible to
have the c-erg or C-11 protein bound to receptors for the hormone,
which allows the c-erg or C-11 protein together with the hormone to
be taken up within the cells.
EXAMPLE 1
[0071] Isolation of C-11 Gene and c-erg Gene
[0072] Sterna were separated from chicken embryos, 18 days old and
total RNA was then extracted. See, Iwamoto M. et al., Microscopy
Research and Technique (1994) 28: 483-491. After the RNA thus
obtained had been subjected to reverse transcription, amplification
was allowed to proceed 30 cycles for one minute at 61.degree. C.,
for two minutes at 72.degree. C., and for 10 seconds at 95.degree.
C., respectively using PCR Primers (C11A and C11C, or C11B and
C11C) which amplify the entire coding region for the c-erg gene.
With either pair of the primers, two bands were obtained.
Respective bands were cut out and DNA fragments were identified
using a QiaexII gel extraction kit (Qiagen, Germany). These
fragments were subcloned into a PCRII vector (Invitrogen, Calif.,
USA), and then the full-length nucleotide sequences were determined
by the Dideoxy method. As a result, a 1454 bp DNA fragment
amplified with the primer pair of C11A and C11C completely matched
the c-erg gene (Mechanism of Development (1995) 50: 17-28), whereas
a 1373 bp DNA fragment turned out to be a sequence lacking 81 bases
of from nucleotide 655 to nucleotide 735, from the c-erg gene. This
novel sequence thus obtained was designated "C-11".
[0073] DNA fragments amplified using the primer pair of C11B and
C11C were two kinds, namely 1446 bp and 1335 bp: the former
fragment was c-erg and the latter was C-11. These results suggest
the possibility that the thus obtained C-11 gene is an isoform of
the c-erg gene.
[0074] It was also possible to isolate the aforementioned C-11 gene
by a conventional subtraction method. Particularly, according to
the subtraction method ordinarily known in the art, a cDNA which
had specifically expressed in the embryonic sterna was cloned by
employing a cDNA library of chicken embryonic sterna and
fibroblasts. From the thus obtained candidate clones, genes were
amplified by the PCR reaction using suitable primers to provide
amplified gene products, the full nucleotide sequences of which
were determined by standard techniques.
[0075] Results obtained with the aforementioned c-erg gene are
shown through Example 2-1 to Example 2-8 as described below. In a
like manner, experiments were conducted using the aforementioned
C-11 gene and results therefrom are shown below, together with
these for the c-erg gene.
EXAMPLE 2-1
[0076] Construction of a Vector Containing the c-erg Gene
[0077] The cloned c-erg as described above was subcloned into a
RCAS vector (See, Journal of Virology (1987), Oct.: 3004-3012) at
its ClaI site in sense (c-erg) and antisense (AS-c-erg) directions,
respectively. That they were indeed sense and antisense as
described was confirmed by DNA sequencing.
[0078] The RCAS vector containing the subcloned c-erg and that
containing the subcloned AS-c-erg were, respectively, introduced
into chicken embryonic fibroblasts by the calcium phosphate
co-precipitation method as described in Chen C. and Okayama H.,
Mol. Cell Biol. (1987), 7: 2745-2752. The vector-introduced cells
were cultured for 48 hours at 37.degree. C. on a DMEM medium
containing 10% fetal bovine serum (The Nikken Biological Science
Research Institute, Kyoto). Subsequently, virus produced in the
culture supernatant was concentrated by means of a ultrafiltration
membrane (molecular weight: 30,000 cut) (Centriprep available from
Amicon Inc., Mass., USA). This virus is herein referred to as
"virus-CM".
[0079] In a like manner, only the RCAS vector was introduced into
chicken embryonic fibroblasts and the virus recovered from the
vector-introduced cells was used as a control.
[0080] A virus stock from the aforementioned chicken embryonic
fibroblasts which was used in this invention was prepared by the
method as described below. Specifically, CEF was transfected with a
DNA which had been obtained from RSV (Rous Sarcoma Virus) by
substitution of its v-src with a target gene by means of Calcium
phosphate method and which contained a proviral structure with LTR
at its both ends. The cells into which the genes were introduced,
temporarily released a large quantity of virus. Then, the virus
reached the state of propagation throughout the whole culture used
in the transfection by virus infection. At this point, a virus
stock was recovered from the culture medium. More specifically, CEF
cells propagated in a confluent manner, which had been cultured 4-5
days after preparation, were inoculated in a 60 mm dish at
0.8.times.10.sup.6 cells. On the following day, 10 .mu.g of a DNA
fragment or plasmid, each of which had been provided with a
proviral structure, was introduced into the cells by transfection,
according to the calcium phosphate co-precipitation method. The
medium was made afresh one to two hours prior to transfection. Ten
hours after transfection, the culture medium was washed three times
with a standard medium and then the cells were allowed to propagate
for two days. The whole culture transfected was passaged to a 90 mm
dish and allowed to propagate for two additional days. The medium
was made afresh and it was recovered as the virus stock after 48
hours. A new medium was again added to the culture medium and,
after 12 hours, a virus stock was recovered for the second
time.
EXAMPLE 2-2
[0081] Introduction of the c-erg Gene into Cells
[0082] The c-erg gene was introduced into chicken osteoblasts to
observe the effects according to the method of Iwamoto et al. as
described in J. Biol. Chem., (1993) 268(13): 9645-52. Parietal
bones were excised from a chicken, 18 days old and osteoblasts for
use were isolated from the bones by the method of Louis C. G. et
al. as described in Developmental Biology (1987), 122: 49-60.
[0083] Virus-CM (and the control virus) prepared in Example 2-1 was
added to the osteoblasts prepared as described above and virus
infection was allowed to take place.
[0084] Whether or not the infection had occurred was determined by
observing changes in the differentiation character of the cells.
Infection efficiency toward virus cells was determined by staining
the osteoblasts using a P19 antivirus antibody (Development Studies
Hybridoma Bank) as described in Potts W. M. et al., J. Gen. Viol.,
(1982), 68: 3177-3182.
EXAMPLE 2-3
[0085] Morphological Observation of a Transformant with the c-erg
Gene
[0086] The virus-infected osteoblasts obtained in Example 2-2 were
observed under a phase contrast microscope with a magnification of
10. The result revealed that when compared with the cells in the
control group, the virus-infected osteoblasts showed polygonal
morphology in a smaller size (data not shown in the Drawings).
EXAMPLE 2-4
[0087] Detection of Expression of the c-erg Gene and C-11 Gene
[0088] To detect the expression of the aforementioned isoform, the
C-11 gene, the RT-PCR method was performed according to the
procedure as described below.
[0089] Total RNA was prepared from the pectus spinal tissue of
chicken embryos, 18 days old by the method of Iwamoto et al. as
described in Microscopy Research and Technique (1994), 28: 483-491.
After converting this RNA into a DNA by means of a random hexamer
and a superscript reverse transcriptase (both available from
Gibco-BRL, MD, USA), the PCR amplification reaction was performed
using Primers C11A and C11C (SEQ ID NO. 5 and SE ID NO. 7 set forth
in the Sequence Listing) which had the nucleotide sequence for the
ETA region (erg/ets transcription region) of the c-erg gene shown
in FIG. 2, and that for the NRT region (transcription repressor
region), respectively. In FIG. 2, the one that lacks 81 bases being
flanked with the ETA and NRT domains is the C-11 gene. The thus
obtained amplified products were subjected to electrophoresis on a
2% agarose gel and the results are shown in FIG. 3. These results
revealed that the kinds of mRNA were amplified to show the isoform
G11 gene as a 392 bp band together with the c-erg gene (as a 473 bp
band).
EXAMPLE 2-5
[0090] Measurement of DNA Synthesizing Ability
[0091] The DNA synthesizing ability of the c-erg transformant cells
was measured by the procedure described below.
[0092] After washing the cells with a cooled physiological saline
solution three times, the cells were recovered from a physiological
saline solution containing 0.01N NaOH and 0.2 v/v% Triton X-100.
Upon recovery, the cells were crushed by ultrasonication and
centrifuged to provide a supernatant which was used as a sample in
the measurement. To 100 .mu.l supernatant was added 200 .mu.l of
0.1 g/ml DABA (3,5-diaminobenzoic acid dihydrochloride). After
incubation for 45 minutes at 65.degree. C. under a light-shielding
condition, the reaction was terminated by adding 300 .mu.l of 2N
HCl. Upon termination of the reaction, fluorescence was monitored
at wavelengths of 420 and 510 nm.
[0093] As used herein, "Rcas (or RCAS)" means the cells infected
with the vector only. "c-erg-L14" means a RCAS into which a sense
segment of the c-erg gene has been introduced. "c-erg-L44" means a
RCAS into which an antisense segment of the c-erg gene has been
introduced. Further, "C-11-L14" means a RCAS into which a sense
segment of the C-11 gene has been introduced.
[0094] As shown in FIG. 4, it was found that either of c-erg-L14
and c-erg-L44 (into both of which c-erg had been introduced) showed
no significant difference in the DNA synthesizing ability as
compared with RCAS (into which c-erg had not been introduced). In
contrast, as shown in FIG. 5, it was found that C-11-L14 (into
which C-11 had been introduced) showed a significant increase in
the DNA synthesizing ability as compared with RCAS itself. This
increase was particularly noted until day 6.
EXAMPLE 2-6
[0095] Measurement of Alkaline Phosphatase Activity
[0096] The alkaline phosphatase activity was measured according to
the method of Kato Y. et al. as described in Endocrimology (1990),
127: 114-118.
[0097] Specifically, after washing the cells on ice with a cooled
physiological saline solution three times, the cells were recovered
from a physiological saline solution containing 0.2 v/v % Triton
X-100. Upon recovery, the cells were crushed by ultrasonication and
centrifuged to provide a supernatant which was used as a sample in
the measurement.
[0098] The alkaline phosphatase activity of the supernatant was
measured in 0.5M Tris/HCl buffer (pH 9.0) containing 0.5 mM pNP
(para-nitrophenyl phosphate) and 0.5 mM MgCl.sub.2. After
incubating the mixed solution for 30 minutes at 37.degree. C., the
reaction was terminated by adding 0.25 volume of 1N NaOH. Upon
termination of the reaction, absorbance was monitored at a
wavelength of 410 nm.
[0099] The results obtained employing RCAS, into which c-erg was
introduced, are shown in FIG. 6. While no significant difference
was observed between RCAS (which was the control) and c-erg-L44
(anti-sense segment introduced), the alkaline phosphatase activity
of c-erg-L14 (sense-segment introduced) was found to be markedly
inhibited.
[0100] Similarly, the results obtained employing C-11-L14, into
which a sense segment of the C-11 gene was introduced, are shown in
FIG. 7. As compared with RCAS which was the control, the alkaline
phosphatase activity of C-11-L14 was found to be markedly
inhibited.
EXAMPLE 2-7
[0101] Alizarin Red Staining
[0102] After washing the cultured osteoblasts (on day 12 after
inoculation) with PBS (phosphate buffer saline) twice the cells
were fixed with 100% ethanol. After fixation, Alizarin Red S
(sodium alizarin sulfonate available from Wako Pure Chemicals) was
dissolved in distilled water and adjusted to pH 6.3-6.4 with 0.1 N
NH.sub.3, yielding a 1% Alizarin solution. This was added to the
cells to effect staining for two minutes. After staining, the cells
were washed with distilled water and air-dried.
[0103] Following the abovementioned operations, the calcification
sites of the cells were stained reddish orange.
[0104] FIG. 8 illustrates the results obtained by measuring the
amount of deposition of calcified products in a culture system of
the osteoblasts on day 19 after inoculation by means of Alizarin
Red. Both uninfected cells and cells infected with the RCAS vector
itself showed similar degrees of deposition of the calcified
products. On the other hand, for c-erg-L14 (c-erg sense
segment-introduced RCAS), the deposition was about half that for
c-erg-L44 (c-erg anti-sense segment-introduced RCAS).
[0105] Further, FIG. 9 illustrates that in the case of a C-11-L14
RCAS into which a sense segment of C-11 was introduced, almost no
deposition of the calcified products was observed as the result of
measurement with Alizarin Red.
[0106] FIG. 10 illustrates the results from staining with Alizarin
Red to compare the amounts of deposition of such calcified
products. When compared under conditions where deposition of the
calcified products was clearly observed in the cells infected with
RCAS itself, c-erg L44 showed an extremely small inhibition on
deposition of the calcified products. In contrast c-erg-L14 was
found to nearly inhibit the deposition and C-11-L14 was found to
almost completely inhibit the deposition.
EXAMPLE 2-8
[0107] von Kossa Staining
[0108] After washing the cultured osteoblasts (on day 12 after
inoculation) with PBS twice, the cells were fixed with 100%
ethanol. Then a 1% solution of silver nitrate was added to the
cells and the solution was exposed to the sunlight for 30 minutes.
Subsequently, the cells were washed with distilled water, to which
a 5% aqueous solution of sodium thiosulfate was added. After
allowing to stand for 5-10 minutes, the cells were washed with
water. After washing, staining of cell nuclei was performed by
adding an Alum-carmine solution and allowing to stand for 24
hours.
[0109] Following the abovementioned operations, the
calcification'sites of the cells were stained black, while the
nuclei were stained crimson.
[0110] As in the Alizarin Red staining, with application of the von
Kossa staining a lowered staining was observed and the deposition
of the calcified products was inhibited in the c-erg-L14 group as
compared with the control group (RCAS). Further, in the C-11-L14
group, the deposition was completely inhibited. The staining with
Alum-carmine showed no discrimination among various groups.
Therefore, the observed effects in this invention are not
ascribable to variations in staining efficiency resulting from
differences in the cell number, but are believed to be due to the
fact that both c-erg-L14 and C-11-L14 functionally inhibit the
calcification of the osteoblasts (amount of calcium deposited per
cell).
Sequence CWU 1
1
7 1 1447 DNA C-11 gene, c-erg gene w/ deletion, chicken DNA 1
gaattccgcg aacgaataat tattattagc aattattagc gatcaataat cttgatcaca
60 ttatggcaag cactattaag gaagcattat cagtggtgag tgaagaccag
tccttgtttg 120 agtgtgccta cggatcgccc caccttgcaa agacagaaat
gacagcctcc tcttccagtg 180 aatatgggca aacatcaaag atgagcccgc
gcgttcccca gcaggactgg ttatcacagc 240 ccccggccag agttaccatt
aagatggagt gtaacccaaa ccaggttaat gggtcaagga 300 attcacctga
tgactgcagc gtggcaaaag gagggaaaat ggttagcagt tcagacaatg 360
ttgggatgaa ctatggaagc tacatggaag agaagcatat tccgcctcca aatatgacaa
420 ccaatgaacg aagagttatt gtgccagcag atcctacgtt atggagcaca
gaccatgtac 480 ggcagtggct ggagtgggca gtgaaggagt atggtcttcc
agacgtggac atcttgttgt 540 tccagaacat tgatgggaaa gagttgtgta
aaatgaccaa agatgacttc cagagactca 600 cgccgagcta taacgcagat
atcctcctgt cacacctaca ctacctcaga gagagaggag 660 ccacttttat
ttttccaaat acatcagttt acccagaagc aacgcaaaga ataacaacaa 720
ggccagattt accttatgag caagcgagga gatcagcgtg gacgagtcac agccatccca
780 ctcagtcaaa agctacccaa ccatcatctt caacagtgcc caaaacagaa
gaccagcgtc 840 ctcagttaga tccttatcag attcttggac cgaccagcag
ccgtcttgca aatccaggga 900 gtgggcagat acagctatgg cagttcctac
tggagcttct gtcggacagc tccaactcca 960 actgcatcac ctgggagggc
acaaatgggg agttcaagat gacagaccct gatgaagtgg 1020 ctcggcgttg
gggagagagg aaaagcaaac ctaacatgaa ctatgacaaa ctcagccgtg 1080
cacttcgcta ctactatgac aaaaatatta tgactaaagt tcatggtaaa cgctatgcct
1140 acaaatttga tttccacgga atcgctcagg ccctccagcc tcaccctcca
gaatcatcca 1200 tgtacaaata cccatcagac ctcccctaca tgagttccta
ccatgcacac ccccagaaga 1260 tgaactttgt agctccccat ccccctgctt
tgcccgtaac ctcatccagc ttttttgctg 1320 cccctaatcc atactggaat
tcaccaactg gaggcatcta ccccaatacc aggctgccag 1380 ctgctcatat
gccttcccat cttggcacct actactaagt ggggaaagaa agaaagcgcc 1440 aagaaaa
1447 2 451 PRT protein sequence from C-11 gene 2 Met Ala Ser Thr
Ile Lys Glu Ala Leu Ser Val Val Ser Glu Asp Gln 1 5 10 15 Ser Leu
Phe Glu Cys Ala Tyr Gly Ser Pro His Leu Ala Lys Thr Glu 20 25 30
Met Thr Ala Ser Ser Ser Ser Glu Tyr Gly Gln Thr Ser Lys Met Ser 35
40 45 Pro Arg Val Pro Gln Gln Asp Trp Leu Ser Gln Pro Pro Ala Arg
Val 50 55 60 Thr Ile Lys Met Glu Cys Asn Pro Asn Gln Val Asn Gly
Ser Arg Asn 65 70 75 80 Ser Pro Asp Asp Cys Ser Val Ala Lys Gly Gly
Lys Met Val Ser Ser 85 90 95 Ser Asp Asn Val Gly Met Asn Tyr Gly
Ser Tyr Met Glu Glu Lys His 100 105 110 Ile Pro Pro Pro Asn Met Thr
Thr Asn Glu Arg Arg Val Ile Val Pro 115 120 125 Ala Asp Pro Thr Leu
Trp Ser Thr Asp His Val Arg Gln Trp Leu Glu 130 135 140 Trp Ala Val
Lys Glu Tyr Gly Leu Pro Asp Val Asp Ile Leu Leu Phe 145 150 155 160
Gln Asn Ile Asp Gly Lys Glu Leu Cys Lys Met Thr Lys Asp Asp Phe 165
170 175 Gln Arg Leu Thr Pro Ser Tyr Asn Ala Asp Ile Leu Leu Ser His
Leu 180 185 190 His Tyr Leu Arg Glu Arg Gly Ala Thr Phe Ile Phe Pro
Asn Thr Ser 195 200 205 Val Tyr Pro Glu Ala Thr Gln Arg Ile Thr Thr
Arg Pro Asp Leu Pro 210 215 220 Tyr Glu Gln Ala Arg Arg Ser Ala Trp
Thr Ser His Ser His Pro Thr 225 230 235 240 Gln Ser Lys Ala Thr Gln
Pro Ser Ser Ser Thr Val Pro Lys Thr Glu 245 250 255 Asp Gln Arg Pro
Gln Leu Asp Pro Tyr Gln Ile Leu Gly Pro Thr Ser 260 265 270 Ser Arg
Leu Ala Asn Pro Gly Ser Gly Gln Ile Gln Leu Trp Gln Phe 275 280 285
Leu Leu Glu Leu Leu Ser Asp Ser Ser Asn Ser Asn Cys Ile Thr Trp 290
295 300 Glu Gly Thr Asn Gly Glu Phe Lys Met Thr Asp Pro Asp Glu Val
Ala 305 310 315 320 Arg Arg Trp Gly Glu Arg Lys Ser Lys Pro Asn Met
Asn Tyr Asp Lys 325 330 335 Leu Ser Arg Ala Leu Arg Tyr Tyr Tyr Asp
Lys Asn Ile Met Thr Lys 340 345 350 Val His Gly Lys Arg Tyr Ala Tyr
Lys Phe Asp Phe His Gly Ile Ala 355 360 365 Gln Ala Leu Gln Pro His
Pro Pro Glu Ser Ser Met Tyr Lys Tyr Pro 370 375 380 Ser Asp Leu Pro
Tyr Met Ser Ser Tyr His Ala His Pro Gln Lys Met 385 390 395 400 Asn
Phe Val Ala Pro His Pro Pro Ala Leu Pro Val Thr Ser Ser Ser 405 410
415 Phe Phe Ala Ala Pro Asn Pro Tyr Trp Asn Ser Pro Thr Gly Gly Ile
420 425 430 Tyr Pro Asn Thr Arg Leu Pro Ala Ala His Met Pro Ser His
Leu Gly 435 440 445 Thr Tyr Tyr 450 3 1528 DNA c-erg gene, chicken
DNA 3 gaattccgcg aacgaataat tattattagc aattattagc gatcaataat
cttgatcaca 60 ttatggcaag cactattaag gaagcattat cagtggtgag
tgaagaccag tccttgtttg 120 agtgtgccta cggatcgccc caccttgcaa
agacagaaat gacagcctcc tcttccagtg 180 aatatgggca aacatcaaag
atgagcccgc gcgttcccca gcaggactgg ttatcacagc 240 ccccggccag
agttaccatt aagatggagt gtaacccaaa ccaggttaat gggtcaagga 300
attcacctga tgactgcagc gtggcaaaag gagggaaaat ggttagcagt tcagacaatg
360 ttgggatgaa ctatggaagc tacatggaag agaagcatat tccgcctcca
aatatgacaa 420 ccaatgaacg aagagttatt gtgccagcag atcctacgtt
atggagcaca gaccatgtac 480 ggcagtggct ggagtgggca gtgaaggagt
atggtcttcc agacgtggac atcttgttgt 540 tccagaacat tgatgggaaa
gagttgtgta aaatgaccaa agatgacttc cagagactca 600 cgccgagcta
taacgcagat atcctcctgt cacacctaca ctacctcaga gagactcctc 660
ttccacattt gacttcagat gatgttgata aggccttaca aaactctcca cggttaatgc
720 atgctagaaa cacaggagga gccactttta tttttccaaa tacatcagtt
tacccagaag 780 caacgcaaag aataacaaca aggccagatt taccttatga
gcaagcgagg agatcagcgt 840 ggacgagtca cagccatccc actcagtcaa
aagctaccca accatcatct tcaacagtgc 900 ccaaaacaga agaccagcgt
cctcagttag atccttatca gattcttgga ccgaccagca 960 gccgtcttgc
aaatccaggg agtgggcaga tacagctatg gcagttccta ctggagcttc 1020
tgtcggacag ctccaactcc aactgcatca cctgggaggg cacaaatggg gagttcaaga
1080 tgacagaccc tgatgaagtg gctcggcgtt ggggagagag gaaaagcaaa
cctaacatga 1140 actatgacaa actcagccgt gcacttcgct actactatga
caaaaatatt atgactaaag 1200 ttcatggtaa acgctatgcc tacaaatttg
atttccacgg aatcgctcag gccctccagc 1260 ctcaccctcc agaatcatcc
atgtacaaat acccatcaga cctcccctac atgagttcct 1320 accatgcaca
cccccagaag atgaactttg tagctcccca tccccctgct ttgcccgtaa 1380
cctcatccag cttttttgct gcccctaatc catactggaa ttcaccaact ggaggcatct
1440 accccaatac caggctgcca gctgctcata tgccttccca tcttggcacc
tactactaag 1500 tggggaaaga aagaaagcgc caagaaaa 1528 4 478 PRT
protein sequence from c-erg gene 4 Met Ala Ser Thr Ile Lys Glu Ala
Leu Ser Val Val Ser Glu Asp Gln 1 5 10 15 Ser Leu Phe Glu Cys Ala
Tyr Gly Ser Pro His Leu Ala Lys Thr Glu 20 25 30 Met Thr Ala Ser
Ser Ser Ser Glu Tyr Gly Gln Thr Ser Lys Met Ser 35 40 45 Pro Arg
Val Pro Gln Gln Asp Trp Leu Ser Gln Pro Pro Ala Arg Val 50 55 60
Thr Ile Lys Met Glu Cys Asn Pro Asn Gln Val Asn Gly Ser Arg Asn 65
70 75 80 Ser Pro Asp Asp Cys Ser Val Ala Lys Gly Gly Lys Met Val
Ser Ser 85 90 95 Ser Asp Asn Val Gly Met Asn Tyr Gly Ser Tyr Met
Glu Glu Lys His 100 105 110 Ile Pro Pro Pro Asn Met Thr Thr Asn Glu
Arg Arg Val Ile Val Pro 115 120 125 Ala Asp Pro Thr Leu Trp Ser Thr
Asp His Val Arg Gln Trp Leu Glu 130 135 140 Trp Ala Val Lys Glu Tyr
Gly Leu Pro Asp Val Asp Ile Leu Leu Phe 145 150 155 160 Gln Asn Ile
Asp Gly Lys Glu Leu Cys Lys Met Thr Lys Asp Asp Phe 165 170 175 Gln
Arg Leu Thr Pro Ser Tyr Asn Ala Asp Ile Leu Leu Ser His Leu 180 185
190 His Tyr Leu Arg Glu Thr Pro Leu Pro His Leu Thr Ser Asp Asp Val
195 200 205 Asp Lys Ala Leu Gln Asn Ser Pro Arg Leu Met His Ala Arg
Asn Thr 210 215 220 Gly Gly Ala Thr Phe Ile Phe Pro Asn Thr Ser Val
Tyr Pro Glu Ala 225 230 235 240 Thr Gln Arg Ile Thr Thr Arg Pro Asp
Leu Pro Tyr Glu Gln Ala Arg 245 250 255 Arg Ser Ala Trp Thr Ser His
Ser His Pro Thr Gln Ser Lys Ala Thr 260 265 270 Gln Pro Ser Ser Ser
Thr Val Pro Lys Thr Glu Asp Gln Arg Pro Gln 275 280 285 Leu Asp Pro
Tyr Gln Ile Leu Gly Pro Thr Ser Ser Arg Leu Ala Asn 290 295 300 Pro
Gly Ser Gly Gln Ile Gln Leu Trp Gln Phe Leu Leu Glu Leu Leu 305 310
315 320 Ser Asp Ser Ser Asn Ser Asn Cys Ile Thr Trp Glu Gly Thr Asn
Gly 325 330 335 Glu Phe Lys Met Thr Asp Pro Asp Glu Val Ala Arg Arg
Trp Gly Glu 340 345 350 Arg Lys Ser Lys Pro Asn Met Asn Tyr Asp Lys
Leu Ser Arg Ala Leu 355 360 365 Arg Tyr Tyr Tyr Asp Lys Asn Ile Met
Thr Lys Val His Pro Pro Glu 370 375 380 Ser Ser Met Tyr Lys Tyr Pro
Ser Asp Leu Pro Tyr Met Ser Ser Tyr 385 390 395 400 His Gly Lys Arg
Tyr Ala Tyr Lys Phe Asp Phe His Gly Ile Ala Gln 405 410 415 Ala Leu
Gln Pro His Ala His Pro Gln Lys Met Asn Phe Val Ala Pro 420 425 430
His Pro Pro Ala Leu Pro Val Thr Ser Ser Ser Phe Phe Ala Ala Pro 435
440 445 Asn Pro Tyr Trp Asn Ser Pro Thr Gly Gly Ile Tyr Pro Asn Thr
Arg 450 455 460 Leu Pro Ala Ala His Met Pro Ser His Leu Gly Thr Tyr
Tyr 465 470 475 5 23 DNA primer for isolation of C-11 and c-erg
genes 5 atcttgatca cattatggca agc 23 6 25 DNA primer for isolation
of C-11 and c-erg genes 6 cacattatgg caagcactat taagg 25 7 25 DNA
primer for isolation of C-11 and c-erg genes 7 cacttagtag
taggtgccaa gatgg 25
* * * * *