U.S. patent application number 10/090887 was filed with the patent office on 2002-10-31 for embryonic stem cells.
Invention is credited to Bongso, Ariffeen, Fong, Chui-Yee, Pera, Martin Frederick, Reubinoff, Benjamin Eithan, Trounson, Alan Osborne.
Application Number | 20020160509 10/090887 |
Document ID | / |
Family ID | 25645915 |
Filed Date | 2002-10-31 |
United States Patent
Application |
20020160509 |
Kind Code |
A1 |
Reubinoff, Benjamin Eithan ;
et al. |
October 31, 2002 |
Embryonic stem cells
Abstract
The present invention relates to undifferentiated human
embryonic stem cells, methods of cultivation and propagation,
production of differentiated cells and in particular the production
of human embryonic stem cells capable of yielding somatic
differentiated cells in vitro, as well as committed progenitor
cells capable of giving rise to mature somatic cells and uses
thereof. The present invention also provides a purified preparation
of undifferentiated human embryonic stem cells capable of
proliferation in vitro. Furthermore, the present invention provides
a somatic cell differentiated in vitro from an undifferentiated
embryonic stem cell. There is also provided a committed progenitor
cell capable of giving rise to mature somatic cells.
Inventors: |
Reubinoff, Benjamin Eithan;
(Elsternwick, AU) ; Pera, Martin Frederick;
(Prahran, AU) ; Fong, Chui-Yee; (Singapore,
SG) ; Trounson, Alan Osborne; (Asburton, AU) ;
Bongso, Ariffeen; (Singapore, SG) |
Correspondence
Address: |
Scully, Scott, Murphy & Presser
400 Garden City Plaza
Garden City
NY
11530
US
|
Family ID: |
25645915 |
Appl. No.: |
10/090887 |
Filed: |
March 5, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10090887 |
Mar 5, 2002 |
|
|
|
09436164 |
Nov 9, 1999 |
|
|
|
Current U.S.
Class: |
435/366 |
Current CPC
Class: |
C12N 5/0606 20130101;
C12N 5/0652 20130101; A61K 35/12 20130101; C12N 2506/02 20130101;
C12N 2502/13 20130101 |
Class at
Publication: |
435/366 |
International
Class: |
C12N 005/08 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 9, 1998 |
AU |
PP7009 |
Sep 15, 1999 |
AU |
PQ2852 |
Claims
1. A purified preparation of human undifferentiated embryonic stem
cells capable of proliferation in vitro
2. A purified preparation of human embryonic stem cells according
to claim 1 capable of maintaining an undifferentiated state when
cultured under conditions which do not induce extra embryonic
differentiation and cell death.
3. A purified preparation of human embryonic stem cells according
to claim 2 wherein the condition includes cultivating the cells on
a fibroblast feeder layer.
4. A purified preparation of human embryonic stem cells according
to any one of claims 1 to 3 and capable of differentiation in vitro
under differentiating conditions.
5. A purified preparation of human embryonic stem cells according
to claim 4 wherein the stem cell is capable of differentiation into
a somatic cell selected from the group including a committed
progenitor cell capable of self renewal and further differentiation
into one or several types of mature cell, or a mature
differentiated cell.
6. An undifferentiated human embryonic stem cell wherein the cell
is immunoreactive with markers for human pluripotent stem cells
including SSEA-4, GCTM-2 antigen, and TRA 1-60.
7. An undifferentiated human embryonic stem cell according to claim
6 wherein the cell expresses Oct-4.
8. A method of preparing undifferentiated human embryonic stem
cells, said method including: obtaining an in vitro fertilised
human embryo and growing the embryo to a blastocyst stage of
development; removing inner cells mass (ICM) cells from the embryo;
culturing ICM cells under conditions which do not induce
extraembryonic differentiation and cell death; and promote
proliferation of undifferentiated stem cells; and recovering stem
cells.
9. A method of preparing undifferentiated human embryonic stem
cells, said method including: obtaining an in vitro fertilised
human embryo and growing the embryo to a blastocyst stage of
development; removing inner cell mass (ICM) cells from the embryo;
culturing ICM cells on a fibroblast feeder layer to obtain
proliferation of undifferentiated stem cells; and recovering stem
cells from the feeder layer.
10. A method according to claim 9 wherein the fibroblast feeder
layer is a mouse and/or human fibroblast feeder layer.
11. A method according to claim 10 wherein the fibroblast feeder
layer comprises embryonic fibroblasts.
12. A method according to any one of claims 9 to 11 wherein the
fibroblasts are tested for their ability to promote embryonic stem
cell growth and to limit extraembryonic differentiation.
13. A method according to claim 12 wherein the fibroblast cell
strain is highly suitable for the promotion of embryonic stem cell
growth and the inhibition of extraembryonic differentiation.
14. A method according to claim 13 wherein the fibroblast cell
strain is derived from the inbred mouse strains 129/Sv, CBA or the
cross of 129/Sv and C57/BI6.
15. A method according to any one of the claims 7 to 14 wherein the
fibroblast express recombinant membrane bound factors essential for
human pluripotent stem cell renewal including human multipotent
stem cell factor.
16. A method according to any one of claims 8 to 15 further
including a preliminary treatment prior to removal of ICM cells,
said treatment including: treating the embryo to dislodge the
trophectoderm of the embryo or a portion thereof; washing the
embryo with a G2.2 or S2 (Scandinavian-2) medium to dislodge the
trophectoderm or a portion thereof; and obtaining inner cell mass
cells of the embryo.
17. A method according to any one of claims 8 to 16 further
including the steps of: replating the stem cells from the
fibroblast feeder layer onto another fibroblast feeder layer; and
culturing the stem cells for a period sufficient to obtain
proliferation of morphologically undifferentiated stem cells.
18. An undifferentiated cell produced by the method according to
any one of claims 8 to 17.
19. A method according to any one of claims 8 to 17 further
including the step of growing cells under culture conditions that
induce somatic differentiation, and wherein said conditions do not
permit continued stem cell renewal but do not kill stem cells or
induce their unidirectional differentiation into extraembryonic
lineages.
20. A method according to claim 19 wherein the condition includes
prolonged cultivation of the undifferentiated stem cells on a
differentiation inducing fibroblast feeder layer to induce a
differentiated somatic lineage or multiple somatic lineage.
21. A method according to claim 20 wherein the differentiation
inducing fibroblast feeder layer is a mouse and/or human fibroblast
feeder layer.
22. A method accordin to claim 20 or 21 wherein the fibroblast
feeder layer comprises embryonic fibroblasts.
23. A method according to any one of claims 20 to 22 wherein the
fibroblasts are tested for their ability to promote embryonic stem
cell growth and to limit extraembryonic differentiation.
24. A method according to any one of claims 19 to 23 wherein the
embryonic fibroblasts are prepared and tested for their ability to
allow somatic differentiation of embryonic stem cells.
25. A method according to any one of claims 19 to 24 wherein the
culture condition includes cultivating the cells for prolonged
periods and/or at high density in the presence of a differentiation
inducing fibroblast feeder layer to induce somatic
differentiation.
26. A method for the isolation of committed progenitor cells from a
culture of differentiated cells said method comprising: preparing a
culture of differentiated cells according to any one of claims 19
to 25; and isolating committed progenitor cells from the
culture.
27. A differentiated cell produced by the method according to any
one of claims 19 to 26.
28. A differentiated cell according to claim 27 which is a somatic
cell selected from the group including a committed progenitor cell
capable of self renewal or differentiation into one or several
somatic lineages, or a fully mature somatic differentiated
cell.
29. A cell line HES-1.
30. A-cell line HES-2.
31. A fibroblast cell strain which is highly suitable for the
promotion of embryonic stem cell growth and the inhibition of
extraembryonic differentiation.
32. A fibroblast cell strain according to claim 31 derived from the
inbred mouse strains 129/Sv, CBA or the cross of 129/Sv and
C57/BI6.
33. A method of preserving a differentiated or undifferentiated
cell wherein the cells undergo vitrification.
34. A method according to claim 33 wherein the vitrification is
Open Pulled Straw (OPS) vitrification.
35. A method of preventing and treating a congenital disease, said
method including: obtaining an undifferentiated stem cell according
to claim 18; introducing a genetic modification to the congenital
disease; and inducing differentiation to a somatic cell line
capable of transplantation to a patient in need.
36. A human embryonic stem cell line as hereinbefore described with
reference to the examples.
Description
[0001] The present invention relates to undifferentiated human
embryonic stem cells, methods of cultivation and propagation,
production of differentiated cells and in particular the production
of human ES capable of yielding somatic differentiated cells in
vitro, as well as committed progenitor cells capable of giving rise
to mature somatic cells and uses thereof.
[0002] The production of human embryonic stem cells which can be
either maintained in an undifferentiated state or directed to
undergo differentiation into extraembryonic or somatic lineages in
vitro allows for the study of the cellular and molecular biology of
early human development, functional genomics, generation of
differentiated cells from the stem cells for use in transplantation
or drug screening and drug discovery in vitro.
[0003] In general, stem cells are undifferentiated cells which can
give rise to a succession of mature functional cells. For example,
a haematopoietic stem cell may give rise to any of the different
types of terminally differentiated blood cells. Embryonic stem (ES)
cells are derived from the embryo and are pluripotent, thus
possessing the capability of developing into any organ, cell type
or tissue type or, at least potentially, into a complete
embryo.
[0004] The development of mouse ES cells in 1981 (Evans and
Kaufman, 1981; Martin, 1981) provided the paradigm, and, much of
the technology, for the development of human ES cells. Development
of ES cells evolved out of work on mouse teratocarcinomas, (tumours
arising in the gonads of a few inbred strains), which consist of a
remarkable array of somatic tissues juxtaposed together in a
disorganised fashion. Classical work on teratocarcinomas
established their origins from germ cells in mice, and provided the
concept of a stem cell (the embryonal carcinoma or EC cell) which
could give rise to the multiple types of tissue found in the
tumours (Kleinsmith and Pierce, 1964; review, Stevens, 1983). The
field of teratocarcinoma research (review, Martin, 1980) expanded
considerably in the 70's, as the remarkable developmental capacity
of the EC stem cell became apparent following the generation of
chimaeric mice by blastocyst injection of EC cells, and
investigators began to realise the potential value of cultured cell
lines from the tumours as models for mammalian development. EC
cells however had limitations: they often contained chromosomal
abnormalities, and their ability to differentiate into multiple
tissue types was often limited.
[0005] Since teratocarcinomas could also be induced by grafting
blastocysts to ectopic sites, it was reasoned that it might be
possible to derive pluripotential cell lines directly from
blastocysts rather than from tumours, as performed in 1981 by Gail
Martin and Martin Evans independently. The result was a stable
diploid cell line which could generate every tissue of the adult
body, including germ cells. Teratocarcinomas also develop
spontaneously from primordial germ cells in some mouse strains, or
following transplantation of primordial germ cells to ectopic
sites, and in 1992 Brigid Hogan and her colleagues reported the
direct derivation of EG cells from mouse primordial germ cells
(Matsui et al., 1992). These EG cells have a developmental capacity
very similar to ES cells.
[0006] Testicular teratocarcinomas occur spontaneously in humans,
and pluripotential cell lines were also developed from these
(review, Andrews, 1988). Two groups reported the derivation of
cloned cell lines from human teratocarcinoma which could
differentiate in vitro into neurons and other cell types (Andrews
et al., 1984, Thompson et al., 1984). Subsequently, cell lines were
developed which could differentiate into tissues representative of
all three embryonic germ layers (Pera et al., 1989). As analysis of
the properties of human EC cells proceeded, it became clear that
they were always aneuploid, usually (though not always) quite
limited in their capacity for spontaneous differentiation into
somatic tissue, and different in phenotype from mouse ES or EC
cells.
[0007] The properties of the pluripotent cell lines developed by
Pera et al. (1989) are as follows:
[0008] Express SSEA-3,SSEA-4, TRA 1-60, GCTM-2, alkaline
phosphatase, Oct-4
[0009] Grow as flat colonies with distinct cell borders
[0010] Differentiate into derivatives of all three embryonic germ
layers
[0011] Feeder cell dependent; feeder cell effect on growth not
reconstituted by conditioned medium from feeder cells or by feeder
cell extracellular matrix
[0012] Highly sensitive to dissociation to single cells, poor
cloning efficiency even on a feeder cell layer
[0013] Do not respond to Leukemia Inhibitoy Factor
[0014] These studies of human EC cells essentially defined the
phenotype of primate pluripotential stem cells.
[0015] Derivation of primate ES cells from the rhesus monkey
blastocyst and later from that of the marmoset (Thomson et al.,
1995, 1996)has been described. These primate cell lines were
diploid, but otherwise they closely resembled their nearest
counterpart, the human EC cell. The implication of the monkey work
and the work on human EC cells was that a pluripotent stem cell,
which would be rather different in phenotype from a mouse ES cell,
could likely be derived from a human blastocyst.
[0016] Bongso and coworkers (1994) reported the short term culture
and maintenance of cells from human embryos fertilised in vitro.
The cells isolated, by Bongso and coworkers had the morphology
expected of pluripotent stem cells, but these early studies did not
employ feeder cell support, and it was impossible to achieve long
term maintenance of the cultures.
[0017] James Thomson and coworkers (1998) derived ES cells from
surplus blastocysts donated by couples undergoing treatment for
infertility. The methodology used was not very different from that
used 17 years earlier to derive mouse ES stem cells: the
trophectoderm, thought to be inhibitory to ES cell establishment,
was removed by immunosurgery, the inner cell mass was plated on to
a mouse embryonic fibroblast feeder cell layer, and following a
brief period of attachment and expansion, the resulting outgrowth
was disaggregated and replated onto another feeder cell layer.
There were no significant departures from mouse ES protocols in the
media or other aspects of the culture system and a relatively high
success rate was achieved. The phenotype of the cells was similar
to that outlined above in the human EC studies of Pera et al.
[0018] In the studies of Thomson et al. on monkey and human ES
cells, there was no evidence that the cells showed the capacity for
somatic differentiation in vitro. Evidence for in vitro
differentiation was limited to expression of markers characteristic
of trophoblast and endoderm formation (production of human
chorionic gonadotrophin and alphafoetoprotein); it is not possible
to state whether the cells found producing alphafetoprotein
represent extraembryonic (yolk sac) endoderm or definitive
(embryonic) endoderm though the former is far more likely. Thus an
essential feature for any human ES cell line to be of practical
use, namely the production of differentiated somatic cells in vitro
as seen in previous studies of human EC cells, was not demonstrated
in the monkey or human ES cell studies.
[0019] It is an object of the invention to overcome or at least
alleviate some of the problems of the prior art.
SUMMARY OF THE INVENTION
[0020] In one aspect of the present invention, there is provided a
purified preparation of undifferentiated human embryonic stem cells
capable of proliferation in vitro.
[0021] In another aspect, there is provided a somatic cell
differentiated in vitro from an undifferentiated embryonic stem
cell. There is also provided a committed progenitor cell capable of
giving rise to mature somatic cells.
[0022] Preferably the undifferentiated cells have the potential to
differentiate into extraembryonic and embryonic (somatic) lineages
when subjected to differentiating conditions.
[0023] More preferably, the undifferentiated cells are capable of
maintaining an undifferentiated state when cultured on a fibroblast
feeder layer.
[0024] In another aspect of the present invention there is provided
an undifferentiated human embryonic stem cell wherein the cell is
immunoreactive with markers for human pluripotent stem cells
including SSEA-4, GCTM-2 antigen, TRA 1-60. Preferably, the cells
express the transcription factor Oct-4 as demonstrated by RT-PCR.
More preferably, the cells maintain a diploid karyotype during
prolonged cultivation in vitro.
[0025] In a further aspect of the present invention, there is
provided a method of preparing undifferentiated human embryonic
stem cells, said method including:
[0026] obtaining an in vitro fertilised human embryo and growing
the embryo to a blastocyst stage of development;
[0027] removing inner cells mass (ICM) cells from the embryo;
[0028] culturing ICM cells under conditions which do not induce
extraembryonic differentiation and cell death; and promote
proliferation of undifferentiated cells; and
[0029] recovering stem cells.
[0030] In a further preferred aspect of the present invention there
is provided a method of preparing undifferentiated human embryonic
stem cells, said method including:
[0031] obtaining in vitro fertilised human embryo;
[0032] removing inner cell mass (ICM) cells from the embryo;
[0033] culturing ICM cells on a fibroblast feeder layer to obtain
proliferation of embryonic stem cells; and
[0034] recovering stem cells from the feeder layer.
[0035] In a preferred aspect of the invention the method further
includes the following steps before removal of inner cell mass
cells, said steps including:
[0036] treating the embryo to dislodge the trophectoderm of the
embryo or a portion thereof;
[0037] washing the embryo with an appropriate blastocysts culture
medium; for example G2 or S2 (Scandinavian-2 medium) to dislodge
the trophectoderm or a portion thereof; and
[0038] obtaining inner cell mass cells of the embryo.
[0039] Preferably, the treatment of the embryo includes treating
with an antibody or antiserum reactive with epitopes on the surface
of the trophectoderm. More preferably, the treatment with antibody
or antiserum is combined with treatment with complement. Most
preferably, the combined antibody and complement are either
anti-placental alkaline phosphatase antibody combined with Baby
Rabbit complement; or antihuman serum antibody combined with Guinea
Pig complement. The antibody and complement may be used together or
separately to treat the embryo to dislodge the trophectoderm or a
portion thereof.
[0040] In a further aspect of the invention, the method further
includes:
[0041] replacing the stem cells from the fibroblast feeder layer
onto another fibroblast feeder layer; and
[0042] culturing the stem cells for a period sufficient to obtain
proliferation of morphologically undifferentiated stem cells.
[0043] In an even further aspect of the invention the method
further includes propagating the undifferentiated stem cells. The
methods of propagation may initially involve removing clumps of
undifferentiated stem cells from colonies of cells. This is
preferably done by chemical or mechanical means. More preferably
the cells are treated chemically and washed in PBS or they are
mechanically severed from the colonies or a combination of the two
methods.
[0044] In another aspect of the invention there is provided a
method of induction of differentiation of stem cells. This method
involves cultivation under conditions which limit stem cell renewal
but do not result in stem cell death or unidirectional
differentiation into extraembryonic lineages such as extraembryonic
endoderm. The method also facilitates the derivation of committed
lineage progenitor cells which are no longer pluripotent but may
give rise to mature somatic cells. Preferably the method provides
for induction of somatic cells from embryonic stem cells.
[0045] In a further aspect of the invention, there is provided a
method of producing large quantities of differentiated and
undifferentiated cells.
[0046] In another aspect there is provided an undifferentiated cell
line produced by the method of the present invention.
[0047] Preferably, the undifferentiated cell line is preserved by
preservation methods such as cryopreservation. Preferably the
method of cryopreservation is a method highly efficient for use
with embryos such as vitrification. Most preferably, the method
includes the Open Pulled Straw (OPS) vitrification method.
FIGURES
[0048] FIG. 1 shows a colony of undifferentiated human ES cell line
HES-1.
[0049] FIG. 2 shows a colony from the same cell line which has
undergone differentiation.
[0050] FIG. 3 shows phase contrast micrographs of ES cells and
their differentiated progeny. A, inner cell mass three days after
plating. B, colony of ES cells. C, higher magnification of an area
of an ES cell colony. D, an area of an ES cell colony undergoing
spontaneous differentiation during routine passage. E, a colony
four days after plating in the absence of a feeder cell layer but
in the presence of 2000 units/ml human LIF undergoing
differentiation in its periphery,. F, neuronal cells in a high
density culture. Scale bars: A and C, 25 microns; 8 and E, 100
microns; D and F, 50 microns.
[0051] FIG. 4 shows marker expression in ES cells and their
differentiated somatic progeny. A, ES cell colony showing
histochemical staining for alkaline phosphatase. B, ES cell colony
stained with antibody MC-813-70 recognising the SSEA-4 epitope. C,
ES cell colony stained with antibody TRA1-60. D, ES cell colony
stained with antibody GCTM-2. E, high density culture, cell body
and processes of a cell stained with anti-neurofilament 68 kDa
protein. F, high density culture, cluster of cells and network of
processes emanating from them stained with antibody against neural
cell adhesion molecule. G, high density culture, cells showing
cytoplasmic filaments stained with antibody to muscle actin. H,
high density culture, cell showing cytoplasmic filaments stained
with antibody to desmin. Scale bars: A, 100 microns; B-D, and F,
200 microns; E, G and H, 50 microns.
[0052] FIG. 5 shows RT-PCR analysis of the expression of Oct-4 and
beta-actin in ES stem cells and high density cultures. 1.5% agarose
gel stained with ethidium bromide. Lane 1, DNA markers. Lane 2,
stem cell culture, beta actin. Lane 3, stem cell culture, Oct-4.
Lane 4, stem cell culture, PCR for Oct-4 carried out with omission
of reverse transcriptase. Lane 5, high density culture, beta actin.
Lane 6, high density culture, Oct-4. Lane 7, high density culture,
PCR for Oct-4 carried out with omission of reverse transcriptase.
Beta actin band is 200 bp and Oct-4 band is 320 bp.
[0053] FIG. 6 shows histology of differentiated elements found in
teratomas formed in the testis of SCID mice following inoculation
of HES-1 or HES-2 colonies. A, cartilage and squamous epithelium,
HES-2. B, neural rosettes, HES-2. C, ganglion, gland and striated
muscle, HES-1. D, bone and cartilage, HES-1. E, glandular
epithelium, HES-1. F, ciliated columnar epithelium, HES-1. Scale
bars: A-E, 100 microns; F, 50 microns.
[0054] FIG. 7 shows RT-PCR analysis of the expression of the
primitive neuroectodermal markers nestin and Pax-6 in neural
precursor cells isolated from differentiating cultures. Lane 1 100
bp marker; lane 2 beta actin, HX 142 neuroblastoma positive
control; lane 3 beta actin, neural progenitor sample one; lane 4
beta actin neural progenitor sample 2; lane 4 nestin HX 142; lane 5
nestin neural progenitor sample 1; lane 6 nestin but no RT, neural
progenitor sample 2; lane 7 nestin, neural progenitor sample 2;
lane 8, nestin but no RT, neural progenitor sample 2; lane 9 Pax-6
neural progenitor sample 1; lane 10 Pax-6 but no RT, neural
progenitor sample 1; lane 11 Pax-6 neural progenitor sample 2; lane
12 Pax-6 but no RT, neural progenitor sample 2.
[0055] FIG. 8 shows phase contrast appearance of spheres of ES
dervied neuronal progenitor cells and mature cells derived from
them, and indirect immunofluorescence detection of markers
characteristic of primitive neuroectoderm and mature neurons in
these cells. A, phase contrast appearance of a spherical structure
formed in serum-free medium after isolation of neural progenitor
cells from a culture of differentiating ES cells; B, polysialyated
N-CAM staining of such a sphere; C, Nestin staining of cells
growing out onto the monolayer from a sphere; D, phase contrast
morphology of an attached sphere with cells with elongated process
emanating from it; E, structure similar to that in D stained with
antibody to MAP-2ab; F, structure similar to that shown in D
stained with antibody to neurofilament 160 kda protein; G,
individual attached cells derived from a structure similar to that
shown in D stained with beta-tubulin. Scale bar: A, 100 micron; B,
100 micron; C, 100 micron; D, 50 micron; E, 50 micron; F, 200
micron; G, 25 micron.
DETAILED DESCRIPTION OF THE INVENTION
[0056] In one aspect of the present invention there is provided a
purified preparation of human undifferentiated embryonic stem cells
capable of proliferation in vitro.
[0057] Proliferation in vitro may include cultivation of the cells
for prolonged periods. The cells are substantially maintained in an
undifferentiated state. Preferably the cells are maintained under
conditions which do not induce cell death or extraembryonic
differentiation.
[0058] Preferably, they are capable of maintaining an
undifferentiated state when cultured on a fibroblast feeder layer
preferably under non-differentiating conditions. Preferably the
fibroblast feeder layer does not induce extraembryonic
differentiation.
[0059] More preferably the cells have the potential to
differentiate in vitro when subjected to differentiating
conditions. Most preferably the cells have the capacity to
differentiate in vitro into a wide array of somatic lineages.
[0060] The promotion of stem cells capable of being maintained in
an undifferentiated state in vitro on one hand, and which are
capable of differentiation in vitro into extraembryonic and somatic
lineages on the other hand, allows for the study of the cellular
and molecular biology of early human development, functional
genomics, generation of differentiated cells from the stem cells
for use in transplantation or drug screening and drug discovery in
vitro.
[0061] Once the cells are maintained in the undifferentiated state,
they may be differentiated to mature functional cells. The
embryonic stem cells are derived from the embryo and are
pluripotent and have the capability of developing into any organ or
tissue type. Preferably the tissue type is selected from the group
including blood cells, neuron cells or muscle cells.
[0062] In another aspect of the present invention there is provided
an undifferentiated human embryonic stem cell wherein the cell is
immunoreactive with markers for human pluripotent stem cells
including SSEA-4, GCTM-2 antigen, TRA 1-60. Preferably, the cells
express specific transcription factors such as Oct-4 as
demonstrated by RT-PCR, or methods of analysis of differential gene
expression, microarray analysis or related techniques. More
preferably the cells maintain a diploid karyotype during prolonged
cultivation in vitro.
[0063] Preferably, the stem cell will constitute a purified
preparation of an undifferentiated stem cell line. More preferably,
the stem cell line is a permanent cell line, distinguished by the
characteristics identified above. They preferably have normal
karyotype along with the characteristics identified above. This
combination of defining properties will identify the cell lines of
the invention regardless of the method used for their
isolation.
[0064] Methods of identifying these characteristics may be by any
method known to the skilled addressee. Methods such as (but not
limited to) indirect immunoflourescence or immunocytochemical
staining may be carried out on colonies of ES cells which are fixed
by conventional fixation protocols then stained using antibodies
against stem cell specific antibodies and visualised using
secondary antibodies conjugated to fluorescent dyes or enzymes
which can produce insoluble colored products. Alternatively, RNA
may be isolated from the stem cells and RT-PCR or Northern blot
analysis carried out to determine expression of stem cell specific
genes such as Oct-4.
[0065] In a preferred embodiment the undifferentiated cells form
tumours when injected in the testis of immunodeprived SCID mice;
these tumours include differentiated cells representative of all
three germ layers. The germ layers are preferably endoderm,
mesoderm and ectoderm. Preferably, once the tumours are
established, they may be disassociated and specific differentiated
cell types may be identified or selected by any methods available
to the skilled addressee. For instance, lineage specific markers
may be used through the use of fluorescent activated cell sorting
(FACS) or other sorting method or by direct micro dissection of
tissues of interest. These differentiated cells may be used in any
manner. They may be cultivated in vitro to produce large numbers of
differentiated cells which could be used for transplantation or for
use in drug screening for example.
[0066] In another preferred embodiment, the undifferentiated cells
differentiate in vitro to form somatic cells.
[0067] In another aspect, there is provided a somatic cell
differentiated in vitro from an undifferentiated embryonic stem
cell. There is also provided a committed progenitor cell capable of
giving rise to mature somatic cells.
[0068] The cells may undergo differentiation in vitro to yield
somatic cells as well as extrembryonic cells, such differentiation
being characterised by novel gene expression characteristic of
specific lineages as demonstrated by immunocytochemical or RNA
analysis. Characterisation may be obtained by using expression of
genes characteristic of pluripotent cells or particular lineages.
Preferably, differential expression of Oct-4 may be used to
identify stem cells from differentiated cells. Otherwise, the
presence or absence of expression of other genes characteristic of
pluripotent stem cells or other lineages may include Genesis, GDF-3
or Cripto, Analysis of these gene expressions may create a gene
expression profile to define the molecular phenotype of an ES cell,
a committed progenitor cell, or a mature differentiated cell of any
type. Such analysis of specific gene expression in defined
populations of cells from ES cultures is called cytomics. Methods
of analysis of gene expression profiles include RT-PCR, methods of
differential gene expression, microarray analysis or related
techniques.
[0069] Differentiating cultures of the stem cells secrete HCG and
AFP into culture medium, as determined by enzyme-linked
immunosorbent assay carried out on culture supernatants. Hence this
may also serve as a means of identifying the differentiated
cells.
[0070] The differentiated cells forming somatic cells may also be
characterised by expressed markers characteristic of
differentiating cells. The in vitro differentiated cell culture may
be differentiated into a single somatic cell type or it may
differentiate into multiple somatic lineages. These multiple
lineages may also be identified by detecting molecules such as
neural cell adhesion molecule, neuro-filament proteins, desmin and
smooth muscle action.
[0071] In a further aspect of the invention, there is provided a
method of preparing undifferentiated human embryonic stem cells,
said method including:
[0072] obtaining an in vitro fertilised human embryo and growing
the embryo to a blastocyst stage of development;
[0073] removing inner cells mass (ICM) cells from the embryo;
[0074] culturing ICM cells under conditions which do not induce
extraembryonic differentiation and cell death; and promote
proliferation of undifferentiated stem cells; and
[0075] recovering stem cells.
[0076] In a further preferred aspect of the present invention there
is provided a method of preparing undifferentiated human embryonic
stem cells, said method including:
[0077] obtaining an in vitro fertilised human embryo;
[0078] removing inner cells mass (ICM) cells from the embryo;
[0079] culturing ICM cells on a fibroblast feeder layer to obtain
proliferation of embryonic stem cells; and
[0080] recovering stem cells from the feeder layer.
[0081] Embryonic stem cells (ES) are derived from the embryo. These
cells are undifferentiated and have the capability of
differentiation to a variety of cell types. The "embryo" is defined
as any stage after fertilization up to 8 weeks post conception. It
develops from repeated division of cells and includes the stages of
a blastocyst stage which comprises an outer trophectoderm and an
inner cell mass (ICM).
[0082] The embryo required in the present method may be an in vitro
fertilised embryo or it may be an embryo derived by transfer of a
somatic cell nucleus into an enucleated oocyte of human or non
human origin which is then activatd and allowed to develop to the
blastocyst stage.
[0083] The embryo may be fertilised by any in vitro methods
available. For instance, the embryo may be fertilised by using
conventional insemination, or intracytoplasmic sperm injection. It
is preferred that any embryo culture method is employed but it is
most preferred that a method producing high quality (good
morphological grade) blastocysts is employed. The high quality of
the embryo can be assessed by morphological criteria. Most
preferably the inner cell mass is well developed. These criteria
can be assessed by the skilled addressee.
[0084] Following insemination, embryos may be cultured to the
blastocyst stage. Embryo quality at this stage may be assessed to
determine suitable embryos for deriving ICM cells. The embryos may
be cultured In any medium that maintains their survival and
enhances blastocyst development.
[0085] Preferably, the embryos are cultured in droplets under
pre-equilibrated sterile mineral oil in IVF-50 or Scandinavian 1
(S1) or G1.2 medium (Scandinavian IVF). Preferably the incubation
is for two days. If IVF-50 or S1 is used, on the third day, an
appropriate medium such as a mixture of 1:1 of IVF-50 and
Scandinavian-2 medium (Scandinavian IVF) may be used. From at least
the fourth day, a suitable medium such as G2.2 or Scandinavian-2
(S2) medium may be used solely to grow the embryos to blastocyst
stage (blastocysts). Preferably, only G2.2 medium is used from the
fourth day onwards.
[0086] In a preferred embodiment, the blastocyst is subjected to
enzymatic digestion to remove the zona pellucida or a portion
thereof. Preferably the blastocyst is subjected to the digestion at
an expanded blastocyst stage which may be approximately on day 6.
Generally this is at approximately six days after insemination.
[0087] Any protein enzyme may be used to digest the zona pellucida
or portion thereof from the blastocyst. Examples include pronase,
acid Tyrodes solution, and mechanical methods such as laser
dissection.
[0088] Preferably, Pronase is used. The pronase may be dissolved in
PBS and G2 or S2 medium. Preferably the PBS and Scandinavian-2
medium is diluted 1:1. For digestion of zone pellucida from the
blastocyst, approximately 10 units/ml of Pronase may be used for a
period sufficient to remove the zona pellucida. Preferably
approximately 1 to 2 mins, more preferably 1-1.5 mins is used.
[0089] The embryo (expanded blastocyst) may be washed in G2.2 or S2
medium, and further incubated to dissolve the zona pellucida.
Preferably, further digestion steps may be used to completely
dissolve the zona. More preferably the embryos are further
incubated in pronase solution for 15 seconds. Removal of the zona
pellucida thereby exposes the trophectoderm.
[0090] In a preferred aspect of the invention the method further
includes the following steps to obtain the inner cell mass cell,
said steps including:
[0091] treating the embryo to dislodge the trophectoderm of the
embryo or a portion thereof:
[0092] washing the embryo with a G2.2 or S2 medium to dislodge the
trophectoderm or a portion thereof; and
[0093] obtaining inner cell mass cells of the embryo.
[0094] Having had removed the zona pellucida, the ICM and
trophectoderm become accessible. Preferably the trophectoderm is
separated from the ICM. Any method may be employed to separate the
trophectoderm from the ICM. Preferably the embryo (or blastocyst
devoid of zona pellucida) is subjected to immuno-surgery.
Preferably it is treated with an antibody or antiserum reactive
with epitopes on the surface of the trophectoderm. More preferably,
the treatment of the embryo, (preferably an embryo at the
blastocyst stage devoid of zona pellucida) is combined with
treatment with complement. The antibody and/or antiserum and
complement treatment may be used separately or together. Preferred
combinations of antibody and/or antiserum and complement include
anti-placental alkaline phosphatase antibody and Baby Rabbit
complement (Serotec) or anti-human serum antibody (Sigma) combined
with Guinea Pig complement (Gibco).
[0095] Preferably the antibodies and complement are diluted in G2.2
or S2 medium. The antibodies and complement, excluding
anti-placental alkaline phosphate (anti-AP) are diluted 1:5 whereas
anti-AP antibody is diluted 1:20 with S-2 medium.
[0096] Preferably the embryo or blastocyst (preferably having the
zona pellucida removed) is subjected to the antibody before it is
subjected to the complement. Preferably, the embryo or blastocyst
is cultured in the antibody for a period of approximately 30
mins.
[0097] Following the antibody exposure, it is preferred that the
embryo is washed. Preferably it is washed in G2.2 or S2 medium. The
embryo or blastocyst preferably is then subjected to complement,
preferably for a period of approximately 30 mins.
[0098] G2.2 or S2 (Scandinavian-2) medium is preferably used to
wash the embryo or blastocyst to dislodge the trophectoderm or a
portion thereof. Dislodgment may be by mechanical means. Preferably
the dislodgment is by pipetting the blastocyst through a small bore
pipette.
[0099] The ICM cells may then be exposed and ready for removal and
culturing. Culturing of the ICM cells is conducted on a fibroblast
feeder layer. In the absence of a fibroblast feeder layer, the
cells will differentiate. Leukaemia inhibitory factor (LIF) has
been shown to replace the feeder layer in some cases and maintain
the cells in an undifferentiated state, However, this seems to only
work for mouse cells. For human cells, high concentration of LIF
were unable to maintain the cells in an undifferentiated state in
the absence of a fibroblast feeder layer.
[0100] The conditions which do not induce extraembryonic
differentiation and cell death may include cultivating the
embryonic stem cells on a fibroblast feeder layer which does not
induce extraembryonic differentiation and cell death.
[0101] Mouse or human fibroblasts are preferably used. They may be
used separately or in combination. Human fibroblasts provide
support for stem cells, but they create a non-even and sometimes
non-stable feeder layer. However, they may combine effectively with
mouse fibroblasts to obtain an optimal stem cell growth and
inhibition of differentiation.
[0102] The cell density of the fibroblast layer affects its
stability and performance. A density of approximately 25,000 human
and 70,000 mouse cells per cm.sup.2 is most preferred, Mouse
fibroblasts alone are used at 75,000-100,000/cm.sup.2. The feeder
layers are preferably established 6-48 hours prior to addition of
ES cells.
[0103] Preferably the mouse or human fibroblast cells are low
passage number cells. The quality of the fibroblast cells affects
their ability to support the stem cells. Embryonic fibroblasts are
preferred. For mouse cells, they may be obtained from 13.5 day old
foetuses. Human fibroblasts may be derived from embryonic or foetal
tissue from termination of pregnancy and may be cultivated using
standard protocols of cell culture.
[0104] The guidelines for handling the mouse embryonic fibroblasts
may include minimising the use of trypsin digestion and avoidance
of overcrowding in the culture. Embryonic fibroblasts that are not
handled accordingly will fail to support the growth of
undifferentiated ES cells. Each batch of newly derived mouse
embryonic fibroblasts is tested to confirm its suitability for
support and maintenance of stem cells.
[0105] Fresh primary embryonic fibroblasts are preferred in
supporting stem cell renewal as compared to frozen-thawed
fibroblasts. Nevertheless, some batches will retain their
supportive potential after repeated freezing and thawing. Therefore
each fresh batch that has proved efficient in supporting ES cells
renewal is retested after freezing and thawing. Batches that retain
their potential after freezing and thawing are most preferably
used.
[0106] Some mouse strains yield embryonic fibroblasts which are
more suitable for stem cell maintenance than those of other
strains. For example, fibroblasts derived from inbred 129/Sv or CBA
mice or mice from a cross of 129/Sv with C57/BI6 strains have
proven highly suitable for stem cell maintenance.
[0107] Isolated ICM masses may be plated and grown in culture
conditions suitable for human stem cells.
[0108] It is preferred that the feeder cells are treated to arrest
their growth. Several methods are available. It is preferred that
they are irradiated or are treated with chemicals such as mitomycin
C which arrests their growth. Most preferably, the fibroblast
feeder cells are treated with mitomycin C (Sigma).
[0109] The fibroblast feeder layer maybe generally plated on a
gelatin treated dish. Preferably, the tissue culture dish is
treated with 0.1% gelatin.
[0110] The fibroblast feeder layer may also contain modified
fibroblasts. For instance, fibroblasts expressing recombinant
membrane bound factors essential for stem cell renewal may be used.
Such factors may include for example human multipotent stem cell
factor.
[0111] Inner cell mass cells may be cultured on the fibroblast
feeder layer and maintained in an ES medium. A suitable medium is
DMEM (GIBCO, without sodium pyruvate, with glucose 4500 mg/L)
supplemented with 20% FBS (Hyclone, Utah),
(betamercaptoethanol--0.1 mM (GIBCO), non essential amino
acids--NEAA 1% (GIBCO), glutamine 2 mM. (GIBCO), and penicillin 50
.mu./ml, streptomycin 50 .mu./ml (GIBCO). In the early stages of ES
cell cultivation, the medium maybe supplemented with human
recombinant leukemia inhibitory factor hLIF preferably at 2000
.mu./ml. However, LIF generally is not necessary. Any medium may be
used that can support the ES cells.
[0112] The ES medium may be further supplemented with soluble
growth factors which promote stem cell growth or survival or
inhibit stem cell differentiation. Examples of such factors include
human multipotent stem cell factor, or embryonic stem cell renewal
factor.
[0113] The isolated ICM may be cultured for at least six days. At
this stage, a colony of cells develops. This colony is comprised
principally of undifferentiated stem cells. They may exist on top
of differentiated cells. Isolation of the undifferentiated cells
may be achieved by chemical or mechanical means or both. Preferably
mechanical isolation and removal by a micropipette is used.
Mechanical isolation may be combined with a chemical or enzymatic
treatment to aid with dissociation of the cells, such as
Ca.sup.2+/Mg.sup.2+ free PBS medium or dispase.
[0114] In a further aspect of the invention, the method further
includes:
[0115] replating the stem cells from the fibroblast feeder layer
onto another fibroblast feeder layer; and
[0116] culturing the stem cells for a period sufficient to obtain
proliferation of morphologically undifferentiated stem cells.
[0117] A further replating of the undifferentiated stem cells is
performed. The isolated clumps of cells from the first fibroblast
feeder layer may be replated on fresh human/mouse fibroblast feeder
layer in the same medium as described above.
[0118] Preferably, the cells are cultured for a period of 7-14
days. After this period, colonies of undifferentiated stem cells
may be observed. The stem cells may be morphologically identified
preferably by the high nuclear/cytoplasmic ratios, prominent
nucleoli and compact colony formation. The cell borders are often
distinct and the colonies are often flatter than mouse ES cells.
The colonies resemble those formed by pluripotent human embryonal
carcinoma cell lines such as GCT 27 X-1.
[0119] In an even further aspect of the invention, the method
further includes propagating the undifferentiated stem cells. The
methods of propagation may initially involve removing clumps of
undifferentiated stem cells from colonies of cells. The dispersion
is preferably by chemical or mechanical means or both. More
preferably, the cells are washed in a Ca.sup.2+/Mg.sup.2+ free PBS
or they are mechanically severed from the colonies or a combination
of the two methods. In both methods, cells may be propagated as
clumps of about 100 cells about every 7 days.
[0120] In the first method, Ca.sup.2+/Mg.sup.2+ free PBS medium may
be used to reduce cell-cell attachments. Following about 15-20
minutes, cells gradually start to dissociate from the monolayer and
from each other and desired size clumps can be isolated. When cell
dissociation is partial, mechanical dissociation using the sharp
edge of the pipette may assist with cutting and the isolation of
the clumps.
[0121] An alternative chemical method may include the use of an
enzyme. The enzyme may be used alone or in combination with a
mechanical method. Preferably, the enzyme is dispase.
[0122] An alternative approach includes the combined use of
mechanical cutting of the colonies followed by isolation of the
subcolonies by dispase. Cutting of the colonies may be performed in
PBS containing Ca.sup.2+ and Mg.sup.2+. The sharp edge of a
micropipette may be used to cut the colonies to clumps of about 100
cells. The pipette may be used to scrape and remove areas of the
colonies. The PBS, is preferably changed to regular equilibrated
human stem cell medium containing dispase (Gibco) 10 mg/ml and
incubated for approximately 5 minutes at 37.degree. C. in a
humidified atmosphere containing 5% CO.sub.2. As soon as the clumps
detached they may be picked up by a wide bore micro-pipette, washed
in PBS containing Ca.sup.2+ and Mg.sup.2+ and transferred to a
fresh fibroblast feeder layer.
[0123] The fibroblast feeder layer may be as described above.
[0124] Undifferentiated embryonic stem cells have a characteristic
morphology as described above. Other means of identifying the stem
cells may be by cell markers or by measuring expression of genes
characteristic of pluripotent cells.
[0125] Examples of genes characteristic of pluripotent cells or
particular lineages may include (but are not limited to) Oct-4 and
Pax-6 or nestin as markers of stem cells and neuronal precursors
respectively. Other genes characteristic of stem cells may include
Genesis, GDF-3 and Cripto. Such gene expression profiles may be
attained by any method including RT-PCR, methods of differential
gene expression, microarray analysis or related techniques.
[0126] Preferably the stem cells may be identified by being
immunoreactive with markers for human pluripotent stem cells
including SSEA-4, GCTM-2 antigen, TRA 1-60. Preferably the cells
express the transcription factor Oct-4. The cells also maintain a
diploid karyotype.
[0127] The stem cells may be further modified at any stage of
isolation. They may be genetically modified through introduction of
vectors expressing a selectable marker under the control of a stem
cell specific promoter such as Oct-4. Some differentiated progeny
of embryonic stem cells may produce products which are inhibitory
to stem cell renewal or survival. Therefore selection against such
differentiated cells, facilitated by the introduction of a
construct such as that described above, may promote stem cell
growth and prevent differentiation.
[0128] The stem cells may be genetically modified at any stage with
markers so that the markers are carried through to any stage of
cultivation. The markers may be used to purify the differentiated
or undifferentiated stem cell population at any stage of
cultivation.
[0129] Progress of the stem cells and their maintenance in a
differentiated or undifferentiated stage may be monitored in a
quantitative fashion by the measurement of stem cell specific
secreted products into the culture medium or in fixed preparations
of the cells using ELISA or related techniques. Such stem cell
specific products might include the soluble form of the CD30
antigen or the GCTM-2 antigen or they may be monitored as described
above using cell markers or gene expression.
[0130] In another aspect of the invention there is provided a
method of induction of differentiation of stem cells in vitro.
[0131] The undifferentiated cell lines of the present invention may
be cultured indefinitely until a differentiating signal is
given.
[0132] In the presence of a differentiation signal,
undifferentiated ES cells in the right conditions will
differentiate into derviatives of the embryonic germ layers
(endoderm, mesoderm and ectoderm), and/or extraembryonic tissues.
This differentiation process can be controlled.
[0133] Conditions for obtaining differentiated cultures of somatic
cells from embryonic stem cells are those which are non-permissive
for stem cell renewal, but do not kill stem cells or drive them to
differentiate exclusively into extraembryonic lineages. A gradual
withdrawal from optimal conditions for stem cell growth favours
somatic differentiation. The stem cells are initially in an
undifferentiated state and can be induced to differentiate.
Generally the presence of a fibroblast feeder layer will maintain
these cells in an undifferentiated state. This has been found to be
the case with the cultivation of mouse and human ES cells. However,
without being restricted by theory, it has now become evident that
the type and handling of the fibroblast feeder layer is important
for maintaining the cells in an undifferentiated state or inducing
differentiation of the stem cells.
[0134] Somatic differentiation in vitro of the ES cell lines is a
function of the period of cultivation following subculture, the
density of the culture, and the fibroblast feeder cell layer. It
has been found that somatic differentiation is morphologically
apparent and demonstrable by immunochemistry approximately 14 days
following routine subcultivation as described above in areas of the
colony which are remote from direct contact with the feeder cell
layer (in contrast to areas adjacent to the feeder cell layer where
rapid stem cell growth is occuring such as the periphery of a
colony at earlier time points after subcultivation), or in cultures
which have reached confluence. Depending upon the method of
preparation and handling of the mouse embryo fibroblasts, the mouse
strain from which the fibroblasts are derived, and the quality of a
particular batch, stem cell renewal, extraembryonic differentiation
or somatic differentiation may be favoured.
[0135] As previously mentioned the guidelines for handling the
mouse embryonic fibroblasts include minimising the use of trypsin
digestion during passage and avoidance of over crowded cultures.
Mouse embryonic fibroblasts which are not handled accordingly will
induce the differentiation of human ES cells mainly into
extraembryonic lineages.
[0136] Each batch of freshly prepared primary embryonic fibroblasts
is routinely tested to determine its suitability for the support of
stem cell renewal, the induction of somatic differentiation or the
induction of extraembryonic differentiation.
[0137] Fresh primary embryonic fibroblasts are preferred in
supporting stem cell renewal and/or induction of somatic
differentiation as compared to frozen-thawed fibroblasts.
Nevertheless, some batches will retain their supportive potential
after repeated freezing and thawing. Therefore each fresh batch
that has proved efficient in supporting ES cells renewal and/or
induction of somatic differentiation is retested after freezing and
thawing. Batches that retain their potential after freezing and
thawing are most preferably used.
[0138] Any mouse strain may be used although crosses between the
strains 129/Sv and C57/BL6 or inbred 129/Sv or CBA mouse are more
preferably used.
[0139] Once a suitable fibroblast cell line is selected, it may be
used as a differentiation inducing fibroblast feeder layer to
induce the undifferentiated stem cells to differentiate into a
somatic lineage or multiple somatic lineages. These may be
identified using markers or gene expression as described above.
Preferably the fibroblast feeder layer does not induce
extraembryonic differentiation and cell death.
[0140] The modulation of stem cell growth by appropriate use of
fibroblast feeder layer and manipulation of the culture conditions
thus provides an example whereby somatic differentiation may be
induced in-vitro concomitant with the limitation of stem cell
renewal without the induction of widespread cell death or
extraembryonic differentiation.
[0141] Other manipulations of the culture conditions may be used to
arrest stem cell renewal without causing stem cell death or
unidirectional extraembryonic differentiation, thereby favouring
differentiation of somatic cells.
[0142] Differentiation may also be induced by cultivating to a high
density in monolayer or on semi-permeable membranes so as to create
structures mimicing the postimplantation phase of human
development, or any modification of this approach. Cultivation in
the presence of cell types representative of those known to
modulate growth and differentiation in the vertebrate embryo (egg
endoderm cells or cells derived from normal embyronic or neoplastic
tissue) or in adult tissues (eg. bone marrow stromal preparation)
may also induce differentiation, modulate differentiation or induce
maturation of cells within specific cell lineage so as to favour
the establishment of particular cell lineages.
[0143] Chemical differentiation may also be used to induce
differentiation. Propagation in the presence of soluble or membrane
bound factors known to modulate differentiation of vertebrate
embryonic cells, such as bone morphogenetic protein-2 or
antagonists of such factors, may be used.
[0144] Applicants have found that Oct-4 is expressed in stem cells
and down-regulated during differentiation and this strongly
indicates that stem cell, selection using drug resistance genes
driven by the Oct-4 promoter will be a useful avenue for
manipulating human ES cells. Directed differentiation using growth
factors, or the complementary strategy of lineage selection coupled
with growth factor enhancement could enable the selection of
populations of pure committed progenitor cells from spontaneously
differentiating cells generated as described here.
[0145] Genetic modification of the stem cells or further
modification of those genetically modified stem cells described
above may be employed to control the induction of differentiation.
Genetic modification of the stem cells so as to introduce a
construct containing a selectable marker under the control of a
promoter expressed only in specific cell lineages, followed by
treatment of the cells as described above and the subsequent
selection for cells in which that promoter is active may be
used.
[0146] In another aspect of the invention, there are provided both
committed progenitor cells capable of self renewal or
differentiation into one or limited number of somatic cell
lineages, as well as mature differentiated cell produced by the
methods of the present invention.
[0147] Once the cells have been induced to differentiate, the
various cell types, identified by means described above, may be
separated and selectively cultivated.
[0148] Selective cultivation means isolation of specific lineages
of progenitors or mature differentiated cells from mixed
populations preferably appearing under conditions unfavourable for
stem cell growth and subsequent propagation of these specific
lineages. Selective cultivation may be used to isolate populations
of mature cells or populations of lineage specific committed
progenitor cells. Isolation may be achieved by various techniques
in cell biology including the following alone or in combination:
microdissection; immunological selection by labelling with
antibodies against epitopes expressed by specific lineages of
differentiated cells followed by direct isolation under
flourescence microscopy, panning, immunomagnetic selection, or
selection by flow cytometry; selective conditions favouring the
growth or adhesion of specific cell lineages such as exposure to
particular growth or extracellular matrix factors or selective
cell-cell adhesion; separation on the basis of biophysical
properties of the cells such as density; disaggregation of mixed
populations of cells followed by isolation and cultivation of small
clumps of cells or single cells in separate culture vessels and
selection on the basis of morphology, secretion of marker proteins,
antigen expression, growth properties, or gene expression; lineage
selection using lineage specific promoter constructs driving
selectable markers or other reporters.
[0149] For example areas of cells which are destined to give rise
to clusters of neuronal cells as shown in FIG. 3 F may be
identified in high density cultures by characteristic morphological
features identified under phase contrast or stereo microscopy.
These areas of cells may be isolated and replated in serum-free
medium, whereupon they form spherical structures. Cells in these
spheres initially express markers of primitive neuroectoderm, such
as the intermediate filament protein nestin and the transcription
factor Pax-6. When plated on an appropriate substrate,
differentiated cells grow out as a monolayer from these precursors
and acquire morphology and expression of markers such as the 160 kd
neurofilament protein and Map-2AB which are characteristic of
mature neurons. These observations on cells of the neuronal lineage
establish the principle that both committed progenitor cells and
fully differentiated cells may be isolated and characterised from
embryonic stem cell cultures using the techniques described.
[0150] In another aspect there is provided an undifferentiated cell
line produced by the method of the present invention.
[0151] Specific cell lines HES-1 and HES-2 were isolated by the
procedures described above and have the properties described
above.
[0152] In another aspect of the invention there is provided a cell
composition including a human differentiated or undifferentiated
cell preferably produced by the method of the present invention,
and a carrier.
[0153] The carrier may be any physiologically acceptable carrier
that maintains the cells. It may be PBS or ES medium.
[0154] The differentiated or undifferentiated cells may be
preserved or maintained by any methods suitable for storage of
biological material. Vitrification of the biological material is
the preferred method over the traditional slow-rate freezing
methods.
[0155] Effective preservation of ES cells is highly important as it
allows for continued storage of the cells for multiple future
usage. Although traditional slow freezing methods, commonly
utilised for the cryo-preservation of cell lines, may be used to
cryo-preserve undifferentiated or differentiated cells, the
efficiency of recovery of viable human undifferentiated ES cells
with such methods is extremely low. ES cell lines differ from other
cell lines since the pluripotent cells are derived from the
blastocyst and retain their embryonic properties in culture.
Therefore, cryo-preservation using a method which is efficient for
embryos is most appropriate. Any method which is efficient for
cryo-preservation of embryos may be used. Preferably, vitrification
method is used. More preferably the Open Pulled Straw (OPS)
vitrification method previously described by Vajta, G. et at (1998)
Molecular Reproduction and Development, 51, 53-58, is used for
cryopreserving the undifferentiated cells. More preferably, the
method described by Vajta, G. et at (1998) Cryo-Letters, 19,
389-392 is employed. Generally, this method has only been used for
cryopreserving embryos.
[0156] The differentiated or undifferentiated cells may be used as
a source for isolation or identification of novel gene products
including but not limited to growth factors, differentiation
factors or factors controlling tissue regeneration, or they may be
used for the generation of antibodies against novel epitopes. The
cell lines may also be used for the development of means to
diagnose, prevent or treat congenital diseases.
[0157] Much attention recently has been devoted to the potential
applications of stem cells in biology and medicine. The properties
of pluripotentiality and immortality are unique to ES cells and
enable investigators to approach many issues in human biology and
medicine for the first time. ES cells potentially can address the
shortage of donor tissue for use in transplantation procedures,
particularly where no alternative culture system can support growth
of the required committed stem cell. ES cells have many other far
reaching applications in human medicine, in areas such as
embryological research, functional genomics, identification of
novel growth factors, and drug discovery, and toxicology.
[0158] The present invention will now be more fully described with
reference to the following examples. It should be understood,
however, that the description following is illustrative only and
should not be taken in any way as a restriction on the generality
of the invention described above.
REFERENCES
[0159] Evans, M. J. and Kaufman, M. Establishment in culture of
pluripotential stem cells from mouse embryos. Nature 292, 151-156
(1981).
[0160] Martin, G. R. Isolation of a pluripotent cell line from
early mouse embryos cultured in medium conditioned by
teratocarcinoma stem cells. Proc. Natl. Acad. Sci U.S.A. 78,
7634-7638 (1981).
[0161] Andrews, P. W. et al. Pluripotent embryonal carcinoma clones
derived from the human teratocarcinoma cell line Tera-2. Lab.
Invest 50, 147-162 (1984).
[0162] Pera, M. F., Cooper, S., Mills, J., & Parrington, J. M.
Isolation and characterization of a multipotent clone of human
embryonal carcinoma-cells. Differentiation 42, 10-23 (1989).
[0163] Thomson, J. A. et al. Isolation of a primate embryonic stem
cell line. Proc. Natl. Acad. Sci. U.S.A. 92, 7844-7844 (1995).
[0164] Thomson, J. A. et al. Pluripotent cell lines derived from
common marmoset (Callithrix jacchus) blastocysts. Biol. Reprod. 55,
254-259. (1996).
[0165] Bongso A., Fong C. Y., Ng S. C., and Ratnam, S. Isolation
and culture of inner cell mass cells from human blastocysts. Hum.
Reprod. 9, 2110-2117 (1994).
[0166] Thomson, J. A. et al. Embryonic stem cell lines derived from
human blastocysts. Science 282, 1145-1147 (1998).
[0167] Andrews, P. W. et al. Comparative-analysis of cell-surface
antigens expressed by cell-lines derived from human germ-cell
tumors. Int.J.Cancer 66, 806-816 (1996).
[0168] Cooper, S., Pera, M. F., Bennett, W., & Finch, J. T. A
novel keratan sulfate proteoglycan from a human embryonal carcinoma
cell-line. Biochem.J. 286, 959-966 (1992).
[0169] Pera, M. F. et al. Analysis of cell-differentiation lineage
in human teratomas using new monoclonal-antibodies to
cytostructural antigens of embryonal carcinoma-cells.
Differentiation 39, 139-149 (1988).
[0170] Fong C. Y., and Bongso A. Comparison of human blastulation
rates and total cell number in sequential culture media with and
without co-culture. Hum. Reprod. 14, 774-781 (1999).
[0171] Fong C. Y. et al. Ongoing pregnancy after transfer of
zona-free blastocysts: implications for embryo transfer in the
human. Hum. Reprod. 12, 557-560 (1997).
[0172] Solter D., and Knowles, B. Immunosurgery of mouse
blastocyst. Proc. Natl. Acad. Sci. U.S.A. 72, 5099-5102 (1975).
[0173] Vajta G, Holm P, Kuwayama M, Both P J, Jacobsen H, Greve T,
Callesen H. Open pulled straw (OPS) vitrification: A new way to
reduce cryoinjuries of bovine ova and embryos. Molecular
Reproduction and Development 1998, 51: 53-58.
[0174] Vajta G, Lewis I M, Kuwayama M, Greve T, Callesen H. Sterile
application of the opened pulled straw (OPS) vitrification method.
Cryo-Letters 1998, 19: 389-392.
EXPERIMENTAL PROTOCOLS
[0175] 1. Derivation and propagation of ES cells.
[0176] Fertilised oocytes were cultured to the blastocyst stage
(day 6 after insemination), in sequential media, according to a
standard co-culture free protocol (Fong C. Y., and Bongso A.
Comparison of human blastulation rates and total cell number in
sequential culture media with and without co-culture. Hum. Reprod.
14, 774-781 (1999)). After zona pellucida digestion by pronase
(Sigma, St. Louis, Mo.)(Fong C. Y. et al. Ongoing pregnancy after
transfer of zona-free blastocysts: implications for embryo transfer
in the human. Hum. Reprod. 12, 557-560 (1997)), ICM were isolated
by immunosurgery (Solter D., and Knowles, B. Immunosurgery of mouse
blastocyst. Proc. Natl. Acad. Sci. U.S.A. 72, 5099-5102 (1975))
using anti-human serum antibody (Sigma) followed by exposure to
guinea pig complement (Life Technologies, Gaithersburg, Md.). ICM
were then cultured on mitomycin C mitotically inactivated mouse
embryonic fibroblast feeder layer (75,000 cells/cm2) in gelatine
coated tissue culture dishes. The culture medium consisted of DMEM
(Gibco, without sodium pyruvate, glucose 4500 mg/L) supplemented
with 20% fetal bovine serum (Hyclone, Logan, Utah), 0.1 mM
beta-mercaptoethanol, 1% non essential amino acids, 2 mM glutamine,
50 u/ml penicillin and 50 .mu.g/ml streptomycin (Life
Technologies). During the isolation and early stages of ES cell
cultivation, the medium was supplemented with human recombinant
leukemia inhibitory factor hLIF at 2000 u/ml (Amrad, Melbourne,
Australia). 6-8 days after initial plating, ICM like clumps were
removed mechanically by a micropipette from differentiated cell
outgrowths and replated on fresh feeder layer. The resulting
colonies were further propagated in clumps of about 100 stem cell
like cells, on mouse feeder layer, about every 7 days. The clumps
were either dissociated mechanically, or with a combined approach
of mechanical slicing followed by exposure to dispase (10 mg/ml,
Life Technologies).
[0177] (a) Embryo culture
[0178] Following insemination, embryos were cultured in droplets
under pre-equilibrated sterile mineral oil in IVF-50 medium
(Scandinavian 2 medium) for 2 days.
[0179] A mixture 1:1 of IVF-50 and Scandinavian 2 medium
(Scandinavian 2 medium) was used in the third day.
[0180] From the forth day of culture, only Scandinavian 2 medium
was used to grow the cleavage stage embryos to blastocysts.
[0181] (b) Zona pellucida digestion.
[0182] Zona pellucida digestion was performed at the expanded
blastocyst stage on day 6.
[0183] The digestion solution included Pronase (Sigma, TC tested)
10 u in PBS and Scandinavian 2 medium (1:1).
[0184] The embryos were incubated in pronase solution for 1-1.5
min, washed in Scandinavian 2 medium and incubated for 30 minutes.
If the zona was not completely dissolved, the embryos were further
incubated in pronase solution for 15 seconds.
[0185] (c) Human stem cell culture.
[0186] Human stem cells were grown on MMC treated fibroblasts'
feeder layer. Fibroblasts were plated on gelatine treated dishes. A
combination of human and mouse derived fibroblasts were used at a
density of approximately 25,000 and 70,000 cells per cm.sup.2
respectively. The fibroblasts were plated up to 48 hours before
culture of the stem cells. Mouse fibroblasts only could also
support the growth of the stem cells. However, while human
fibroblasts could also support stem cells, they created an uneven
and unstable feeder layer. Therefore, the human fibroblasts were
combined with the mouse fibroblasts to augment and achieve better
support of growth and prevention of differentiation.
[0187] The medium that was used for the growth of human stem was
DMEM (GIBCO, without sodium pyruvate, with glucose 4500 mg/L)
supplemented with 20% FBS (Hyclone, Utah)
.beta.-mercaptoethanol--0.1 mM (GIBCO), Non Essential Amino
Acids--NEAA 1% (GIBCO), glutamine 2 mM.(GIBCO), penicillin 50 u/ml,
and streptomycin 50 .mu.g/ml (GIBCO). At the initial isolation of
the stem cells the medium was supplemented by hLIF 2000 u/ml. It
was later shown that LIF was not necessary.
[0188] (d) Human stem cell propagation:
[0189] Following plating, the isolated ICM attached and was
cultured for 6 days. At that stage, a colony which included a clump
of stem cells on top of differentiated cells developed. The ICM
clump was isolated and removed mechanically by a micro-pipette with
the aid of using Ca/Mg free PBS medium to reduce cell to cell
attachments.
[0190] The isolated clump was replated on fresh human/mouse
fibroblast feeder layer. Following 2 weeks of culture, a colony
with typical morphology of primate pluripotent stem cells
developed. The stem cells were further propagated in one of two
methods. In both methods cells which appeared nondifferentiated
were propagated in clumps of about 100 cells every 5-7 days.
[0191] In the first method, Ca/Mg free PBS medium was used to
reduce cell to cell attachments. Following about 15-20 minutes,
cells gradually start to dissociate and the desired size clumps can
be isolated. When cell dissociation is partial, mechanical
dissociation using the sharp edge of the pipette assisted with
cutting and the isolation of the clumps.
[0192] An alternative approach was performed by the combined use of
mechanical cutting of the colonies followed by isolation of the
subcolonies by dispase. Cutting of the colonies was performed in
PBS containing Ca and Mg. The sharp edge of micropipette was used
to cut the colonies to clumps of about 100 cells. The pipette was
also used to scrape and remove differentiated areas of the
colonies. The PBS was then changed to regular prequilibrated human
stem cells medium containing dispase (Gibco) 10 mg/ml and incubated
for 5-10 minutes (at 37.degree. C., 5% CO2). As soon as the clumps
were detached they were picked up by wide bore micro-pipette,
washed in PBS containing Ca and Mg and transferred to a fresh
feeder layer.
[0193] e) Human stem cell cryopreservation.
[0194] Early passage cells were cryo-preserved in clumps of about
100 cells by using the open pulled straw (OPS) vitrification method
(Vajta et al 1998) with some modifications. French mini-straws (250
.mu.l, IMV, L'Aigle, France) were heat-softened over a hot plate,
and pulled manually until the inner diameter was reduced to about
half of the original diameter. The straws were allowed to cool to
room temperature and were than cut at the narrowest point with a
razor blade. The straws were sterilised by gamma irradiation (15-25
K Gy). Two vitrification solutions (VS) were used. Both were based
on a holding medium (HM) which included DMEM containing HEPES
buffer (Gibco, without sodium pyruvate, glucose 4500 mg/L)
supplemented with 20% fetal bovine serum (Hyclone, Logan, Utah).
The first VS (VS1) included 10% dimethyl sulfoxide (DMSO, Sigma)
and 10% ethylene glycol (EG, Sigma). The second vitrification
solution (VS2) included 20% DMSO, 20% EG and 0.5M sucrose. All
procedures were performed on a heating stage at 37.degree. C. 4-6
clumps of ES cells were first incubated in VS1 for 1 minute
followed by incubation in VS2 for 25 seconds. They were then washed
in a 20 .mu.l droplet of VS2 and placed within a droplet of 1-2
.mu.l of VS2. The clumps were loaded into the narrow end of the
straw from the droplet by capillary action. The narrow end was
immediately submerged into liquid nitrogen. Straws were stored in
liquid nitrogen. Thawing was also performed on a heating stage at
37.degree. C. as previously described with slight modifications
(Vatja et al 1998). Three seconds after removal from liquid
nitrogen, the narrow end of the straw was submerged into HM
supplemented with 0.2M sucrose. After 1 minute incubation the
clumps were further incubated 5 minutes in HM with 0.1 M sucrose
and an additional 5 minutes in HM.
[0195] 2. Stem cell characterization.
[0196] Colonies were fixed in the culture dishes by 100% ethanol
for immuno-fluorescence demonstration of the stem cell surface
markers GCTM-2, TRA 1-60 and SSEA-1, while 90% acetone fixation was
used for SSEA-4. The sources of the monoclonal antibodies used for
the detection of the markers were as follows: GCTM-2, this
laboratory; TRA 1-60, a gift of Peter Andrews, University of
Sheffield; SSEA-1 (MC-480) and SSEA-4 (MC-813-70), Developmental
Studies Hybridoma Bank, Iowa, IA. Antibody localisation was
performed by using rabbit anti-mouse immunoglobulins conjugated to
fluorescein isothiocyanate (Dako,Carpinteria, Calif.).
[0197] Alkaline phosphatase activity was demonstrated as previously
described (Buehr M. and Mclaren A. Isolation and culture of
primordial germ cells. Methods Enzymol. 225, 58-76, (1993)).
Standard G-banding techniques were used for karyotyping.
[0198] 3. Oct-4 expression studies.
[0199] To monitor expression of Oct-4, RT-PCR was carried out on
colonies consisting predominantly of stem cells, or colonies which
had undergone spontaneous differentiation as described below. mRNA
was isolated on magnetic beads (Dynal AS, Oslo) following cell
lysis according to the manufacturer's instructions, and solid-phase
first strand cDNA synthesis was performed using Superscript II
reverse transcriptase (Life Technologies). OCT-4 transcripts were
assayed using the following primers: 5'-CGTTCTCTTTGGAAAGGTGTTC
(forward) and 3'-ACACTCGGACCACGTCTTTC (reverse). As a control for
mRNA quality, beta-actin transcripts were assayed using the same
RT-PCR and the following primers: 5'-CGCACCACTGGCATTGTCAT-3'
(forward), 5'-TTCTCCTTGATGTCACGCAC-3' (reverse). Products were
analysed on a 1.5% agarose gel and visualised by ethidium bromide
staining.
[0200] 4. In-vitro differentiation.
[0201] Colonies were cultured on mitotically inactivated mouse
embryonic fibroblasts to confluency (about 3 weeks) and further on
up to 7 weeks after passage. The medium was replaced every day.
Alphafetoprotein and beta human chorionic gonadotropin levels were
measured in medium conditioned by HES-1 and HES-2 at passage level
17 and 6 respectively. After 4-5 weeks of culture, conditioned
medium was harvested 36 hours after last medium change, and the
protein levels were determined by a specific immunoenzymometric
assays (Eurogenetics, Tessenderilo, Belgium) and a fluorometric
enzyme immunoassay (Dade, Miami, Fla.) respectively. These
compounds were not detected in control medium conditioned only by
feeder layer.
[0202] Differentiated cultures were fixed 6-7 weeks after passage
(26--HES-1 and 9--HES-2) for immunofluorescence detection of
lineage specific markers. After fixation with 100% ethanol,
specific monoclonal antibodies were used to detect the 68 kDa
neurofilament protein (Amersham, Amersham U.K), and neural cell
adhesion molecule (Dako). Muscle specific actin and desmin were
also detected by monoclonal antibodies (Dako) after fixation with
methanol/acetone (1:1). Antibody localisation was performed as
described above.
[0203] Clusters of cells destined to give rise to neural precursors
were identified by their characteristic morphological features in
central areas of ES cell colonies 2-3 weeks after plating. The
clusters were dissected mechanically by a micropipette and replated
in fresh serum free medium. Within 24 hours they formed spherical
structures. The expression of the transcription factor PAX-6 and
the intermediate filament nestin by these clusters was demonstrated
by RT-PCR as described above. The following primers were used for
PAX-6 and
1 nestin respectively: Pax-8 forward primer,
5"AACAGACACAGCCCTCACAAACA3"; Pax-6 reverse primer,
5"CGGGAACTTGAACTGGAACTGAC3"; nestin forward primer,
5"CAGCTGGCGCACCTCAAGATG3" nestin reverse primer,
5"AGGGAAGTTGGGCTCAGGACTGG3".
[0204] The clusters were plated on poly-D-lysine (Sigma) and
laminin (Sigma). They were fixed after 5 hours using 90% acetone in
water for the immuno-fluorescence demonstration of N-CAM (Dako)
while fixation with 4% paraformaldehyde in PBS was used to
demonstrate nestin. Five days after plating, differentiated cells
expending from the clusters were fixed with methanol for the
immuno-fluorescence demonstration of NF160 KD (Boehringer Mannheim
Biochemica) and with 4% paraformaldehyde in PBS for MAP 2a+b
(Neomarkers, clone AP20). Antibody localisation was performed as
described above.
[0205] 5. Teratoma formation in Severe Combined Immunodeficient
(SCID) mice.
[0206] At the time of routine passage, clumps of about 200 cells
with an undifferentiated morphology were harvested as described
above, and injected into the testis of 4-8 week old SCID mice (CB17
strain from the Walter and Eliza Hall Institute, Melbourne,
Australia, 10-15 clumps/testis). 6-7 weeks later, the resulting
tumours were fixed in neutral buffered formalin 10%, embedded in
paraffin and examined histologically after hematoxylin and eosin
staining.
EXAMPLES
Example 1
[0207] Derivation of cell lines HES-1 and HES-2
[0208] The outer trophectoderm layer was removed from four
blastocysts by immunosurgery to isolate inner cell masses (ICM),
which were then plated onto a feeder layer of mouse embryo
fibroblasts (FIG. 3A). Within several days, groups of small,
lightly packed cells had begun to proliferate from two of the four
ICM. The small cells were mechanically dissociated from outgrowths
of differentiated cells, and following replating they gave rise to
flat colonies of cells with the morphological appearance of human
EC or primate ES cells (FIGS. 3B, C stem cell colonies). These
colonies were further propagated by mechanically disaggregation to
clumps which were replated onto fresh feeder cell layers. Growth
from small clumps of cells (<10 cells) was not possible under
the conditions of these cultures. Spontaneous differentiation,
often yielding cells with the morphological appearance of early
endoderm, was frequently observed during routine passage of the
cells (FIG. 3D). Differentiation occurred rapidly if the cells were
deprived of a feeder layer, even in the presence of LIF (FIG. 3E).
While LIF was used during the early phases of the establishment of
the cell lines, it was subsequently found to have no effect on the
growth or differentiation of established cultures (not shown). Cell
line HES-1 has been grown for 60 passages in vitro and HES-2 for 40
passages, corresponding to a minimum of approximately 360 and 90240
population doublings respectively, based on the average increase in
colony size during routine passage, and both cell lines still
consist mainly of cells with the morphology of ES cells. Both cell
lines have been successfully recovered from cryopreservation.
Example 2
[0209] Marker expression and karyotype of the human ES cells
[0210] Marker and karyotype analysis were performed on HES-1 at
passage levels 5-7, 14-18, 24-26 and 44-46, and on HES-2 at passage
levels 6-8. ES cells contained alkaline phosphatase activity (FIG.
4A). Immunophenotyping of the ES cells was carried out using a
series of antibodies which detect cell surface carbohydrates and
associated proteins found on human EC cells. The ES cells reacted
positively in indirect immunofluorescence assays with antibodies
against the SSEA-4 and TRA 1-60 carbohydrate epitopes, and the
staining patterns were similar to those observed in human EC cells
(FIGS. 4B, C). ES cells also reacted with monoclonal antibody
GCTM-2, which detects an epitope on the protein core of a keratan
sulphate/chondroitin sulphate pericellular matrix proteoglycan
found in human EC cells (FIG. 4D). Like human EC cells, human ES
cells did not express SSEA-1, a marker for mouse ES cells. Both
cell lines were karyotypically normal and both were derived from
female blastocysts.
[0211] Oct-4 is a POU domain transcription factor whose expression
is limited in the mouse to pluripotent cells, and recent results
show directly that zygotic expression of Oct-4 is essential for
establishment of the pluripotent stem cell population of the inner
cell mass. Oct-4 is also expressed in human EC cells and its
expression is down regulated when these cells differentiate. Using
RT-PCR to carry out mRNA analysis on isolated colonies consisting
mainly of stem cells, we showed that human ES cells also express
Oct-4 (FIG. 5, lanes 2-4). The PCR product was cloned and sequenced
and shown to be identical to human Oct-4 (not shown).
Example 3
[0212] Differentiation of human ES cells in vitro
[0213] Both cell lines underwent spontaneous differentiation under
standard culture conditions, but the process of spontaneous
differentiation could be accelerated by suboptimal culture
conditions. Cultivation to high density for extended periods (4-7
weeks) without replacement of a feeder layer promoted
differentiation of human ES cells. In high density cultures,
expression of the stem cell marker Oct-4 was either undetectable or
strongly downregulated relative to the levels of the housekeeping
gene beta actin (FIG. 5, lanes 5-7). Alphafetoprotein and human
chorionic gonadotrophin were readily detected by immunoassay in the
supernatants of cultures grown to high density. Alphafetoprotein is
a characteristic product of endoderm cells and may reflect either
extraembryonic or embryonic endodermal differentiation; the levels
observed (1210-5806 ng/ml) are indicative of extensive endoderm
present. Human chorionic gonadotrophin secretion is characteristic
of trophoblastic differentiation; the levels observed (6.4-54.6
IU/Liter) are consistent with a modest amount of differentiation
along this lineage.
[0214] After prolonged cultivation at high density, multicellular
aggregates or vesicular structures formed above the plane of the
monolayer, and among these structures clusters of cells or single
cells with elongated processes which extended out from their cell
bodies, forming networks as they contacted other cells (FIG. 3F)
were observed. The cells and the processes stained positively with
antibodies against neurofilament proteins and the neural cell
adhesion molecule (FIGS. 4E and F). Contracting muscle was seen
infrequently in the cultures. While contracting muscle was a rare
finding, bundles of cells which were stained positively with
antibodies directed against muscle specific forms of actin, and
less commonly cells containing desmin intermediate filaments (FIGS.
6G and H) were often observed. In these high density cultures,
there was no consistent pattern of structural organisation
suggestive of the formation of embryoid bodies similar to those
formed in mouse ES cell aggregates or arising sporadically in
marmoset ES cell cultures.
Example 4
[0215] Differentiation of human ES cells in xenografts
[0216] When HES-1 or HES-2 colonies of either early passage level
(6; HES 1 and 2) or late passage level (HES-1, 14 and 27) were
inoculated beneath the testis capsule of SCID mice, testicular
lesions developed and were palpable from about 5 weeks after
inoculation. All mice developed tumours, and in most cases both
testis were affected. Upon autopsy lesions consisting of cystic
masses filled with pale fluid and areas of solid tissue were
observed. There was no gross evidence of metastatic spread to other
sites within the peritoneal cavity. Histological examination
revealed that the lesion had displaced the normal testis and
contained solid areas of teratoma. Embryonal carcinoma was not
observed in any lesion. All teratomas contained tissue
representative of all three germ layers. Differentiated tissues
seen included cartilage, squamous epithelium, primitive
neuroectoderm, ganglionic structures, muscle, bone, and glandular
epithelium (FIG. 6). Embryoid bodies were not observed in the
xenografts.
Example 5
[0217] Identification and characterisation of neuronal progenitor
cells and mature neuronal cells after induction of differentiation
in vitro.
[0218] Differentiation was induced by culturing for prolonged
periods and areas destined to give rise to neuronal cells cultures
were identified by their characteristic morphology under phase
microscopy or stereo microscopy. These aggregates of cells were
isolated and replated into fresh serum free medium. They formed
spherical structures. RT-PCR and immunofluorescence analysis showed
that cells within these spheres expressed markers of primitive
neuroectoderm including nestin, Pax-6 and polysialyated N-CAM.
After cultivation for a brief period, cells migrated from the
spheres onto the monolayer, where they acquired the morphological
appearance of neurons; immunofluorescence analysis revealed that
these cells expressed markers of mature neurons including the 160
kd neurofilament protein and MAP-2AB.
Example 6
[0219] Cryo-preservation of human ES cells.
[0220] Attempts to cryo-preserve human ES cells by using
conventional slow freezing protocols were associated with a very
poor outcome after thawing. Since ES cells are derived from the
blastocyst and retain their embryonic properties in culture, we
have postulated that cryopreservation by using a method which is
efficient for embryos may be beneficial. Early passage clumps of
human ES cells were frozen by using the open pulled straw (OPS)
vitrification method which was recently shown to be highly
efficient for the cryopreservation of bovine blastocysts (Vatja et
al. 1998). Both cell lines were successfully thawed and further
propagated for prolonged periods. The outcome of the vitrification
procedure was further studied on cell line HES-1, and recovery of
viable cells with this procedure was found to be highly efficient.
All clumps (n=25) survived the procedure and attached and grew
after thawing. Vitrification was associated with some cell death as
evidenced by the reduced size of colonies originating from
vitrified clumps two days after thawing in comparison to colonies
from non-vitrified control clumps. However, two days in culture
were sufficient to overcome this cell deficit, and 9 days after
plating the size of colonies from frozen-thawed clumps exceeded
that of control colonies at 7 days. Vitrification did not induce
differentiation after thawing. Thawed cells retained a normal
karyotype and the expression of primate stem cell markers, and
formed teratomas in SCID mice.
[0221] Finally it is to be understood that various other
modifications and/or alterations may be made without departing from
the spirit of the present invention as outlined herein.
Sequence CWU 1
1
8 1 22 DNA Artificial Sequence Description of Artificial Sequence
PCR primer 1 cgttctcttt ggaaaggtgt tc 22 2 20 DNA Artificial
Sequence Description of Artificial Sequence PCR primer 2 acactcggac
cacgtctttc 20 3 20 DNA Artificial Sequence Description of
Artificial Sequence PCR primer 3 cgcaccactg gcattgtcat 20 4 20 DNA
Artificial Sequence Description of Artificial Sequence PCR primer 4
ttctccttga tgtcacgcac 20 5 23 DNA Artificial Sequence Description
of Artificial Sequence PCR primer 5 aacagacaca gccctcacaa aca 23 6
23 DNA Artificial Sequence Description of Artificial Sequence PCR
primer 6 cgggaacttg aactggaact gac 23 7 21 DNA Artificial Sequence
Description of Artificial Sequence PCR primer 7 cagctggcgc
acctcaagat g 21 8 23 DNA Artificial Sequence Description of
Artificial Sequence PCR primer 8 agggaagttg ggctcaggac tgg 23
* * * * *