U.S. patent application number 09/282879 was filed with the patent office on 2002-10-31 for recombinant n-smases and nucleic acids encoding same.
Invention is credited to CHATTERJEE, SUBROTO.
Application Number | 20020160484 09/282879 |
Document ID | / |
Family ID | 25100257 |
Filed Date | 2002-10-31 |
United States Patent
Application |
20020160484 |
Kind Code |
A1 |
CHATTERJEE, SUBROTO |
October 31, 2002 |
RECOMBINANT N-SMASES AND NUCLEIC ACIDS ENCODING SAME
Abstract
Isolated nucleic acids are provided that encode human neutral
sphingomyelinase (N-SMase) and N-SMase fragments and derivatives
capable of hybridizing to such N-SMase-encoding nucleic acids. The
invention also includes isolated recombinant human neutral
sphingomyelinase (N-SMase) and N-SMase fragments and derivatives
are also provided. Novel assays are also provided to identify
compounds useful in the diagnosis or treatment of human neutral
sphingomyelinase related disorders.
Inventors: |
CHATTERJEE, SUBROTO;
(COLUMBIA, MD) |
Correspondence
Address: |
Dike Bronstein Roberts & Cushman
Intellectual Property Practice Group
EDWARDS & ANGELL
P O Box 9169
Boston
MA
02209
US
|
Family ID: |
25100257 |
Appl. No.: |
09/282879 |
Filed: |
March 31, 1999 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09282879 |
Mar 31, 1999 |
|
|
|
08774104 |
Dec 24, 1996 |
|
|
|
Current U.S.
Class: |
435/196 ;
435/320.1; 435/325; 536/23.2 |
Current CPC
Class: |
A61P 35/00 20180101;
C07K 2319/00 20130101; A61K 38/00 20130101; C12N 9/16 20130101;
A61P 3/00 20180101; A61P 43/00 20180101; A61P 29/00 20180101 |
Class at
Publication: |
435/196 ;
435/320.1; 435/325; 536/23.2 |
International
Class: |
C12N 009/16 |
Claims
What is claimed is:
1. An isolated nucleic acid encoding human neutral
sphingomyelinase.
2. The nucleic acid of claim 1 where the nucleic acid comprises the
sequence of SEQ ID NO:1, or the complement thereto.
3. The nucleic acid of claim 1 where the nucleic acid codes for the
human neutral sphingomyelinase of SEQ ID NO:2.
4. The nucleic acid of claim 1 where the human neutral
sphingomyelinase has a molecular weight of about 44 kDa as
determined by polyacrylamide gel electrophoresis using sodium
laurylsarocine.
5. The nucleic acid of claim 1 where the nucleic acid has at least
about 80 percent sequence identity to SEQ ID NO:1, or the
complement thereto.
6. The nucleic acid of claim 1 wherein the polynucleotide is
cDNA.
7. The nucleic acid of claim 1 wherein the polynucleotide is
RNA.
8. A recombinant vector comprising the nucleic acid of claim 1.
9. A host cell comprising the vector of claim 8.
10. A method of producing human neutral sphingomyelinase comprising
culturing a host cell of claim 9 under conditions suitable for
expression of human neutral sphingomyelinase.
11. A nucleic acid that hybridizes to the sequence of SEQ ID NO:1
under normal stringency conditions.
12. The nucleic acid of claim 11 where the nucleic acid hybridizes
to the sequence of SEQ ID NO:1 under high stringency
conditions.
13. A method of identifying a compound useful in the diagnosis or
treatment of a human neutral sphingomyelinase related disorder,
comprising contacting a candidate pharmacological agent with human
neutral sphingomyelinase or fragment or derivative thereof and
analyzing the mixture of the candidate agent and human neutral
sphingomyelinase or fragment or derivative thereof.
14. The method of claim 13 wherein the human neutral
sphingomyelinase has a sequence represented by SEQ ID NO:2.
15. The method of claim 13 wherein 1) a mixture is formed of i) a
human neutral sphingomyelinase cleavage target, ii) the human
neutral sphingomyelinase or fragment or derivative thereof, and
iii) a candidate pharmacological agent; 2) the mixture is treated
under conditions whereby, but for the presence of the candidate
agent, the human neutral sphingomyelinase or fragment or derivative
cleaves the cleavage target to yield a cleavage product; and 3) the
presence of the cleavage product is detected, wherein a reduced
concentration of the cleavage product relative to a control mixture
that does not contain the candidate agent identifies the candidate
agent as a compound potentially useful in the diagnosis or
treatment of a human neutral sphingomyelinase related disorder.
16. The method of claim 15 wherein the human neutral
sphingomyelinase cleavage target is sphingomyelin.
17. The method of claim 15 wherein the human neutral
sphingomyelinase cleavage product is ceramide.
18. An isolated human neutral sphingomyelinase having an apparent
molecular weight of about 44 kDa as determined by polyacrylamide
gel electrophoresis using sodium laurylsarocine.
19. An isolated human neutral sphingomyelinase of claim 18
comprising a sequence represented by SEQ ID NO:2.
20. An isolated polypeptide having at least about 70 percent
sequence identity to SEQ ID NO:2.
21. A method for modulating N-SMase activity comprising
administering to human cells a modulation effective amount of a
nucleic acid of claim 1 or fragment or derivative thereof.
22. A method for modulating N-SMase activity comprising
administering to human cells a modulation effective amount of an
isolated hu m an neutral sphingomyelinase of claim 18 or fragment
or derivative thereof.
23. A method for treating a disorder associated with N-SMase
comprising administering to a patient suffering from or susceptible
to such disorder an effective amount of an isolated nucleic acid of
claim 1 or fragment or derivative thereof.
24. The method of claim 23 wherein the disorder is an inflammatory
disorder, arthritis, osteroarthritis, Crohn's disease, obesity,
diabetes, cirrhosis, susceptible tumors, central nervous system
disorder, vascular restonsis, arterial occlusion arising from
plaque formation, cardiac disease where LV dysfunction occurs,
hyperchloesteroloemia, cholesteryl ester storage disorder, renal
failure, HIV infection, depression, schizophrenia,
neurodegeneration and Alzheimer's disease.
25. A method for treating a disorder associated with N-SMase
comprising administering to a patient suffering from or susceptible
to such disorder an effective amount of an isolated human neutral
sphingomyelinase of claim 18 or fragment or derivative thereof.
26. The method of claim 25 wherein the disorder is an inflammatory
disorder, arthritis, osteroarthritis, Crohn's disease, obesity,
diabetes, cirrhosis, susceptible tumors, central nervous system
disorder, vascular restonsis, arterial occlusion arising from
plaque formation, cardiac disease where LV dysfunction occurs,
hyperchloesteroloemia, cholesteryl ester storage disorder, renal
failure, HIV infection, depression, schizophrenia,
neurodegeneration and Alzheimer's disease.
27. A method of maintaining samples of sperm or seminal fluid
comprising providing a mixture comprising sperm or seminal fluid
and an effective amount of an a fragment or derivative of human
neutral sphingomyelinase.
28. The method of claim 27 wherein the mixture comprises human
sperm or seminal fluid.
29. A storage sample of sperm or seminal fluid comprising sperm or
seminal fluid and a storage effective amount of a fragment or
derivative of human neutral sphingomyelinase of claim 18.
30. A method to reduce TNF-.alpha. induced apoptosis of mammalian
cells comprising administering to a mammal an effective amount of
antibody against N-SMase or fragment or derivative thereof.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention relates to human neutral
sphingomyelinases (N-SMases), including recombinant N-SMases and
fragments and derivatives thereof and isolated nucleic acids
encoding N-SMases and fragments and derivatives. In preferred
aspects, assays for identifying compounds that can modulate N-SMase
related activity are provided, particularly assays to identify a
pharmacological agent useful in the diagnosis or treatment of
disorders associated with human neutral sphingomyelinases.
[0003] 2. Background
[0004] Sphingomyelinases type-C (E.C. 3.1.4.12) are a group of
phospholipases that catalyze the hydrolytic cleavage of
sphingomyelin via the following reaction (1).
Sphingomyelin.fwdarw.Ceramide+Phosphocholine (1)
[0005] Native N-SMase purified from human urine and cultured human
kidney proximal tubular cell membranes has an apparent molecular
weight of 92 kDa, neutral pH optima, is heat unstable and is
localized on the surface of various cells. S. Chatterjee, Adv.
Lipid Res., 26:25-48 (1993); S. Chatterjee et al., J. Biol. Chem.,
264:12,534-12,561 (1989); and S. Chatterjee et al., Methods in
Enzymology, Phospholipase, 197:540-547 (1991). N-SMase action has
been shown to mediate signal transduction of vitamin D.sub.3, tumor
necrosis factor-.alpha. (TNF-.alpha.), interferon-gamma and nerve
growth factor (Y. Hannun, J. Biol. Chem., 269:3,125-3,128 (1994);
S. Chatterjee, J. Biol. Chem., 268:3,401-3,406 (1993); and S.
Chatterjee, J. Biol. Chem., 269:879-882 (1994)) leading to cell
differentiation in human leukemic (HL-60) cells and insulin
signaling (P. Peraldi et al., J. Biol. Chem., 271:13018-13022
(1996)).
[0006] In addition to the biological roles of sphingomyelin and
ceramide in signal transduction pathways involving cell regulation,
recent evidence suggests that sphingomyelinases may be involved in
the mobilization of cell surface cholesterol, in cholesterol ester
synthesis, and in induction of low density lipoprotein (LDL)
receptor activity. See S. Chatterjee, Advances in Lipid Research,
26:25-48 (1993). Recent evidence also supports a possible role of
ceramide (a product of N-SMase activity) in programmed cell death
and/or "apoptosis" and activation of the gene for nuclear factor
(NF)-kB. See A. Alessenko and S. Chatterjee, Mol. Cell. Biochem.,
143:169-174 (1995). Sphingomyelinases are also believed to serve as
a signal for various exogenous effectors such as antibiotics,
drugs, and growth factors, which influence the normal physiology of
cells.
[0007] A number of specific disorders have been associated with
N-SMase. For example, N-SMase has been reported to be associated
with insulin resistant diabetes and obesity. See Speigel et al., J.
Biol. Chem., 1996. N-SMase is also associated with malaria. The
development of the malaria parasite plasmodium requires N-SMase.
See Lauer et al., Proc. Nat. Acad. Sci. (USA), 1995. N-SMase also
is involved in liver cell proliferation. See Alessenko, Chatterjee,
Mol. Cell Biochem., 143:169-174 (1995).
[0008] Thus, methods for identifying agents which can modulate
N-SMase activity would be highly useful. Moreover, methods for
identifying pharmacological agents of interest by automated, high
throughput drug screening have become increasing relied upon in a
variety of pharmaceutical and biotechnology drug development
programs. Unfortunately, however, requisite reagents for such high
throughput screening assays to identify agents potentially useful
in treatment of N-SMase associated disorders are not readily
available. For example, current methods for procuring N-SMase
include isolation of the protein from substantial quantities of
urine. See, for example, S. Chatterjee, J. Biol. Chem.,
264(21):12554 (1989).
[0009] It thus would be desirable to have a convenient source of
N-SMases. It also would be desirable to have agents that can
modulate N-SMase activity. It would be further desirable to have
effective assays for identifying compounds that have the potential
to modulate N-SMase activity or to diagnose or treat disorders
relating to N-SMase.
SUMMARY OF THE INVENTION
[0010] The present invention provides isolated nucleic acids that
encode human neutral sphingomyelinases (N-SMase) and N-SMase
fragments and derivatives capable of hybridizing to such
N-SMase-encoding nucleic acids. cDNA (SEQ ID NO:1) encoding human
N-SMase has been isolated and expressed to provide recombinant
N-SMase having an apparent molecular weight of 44 kDa.
[0011] The invention further provides isolated recombinant human
neutral sphingomyelinase (N-SMase) and N-SMase fragments and
derivatives.
[0012] The invention also provides novel assays for identifying
compounds useful in the diagnosis or treatment of human neutral
sphingomyelinase related disorders. Preferred compounds identified
through assays of the invention can modulate, particularly inhibit,
human neutral sphingomyelinase activity.
[0013] A variety of such assays are provided including, e.g.,
cleavage assays, direct binding assays, as well as assays that
identify a particular domain function. A preferred assay of the
invention comprises providing 1) an isolated human neutral
sphingomyelinase or a fragment or derivative thereof, 2) a human
neutral sphingomyelinase cleavage target such as sphingomyelin, and
3) a candidate pharmacological agent potentially useful in the
diagnosis or treatment of disease associated with human neutral
sphingomyelinase, which agents 1), 2) and 3) are typically assayed
in admixture. Those agents are suitably treated under conditions
whereby, but for the presence of the candidate pharmacological
agent, the N-SMase or fragment or derivative thereof selectively
cleaves the cleavage target to yield a cleavage product such as
ceramide. The agents are then analyzed for the presence of the
cleavage product, wherein the absence or reduced concentration
(e.g. relative to control, i.e. same mixture of agents 1) and 2)
but without the candidate agent 3)) of the cleavage product
indicates that the candidate pharmacological agent is capable of
modulating N-SMase activity, particularly inhibition of
sphingomyelin cleavage activity.
[0014] Agents identified through assays of the invention will have
potential for use in a number of therapeutic applications,
especially to modulate, particularly inhibit, expression or
activity of human neutral sphingomyelinase in particular cells.
Specific disorders that potentially could be treated by
administration of pharmacological agents identified through assays
of the invention include inflammatory disorders such as arthritis
and osteroarthritis, treatment of obesity and diabetes, treatment
of malignancies, and treatment of HIV. Identified agents also may
be useful for treatment of cirrhosis of the liver and other liver
diseases, to increase human plasma low density lipoproteins
receptors (to thereby reduce excessive cholesterol levels of a
subject), and for treatment of atherosclerosis.
[0015] Identified agents also may be useful for in vitro
fertilization applications, particularly to improve viability
and/or effective lifetime of sperm or seminal fluid samples during
storage. Identified agents also may be useful to treat or inhibit
undesired vascular restensosis e.g. subsequent to arterial plaque
removal. Identified agents also may be useful in the treatment of
central nervous system disorders such as treatment of depression,
schizophrenia and Alzheimer's disease, and treatment or prevention
or inhibition of neurodegeneration. Identified agents also may be
useful to prevent transmission of malaria by application of the
agent to areas frequented by malaria carriers to thereby prevent
development of the parasite plasmodium.
[0016] The invention further provides methods to modulate
expression or activity of N-SMase in particular cells through
administering to a patient in need thereof a therapeutically
effective amount of human neutral sphingomyelinase or N-SMase
fragment or derivative thereof or a nucleic acid encoding same.
Preferably, an N-SMase fragment or derivative or corresponding
nucleic acid is administered that contains only selected domains to
thereby modulate N-SMase activity as desired and without effects
associated with the deleted or otherwise altered domain(s). For
instance, as discussed in more detail below, it will be generally
preferred the TSLKVPA domain of N-SMase or corresponding nucleic
acid sequence will not be present in functional form in
administered peptides or nucleic acids.
[0017] Such therapeutic methods can be employed to treat subjects
susceptible to (i.e. prophylactic treatment) or suffering from
N-SMase related disorders including e.g. inflammatory disorders
such as arthritis and osteroarthritis, Crohn's disease, treatment
of obesity and diabetes, treatment of malignancies, particularly
cancers including susceptible solid tumors, treatment of HIV,
treatment of renal failure, and to prevent or inhibit transmission
of malaria. N-SMase or fragments or derivatives thereof, and
nucleic acids encoding same of the invention, also can be used for
treatment of cirrhosis of the liver and other liver diseases, and
to increase human plasma low density lipoproteins (LDL) receptors
and to thereby reduce excessive cholesterol levels. N-SMase or
fragments or derivatives thereof, and nucleic acids encoding same,
also may be used for treatment of atherosclerosis.
[0018] N-SMase or fragments or derivatives thereof, and nucleic
acids encoding same, also may be used for in vitro fertilization
applications, particularly to improve viability and/or effective
lifetime of sperm or seminal fluid samples during storage. In this
aspect, the invention provides sperm or seminal fluid in
combination with an N-SMase fragment or derivative to thereby
provide enhanced viability or lifetime of samples during the
storage period. The sperm or seminal fluid sample may be human, or
of other mammal such as horse, cattle or other livestock.
[0019] N-SMase or fragments or derivatives, and nucleic acids
encoding same, can be further employed to treat or inhibit
undesired vascular restensosis e.g. subsequent to arterial plaque
removal, and the treatment of central nervous system disorders such
as treatment of depression, schizophrenia and Alzheimer's disease,
and treatment or prevention or inhibition of neurodegeneration.
[0020] N-SMase or fragments or derivatives, and nucleic acids
encoding same, particularly fragment or derivatives and nucleic
acids that inhibit N-SMase activity, also may be administered to
treat a patient, particularly a human, suffering from or
susceptible to cardiac disease where LV dysfunction occurs,
including a patient, particularly a human, suffering from or
susceptible to heart failure.
[0021] Other aspects of the invention are disclosed infra.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 shows a nucleotide sequence (SEQ ID NO:1) of isolated
cDNA encoding human N-SMase.
[0023] FIG. 2 shows the deduced amino acid sequence (SEQ ID NO:2)
of human N-SMase. .diamond-solid. N-glycosylation site,
.circle-solid. tyrosine kinase phosphorylation site, protein kinase
phosphoryolation sites, casein kinase II phosphorylation sites,
.gradient. cyclic AMP and cyclic GMP dependent protein
phosphorylation sites, underline: myristoylation sites, * stop
codon.
[0024] FIG. 3 shows the hydropathy plot analysis of N-SMase.
[0025] FIGS. 4A and 4B show gel electrophoretic analysis of
recombinant N-SMase expressed in E. coli.
[0026] FIG. 4A shows a Comassie blue staining and
[0027] FIG. 4B shows Western immunoblot analysis.
[0028] FIG. 5 shows transient expression of recombinant N-SMase in
Cos-7 cells.
[0029] FIGS. 6A and 6B show Northern blot analyses of N-SMase.
[0030] FIG. 6A shows tissue distribution of N-SMase.
[0031] FIG. 6B shows transcript size of human kidney N-SMase.
[0032] FIG. 7 shows N-SMase activity in aortic smooth muscle cells
transiently transfected with cDNA for N-SMase.
[0033] FIGS. 8A, 8B and 8C show chromatin condensation in
transiently transfected aortic smooth muscle cells.
[0034] FIG. 8A shows control cells.
[0035] FIG. 8B shows PVS-SPOT.
[0036] FIG. 8C shows PHH1.
DETAILED DESCRIPTION OF THE INVENTION
[0037] We have now isolated cDNA encoding a human N-SMase. This
cDNA is represented by SEQ ID NO:1 (FIG. 1) and encodes a protein
that when expressed in E. coli cells has an apparent molecular
weight of 44 kDa as determined by polyacrylamide gel
electrophoresis using sodium laurylsarocine. That recombinant
protein is bound by an antibody against the 92 kDa native N-SMase.
Protein was also expressed in Cos-7 cells. The isolated and
purified recombinant N-SMase has been shown to have N-SMase
activity. See, for instance, the results disclosed in Example 1
which follows.
[0038] As discussed above, the ability to regulate N-SMase activity
in a particular environment is very important. Too high a level of
N-SMase or conversely too low a level of N-SMase can result in
undesired effects. For example, excessively high N-SMase levels can
result in apoptosis, while excessively low levels of N-SMase can
result in lack of cell proliferation or lack of LDL receptors.
Similarly, N-SMase expression in one cell type can be desirable in
leading to more efficient cholesterol processing, whereas its
expression in another cell type can be undesirable.
[0039] As discussed above, the invention provides methods to
modulate, including inhibition of, expression or activity of
N-SMase in particular cells. For example, one can use a N-SMase
nucleic acid segment operably linked to a N-SMase promoter to
selectively direct it to desired cells. As another example, one can
administer a N-SMase protein or fragment or derivative to modulate
N-SMase activity.
[0040] The invention further provides isolated N-SMase having an
amino acid sequence represented by SEQ ID NO:2 (FIG. 2), as well as
fragments or derivatives thereof.
[0041] The term "fragment" or "derivative" when referring to an
N-SMase protein means proteins or polypeptides which retain
essentially the same biological function or activity as the protein
of SEQ ID NO:2. For example, the N-SMase fragments or derivatives
of the present invention maintain at least about 50% of the
activity of the protein of SEQ ID NO:2, preferably at least 75%,
more preferably at least about 95% of the activity of the protein
of SEQ ID NO:2, as determined e.g. by a standard activity gel assay
such as the assay disclosed in Example 1, part 6, which follows and
includes measuring activity of the N-SMase peptide using
[.sup.14C]-sphingomyelin.
[0042] Fragments or derivatives as the term is used herein can
include competitors of the native N-SMase with respect to a
particular N-SMase domain activity. However, the fragment or
derivative shows an overall similarity to N-SMase in other areas as
explained herein.
[0043] An N-SMase fragment or derivative of the invention may be
(i) a peptide in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) a peptide in which one or more of the amino acid
residues includes a substituent group, or (iii) a peptide in which
the mature protein is fused with another compound, such as a
compound to increase the half-life of the polypeptide (for example,
polyethylene glycol). Thus, an N-SMase fragment or derivative
includes a proprotein which can be activated by cleavage of the
proprotein portion to produce an active mature polypeptide.
[0044] The protein fragments and derivatives of the invention are
of a sufficient length to uniquely identify a region of N-SMase.
N-SMase fragments and derivatives thus preferably comprise at least
8 amino acids, usually at least about 12 amino acids, more usually
at least about 15 amino acids, still more typically at least about
30 amino acids, even more typically at least about 50 or 70 amino
acids. Preferred N-SMase fragments or derivatives of the invention
include those that have at least about 70 percent homology
(sequence identity) to the protein of SEQ ID NO:2, more preferably
about 80 percent or more homology to the protein of SEQ ID NO:2,
still more preferably about 85 to 90 percent or more homology to
the protein of SEQ ID NO:2.
[0045] N-SMase and fragments and derivatives thereof of the
invention are "isolated", meaning the protein or peptide
constitutes at least about 70%, preferably at least about 85%, more
preferably at least about 90% and still more preferably at least
about 95% by weight of the total protein in a given sample. A
protein or peptide of the invention preferably is also at least 70%
free of immunoglobulin contaminants, more preferably at least 85%
free, still more preferably at least 90% free and even more
preferably at least 95% free of immunoglobulin contaminants. The
N-SMase fragments and derivatives may be present in a free state or
bound to other components, e.g. blocking groups to chemically
insulate reactive groups (e.g. amines, carboxyls, etc.) of the
peptide, or fusion peptides or polypeptides (i.e. the peptide may
be present as a portion of a larger polypeptide).
[0046] As discussed above, N-SMase nucleic acid fragments and
derivatives are also provided. Those fragments and derivatives are
of a length sufficient to bind to the sequence of SEQ ID NO:1 under
the following moderately stringent conditions (referred to herein
as "normal stringency" conditions): use of a hybridization buffer
comprising 20% formamide in 0.8M saline/0.08M sodium citrate (SSC)
buffer at a temperature of 37.degree. C. and remaining bound when
subject to washing once with that SSC buffer at 37.degree. C.
[0047] Preferred N-SMase nucleic acid fragments and derivatives of
the invention will bind to the sequence of SEQ ID NO:1 under the
following highly stringent conditions (referred to herein as "high
stringency" conditions): use of a hybridization buffer comprising
20% formamide in 0.9M saline/0.09M sodium citrate (SSC) buffer at a
temperature of 42.degree. C. and remaining bound when subject to
washing twice with that SSC buffer at 42.degree. C.
[0048] These nucleic acid fragments and derivatives preferably
should comprise at least 20 base pairs, more preferably at least
about 50 base pairs, and still more preferably a nucleic acid
fragment or derivative of the invention comprises at least about
100, 200, 300, 400, 500 or 800 base pairs. In some preferred
embodiments, the nucleic acid fragment or derivative is bound to
some moiety which permits ready identification such as a
radionucleotide, fluorescent or other chemical identifier.
[0049] N-SMase will have a number of functional domains, e.g., a
TNF-.alpha. 55kDa receptor/Fas Apo(o)-1 domain, the sterol
regulator element binding protein (SREBP) domain, etc. N-SMase of
FIG. 2 also has a domain (TSLKVPA, residues 258-264 of FIG. 1; SEQ
ID NO:3) homologous to the Staphyococcal enterotoxin-B peptide
domain (RSITVRV; SEQ ID NO:4), which domain has been reported to
elicit toxic effects in human kidney cells. Accordingly, preferred
N-SMase fragments and derivatives do not include that TSLKVPA
domain in functional form. Other N-SMase domains can be readily
identified by standard techniques such as deletion analysis.
[0050] In a similar manner, one can readily identify a deletion,
addition or substitution that will inactivate a particular domain,
e.g. by simply testing a fragment or derivative with altered domain
to determine if the fragment or derivative exhibits activity
associated with the altered domain. Any of a variety of tests can
be employed, such as e.g. the in vitro tests of Example 1 which
follows.
[0051] Thus, an N-SMase protein or nucleic acid fragment or
derivative can be employed that contains only specific domains and
can be administered to a subject such as a mammal to modulate
N-SMase activity in targeted cells as desired.
[0052] Preferred N-SMase protein and nucleic acid fragments and
derivatives include at least one functional domain region, e.g. the
TNF-.alpha. binding domain, the SREBP domain or the sphingomyelin
cleavage domain. Particularly preferred fragments and derivatives
comprise one or more conserved peptides or corresponding nucleic
acid sequences of at least one functional domain region.
[0053] Several apparent isoforms of human N-SMase exist that can be
distinguished based on physical-chemical criteria, including
electrophoretic migration rates, reactions against antibody of
N-SMase and reactions to metals including copper, lithium and
magnesium. The N-SMase and fragments and derivatives thereof of the
present invention, and nucleic acids encoding same, include such
isoforms.
[0054] Isolated N-SMase and peptide fragments or derivatives of the
invention are preferably produced by recombinant methods. See the
procedures disclosed in Example 1 which follows. A wide variety of
molecular and biochemical methods are available for generating and
expressing the N-SMase of the present invention; see e.g. the
procedures disclosed in Molecular Cloning, A Laboratory Manual (2nd
Ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor), Current
Protocols in Molecular Biology (Eds. Aufubel, Brent, Kingston,
More, Feidman, Smith and Stuhl, Greene Publ. Assoc.,
Wiley-Interscience, NY, N.Y. 1992) or other procedures that are
otherwise known in the art. For example, N-SMase or fragments
thereof may be obtained by chemical synthesis, expression in
bacteria such as E. coli and eukaryotes such as yeast, baculovirus,
or mammalian cell-based expression systems, etc., depending on the
size, nature and quantity of the N-SMase or fragment. The use of
mammalian-based expression systems, particularly human, is
particularly preferred where the peptide is to be used
therapeutically.
[0055] Nucleic acids encoding the novel N-SMase of the present
invention and fragments and derivatives thereof may be part of
N-SMase expression vectors and may be incorporated into recombinant
cells for expression and screening, transgenic animals for
functional studies (e.g. the efficacy of candidate drugs for
disease associated with expression of a N-SMase), etc. Nucleic
acids encoding N-SMase containing proteins are isolated from
eukaryotic cells, preferably human cells, by screening cDNA
libraries with probes or PCR primers derived from the disclosed
N-SMase cDNAs.
[0056] The nucleic acids of the present invention are isolated,
meaning the nucleic acids comprise a sequence joined to a
nucleotide other than that which it is joined to on a natural
chromosome and usually constitutes at least about 0.5%, preferably
at least about 2%, and more preferably at least about 5% by weight
of total nucleic acid present in a given fraction. A partially pure
nucleic acid constitutes at least about 10%, preferably at least
about 30%, and more preferably at least about 60% by weight of
total nucleic acid present in a given fraction. A pure nucleic acid
constitutes at least about 80%, preferably at least about 90%, and
more preferably at least about 95% by weight of total nucleic acid
present in a given fraction.
[0057] The nucleic acids of the present invention find a wide
variety of applications including: use as translatable transcripts,
hybridization probes, PCR primers, therapeutic nucleic acids, etc.;
use in detecting the presence of N-SMase genes and gene
transcripts; use in detecting or amplifying nucleic acids encoding
additional N-SMase homologs and structural analogs; and use in gene
therapy applications.
[0058] For example, N-SMase nucleic acids can be used to modulate
cellular expression or intracellular concentration or availability
of active N-SMase. Thus, for example, N-SMase has been shown to be
involved in liver cell proliferation (Alessenko and Chatterjee,
Mol. Cell. Biochem. 143:119-174, (1995)), and thus N-SMase nucleic
acids may be used to treat liver diseases such as cirrhosis.
[0059] To inhibit N-SMase activity, nucleic acid encoding a
competitor or an antagonist can be administered to a subject. One
preferred embodiment employs nucleic acid encoding an N-SMase
derivative that acts as a competitor or an antagonist. For example,
dependent upon the N-SMase activity desired to be inhibited, the
N-SMase domain responsible for that activity can be appropriately
altered (e.g. deleted or mutated), whereby the protein will still
display the desired activity, but will not exhibit the undesired
activity. Moreover, the altered protein can compete with the native
N-SMase to thereby inhibit the undesired activity.
[0060] Further, to reduce N-SMase activity, nucleic acids capable
of inhibiting translation of N-SMase also may be administered.
These nucleic acids are typically antisense: single-stranded
sequences comprising complements of the disclosed relevant N-SMase
fragment-encoding nucleic acid. Antisense modulation of the
expression of a given N-SMase fragment containing protein may
employ N-SMase fragment antisense nucleic acids operably linked to
gene regulatory sequences. Cells are transfected with a vector
comprising an N-SMase fragment sequence with a promoter sequence
oriented such that transcription of the gene yields an antisense
transcript capable of binding to endogenous N-SMase fragment
containing protein encoding mRNA. Transcription of the antisense
nucleic acid may be constitutive or inducible and the vector may
provide for stable extrachromosomal maintenance or integration.
Alternatively, single-stranded antisense nucleic acids that bind to
genomic DNA or mRNA encoding a given N-SMase fragment containing
protein may be administered to the target cell, in or temporarily
isolated from a host, at a concentration that results in a
substantial reduction in expression of the N-SMase.
[0061] The N-SMase nucleic acids are introduced into the target
cell by any method which will result in the uptake and expression
of the nucleic acid by the target cells. These can include vectors,
liposomes, naked DNA, adjuvant-assisted DNA, catheters, etc.
Vectors include chemical conjugates such as described in WO
93/04701, which has targeting moiety (e.g. a ligand to a cellular
surface receptor), and a nucleic acid binding moiety (e.g.
polylysine), viral vector (e.g. a DNA or RNA viral vector), fusion
proteins such as described in PCT/US 95/02140 (WO 95/22618) which
is a fusion protein containing a target moiety (e.g. an antibody
specific for a target cell) and a nucleic acid binding moiety (e.g.
a protamine), plasmids, phage, etc. The vectors can be chromosomal,
non-chromosomal or synthetic.
[0062] Preferred vectors include viral vectors, fusion proteins and
chemical conjugates. Retroviral vectors include moloney murine
leukemia viruses. DNA viral vectors are preferred. These vectors
include pox vectors such as orthopox or avipox vectors, herpes
virus vectors such as a herpes simplex I virus (HSV) vector [A. I.
Geller et al., J. Neurochem, 64:487 (1995); F. Lim et al., in DNA
Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press,
Oxford England) (1995); A. I. Geller et al., Proc Natl. Acad. Sci.:
U.S.A.: 90 7603 (1993); A. I. Geller et al., Proc Natl. Acad. Sci
USA: 87:1149 (1990)], Adenovirus Vectors [LeGal LaSalle et al.,
Science, 259:988 (1993); Davidson, et al., Nat. Genet., 3:219
(1993); Yang et al., J. Virol., 69: 2004 (1995)] and
Adeno-associated Virus Vectors [Kaplitt, M. G., et al., Nat.
Genet., 8:148 (1994)].
[0063] Pox viral vectors introduce the gene into the cells
cytoplasm. Avipox virus vectors result in only a short term
expression of the nucleic acid. Adenovirus vectors,
adeno-associated virus vectors and herpes simplex virus (HSV)
vectors are preferred for introducing the nucleic acid into neural
cells. The adenovirus vector results in a shorter term expression
(about 2 months) than adeno-associated virus (about 4 months),
which in turn is shorter than HSV vectors. The particular vector
chosen will depend upon the target cell and the condition being
treated. The introduction can be by standard techniques, e.g.
infection, transfection, transduction or transformation. Examples
of modes of gene transfer include e.g., naked DNA,
Ca.sub.3(PO.sub.4).sub.2 precipitation, DEAE dextran,
electroporation, protoplast fusion, lipofecton, cell
microinjection, and viral vectors.
[0064] The vector can be employed to target essentially any desired
target cell, such as a glioma. For example, stereotaxic injection
can be used to direct the vectors (e.g. adenovirus, HSV) to a
desired location. Additionally, the particles can be delivered by
intracerebroventricular (icv) infusion using a minipump infusion
system, such as a SynchroMed Infusion System. A method based on
bulk flow, termed convection, has also proven effective at
delivering large molecules to extended areas of the brain and may
be useful in delivering the vector to the target cell (Bobo et al.,
Proc. Natl. Acad. Sci. USA, 91:2076-2080 (1994); Morrison et al.,
Am. J. Physiol., 266: 292-305 (1994)). Other methods that can be
used include catheters, intravenous, parenteral, intraperitoneal
and subcutaneous injection, and oral or other known routes of
administration.
[0065] The invention provides efficient screening methods to
identify pharmacological agents or lead compounds for agents which
modulate, e.g. interfere with or increase an N-SMase activity. The
methods are amenable to automated, cost-effective high throughput
drug screening and have immediate application in a broad range of
pharmaceutical drug development programs.
[0066] A wide variety of assays are provided including, e.g.,
cleavage assays, direct binding assays as well as assays to
identify a particular domain function.
[0067] A preferred assay mixture of the invention comprises at
least a portion of the N-SMase capable of cleaving a N-SMase
cleavage target, e.g. sphingomyelin. An assay mixture of the
invention also comprises a candidate pharmacological agent.
Generally a plurality of assay mixtures are run in parallel with
different candidate agent concentrations to obtain a differential
response to the various concentrations. Typically, one of these
assay mixtures serves as a negative control, i.e. at zero
concentration or below the limits of assay detection. Candidate
agents encompass numerous chemical classes, though typically they
are organic compounds and preferably small organic compounds. Small
organic compounds suitably may have e.g. a molecular weight of more
than about 50 yet less than about 2,500. Candidate agents may
comprise functional chemical groups that interact with proteins
and/or DNA.
[0068] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides. Alternatively, libraries
of natural compounds in the form of bacterial, fungal, plant and
animal extracts are available or readily produced.
[0069] Additionally, natural and synthetically produced libraries
and compounds are readily modified through conventional chemical,
physical, and biochemical means. In addition, known pharmacological
agents may be subject to directed or random chemical modifications,
such as acylation, alkylation, esterification, amidification,
etc.
[0070] A variety of other reagents may also be included in the
mixture. These include reagents such as salts, buffers, neutral
proteins, e.g. albumin, detergents, etc. which may be used to
facilitate optimal protein-protein and/or protein-nucleic acid
binding and/or reduce non-specific or background interactions, etc.
Also, reagents that otherwise improve the efficiency of the assay,
such as protease inhibitors, nuclease inhibitors, antimicrobial
agents, etc. may be used.
[0071] The resultant mixture is incubated under conditions whereby,
but for the presence of the candidate pharmacological agent, the
N-SMase or fragment or derivative thereof cleaves the cleavage
target. The mixture components can be added in any order that
provides for the requisite bindings. Incubations may be performed
at any temperature which facilitates optimal binding, typically
between 4.degree. and 40.degree. C., more commonly between
15.degree. and 40.degree. C. Incubation periods are likewise
selected for optimal binding but also minimized to facilitate
rapid, high throughput screening, and are typically between 0.1 and
10 hours, preferably less than 5 hours, more preferably less than 2
hours.
[0072] After incubation, the presence or absence of the cleavage
product is detected by any convenient way. For cell-free type
assays, the cleavage target may be bound to a solid substrate and
the cleavage product labelled, e.g., radiolabelled. A separation
step can be used to separate the bound-target from unbound cleavage
product. The separation step may be accomplished in a variety of
ways known in the art. The solid substrate may be made of a wide
variety of materials and in a wide variety of shapes, e.g.
microtiter plate, microbead, dipstick, resin particle, etc. The
substrate is chosen to maximize signal to noise ratios, to minimize
background binding, to facilitate washing and to minimize cost.
[0073] Separation may be effected for example, by removing a bead
or dipstick from a reservoir, emptying or diluting a reservoir such
as a microtiter plate well, rinsing a bead (e.g. beads with iron
cores may be readily isolated and washed using magnets), particle,
chromatographic column or filter with a wash solution or solvent.
Typically, the separation step will include an extended rinse or
wash or a plurality of rinses or washes. For example, where the
solid substrate is a microtiter plate, the wells may be washed
several times with a washing solution, which typically includes
those components of the incubation mixture that do not participate
in specific binding such as salts, buffer, detergent, nonspecific
protein, etc. may exploit a polypeptide specific binding reagent
such as an antibody or receptor specific to a ligand of the
polypeptide.
[0074] As mentioned, detection may be effected in any convenient
way, and for cell-free assays, one of the components usually
comprises or is coupled to a label. Essentially any label can be
used that provides for detection. The label may provide for direct
detection as radioactivity, luminescence, optical or electron
density, etc. or indirect detection such as an epitope tag, an
enzyme, etc. The label may be appended to a reagent or incorporated
into the peptide structure, e.g. in the case of a peptide reagent,
a methionine residue comprising a radioactive isotope of
sulfur.
[0075] A variety of methods may be used to detect the label
depending on the nature of the label and other assay components.
For example, the label may be detected bound to the solid substrate
or a portion of the bound complex containing the label may be
separated from the solid substrate, and thereafter the label
detected. Labels may be directly detected through optical or
electron density, radiative emissions, nonradiative energy
transfers, etc. or indirectly detected with antibody conjugates,
etc. For example, in the case of radioactive labels, emissions may
be detected directly, e.g. with particle counters or indirectly,
e.g. with scintillation cocktails and counters.
[0076] The assays of the invention are particularly suited to
automated high throughput drug screening. In a particular
embodiment, an automated mechanism, e.g. a mechanized arm,
retrieves and transfers a microtiter plate to a liquid dispensing
station where measured aliquots of each of an incubation buffer and
a solution comprising one or more candidate agents are deposited
into each designated well. The arm then retrieves and transfers to
and deposits in designated wells a measured aliquot of a solution
comprising a N-SMase protein or fragment or derivative thereof as
well as solutions of other reagents such as a cleavage target.
Thereafter, the arm transfers the microtiter plate to an analysis
station where the reaction mixture can be analyzed for the presence
or absence of various reaction products.
[0077] A preferred assay is disclosed in Example 2 which follows
and which includes application of labeled sphingomyelin
([.sup.14C]sphingomyelin) to a solid substrate such as a multi-well
tray together with N-SMase.
[0078] As discussed above, N-SMase or fragments or derivatives
thereof, and nucleic acids encoding same, also may be used for in
vitro fertilization applications, particularly to improve viability
and/or effective lifetime of sperm or seminal fluid samples during
storage.
[0079] In this aspect, the invention also provides stored samples
of human or other mammal such as cattle or horse sperm or seminal
fluid in combination with an N-SMase fragment or derivative to
thereby provide enhanced viability or lifetime of samples during
the storage period.
[0080] For example, a sperm or seminal fluid storage unit of the
invention may suitably comprise-an N-SMase fragment or derivative
of the invention in combination with a sperm or seminal fluid
sample. That mixture also may optionally comprise a buffer or
diluent as may be used with such samples. The N-SMase fragment or
derivative preferably will be present in an amount sufficient to
enhance the viability of lifetime of the sperm or seminal fluid
sample during the storage period. Such storage effective amount
amounts can be readily determined empirically for the particular
N-SMase fragment or derivative employed. Storage effective amounts
suitably may be at least about 0.01 weight percent of N-SMase
derivative or fragment thereof based on total weight of the storage
sample, more preferably at least about 0.05 weight percent. The
sperm or seminal fluid sample may be human or of other mammal, e.g.
horse, cattle or other livestock sample. The storage unit may
suitably be a sterile cryovial or other vessel as conventionally
employed to store sperm and seminal fluid.
[0081] The proteins and nucleic acids and fragments and derivatives
thereof of the invention also may be used to generate immune
responses. For example, it has been found that in certain instances
where inappropriate expression of a self-protein is occurring an
immune reaction can be useful. The nucleic acid permits the
creation of unique peptides that can generate such a reaction. The
characteristics needed to generate a peptide that will induce a MHC
class I or II reaction are known and suitable peptides having such
characteristics can be readily prepared based upon the present
disclosure.
[0082] Antibodies also can be prepared that will bind to one or
more particular domains of a peptide of the invention and can be
used to modulate N-SMase activity. Moreover, administration of an
antibody against N-SMase or fragment or derivative thereof,
preferably monoclonal or monospecific, to mammalian cells
(including human cells) can reduce or abrogate TNF-.alpha. induced
cell death (apoptosis) and the invention includes such therapeutic
methods. In such methods, antibody against N-SMase can be
administered to a mammal (including a human) by known procedures.
It has been specifically found that apoptosis of human leukemic
(HL-60) cells expressing N-SMase was abrogated by treatment with
antibody against N-SMase.
[0083] The preferred therapeutic methods of the invention (which
include prophylactic treatment) in general comprise administration
of a therapeutically effective amount of N-SMase or fragment or
derivative thereof, or nucleic acid encoding same, to an animal in
need thereof, including a mammal, particularly a human. Such
treatment will be suitably administered to subjects, particularly
humans, suffering from or susceptible to one of the above discussed
disorders, including inflammatory disorders such as arthritis,
osteroarthritis and Crohn's disease, obesity, diabetes,
malignancies, particularly cancers including susceptible solid
tumors, HIV, liver disorders including cirrhosis, excessive
cholesterol levels, renal failure, cholesteryl ester storage
disorder, cardiac disease associated with LV dysfunction,
atherosclerosis, undesired vascular restensosis, neurodegeneration,
and central nervous system disorders such as depression,
schizophrenia and Alzheimer's disease.
[0084] For therapeutic applications, peptides and nucleic acids of
the invention may be suitably administered to a subject such as a
mammal, particularly a human, alone or as part of a pharmaceutical
composition, comprising the peptide or nucleic acid together with
one or more acceptable carriers thereof and optionally other
therapeutic ingredients. The carrier(s) must be "acceptable" in the
sense of being compatible with the other ingredients of the
formulation and not deleterious to the recipient thereof.
[0085] The pharmaceutical compositions of the invention include
those suitable for oral, rectal, nasal, topical (including buccal
and sublingual), vaginal or parenteral (including subcutaneous,
intramuscular, intravenous and intradermal) administration. The
formulations may conveniently be presented in unit dosage form,
e.g., tablets and sustained release capsules, and in liposomes, and
may be prepared by any methods well know in the art of pharmacy.
See, for example, Remington's Pharmaceutical Sciences, Mack
Publishing Company, Philadelphia, Pa. (17th ed. 1985).
[0086] Such preparative methods include the step of bringing into
association with the molecule to be administered ingredients such
as the carrier which constitutes one or more accessory ingredients.
In general, the compositions are prepared by uniformly and
intimately bringing into association the active ingredients with
liquid carriers, liposomes or finely divided solid carriers or
both, and then if necessary shaping the product.
[0087] Compositions of the present invention suitable for oral
administration may be presented as discrete units such as capsules,
cachets or tablets each containing a predetermined amount of the
active ingredient; as a powder or granules; as a solution or a
suspension in an aqueous liquid or a non-aqueous liquid; or as an
oil-in-water liquid emulsion or a water-in-oil liquid emulsion, or
packed in liposomes and as a bolus, etc.
[0088] A tablet may be made by compression or molding, optionally
with one or more accessory ingredients. Compressed tablets may be
prepared by compressing in a suitable machine the active ingredient
in a free-flowing form such as a powder or granules, optionally
mixed with a binder, lubricant, inert diluent, preservative,
surface-active or dispersing agent. Molded tablets may be made by
molding in a suitable machine a mixture of the powdered compound
moistened with an inert liquid diluent. The tablets optionally may
be coated or scored and may be formulated so as to provide slow or
controlled release of the active ingredient therein.
[0089] Compositions suitable for topical administration include
lozenges comprising the ingredients in a flavored basis, usually
sucrose and acacia or tragacanth; and pastilles comprising the
active ingredient in an inert basis such as gelatin and glycerin,
or sucrose and acacia.
[0090] Compositions suitable for parenteral administration include
aqueous and non-aqueous sterile injection solutions which may
contain anti-oxidants, buffers, bacteriostats and solutes which
render the formulation isotonic with the blood of the intended
recipient; and aqueous and non-aqueous sterile suspensions which
may include suspending agents and thickening agents. The
formulations may be presented in unit-dose or multi-dose
containers, for example, sealed ampules and vials, and may be
stored in a freeze dried (lyophilized) condition requiring only the
addition of the sterile liquid carrier, for example water for
injections, immediately prior to use. Extemporaneous injection
solutions and suspensions may be prepared from sterile powders,
granules and tablets.
[0091] Application of the subject therapeutics often will be local,
so as to be administered at the site of interest. Various
techniques can be used for providing the subject compositions at
the site of interest, such as injection, use of catheters, trocars,
projectiles, pluronic gel, stents, sustained drug release polymers
or other device which provides for internal access. Where an organ
or tissue is accessible because of removal from the patient, such
organ or tissue may be bathed in a medium containing the subject
compositions, the subject compositions may be painted onto the
organ, or may be applied in any convenient way. Systemic
administration of a nucleic acid using lipofection, liposomes with
tissue targeting (e.g. antibody) may also be employed.
[0092] It will be appreciated that actual preferred amounts of a
given peptide or nucleic acid of the invention used in a given
therapy will vary to the particular active peptide or nucleic acid
being utilized, the particular compositions formulated, the mode of
application, the particular site of administration, the patient's
weight, general health, sex, etc., the particular indication being
treated, etc. and other such factors that are recognized by those
skilled in the art including the attendant physician or
veterinarian. Optimal administration rates for a given protocol of
administration can be readily determined by those skilled in the
art using conventional dosage determination tests.
[0093] The present invention is further illustrated by the
following Examples. These Examples are provided to aid in the
understanding of the invention and are not construed as a
limitation thereof.
EXAMPLE 1
Cloning and Expression of Human Neutral Sphingomyelinase
[0094] 1. Purification of Human Neutral Sphingomyelinase and
Preparation of Antibodies.
[0095] Neutral sphingomyelinase (N-SMase) was prepared from human
urine and polyclonal antibodies against that enzyme were raised in
rabbits as described previously by S. Chatterjee et al., J. Biol.
Chem., 264:12,534-12,561 (1989). Monospecific polyclonal antibodies
against N-SMase were prepared by appropriate immuno-affinity
absorption techniques as described in J. Biol. Chem.,
264:12,534-12,561 (1989).
[0096] 2. Screening of cDNA Library.
[0097] The human kidney library was purchased from Clontech (Palo
Alto, Calif.) and was screened using anti-N-SMase described above
according to the manufacturers protocol. Briefly, the .lambda.gt11
phage was plated at 3.times.10.sup.4 pfu/150 mm plate on a lawn of
E.Coli strain y1090r. Incubation was carried out at 42.degree. C.
for 3.5 hrs to allow lytic phage growth. Then, a filter saturated
with 10 mM IPTG was placed on top of the plate and incubated
overnight at 37.degree. C. Next, the filter was blocked with a
solution of 5% non-fat dry milk for 1 hr at room temperature. Next,
the filter was incubated with antibody against N-SMase at 1:200
dilution at room temperature overnight, and signal was detected by
enhanced chemiluminence technique (ECL, Amersham). Sixty-three
clones were obtained by screening 1.times.10.sup.6 .lambda.gt11
phage clones. The most intense clones of cells were subjected to
secondary and tertiary screening. All positive clones were subject
to PCR to identify their insert size. Finally, a clone containing
the longest insert (3.7 kb) referred to as .lambda. .sup.32-1 was
used for further analysis by subcloning, sequencing and
expression.
[0098] 3. Preparation of Fusion Proteins.
[0099] The protocol as described by the manufacturer's manual
(Biotech, #5, 1992, pg. 636) was followed. By this procedure, the
host growing in the logarithmic phase was infected with phage and
incubated for 2 hr at 30.degree. C. Next, IPTG (10 mM) was added
and incubation continued at 37.degree. C. The cell cultures were
removed at 0, 15 min., 30 min., 45 min., 1 hr, 2 hr, 4 hr and 24
hr. The cells were centrifuged, washed with PBS, and stored frozen
for N-SMase activity measurement.
[0100] 4. Subcloning and Sequencing of N-SMase cDNA.
[0101] First, the .lambda. .sup.32-1 DNA was purified with the
Magical Lambda preps DNA purification system from Promega by
following the manufacturer's manual. Then, it was digested with the
restriction endonucleosidase EcoRI. The 3.7 kb insert was gel
purified and subcloned into the EcoRI site of the vector
pBluescriptII-SK (Stratagene, La Jolla, Calif.). The plasmid, thus
generated was termed pBC32-2, and was purified using QIAGEN's DNA
purification system. The N-SMase cDNA insert was sequenced with
Sequenase using T7 and T3 primers by automatic sequence machine
Model 373A (Applied Biosystems).
[0102] 5. Transient Expression of N-SMase in Cos-7 Cells.
[0103] To put N-SMase cDNA into a transient expression vector, the
pBC32-2 was double digested with restriction endonucleosidases NotI
and SalI. The 3.6 kb insert containing N-SMase was gel purified and
inserted into a transient expression vector PSV-SPOT-1 (BRL). Thus,
a plasmid called pHH.sub.1 was constructed.
[0104] To transfect Cos-7 cells with pHH.sub.1 and mock vector,
3.times.10.sup.5 Cos-1 cells/plate in a p100 plate in 8 ml of
Dulbecco's modified Eagle's medium (D-MEM) were seeded with 10% FCS
(Bethesda Research Laboratory; BRL). Cells were incubated in a 10%
CO.sub.2 37.degree. C. incubator until they are 80% confluent. The
cells were then transfected with 10 .mu.g of purified pHHI (QIAGEN)
using LipoFectamine.TM. (BRL) in medium. Medium was changed after 5
hours of incubation. Finally, the cells were harvested at various
time points (16 hr, 24 hr, 36 hr, and 48 hr, post transfection) by
centrifugation at 1500.times. g for 10 min., washed with phosphate
buffered saline (PBS) and stored frozen at -20.degree. C.
[0105] 6. Activity Gel Assay of N-SMase Expression in Transfected
Cos-7 Cells.
[0106] Both the bacterial cells and Cos-7 cells transfected with
N-SMase cDNA were homogenized in Tris-glycine buffer (pH 7.4)
containing 0.1% cutscum. The samples were mixed vigorously and
sonicated for 10 sec. Next, the samples were transferred to a
4.degree. C. incubator and shaken for about 2 hours. Every hour,
the samples were sonicated again on ice and further shaken.
Subsequently, the samples were centrifuged at 10,000.times. g for
10 min. The supernatants were collected, the protein content was
measured and subjected to polyacrylamide gel electrophoresis using
sodium laurylsarcosine. Subsequent to electrophoresis, the gel was
sliced into several pieces and the activity of N-SMase was measured
using [.sup.14C]-sphingomyelin as a substrate (see T. Taki and S.
Chatterjee, Analyt. Biochem., 224:490-493 (1995)).
[0107] 7. Measurement of Sphingomyelinase Activity in Aortic Smooth
Muscle Cells Transiently Transfected With N-SMase cDNA.
[0108] The activity of sphingomyelinase was measured in aortic
smooth muscle cell extracts transiently transfected with pSVSPOT
(mock cDNA) and pHH1 (cDNA for N-SMase) as shown previously in P.
Ghosh and S. Chatterjee, J. Biol. Chem., 262:12,550-12,556 (1987)).
Briefly, the cell extracts (100 .mu.g protein) were incubated with
cutscum, MgCl.sub.2, human serum albumin and Tris glycine buffer
(pH 7.4) plus [.sup.14C]-sphingomyelin (15,000 cpm) for 1 hr at
37.degree. C. The reaction was terminated with 1 ml of 10% TCA and
centrifuged. The supernatant was extracted with diethylether and
the aqueous layer was withdrawn to measure radioactivity.
[0109] 8. Reverse Transcriptase-polymerase Chain Reaction.
[0110] Human kidney cells were seeded (1.times.10.sup.5 cell/plate
in p100 plates) and grown to confluence in complete medium with 10%
fetal calf serum. Total RNA was isolated by acid guanidium
thiocyanate-phenol-chloro- form extraction. 1 .mu.g of total RNA
was used to synthesize first strand cDNA using 20 pmol random
hexamer primer, 200 units moloney murine leukemia virus reverse
transcriptase, 0.5 mM each of deoxynucleotide triphosphates
(Clontech, Palo Alto, Calif.) in buffer containing 50 mM Tris-HCl,
75 mM KCl, 3 MM MgCl.sub.2, and 0.5 units of RNAse inhibitor, pH
8.3 at 42.degree. C. for 1 hour. 1 .mu.l of 1:100 dilution of cDNA
products was used to run PCR in 50 .mu.l reaction mixture
containing 0.2 mM each of dNTP, 2.0 units of Taq polymerase, 0.4 uM
of each primers, 10 mM Tris HCl, 50 mM KCl, and 1.5 mM MgCl.sub.2
(pH 8.3). The PCR was run for 35 cycles (30 s at 94.degree. C., 30
s at 55.degree. C. and 30 s at 72.degree. C.) using a Perkin-Elmer
Thermocycler.
[0111] 9. Northern Blot Analysis.
[0112] One set of sequence primers from pBC32-2, T3-2/4T3R5, as
RT-PCR primer was selected to conduct RT-PCR as described above.
The 18-mer primers had the following sequence: TTGCGGCACTATTAGGTG
(SEQ ID NO:5) and CGCCAATGCCAAAACGTA (SEQ ID NO:6). A 465 bp
specific product was obtained, and gel purified. 50 ng of this
product was labeled with 25 .mu.Ci [.alpha.-.sup.32P] dATP and 25
.mu.Ci [.alpha.-.sup.32P] dCTP using Random hexamer primers (BRL).
The specific activity of this probe was 1.88.times.10.sup.9
cpm/.mu.g. Next, the multiple tissue northern blot (Clontech; Palo
Alto, Calif.) were hybridized with this probe (2.times.10) at
50.degree. C. overnight with hybridization buffer. Next, the blots
were washed twice in 2.times. SSC, 0.05% SDS at room temperature
for 30-40 min, then in 0.1.times. SSC and 0.05% SDS for 40 min. at
50.degree. C. Finally, the blot was exposed to an x-ray film at
-70.degree. C. using two intensifying screens overnight.
[0113] 10. Expression and Purification of Glutathione-S-Transferase
(GST)-NSMase Fusion Protein in E.Coli.
[0114] To prepare GST-NSMase fusion protein, an expression plasmid
pJK2, pBC32-2 was digested with BssHII and EcoRI. A 2793 bp insert
representing N-SMase open reading frame that is missing 18 bp
N-terminal sequence, was ligated with a phosphorylated BamHI-BssHII
linker containing the N-terminal sequence of
GATCCATGATGACATATCACGAAACGCGCGTTTCGTGATA TGTCATCATG (SEQ ID NO:7)
and a pGEX4T-1 vector double digested with BamHI and EcoRI
(Phamacia; Piscataway, N.J.). To express and purify GST-N-SMase
fusion protein, plasmid pJK2 was transformed into E.Coli (HB101)
cells. A single colony of HB101 [pJK2] was grown in 2X YTA medium
at 30.degree. C. until appropriate cell density (A600=1.5) was
achieved. IPTG (0.1M) was added to induce fusion protein expression
for 2 hours. Cells were harvested and the fusion protein was
purified using Glutathione Sepharose-4B chromatography according to
instructions provided by the manufacturer. N-SMase was released
from the fusion protein by thrombin digestion. Such preparations
were subjected to activity measurements and western immunoblot
assays.
[0115] 11. Coomassie Blue Staining and Western Immunoblot Assays of
r-N-SMase.
[0116] 20 .mu.g of purified r-N-SMase was subjected to
electrophoresis on 12.5% SDS-PAGE gel. One gel was stained with
Coomassie blue according to standard protocol. Another gel were
transferred onto a PVDF membrane. Next, the polyvinyldiflouride
(PVDF) membrane was blocked with 1% bovine serum albumin in TBS-T,
incubated with anti-N-SMase at a dilution of 1:200 and developed
with horse radish peroxidase (see S. Chatterjee et al., J. Biol.
Chem., 264:12,534-12,561 (1989)).
[0117] 12. Measurement of Apoptosis in Aortic Smooth Muscle cells
Transfected With cDNA for N-SMase.
[0118] Aortic smooth muscle cells transiently transfected with
PVSPOT (mock cDNA) and pHH1 (cDNA for N-SMase) for 24 hours were
solubilized and subjected to agarose gel electrophoresis (2 hr at
90 volts) for DNA fragamentation analysis.
[0119] Another set of cells transfected with cDNA were subjected to
staining with the DNA-binding florochrome bis-benzimidine (Hoescht
323288; Sigma Chemical Co., St. Louis, Mo.). Briefly, transfected
cells grown on glass cover slips were washed with PBS. The cells
were fixed with 3% paraformaldehyde in PBS and incubated for 10 min
at room temperature. The cells were washed with PBS and stained
with 16 .mu.g/ml of bis-benzimidine in PBS. After 15 min of
incubation at room temperature, the samples were photographed. An
Olympus BH.sub.2 flourescence microscope with a BH.sub.2-DMU
U.sub.2 UV mirror cube filter was used. Cells with three or more
chromatin fragments were considered apoptotic.
[0120] The above-mentioned 3.7 kb nucleotide sequence of cDNA
revealed an open reading frame size of 1197 base pairs which
predicts a 397 amino acid polypeptide. The deduced amino acid
sequence is shown in FIG. 2. The estimated protein molecular weight
is approximately 44 kDa, the estimated pI is 4.93. There are
several potential modification sites in this protein: 1
N-glycosylation site at amino acid position 353; 1 tyrosine
phosphorylation site at 238; and 2 cyclic AMP and cyclic GMP
dependent protein kinase phosphorylation sites at position 218 and
357. It also has four casein kinase II phosphorylation sites at 3,
33, 65 and 101. Five myristoylation sites at 28, 44, 205, 206 and
220 bases were also found. There are ten protein kinase-C
phosphorylation sites at 38, 48, 164, 216, 217, 236, 251, 260, 323
and 355.
[0121] Hydropathy plot analysis of N-SMase (FIG. 3 of the drawings)
indicates that there is no apparent transmembrane domain. The
N-glycosylation site at amino acid position 353, tyrosine
phosphorylation site at 238, as well as several other
phosphorylation sites are presumably located on the exterior. Such
sites may be subjected to further glycosylation and
phosphorylation.
[0122] To confirm that the 3.7 kb cDNA does encode N-SMase with an
apparent molecular weight of 44 kDa, constructs were made to fuse
cDNA coding region with Glutathione-S-Transferase. Then, this
plasmid was transformed into E.coli (HB101) to express and purify
GST-NSMase fusion protein. The expression of fusion protein was
induced by IPTG (0.1M) for 2 hours. The fusion protein was purified
using Glutathione Sepharose-4B chromatography. The fusion protein
has an apparent molecular weight of 73 kDa. After thrombin
digestion, it resolved into two bands, 29 kDa and 44 kDa which
correspond to GST and N-SMase, respectively. After N-SMase was
released from fusion protein by Glutathione Sepharose-4B
chromatography, it resolved as a single band, having a molecular
weight on the order of 44 kDa. This protein was recognized by
antibody against human N-SMase. See FIGS. 4A and 4B.
Affinity-purified recombinant N-SMase expressed in E. coli had
activity on the order of 3.9 nmole/mg protein/2 h compared to mock
cDNA transfected cells which had activity of 2.9 nmoles/mg
protein/2 h).
[0123] The results set forth in FIG. 5 of the drawings show that
Cos-7 cells transfected with pHHI exhibited a 10-fold increase in
N-SMase activity compared to cells transfected with mock vector
pSPOT-1 24 hours post-transfection. The most active recombinant
N-SMase had an apparent molecular weight of 100 kDa. Significant
N-SMase activity in a descending order was observed in protein
bands having apparent kDa of 130 and 74. Those results indicate
that N-SMase undergoes multiple post-translational
modification.
[0124] The 465 bp RT-PCR fragment amplified 5' end of N-SMase cDNA
coding region was used to probe N-SMase mRNA in various human
tissues. N-SMase was expressed in all the human tissues
investigated, the transcript size and copy numbers varied from one
tissue to another (see FIG. 6A of the drawings). The major
transcript size of N-SMase expressed in all of these tissues is 1.7
kb. The other transcripts are 900 bp, 400 bp and 200 bp. Extended
exposures of the x-ray film showed additional transcripts on the
order of 2.5 kb and 4.0 kb (FIG. 6B) in human kidney. The cDNA of
.lambda. .sup.32-1 consists of 3670 bp, and contains a
polyadenylation signal (ATTATT) at 351, (ATTAAA) at 805, (AATTAA)
at 2562 and (ATTAAA) at 2835. These polyadenylation signals vary
from the consensus AATAAA sequence, but it was found in 12%
(ATTAAA) and 2% (AATTAA, ATTATT) of the mRNAs in vertebrates,
respectively. Such smaller transcripts exist due to their
termination at different locations. The 1.7 kb transcript may be
derived either from different genes or from alternative
splicing.
[0125] Aortic smooth muscle cells transiently transfected with pHH1
(cDNA for N-SMase) had a 5-fold increase in enzyme activity
compared to control (pSVSPOT) (see FIG. 7). This was accompanied by
DNA fragmentation in pHH1 transfected cells and chromatin
condensation. Based on an analysis of about 500 cells, about 32% of
the cells were found to be apoptotic (see FIG. 8C) as compared to
control (FIG. 8A) and mock cDNA transfected cells (FIG. 8B). Those
findings indicate that over-expression of N-SMase in aortic smooth
muscle cells is accompanied by an increase in enzyme activity and
apoptosis.
EXAMPLE 2
Protocol of a Preferred N-SMase Cleavage Assay
[0126] A. Reagents:
[0127] N-methyl-.sup.14C]spingomyelin (22,000 dpm/2 .mu.l in
toluene:ethanol #:2 v/v). Cutsum (detergent) 0.002%, MgCl.sub.2, 20
.mu.g human serum albumin, 25 .mu.Mol Tris-glycine buffer pH 7.4.
Enzyme (neutral sphingomyelinase) (1 ng-1 .mu.g/well).
[0128] B. Preparation of Assay Plates:
[0129] First 2 .mu.l of [.sup.14C]sphingomyelin (22,000 dpm) is
applied at the center of the PVDF well (Millipore MAIP-S-45-10),
high protein binding Immobilon-P (0.4.mu. thick in a 96 well
plastic tray. The assay plates are dried in vacuum and stored until
use.
[0130] C. Assay:
[0131] The above reagents of Part A. are added to the well. Next,
increasing concentration of the pure N-SMase (1 ng-1 .mu.g) or
samples of enzyme (human fluids, cell extracts, etc.) are added.
Then, the sphingomyelinase assay (incubation at 37.degree. C. for
30 minutes) is conducted. The contents of the reaction mixture are
removed by suction attached to the bottom of the 96 well tray.
After washing with PBS (5 times/50 .mu.l) to remove non-specific
radioactivity, 10 .mu.l of liquid scintillation cocktail is added
to each well and the [.sup.14C]sphingomyelin radioactivity which
remains on the PVDF 96 well tray is counted in a Packard top .beta.
counter.
[0132] This assay can be completely automated employing modern
robotic systems. This assay also enables high-throughput, e.g. 96
samples can be conveniently assayed for sphingomyelinase in 30
minutes. The assay also enables screening or identifying both
inhibitors (antagonists) and activators (agonists) of N-SMase. The
assay also may be employed to assay any enzyme that requires a
lipid as a substrate that can be adsorbed to PVDF. The method also
may be employed for antigen antibody binding assays, receptors
binding assays, bacterial assays, viral assays and other toxin
binding assays.
[0133] D. Controls for Assays:
[0134] Purified N-SMase (1 ng-1 .mu.g) is used as a standard
control. Additionally, a constant set of samples (human urine)
spiked with pure N-SMase are preferably employed and activity of
such samples measured to serve as quality control and to assess
day-to-day variation in the results.
[0135] The invention has been described in detail with reference to
preferred embodiments thereof. However, it will be appreciated that
those skilled in the art, upon consideration of this disclosure,
may make modifications and improvements within the spirit and scope
of the invention.
Sequence CWU 0
0
* * * * *