U.S. patent application number 09/887593 was filed with the patent office on 2002-10-31 for bpc-1: a secreted brain-specific protein expressed and secreted by prostate and bladder cancer cells.
Invention is credited to Afar, Daniel E., Hubert, Rene S., Jakobovits, Aya, Leong, Kahan, Raitano, Arthur B., Saffran, Douglas C..
Application Number | 20020161212 09/887593 |
Document ID | / |
Family ID | 22254489 |
Filed Date | 2002-10-31 |
United States Patent
Application |
20020161212 |
Kind Code |
A1 |
Afar, Daniel E. ; et
al. |
October 31, 2002 |
BPC-1: a secreted brain-specific protein expressed and secreted by
prostate and bladder cancer cells
Abstract
Described is a novel gene and its encoded secreted tumor
antigen, termed BPC-1, and to diagnostic and therapeutic methods
and compositions useful in the management of various cancers which
express BPC-1, particularly including prostate cancer and bladder
cancer. In human normal tissues, BPC-1 is only expressed in certain
tissues of the brain. However, BPC-1 is expressed at high levels in
prostate cancer cells and is also expressed in bladder cancer
cells. The structure of BPC-1 includes a signal sequence and a CUB
domain. BPC-1 protein is secreted. Preliminary experimental
evidence suggests that BPC-1 is directly involved in oncogenesis or
maintenance of the transformed phenotype of cancer cells expressing
BPC-1. BPC-1 also appears to bind specifically to a cellular
protein expressed in prostate cancer cells and other cells.
Inventors: |
Afar, Daniel E.; (Pacific
Palisades, CA) ; Hubert, Rene S.; (Los Angeles,
CA) ; Leong, Kahan; (Playa Del Rey, CA) ;
Raitano, Arthur B.; (Los Angeles, CA) ; Saffran,
Douglas C.; (Los Angeles, CA) ; Jakobovits, Aya;
(Beverly Hills, CA) |
Correspondence
Address: |
Attention of Karen S. Canady
Gates & Cooper LLP
Howard Hughes Center
6701 Center Drive West, Suite 1050
Los Angeles
CA
90045
US
|
Family ID: |
22254489 |
Appl. No.: |
09/887593 |
Filed: |
June 21, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09887593 |
Jun 21, 2001 |
|
|
|
09374135 |
Aug 10, 1999 |
|
|
|
6277972 |
|
|
|
|
60095982 |
Aug 10, 1998 |
|
|
|
Current U.S.
Class: |
536/23.2 ;
435/226; 435/320.1; 435/325; 435/69.3; 530/350 |
Current CPC
Class: |
A61K 48/00 20130101;
A61P 13/10 20180101; A61K 39/00 20130101; C07K 2317/24 20130101;
A61P 13/08 20180101; C12N 2799/027 20130101; C07K 2319/02 20130101;
A61P 35/00 20180101; C07K 14/47 20130101; C12N 2799/026
20130101 |
Class at
Publication: |
536/23.2 ;
435/226; 530/350; 435/69.3; 435/325; 435/320.1 |
International
Class: |
C07H 021/04; C12N
009/64; C12N 005/06; C07K 014/435; C12P 021/02 |
Claims
1. An isolated BPC-1 protein having the amino acid sequence as
shown in FIG. 1, from amino acid residue number 1 through amino
acid residue 158.
2. An isolated BPC-1 protein having the amino acid sequence as
shown in FIG. 1, from amino acid residue number 24 through amino
acid residue 158.
3. An isolated protein comprising at least one CUB domain of the
BPC-1 protein as shown in FIG. 1, from about amino acid residue
number 51 through about amino acid residue number 152.
4. An isolated polypeptide of at least 15 contiguous amino acids of
the protein of claim 1.
5. An isolated polypeptide which is at least 90% identical to the
amino acid sequence of the protein of claim 2 over its entire
length.
6. An isolated polynucleotide selected from the group consisting of
(a) a polynucleotide having the sequence as shown in FIG. 1,
wherein T can also be U; (b) a polynucleotide having the sequence
as shown in FIG. 1, from nucleotide residue number 793 through
nucleotide residue number 1269, wherein T can also be U; (c) a
polynucleotide having the sequence as shown in FIG. 1, from
nucleotide residue number 862 through nucleotide residue number
1269, wherein T can also be U (d) a polynucleotide encoding a BPC-1
polypeptide whose sequence is encoded by the cDNA contained in
plasmid p19P1E8 clone 6.1 as deposited with American Type Culture
Collection as Accession No. 98833; (e) a polynucleotide encoding
the BPC-1 protein of claim 1; (f) a polynucleotide encoding the
BPC-1 protein of claim 2; and (g) a polynucleotide encoding the
BPC-1 protein of claim 3.
7. An isolated polynucleotide comprising the precursor BPC-1 coding
sequence as shown in FIG. 1 from nucleotide residue number 793
through 1269.
8. An isolated polynucleotide comprising the mature BPC-1 coding
sequence as shown in FIG. 1 from nucleotide residue number 862
through 1269.
9. An isolated polynucleotide comprising the BPC-1 CUB domain
coding sequence as shown in FIG. 1 from nucleotide residue number
943 through 1248.
10. An isolated polynucleotide which is fully complementary to a
polynucleotide according to claim 6.
11. A recombinant expression vector which contains a polynucleotide
according to claim 6.
12. A host cell which contains an expression vector according to
claim 11.
13. An isolated polynucleotide according to claim 6 which is
labeled with a detectable marker.
14. A process for producing a BPC-1 protein comprising culturing a
host cell of claim 12 under conditions sufficient for the
production of the polypeptide and recovering the BPC-1 protein from
the culture.
15. The process according to claim 14 wherein the BPC-1 protein is
secreted into the culture medium.
16. A BPC-1 polypeptide produced by the process of claim 14 or
15.
17. An antibody which immunospecifically binds to the BPC-1 protein
of claim 1.
18. An antibody which immunospecifically binds to the BPC-1 protein
of claim 2.
19. An antibody which immunospecifically binds to the BPC-1 protein
of claim 3.
20. An antibody which immunospecifically binds to the polypeptide
of claim 4.
21. A monoclonal antibody according to claim 17, 18, 19 or 20.
22. A monoclonal antibody according to claim 21 which is labeled
with a detectable marker.
23. A monoclonal antibody according to claim 22, wherein the
detectable marker is selected from the group consisting of a
radioisotope, fluorescent compound, bioluminescent compound,
chemiluminescent compound, metal chelator or enzyme.
24. An Fab, F(ab')2, Fv or Sfv fragment of a monoclonal antibody
according to claim 17, 18, 19 or 20.
25. A fragment of a monoclonal antibody according to claim 24 which
is labeled with a detectable marker.
26. A fragment of a monoclonal antibody according to claim 25,
wherein the detectable marker is selected from the group consisting
of a radioisotope, fluorescent compound, bioluminescent compound,
chemiluminescent compound, metal chelator or enzyme.
27. A monoclonal antibody according to claim 17, 18, 19 or 20 which
comprises murine antigen binding region residues and human antibody
residues.
28. A monoclonal antibody according to claim 17, 18, 19 or 20 which
is a human antibody.
29. A transgenic animal producing a monoclonal antibody according
to claim 28.
30. A hybridoma producing a monoclonal antibody according to claim
21.
31. A recombinant protein comprising the antigen binding region of
a monoclonal antibody according to claim 17, 18, 19 or 20.
32. A recombinant protein according to claim 31 which is labeled
with a detectable marker.
33. A recombinant protein according to claim 32, wherein the
detectable marker is selected from the group consisting of a
radioisotope, fluorescent compound, bioluminescent compound,
chemiluminescent compound, metal chelator or enzyme.
34. A single chain monoclonal antibody which comprises the variable
domains of the heavy and light chains of a monoclonal antibody
according to claim 17, 18, 19 or 20.
35. A vector comprising a polynucleotide encoding a single chain
monoclonal antibody according to claim 34.
36. A monoclonal antibody according to claim 17, 18, 19 or 20 which
inhibits the growth of tumor cells which express BPC-1 in a patient
treated with an effective amount of said antibody.
37. A bi-specific monoclonal antibody which binds to two epitopes
within the mature BPC-1 protein.
38. An assay for detecting the presence of a BPC-1 protein in a
biological sample comprising contacting the sample with an antibody
of claim 22, an antibody fragment of claim 25, or a recombinant
protein of claim 32, and detecting the binding of BPC-1 protein in
the sample thereto.
39. The assay of claim 38, wherein the biological sample is
serum.
40. The assay of claim 38, wherein the biological sample is
semen.
41. The assay of claim 38, wherein the biological sample is
urine.
42. An assay for detecting the presence of a BPC-1 polynucleotide
in a biological sample, comprising (a) contacting the sample with a
polynucleotide probe which specifically hybridizes to the BPC-1
cDNA contained within plasmid p9P1E8 clone 6.1 as deposited with
American Type Culture Collection as Accession No. 98833, or the
polynucleotide as shown in FIG. 1, or the complements thereof; and
(b) detecting the presence of a hybridization complex formed by the
hybridization of the probe with BPC-1 polynucleotide in the sample,
wherein the presence of the hybridization complex indicates the
presence of BPC-1 polynucleotide within the sample.
43. An assay for detecting the presence of BPC-1 mRNA in a
biological sample comprising: (a) producing cDNA from the sample by
reverse transcription using at least one primer; (b) amplifying the
cDNA so produced using BPC-1 polynucleotides as sense and antisense
primers to amplify BPC-1 cDNAs therein; (c) detecting the presence
of the amplified BPC-1 cDNA, wherein the BPC-1 polynucleotides used
as the sense and antisense probes are capable of amplifying the
polynucleotide shown in FIG. 1.
44. A method of detecting the presence of a cancer expressing BPC-1
protein in an individual which comprises detecting BPC-1 protein
present in the serum of the individual using an assay according to
claim 38.
45. The method according to claim 44 which further comprises
quantifying and comparing the amount of BPC-1 protein present in a
test serum sample of the individual with the amount of BPC-1
protein present in a comparable serum sample of a normal
individual, the presence of a higher amount of BPC-1 protein in the
test serum sample relative to the normal serum sample indicating
the presence of a cancer expressing BPC-1 protein.
46. The method according to claim 44 or 45, wherein the cancer is
prostate cancer.
47. The method according to claim 44 or 45, wherein the cancer is
bladder cancer.
48. A method of detecting the presence of a bladder cancer
expressing BPC-1 protein in an individual which comprises detecting
BPC-1 protein present in the urine of the individual using an assay
according to claim 38.
49. A method of detecting the presence of a cancer expressing BPC-1
protein which comprises determining the level of BPC-1 protein
expressed by cells in a test tissue sample from an individual, or
in a serum, semen or urine sample from an individual, and comparing
the level so determined to the level of BPC-1 expressed in a
corresponding normal sample, the presence of elevated BPC-1 protein
in the test sample relative to the normal sample providing an
indication of the presence of such cancer in the individual.
50. A method of diagnosing the presence of cancer in an individual
comprising: (a) obtaining a test sample of tissue from the
individual; (b) determining the level of BPC-1 mRNA expressed in
the test sample; (c) comparing the level so determined to the level
of BPC-1 mRNA expressed in a comparable known normal tissue sample,
the presence of elevated BPC-1 mRNA expression in the test sample
relative to the normal tissue sample providing an indication of the
presence of cancer.
51. The method of claim 50, wherein the cancer is prostate cancer,
and the test and normal tissue samples are selected from the group
consisting of prostate tissue, bone tissue, lymphatic tissue,
serum, blood or semen.
52. The method of claim 50, wherein the cancer is bladder cancer,
and the test and normal tissue samples are selected from the group
consisting of bladder tissue, lymphatic tissue, serum, blood, semen
or urine.
53. A method of diagnosing the presence of cancer in an individual
comprising: (a) obtaining a test sample of tissue from the
individual; (b) determining the level of BPC-1 protein expressed in
the test sample; (c) comparing the level so determined to the level
of BPC-1 protein expressed in a comparable known normal tissue
sample, the presence of elevated BPC-1 protein in the test sample
relative to the normal tissue sample providing an indication of the
presence of cancer.
54. The method of claim 53, wherein the cancer is prostate cancer,
and the test and normal tissue samples are selected from the group
consisting of prostate tissue, lymphatic tissue, bone tissue,
serum, blood or semen.
55. The method of claim 53, wherein the cancer is bladder cancer,
and the test and normal tissue samples are selected from the group
consisting of bladder tissue, lymphatic tissue, serum, blood, semen
or urine.
56. A method of treating a patient susceptible to or having a
cancer that expresses BPC-1 which comprises administering to said
patient an antibody according to claim 18 or 19 in an amount
sufficient to inhibit the function of BPC-1.
57. The method according to claim 56, wherein the cancer is
selected from the group consisting of prostate cancer and bladder
cancer.
58. A method of treating a patient with a cancer that expresses
BPC-1 which comprises administering to said patient a vector
according to claim 35, such that the vector delivers the single
chain monoclonal antibody coding sequence to the cancer cells and
the encoded single chain antibody is expressed intracellularly
therein.
59. The method according to claim 58, wherein the cancer is
selected from the group consisting of prostate cancer and bladder
cancer.
60. A method of treating a patient with a cancer that expresses
BPC-1 which comprises inhibiting the transcription of BPC-1 in the
cells of said cancer.
61. The method according to claim 60, wherein BPC-1 transcription
is inhibited by contacting the BPC-1 gene with an antisense
polynucleotide complementary to a polynucleotide of claim 6.
62. A method of treating a patient with a cancer that expresses
BPC-1 which comprises inhibiting the translation of BPC-1 mRNA in
the cells of said cancer.
63. The method according to claim 62, wherein BPC-1 mRNA
translation is inhibited by contacting the BPC-1 mRNA with an
antisense polynucleotide complementary to a polynucleotide of claim
6.
64. The method according to claim 62, wherein BPC-1 mRNA
translation is inhibited by contacting the BPC-1 mRNA with an
antisense polynucleotide complementary to the 5' UTR of the BPC-1
mRNA.
65. The method according to claim 62, wherein BPC-1 mRNA
translation is inhibited by contacting the BPC-1 mRNA with a
ribozyme capable of cleaving said BPC-1 mRNA.
66. A method of treating a patient with a cancer that expresses
BPC-1 which comprises inhibiting the processing of BPC-1 in the
cells of said cancer.
67. A method of treating a patient with a cancer that expresses
BPC-1 which comprises inhibiting the secretion of BPC-1 from the
cells of said cancer.
68. The method according to claim 66, further comprising
administering chemotherapy or radiation therapy to the patient.
69. A vaccine composition for the treatment of a cancer expressing
BPC-1 comprising an immunogenic portion of a BPC-1 protein
according to claim 2 and a physiologically acceptable carrier.
70. A vaccine composition for the treatment of cancer expressing
BPC-1 comprising a polypeptide encoding an immunogenic portion of a
BPC-1 protein according to claim 2 and a physiologically acceptable
carrier.
71. A method of inhibiting the development of a cancer expressing
BPC-1 in a patient, comprising administering to the patient an
effective amount of the vaccine composition of claim 78 or 79.
Description
FIELD OF THE INVENTION
[0001] The invention described herein relates to a novel gene and
its encoded secreted tumor antigen, termed BPC-1, and to diagnostic
and therapeutic methods and compositions useful in the management
of various cancers which express BPC-1, particularly including
prostate cancer and bladder cancer.
BACKGROUND OF THE INVENTION
[0002] Cancer is the second leading cause of human death next to
coronary disease. Worldwide, millions of people die from cancer
every year. In the United States alone, cancer causes the death of
well over a half-million people each year, with some 1.4 million
new cases diagnosed per year. While deaths from heart disease have
been declining significantly, those resulting from cancer generally
are on the rise. In the early part of the next century, cancer is
predicted to become the leading cause of death.
[0003] Worldwide, several cancers stand out as the leading killers.
In particular, carcinomas of the lung, prostate, breast, colon,
pancreas, and ovary represent the primary causes of cancer death.
These and virtually all other carcinomas share a common lethal
feature. With very few exceptions, metastatic disease from a
carcinoma is fatal. Moreover, even for those cancer patients who
initially survive their primary cancers, common experience has
shown that their lives are dramatically altered. Many cancer
patients experience strong anxieties driven by the awareness of the
potential for recurrence or treatment failure. Many cancer patients
experience physical debilitations following treatment. Many cancer
patients experience a recurrence.
[0004] Generally speaking, the fundamental problem in the
management of the deadliest cancers is the lack of effective and
non-toxic systemic therapies. Molecular medicine, still very much
in its infancy, promises to redefine the ways in which these
cancers are managed. Unquestionably, there is an intensive
worldwide effort aimed at the development of novel molecular
approaches to cancer diagnosis and treatment. For example, there is
a great interest in identifying truly tumor-specific genes and
proteins that could be used as diagnostic and prognostic markers
andlor therapeutic targets or agents. Research efforts in these
areas are encouraging, and the increasing availability of useful
molecular technologies has accelerated the acquisition of
meaningful knowledge about cancer. Nevertheless, progress is slow
and generally uneven.
[0005] As discussed below, the management of prostate cancer serves
as a good example of the limited extent to which molecular biology
has translated into real progress in the clinic. With limited
exceptions, the situation is more or less the same for the other
major carcinomas mentioned above.
[0006] Worldwide, prostate cancer is the fourth most prevalent
cancer in men. In North America and Northern Europe, it is by far
the most common male cancer and is the second leading cause of
cancer death in men. In the United States alone, well over 40,000
men die annually of this disease--second only to lung cancer.
Despite the magnitude of these figures, there is still no effective
treatment for metastatic prostate cancer. Surgical prostatectomy,
radiation therapy, hormone ablation therapy, and chemotherapy
remain fixed as the main treatment modalities. Unfortunately, these
treatments are ineffective for many and are often associated with
significant undesirable consequences.
[0007] On the diagnostic front, the lack of a prostate tumor marker
that can accurately detect early-stage, localized tumors remains a
significant limitation in the management of this disease. Although
the serum PSA assay has been a very useful tool, its specificity
and general utility is widely regarded as lacking in several
important respects, as further discussed below. Most prostate
cancers initially occur in the peripheral zone of the prostate
gland, away from the urethra. Tumors within this zone may not
produce any symptoms and, as a result, most men with early-stage
prostate cancer will not present clinical symptoms of the disease
until significant progression has occurred. Tumor progression into
the transition zone of the prostate may lead to urethral
obstruction, thus producing the first symptoms of the disease.
However, these clinical symptoms are indistinguishable from the
common non-malignant condition of benign prostatic hyperplasia
(BPH). Early detection and diagnosis of prostate cancer currently
relies on digital rectal examinations (DRE), prostate specific
antigen (PSA) measurements, transrectal ultrasonography (TRUS), and
transrectal needle biopsy (TRNB). At present, serum PSA measurement
in combination with DRE represent the leading tool used to detect
and diagnose prostate cancer. Both have major limitations which
have fueled intensive research into finding better diagnostic
markers of this disease.
[0008] Similarly, there is no available marker that can predict the
emergence of the typically fatal metastatic stage of prostate
cancer. Diagnosis of metastatic stage is presently achieved by open
surgical or laparoscopic pelvic lymphadenectomy, whole body
radionuclide scans, skeletal radiography, and/or bone lesion biopsy
analysis. Clearly, better imaging and other less invasive
diagnostic methods offer the promise of easing the difficulty those
procedures place on a patient, as well as improving diagnostic
accuracy and opening therapeutic options. A similar problem is the
lack of an effective prognostic marker for determining which
cancers are indolent and which ones are or will be aggressive. PSA,
for example, fails to discriminate accurately between indolent and
aggressive cancers. Until there are prostate tumor markers capable
of reliably identifying early-stage disease, predicting
susceptibility to metastasis, and precisely imaging tumors, the
management of prostate cancer will continue to be extremely
difficult.
[0009] PSA is the most widely used tumor marker for screening,
diagnosis, and monitoring prostate cancer today. In particular,
several immunoassays for the detection of serum PSA are in
widespread clinical use. Recently, a reverse
transcriptase-polymerase chain reaction (RT-PCR) assay for PSA mRNA
in serum has been developed. However, PSA is not a disease-specific
marker, as elevated levels of PSA are detectable in a large
percentage of patients with BPH and prostatitis (25-86%)(Gao et
al., 1997, Prostate 31: 264-281), as well as in other nonmalignant
disorders and in some normal men, a factor which significantly
limits the diagnostic specificity of this marker. For example,
elevations in serum PSA of between 4 to 10 ng/ml are observed in
BPH, and even higher values are observed in prostatitis,
particularly acute prostatitis. BPH is an extremely common
condition in men. Further confusing the situation is the fact that
serum PSA elevations may be observed without any indication of
disease from DRE, and visa-versa. Moreover, it is now recognized
that PSA is not prostate-specific (Gao et al., supra, for
review).
[0010] Various methods designed to improve the specificity of
PSA-based detection have been described, such as measuring PSA
density and the ratio of free vs. complexed PSA. However, none of
these methodologies have been able to reproducibly distinguish
benign from malignant prostate disease. In addition, PSA
diagnostics have sensitivities of between 57-79% (Cupp &
Osterling, 1993, Mayo Clin Proc 68:297-306), and thus miss
identifying prostate cancer in a significant population of men with
the disease.
[0011] There are some known markers which are expressed
predominantly in prostate, such as prostate specific membrane
antigen (PSM), a hydrolase with 85% identity to a rat
neuropeptidase (Carter et al., 1996, Proc. Natl. Acad. Sci. USA 93:
749; Bzdega et al., 1997, J. Neurochem. 69: 2270). However, the
expression of PSM in small intestine and brain (Israeli et al.,
1994, Cancer Res. 54: 1807), as well its potential role in
neuropeptide catabolism in brain, raises concern of potential
neurotoxicity with anti-PSM therapies. Preliminary results using an
Indium-111 labeled, anti-PSM monoclonal antibody to image recurrent
prostate cancer show some promise (Sodee et al., 1996, Clin Nuc Med
21: 759-766). More recently Identified prostate cancer markers
include PCTA-1 (Su et al., 1996, Proc. Natl. Acad. Sci. USA 93:
7252) and prostate stem cell antigen (PSCA) (Reiter et al., 1998,
Proc. Natl. Acad. Sci. USA 95: 1735). PCTA-1, a novel galectin, is
largely secreted into the media of expressing cells and may hold
promise as a diagnostic serum marker for prostate cancer (Su et
al., 1996). PSCA, a GPI-linked cell surface molecule, was cloned
from LAPC-4 cDNA and is unique in that it is expressed primarily in
basal cells of normal prostate tissue and in cancer epithelia
(Reiter et al., 1998). Vaccines for prostate cancer are also being
actively explored with a variety of antigens, including PSM and
PSA.
SUMMARY OF THE INVENTION
[0012] The present invention relates to a novel secreted protein
designated BPC-1. In normal individuals, BPC-1 protein is only
expressed in certain tissues of the brain. In prostate cancer,
BPC-1 is expressed at high levels in tumor cells. BPC-1 is also
expressed in bladder cancer cells, and may be expressed in other
cancer cells. The structure of BPC-1 includes a signal sequence and
a CUB domain. The BPC-1 protein CUB domain is structurally similar
to the CUB domains of several other proteins.
[0013] The BPC-1 gene therefore encodes a secreted tumor antigen
which may be useful as a diagnostic, staging and/or prognostic
marker, and/or may serve as an excellent target for various
approaches to the treatment of prostate, bladder and other cancers
expressing BPC-1. Although the precise function of BPC-1 is
presently unknown, preliminary experimental evidence suggests that
BPC-1 is directly involved in oncogenesis or maintenance of the
transformed phenotype of cancer cells expressing BPC-1. BPC-1 also
appears to bind specifically to a cellular protein expressed in
prostate cancer cells and other cells. Taken together, this
evidence indicates that BPC-1 is functionally involved in an
oncogenic pathway. As further described herein, this understanding
leads to a number of potential approaches to the treatment of
cancers expressing BPC-1 involving the inhibition of BPC-1
function.
[0014] The invention provides polynucleotides corresponding or
complementary to all or part of the BPC-1 genes, mRNAs, and/or
coding sequences, preferably in isolated form, including
polynucleotides encoding BPC-1 proteins and fragments thereof, DNA,
RNA, DNA/RNA hybrid, and related molecules, polynucleotides or
oligonucleotides complementary to the BPC-1 genes or mRNA sequences
or parts thereof, and polynucleotides or oligonucleotides which
hybridize to the BPC-1 genes, mRNAs, or to BPC-1-encoding
polynucleotides. Also provided are means for isolating cDNAs and
the genes encoding BPC-1. Recombinant DNA molecules containing
BPC-1 polynucleotides, cells transformed or transduced with such
molecules, and host-vector systems for the expression of BPC-1 gene
products are also provided. The invention further provides BPC-1
proteins and polypeptide fragments thereof. The invention further
provides antibodies that bind to BPC-1 proteins and polypeptide
fragments thereof, including polyclonal and monoclonal antibodies,
murine and other mammalian antibodies, chimeric antibodies,
humanized and fully human antibodies, antibodies labeled with a
detectable marker, and antibodies conjugated to radionuclides,
toxins or other therapeutic compositions. The invention further
provides methods for detecting the presence of BPC-1
polynucleotides and proteins in various biological samples, as well
as methods for identifying cells that express a BPC-1. The
invention further provides various therapeutic compositions and
strategies for treating cancers which express BPC-1 such as
prostate and bladder cancers, including antibody, vaccine and small
molecule therapy, and therapies aimed at inhibiting the
transcription, translation, processing or function of BPC-1.
BRIEF DESCRIPTION OF THE FIGURES
[0015] FIG. 1. Molecular structure of human BPC-1: Nucleotide and
deduced amino acid sequences of BPC-1 clone 6 cDNA. The signal
sequence is indicated in boldface, the CUB domain in underlined
boldface, and the SSH-derived nucleic acid sequence in
boldface.
[0016] FIG. 2. Molecular structure of human BPC-1: Schematic
representation of the human BPC-1 structure. Percentage CG contents
across regions of the sequence are also indicated.
[0017] FIG. 3. Molecular structure of human BPC-1: Amino acid
sequence alignment of the BPC-1 CUB domain with CUB domains from
various known proteins. (A) Alignment of BPC-1 with C. elegans CUB
domain protein (Wilson et al., 1994, Nature 368:32-38), and (B)
alignments with the CUB domains of murine BMP-1 (Fukagawa et al.
1994, Dev. Biol 163: 175-183). Percent sequence identities are
indicated on the figure.
[0018] FIG. 4. Northern blot analysis of human BPC-1 expression in
various normal tissues showing exclusive expression in brain.
[0019] FIG. 5. Semi-quantitative RT-PCR expression analysis showing
human BPC-1 expression in prostate cancer xenografts and a limited
number of normal human tissues.
[0020] FIG. 6. RNA dot blot analysis of human BPC-1 mRNA expression
in 37 normal tissues, showing expression only in specific regions
of the brain.
[0021] FIG. 7. Northern blot analysis of human BPC-1 mRNA
expression in cortical regions of the brain, showing expression
only in specific regions of the cortex.
[0022] FIG. 8. Semi-quantitative RT-PCR expression analysis of
human BPC-1 expression in fetal tissues, showing that BPC-1
expression is predominant in fetal brain, and is also expressed at
lower levels in a number of other fetal tissues.
[0023] FIG. 9. Northern blot analysis of human BPC-1 mRNA
expression in a panel of prostate and bladder carcinoma xenografts
and/or cell lines, showing expression in all prostate cancer
xenograft samples, the LnCAP prostate cancer cell line, and a
bladder carcinoma cell line.
[0024] FIG. 10. SDS-PAGE autoradiography of immunoprecipitated
recombinant human BPC-1 protein secreted into the tissue culture
media of BPC-1 transfected 293T cells.
[0025] FIG. 11. Western blot analysis of recombinant human BPC-1
protein, as expressed in HighFive insect cells infected with a
BPC-1 encoding baculovirus, showing processed mature BPC-1 and
unprocessed precursor BPC-1 in cell lysates and low levels of
processed mature BPC-1 in cell media.
[0026] FIG. 12. Northern blot analysis of recombinant human BPC-1
expressed by PC3 and 3T3CL7 cells infected with BPC-1 encoding
retrovirus.
[0027] FIG. 13. Western blot detection of BPC-1 protein in tissue
culture supernatants of cells expressing the BPC-1 gene. 25 .mu.l
of neat supernatant from of various cell lines was subjected to
Western blot analysis using a 1:500 dilution of murine anti-BPC-1
polyclonal serum. The blot was then incubated with anti-mouse-HRP
conjugated secondary antibody and BPC-1 specific signals were
visualized by enhanced chemiluminescent detection. Left blot. Lane
1: Affinity (nickel) purified MYC/HIS BPC-1; Lane 2: 293T control
cells, 24 hr conditioned medium. Right blot. Lane 1: 293T control
cells, 24 hr conditioned medium; Lane 2: 293T transfected with a
MYC/HIS tagged BPC1 vector, 24 hr conditioned medium; Lane 3: 293T
cells transfected with an alkaline phosphatase (AP)/BPC-1 fusion
vector, 24 hr conditioned medium; Lane 4: PC3 cells infected with
control Neo retrovirus and G418 selected, 4 day conditioned medium;
Lane 5: PC3 cells infected with BPC-1 retrovirus and G418 selected,
4 day conditioned medium stored 1 week at 4C; Lane 6: PC3 cells
infected with BPC-1 retrovirus and G418 selected, 4 day conditioned
medium; Lane 7: NIH3T3 cells acutely infected with control Neo
retrovirus, 4 day conditioned medium; Lane 8: NIH3T3 cells infected
with BPC1 retrovirus and G418 selected, 4 day conditioned medium;
Lane 8: NIH3T3 cells acutely infected with BPC1 retrovirus, 4 day
conditioned medium.
[0028] FIG. 14. Western blot analysis showing that BPC-1-AP is
present in conditioned media. The lanes contain 20 .mu.l
conditioned media from 293T cells or 293T cells collected 48 hours
after media change from transfections with the BPC-1-AP construct
or with a construct having AP alone. Anti-HIS antibodies were used
to detect proteins.
[0029] FIG. 15. BPC-1-AP binds to a 45 kDa protein using a
far-western analysis. Lysates from brain, testis, prostate, the
xenografts LAPC4AD and LAPC9AD, and the cell lines 3T3, LAPC4,
LNCaP, and PC-3 were used to make the western blots. The blots were
incubated with conditioned media from a 293T cell line producing
only secreted alkaline phosphatase (B) and with media containing
BPC-1-AP (A). The alkaline phosphatase signals were detected using
the a chemiluminescent AP detection system.
DETAILED DESCRIPTION OF THE INVENTION
[0030] Unless otherwise defined, all terms of art, notations and
other scientific terminology used herein are intended to have the
meanings commonly understood by those of skill in the art to which
this invention pertains. In some cases, terms with commonly
understood meanings are defined herein for clarity and/or for ready
reference, and the inclusion of such definitions herein should not
necessarily be construed to represent a substantial difference over
what is generally understood in the art. The techniques and
procedures described or referenced herein are generally well
understood and commonly employed using conventional methodology by
those skilled in the art, such as, for example, the widely utilized
molecular cloning methodologies described in Sambrook et al.,
Molecular Cloning: A Laboratory Manual 2nd. edition (1989) Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. As
appropriate, procedures involving the use of commercially available
kits and reagents are generally carried out in accordance with
manufacturer defined protocols and/or parameters unless otherwise
noted.
[0031] As used herein, the terms "advanced prostate cancer",
"locally advanced prostate cancer", "advanced disease" and "locally
advanced disease" mean prostate cancers which have extended through
the prostate capsule, and are meant to include stage C disease
under the American Urological Association (AUA) system, stage C1-C2
disease under the Whitmore-Jewett system, and stage T3-T4 and N+
disease under the TNM (tumor, node, metastasis) system. In general,
surgery is not recommended for patients with locally advanced
disease, and these patients have substantially less favorable
outcomes compared to patients having clinically localized
(organ-confined) prostate cancer. Locally advanced disease is
clinically identified by palpable evidence of induration beyond the
lateral border of the prostate, or asymmetry or induration above
the prostate base. Locally advanced prostate cancer is presently
diagnosed pathologically following radical prostatectomy if the
tumor invades or penetrates the prostatic capsule, extends into the
surgical margin, or invades the seminal vesicles.
[0032] As used herein, the terms "metastatic prostate cancer" and
"metastatic disease" mean prostate cancers which have spread to
regional lymph nodes or to distant sites, and are meant to include
stage D disease under the AUA system and stage T.times.N.times.M+
under the TNM system. As is the case with locally advanced prostate
cancer, surgery is generally not indicated for patients with
metastatic disease, and hormonal (androgen ablation) therapy is the
preferred treatment modality. Patients with metastatic prostate
cancer eventually develop an androgen-refractory state within 12 to
18 months of treatment initiation, and approximately half of these
patients die within 6 months thereafter. The most common site for
prostate cancer metastasis is bone. Prostate cancer bone metastases
are, on balance, characteristically osteoblastic rather than
osteolytic (i.e., resulting in net bone formation). Bone metastases
are found most frequently in the spine, followed by the femur,
pelvis, rib cage, skull and humerus. Other common sites for
metastasis include lymph nodes, lung, liver and brain. Metastatic
prostate cancer is typically diagnosed by open or laparoscopic
pelvic lymphadenectomy, whole body radionuclide scans, skeletal
radiography, and/or bone lesion biopsy.
[0033] As used herein, the term "polynucleotide" means a polymeric
form of nucleotides of at least 10 bases or base pairs in length,
either ribonucleotides or deoxynucleotides or a modified form of
either type of nucleotide, and is meant to include single and
double stranded forms of DNA.
[0034] As used herein, the term "polypeptide" means a polymer of at
least 10 amino acids. Throughout the specification, standard three
letter or single letter designations for amino acids are used.
[0035] As used herein, the terms "hybridize", "hybridizing",
"hybridizes" and the like, used in the context of polynucleotides,
are meant to refer to conventional hybridization conditions,
preferably such as hybridization in 50% formamide/6.times.SSC/0.1%
SDS/100 .mu.g/ml ssDNA, in which temperatures for hybridization are
above 37 degrees C. and temperatures for washing in
0.1.times.SSC/0.1% SDS are above 55 degrees C., and most preferably
to stringent hybridization conditions.
[0036] In the context of amino acid sequence comparisons, the term
"identity" is used to express the percentage of amino acid residues
at the same relative position which are the same. Also in this
context, the term "homology" is used to express the percentage of
amino acid residues at the same relative positions which are either
identical or are similar, using the conserved amino acid criteria
of BLAST analysis, as is generally understood in the art. Further
details regarding amino acid substitutions, which are considered
conservative under such criteria, are provided below.
[0037] Additional definitions are provided throughout the
subsections which follow.
[0038] Molecular and Biochemical Features of BCP-1
[0039] As is further described in the Examples which follow, the
BPC-1 gene and protein have been characterized using a number of
analytical approaches. For example, analyses of nucleotide coding
and amino acid sequences were conducted in order to identify
potentially related molecules, as well as recognizable structural
domains, topological features, and other elements within the BPC-1
mRNA and protein structure. RT-PCR and Northern blot analyses of
BPC-1 mRNA expression were conducted in order to establish the
range of normal and cancerous tissues expressing BPC-1 message.
Western blot analyses of BPC-1 protein expression in experimentally
transfected cells were conducted to determine cell localization and
secretion of processed and unprocessed recombinant human BPC-1
protein. Functional assays designed to determine BPC-1 interaction
with cellular binding partner(s) and activity were also
conducted.
[0040] BPC-1 is an oncogenic, secreted, CUB domain-containing
protein which is expressed in prostate and bladder carcinoma cells
and binds to a cellular protein. BPC-1 expression is exquisitely
brain-specific in normal adult human tissues. In fetal tissues,
BPC-1 expression is predominant in brain, but is also turned on in
a number of other developing organs and tissues. BPC-1 gene
expression is activated in human prostate cancer. In particular,
BPC-1 is expressed at very high levels in androgen dependent human
prostate tumor xenografts originally derived from a patient with
high grade metastatic prostate cancer, and is expressed at lower
but significant levels in other prostate cancer samples. BPC-1 is
also expressed at high levels in at least some bladder
carcinomas.
[0041] The BPC-1 protein is initially translated into a 158 amino
acid precursor containing a signal sequence. During
post-translational processing, the signal sequence is cleaved to
yield the mature 135 amino acid secreted protein. The 5' non-coding
region of the BPC-1 gene is extremely G/C rich (approximately 72%
G/C content, compared to 42% in the coding region and 30% in the 3'
non-coding region), implying that this region of the gene contains
elements involved in transcriptional or translational control (FIG.
1).
[0042] The BPC-1 primary structure contains a recognizable CUB
domain (Complement subcomponents C1r/C1s, Uegf, Bmp1)(Borck and
Beckmann, 1993, J. Mol. Biol. 231: 539-545) which shares homology
with other CUB domain proteins (FIG. 1; FIG. 3). CUB domains were
originally found in complement subcomponents C1r and C1s, and were
subsequently identified in Uegf (epidermal growth factor related
sea urchin protein) and Bmp1 (bone morphogenetic protein 1), a
protease involved in bone development. Functionally, CUB domains
have been associated with protein interaction, receptor binding and
other activities. Unlike other CUB domain proteins which have
additional enzymatic functions, BPC-1 is unique in that it is
essentially a secreted CUB domain with no other apparent functional
domains. The CUB domain of BPC-1 could function as a
protein-protein interaction domain, mediating interactions with
other secreted molecules, extracellular matrix molecules and/or
cell surface receptors. This would imply a potential growth-factor
or cell stimulator function.
[0043] The presence of a CUB domain in the BPC-1 structure further
supports the conclusion that BPC-1 interacts with and probably
binds to other proteins. The CUB domain, viewed as an extracellular
domain involved in protein-protein interaction, occurs in many
diverse secreted or cell surface proteins involved in a variety
developmental processes (Borck and Beckmann, 1993, J. Mol. Biol.
231: 539-545). One family of proteins characterized by CUB domains,
to which BPC-1 protein may bear some relation, are the
Spermadhesins. The Spermadhesins are CUB domain containing secreted
proteins produced by the seminal vesicles and are estimated to be
about 15-18kd in size (approx. 140 amino acids); these proteins
function to inhibit sperm motility and are inactivated by
proteolysis (Iwamoto et al., 1995, FEBBS Letters 368: 420-424).
[0044] Preliminary experimental evidence suggests that BPC-1 is
directly involved in oncogenesis or maintenance of the transformed
phenotype of cancer cells expressing BPC-1. In this regard, BPC-1
shows transforming activity in soft agar assays and binds to a
cellular protein expressed by cells including those expressing
BPC-1. Taken together, this evidence indicates that BPC-1 is
functionally involved in an oncogenic pathway, and that BPC-1
activity in this pathway may occur through interaction with a BPC-1
binding partner or through binding to or association with other
protein(s). As further described herein, this understanding leads
to a number of potential approaches to the treatment of cancers
expressing BPC-1, involving the inhibition of BPC-1 function.
[0045] BPC-1 Polynucleotides
[0046] One aspect of the invention provides polynucleotides
corresponding or complementary to all or part of a BPC-1 gene,
mRNA, and/or coding sequence, preferably in isolated form,
including polynucleotides encoding a BPC-1 protein and fragments
thereof, DNA, RNA, DNA/RNA hybrid, and related molecules,
polynucleotides or oligonucleotides complementary to a BPC-1 gene
or mRNA sequence or a part thereof, and polynucleotides or
oligonucleotides which hybridize to a BPC-1 gene, mRNA, or to a
BPC-1-encoding polynucleotide (collectively, "BPC-1
polynucleotides"). As used herein, the BPC-1 gene and protein is
meant to include the BPC-1 gene and protein specifically described
herein and the genes and proteins corresponding to other BPC-1
proteins and structurally similar variants of the foregoing. Such
other BPC-1 proteins and variants will generally have coding
sequences which are highly homologous to the BPC-1 and/or BPC-1-2
coding sequences, and preferably will share at least about 50%
amino acid identity and at least about 60% amino acid homology
(using BLAST criteria), more preferably sharing 70% or greater
homology (using BLAST criteria).
[0047] A BPC-1 polynucleotide may comprise a polynucleotide having
the nucleotide sequence of human BPC-1 as shown in FIG. 1, a
sequence complementary to the foregoing, or a polynucleotide
fragment of any of the foregoing. Another embodiment comprises a
polynucleotide which is capable of hybridizing under stringent
hybridization conditions to the human BPC-1 cDNA shown in FIG. 1 or
to a polynucleotide fragment thereof.
[0048] Specifically contemplated are genomic DNA, cDNAs, ribozymes,
and antisense molecules, as well as nucleic acid molecules based on
an alternative backbone or including alternative bases, whether
derived from natural sources or synthesized. For example, antisense
molecules can be RNAs or other molecules, including peptide nucleic
acids (PNAs) or non-nucleic acid molecules such as phosphorothioate
derivatives, that specifically bind DNA or RNA in a base
pair-dependent manner. A skilled artisan can readily obtain these
classes of nucleic acid molecules using the BPC-1 polynucleotides
and polynucleotide sequences disclosed herein.
[0049] Further specific embodiments of this aspect of the invention
include primers and primer pairs, which allow the specific
amplification of the polynucleotides of the invention or of any
specific parts thereof, and probes that selectively or specifically
hybridize to nucleic acid molecules of the invention or to any part
thereof. Probes may be labeled with a detectable marker, such as,
for example, a radioisotope, fluorescent compound, bioluminescent
compound, a chemiluminescent compound, metal chelator or enzyme.
Such probes and primers can be used to detect the presence of a
BPC-1 polynucleotide in a sample and as a means for detecting a
cell expressing a BPC-1 protein. Examples of such probes include
polypeptides comprising all or part of the human BPC-1 cDNA
sequence shown in FIG. 1. Examples of primer pairs capable of
specifically amplifying BPC-1 mRNAs are also described in the
Examples which follow. As will be understood by the skilled
artisan, a great many different primers and probes may be prepared
based on the sequences provided in herein and used effectively to
amplify and/or detect a BPC-1 mRNA.
[0050] As used herein, a polynucleotide is said to be "isolated"
when it is substantially separated from contaminant polynucleotides
which correspond or are complementary to genes other than the BPC-1
gene or which encode polypeptides other than BPC-1 gene product or
fragments thereof. A skilled artisan can readily employ nucleic
acid isolation procedures to obtain an isolated BPC-1
polynucleotide.
[0051] The BPC-1 polynucleotides of the invention are useful for a
variety of purposes, including but not limited to their use as
probes and primers for the amplification and/or detection of the
BPC-1 gene(s), mRNA(s), or fragments thereof; as reagents for the
diagnosis and/or prognosis of prostate cancer and other cancers; as
coding sequences capable of directing the expression of BPC-1
polypeptides; as tools for modulating or inhibiting the expression
of the BPC-1 gene(s) and/or translation of the BPC-1 transcript(s);
and as therapeutic agents.
[0052] Methods for Isolating BPC-1-Encoding Nucleic Acid
Molecules
[0053] The BPC-1 cDNA sequences described herein enable the
isolation of other polynucleotides encoding BPC-1 gene product(s),
as well as the isolation of polynucleotides encoding BPC-1 gene
product homologues, alternatively spliced isoforms, allelic
variants, and mutant forms of the BPC-1 gene product. Various
molecular cloning methods that can be employed to isolate full
length cDNAs encoding a BPC-1 gene are well known (See, for
example, Sambrook, J. et al., Molecular Cloning: A Laboratory
Manual, 2d edition., Cold Spring Harbor Press, New York, 1989;
Current Protocols in Molecular Biology. Ausubel et al., Eds., Wiley
and Sons, 1995). For example, lambda phage cloning methodologies
may be conveniently employed, using commercially available cloning
systems (e.g., Lambda ZAP Express, Stratagene). Phage clones
containing BPC-1 gene cDNAs may be identified by probing with a
labeled BPC-1 cDNA or a fragment thereof. For example, in one
embodiment, the BPC-1 cDNA (FIG. 1) or a portion thereof can be
synthesized and used as a probe to retrieve overlapping and full
length cDNAs corresponding to a BPC-1 gene. The BPC-1 gene itself
may be isolated by screening genomic DNA libraries, bacterial
artificial chromosome libraries (BACs), yeast artificial chromosome
libraries (YACs), and the like, with BPC-1 DNA probes or
primers.
[0054] Recombinant DNA Molecules and Host-Vector Systems
[0055] The invention also provides recombinant DNA or RNA molecules
containing a BPC-1 polynucleotide, including but not limited to
phages, plasmids, phagemids, cosmids, YACs, BACs, as well as
various viral and non-viral vectors well known in the art, and
cells transformed or transfected with such recombinant DNA or RNA
molecules. As used herein, a recombinant DNA or RNA molecule is a
DNA or RNA molecule that has been subjected to molecular
manipulation in vitro. Methods for generating such molecules are
well known (see, for example, Sambrook et al, 1989, supra).
[0056] The invention further provides a host-vector system
comprising a recombinant DNA molecule containing a BPC-1
polynucleotide within a suitable prokaryotic or eukaryotic host
cell. Examples of suitable eukaryotic host cells include a yeast
cell, a plant cell, or an animal cell, such as a mammalian cell or
an insect cell (e.g., a baculovirus-infectible cell such as an Sf9
or HghFive cell). Examples of suitable mammalian cells include
various prostate cancer cell lines such LnCaP, PC-3, DU145, LAPC-4,
TsuPr1, other transfectable or transducible prostate cancer cell
lines, as well as a number of mammalian cells routinely used for
the expression of recombinant proteins (e.g., COS, CHO, 293, 293T
cells). More particularly, a polynucleotide comprising the coding
sequence of a BPC-1 may be used to generate BPC-1 proteins or
fragments thereof using any number of host-vector systems routinely
used and widely known in the art.
[0057] A wide range of host-vector systems suitable for the
expression of BPC-1 proteins or fragments thereof are available,
see for example, Sambrook et al., 1989, supra; Current Protocols in
Molecular Biology, 1995, supra). Preferred vectors for mammalian
expression include but are not limited to pcDNA 3.1 myc-His-tag
(Invitrogen) and the retroviral vector pSR.alpha.tkneo (Muller et
al., 1991, MCB 11:1785). Using these expression vectors, BPC-1 may
be preferably expressed in several prostate cancer and non-prostate
cell lines, including for example 293, 293T, rat-1, 3T3, PC-3,
LNCaP and TsuPr1. The host-vector systems of the invention are
useful for the production of a BPC-1 protein or fragment thereof.
Such host-vector systems may be employed to study the functional
properties of BPC-1 and BPC-1 mutations.
[0058] Mature recombinant human BPC-1 protein may be produced and
secreted by mammalian cells transfected with a construct encoding
precursor BPC-1. In a particular embodiment described in the
Examples, 293T cells are transfected with an expression plasmid
encoding the precursor form of BPC-1 (i.e., including the signal
sequence) and mature BPC-1 protein is secreted into the cell
culture medium where it may be conveniently isolated using standard
purification methods. Mature recombinant human BPC-1 may also be
produced by cells which process but do not secrete the mature
protein. One example of such a system is a BPC-1 encoding
baculovirus-infected cell. As described in the examples, such cells
express and process high levels of BPC-1 intracellularly. The
mature BPC-1 protein may be recovered, in such cases, from cell
lysates using standard procedures. Whether the mature BPC-1 is
secreted or is retained intracellularly by the host cell, BPC-1 may
be affinity purified from media or cell lysates using BPC-1
antibodies.
[0059] Proteins encoded by the BPC-1 genes, or by fragments
thereof, will have a variety of uses, including but not limited to
generating antibodies and in methods for identifying ligands and
other agents and cellular constituents that bind to a BPC-1 gene
product. Antibodies raised against a BPC-1 protein or fragment
thereof may be useful in diagnostic and prognostic assays, imaging
methodologies (including, particularly, cancer imaging), and
therapeutic methods in the management of human cancers
characterized by expression of a BPC-1 protein, including but not
limited to cancer of the prostate. Various immunological assays
useful for the detection of BPC-1 proteins are contemplated,
including but not limited to various types of radioimmunoassays,
enzyme-linked immunosorbent assays (ELISA), enzyme-linked
immunofluorescent assays (ELIFA), immunocytochemical methods, and
the like. Such antibodies may be labeled and used as immunological
imaging reagents capable of detecting prostate cells (e.g., in
radioscintigraphic imaging methods). BPC-1 proteins may also be
particularly useful in generating cancer vaccines, as further
described below.
[0060] BPC-1 Proteins
[0061] Another aspect of the present invention provides BPC-1
proteins and polypeptide fragments thereof. The BPC-1 proteins of
the invention include those specifically identified herein, as well
as allelic variants, conservative substitution variants and
homologs that can be isolated/generated and characterized without
undue experimentation following the methods outlined below. Fusion
proteins which combine parts of different BPC-1 proteins or
fragments thereof, as well as fusion proteins of a BPC-1 protein
and a heterologous polypeptide are also included. Such BPC-1
proteins will be collectively referred to as the BPC-1 proteins,
the proteins of the invention, or BPC-1. As used herein, the term
"BPC-1 polypeptide" refers to a polypeptide fragment or a BPC-1
protein of at least 10 amino acids, preferably at least 15 amino
acids.
[0062] A specific embodiment of a BPC-1 protein comprises a
polypeptide having the amino acid sequence of human BPC-1 as shown
in FIG. 1, from about amino acid residue number 1 through about
amino acid residue number 158 as shown therein. Another specific
embodiment of a BPC-1 protein comprises a polypeptide having the
amino acid sequence of human BPC-1 as shown in FIG. 1, from about
amino acid residue number 24 through about amino acid residue
number 158 as shown therein.
[0063] In general, naturally occurring allelic variants of human
BPC-1 will share a high degree of structural identity and homology
(e.g., 90% or more identity). Typically, allelic variants of the
BPC-1 proteins will contain conservative amino acid substitutions
within the BPC-1 sequences described herein or will contain a
substitution of an amino acid from a corresponding position in a
BPC-1 homologue. One class of BPC-1 allelic variants will be
proteins that share a high degree of homology with at least a small
region of a particular BPC-1 amino acid sequence, but will further
contain a radical departure form the sequence, such as a
non-conservative substitution, truncation, insertion or frame
shift.
[0064] Conservative amino acid substitutions can frequently be made
in a protein without altering either the conformation or the
function of the protein. Such changes include substituting any of
isoleucine (I), valine (V), and leucine (L) for any other of these
hydrophobic amino acids; aspartic acid (D) for glutamic acid (E)
and vice versa; glutamine (Q) for asparagine (N) and vice versa;
and serine (S) for threonine (T) and vice versa. Other
substitutions can also be considered conservative, depending on the
environment of the particular amino acid and its role in the
three-dimensional structure of the protein. For example, glycine
(G) and alanine (A) can frequently be interchangeable, as can
alanine (A) and valine (V). Methionine (M), which is relatively
hydrophobic, can frequently be interchanged with leucine and
isoleucine, and sometimes with valine. Lysine (K) and arginine (R)
are frequently interchangeable in locations in which the
significant feature of the amino acid residue is its charge and the
differing pK's of these two amino acid residues are not
significant. Still other changes can be considered "conservative"
in particular environments.
[0065] BPC-1 proteins may be embodied in many forms, preferably in
isolated form. As used herein, a protein is said to be "isolated"
when physical, mechanical or chemical methods are employed to
remove the BPC-1 protein from cellular constituents that are
normally associated with the protein. A skilled artisan can readily
employ standard purification methods to obtain an isolated BPC-1
protein. A purified BPC-1 protein molecule will be substantially
free of other proteins or molecules which impair the binding of
BPC-1 to antibody or other ligand. The nature and degree of
isolation and purification will depend on the intended use.
Embodiments of a BPC-1 protein include a purified BPC-1 protein and
a functional, soluble BPC-1 protein. In one form, such functional,
soluble BPC-1 proteins or fragments thereof retain the ability to
bind antibody or other ligand.
[0066] The invention also provides BPC-1 polypeptides comprising
biologically active fragments of the BPC-1 amino acid sequence,
such as a polypeptide corresponding to part of the amino acid
sequences for BPC-1 as shown in FIG. 1. Such polypeptides of the
invention exhibit properties of the BPC-1 protein, such as the
ability to elicit the generation of antibodies which specifically
bind an epitope associated with the BPC-1 protein.
[0067] BPC-1 polypeptides can be generated using standard peptide
synthesis technology or using chemical cleavage methods well known
in the art based on the amino acid sequences of the human BPC-1
proteins disclosed herein. Alternatively, recombinant methods can
be used to generate nucleic acid molecules that encode a
polypeptide fragment of a BPC-1 protein. In this regard, the
BPC-1-encoding nucleic acid molecules described herein provide
means for generating defined fragments of BPC-1 proteins. BPC-1
polypeptides are particularly useful in generating and
characterizing domain specific antibodies (e.g., antibodies
recognizing an extracellular or intracellular epitope of a BPC-1
protein), in identifying agents or cellular factors that bind to
BPC-1 or a particular structural domain thereof, and in various
therapeutic contexts, including but not limited to cancer vaccines.
BPC-1 polypeptides containing particularly interesting structures
can be predicted and/or identified using various analytical
techniques well known in the art, including, for example, the
methods of Chou-Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg,
Karplus-Schultz or Jameson-Wolf analysis, or on the basis of
immunogenicity. Fragments containing such structures are
particularly useful in generating subunit specific anti-BPC-1
antibodies or in identifying cellular factors that bind to
BPC-1.
[0068] In a specific embodiment described in the examples which
follow, mature secreted BPC-1 is conveniently expressed in 293T
cells transfected with a CMV-driven expression vector encoding
BPC-1 with a C-terminal 6.times.His and MYC tag (pcDNA3.1/mycHIS,
Invitrogen). The secreted HIS-tagged BPC-1 in the culture media may
be purified using a nickel column using standard techniques.
[0069] BPC-1 Antibodies
[0070] Another aspect of the invention provides antibodies that
bind to BPC-1 proteins and polypeptides. The most preferred
antibodies will selectively bind to a BPC-1 protein and will not
bind (or will bind weakly) to non-BPC-1 proteins and polypeptides.
Anti-BPC-1 antibodies that are particularly contemplated include
monoclonal and polyclonal antibodies as well as fragments
containing the antigen binding domain and/or one or more
complementarity determining regions of these antibodies. As used
herein, an antibody fragment is defined as at least a portion of
the variable region of the immunoglobulin molecule which binds to
its target, i.e., the antigen binding region.
[0071] BPC-1 antibodies of the invention may be particularly useful
in prostate cancer therapeutic strategies, diagnostic and
prognostic assays, and imaging methodologies. Similarly, such
antibodies may be useful in the treatment, diagnosis, and/or
prognosis of other cancers, to the extent BPC-1 is also expressed
or overexpressed in other types of cancer. One such cancer that
expresses BPC-1 is bladder carcinoma.
[0072] The invention also provides various immunological assays
useful for the detection and quantification of BPC-1 and mutant
BPC-1 proteins and polypeptides. Such assays generally comprise one
or more BPC-1 antibodies capable of recognizing and binding a BPC-1
or mutant BPC-1 protein, as appropriate, and may be performed
within various immunological assay formats well known in the art,
including but not limited to various types of radioimmunoassays,
enzyme-linked immunosorbent assays (ELISA), enzyme-linked
immunofluorescent assays (ELIFA), and the like. In addition,
immunological imaging methods capable of detecting prostate cancer
are also provided by the invention, including but limited to
radioscintigraphic imaging methods using labeled BPC-1 antibodies.
Such assays may be clinically useful in the detection, monitoring,
and prognosis of prostate cancer, particularly advanced prostate
cancer.
[0073] BPC-1 antibodies may also be used in methods for purifying
BPC-1 and mutant BPC-1 proteins and polypeptides and for isolating
BPC-1 homologues and related molecules. For example, in one
embodiment, the method of purifying a BPC-1 protein comprises
incubating a BPC-1 antibody, which has been coupled to a solid
matrix, with a lysate or other solution containing BPC-1 under
conditions which permit the BPC-1 antibody to bind to BPC-1;
washing the solid matrix to eliminate impurities; and eluting the
BPC-1 from the coupled antibody. Other uses of the BPC-1 antibodies
of the invention include generating anti-idiotypic antibodies that
mimic the BPC-1 protein.
[0074] BPC-1 antibodies may also be used therapeutically by, for
example, modulating or inhibiting the biological activity of a
BPC-1 protein or targeting and destroying cancer cells expressing a
BPC-1 protein or BPC-1 binding partner. Because BPC-1 is a secreted
protein which appears to bind to a cellular protein and because
BPC-1 appears to have oncogenic activity, antibodies may be
therapeutically useful for blocking BPC-1's ability to bind to its
receptor or interact with other proteins through which it exerts
its oncogenic biological activity. In a particular embodiment, a
BPC-1 specific antibody or combination thereof (preferably a
monoclonal antibody or combination thereof) is administered to a
patient suffering from a BPC-1 expressing tumor such that the
antibody binds to BPC-1 and inhibits its ability to execute its
function. BPC-1 antibody therapy is more specifically described in
the THERAPEUTIC METHODS AND COMPOSITIONS subsection below.
[0075] Various methods for the preparation of antibodies are well
known in the art. For example, antibodies may be prepared by
immunizing a suitable mammalian host using a BPC-1 protein,
peptide, or fragment, in isolated or immunoconjugated form
(Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane
(1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)).
In addition, fusion proteins of BPC-1 may also be used, such as a
BPC-1 GST-fusion protein. In a particular embodiment, a GST fusion
protein comprising all or most of the open reading frame amino acid
sequence of FIG. 1 may be produced and used as an immunogen to
generate appropriate antibodies. Cells expressing or overexpressing
BPC-1 may also be used for immunizations. Similarly, any cell
engineered to express BPC-1 may be used. Such strategies may result
in the production of monoclonal antibodies with enhanced capacities
for recognizing endogenous BPC-1. Another useful immunogen
comprises BPC-1 proteins linked to the plasma membrane of sheep red
blood cells. In addition, naked DNA immunization techniques known
in the art may be used (with or without purified BPC-1 protein or
BPC-1 expressing cells) to generate an immune response to the
encoded immunogen (for review, see Donnelly et al., 1997, Ann. Rev.
Immunol. 15: 617-648).
[0076] The amino acid sequence of BPC-1 as shown in FIG. 1 may be
used to select specific regions of the BPC-1 protein for generating
antibodies. For example, hydrophobicity and hydrophilicity analyses
of the BPC-1 amino acid sequence may be used to identify
hydrophilic regions in the BPC-1 structure. Regions of the BPC-1
protein that show immunogenic structure, as well as other regions
and domains, can readily be identified using various other methods
known in the art, such as Chou-Fasman, Garnier-Robson,
Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf
analysis.
[0077] Methods for the generation of BPC-1 antibodies are further
illustrated by way of the examples provided herein.
[0078] Methods for preparing a protein or polypeptide for use as an
immunogen and for preparing immunogenic conjugates of a protein
with a carrier such as BSA, KLH, or other carrier proteins are well
known in the art. In some circumstances, direct conjugation using,
for example, carbodiimide reagents may be used; in other instances
linking reagents such as those supplied by Pierce Chemical Co.,
Rockford, Ill., may be effective. Administration of a BPC-1
immunogen is conducted generally by injection over a suitable time
period and with use of a suitable adjuvant, as is generally
understood in the art. During the immunization schedule, titers of
antibodies can be taken to determine adequacy of antibody
formation.
[0079] BPC-1 monoclonal antibodies are preferred and may be
produced by various means well known in the art. For example,
immortalized cell lines which secrete a desired monoclonal antibody
may be prepared using the standard method of Kohler and Milstein or
modifications which effect immortalization of lymphocytes or spleen
cells, as is generally known. The immortalized cell lines secreting
the desired antibodies are screened by immunoassay in which the
antigen is the BPC-1 protein or BPC-1 fragment. When the
appropriate immortalized cell culture secreting the desired
antibody is identified, the cells may be expanded and antibodies
produced either from in vitro cultures or from ascites fluid.
[0080] The antibodies or fragments may also be produced, using
current technology, by recombinant means. Regions that bind
specifically to the desired regions of the BPC-1 protein can also
be produced in the context of chimeric or CDR grafted antibodies of
multiple species origin. Humanized or human BPC-1 antibodies may
also be produced and are preferred for use in therapeutic contexts.
Methods for humanizing murine and other non-human antibodies by
substituting one or more of the non-human antibody CDRs for
corresponding human antibody sequences are well known (see for
example, Jones et al., 1986, Nature 321: 522-525; Riechmnan et al.,
1988, Nature 332: 323-327; Verhoeyen et al., 1988, Science 239:
1534-1536). See also, Carter et al., 1993, Proc. Natl. Acad. Sci.
USA 89: 4285 and Sims et al., 1993, J. Immunol. 151: 2296. Methods
for producing fully human monoclonal antibodies include phage
display and transgenic methods (for review, see Vaughan et al.,
1998, Nature Biotechnology 16: 535-539).
[0081] Fully human BPC-1 monoclonal antibodies may be generated
using cloning technologies employing large human Ig gene
combinatorial libraries (i.e., phage display) (Griffiths and
Hoogenboom, Building an in vitro immune system: human antibodies
from phage display libraries. In: Protein Engineering of Antibody
Molecules for Prophylactic and Therapeutic Applications in Man.
Clark, M. (Ed.), Nottingham Academic, pp 45-64 (1993); Burton and
Barbas, Human Antibodies from combinatorial libraries. Id., pp
65-82). Fully human BPC-1 monoclonal antibodies may also be
produced using transgenic mice engineered to contain human
immunoglobulin gene loci as described in PCT Patent Application
WO98/24893, Kucherlapati and Jakobovits et al., published Dec. 3,
1997 (see also, Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4):
607-614). This method avoids the in vitro manipulation required
with phage display technology and efficiently produces high
affinity authentic human antibodies.
[0082] Reactivity of BPC-1 antibodies with a BPC-1 protein may be
established by a number of well known means, including Western
blot, immunoprecipitation, ELISA, and FACS analyses using, as
appropriate, BPC-1 proteins, peptides, BPC-1-expressing cells or
extracts thereof.
[0083] A BPC-1 antibody or fragment thereof of the invention may be
labeled with a detectable marker or conjugated to a second
molecule, such as a cytotoxic agent, and used for targeting the
second molecule to a BPC-1 positive cell (Vitetta, E. S. et al.,
1993, Immunotoxin therapy, in DeVita, Jr., V. T. et al., eds,
Cancer: Principles and Practice of Oncology, 4th ed., J. B.
Lippincott Co., Philadelphia, 2624-2636). Examples of cytotoxic
agents include, but are not limited to ricin, ricin A-chain,
doxorubicin, daunorubicin, taxol, ethiduim bromide, mitomycin,
etoposide, tenoposide, vincristine, vinblastine, colchicine,
dihydroxy anthracin dione, actinomycin D, diphteria toxin,
Pseudomonas exotoxin (PE) A, PE40, abrin, arbrin A chain, modeccin
A chain, alpha-sarcin, gelonin, mitogellin, retstrictocin,
phenomycin, enomycin, curicin, crotin, calicheamicin, sapaonaria
officinalis inhibitor, and glucocorticoid and other
chemotherapeutic agents, as well as radioisotopes such as
.sup.212Bi, .sup.131I, .sup.131In, .sup.90Y, and .sup.186Re.
Suitable detectable markers include, but are not limited to, a
radioisotope, a fluorescent compound, a bioluminescent compound,
chemiluminescent compound, a metal chelator or an enzyme.
Antibodies may also be conjugated to an anti-cancer pro-drug
activating enzyme capable of converting the pro-drug to its active
form. See, for example, U.S. Pat. No. 4,975,287.
[0084] Further, bi-specific antibodies specific for two or more
BPC-1 epitopes may be generated using methods generally known in
the art. Further, antibody effector functions may be modified so as
to enhance the therapeutic effect of BPC-1 antibodies on the growth
of cancer cells. Homodimeric antibodies may also be generated by
cross-linking techniques known in the art (e.g., Wolff et al.,
Cancer Res. 53: 2560-2565). Such antibodies may provide a means for
achieving enhanced BPC-1 inhibition.
[0085] Methods for the Detection of BPC-1
[0086] Another aspect of the present invention relates to methods
for detecting BPC-1 polynucleotides and BPC-1 proteins, as well as
methods for identifying a cell which expresses BPC-1.
[0087] More particularly, the invention provides assays for the
detection of BPC-1 polynucleotides in a biological sample, such as
serum, bone, prostate, and other tissues, urine, semen, cell
preparations, and the like. Detectable BPC-1 polynucleotides
include, for example, a BPC-1 gene or fragments thereof, BPC-1
mRNA, alternative splice variant BPC-1 mRNAs, and recombinant DNA
or RNA molecules containing a BPC-1 polynucleotide. A number of
methods for amplifying and/or detecting the presence of BPC-1
polynucleotides are well known in the art and may be employed in
the practice of this aspect of the invention.
[0088] In one embodiment, a method for detecting a BPC-1 mRNA in a
biological sample comprises producing cDNA from the sample by
reverse transcription using at least one primer; amplifying the
cDNA so produced using a BPC-1 polynucleotides as sense and
antisense primers to amplify BPC-1 cDNAs therein; and detecting the
presence of the amplified BPC-1 cDNA. In another embodiment, a
method of detecting a BPC-1 gene in a biological sample comprises
first isolating genomic DNA from the sample; amplifying the
isolated genomic DNA using BPC-1 polynucleotides as sense and
antisense primers to amplify the BPC-1 gene therein; and detecting
the presence of the amplified BPC-1 gene. Any number of appropriate
sense and antisense probe combinations may be designed from the
nucleotide sequences provided for BPC-1 (FIG. 1) and used for this
purpose.
[0089] The invention also provides assays for detecting the
presence of a BPC-1 protein in a tissue of other biological sample
such as serum, bone, prostate, and other tissues, urine, cell
preparations, and the like. Methods for detecting a BPC-1 protein
are also well known and include, for example, immunoprecipitation,
immunohistochemical analysis, Western Blot analysis, molecular
binding assays, ELISA, ELIFA and the like. For example, in one
embodiment, a method of detecting the presence of a BPC-1 protein
in a biological sample comprises first contacting the sample with a
BPC-1 antibody, a BPC-1-reactive fragment thereof, or a recombinant
protein containing an antigen binding region of a BPC-1 antibody;
and then detecting the binding of BPC-1 protein in the sample
thereto.
[0090] Methods for identifying a cell which expresses BPC-1 are
also provided. In one embodiment, an assay for identifying a cell
which expresses a BPC-1 gene comprises detecting the presence of
BPC-1 mRNA in the cell. Methods for the detection of particular
mRNAs in cells are well known and include, for example,
hybridization assays using complementary DNA probes (such as in
situ hybridization using labeled BPC-1 riboprobes, Northern blot
and related techniques) and various nucleic acid amplification
assays (such as RT-PCR using complementary primers specific for
BPC-1, and other amplification type detection methods, such as, for
example, branched DNA, SISBA, TMA and the like). Alternatively, an
assay for identifying a cell which expresses a BPC-1 gene comprises
detecting the presence of BPC-1 protein in the cell or secreted by
the cell. Various methods for the detection of proteins are well
known in the art and may be employed for the detection of BPC-1
proteins and BPC-1 expressing cells.
[0091] BPC-1 expression analysis may also be useful as a tool for
identifying and evaluating agents which modulate BPC-1 gene
expression. For example, BPC-1 expression is significantly
upregulated in prostate cancer, and may also be expressed in other
cancers. Identification of a molecule or biological agent that
could inhibit BPC-1 expression or over-expression in cancer cells
may be of therapeutic value. Such an agent may be identified by
using a screen that quantifies BPC-1 expression by RT-PCR, nucleic
acid hybridization or antibody binding.
[0092] Assays for Determining BPC-1 Expression Status
[0093] Determining the status of BPC-1 expression patterns in an
individual may be used to diagnose cancer and may provide
prognostic information useful in defining appropriate therapeutic
options. Similarly, the expression status of BPC-1 may provide
information useful for predicting susceptibility to particular
disease stages, progression, andlor tumor aggressiveness. The
invention provides methods and assays for determining BPC-1
expression status and diagnosing cancers which express BPC-1, such
as prostate and bladder cancers.
[0094] In one aspect, the invention provides assays useful in
determining the presence of cancer in an individual, such as
prostate and bladder cancers, comprising detecting a significant
increase in BPC-1 mRNA or protein expression in a test cell or
tissue sample relative to expression levels in the corresponding
normal cell or tissue. The presence of BPC-1 mRNA may, for example,
be evaluated in tissue samples of the colon, lung, prostate,
pancreas, bladder, breast, ovary, cervix, testis, head and neck,
brain, stomach, etc. The presence of significant BPC-1 expression
in any of these tissues may be useful to indicate the emergence,
presence and/or severity of these cancers, since the corresponding
normal tissues do not express BPC-1 mRNA or express it at lower
levels.
[0095] In a related embodiment, BPC-1 expression status may be
determined at the protein level rather than at the nucleic acid
level. For example, such a method or assay would comprise
determining the level of BPC-1 protein expressed by cells in a test
tissue sample or in serum, semen or urine, and comparing the level
so determined to the level of BPC-1 expressed in a corresponding
normal sample. In one embodiment, the presence of BPC-1 protein is
evaluated, for example, using immunohistochemical methods. BPC-1
antibodies or binding partners capable of detecting BPC-1 protein
expression may be used in a variety of assay formats well known in
the art for this purpose. In another embodiment, the presence of
secreted BPC-1 protein in serum or urine or other body fluids is
examined.
[0096] Because BPC-1 is a secreted protein expressed in prostate,
bladder, and possibly other cancers, assays for detecting and
quantifying BPC-1 in blood or serum are expected to be useful for
the detection, diagnosis, prognosis, andlor staging of a BPC-1
expressing tumor in an individual. For example, BPC-1 is not
expressed in normal prostate, but is expressed in prostate and
bladder cancers. Accordingly, detection of serum BPC-1 may provide
an Indication of the presence of a prostate or bladder tumor.
Diagnosis of prostate or bladder cancer may be made on the basis of
this information and/or other information. In respect of prostate
cancer, for example, such other information may include serum PSA
measurements, DRE and/or ultrasonography. Further, the level of
BPC-1 detected in the serum may provide information useful in
staging or prognosis. For example, very high levels of BPC-1
protein in serum may suggest a larger and/or more aggressive
tumor.
[0097] The brain-specific expression of BPC-1 in normal tissues is
expected to provide an important advantage of this aspect of the
invention, namely, very low to non-existent background levels of
circulating BPC-1, resulting in a high correlation between the
presence of serum BPC-1 protein and the presence of cancer. This
advantage is expected to result from the characteristics of the
blood-brain barrier, a system of tight junctions in capillaries of
the central nervous system that resists the passage of cells,
pathogens and macromolecules into and out of the subarachnoid
space. Accordingly, BPC-1 expressed in the brain is not expected to
be released into the vascular system. Since no other normal tissue
tested has demonstrated significant expression of BPC-1, the
presence of serum BPC-1 would strongly suggest the presence of a
BPC-1 expressing tumor.
[0098] In addition, peripheral blood may be conveniently assayed
for the presence of cancer cells, including but not limited to
prostate cancer, using RT-PCR to detect BPC-1 expression. The
presence of RT-PCR amplifiable BPC-1 mRNA provides an indication of
the presence of prostate cancer. RT-PCR detection assays for tumor
cells in peripheral blood are currently being evaluated for use in
the diagnosis and management of a number of human solid tumors. In
the prostate cancer field, these include RT-PCR assays for the
detection of cells expressing PSA and PSM (Verkaik et al., 1997,
Urol. Res. 25: 373-384; Ghossein et al., 1995, J. Clin. Oncol. 13:
1195-2000; Heston et al., 1995, Clin. Chem. 41: 1687-1688). RT-PCR
assays are well known in the art.
[0099] A related aspect of the invention is directed to predicting
susceptibility to developing cancer in an individual. In one
embodiment, a method for predicting susceptibility to cancer
comprises detecting BPC-1 mRNA or BPC-1 protein in a tissue sample,
its presence indicating susceptibility to cancer, wherein the
degree of BPC-1 mRNA expression present is proportional to the
degree of susceptibility. In a specific embodiment, the presence of
BPC-1 in prostate tissue is examined, with the presence of BPC-1 in
the sample providing an indication of prostate cancer
susceptibility (or the emergence or existence of a prostate tumor).
In another specific embodiment, the presence of BPC-1 in bladder
tissue is examined, with the presence of BPC-1 in the sample
providing an indication of bladder cancer susceptibility (or the
emergence or existence of a bladder tumor). In yet another specific
embodiment, the presence of BPC-1 in serum is examined, with the
presence of BPC-1 providing an indication of susceptibility to (or
presence of) a BPC-1 expressing tumor, such as a bladder or
prostate tumor. In another embodiment, the presence of BPC-1 in
urine is examined, with the presence of BPC-1 therein providing an
indication of susceptibility to (or presence of) a BPC-1 expressing
bladder tumor.
[0100] Yet another related aspect of the invention is directed to
methods for gauging tumor aggressiveness. In one embodiment, a
method for gauging aggressiveness of a tumor comprises determining
the level of BPC-1 mRNA or BPC-1 protein expressed by cells in a
sample of the tumor, comparing the level so determined to the level
of BPC-1 mRNA or BPC-1 protein expressed in a corresponding normal
tissue taken from the same individual or a normal tissue reference
sample, wherein the degree of BPC-1 mRNA or BPC-1 protein
expression in the tumor sample relative to the normal sample
indicates the degree of aggressiveness. In a specific embodiment,
aggressiveness of prostate tumors is evaluated by determining the
extent to which BPC-1 is expressed in the tumor cells, with higher
expression levels indicating more aggressive tumors.
[0101] In a related embodiment, serum levels of BPC-1 may be used
to provide an indication of the extent and aggressiveness of a
BPC-1 expressing tumor, wherein higher levels of serum BPC-1 may
suggest a more advanced and more aggressive tumor. Serum BPC-1
measurements over time would be expected to provide further
information, wherein an increase in BPC-1 would be expected to
reflect progression and the rate of the increase would be expected
to correlate with aggressiveness. Similarly, a decline in serum
BPC-1 would be expected to reflect a slower growing or regressing
tumor. The identification of BPC-1 in serum may be useful to detect
tumor initiation and early stage disease, particularly since
background BPC-1 interference is expected to be minimal to
non-existent in view of the BPC-1 brain specific expression profile
in normal individuals. In patients who have undergone surgery or
therapy, serum BPC-1 levels would be useful for monitoring
treatment response and potential recurrence. As an alternative or
adjunct to serum BPC-1 measurements, the presence and levels of
BPC-1 secreted in urine may be useful in relation to bladder
cancer.
[0102] Methods for detecting and quantifying the expression of
BPC-1 mRNA or protein are described herein and use standard nucleic
acid and protein detection and quantification technologies well
known in the art. Standard methods for the detection and
quantification of BPC-1 mRNA include in situ hybridization using
labeled BPC-1 riboprobes, Northern blot and related techniques
using BPC-1 polynucleotide probes, RT-PCR analysis using primers
specific for BPC-1, and other amplification type detection methods,
such as, for example, branched DNA, SISBA, TMA and the like. In a
specific embodiment, semi-quantitative RT-PCR may be used to detect
and quantify BPC-1 mRNA expression as described in the Examples
which follow. Any number of primers capable of amplifying BPC-1 may
be used for this purpose, including but not limited to the various
primer sets specifically described herein. Standard methods for the
detection and quantification of protein may be used for this
purpose. In a specific embodiment, polyclonal or monoclonal
antibodies specifically reactive with the wild-type BPC-1 protein
may be used in an immunohistochemical assay of biopsied tissue.
[0103] Assays for Circulating and Excreted BPC-1
[0104] The mature BPC-1 is a secreted protein. Tumors which express
BPC-1 would be expected to secrete BPC-1 into the vasculature,
and/or excreted in urine or semen, where the protein may be
detected and quantified using assays and techniques well known in
the molecular diagnostic art. Excreted BPC-1 may also be detectable
in urine and semen. Detecting and quantifying the levels of
circulating or excreted BPC-1 is expected to have a number of uses
in the diagnosis, staging, and prognosis of prostate, bladder and
other such BPC-1 expressing tumors. A number of different technical
approaches for the detection and quantification of serum proteins
are well known in the art.
[0105] Detecting BPC-1 protein in urine may indicate the presence
of a bladder cancer secreting BPC-1. Normally, significant levels
of protein are not detected in urine, provided that renal function
is normal. However, proteins expressed and secreted by bladder
cancer cells may enter urine in the bladder directly, permitting
their detection in urine. Interestingly, the BPC-1 protein exhibits
a relatively high degree of stability in recombinant cell culture
media, suggesting that the protein may also remain stable in
urine.
[0106] In one embodiment, a capture ELISA is used to detect and
quantify BPC-1 in serum, urine or semen. A capture ELISA for BPC-1
comprises, generally, at least two monoclonal antibodies of
different isotypes that recognize distinct epitopes of the BPC-1
protein, or one anti-BPC-1 monoclonal antibody and a specific
polyclonal serum derived from a different species (e.g., rabbit,
goat, sheep, hamster, etc.). In this assay, one reagent serves as
the capture (or coating) antibody and the other as the detection
antibody (see Example 13 herein).
[0107] Therapeutic Methods and Compositions
[0108] The identification of BPC-1 as a secreted protein which is
only expressed in tissues of the brain in normal individuals but
which is highly expressed in prostate cancer (as well as expressed
in bladder carcinoma and possibly other cancers), opens a number of
therapeutic approaches to the treatment of prostate, bladder and
potentially other cancers. Applicants' initial functional research
suggests that BPC-1 has transformation activity and that this
activity is initiated through the interaction of BPC-1 to a
cellular protein, or through binding to or association with another
protein. The protein's CUB domain may also function as a
protein-protein interaction domain, mediating interactions with
other secreted molecules, extracellular matrix molecules and/or
cell surface receptors.
[0109] Accordingly, therapeutic approaches aimed at inhibiting the
activity of the BPC-1 protein are expected to be useful for
patients suffering from prostate cancer, bladder cancer, and other
cancers expressing BPC-1. These therapeutic approaches generally
fall into two classes. One class comprises various methods for
inhibiting the binding of the BPC-1 protein to its receptor, or
inhibiting its binding to or association with another protein.
[0110] Another class comprises a variety of methods for inhibiting
the transcription of the BPC-1 gene or translation of BPC-1
mRNA.
[0111] A. Therapeutic Methods Based on Inhibition of BPC-1 Protein
Function
[0112] Within the first class of therapeutic approaches, the
invention includes various methods and compositions for inhibiting
the binding of BPC-1 to its receptor or other binding partner or
its association with other protein(s) as well as methods for
inhibiting BPC-1 function.
[0113] A.1. Therapeutic Inhibition of BPC-1 with BPC-1
Antibodies
[0114] In one approach, antibodies which bind to BPC-1 and thereby
inhibit the ability of BPC-1 to bind to its coordinate binding
partner, or to bind to or associate with other protein(s), may be
used to attenuate an oncogenic/transformation signal pathway
involving BPC-1. To the extent BPC-1 is involved in initiating,
promoting and/or sustaining tumor cell growth or other tumor cell
properties through a binding partner-mediated signal, such
antibodies are expected to be therapeutically useful.
[0115] BPC-1 antibodies and fragments thereof which are capable of
inhibiting BPC-1 function are expected to be useful in treating
prostate, bladder, and possibly other cancers. Such antibodies may
function to inhibit BPC-1 activity in different ways. For example,
a BPC-1 antibody may prevent BPC-1 binding to its receptor or
binding to/associating with another protein.
[0116] Alternatively, a BPC-1 antibody may bind to a biologically
active domain of the BPC-1 protein, thereby inhibiting function. In
this regard, antibodies specifically directed to the BPC-1 CUB
domain (see FIG. 1) may be particularly effective in either
inhibiting BPC-1 binding (if the CUB domain is functionally
involved in binding) or in otherwise inhibiting the CUB domain's
function. Such domain-specific BPC-1 antibodies may be generated as
previously described. For example, the CUB domain amino acid
sequence shown in FIG. 1 may be used to generate a CUB-domain
immunogen for the generation of such antibodies.
[0117] With respect to the treatment of cancer with BPC-1
antibodies, a number of factors may be considered, including but
not limited to the following. First, monoclonal antibodies are
generally preferred, particularly those with very high binding
affinity for the secreted BPC-1 protein. Second, fully human or
humanized monoclonal antibodies exhibiting low or no antigenicity
in the patient are preferred. The use of murine or other non-human
monoclonal antibodies and humanimouse chimeric mAbs may induce
moderate to strong immune responses in some patients. Third, the
method by which the antibodies are delivered to the patient may
vary with the type of cancer being treated.
[0118] Generally, where the therapeutic objective is the inhibition
of BPC-1 activity or signal transduction in the target tumor
tissue, administration of BPC-1 antibodies directly to the tumor
site may provide local elimination of BPC-1 function sufficient to
generate a clinical response. Direct administration of BPC-1 Mabs
is also possible and may have advantages in certain contexts. For
example, for the treatment of bladder carcinoma, BPC-1 Mabs may be
injected directly into the bladder.
[0119] Alternatively, BPC-1 antibodies may be administered
systemically, which may result in elimination of BPC-1 function in
the primary tumor, in circulating micrometastasis, andlor in
established metastasis. The degree of tumor vascularization may
provide guidance on which delivery approach is recommended.
Similarly, the grade andlor stage of disease would be expected to
provide useful information in this regard. For example, a higher
grade, more advanced tumor may be more likely to seed metastasis,
suggesting systemic administration in order to treat or prevent the
emergence of metastases.
[0120] BPC-1 mAbs may be therapeutically useful either alone or as
well as combinations, or "cocktails", of different mAbs such as
those recognizing different epitopes. Such mAb cocktails may have
certain advantages inasmuch as they contain mAbs which bind to
different epitopes and enhance the functional inhibition of BPC-1.
In addition, the administration of BPC-1 mAbs may be combined with
other therapeutic agents, including but not limited to various
chemotherapeutic agents, androgen-blockers, and immune modulators
(e.g., IL-2, GM-CSF).
[0121] Treatment of cancer with a BPC-1 antibody will generally
involve the administration of the BPC-1 antibody preparation via an
acceptable route of administration such as intravenous injection
(IV) or bolus infusion, typically at a dose in the range of about
0.1 to about 200 mg/kg body weight. Doses in the range of 10-500 mg
mAb per week (or more) may be effective and well tolerated. An
initial loading dose followed by smaller weekly doses of the mAb
preparation may be used. As one of skill in the art will
understand, various factors will influence the ideal dose regimen
in a particular case. Such factors may include, for example, the
binding affinity and half life of the mAb or mAbs used, the degree
of BPC-1 expression in the patient, the desired steady-state
antibody concentration level, frequency of treatment, and the
influence of chemotherapeutic agents or other therapies used in
combination with the therapeutic composition.
[0122] A.2. Therapeutic Inhibition of BPC-1 with Intracellular
Antibodies
[0123] In another approach, recombinant vectors encoding single
chain antibodies which specifically bind to BPC-1 may be introduced
into BPC-1 expressing cells via gene transfer technologies, wherein
the encoded single chain anti- BPC-1 antibody is expressed
intracellularly, binds to BPC-1 protein, and thereby inhibits its
function. Methods for engineering such intracellular single chain
antibodies are well known. Such intracellular antibodies, also
known as "intrabodies", may be specifically targeted to a
particular compartment within the cell, providing a great deal of
control over where the inhibitory activity of the treatment will be
focused. This technology has been successfully applied in the art
(for review, see Richardson and Marasco, 1995, TIBTECH vol. 13).
Intrabodies have been shown to virtually eliminate the expression
of otherwise abundant cell surface receptors. See, for example,
Richardson et al., 1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141;
Beerli et al., 1994, J. Biol. Chem. 289: 23931-23936; Deshane et
al., 1994, Gene Ther. 1: 332-337.
[0124] Single chain antibodies comprise the variable domains of the
heavy and light chain joined by a flexible linker polypeptide, and
is expressed as a single polypeptide. Optionally, single chain
antibodies may be expressed as a single chain variable region
fragment joined to the light chain constant region. Well known
intracellular trafficking signals may be engineered into
recombinant polynucleotide vectors encoding such single chain
antibodies in order to precisely target the expressed intrabody to
the desired intracellular compartment. For example, intrabodies
targeted to the endoplasmic reticulum (ER) may be engineered to
incorporate a leader peptide and, optionally, a C-terminal ER
retention signal, such as the KDEL amino acid motif. Intrabodies
intended to exert activity in the nucleus may be engineered to
include a nuclear localization signal. Lipid moieties may be joined
to intrabodies in order to tether the intrabody to the cytosolic
side of the plasma membrane. Intrabodies may also be targeted to
exert function in the cytosol. For example, cytosolic intrabodies
may be used to sequester factors within the cytosol, thereby
preventing them from being transported to their natural cellular
destination.
[0125] In one embodiment, intrabodies may be used to capture BPC-1
in the ER, thereby preventing its maturation and secretion outside
of the cell. ER-targeting signals and/or leader peptides may be
engineered into such BPC-1 intrabodies in order to achieve the
desired targeting. Such intrabodies would be expected to capture
BPC-1 as its is being processed by the ER, thereby inhibiting BPC-1
processing or transport through the plasma membrane of the cell.
This method would essentially prevent the existence of secreted
mature bioactive BPC-1 at the level of the ER. Such BPC-1
intrabodies may be designed to bind specifically to a particular
BPC-1 domain, including the signal sequence of precursor BPC-1.
Endoplasmic reticulum-targeted intrabodies reactive with the BPC-1
protein would be expected to capture BPC-1 in the endoplasmic
reticulum. In another embodiment, intrabodies specifically reactive
with the BPC-1 CUB domain may be used to block BPC-1 CUB domain
function within the cytosol.
[0126] A.3. Therapeutic Inhibition of BPC-1 with Recombinant
Proteins
[0127] In another approach, recombinant molecules which are capable
of binding to BPC-1 thereby preventing BPC-1 from accessing/binding
to its coordinate receptor or associating with another protein
involved in transmitting an oncogenic signal may be used to inhibit
BPC-1 function. Such recombinant molecules may, for example,
contain the reactive part(s) of a BPC-1 specific antibody molecule.
In a particular embodiment, the BPC-1 ligand binding domain of a
BPC-1 receptor or binding partner may be engineered into a dimeric
fusion protein comprising two BPC-1 ligand binding domains linked
to the Fc portion of a human IgG, such as human IgG1. Such IgG
portion may contain, for example, the C.sub.H2 and C.sub.H3 domains
and the hinge region, but not the C.sub.H1 domain. Such dimeric
fusion proteins may be administered in soluble form to patients
suffering from a cancer associated with the expression of BPC-1,
including but not limited to prostate and bladder cancers, where
the dimeric fusion protein specifically binds to BPC-1 thereby
blocking BPC-1 interaction with its receptor or other binding
partner. Such dimeric fusion proteins may be further combined into
multimeric proteins using known antibody linking technologies.
[0128] B. Therapeutic Methods Based on Inhibition of BPC-1
Transcription or Translation
[0129] Within the second class of therapeutic approaches, the
invention provides various methods and compositions for inhibiting
the transcription of the BPC-1 gene. Similarly, the invention also
provides methods and compositions for inhibiting the translation of
BPC-1 mRNA into protein.
[0130] In one approach, a method of inhibiting the transcription of
the BPC-1 gene comprises contacting the BPC-1 gene with a BPC-1
antisense polynucleotide. In another approach, a method of
inhibiting BPC-1 mRNA translation comprises contacting the BPC-1
mRNA with an antisense polynucleotide. In another approach, a BPC-1
specific ribozyme may be used to cleave the BPC-1 message, thereby
inhibiting translation. Such antisense and ribozyme based methods
may also be directed to the regulatory regions of the BPC-1 gene,
such as the BPC-1 promoter andlor enhancer elements. Similarly,
proteins capable of inhibiting a BPC-1 gene transcription factor
may be used to inhibit BPC-1 mRNA transcription. The various
polynucleotides and compositions useful in the aforementioned
methods have been described above. The use of antisense and
ribozyme molecules to inhibit transcription and translation is well
known in the art.
[0131] The 5' untranslated region (UTR) of the BPC-1 cDNA of FIG. 1
is an extremely GC rich sequence, strongly implying the presence of
translational control elements within this part of the BPC-1 mRNA.
This characteristic of the BPC-1 gene suggests that blocking
accessibility of the 5' UTR may result in inhibition of BPC-1
translation. In one approach, an antisense molecule complementary
to the 5' UTR of the BPC-1 mRNA is contacted with the 5' UTR of the
BPC-1 message, thereby resulting in hybridization which prevents
endogenous BPC-1 translation factors from accessing the necessary
activation element(s) in the BPC-1 5' UTR. A modification of this
approach uses an polynucleotide comprising a sequence complementary
to the 5' UTR BPC-1 mRNA joined to a ribozyme or similarly active
polynucleotide capable of splicing the BPC-1 mRNA, thereby adding a
second layer of translational inhibition.
[0132] Although, in the above method, a BPC-1 splicing ribozyme may
be contacted with the BPC-1 mRNA separately, i.e., not joined to a
heterologous sequence such as the anti-5' UTR mentioned above,
delivering the ribozyme or similarly active polynucleotide as part
of such a heterologous BPC-1 hybridizing polynucleotide would be
expected to result in placing the ribozyme in direct proximity to
the target sequence and may result in a higher level of inhibitory
activity.
[0133] Other factors which inhibit the transcription of BPC-1
through interfering with BPC-1 transcriptional activation may also
be useful for the treatment of cancers expressing BPC-1, and cancer
treatment methods utilizing such factors are also within the scope
of the invention. Similarly, factors which are capable of
interfering with BPC-1 processing may be useful for the treatment
of cancers expressing BPC-1.
[0134] C. General Consideration
[0135] Gene transfer and gene therapy technologies may be used for
delivering therapeutic polynucleotide molecules to tumor cells
synthesizing BPC-1 (i.e., antisense, ribozyme, polynucleotides
encoding intrabodies and other BPC-1 inhibitory molecules). A
number of gene therapy approaches are known in the art. Recombinant
vectors encoding BPC-1 antisense polynucleotides, ribozymes,
factors capable of interfering with BPC-1 transcription, factors
which are capable of interfering with processing and/or secretion
of mature BPC-1, and so forth, may be delivered to target tumor
cells using such gene therapy approaches.
[0136] The above therapeutic approaches may be combined with
chemotherapy or radiation therapy regimens. These therapeutic
approaches may also enable the use of reduced dosages of
concomitant chemotherapy, particularly in patients that do not
tolerate the toxicity of the chemotherapeutic agent well.
[0137] The anti-tumor activity of a particular composition (e.g.,
antibody, ribozyme, recombinant fusion protein), or a combination
of such compositions, may be evaluated using various in vitro and
in vivo assay systems. In vitro assays for evaluating therapeutic
potential include cell growth assays, soft agar assays and other
assays indicative of tumor promoting activity, binding assays
capable of determining the extent to which a therapeutic
composition will inhibit the binding of BPC-1 to its coordinate
receptor or other binding partner, cell adhesion assays, and the
like. For example, antibody to HER2 inhibits binding of ligand to
receptor and leads to the inhibition of tumor growth. Additionally,
for example, antibodies to EGFR inhibit binding of EGF to receptor,
leading to growth arrest and tumor inhibition. See, also, the
Examples below.
[0138] Various in vitro assays for determining binding affinity of
the therapeutic composition for its target are also known. For
example, binding affinities of BPC-1 antibodies may be determined
using a number of techniques well known in the art (e.g., BIAcore
technology). Higher affinity BPC-1 antibodies are expected to
provide greater levels of the desired inhibition and are therefore
preferred.
[0139] In vivo, the effect of a BPC-1 therapeutic composition may
be evaluated in a suitable animal model. For example, xenogenic
prostate cancer models wherein human prostate cancer explants or
passaged xenograft tissues are introduced into immune compromised
animals, such as nude or SCID mice, are appropriate in relation to
prostate cancer and have been described (Klein et al., 1997, Nature
Medicine 3: 402-408). For Example, PCT Patent Application
WO98/16628, Sawyers et al., published Apr. 23, 1998, describes
various xenograft models of human prostate cancer capable of
recapitulating the development of primary tumors, micrometastasis,
and the formation of osteoblastic metastases characteristic of late
stage disease. Various bladder carcinoma models are known (see, for
example, Russell et al., 1986, Cancer Res. 46: 2035-2040; Raghavan
et al., 1992, Semin. Surg. Oncol. 8: 279-284; Rieger et al., 1995,
Br. J. Cancer 72: 683-690; Oshinsky et al., 1995, J. Urol. 154:
1925-1929). Efficacy may be predicted using assays which measure
inhibition of tumor formation, tumor regression or metastasis, and
the like. See, also, the Examples below.
[0140] In vivo assays which qualify the promotion of apoptosis may
also be useful in evaluating potential therapeutic compositions. In
one embodiment, xenografts from bearing mice treated with the
therapeutic composition may be examined for the presence of
apoptotic foci and compared to un-treated control xenograft-bearing
mice. The extent to which apoptotic foci are found in the tumors of
the treated mice would provide an indication of the therapeutic
efficacy of the composition.
[0141] The therapeutic compositions used in the practice of the
foregoing methods may be formulated into pharmaceutical
compositions comprising a carrier suitable for the desired delivery
method. Suitable carriers include any material which when combined
with the therapeutic composition retains the anti-tumor function of
the therapeutic composition and is non-reactive with the patient's
immune system. Examples include, but are not limited to, any of a
number of standard pharmaceutical carriers such as sterile
phosphate buffered saline solutions, bacteriostatic water, and the
like (see, generally, Remington's Pharmaceutical Sciences 16.sup.th
Edition, A. Osal., Ed., 1980).
[0142] Therapeutic formulations may be solubilized and administered
via any route capable of delivering the therapeutic composition to
the tumor site. Potentially effective routes of administration
include, but are not limited to, intravenous, parenteral,
intraperitoneal, intramuscular, intratumor, intradermal,
intraorgan, orthotopic, and the like. A preferred formulation for
intravenous injection comprises the therapeutic composition (i.e.,
BPC-1 monoclonal antibody) in a solution of preserved
bacteriostatic water, sterile unpreserved water, and/or diluted in
polyvinylchloride or polyethylene bags containing 0.9% sterile
Sodium Chloride for Injection, USP. The anti-BPC-1 mAb preparation
may be lyophilized and stored as a sterile powder, preferably under
vacuum, and then reconstituted in bacteriostatic water containing,
for example, benzyl alcohol preservative, or in sterile water prior
to injection.
[0143] Dosages and administration protocols for the treatment of
cancers using the foregoing methods will vary with the method and
the target cancer and will generally depend on a number of other
factors appreciated in the art.
[0144] Cancer Vaccines
[0145] The invention further provides prostate cancer vaccines
comprising a BPC-1 protein or fragment thereof. The use of a tumor
antigen in a vaccine for generating humoral and cell-mediated
immunity for use in anti-cancer therapy is well known in the art
and has been employed in prostate cancer using human PSMA and
rodent PAP immunogens (Hodge et al., 1995, Int. J. Cancer 63:
231-237; Fong et al., 1997, J. Immunol. 159: 3113-3117). Such
methods can be readily practiced by employing a BPC-1 protein, or
fragment thereof, or a BPC-1-encoding nucleic acid molecule and
recombinant vectors capable of expressing and appropriately
presenting the BPC-1 immunogen.
[0146] For example, viral gene delivery systems may be used to
deliver a BPC-1-encoding nucleic acid molecule. Various viral gene
delivery systems which can be used in the practice of this aspect
of the invention include, but are not limited to, vaccinia,
fowlpox, canarypox, adenovirus, influenza, poliovirus,
adeno-associated virus, lentivirus, and sindbus virus (Restifo,
1996, Curr. Opin. Immunol. 8: 658-663). Non-viral delivery systems
may also be employed by using naked DNA encoding a BPC-1 protein or
fragment thereof introduced into the patient (e.g.,
intramuscularly) to induce an anti-tumor response. In one
embodiment, the full-length human BPC-1 cDNA may be employed. In
another embodiment, BPC-1 nucleic acid molecules encoding specific
cytotoxic T lymphocyte (CTL) epitopes may be employed. CTL epitopes
can be determined using specific algorithms (e.g., Epimer, Brown
University) to identify peptides within a BPC-1 protein which are
capable of optimally binding to specified HLA alleles.
[0147] Various ex vivo strategies may also be employed. One
approach involves the use of dendritic cells to present BPC-1
antigen to a patient's immune system. Dendritic cells express MHC
class I and II, B7 costimulator, and IL-12, and are thus highly
specialized antigen presenting cells. In prostate cancer,
autologous dendritic cells pulsed with peptides of the
prostate-specific membrane antigen (PSMA) are being used in a Phase
I clinical trial to stimulate prostate cancer patients' immune
systems (Tjoa et al., 1996, Prostate 28: 65-69; Murphy et al.,
1996, Prostate 29: 371-380). Dendritic cells can be used to present
BPC-1 peptides to T cells in the context of MHC class I and II
molecules. In one embodiment, autologous dendritic cells are pulsed
with BPC1 peptides capable of binding to MHC molecules. In another
embodiment, dendritic cells are pulsed with the complete BPC-1
protein. Yet another embodiment involves engineering the
overexpression of the BPC-1 gene in dendritic cells using various
implementing vectors known in the art, such as adenovirus (Arthur
et al., 1997, Cancer Gene Ther. 4: 17-25), retrovirus (Henderson et
al., 1996, Cancer Res. 56: 3763-3770), lentivirus, adeno-associated
virus, DNA transfection (Ribas et al., 1997, Cancer Res. 57:
2865-2869), and tumor-derived RNA transfection (Ashley et al.,1997,
J. Exp. Med.186:1177-1182). Cells expressing BPC-1 may also be
engineered to express immune modulators, such as GM-CSF, and used
as immunizing agents.
[0148] Anti-idiotypic anti-BPC-1 antibodies can also be used in
anti-cancer therapy as a vaccine for inducing an immune response to
cells expressing a BPC-1 protein. Specifically, the generation of
anti-idiotypic antibodies is well known in the art and can readily
be adapted to generate anti-idiotypic anti-BPC-1 antibodies that
mimic an epitope on a BPC-1 protein (see, for example, Wagner et
al., 1997, Hybridoma 16: 33-40; Foon et al., 1995, J Clin Invest
96: 334-342; Herlyn et al., 1996, Cancer Immunol Immunother 43:
65-76). Such an anti-idiotypic antibody can be used in cancer
vaccine strategies.
[0149] Genetic immunization methods may be employed to generate
prophylactic or therapeutic humoral and cellular immune responses
directed against cancer cells expressing BPC-1.
[0150] Constructs comprising DNA encoding a BPC-1 protein/immunogen
and appropriate regulatory sequences may be injected directly into
muscle or skin of an individual, such that the cells of the muscle
or skin take-up the construct and express the encoded BPC-1
protein/immunogen. Expression of the BPC-1 protein immunogen
results in the generation of prophylactic or therapeutic humoral
and cellular immunity against prostate cancer. Various prophylactic
and therapeutic genetic immunization techniques known in the art
may be used (for review, see information and references published
at Internet address www.genweb.com).
[0151] Kits
[0152] For use in the diagnostic and therapeutic applications
described or suggested above, kits are also provided by the
invention. Such kits may comprise a carrier means being
compartmentalized to receive in close confinement one or more
container means such as vials, tubes, and the like, each of the
container means comprising one of the separate elements to be used
in the method. For example, one of the container means may comprise
a probe which is or can be detectably labeled. Such probe may be an
antibody or polynucleotide specific for a BPC-1 protein or a BPC-1
gene or message, respectively. Where the kit utilizes nucleic acid
hybridization to detect the target nucleic acid, the kit may also
have containers containing nucleotide(s) for amplification of the
target nucleic acid sequence andlor a container comprising a
reporter-means, such as a biotin-binding protein, such as avidin or
streptavidin, bound to a reporter molecule, such as an enzymatic,
florescent, or radioisotope label.
EXAMPLES
[0153] Various aspects of the invention are further described and
illustrated by way of the several examples which follow, none of
which are intended to limit the scope of the invention.
Example 1
[0154] Isolation of cDNA Fragment of BPC-1 Gene
[0155] Materials and Methods
[0156] LAPC Xenografts
[0157] LAPC xenografts were obtained from Dr. Charles Sawyers
(UCLA) and generated as described (Klein et al, 1997, Nature Med.
3: 402-408). Androgen dependent and independent LAPC-4 xenografts
LAPC-4 AD and AI, respectively) and LAPC-9 AD xenografts were grown
in male SCID mice and were passaged as small tissue chunks in
recipient males. LAPC-4 AI xenografts were derived from LAPC-4 AD
tumors. Male mice bearing LAPC-4 AD tumors were castrated and
maintained for 2-3 months. After the LAPC-4 tumors re-grew, the
tumors were harvested and passaged in castrated males or in female
SCID mice.
[0158] Cell Lines
[0159] Human cell lines (e.g., HeLa) were obtained from the ATCC
and were maintained in DMEM with 10% fetal calf serum.
[0160] RNA Isolation
[0161] Tumor tissue and cell lines were homogenized in Trizol
reagent (Life Technologies, Gibco BRL) using 10 ml/g tissue or 10
ml/10.sup.8 cells to isolate total RNA. Poly A RNA was purified
from total RNA using Qiagen's Oligotex mRNA Mini and Midi kits.
Total and mRNA were quantified by spectrophotometric analysis (O.D.
260/280 nm) and analyzed by gel electrophoresis.
[0162] Oligonucleotides
[0163] The following HPLC purified oligonucleotides were used.
1 DPNCDN (cDNA synthesis primer): 5'TTTTGATCAAGCTT.sub.303' Adaptor
1: 5'CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCG- GGCAG3'
3'GGCCCGTCCTAG5' Adaptor 2:
5'GTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAG3' 3'CGGCTCCTAG5' PCR
primer 1: 5'CTAATACGACTCACTATAGGGC3' Nested primer (NP)1:
5'TCGAGCGGCCGCCCGGGCAGGA3' Nested primer (NP)2:
5'AGCGTGGTCGCGGCCGAGGA3'
[0164] Suppression Subtractive Hybridization
[0165] Suppression Subtractive Hybridization (SSH) was used to
identify cDNAs corresponding to genes which may be down-regulated
in androgen independent prostate cancer compared to androgen
dependent prostate cancer.
[0166] Double stranded cDNAs corresponding to the LAPC-4 AD
xenograft (tester) and the LAPC-4 AI xenograft (driver) were
synthesized from 2 .mu.g of poly(A).sup.+ RNA isolated from
xenograft tissue, as described above, using CLONTECH's PCR-Select
cDNA Subtraction Kit and 1 ng of oligonucleotide DPNCDN as primer.
First- and second-strand synthesis were carried out as described in
the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1,
Catalog No. K1804-1). The resulting cDNA was digested with Dpn II
for 3 hrs. at 37.degree. C. Digested cDNA was extracted with
phenol/chloroform (1:1) and ethanol precipitated.
[0167] Driver cDNA (LAPC-4 AI) was generated by combining in a 1:1
ratio Dpn II digested LAPC-4 AI cDNA with a mix of digested cDNAs
derived from human benign prostatic hyperplasia (BPH), the human
cell lines HeLA, 293, A431, Colo2O5, and mouse liver.
[0168] Tester cDNA (LAPC-4 AD) was generated by diluting 1 .mu.l of
Dpn II digested LAPC-4 AD cDNA (400 ng) in 5 .mu.l of water. The
diluted cDNA (2 .mu.l, 160 ng) was then ligated to 2 .mu.l of
adaptor 1 and adaptor 2 (10 .mu.M), in separate ligation reactions,
in a total volume of 10 .mu.l at 16.degree. C. overnight, using 400
u of T4 DNA ligase (CLONTECH). Ligation was terminated with 1 .mu.l
of 0.2 M EDTA and heating at 72.degree. C. for 5 min.
[0169] The first hybridization was performed by adding 1.5 .mu.l
(600 ng) of driver cDNA to each of two tubes containing 1.5 .mu.l
(20 ng) adaptor 1- and adaptor 2-ligated tester cDNA. In a final
volume of 4 .mu.l, the samples were overlayed with mineral oil,
denatured in an MJ Research thermal cycler at 98.degree. C. for 1.5
minutes, and then were allowed to hybridize for 8 hrs at 68.degree.
C. The two hybridizations were then mixed together with an
additional 1 .mu.l of fresh denatured driver cDNA and were allowed
to hybridize overnight at 68.degree. C. The second hybridization
was then diluted in 200 .mu.l of 20 mM Hepes, pH 8.3, 50 mM NaCl,
0.2 mM EDTA, heated at 70.degree. C. for 7 min. and stored at
-20.degree. C.
[0170] PCR Amplification, Cloning and Sequencing of Gene Fragments
Generated from SSH
[0171] To amplify gene fragments resulting from SSH reactions, two
PCR amplifications were performed. In the primary PCR reaction 1
.mu.l of the diluted final hybridization mix was added to 1 .mu.l
of PCR primer 1 (10 .mu.M), 0.5 .mu.l dNTP mix (10 .mu.M), 2.5
.mu.l 10.times.reaction buffer (CLONTECH) and 0.5 .mu.l
50.times.Advantage cDNA polymerase Mix (CLONTECH) in a final volume
of 25 .mu.l. PCR 1 was conducted using the following conditions:
75.degree. C. for 5 min., 94.degree. C. for 25 sec., then 27 cycles
of 94.degree. C. for 10 sec, 66.degree. C. for 30 sec, 72.degree.
C. for 1.5 min. Five separate primary PCR reactions were performed
for each experiment. The products were pooled and diluted 1:10 with
water. For the secondary PCR reaction, 1 .mu.l from the pooled and
diluted primary PCR reaction was added to the same reaction mix as
used for PCR 1, except that primers NP1 and NP2 (10 .mu.M) were
used instead of PCR primer 1. PCR 2 was performed using 10-12
cycles of 94.degree. C. for 10 sec, 68.degree. C. for 30 sec,
72.degree. C. for 1.5 minutes. The PCR products were analyzed using
2% agarose gel electrophoresis.
[0172] The PCR products were inserted into pCR2.1 using the T/A
vector cloning kit (Invitrogen). Transformed E. coli were subjected
to blue/white and ampicillin selection. White colonies were picked
and arrayed into 96 well plates and were grown in liquid culture
overnight. To identify inserts, PCR amplification was performed on
1 ml of bacterial culture using the conditions of PCR1 and NP1 and
NP2 as primers. PCR products were analyzed using 2% agarose gel
electrophoresis.
[0173] Bacterial clones were stored in 20% glycerol in a 96 well
format. Plasmid DNA was prepared, sequenced, and subjected to
nucleic acid homology searches of the GenBank, dBest, and NCI-CGAP
databases.
[0174] RT-PCR Expression Analysis
[0175] First strand cDNAs were generated from 1 .mu.g of mRNA with
oligo (dT)12-18 priming using the Gibco-BRL Superscript
Preamplification system. The manufacturers protocol was used and
included an incubation for 50 min at 42.degree. C. with reverse
transcriptase followed by RNAse H treatment at 37.degree. C. for 20
min. After completing the reaction, the volume was increased to 200
.mu.l with water prior to normalization. First strand cDNAs from 16
different normal human tissues were obtained from Clontech.
[0176] Normalization of the first strand cDNAs from multiple
tissues was performed by using the primers
5'atatcgccgcgctcgtcgtcgacaa3' and 5'agccacacgcagctcattgtagaagg 3'
to amplify .beta.-actin. First strand cDNA (5 .mu.l) was amplified
in a total volume of 50 .mu.l containing 0.4 .mu.M primers, 0.2
.mu.M each dNTPs, 1.times.PCR buffer (Clontech, 10 mM Tris-HCL, 1.5
mM MgCl.sub.2, 50 mM KCl, pH8.3) and 1.times.Klentaq DNA polymerase
(Clontech). Five .mu.l of the PCR reaction was removed at 18, 20,
and 22 cycles and used for agarose gel electrophoresis. PCR was
performed using an MJ Research thermal cycler under the following
conditions: initial denaturation was at 94.degree. C. for 15 sec,
followed by a 18, 20, and 22 cycles of 94.degree. C. for 15,
65.degree. C. for 2 min, 72.degree. C. for 5 sec. A final extension
at 72.degree. C. was carried out for 2 min. After agarose gel
electrophoresis, the band intensities of the 283 bp .beta.-actin
bands from multiple tissues were compared by visual inspection.
Dilution factors for the first strand cDNAs were calculated to
result in equal .beta.-actin band intensities in all tissues after
22 cycles of PCR. Three rounds of normalization were required to
achieve equal band intensities in all tissues after 22 cycles of
PCR.
[0177] To determine expression levels of the 19P1E8 gene, 5 .mu.l
of normalized first strand cDNA was analyzed by PCR using 25, 30,
and 35 cycles of amplification using the following primer pairs,
which were designed with the assistance of (MIT; for details, see,
www.genome.wi.mit.edu):
2 5'-TGC CGT ATG TCA CTG TCT CTA GGT-3' 5'-GAA ATC ATG GGT ATT TCA
TGT GCT-3'
[0178] These primers were designed from the sequence of the SSH
fragment of the initially isolated 19P1E8 gene. Use of the
following primer pair, based on sequences within the open reading
frame of the 19P1E8 gene, produced the same expression pattern.
3 5'-CTC CCA ACT ATC CCA GCA AGT ATC-3' 5'-AAA TCC CAT AGA TTC CAG
CTC TCC-3'
[0179] Semi quantitative expression analysis was achieved by
comparing the PCR products at cycle numbers that give light band
intensities.
[0180] Results
[0181] Several SSH experiments were conduced as described in the
Materials and Methods, supra, and led to the isolation of numerous
candidate gene fragment clones (SSH clones). All candidate clones
were sequenced and subjected to homology analysis against all
sequences in the major public gene and EST databases in order to
provide information on the identity of the corresponding gene and
to help guide the decision to analyze a particular gene for
differential expression. In general, gene fragments which had no
homology to any known sequence in any of the searched databases,
and thus considered to represent novel genes, as well as gene
fragments showing homology to previously sequenced expressed
sequence tags (ESTs), were subjected to differential expression
analysis by RT-PCR and/or Northern analysis.
[0182] One of the SSH clones comprising about 700 bp, showed no
homology to any known gene or EST sequence was designated 19P1E8.
The nucleotide sequence of this SHH clone is shown in FIG. 1,
approximately nucleotide residues 1883-2583. Differential
expression analysis by Northern blot showed that 19P1E8 is
expressed in LAPC-4 AD xenograft, and to a significantly lesser
extent in LAPC-4 AI, LAPC-9 AD and LAPC-9 AI (FIG. 9). No
expression was detected in normal prostate (FIG. 9). Three distinct
transcripts are shown, with sizes of 3.5 kb, 8 kb, and greater than
9 kb.
[0183] RT-PCR analysis of 19P1E8 expression produced essentially
identical results (FIG. 5, Panel A). In addition, further RT-PCR
expression analysis of first strand cDNAs from 16 normal tissues
detected expression of the 19P1E8 gene only in brain, spleen and
testis tissue, and only at very low levels detectable at 35 and not
30 cycles of PCR amplification (FIG. 5, panels B and C). In
comparison, substantial expression was detected in LAPC-4 AD with
only 30 cycles (FIG. 5).
Example 2
[0184] Isolation of Full Length BCP-1 Encoding cDNA
[0185] The 19P1E8 SHH clone above (Example 1) was used to isolate a
full length 19P1E8 cDNA. Briefly, a cDNA library generated from
LAPC-4 mRNA was screened with a labeled probe generated from the
SSH clone. Specifically, a full length 19P1E8 cDNA of 2639 base
pairs (bp) was cloned from an LAPC-4 AD cDNA library generated in
lambda ZAP Express (Stratagene).
[0186] The cDNA encodes an open reading frame (ORF) of 158 amino
acids containing a signal sequence and a CUB domain (Complement
sub-components C1r/C1s, Uegf, Bmp1) (Borck and Beckmann, 1993, J.
Mol. Biol. 231: 539-545). The 5' UTR (untranslated region) is very
GC rich, suggesting that this region contains regulatory elements
for translation. CUB domains were originally found in complement
sub-components Clr and Cls, and were subsequently identified in
Uegf (epidermal growth factor related sea urchin protein) and Bmp1
(bone morphogenetic protein 1) a protease involved in bone
development.
[0187] In view of the exclusive expression of this gene in brain
and its up-regulation in prostate cancer xenografts, this gene was
named BPC-1 (Brain/Prostate cancer CUB protein). The nucleotide and
deduced amino acid sequences of the isolated BPC-1 cDNA are shown
in FIG. 1. A schematic representation of the BPC-1 structure is
shown in FIG. 2. An amino acid alignment between the CUB domain of
BPC-1 and the CUB domains of other proteins is shown in FIG. 3.
Referring to FIG. 3, of particular interest is that the CUB domain
of BPC-1 is 30-40% identical to the CUB domains in BMP-1.
[0188] The full length BPC-1 cDNA (p19P1E8, clone 6.1) was
deposited with the American Type Culture Collection on Aug. 7, 1998
and has been accorded ATCC accession number 98833.
Example 3
[0189] BPC-1 Gene Expression Analysis--Brain Specific in Normal
Tissues
[0190] Initial analysis of BPC-1 mRNA expression in normal human
tissues was conducted by Northern blotting two multiple tissue
blots obtained from Clontech (Palo Alto, Calif.), comprising a
total of 16 different normal human tissues, using labeled 19P1E8
SSH clone (Example 1) as a probe. RNA samples were quantitatively
normalized with a .beta.-actin probe.
[0191] The results are shown in FIG. 4. Expression was only
detected in normal brain. The northern blots showed two transcripts
of 3.5 kb and 8.0 kb (FIG. 5). The 3.5 kb transcript corresponds to
the cDNA identified from LAPC-4 AD that encodes the BPC-1 ORF. The
larger transcript may encode an un-processed message or an
alternative isoform of the gene.
[0192] To further explore BPC-1 expression in normal tissues, a
multi-tissue RNA dot blot was probed with a BPC-1 probe. Out of 37
different normal tissues tested, only brain regions exhibited
detectable levels of BPC-1 (FIG. 6). Interestingly, expression of
BPC-1 was confined to cortical regions of the brain, such as the
temporal, frontal and occipital lobes. Expression was also seen in
hippocampus, amygdala, caudate nucleus and putamen. Other brain
regions such as thalamus, sub-thalamic nucleus and substantia nigra
did not express BPC-1. Similarly, no expression was detected in
other central nervous system (CNS) structures such as cerebellum,
spinal cord and medulla oblongata (mid-brain). The RNA dot blot
results were confirmed with a northern blot containing RNA for
different CNS tissues (FIG. 7).
Example 4
[0193] BPC-1 Expression in Fetal Tissues--Broader Expression in
Development
[0194] CUB domain proteins often are often developmentally
regulated. To determine if BPC-1 is expressed in human fetal
tissue, RT-PCR was performed on first strand cDNA derived from 8
different fetal tissues. The results show that BPC-1 is highly
expressed in fetal brain, with lower levels detected in all other
fetal tissues (FIG. 8). This suggests that expression in the adult
is exclusive to brain, while expression in other tissues is turned
off during development.
Example 5
[0195] High Level BPC-1 Expression in Prostate Cancer
[0196] To analyze BPC-1 expression in cancer tissues and cell
lines, Northern blot analysis was performed on RNA derived from the
LAPC prostate cancer xenografts as well as a panel of prostate and
bladder cancer cell lines. The results, shown in FIG. 9, reveal the
highest levels of BPC-1 expression in the LAPC-4 AD prostate cancer
xenograft and in the LNCaP prostate cancer cell line, both of which
originated from lymph-node metastasis of prostate cancer (Klein et
a., 1997, Nature Med. 3:402; Horoszewicz et al., 1983, Cancer Res.
43:1809). Lower level expression of BPC-1 was detected in LAPC-4
AI, LAPC-9 AD and LAPC-9 AI (FIG. 9). Among the bladder cancer cell
lines tested, one (5637) showed detectable BPC-1 expression (FIG.
9). No expression was detected in PrEC cells (Clonetics), which
represent the basal cell compartment of the prostate and normal
prostate.
Example 6
[0197] Production of Secreted Recombinant BPC-1 In Vitro
[0198] To express recombinant BPC-1 and analyze the subcellular
localization of BPC-1 protein, the full length cDNA was cloned into
an expression vector that provides a 6His tag at the
carboxyl-terminus (pCDNA 3.1 myc-his, InVitrogen). The construct
was transfected into 293T cells which were labeled for one hour
with .sup.35S-methionine. The cells were then washed and incubated
in non-radioactive media to chase the labeled proteins for various
time points. BPC-1-His tagged protein was immunoprecipitated using
anti-His antibodies (Santa Cruz) from cell extracts and from cell
supernatant (media) at various time points after the chase. The
immunoprecipitates were analyzed by SDS-PAGE (sodium-dodecyl
sulfate polyacrylamide-gel electrophoresis) with subsequent
autoradiography to visualize .sup.35S-methionine labeled
protein.
[0199] The results show that BPC-1 protein appears in the cell
extract and the cell media immediately after the
.sup.35S-methionine labeling period (FIG. 10). Within two hours of
the chase, nearly all BPC-1 protein is secreted into the media and
remains stable in the media for several hours. The half-life of the
protein is estimated to be longer than 24 hours. Vector transfected
cells were also labeled and analyzed using the same protocol.
Interestingly, a non-specific protein appears in both the vector
and the BPC-1 transfected cells. This protein seems to have a very
short half-life in the media compared to BPC-1, as it disappears
after the 4 hour time point. These results demonstrate that BPC-1
is indeed a secreted protein that appears to be very stable in cell
culture media.
Example 7
[0200] Production of Recombinant BPC-1 Using Baculovirus System
[0201] To generate recombinant BPC-1 protein in a baculovirus
expression system, BPC-1 cDNA was cloned into the baculovirus
transfer vector pMeIBac (Invitrogen) which provides the honeybee
mellitin signal sequence for secretion into the media of insect
cells. pMelBac-BPC-1 was co-transfected with helper plasmid
pBlueBac4.5 (Invitrogen) into SF9 (Spodoptera frugiperda) insect
cells to generate recombinant baculovirus (see Invitrogen
instruction manual for details). Baculovirus was collected from
cell supernatant and was purified by plaque assay.
[0202] Recombinant BPC-1 protein was generated by infection of
HighFive insect cells (InVitrogen) with purified baculovirus.
Recombinant BPC-1 protein was detected in both cell extract and
cell supernatant using anti-BPC-1 mouse polyclonal antibody (see
Example 8, below). Interestingly, the cell extract contains two
forms of BPC-1, signal sequence cleaved BPC-1 and unprocessed BPC-1
(FIG. 11). The supernatant only contained cleaved mature BPC-1.
This recombinant BPC-1 protein may be purified and used in various
cell based assays or as immunogen to generate polyclonal and
monoclonal antibodies specific for BPC-1.
Example 8
[0203] Generation of BPC-1 Polyclonal Antibodies
[0204] In order to generate antibody reagents that specifically
bind to BPC-1, a glutathione-S-transferase (GST) fusion protein
encompassing amino acids 29-93 of the BPC-1 protein was synthesized
to serve as immunogen. This fusion protein was generated by
PCR-mediated amplification of nucleotides 877-1,071 (AA 29-93) of
the cDNA clone of BPC-1 with the following primers:
4 5' PRIMER TTGAATTCCAAGCAAACCACCTCAGA EcoRI 3' PRIMER
AAGCTCGAGTCAGACGGTTCAATAGAGT XhoI
[0205] The resultant product was cloned into the EcoR1 and XhoI
restriction sites of the pGEX-2 T GST-fusion vector (Pharmacia).
Recombinant GST-BPC-1 fusion protein was purified to greater than
90% purity from induced bacteria by glutathione-sepaharose affinity
chromatography.
[0206] To generate polyclonal sera to BPC-1, the purified fusion
protein was used as follows. A rabbit was initially immunized with
200 .mu.g of GST-BPC-1 fusion protein mixed in complete Freund's
adjuvant. The rabbit was injected every two weeks with 200 .mu.g of
GST-BPC-1 protein in incomplete Freund's adjuvant. Test bleeds were
taken approximately 7-10 days following each immunization. ELISA,
Western blotting and immunoprecipitation analyses were used to
determine specificity and titer of the rabbit serum to BPC-1. Cell
lines that express BPC-1 endogenously such as LNCaP and cell lines
engineered to overexpress BPC-1 by transfection (293T) and by
retroviral infection (PC-3 and NIH3T3) were used for
characterization of the antiserum. Antiserum representing specific
high titer to BPC-1 protein is purified by a 3 step process: (1)
removal of GST-reactive antibody by depletion over a GST affinity
column, (2) BPC-1 specific IgG antibody was isolated by passage
over a GST-BPC-1 affinity column, and (3) protein G
chromatography.
[0207] The mouse polyclonal antibody was successfully used for
detecting recombinant BPC-1 expressed in a baculovirus expression
system (see Example 7, above), affinity (nickel) purified MYC/HIS
BPC-1 protein (FIG. 13) and recombinant BPC-1 protein in tissue
culture supernatants of cells expressing the BPC-1 gene (FIG. 13).
Rabbit polyclonal serum was also generated and similarly was
capable of detecting BPC-1 in tissue culture supernatants of cells
expressing the BPC-1 gene.
Example 9
[0208] Generation of BPC-1 Monoclonal Antibodies
[0209] To generate mAbs to BPC-1, 5 Balb C mice were initially
immunized intraperitoneally with 200 .mu.g of GST-BPC-1 fusion
protein mixed in complete Freund's adjuvant. Mice were subsequently
immunized every 2 weeks with 75 .mu.g of GST-BPC-1 protein mixed in
Freund's incomplete adjuvant for a total of 3 immunizations.
Reactivity of serum from immunized mice to full length BPC-1
protein was monitored by ELISA using a partially purified
preparation of HIS-tagged BPC-1 protein expressed from 293T cells.
Two mice with strongest reactivity were rested for 3 weeks and
given a final injection of fusion protein in PBS and then
sacrificed 4 days later. The spleens of the sacrificed mice were
harvested and fused to SPO/2 myeloma cells using standard
procedures (Harlow and Lane, 1988). Supernatants from growth wells
following HAT selection are being screened by ELISA and Western
blot to identify BPC-1 specific antibody producing clones.
[0210] The binding affinity of a BPC-1 monoclonal antibody may be
determined using standard technology. Affinity measurements
quantify the strength of antibody to epitope binding and may be
used to help define which BPC-1 monoclonal antibodies are preferred
for diagnostic or therapeutic use. The BIAcore system (Uppsala,
Sweden) is a preferred method for determining binding affinity. The
BIAcore system uses surface plasmon resonance (SPR, Welford K.
1991, Opt. Quant. Elect. 23:1; Morton and Myszka, 1998, Methods in
Enzymology 295: 268) to monitor biomolecular interactions in real
time. BIAcore analysis conveniently generates association rate
constants, dissociation rate constants, equilibrium dissociation
constants, and affinity constants.
Example 10
[0211] Production and Purification of Recombinant BPC-1 Expressed
in a Mammalian Expression System
[0212] 293T cells transiently transfected or 293 cells stably
expressing a CMV-driven expression vector encoding BPC-1 with a
C-terminal 6.times.His and MYC tag (pcDNA3.1/mycHIS, Invitrogen)
serves as source of secreted soluble BPC-1 protein for purification
(see Example 6, above). The HIS-tagged BPC-1 protein secreted into
the conditioned media is purified using the following method.
Conditioned media (500 ml) is concentrated 10 fold and
simultaneously buffer exchanged into a phosphate buffer (pH 8.0)
containing 750 mM NaCl and 10 mM imidazole using an amicon
ultrafiltration unit with a 10 kd MW cutoff membrane. The
preparation is then passed over a nickel metal affinity resin with
a 0.5 ml bed volume (Ni-NTA, Qiagen) and washed extensively with
phosphate buffer (pH 6.0) containing 10% ethanol and 300 mM NaCl.
The HIS-tagged BPC-1 protein is then eluted with phosphate buffer
(pH 6.0) containing 250 mM imidizole. Higher purity preparations
are obtained by repeating the above chromatography step with higher
stringency of wash (phosphate buffer containing 75 mM imidizole) or
by passage over an anti-HIS Ab immunoaffinity column. This method
was successfully used to purify recombinant HIS-BPC-1. A western
blot of the purified protein is shown in the far left hand lane of
FIG. 13.
Example 11
[0213] Retrovirus Mediated Expression of Secreted Human BPC-1
[0214] The BPC-1 coding region was subcloned into the retroviral
SR.alpha.msvtkneo vector (Muller et al., 1991 MCB 11: 1785-1792).
Retroviruses were made and used to generate cell lines expressing
the BPC-1 gene. The cell lines generated are 3T3/BPC-1 and
PC3/BPC-1. 3T3 cells acutely infected with the SR-.alpha.BPC-1
virus express a very high level of BPC-1 mRNA, as demonstrated by
the Northern blot shown in FIG. 12. The PC3/BPC-1 lysate and
supernatant were tested for BPC-1 expression by Western blot
analysis using a polyclonal antibody against a GST fusion protein
containing the N-terminal portion of the BPC-1 protein (aa29-93) as
follows. PC3 and 3T3 cells stably expressing either control(Neo) or
BPC-1 encoding retrovirus and 3T3 cells acutely infected with BPC-1
retrovirus were cultured in 10 cm tissue culture plates for 4 days.
25 .mu.l of neat supernatant from each line was subjected to
Western blot analysis using a 1:500 dilution of murine anti-BPC-1
polyclonal serum. The blot was then incubated with anti-mouse-HRP
conjugated secondary antibody and BPC-1 specific signals were
visualized by enhanced chemiluminescent detection. The results of
this Western blot analysis are shown in FIG. 13.
Example 12
[0215] BPC-1 Expression Analysis In Vitro and In Vivo
[0216] Western and immunoprecipitation analyses of cell lysates and
conditioned media with BPC-1 specific antibodies may be used to
identify and characterize BPC-1 protein expression in cell lines
and tissues, such as LAPC4 and LAPC9 xenografts, LNCaP prostate
cancer cells, 5637 bladder carcinoma cells, normal human brain
lysate, all of which express BPC-1 mRNA, as well as a variety of
other carcinoma cell lines, xenografts, and normal tissues. Due to
the structural homology of BPC-1 to the porcine and bovine
spermadhesin family of proteins (Topfer-Petersen et al. Andrologia,
1998) human semen may also contain detectable levels of BPC-1
protein. Also, given its expression in bladder carcinoma, BPC-1
protein may also be detectable in the urine of bladder carcinoma
patients. MYC-HIS BPC-1 transfected 293T cells and retrovirally
transduced PC3 and NIH3T3 cells serve as positive controls for
BPC-1 protein expression (FIG. 13).
[0217] Identification and quantitation of BPC-1 protein present in
clinical samples of human serum, semen, and urine may be carried
out by capture ELISA as described in the following example.
Immunohistochemical analysis of BPC-1 protein in normal and
cancerous tissues may be conducted on formalin-fixed,
paraffin-embedded or frozen tissue sections using standard
immunohistochemical methods well known in the art and the BPC-1
antibodies provided herein. Formalin-fixed, paraffin-embedded
sections of LNCaP cells may used as a positive control.
Example 13
[0218] BPC-1 Capture ELISA
[0219] Capture ELISA may be used to identify and quantify BPC-1
protein present in clinical samples of human serum, semen, and
urine as follows. The capture ELISA for BPC-1 is dependent on the
generation of at least 2 mAbs of different isotypes that recognize
distinct epitopes of the BPC-1 protein or 1 mAb and a specific
rabbit polyclonal serum. One reagent will serve as the capture (or
coating) Ab and the other as the detection Ab.
[0220] Captured BPC-1 is then visualized by the addition of a
secondary Ab-HRP conjugate against the detection antibody followed
by incubation with TMB substrate. Optical density of wells is then
measured in a spectrophotometric plate reader at 450 nm. Purified
MYC/HIS tagged BPC-1 protein serves as a standardization antigen
for the ELISA.
Example 14
[0221] BPC-1 Expression Results in Anchorage Independent Colony
Formation In Vitro
[0222] Retrovirally-infected cells expressing BPC-1 were generated
as described in EXAMPLE 11 and used along with the respective neo
control cell lines to perform soft agar assays to evaluate the
oncogenic potential of BPC-1. The agar assay was performed
according to conditions previously described (Lugo, T. R and O. N.
Witte, 1989, Molec. Cell. Biol. 9: 1263-1270). Briefly, cells were
trypsinized and resuspended in Iscove medium containing 0.3% Noble
agar and 20% fetal bovine serum. This cell agar suspension
(10.sup.4 cells/60 mm plate) was plated between a bottom and top
layer of medium containing 0.6% Noble agar and 20% fetal bovine
serum. The plates were fed after 7 days, and colonies examined and
scored 2 or 3 weeks after the agar assay was set up, depending on
the size of the colonies. The colonies were counted suing a
software from Alphalmager 200. The results are tabulated below in
Table 1.
5TABLE 1 BPC-1 EXPRESSION INDUCES CELL TRANSFORMATION AVG. NO.
COLONIES AVG. NO. COLONIES [G418 selection CELLS [acute infection]
for 2 weeks] 3T3CL7/neo 14 65 3T3CL7/BPC-1 116 235
[0223] 3T3CL7 cells infected with retrovirus expressing BPC-1 or
neo were used. Colonies were scored 3 weeks after the agar assays
were set up. The 3T3CL7/BPC-1 cells generated about 8 fold more
colonies compared to the control plate for acutely infected cells.
Using G418 selected cells, there are about 3.6 fold more colonies
in the 3T3CL7/BPC-1 plates compared to the 3T3CL7/neo plates.
[0224] The above results indicate that the BPC-1 protein induces
anchorage independent growth in cells experimentally engineered to
express and secrete BPC-1 and thus exerts a transforming effect on
those cells.
Example 15
[0225] BPC-1 Binds to a Cellular Protein
[0226] In order to establish whether BPC-1 binds to cellular
proteins expressed in prostate cancer cells and other cancer cells
or normal cells, two approaches were taken. In the first approach,
in vitro assay for recombinant HlS-tagged BPC-1 (Example 6, above)
binding to various cell lines are used. In another approach, a
recombinant alkaline phosphatase-BPC-1 fusion protein are generated
using the AP-TAG system from GenHunter Corporation (Nashville,
Tenn., cat# Q202), and the AP-TAG fusion used to test BPC-1 binding
to a variety of prostate cancer cell lines.
[0227] A. HIS-Tagged BPC-1 Cell Surface Binding Analysis
[0228] PC-3 and NIH3T3 cells are incubated on ice at 4 degrees C.
for 2 hours with conditioned media containing HIS-tagged BPC-1
(from 293T transfected cells) or media containing purified
HIS-tagged BPC-1 or control media. Cells are washed extensively
with ice cold PBS with 0.5% FBS and then incubated with an excess
of anti-HIS rabbit polyclonal antibody (5 ug/ml, PBS 0.5%FBS) at 4
degrees C. for 1 hour. Cells are again washed and then incubated
with anti-rabbit FITC conjugated secondary Ab (1:4,000 in PBS/0.5%
FBS) for 30 minutes at 4 degrees C. Cell bound BPC-1 is then
detected by fluorimetric analysis of cells in a Cytofluor 4000
fluorimeter (PE Biosystems) andlor by flow cytometry.
[0229] As an alternative to the fluorescence-based assay used
above, binding assays can be carried out with .sup.125I-labeled
BPC-1 protein. Determination of BPC-1 receptor number and affinity
on cells and monitoring internalization of receptor bound BPC-1
protein is carried out using standard published procedures (Raitano
and Korc, J. Biol. Chem., 1990, J. Biol. Chem. 265:
10466-10472).
[0230] B. Alkaline Phosphatase Tagged BPC-1 Generates Cell Surface
Staining in Prostate Cancer Cells
[0231] Alkaline phosphatase-tagged BPC-1 was generated as follows.
The sequence encoding mature BPC-1 (i.e., without the signal
sequence) was cloned into pAPtag-5 (GenHunter Corp. Nashville,
Tenn.). The BPC-1.HindIII and BPC1.BamH1 primers, below, were used
to amplify the BPC-1 open reading frame between amino acids 23 and
58 from the plasmid template SRa-19P1E8 clone 1. The HindIII and
BamH1 digested PCR product was ligated into HindIII and BgIII
digested pAPtag-5 while keeping the IgGK signal sequence, BPC-1
ORF, and alkaline phosphatase all in frame. The BPC-1-AP fusion
protein contains an IgGK signal sequence to promote secretion along
with myc/His tags at the carboxy terminus of alkaline
phosphatase.
6 BPC1.HINDIII PRIMER: GTGTAAGCTTCCACCAAGAAAGGA- ACAGAA BPC1.BAMHI
PRIMER: CACAGGATCCCTTACCAGGTGTGAAATTG
[0232] To detect whether BPC-1 binds with a cell surface receptor
on prostate cancer cells, several prostate cancer cell lines and
xenograft tissues are incubated with the BPC-1-AP fusion protein as
described (Cheng and Flanagan, 1994, Cell 79:157-168). After
washing the cells and adding the AP substrate BCIP, which forms an
insoluble blue precipitate upon dephosphorylation, BPC-1 receptor
binding is determined by identifying cells staining blue under the
light microscope. Various cancer cell lines can be examined,
including without limitation, various prostate cancer cell lines
(e.g., LNCaP, PC-3, DU145, TSUPR, LAPC4) and bladder carcinoma cell
lines. Other cell lines such as PREC prostate cell line, 293T, and
NIH 3T3, etc. may also be examined. Additionally, the LAPC and
other prostate cancer xenografts may be tested.
[0233] Equilibrium dissociation rate constants may be calculated to
evaluate the strength of the binding interaction. In addition, the
number of cell surface receptors per cell can be determined. Cell
lines or tissues with the highest binding capacity for BPC-1 would
be preferred for cloning the BPC-1 receptor or other binding
partner.
[0234] The BPC-1-AP fusion protein was detected in the conditioned
media of 293T cells transfected with the above construct by Western
blot analysis. Western blot analysis using anti-alkaline
phosphatase and anti-HIS antibodies detects the BPC-1-AP fusion
protein running at approximately 90 kDa (FIG. 14).
[0235] Conditioned media containing this fusion protein was used to
detect a 45 kDa binding partner for BPC-1 (FIG. 15), as follows. A
western blot procedure was used to identify a 45 kDa receptor
interacting with BPC-1. Lysates from brain, testis, prostate, the
xenografts LAPC4AD and LAPC9AD, and the cell lines 3T3, LAPC4,
LNCaP, and PC-3 were used to generate two duplicate western blots.
After blocking in 5% milk in PBS for 1 hr and washing twice with
PBS-Tween for 7 minutes each, the blots were incubated with
conditioned media from a 293T cell line producing only secreted
alkaline phosphatase and with media containing BPC-1-AP fusion
protein (see FIG. 14). Following 3 washes with PBS-Tween, the blot
was developed using chemiluminescent alkaline phosphatase substrate
(Immune-Star, BioRad, cat 170-5010). The results are shown in FIG.
15. The arrow (FIG. 15) shows BPC-1-AP binding to a 45 kDa protein
in 3T3, LAPC9AD, LNCaP, PC-3, and to a lesser extent in LAPC4AD and
the LAPC-4 cell line. The 45 kDa protein is not detected in brain,
testis or prostate. The protein interaction is due to BPC-1 and not
AP since the blot shown in FIG. 15 (which was incubated with AP
conditioned media) did not detect binding the 45 kDa protein.
Example 16
[0236] Identification of Potential Signal Transduction Pathways
[0237] To determine whether BPC-1 directly or indirectly activates
known signal transduction pathways in cells, luciferase (luc) based
transcriptional reporter assays are carried out in cells expressing
BPC-1 or exposed to exogenously added BPC-1. These transcriptional
reporters contain consensus binding sites for known transcription
factors which lie downstream of well characterized signal
transduction pathways. The reporters and examples of there
associated transcription factors, signal transduction pathways, and
activation stimuli are listed below.
[0238] 1. NFkB-luc, NFkB/Rel; Ik-kinase/SAPK;
growth/apoptosis/stress
[0239] 2. SRE-luc, SRF/TCF/ELK1; MAPK/SAPK;
growth/differentiation
[0240] 3. AP-1-luc, FOS/JUN; MAPK/SAPK/PKC;
growth/apoptosis/stress
[0241] 4. ARE-luc, androgen receptor; steroids/MAPK;
growth/differentiation/apoptosis
[0242] 5. p53-luc, p53; SAPK; growth/differentiation/apoptosis
[0243] 6. CRE-luc, CREB/ATF2; PKA/p38;growth/apoptosis/stress
[0244] Cells to be assayed for BPC-1-mediated effects include
LAPC4, LNCaP, PC3, and NIH3T3. The luciferase reporter plasmids may
be introduced by lipid mediated transfection (TFX-50, Promega).
Luciferase activity, an indicator of relative transcriptional
activity, is measured by incubation of cells extracts with
luciferin substrate and luminescence of the reaction is monitored
in a luminometer.
Example 17
[0245] In Vitro Assays of BPC-1 Function
[0246] A. Cell Invasion/Migration/Chemoattraction Assay
[0247] Cell lines expressing BPC-1 may be assayed for alteration of
invasive and migratory properties by measuring passage of cells
through a matrigel coated porous membrane chamber (Becton
Dickinson). Passage of cells through the membrane to the opposite
side is monitored using a fluorescent assay (Becton Dickinson
Technical Bulletin #428) using calcein-Am (Molecular Probes) loaded
indicator cells. Cell lines analyzed include parental and BPC-1
overexpressing PC3, 3T3 and LNCaP cells. To assay whether BPC-1 has
chemoattractant properties, parental indicator cells are monitored
for passage through the porous membrane toward a gradient of BPC-1
conditioned media compared to control media.
[0248] This assay may also be used to qualify and quantify specific
neutralization of the BPC-1 induced effect by candidate cancer
therapeutic compositions.
[0249] B. Cell Growth Assay
[0250] To determine whether BPC-1 alters the growth rate of
established prostate and non-prostate cell lines, growth curves are
generated comparing parental cells transduced with a control
retroviral vector to cells transduced with a retrovirus encoding
the BPC-1 gene. Cell lines to assay include LNCaP, PC3, TsuPR
prostate cell lines and murine NIH3T3 fibroblasts and various other
human non-prostate cell lines. In addition, the growth rate of
parental cells is assayed in the presence and absence of
exogenously added purified MYC-HIS BPC-1. As an alternative source
of exogenous BPC-1, conditioned media from the respective BPC-1
retrovirally transduced cell line can be used. Growth of the cell
lines is monitored in a 96 well format MTT colorimetric assay
(Raitano and Korc, 1990, J. Biol. Chem. 265:10466-10472).
Example 18
[0251] In Vivo Models for Studying BPC-1 and Testing Prostate
Cancer Therapeutic Compositions
[0252] A. Determination of Serum BPC-1 Levels in Mice Bearing
Xenogenic Tumors
[0253] LNCaP prostate cancer cells and LAPC-4 AD xenograft cells
express high levels of BPC-1 as determined by Northern blot
analysis. To evaluate BPC-1 as a serum diagnostic marker, SCID mice
are injected SQ or orthotopically with either 1.times.10.sup.6
LNCaP or LAPC-4 AD cells. Mice are injected on each flank and tumor
growth is monitored by caliper measurements to reflect
length.times.width.times.height (L.times.W.times.H). The mice are
bled at the initial appearance of palpable tumors and every week
thereafter until tumors are 1,000 mm.sup.3 in size. Serial bleeds
are screened for the presence of BPC-1 by an ELISA assay as
described above. As a control, serum from the tumor-bearing mice is
assessed for the secretion of PSA using a specific ELISA kit. To
confirm BPC-1 expression, tumors are harvested from the mice and
screened for BPC-1 expression by Western blot.
[0254] In addition, the 5637 bladder cancer cell line has been
shown to express BPC-1 by Northern blot analysis. To evaluate
bladder cancer BPC-1 expression, 5637 bladder tumor xenografts are
established in SCID mice and serum collected and evaluated for
BPC-1 protein by ELISA as described.
[0255] Alternatively, prostate cancer cell lines that do not
express endogenous BPC-1 and engineered to overexpress BPC-1 may be
injected into SCID mice to confirm BPC-1 secretion. These include
PC-3, TSUPR1, and DU145. Individual mice are injected SQ with
either 1.times.10.sup.6 PC3, TSUPR1, and DU145 cells expressing an
empty tkNeo vector (tkNeo) or a vector containing BPC-1. All mice
are injected on each flank and tumor growth is monitored by caliper
measurements as described above. The mice are bled at the initial
appearance of palpable tumors and every week thereafter until
tumors are 1,000 mm in size. Differences in tumor growth rate, if
apparent, are noted and studied further (see below). Serial bleeds
may be screened for the presence of BPC-1 by an ELISA assay. To
confirm BPC-1 expression, tumors may be harvested from the mice and
screened for BPC-1 expression by Western blots.
[0256] B. In Vivo Assay for BPC-1 Tumor Growth Promotion
[0257] The effect of the BPC-1 protein on tumor cell growth may be
evaluated in vivo either by gene overexpression or addition of
soluble, purified BPC-1 protein to tumor-bearing mice. In the first
example, SCID mice are injected SQ on each flank with
1.times.10.sup.6 of either PC3, TSUPR1, or DU145 cells containing
tkNeo empty vector or BPC-1. At least two strategies may be used:
(1) Constitutive BPC-1 expression under regulation of an LTR
promoter, and (2) Regulated expression under control of the
ecdysone-inducible vector system. Tumor volume is then monitored at
the appearance of palpable tumors and followed over time to
determine if BPC-1 expressing cells grow at a faster rate.
Additionally, mice may be implanted with 1.times.10.sup.5 of the
same cells orthotopically to determine if BPC-1 has an effect on
local growth in the prostate or on the ability of the cells to
metastasize, specifically to lungs, lymph nodes, and bone
marrow.
[0258] In the second example, purified BPC-1 protein is be
evaluated for an effect on tumor cell growth in vivo. Mice are
first divided into groups injected SQ with either 1.times.10.sup.6
LNCaP or LAPC-4 AD cells, which express BPC-1, or PC3 cells, which
do not express BPC-1. On the same day as tumor cells are injected,
groups are injected IV with a range of purified BPC-1 protein (for
example 100, 500, or 1,000 .mu.g). As a control, one group of each
tumor type is injected with PBS only. Injections continue 2 times
per week for 4 consecutive weeks until tumors grow and reach a size
of 1,000 mm.sup.3. Tumor volume is followed to determine if BPC-1
has a dose response effect on tumor growth.
[0259] In a separate set of experiments to determine if BPC-1
accelerates tumor growth, LNCaP, LAPC-4 AD, and PC3 tumors may be
allowed to establish SQ to a size of 100 mm.sup.3, at which time
purified BPC-1 protein is injected IV in the doses and regimen
indicated above. To determine if BPC-1 promotes metastasis, the
same tumors may also be implanted orthotopically, and after tumors
have been established (determined by circulating PSA levels)
purified BPC-1 can be administered as described and metastatic
growth evaluated.
[0260] The above assays are also useful to determine the BPC-1
inhibitory effect of candidate therapeutic compositions, such as
for example, BPC-1 antibodies and intrabodies, BPC-1 mRNA antisense
molecules and ribozymes, and BPC-1 receptor compositions.
[0261] C. In Vivo BPC-1 Antibody Tumor Inhibition Assay
[0262] To study the effect of BPC-1 specific mAbs on the formation
and growth of tumors, mice are divided in groups of either BPC-1
positive LNCaP, LAPC-4 AD, and PC3-BPC-1 tumors, or PC3-tkNeo,
which does not express BPC-1. To evaluate an effect on tumor
formation, mice are injected with 1.times.10.sup.6 tumor cells SQ
and on the same day are injected IP with a range of BPC-1 specific
mAb or control Ig (for example, 100, 500, or 1,000 .mu.g).
Injections of mAbs continue 2 times per week for 4 consecutive
weeks. Tumor growth is followed as described above. Alternatively,
to evaluate an effect on established tumors, mice are divided into
groups bearing established tumors 100 mm.sup.3 in size and are
injected IP with mAbs according to the doses and regimen described
previously. Tumor volume is followed to determine the mAb's effect
on growth of established tumors.
[0263] To study effect on metastasis, 1.times.10.sup.5 of LAPC-4 AD
cells are injected orthotopically into SCID mice. At the same time
the mice are injected IP with a range of anti-BPC-1 mAb or control
Ig as described above. Tumor growth is followed by weekly
determinations of circulating PSA. At the end of the antibody
administration, the mice are sacrificed and local tumor growth and
metastasis to lungs, lymph nodes, and bone marrow are evaluated. To
examine an effect on mice with established tumors, LAPC-4 AD are
injected orthotopically and PSA levels are followed weekly. When
PSA reaches measurable levels, the mice are injected with the same
dose and regimen of mAbs described. The mice are sacrificed after
the completion of antibody injections to evaluate local tumor
growth as well as metastasis.
Example 19
[0264] Molecular Cloning of the BPC-1 Receptor or Binding
Partner
[0265] Expression cloning strategies such as described in Tartaglia
et al., 1995, Cell 83: 1263-1271 and Cheng and Flanagan, 1994, Cell
79:157-168 and others may be used to clone the receptor for BPC-1.
An expression library is first constructed from cells showing
BPC-1-AP binding. The library may be constructed in pools of
approximately 1000 clones and then screened by a sib selection
procedure. Transient transfection of COS cells with DNA from each
pool and subsequent screening with BPC-1-AP binding, washing, and
staining for AP activity identifies cells binding BPC-1 and
consequently expression of BPC-1 receptor. After successive rounds
of pool subdivision and screening, single colonies binding to
BPC-1-AP can be identified.
[0266] An alternative approach to cloning BPC-1 receptor/binding
partner genes utilizes expression cloning in phage (Stone J. in
Current Protocols in Molecular Biology (1997): 20.3.1-20.3.9). For
example, a LAPC-9 AD phage expression library in Lambda Zap Express
(Stratagene) may be used. Membrane lifts can be probed using
BPC-1-AP and positive clones detected with an alkaline phosphatase
chemiluminescent reagent (e.g., BioRad). Plaques binding BPC-1-AP
and producing a blue precipitates are selected and plasmids
isolated and evaluated for the receptor/binding partner sequences.
This approach may also result in the identification of cytoplasmic
or secreted proteins interacting with BPC-1.
[0267] Throughout this application, various publications are
referenced within parentheses. The disclosures of these
publications are hereby incorporated by reference herein in their
entireties.
[0268] The present invention is not to be limited in scope by the
embodiments disclosed herein, which are intended as single
illustrations of individual aspects of the invention, and any which
are functionally equivalent are within the scope of the invention.
Various modifications to the models and methods of the invention,
in addition to those described herein, will become apparent to
those skilled in the art from the foregoing description and
teachings, and are similarly intended to fall within the scope of
the invention. Such modifications or other embodiments can be
practiced without departing from the true scope and spirit of the
invention.
Sequence CWU 1
1
20 1 2639 DNA Homo sapiens 1 cagccccggg gcgccggccg cgcgcagcct
cgctatccca cccaggctcc gggcttccag 60 gagggtcgcg gagccccaag
ccatgactaa ggagcccatt tgatagcaga ggtggcgcgc 120 agcccggcga
gccgatgacg gaccccttct tcctgccttc aatgcctcag cggaagatcc 180
ccaagggctg gagcgaggag cgctgccgct ggacatcctc ccggggaggc tgctccgacc
240 tgctgcgcgg cgcgtctgag actggggact gagccactcc gccgccgccg
gcgccgccgc 300 cgccgcccgc tccgtcgctg ccgtcggtct ggactggccc
ccacctcgct gcgccctctc 360 cccggccccg gccccggctc ggggcgtccc
ggggctcgcc ctgcgaccgc cgcctcccgc 420 gcgccgcgtc ctcccgaccc
cgcggcggcg acgatgcccg ggaggagggt cctgacggcg 480 gcggcgcgga
tggtggcggc cggcgcccgg gtgtgatgcg agcgtcacgg tggggatgct 540
gctggctgcg cggcgctgag ggccagcgag agcgagagcc cgcccggggc ggaggacgga
600 ctcatccgga tctggctgca gcgtgggctc ggagctcccc cttcctctcg
gtctccctct 660 cggcccccct ttatttcctt cttgctttgc gtctttaaca
cctctcgacc ctgtcctccc 720 cccgccactg gaagtcttcc cgtctctaaa
tggaattagt ggagcccgga gcctctggtg 780 taacgcacag acatgatcca
tgggcgcagc gtgcttcaca ttgtagcaag tttaatcatc 840 ctccatttgt
ctggggcaac caagaaagga acagaaaagc aaaccacctc agaaacacag 900
aagtcagtgc agtgtggaac ttggacaaaa catgcagagg gaggtatctt tacctctccc
960 aactatccca gcaagtatcc ccctgaccgg gaatgcatct acatcataga
agccgctcca 1020 agacagtgca ttgaacttta ctttgatgaa aagtactcta
ttgaaccgtc ttgggagtgc 1080 aaatttgatc atattgaagt tcgagatgga
ccttttggct tttctccaat aattggacgt 1140 ttctgtggac aacaaaatcc
acctgtcata aaatccagtg gaagatttct atggattaaa 1200 ttttttgctg
atggagagct ggaatctatg ggattttcag ctcgatacaa tttcacacct 1260
ggtaagtaag tacttaaaaa aaaaatttct ttttcttcct catttttcta tcttcatagt
1320 acaaaatctt gtgtaagaca acattatact ttctcagaga atgttccagt
tctatttaaa 1380 accaaatcta cagtgctttt tcttttccct acacaaattc
tgaaaggaaa agatgttttc 1440 cttaaaacag cctatactag aggtaaagag
tagtgactca aggctctaaa tgggcatcag 1500 ccacatcatc aagtggactt
ttgttatgat ggaatgtgta attggagaga cagtctgtga 1560 taaggaaact
atacatagga gctgaataaa cttgaaaaga caattgtagt attataaaat 1620
atatccacca aaatgatctt tggggaactt gaatcaaaag tttatttgtt ctgaaaatta
1680 ccgtgtttca atcaaataga tcctacttta ggaagtagtc tgctctcttt
tcaggaaagc 1740 aaattcttaa gagttttgat gaaaggaaaa ctgagacctg
taacagccaa atactcattt 1800 acaaggtctt gcagaaattg tgtgcaatta
tcaaattatg caatctgtat caattttcct 1860 tttaactcgc tagaattaaa
aagatcctgt gttgttgcct ggcccacttg attaagagtt 1920 accattcatt
acaataaaaa taggttatca cattttttca ctgcaagaac actacatgca 1980
ttaatttaaa tggaaaaatg attcaaatta cataaagccc attttttata tagtttgttt
2040 tcagtttgta tgtattgttt tatttaagtt aggcaatagc ataatttcaa
atatatgtaa 2100 agttggttga agtttgtatt ccatgttaaa gaagtaacat
ctaaatacag ctttgatact 2160 cagttaaaaa actaaaattt taaaaattat
taatataagt ttaatgatga ctttcattat 2220 gacatcatgg ggtatgttaa
atcaagtatt tactgtagca tatatattag ctttaagcat 2280 taggaatgtt
tttaataata tcactaaagg attgtggttt taattatgct ttgctgataa 2340
tggattactc acagaaatca tgggtatttc atgtgctaca gtcgaactaa tttgaagtat
2400 tcccaaaagg tacaaatgtt agcttaattt gtttgttcag attattagtg
ctagagttgt 2460 aaatggaaag gtaggtattt ttttcttaac tgataatttt
gaatataacc tgtacctaga 2520 gacagtgaca tacggcatgt tctaggtttc
ataagttata ttttcattct gggtttggtg 2580 atcatgaaaa taatgtcttg
gatttaaaat tgtggtttca caaaaaaaaa aaaaaaaaa 2639 2 158 PRT Homo
sapiens 2 Met Ile His Gly Arg Ser Val Leu His Ile Val Ala Ser Leu
Ile Ile 1 5 10 15 Leu His Leu Ser Gly Ala Thr Lys Lys Gly Thr Glu
Lys Gln Thr Thr 20 25 30 Ser Glu Thr Gln Lys Ser Val Gln Cys Gly
Thr Trp Thr Lys His Ala 35 40 45 Glu Gly Gly Ile Phe Thr Ser Pro
Asn Tyr Pro Ser Lys Tyr Pro Pro 50 55 60 Asp Arg Glu Cys Ile Tyr
Ile Ile Glu Ala Ala Pro Arg Gln Cys Ile 65 70 75 80 Glu Leu Tyr Phe
Asp Glu Lys Tyr Ser Ile Glu Pro Ser Trp Glu Cys 85 90 95 Lys Phe
Asp His Ile Glu Val Arg Asp Gly Pro Phe Gly Phe Ser Pro 100 105 110
Ile Ile Gly Arg Phe Cys Gly Gln Gln Asn Pro Pro Val Ile Lys Ser 115
120 125 Ser Gly Arg Phe Leu Trp Ile Lys Phe Phe Ala Asp Gly Glu Leu
Glu 130 135 140 Ser Met Gly Phe Ser Ala Arg Tyr Asn Phe Thr Pro Gly
Lys 145 150 155 3 115 PRT Caenorhabditis elegans 3 Ile Phe Thr Ser
Pro Asn Phe Pro Asp Arg Tyr Pro Pro Asn Ile Asp 1 5 10 15 Cys Val
Arg Val Ile His Ser Arg Pro Gln His Asp Val Val Val Lys 20 25 30
Phe His His Val Phe His Ile Glu Ser Thr Tyr Asp Lys Ile Asp Ala 35
40 45 Gly Glu Glu Cys Pro Asn Asp Phe Ile Glu Phe Arg Asp Gly Arg
Tyr 50 55 60 Gly Phe Ser Pro Leu Ile Ala Arg Phe Cys Gly Asp Arg
Met Pro Lys 65 70 75 80 Arg Glu Ile Arg Ala Val Ser Gly Phe Leu Trp
Ile Arg Phe Arg Ser 85 90 95 Asp Ser Met Leu Glu Tyr Gln Gly Phe
Ser Ala Glu Tyr Ala Ile Val 100 105 110 Pro Ser Lys 115 4 101 PRT
Mouse 4 Gly Asn Phe Ser Ser Pro Glu Tyr Pro Asn Gly Tyr Ser Ala His
Met 1 5 10 15 His Cys Val Trp Arg Ile Ser Val Thr Pro Gly Glu Lys
Ile Ile Leu 20 25 30 Asn Phe Thr Ser Met Asp Leu Tyr Arg Ser Arg
Leu Cys Trp Tyr Asp 35 40 45 Tyr Val Glu Val Arg Asp Gly Phe Trp
Arg Lys Val Trp Val Arg Gly 50 55 60 Arg Phe Cys Gly Gly Lys Leu
Pro Glu Pro Ile Val Ser Thr Asp Ser 65 70 75 80 Arg Leu Trp Val Glu
Phe Arg Ser Ser Ser Asn Trp Val Gly Lys Gly 85 90 95 Phe Phe Ala
Val Tyr 100 5 103 PRT Mouse 5 Asp Asn Gly His Ile Gln Ser Pro Asn
Tyr Pro Asp Asp Tyr Arg Pro 1 5 10 15 Ser Lys Val Cys Ile Trp Arg
Ile Gln Val Ser Glu Gly Phe His Val 20 25 30 Gly Leu Thr Phe Gln
Ser Phe Glu Ile Glu Arg His Asp Ser Cys Ala 35 40 45 Tyr Asp Tyr
Leu Glu Val Arg Asp Gly His Ser Glu Ser Ser Asn Leu 50 55 60 Ile
Gly Arg Tyr Cys Gly Tyr Glu Asn Pro Asp Asp Ile Lys Ser Thr 65 70
75 80 Ser Ser Arg Leu Trp Leu Lys Phe Val Ser Asp Gly Ser Ile Asn
Lys 85 90 95 Ala Gly Phe Ala Val Asn Phe 100 6 101 PRT Mouse 6 Gly
Ser Ile Thr Ser Pro Gly Trp Pro Lys Glu Tyr Pro Pro Asn Lys 1 5 10
15 Asn Cys Ile Trp Gln Leu Val Ala Pro Thr Gln Tyr Arg Ile Ser Leu
20 25 30 Gln Phe Asp Phe Phe Glu Thr Glu Gly Asn Asp Val Cys Lys
Tyr Asp 35 40 45 Phe Val Glu Val Arg Ser Gly Leu Thr Ala Asp Ser
Lys Leu His Gly 50 55 60 Lys Phe Cys Gly Ser Glu Lys Pro Glu Val
Ile Thr Ser Gln Tyr Asn 65 70 75 80 Asn Met Arg Val Glu Phe Lys Ser
Asp Asn Thr Val Ser Lys Lys Gly 85 90 95 Phe Lys Ala His Phe 100 7
102 PRT Mouse 7 Gly Thr Ile Thr Ser Pro Asn Trp Pro Asp Lys Tyr Pro
Ser Lys Lys 1 5 10 15 Glu Cys Thr Trp Ala Ile Ser Ser Thr Pro Gly
His Arg Val Lys Leu 20 25 30 Thr Phe Val Glu Met Asp Ile Glu Ser
Gln Pro Glu Cys Ala Tyr Asp 35 40 45 His Leu Glu Val Phe Asp Gly
Arg Asp Ala Lys Ala Pro Val Leu Gly 50 55 60 Arg Phe Cys Gly Ser
Lys Lys Pro Glu Pro Val Leu Ala Thr Gly Asn 65 70 75 80 Arg Met Phe
Leu Arg Phe Tyr Ser Asp Asn Ser Val Gln Arg Lys Gly 85 90 95 Phe
Gln Ala Ser His Ser 100 8 95 PRT Mouse 8 Asn Asn Tyr Pro Gly Gly
Val Asp Cys Glu Trp Val Ile Val Ala Glu 1 5 10 15 Glu Gly Tyr Gly
Val Glu Leu Val Phe Gln Thr Phe Glu Val Glu Glu 20 25 30 Glu Thr
Asp Cys Gly Tyr Asp Tyr Ile Glu Leu Phe Asp Gly Tyr Asp 35 40 45
Ser Thr Ala Pro Arg Leu Gly Arg Tyr Cys Gly Ser Gly Pro Pro Glu 50
55 60 Glu Val Tyr Ser Ala Gly Asp Ser Val Leu Val Lys Phe His Ser
Asp 65 70 75 80 Asp Thr Ile Ser Lys Lys Gly Phe His Leu Arg Tyr Thr
Ser Thr 85 90 95 9 14 DNA Artificial Sequence Description of
Artificial Sequence cDNA synthesis primer 9 ttttgatcaa gctt 14 10
42 DNA Artificial Sequence Description of Artificial Sequence DNA
Adaptor 1 10 ctaatacgac tcactatagg gctcgagcgg ccgcccgggc ag 42 11
40 DNA Artificial Sequence Description of Artificial Sequence DNA
Adaptor 2 11 gtaatacgac tcactatagg gcagcgtggt cgcggccgag 40 12 22
DNA Artificial Sequence Description of Artificial Sequence PCR
primer 1 12 ctaatacgac tcactatagg gc 22 13 22 DNA Artificial
Sequence Description of Artificial Sequence Nested primer (NP)1 13
tcgagcggcc gcccgggcag ga 22 14 20 DNA Artificial Sequence
Description of Artificial Sequence Nested primer (NP)2 14
agcgtggtcg cggccgagga 20 15 24 DNA Artificial Sequence Description
of Artificial Sequence RT-PCR primer 15 tgccgtatgt cactgtctct aggt
24 16 24 DNA Artificial Sequence Description of Artificial Sequence
RT-PCR primer 16 gaaatcatgg gtatttcatg tgct 24 17 26 DNA Artificial
Sequence Description of Artificial Sequence RT-PCR primer 17
ttgaattcca agcaaaccac ctcaga 26 18 28 DNA Artificial Sequence
Description of Artificial Sequence RT-PCR primer 18 aagctcgagt
cagacggttc aatagagt 28 19 30 DNA Artificial Sequence Description of
Artificial Sequence BPC1.HINDIII primer 19 gtgtaagctt ccaccaagaa
aggaacagaa 30 20 29 DNA Artificial Sequence Description of
Artificial Sequence BPC1.BAMHI primer 20 cacaggatcc cttaccaggt
gtgaaattg 29
* * * * *
References