U.S. patent application number 10/125767 was filed with the patent office on 2002-10-31 for artificial chromosomes, uses thereof and methods for preparing artificial chromosomes.
Invention is credited to Hadlaczky, Gyula, Szalay, Aladar A..
Application Number | 20020160410 10/125767 |
Document ID | / |
Family ID | 46279087 |
Filed Date | 2002-10-31 |
United States Patent
Application |
20020160410 |
Kind Code |
A1 |
Hadlaczky, Gyula ; et
al. |
October 31, 2002 |
Artificial chromosomes, uses thereof and methods for preparing
artificial chromosomes
Abstract
Methods for amplification of nucleic acids in cells are
provided. Also provided are cells that contain the the nucleic
acids.
Inventors: |
Hadlaczky, Gyula; (Szamos,
HU) ; Szalay, Aladar A.; (Highland, CA) |
Correspondence
Address: |
Stephanie Seidman
Heller Ehrman White & McAuliffe LLP
6th Floor
4350 La Jolla Village Drive
San Diego
CA
92122
US
|
Family ID: |
46279087 |
Appl. No.: |
10/125767 |
Filed: |
April 17, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10125767 |
Apr 17, 2002 |
|
|
|
09724693 |
Nov 28, 2000 |
|
|
|
10125767 |
Apr 17, 2002 |
|
|
|
08835682 |
Apr 10, 1997 |
|
|
|
10125767 |
Apr 17, 2002 |
|
|
|
08695191 |
Aug 7, 1996 |
|
|
|
6025155 |
|
|
|
|
10125767 |
Apr 17, 2002 |
|
|
|
08682080 |
Jul 15, 1996 |
|
|
|
6077697 |
|
|
|
|
10125767 |
Apr 17, 2002 |
|
|
|
08629822 |
Apr 10, 1996 |
|
|
|
08695191 |
Aug 7, 1996 |
|
|
|
08682080 |
Jul 15, 1996 |
|
|
|
6077697 |
|
|
|
|
08695191 |
Aug 7, 1996 |
|
|
|
08629822 |
Apr 10, 1996 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/412; 435/414; 435/419; 435/91.1 |
Current CPC
Class: |
C12N 15/8509 20130101;
A01K 2227/30 20130101; A01K 2267/03 20130101; A01K 2267/025
20130101; C12N 2800/208 20130101; A01K 2217/05 20130101; C07K
2319/036 20130101; A01K 2217/20 20130101; A61K 38/00 20130101; C12N
15/625 20130101; C07K 2319/61 20130101; C12N 15/113 20130101; A61K
48/00 20130101; A01K 2217/072 20130101; A01K 2267/01 20130101; C12N
2800/20 20130101; C12N 2800/206 20130101; A01K 2267/02 20130101;
C12N 15/82 20130101; C12N 15/85 20130101; A01K 67/0275 20130101;
A01K 2227/105 20130101; C12N 2310/111 20130101 |
Class at
Publication: |
435/6 ; 435/419;
435/412; 435/414; 435/91.1 |
International
Class: |
C12Q 001/68; C12P
019/34; C12N 005/04 |
Claims
What is claimed:
1. A method for amplifying nucleic acid, comprising: introducing a
DNA fragment into a cell, wherein the DNA fragment comprises a
selectable marker; growing the cell under selective conditions to
produce cells that have incorporated the DNA fragment or a portion
thereof that comprises the selectable marker into a chromosome; and
identifying from among the resulting cells those that include a
chromosome or fragment thereof with a portion that has undergone
amplification.
2. The method of claim 1, wherein the DNA fragment comprises
rDNA.
3. The method of claim 1, wherein the cell is an animal cell.
4. The method of claim 1, wherein the cell is a plant cell.
5. The method of claim 4, wherein the animal is a mammal.
6. The method of claim 4, wherein the cell is a plant cell.
7. The method of claim 6, wherein the plant is tobacco, rice,
maize, rye, soybean, Brassica napus, cotton, lettuce, potato,
tomato or arabidopsis.
8. An isolated cell identified by the method of claim 1.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of copending U.S.
application Ser. No. 09/724,693, filed Nov. 28, 2000, to GYULA
HADLACZKY, entitled ARTIFICIAL CHROMOSOMES, USES THEREOF AND
METHODS FOR PREPARING ARTIFICIAL CHROMOSOMES.
[0002] This application is a continuation of copending U.S.
application Ser. No. 08/835,682, now abandoned, filed Apr. 10,
1997, to GYULA HADLACZKY and ALADAR SZALAY, entitled ARTIFICIAL
CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING ARTIFICIAL
CHROMOSOMES. This application is also a continuation-in-part of
U.S. application Ser. No. 08/695,191, filed Aug. 7, 1996, now U.S.
Pat. No. 6,025,155, to GYULA HADLACZKY and ALADAR SZALAY, entitled
ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING
ARTIFICIAL CHROMOSOMES. This application is also
continuation-in-part of U.S. application Ser. No. 08/682,080, filed
Jul. 15, 1996, now U.S. Pat. No. 6,077,697, to GYULA HADLACZKY and
ALADAR SZALAY, entitled ARTIFICIAL CHROMOSOMES, USES THEREOF AND
METHODS FOR PREPARING ARTIFICIAL CHROMOSOMES, and is also a
continuation-in-part of copending U.S. application Ser. No.
08/629,822, now abandoned, filed Apr. 10, 1996 to GYULA HADLACZKY
and ALADAR SZALAY, entitled ARTIFICIAL CHROMOSOMES, USES THEREOF
AND METHODS FOR PREPARING ARTIFICIAL CHROMOSOMES.
[0003] U.S. application Ser. No. 08/835,682 is a
continuation-in-part of U.S. application Ser. No. 08/695,191. U.S.
application Ser. No. 08/695,191 is a continuation-in-part of U.S.
application Ser. No. 08/682,080 and also is a continuation-in-part
of U.S. application Ser. No. 08/629,822. U.S. application Ser. No.
08/682,080 is a continuation-in-part of U.S. application Ser. No.
08/629,822.
[0004] This application is related to U.S. application Ser. No.
07/759,558, now U.S. Pat. No. 5,288,625, is related to U.S.
application Ser. No. 08/734,344, filed Oct. 21, 1996, and is
related to U.S. application Ser. No. 08/375,271, filed Jan. 19,
1995, now U.S. Pat. No. 5,712,134. U.S. application Ser. No.
08/375,271 is a continuation of U.S. application Ser. No.
08/080,097, filed Jun. 23, 1993 which is a continuation of U.S.
application Ser. No. 07/892,487, filed Jun. 3, 1992, which is a
continuation of U.S. application Ser. No. 07/521,073, filed May 9,
1990.
[0005] The subject matter of each of the above-noted U.S.
applications and patents is incorporated in its entirety by
reference thereto.
FIELD OF THE INVENTION
[0006] The present invention relates to methods for preparing cell
lines that contain artificial chromosomes, methods for isolation of
the artificial chromosomes, targeted insertion of heterologous DNA
into the chromosomes, delivery of the chromosomes to selected cells
and tissues and methods for isolation and large-scale production of
the chromosomes. Also provided are cell lines for use in the
methods, and cell lines and chromosomes produced by the methods.
Further provided are cell-based methods for production of
heterologous proteins, gene therapy methods and methods of
generating transgenic animals, particularly non-human transgenic
animals, that use artificial chromosomes.
BACKGROUND OF THE INVENTION
[0007] Several viral vectors, non-viral, and physical delivery
systems for gene therapy and recombinant expression of heterologous
nucleic acids have been developed [see, e.g., Mitani et al. (1993)
Trends Biotech. 11:162-166]. The presently available systems,
however, have numerous limitations, particularly where persistent,
stable, or controlled gene expression is required. These
limitations include: (1) size limitations because there is a limit,
generally on order of about ten kilobases [kB], at most, to the
size of the DNA insert [gene] that can be accepted by viral
vectors, whereas a number of mammalian genes of possible
therapeutic importance are well above this limit, especially if all
control elements are included; (2) the inability to specifically
target integration so that random integration occurs which carries
a risk of disrupting vital genes or cancer suppressor genes; (3)
the expression of randomly integrated therapeutic genes may be
affected by the functional compartmentalization in the nucleus and
are affected by chromatin-based position effects; (4) the copy
number and consequently the expression of a given gene to be
integrated into the genome cannot be controlled. Thus, improvements
in gene delivery and stable expression systems are needed [see,
e.g., Mulligan (1993) Science 260:926-932].
[0008] In addition, safe and effective vectors and gene therapy
methods should have numerous features that are not assured by the
presently available systems. For example, a safe vector should not
contain DNA elements that can promote unwanted changes by
recombination or mutation in the host genetic material, should not
have the potential to initiate deleterious effects in cells,
tissues, or organisms carrying the vector, and should not interfere
with genomic functions. In addition, it would be advantageous for
the vector to be non-integrative, or designed for site-specific
integration. Also, the copy number of therapeutic gene(s) carried
by the vector should be controlled and stable, the vector should
secure the independent and controlled function of the introduced
gene(s); and the vector should accept large (up to Mb size) inserts
and ensure the functional stability of the insert.
[0009] The limitations of existing gene delivery technologies,
however, argue for the development of alternative vector systems
suitable for transferring large [up to Mb size or larger] genes and
gene complexes together with regulatory elements that will provide
a safe, controlled, and persistent expression of the therapeutic
genetic material.
[0010] At the present time, none of the available vectors fulfill
all these requirements. Most of these characteristics, however, are
possessed by chromosomes. Thus, an artificial chromosome would be
an ideal vector for gene therapy, as well as for stable,
high-level, controlled production of gene products that require
coordination of expression of numerous genes or that are encoded by
large genes, and other uses. Artificial chromosomes for expression
of heterologous genes in yeast are available, but construction of
defined mammalian artificial chromosomes has not been achieved.
Such construction has been hindered by the lack of an isolated,
functional, mammalian centromere and uncertainty regarding the
requisites for its production and stable replication. Unlike in
yeast, there are no selectable genes in close proximity to a
mammalian centromere, and the presence of long runs of highly
repetitive pericentric heterochromatic DNA makes the isolation of a
mammalian centromere using presently available methods, such as
chromosome walking, virtually impossible. Other strategies are
required for production of mammalian artificial chromosomes, and
some have been developed. For example, U.S. Pat. No. 5,288,625
provides a cell line that contains an artificial chromosome, a
minichromosome, that is about 20 to 30 megabases. Methods provided
for isolation of these chromosomes, however, provide preparations
of only about 10-20% purity. Thus, development of alternative
artificial chromosomes and perfection of isolation and purification
methods as well as development of more versatile chromosomes and
further characterization of the minichromosomes is required to
realize the potential of this technology.
[0011] Therefore, it is an object herein to provide mammalian
artificial chromosomes and methods for introduction of foreign DNA
into such chromosomes. It is also an object herein to provide
methods of isolation and purification of the chromosomes. It is
also an object herein to provide methods for introduction of the
mammalian artificial chromosome into selected cells, and to provide
the resulting cells, as well as transgenic non-human animals,
birds, fish and plants that contain the artificial chromosomes. It
is also an object herein to provide methods for gene therapy and
expression of gene products using artificial chromosomes. It is a
further object herein to provide methods for constructing
species-specific artificial chromosomes de novo. Another object
herein is to provide methods to generate de novo mammalian
artificial chromosomes.
SUMMARY OF THE INVENTION
[0012] Mammalian artificial chromosomes [MACs] are provided. Also
provided are artificial chromosomes for other higher eukaryotic
species, such as insects, birds, fowl and fish, produced using the
MACS and methods provided herein. Methods for generating and
isolating such chromosomes are provided. Methods using the MACs to
construct artificial chromosomes from other species, such as
insect, bird, fowl and fish species are also provided. The
artificial chromosomes are fully functional stable chromosomes. Two
types of artificial chromosomes are provided. One type, herein
referred to as SATACs [satellite artificial chromosomes or
satellite DNA based artificial chromosomes (the terms are used
interchangeably herein)] are stable heterochromatic chromosomes,
and the other type are minichromosomes based on amplification of
euchromatin.
[0013] Artificial chromosomes provide an extra-genomic locus for
targeted integration of megabase [Mb] pair size DNA fragments that
contain single or multiple genes, including multiple copies of a
single gene operatively linked to one promoter or each copy or
several copies linked to separate promoters. Thus, methods using
the MACs to introduce the genes into cells, tissues, and animals,
as well as species such as birds, fowl, fish and plants, are also
provided. The artificial chromosomes with integrated heterologous
DNA may be used in methods of gene therapy, in methods of
production of gene products, particularly products that require
expression of multigenic biosynthetic pathways, and also are
intended for delivery into the nuclei of germline cells, such as
embryo-derived stem cells [ES cells], for production of transgenic
(non-human) animals, birds, fowl and fish. Transgenic plants,
including monocots and dicots, are also contemplated herein.
[0014] Mammalian artificial chromosomes provide extra-genomic
specific integration sites for introduction of genes encoding
proteins of interest and permit megabase size DNA integration so
that, for example, genes encoding an entire metabolic pathway or a
very large gene, such as the cystic fibrosis [CF; .about.250 kb]
genomic DNA gene, several genes, such as multiple genes encoding a
series of antigens for preparation of a multivalent vaccine, can be
stably introduced into a cell. Vectors for targeted introduction of
such genes, including the tumor suppressor genes, such as p53, the
cystic fibrosis transmembrane regulator cDNA [CFTR], and the genes
for anti-HIV ribozymes, such as an anti-HIV gag ribozyme gene, into
the artificial chromosomes are also provided.
[0015] The chromosomes provided herein are generated by introducing
heterologous DNA that includes DNA encoding one or multiple
selectable marker(s) into cells, preferably a stable cell line,
growing the cells under selective conditions, and identifying from
among the resulting clones those that include chromosomes with more
than one centromere and/or fragments thereof. The amplification
that produces the additional centromere or centromeres occurs in
cells that contain chromosomes in which the heterologous DNA has
integrated near the centromere in the pericentric region of the
chromosome. The selected clonal cells are then used to generate
artificial chromosomes.
[0016] Although non-targeted introduction of DNA, which results in
some frequency of integration into appropriate loci, targeted
introduction is preferred. Hence, in preferred embodiments, the DNA
with the selectable marker that is introduced into cells to
initiate generation of artificial chromosomes includes sequences
that target it to the an amplifiable region, such as the
pericentric region, heterochromatin, and particularly rDNA of the
chromosome. For example, vectors, such as pTEMPUD and pHASPUD
[provided herein], which include such DNA specific for mouse
satellite DNA and human satellite DNA, respectively, are provided.
The plasmid pHASPUD is a derivative of pTEMPUD that contains human
satellite DNA sequences that specifically target human chromosomes.
Preferred targeting sequences include mammalian ribosomal RNA
(rRNA) gene sequences (referred to herein as rDNA) which target the
heterologous DNA to integrate into the rDNA region of those
chromosomes that contain rDNA. For example, vectors, such as
pTERPUD, which include mouse rDNA, are provided. Upon integration
into existing chromosomes in the cells, these vectors can induce
the amplification that results in generation of additional
centromeres.
[0017] Artificial chromosomes are generated by culturing the cells
with the multicentric, typically dicentric, chromosomes under
conditions whereby the chromosome breaks to form a minichromosome
and formerly dicentric chromosome. Among the MACs provided herein
are the SATACs, which are primarily made up of repeating units of
short satellite DNA and are nearly fully heterochromatic, so that
without insertion of heterologous or foreign DNA, the chromosomes
preferably contain no genetic information or contain only
non-protein-encoding gene sequences such as rDNA sequences. They
can thus be used as "safe" vectors for delivery of DNA to mammalian
hosts because they do not contain any potentially harmful genes.
The SATACs are generated, not from the minichromosome fragment as,
for example, in U.S. Pat. No. 5,288,625, but from the fragment of
the formerly dicentric chromosome.
[0018] In addition, methods for generating euchromatic
minichromosomes and the use thereof are also provided herein.
Methods for generating one type of MAC, the minichromosome,
previously described in U.S. Pat. No. 5,288,625, and the use
thereof for expression of heterologous DNA are provided. In a
particular method provided herein for generating a MAC, such as a
minichromosome, heterologous DNA that includes mammalian rDNA and
one or more selectable marker genes is introduced into cells which
are then grown under selective conditions. Resulting cells that
contain chromosomes with more than one centromere are selected and
cultured under conditions whereby the chromosome breaks to form a
minichromosome and a formerly multicentric (typically dicentric)
chromosome from which the minichromosome was released.
[0019] Cell lines containing the minichromosome and the use thereof
for cell fusion are also provided. In one embodiment, a cell line
containing the mammalian minichromosome is used as recipient cells
for donor DNA encoding a selected gene or multiple genes. To
facilitate integration of the donor DNA into the minichromosome,
the recipient cell line preferably contains the minichromosome but
does not also contain the formerly dicentric chromosome. This may
be accomplished by methods disclosed herein such as cell fusion and
selection of cells that contain a minichromosome and no formerly
dicentric chromosome. The donor DNA is linked to a second
selectable marker and is targeted to and integrated into the
minichromosome. The resulting chromosome is transferred by cell
fusion into an appropriate recipient cell line, such as a Chinese
hamster cell line [CHO]. After large-scale production of the cells
carrying the engineered chromosome, the chromosome is isolated. In
particular, metaphase chromosomes are obtained, such as by addition
of colchicine, and they are purified from the cell lysate. These
chromosomes are used for cloning, sequencing and for delivery of
heterologous DNA into cells.
[0020] Also provided are SATACs of various sizes that are formed by
repeated culturing under selective conditions and subcloning of
cells that contain chromosomes produced from the formerly dicentric
chromosomes. The exemplified SATACs are based on repeating DNA
units that are about 15 Mb [two .about.7.5 Mb blocks]. The
repeating DNA unit of SATACs formed from other species and other
chromosomes may vary, but typically would be on the order of about
7 to about 20 Mb. The repeating DNA units are referred to herein as
megareplicons, which in the exemplified SATACs contain tandem
blocks of satellite DNA flanked by non-satellite DNA, including
heterologous DNA and non-satellite DNA. Amplification produces an
array of chromosome segments [each called an amplicon] that contain
two inverted megareplicons bordered by heterologous ["foreign"]
DNA. Repeated cell fusion, growth on selective medium and/or BrdU
[5-bromodeoxyuridine] treatment or other treatment with other
genome destabilizing reagent or agent, such as ionizing radiation,
including X-rays, and subcloning results in cell lines that carry
stable heterochromatic or partially heterochromatic chromosomes,
including a 150-200 Mb "sausage" chromosome, a 500-1000 Mb
gigachromosome, a stable 250-400 Mb megachromosome and various
smaller stable chromosomes derived therefrom. These chromosomes are
based on these repeating units and can include heterologous DNA
that is expressed.
[0021] Thus, methods for producing MACs of both types (i.e., SATACS
and minichromosomes) are provided. These methods are applicable to
the production of artificial chromosomes containing centromeres
derived from any higher eukaryotic cell, including mammals, birds,
fowl, fish, insects and plants.
[0022] The resulting chromosomes can be purified by methods
provided herein to provide vectors for introduction of heterologous
DNA into selected cells for production of the gene product(s)
encoded by the heterologous DNA, for production of transgenic
(non-human) animals, birds, fowl, fish and plants or for gene
therapy.
[0023] In addition, methods and vectors for fragmenting the
minichromosomes and SATACs are provided. Such methods and vectors
can be used for in vivo generation of smaller stable artificial
chromosomes. Vectors for chromosome fragmentation are used to
produce an artificial chromosome that contains a megareplicon, a
centromere and two telomeres and will be between about 7.5 Mb and
about 60 Mb, preferably between about 10 Mb-15 Mb and 30-50 Mb. As
exemplified herein, the preferred range is between about 7.5 Mb and
50 Mb. Such artificial chromosomes may also be produced by other
methods.
[0024] Isolation of the 15 Mb [or 30 Mb amplicon containing two 15
Mb inverted repeats] or a 30 Mb or higher multimer, such as 60 Mb,
thereof should provide a stable chromosomal vector that can be
manipulated in vitro. Methods for reducing the size of the MACs to
generate smaller stable self-replicating artificial chromosomes are
also provided.
[0025] Also provided herein, are methods for producing mammalian
artificial chromosomes, including those provided herein, in vitro,
and the resulting chromosomes. The methods involve in vitro
assembly of the structural and functional elements to provide a
stable artificial chromosome. Such elements include a centromere,
two telomeres, at least one origin of replication and filler
heterochromatin, e.g., satellite DNA. A selectable marker for
subsequent selection is also generally included. These specific DNA
elements may be obtained from the artificial chromosomes provided
herein such as those that have been generated by the introduction
of heterologous DNA into cells and the subsequent amplification
that leads to the artificial chromosome, particularly the SATACs.
Centromere sequences for use in the in vitro construction of
artificial chromosomes may also be obtained by employing the
centromere cloning methods provided herein. In preferred
embodiments, the sequences providing the origin of replication, in
particular, the megareplicator, are derived from rDNA. These
sequences preferably include the rDNA origin of replication and
amplification promoting sequences.
[0026] Methods and vectors for targeting heterologous DNA into the
artificial chromosomes are also provided as are methods and vectors
for fragmenting the chromosomes to produce smaller but stable and
self-replicating artificial chromosomes.
[0027] The chromosomes are introduced into cells to produce stable
transformed cell lines or cells, depending upon the source of the
cells. Introduction is effected by any suitable method including,
but not limited to electroporation, direct uptake, such as by
calcium phosphate precipitation, uptake of isolated chromosomes by
lipofection, by microcell fusion, by lipid-mediated carrier systems
or other suitable method. The resulting cells can be used for
production of proteins in the cells. The chromosomes can be
isolated and used for gene delivery. Methods for isolation of the
chromosomes based on the DNA content of the chromosomes, which
differs in MACs versus the authentic chromosomes, are provided.
Also provided are methods that rely on content, particularly
density, and size of the MACs.
[0028] These artificial chromosomes can be used in gene therapy,
gene product production systems, production of humanized
genetically transformed animal organs, production of transgenic
plants and animals (non-human), including mammals, birds, fowl,
fish, invertebrates, vertebrates, reptiles and insects, any
organism or device that would employ chromosomal elements as
information storage vehicles, and also for analysis and study of
centromere function, for the production of artificial chromosome
vectors that can be constructed in vitro, and for the preparation
of species-specific artificial chromosomes. The artificial
chromosomes can be introduced into cells using microinjection, cell
fusion, microcell fusion, electroporation, nuclear transfer,
electrofusion, projectile bombardment, nuclear transfer, calcium
phosphate precipitation, lipid-mediated transfer systems and other
such methods. Cells particularly suited for use with the artificial
chromosomes include, but are not limited to plant cells,
particularly tomato, arabidopsis, and others, insect cells,
including silk worm cells, insect larvae, fish, reptiles,
amphibians, arachnids, mammalian cells, avian cells, embryonic stem
cells, haematopoietic stem cells, embryos and cells for use in
methods of genetic therapy, such as lymphocytes that are used in
methods of adoptive immunotherapy and nerve or neural cells. Thus
methods of producing gene products and transgenic (non-human)
animals and plants are provided. Also provided are the resulting
transgenic animals and plants.
[0029] Exemplary cell lines that contain these chromosomes are also
provided.
[0030] Methods for preparing artificial chromosomes for particular
species and for cloning centromeres are also provided. For example,
two exemplary methods provided for generating artificial
chromosomes for use in different species are as follows. First, the
methods herein may be applied to different species. Second, means
for generating species-specific artificial chromosomes and for
cloning centromeres are provided. In particular, a method for
cloning a centromere from an animal or plant is provided by
preparing a library of DNA fragments that contain the genome of the
plant or animal and introducing each of the fragments into a
mammalian satellite artificial chromosome [SATAC] that contains a
centromere from a species, generally a mammal, different from the
selected plant or animal, generally a non-mammal, and a selectable
marker. The selected plant or animal is one in which the mammalian
species centromere does not function. Each of the SATACs is
introduced into the cells, which are grown under selective
conditions, and cells with SATACs are identified. Such SATACS
should contain a centromere encoded by the DNA from the library or
should contain the necessary elements for stable replication in the
selected species.
[0031] Also provided are libraries in which the relatively large
fragments of DNA are contained on artificial chromosomes.
[0032] Transgenic (non-human) animals, invertebrates and
vertebrates, plants and insects, fish, reptiles, amphibians,
arachnids, birds, fowl, and mammals are also provided. Of
particular interest are transgenic (non-human) animals and plants
that express genes that confer resistance or reduce susceptibility
to disease. For example, the transgene may encode a protein that is
toxic to a pathogen, such as a virus, bacterium or pest, but that
is not toxic to the transgenic host. Furthermore, since multiple
genes can be introduced on a MAC, a series of genes encoding an
antigen can be introduced, which upon expression will serve to
immunize [in a manner similar to a multivalent vaccine] the host
animal against the diseases for which exposure to the antigens
provide immunity or some protection.
[0033] Also of interest are transgenic (non-human) animals that
serve as models of certain diseases and disorders for use in
studying the disease and developing therapeutic treatments and
cures thereof. Such animal models of disease express genes
[typically carrying a disease-associated mutation], which are
introduced into the animal on a MAC and which induce the disease or
disorder in the animal. Similarly, MACs carrying genes encoding
antisense RNA may be introduced into animal cells to generate
conditional "knock-out" transgenic (non-human) animals. In such
animals, expression of the antisense RNA results in decreased or
complete elimination of the products of genes corresponding to the
antisense RNA. Of further interest are transgenic mammals that
harbor MAC-carried genes encoding therapeutic proteins that are
expressed in the animal's milk. Transgenic (non-human) animals for
use in xenotransplantation, which express MAC-carried genes that
serve to humanize the animal's organs, are also of interest. Genes
that might be used in humanizing animal organs include those
encoding human surface antigens.
[0034] Methods for cloning centromeres, such as mammalian
centromeres, are also provided. In particular, in one embodiment, a
library composed of fragments of SATACs are cloned into YACs [yeast
artificial chromosomes] that include a detectable marker, such as
DNA encoding tyrosinase, and then introduced into mammalian cells,
such as albino mouse embryos. Mice produced from embryos containing
such YACs that include a centromere that functions in mammals will
express the detectable marker. Thus, if mice are produced from
albino mouse embryos into which a functional mammalian centromere
was introduced, the mice will be pigmented or have regions of
pigmentation.
[0035] A method for producing repeated tandem arrays of DNA is
provided. This method, exemplified herein using telomeric DNA, is
applicable to any repeat sequence, and in particular, low
complexity repeats. The method provided herein for synthesis of
arrays of tandem DNA repeats are based in a series of extension
steps in which successive doublings of a sequence of repeats
results in an exponential expansion of the array of tandem repeats.
An embodiment of the method of synthesizing DNA fragments
containing tandem repeats may generally be described as follows.
Two oligonucleotides are used as starting materials.
Oligonucleotide 1 is of length k of repeated sequence (the flanks
of which are not relevant) and contains a relatively short stretch
(60-90 nucleotides) of the repeated sequence, flanked with
appropriately chosen restriction sites:
[0036]
5'-S>>>>>>>>>>>>>>>>-
;>>>>>>>>>>>S2_-3'
[0037] where S1 is restriction site 1 cleaved by E1, S2 is a second
restriction site cleaved by E2> represents a simple repeat unit,
and `_` denotes a short (8-10) nucleotide flanking sequence
complementary to oligonucleotide 2:
[0038] 3'-_S3-5'
[0039] where S3 is a third restriction site for enzyme E3 and which
is present in the vector to be used during the construction. The
method involves the following steps: (1) oligonucleotides 1 and 2
are annealed; (2) the annealed oligonucleotides are filled-in to
produce a double-stranded (ds) sequence; (3) the double-stranded
DNA is cleaved with restriction enzymes E1 and E3 and subsequently
ligated into a vector (e.g., pUC19 or a yeast vector) that has been
cleaved with the same enzymes E1 and E3; (4) the insert is isolated
from a first portion of the plasmid by digesting with restriction
enzymes E1 and E3, and a second portion of the plasmid is cut with
enzymes E2 (treated to remove the 3'-overhang) and E3, and the
large fragment (plasmid DNA plus the insert) is isolated; (5) the
two DNA fragments (the S1-S3 insert fragment and the vector plus
insert) are ligated; and (6) steps 4 and 5 are repeated as many
times as needed to achieve the desired repeat sequence size. In
each extension cycle, the repeat sequence size doubles, i.e., if m
is the number of extension cycles, the size of the repeat sequence
will be k.times.2.sup.m nucleotides.
DESCRIPTION OF THE DRAWINGS
[0040] FIG. 1 is a schematic drawing depicting formation of the
MMCneo [the minichromosome] chromosome. A-G represents the
successive events consistent with observed data that would lead to
the formation and stabilization of the minichromosome.
[0041] FIG. 2 shows a schematic summary of the manner in which the
observed new chromosomes would form, and the relationships among
the different de novo formed chromosomes. In particular, this
figure shows a schematic drawing of the de novo chromosome
formation initiated in the centromeric region of mouse chromosome
7. (A) A single E-type amplification in the centromeric region of
chromosome 7 generates a neo-centromere linked to the integrated
"foreign" DNA, and forms a dicentric chromosome. Multiple E-type
amplification forms the .lambda. neo-chromosome, which separates
from the remainder of mouse chromosome 7 through a specific
breakage between the centromeres of the dicentric chromosome and
which was stabilized in a mouse-hamster hybrid cell line; (B)
Specific breakage between the centromeres of a dicentric chromosome
7 generates a chromosome fragment with the neo-centromere, and a
chromosome 7 with traces of heterologous DNA at the end; (C)
Inverted duplication of the fragment bearing the neo-centromere
results in the formation of a stable neo-minichromosome; (D)
Integration of exogenous DNA into the heterologous DNA region of
the formerly dicentric chromosome 7 initiates H-type amplification,
and the formation of a heterochromatic arm. By capturing a
euchromatic terminal segment, this new chromosome arm is stabilized
in the form of the "sausage" chromosome; (E) BrdU
[5-bromodeoxyuridine] treatment and/or drug selection induce
further H-type amplification, which results in the formation of an
unstable gigachromosome: (F) Repeated BrdU treatments and/or drug
selection induce further H-type amplification including a
centromere duplication, which leads to the formation of another
heterochromatic chromosome arm. It is split off from the chromosome
7 by chromosome breakage, and by acquiring a terminal segment, the
stable megachromosome is formed.
[0042] FIG. 3 is a schematic diagram of the replicon structure and
a scheme by which a megachromosome could be produced.
[0043] FIG. 4 sets forth the relationships among some of the
exemplary cell lines described herein.
[0044] FIG. 5 is a diagram of the plasmid pTEMPUD.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0045] Definitions
[0046] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which this invention belongs. All patents
and publications referred to herein are incorporated by
reference.
[0047] As used herein, a mammalian artificial chromosome [MAC] is a
piece of DNA that can stably replicate and segregate alongside
endogenous chromosomes. It has the capacity to accommodate and
express heterologous genes inserted therein. It is referred to as a
mammalian artificial chromosome because it includes an active
mammalian centromere(s). Plant artificial chromosomes, insect
artificial chromosomes and avian artificial chromosomes refer to
chromosomes that include plant and insect centromeres,
respectively. A human artificial chromosome [HAC] refers to
chromosomes that include human centromeres, BUGACs refer to insect
artificial chromosomes, and AVACs refer to avian artificial
chromosomes. Among the MACs provided herein are SATACs,
minichromosomes, and in vitro synthesized artificial chromosomes.
Methods for construction of each type are provided herein.
[0048] As used herein, in vitro synthesized artificial chromosomes
are artificial chromosomes that is produced by joining the
essential components (at least the centromere, and origins of
replication) In vitro.
[0049] As used herein, endogenous chromosomes refer to genomic
chromosomes as found in the cell prior to generation or
introduction of a MAC.
[0050] As used herein, stable maintenance of chromosomes occurs
when at least about 85%, preferably 90%, more preferably 95%, of
the cells retain the chromosome. Stability is measured in the
presence of a selective agent. Preferably these chromosomes are
also maintained in the absence of a selective agent. Stable
chromosomes also retain their structure during cell culturing,
suffering neither intrachromosomal nor interchromosomal
rearrangements.
[0051] As used herein, growth under selective conditions means
growth of a cell under conditions that require expression of a
selectable marker for survival.
[0052] As used herein, an agent that destabilizes a chromosome is
any agent known by those of skill in the art to enhance
amplification events, mutations. Such agents, which include BrdU,
are well known to those of skill in the art.
[0053] As used herein, de novo with reference to a centromere,
refers to generation of an excess centromere as a result of
incorporation of a heterologous DNA fragment using the methods
herein.
[0054] As used herein, euchromatin and heterochromatin have their
recognized meanings, euchromatin refers to chromatin that stains
diffusely and that typically contains genes, and heterochromatin
refers to chromatin that remains unusually condensed and that has
been thought to be transcriptionally inactive. Highly repetitive
DNA sequences [satellite DNA], at least with respect to mammalian
cells, are usually located in regions of the heterochromatin
surrounding the centromere [pericentric heterochromatin].
Constitutive heterochromatin refers to heterochromatin that
contains the highly repetitive DNA which is constitutively
condensed and genetically inactive.
[0055] As used herein, BrdU refers to 5-bromodeoxyuridine, which
during replication is inserted in place of thymidine. BrdU is used
as a mutagen; it also inhibits condensation of metaphase
chromosomes during cell division.
[0056] As used herein, a dicentric chromosome is a chromosome that
contains two centromeres. A multicentric chromosome contains more
than two centromeres.
[0057] As used herein, a formerly dicentric chromosome is a
chromosome that is produced when a dicentric chromosome fragments
and acquires new telomeres so that two chromosomes, each having one
of the centromeres, are produced. Each of the fragments are
replicable chromosomes. If one of the chromosomes undergoes
amplification of euchromatic DNA to produce a fully functional
chromosome that contains the newly introduced heterologous DNA and
primarily [at least more than 50%] euchromatin, it is a
minichromosome. The remaining chromosome is a formerly dicentric
chromosome. If one of the chromosomes undergoes amplification,
whereby heterochromatin [satellite DNA] is amplified and a
euchromatic portion [or arm] remains, it is referred to as a
sausage chromosome. A chromosome that is substantially all
heterochromatin, except for portions of heterologous DNA, is called
a SATAC. Such chromosomes [SATACs] can be produced from sausage
chromosomes by culturing the cell containing the sausage chromosome
under conditions, such as BrdU treatment and/or growth under
selective conditions, that destabilize the chromosome so that a
satellite artificial chromosomes [SATAC] is produced. For purposes
herein, it is understood that SATACs may not necessarily be
produced in multiple steps, but may appear after the initial
introduction of the heterologous DNA and growth under selective
conditions, or they may appear after several cycles of growth under
selective conditions and BrdU treatment.
[0058] As used herein, a SATAC refers to a chromosome that is
substantially all heterochromatin, except for portions of
heterologous DNA. Typically, SATACs are satellite DNA based
artificial chromosomes, but the term encompasses any chromosome
made by the methods herein that contains more heterochromatin than
euchromatin.
[0059] As used herein, amplifiable, when used in reference to a
chromosome, particularly the method of generating SATACs provided
herein, refers to a region of a chromosome that is prone to
amplification. Amplifcation typically occurs during replication and
other cellular events involving recombination. Such regions are
typically regions of the chromosome that include tandem repeats,
such as satellite DNA, rDNA and other such sequences.
[0060] As used herein, amplification, with reference to DNA, is a
process in which segments of DNA are duplicated to yield two or
multiple copies of identical or nearly identical DNA segments that
are typically joined as substantially tandem or successive repeats
or inverted repeats.
[0061] As used herein an amplicon is a repeated DNA amplification
unit that contains a set of inverted repeats of the megareplicon. A
megareplicon represents a higher order replication unit. For
example, with reference to the SATACs, the megareplicon contains a
set of tandem DNA blocks each containing satellite DNA flanked by
non-satellite DNA. Contained within the megareplicon is a primary
replication site, referred to as the megareplicator, which may be
involved in organizing and facilitating replication of the
pericentric heterochromatin and possibly the centromeres. Within
the megareplicon there may be smaller [e.g., 50-300 kb in some
mammalian cells] secondary replicons. In the exemplified SATACS,
the megareplicon is defined by two tandem .about.7.5 Mb DNA blocks
[see, e.g., FIG. 3]. Within each artificial chromosome [AC] or
among a population thereof, each amplicon has the same gross
structure but may contain sequence variations. Such variations will
arise as a result of movement of mobile genetic elements, deletions
or insertions or mutations that arise, particularly in culture.
Such variation does not affect the use of the ACs or their overall
structure as described herein.
[0062] As used herein, ribosomal RNA [rRNA] is the specialized RNA
that forms part of the structure of a ribosome and participates in
the synthesis of proteins. Ribosomal RNA is produced by
transcription of genes which, in eukaryotic cells, are present in
multiple copies. In human cells, the approximately 250 copies of
rRNA genes per haploid genome are spread out in clusters on at
least five different chromosomes (chromosomes 13, 14, 15, 21 and
22). In mouse cells, the presence of ribosomal DNA [rDNA] has been
verified on at least 11 pairs out of 20 mouse chromosomes
[chromosomes 5, 6, 9, 11, 12, 15, 16, 17, 18, 19 and X] [see e.g.,
Rowe et al. (1996) Mamm. Genome 7:886-889 and Johnson et al. (1993)
Mamm. Genome 4:49-52]. In eukaryotic cells, the multiple copies of
the highly conserved rRNA genes are located in a tandemly arranged
series of rDNA units, which are generally about 40-45 kb in length
and contain a transcribed region and a nontranscribed region known
as spacer (i.e., intergenic spacer) DNA which can vary in length
and sequence. In the human and mouse, these tandem arrays of rDNA
units are located adjacent to the pericentric satellite DNA
sequences (heterochromatin). The regions of these chromosomes in
which the rDNA is located are referred to as nucleolar organizing
regions (NOR) which loop into the nucleolus, the site of ribosome
production within the cell nucleus.
[0063] As used herein, the minichromosome refers to a chromosome
derived from a multicentric, typically dicentric, chromosome [see,
e.g., FIG. 1] that contains more euchromatic than heterochromatic
DNA.
[0064] As used herein, a megachromosome refers to a chromosome
that, except for introduced heterologous DNA, is substantially
composed of heterochromatin. Megachromosomes are made of an array
of repeated amplicons that contain two inverted megareplicons
bordered by introduced heterologous DNA [see, e.g., FIG. 3 for a
schematic drawing of a megachromosome]. For purposes herein, a
megachromosome is about 50 to 400 Mb, generally about 250-400 Mb.
Shorter variants are also referred to as truncated megachromosomes
[about 90 to 120 or 150 Mb], dwarf megachromosomes [.about.150-200
Mb] and cell lines, and a micro-megachromosome [.about.50-90 Mb,
typically 50-60 Mb]. For purposes herein, the term megachromosome
refers to the overall repeated structure based on an array of
repeated chromosomal segments [amplicons] that contain two inverted
megareplicons bordered by any inserted heterologous DNA. The size
will be specified.
[0065] As used herein, genetic therapy involves the transfer or
insertion of heterologous DNA into certain cells, target cells, to
produce specific gene products that are involved in correcting or
modulating disease. The DNA is introduced into the selected target
cells in a manner such that the heterologous DNA is expressed and a
product encoded thereby is produced. Alternatively, the
heterologous DNA may in some manner mediate expression of DNA that
encodes the therapeutic product. It may encode a product, such as a
peptide or RNA, that in some manner mediates, directly or
indirectly, expression of a therapeutic product. Genetic therapy
may also be used to introduce therapeutic compounds, such as TNF,
that are not normally produced in the host or that are not produced
in therapeutically effective amounts or at a therapeutically useful
time. Expression of the heterologous DNA by the target cells within
an organism afflicted with the disease thereby enables modulation
of the disease. The heterologous DNA encoding the therapeutic
product may be modified prior to introduction into the cells of the
afflicted host in order to enhance or otherwise alter the product
or expression thereof.
[0066] As used herein, heterologous or foreign DNA and RNA are used
interchangeably and refer to DNA or RNA that does not occur
naturally as part of the genome in which it is present or which is
found in a location or locations in the genome that differ from
that in which it occurs in nature. It is DNA or RNA that is not
endogenous to the cell and has been exogenously introduced into the
cell. Examples of heterologous DNA include, but are not limited to,
DNA that encodes a gene product or gene product(s) of interest,
introduced for purposes of gene therapy or for production of an
encoded protein. Other examples of heterologous DNA include, but
are not limited to, DNA that encodes traceable marker proteins,
such as a protein that confers drug resistance, DNA that encodes
therapeutically effective substances, such as anti-cancer agents,
enzymes and hormones, and DNA that encodes other types of proteins,
such as antibodies. Antibodies that are encoded by heterologous DNA
may be secreted or expressed on the surface of the cell in which
the heterologous DNA has been introduced.
[0067] As used herein, a therapeutically effective product is a
product that is encoded by heterologous DNA that, upon introduction
of the DNA into a host, a product is expressed that effectively
ameliorates or eliminates the symptoms, manifestations of an
inherited or acquired disease or that cures said disease.
[0068] As used herein, transgenic plants refer to plants in which
heterologous or foreign DNA is expressed or in which the expression
of a gene naturally present in the plant has been altered.
[0069] As used herein, operative linkage of heterologous DNA to
regulatory and effector sequences of nucleotides, such as
promoters, enhancers, transcriptional and translational stop sites,
and other signal sequences refers to the relationship between such
DNA and such sequences of nucleotides. For example, operative
linkage of heterologous DNA to a promoter refers to the physical
relationship between the DNA and the promoter such that the
transcription of such DNA is initiated from the promoter by an RNA
polymerase that specifically recognizes, binds to and transcribes
the DNA in reading frame. Preferred promoters include tissue
specific promoters, such as mammary gland specific promoters, viral
promoters, such TK, CMV, adenovirus promoters, and other promoters
known to those of skill in the art.
[0070] As used herein, isolated, substantially pure DNA refers to
DNA fragments purified according to standard techniques employed by
those skilled in the art, such as that found in Maniatis et al.
[(1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.].
[0071] As used herein, expression refers to the process by which
nucleic acid is transcribed into mRNA and translated into peptides,
polypeptides, or proteins. If the nucleic acid is derived from
genomic DNA, expression may, if an appropriate eukaryotic host cell
or organism is selected, include splicing of the mRNA.
[0072] As used herein, vector or plasmid refers to discrete
elements that are used to introduce heterologous DNA into cells for
either expression of the heterologous DNA or for replication of the
cloned heterologous DNA. Selection and use of such vectors and
plasmids are well within the level of skill of the art.
[0073] As used herein, transformation/transfection refers to the
process by which DNA or RNA is introduced into cells. Transfection
refers to the taking up of exogenous nucleic acid, e.g., an
expression vector, by a host cell whether or not any coding
sequences are in fact expressed. Numerous methods of transfection
are known to the ordinarily skilled artisan, for example, by direct
uptake using calcium phosphate [CaPO4; see, e.g., Wigler et al.
(1979) Proc. Natl. Acad. Sci. U.S.A. 76:1373-1376], polyethylene
glycol [PEG]-mediated DNA uptake, electroporation, lipofection
[see, e.g., Strauss (1996) Meth. Mol. Biol. 54:307-327], microcell
fusion [see, EXAMPLES, see, also Lambert (1991) Proc. Natl. Acad.
Sci. U.S.A. 88:5907-5911; U.S. Pat. No. 5,396,767, Sawford et al.
(1987) Somatic Cell Mol. Genet. 13:279-284; Dhar et al. (1984)
Somatic Cell Mol. Genet. 10:547-559; and McNeill-Killary et al.
(1995) Meth. Enzymol. 254:133-152], lipid-mediated carrier systems
[see, e.g., Teifel et al. (1995) Biotechniques 19:79-80; Albrecht
et al. (1996) Ann. Hematol. 72:73-79; Holmen et al. (1995) In Vitro
Cell Dev. Biol. Anim. 31:347-351; REmy et al. (1994) Bioconjug.
Chem. 5:647-654; Le Bolch et al. (1995) Tetrahedron Lett.
36:6681-6684; Loeffler et al. (1993) Meth. Enzymol. 217:599-618] or
other suitable method. Successful transfection is generally
recognized by detection of the presence of the heterologous nucleic
acid within the transfected cell, such as any indication of the
operation of a vector within the host cell. Transformation means
introducing DNA into an organism so that the DNA is replicable,
either as an extrachromosomal element or by chromosomal
integration.
[0074] As used herein, injected refers to the microinjection [use
of a small syringe] of DNA into a cell.
[0075] As used herein, substantially homologous DNA refers to DNA
that includes a sequence of nucleotides that is sufficiently
similar to another such sequence to form stable hybrids under
specified conditions.
[0076] It is well known to those of skill in this art that nucleic
acid fragments with different sequences may, under the same
conditions, hybridize detectably to the same "target" nucleic acid.
Two nucleic acid fragments hybridize detectably, under stringent
conditions over a sufficiently long hybridization period, because
one fragment contains a segment of at least about 14 nucleotides in
a sequence which is complementary [or nearly complementary] to the
sequence of at least one segment in the other nucleic acid
fragment. If the time during which hybridization is allowed to
occur is held constant, at a value during which, under preselected
stringency conditions, two nucleic acid fragments with exactly
complementary base-pairing segments hybridize detectably to each
other, departures from exact complementarity can be introduced into
the base-pairing segments, and base-pairing will nonetheless occur
to an extent sufficient to make hybridization detectable. As the
departure from complementarity between the base-pairing segments of
two nucleic acids becomes larger, and as conditions of the
hybridization become more stringent, the probability decreases that
the two segments will hybridize detectably to each other.
[0077] Two single-stranded nucleic acid segments have
"substantially the same sequence," within the meaning of the
present specification, if (a) both form a base-paired duplex with
the same segment, and (b) the melting temperatures of said two
duplexes in a solution of 0.5.times.SSPE differ by less than
10.degree. C. If the segments being compared have the same number
of bases, then to have "substantially the same sequence", they will
typically differ in their sequences at fewer than 1 base in 10.
Methods for determining melting temperatures of nucleic acid
duplexes are well known [see, e.g., Meinkoth and Wahl (1984) Anal.
Biochem. 138:267-284 and references cited therein].
[0078] As used herein, a nucleic acid probe is a DNA or RNA
fragment that includes a sufficient number of nucleotides to
specifically hybridize to DNA or RNA that includes identical or
closely related sequences of nucleotides. A probe may contain any
number of nucleotides, from as few as about 10 and as many as
hundreds of thousands of nucleotides. The conditions and protocols
for such hybridization reactions are well known to those of skill
in the art as are the effects of probe size, temperature, degree of
mismatch, salt concentration and other parameters on the
hybridization reaction. For example, the lower the temperature and
higher the salt concentration at which the hybridization reaction
is carried out, the greater the degree of mismatch that may be
present in the hybrid molecules.
[0079] To be used as a hybridization probe, the nucleic acid is
generally rendered detectable by labelling it with a detectable
moiety or label, such as .sup.32P, .sup.3H and .sup.14C, or by
other means, including chemical labelling, such as by
nick-translation in the presence of deoxyuridylate biotinylated at
the 5'-position of the uracil moiety. The resulting probe includes
the biotinylated uridylate in place of thymidylate residues and can
be detected [via the biotin moieties] by any of a number of
commercially available detection systems based on binding of
streptavidin to the biotin. Such commercially available detection
systems can be obtained, for example, from Enzo Biochemicals, Inc.
[New York, N.Y.]. Any other label known to those of skill in the
art, including non-radioactive labels, may be used as long as it
renders the probes sufficiently detectable, which is a function of
the sensitivity of the assay, the time available [for culturing
cells, extracting DNA, and hybridization assays], the quantity of
DNA or RNA available as a source of the probe, the particular label
and the means used to detect the label.
[0080] Once sequences with a sufficiently high degree of homology
to the probe are identified, they can readily be isolated by
standard techniques, which are described, for example, by Maniatis
et al. ((1982) Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[0081] As used herein, conditions under which DNA molecules form
stable hybrids and are considered substantially homologous are such
that DNA molecules with at least about 60% complementarity form
stable hybrids. Such DNA fragments are herein considered to be
"substantially homologous". For example, DNA that encodes a
particular protein is substantially homologous to another DNA
fragment if the DNA forms stable hybrids such that the sequences of
the fragments are at least about 60% complementary and if a protein
encoded by the DNA retains its activity.
[0082] For purposes herein, the following stringency conditions are
defined:
[0083] 1) high stringency: 0.1.times.SSPE, 0.1% SDS, 65.degree.
C.
[0084] 2) medium stringency: 0.2.times.SSPE, 0.1% SDS, 50.degree.
C.
[0085] 3) low stringency: 1.0.times.SSPE, 0.1% SDS, 50.degree.
C.
[0086] or any combination of salt and temperature and other
reagents that result in selection of the same degree of mismatch or
matching.
[0087] As used herein, immunoprotective refers to the ability of a
vaccine or exposure to an antigen or immunity-inducing agent, to
confer upon a host to whom the vaccine or antigen is administered
or introduced, the ability to resist infection by a disease-causing
pathogen or to have reduced symptoms. The selected antigen is
typically an antigen that is presented by the pathogen.
[0088] As used herein, all assays and procedures, such as
hybridization reactions and antibody-antigen reactions, unless
otherwise specified, are conducted under conditions recognized by
those of skill in the art as standard conditions.
[0089] A. Preparation of Cell Lines Containing MACs
[0090] 1. The Megareplicon
[0091] The methods, cells and MACs provided herein are produced by
virtue of the discovery of the existence of a higher-order
replication unit [megareplicon] of the centromeric region. This
megareplicon is delimited by a primary replication initiation site
[megareplicator], and appears to facilitate replication of the
centromeric heterochromatin, and most likely, centromeres.
Integration of heterologous DNA into the megareplicator region or
in close proximity thereto, initiates a large-scale amplification
of megabase-size chromosomal segments, which leads to de novo
chromosome formation in living cells.
[0092] DNA sequences that provide a preferred megareplicator are
the rDNA units that give rise to ribosomal RNA (rRNA). In mammals,
particularly mice and humans, these rDNA units contain specialized
elements, such as the origin of replication (or origin of
bidirectional replication, i.e., OBR, in mouse) and amplification
promoting sequences (APS) and amplification control elements (ACE)
(see, e.g., Gogel et al. (1996) Chromosoma 104:511-518; Coffman et
al. (1993) Exp. Cell. Res. 209:123-132; Little et al. (1993) Mol.
Cell. Biol. 13:6600-6613; Yoon et al. (1995) Mol. Cell. Biol.
15:2482-2489; Gonzalez and Sylvester (1995) Genomics 27:320-328;
Miesfeld and Arnheim (1982) Nuc. Acids Res. 10:3933-3949]); Maden
et al. (1987) Biochem. J. 246:519-527).
[0093] As described herein, without being bound by any theory,
these specialized elements may facilitate replication and/or
amplification of megabase-size chromosomal segments in the de novo
formation of chromosomes, such as those described herein, in cells.
These specialized elements are typically located in the
nontranscribed intergenic spacer region upstream of the transcribed
region of rDNA. The intergenic spacer region may itself contain
internally repeated sequences which can be classified as tandemly
repeated blocks and nontandem blocks (see e.g., Gonzalez and
Sylvester (1995) Genomics 27:320-328). In mouse rDNA, an origin of
bidirectional replication may be found within a 3-kb initiation
zone centered approximately 1.6 kb upstream of the transcription
start site (see, e.g., Gogel et al. (1996) Chromosoma 104:511-518).
The sequences of these specialized elements tend to have an altered
chromatin structure, which may be detected, for example, by
nuclease hypersensitivity or the presence of AT-rich regions that
can give rise to bent DNA structures. An exemplary sequence
encompassing an origin of replication is shown in SEQ ID NO. 16 and
in GENBANK accession no. X82564 at about positions 2430-5435.
Exemplary sequences encompassing amplification-promoting sequences
include nucleotides 690-1060 and 1105-1530 of SEQ ID NO. 16.
[0094] In human rDNA, a primary replication initiation site may be
found a few kilobase pairs upstream of the transcribed region and
secondary initiation sites may be found throughout the
nontranscribed intergenic spacer region (see, e.g., Yoon et al.
(1995) Mol. Cell. Biol. 15:2482-2489). A complete human rDNA repeat
unit is presented in GENBANK as accession no. U13369 and is set
forth in SEQ ID NO. 17 herein. Another exemplary sequence
encompassing a replication initiation site may be found within the
sequence of nucleotides 35355-42486 in SEQ ID NO. 17 particularly
within the sequence of nucleotides 37912-42486 and more
particularly within the sequence of nucleotides 37912-39288 of SEQ
ID NO. 17 (see Coffman et al. (1993) Exp. Cell. Res.
209:123-132).
[0095] Cell lines containing MACs can be prepared by transforming
cells, preferably a stable cell line, with a heterologous DNA
fragment that encodes a selectable marker, culturing under
selective conditions, and identifying cells that have a
multicentric, typically dicentric, chromosome. These cells can then
be manipulated as described herein to produce the minichromosomes
and other MACs, particularly the heterochromatic SATACs, as
described herein.
[0096] Development of a multicentric, particularly dicentric,
chromosome typically is effected through integration of the
heterologous DNA in the pericentric heterochromatin, preferably in
the centromeric regions of chromosomes carrying rDNA sequences.
Thus, the frequency of incorporation can be increased by targeting
to these regions, such as by including DNA, including, but not
limited to, rDNA or satellite DNA, in the heterologous fragment
that encodes the selectable marker. Among the preferred targeting
sequences for directing the heterologous DNA to the pericentromeric
heterochromatin are rDNA sequences that target centromeric regions
of chromosomes that carry rRNA genes. Such sequences include, but
are not limited to, the DNA of SEQ ID NO. 16 and GENBANK accession
no. X82564 and portions thereof, the DNA of SEQ ID NO. 17 and
GENBANK accession no. U13369 and portions thereof, and the DNA of
SEQ ID NOS. 18-24. A particular vector incorporating from within
SEQ ID NO. 16 for use in directing integration of heterologous DNA
into chromosomal rDNA is pTERPUD (see Example 12). Satellite DNA
sequences can also be used to direct the heterologous DNA to
integrate into the pericentric heterochromatin. For example,
vectors pTEMPUD and pHASPUD, which contain mouse and human
satellite DNA, respectively, are provided herein (see Example 12)
as exemplary vectors for introduction of heterologous DNA into
cells for de novo artificial chromosome formation.
[0097] The resulting cell lines can then be treated as the
exemplified cells herein to produce cells in which the dicentric
chromosome has fragmented. The cells can then be used to introduce
additional selective markers into the fragmented dicentric
chromosome (i.e., formerly dicentric chromosome), whereby
amplification of the pericentric heterochromatin will produce the
heterochromatic chromosomes.
[0098] The following discussion describes this process with
reference to the EC3/7 line and the resulting cells. The same
procedures can be applied to any other cells, particularly cell
lines to create SATACs and euchromatic minichromosomes.
[0099] 2. Formation of de novo Chromosomes
[0100] De novo centromere formation in a transformed mouse
LMTK-fibro-blast cell line [EC3/7] after cointegration of .lambda.
constructs [.lambda.CM8 and .lambda.gtWESneo] carrying human and
bacterial DNA [Hadlaczky et al. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:8106-8110 and U.S. application Ser. No. 08/375,271] has
been shown. The integration of the "heterologous" engineered human,
bacterial and phage DNA, and the subsequent amplification of mouse
and heterologous DNA that led to the formation of a dicentric
chromosome, occurred at the centromeric region of the short arm of
a mouse chromosome. By G-banding, this chromosome was identified as
mouse chromosome 7. Because of the presence of two functionally
active centromeres on the same chromosome, regular breakages occur
between the centromeres. Such specific chromosome breakages gave
rise to the appearance [in approximately 10% of the cells] of a
chromosome fragment carrying the neo-centromere. From the EC3/7
cell line [see, U.S. Pat. No. 5,288,625, deposited at the European
Collection of Animal Cell Culture (hereinafter ECACC) under
accession no. 90051001; see, also Hadlaczky et al. (1991) Proc.
Natl. Acad. Sci. U.S.A. 88:8106-8110, and U.S. application Ser. No.
08/375,271 and the corresponding published European application EP
0 473 253, two sublines [EC3/7C5 and EC3/7C6] were selected by
repeated single-cell cloning. In these cell lines, the
neo-centromere was found exclusively on a minichromosome
[neo-minichromosome], while the formerly dicentric chromosome
carried traces of "heterologous" DNA.
[0101] It has now been discovered that integration of DNA encoding
a selectable marker in the heterochromatic region of the centromere
led to formation of the dicentric chromosome.
[0102] 3. The Neo-minichromosome
[0103] The chromosome breakage in the EC3/7 cells, which separates
the neo-centromere from the mouse chromosome, occurred in the
G-band positive "heterologous" DNA region. This is supported by the
observation of traces of .lambda. and human DNA sequences at the
broken end of the formerly dicentric chromosome. Comparing the
G-band pattern of the chromosome fragment carrying the
neo-centromere with that of the stable neo-minichromosome, it is
apparent that the neo-minichromosome is an inverted duplicate of
the chromosome fragment that bears the neo-centromere. This is
supported by the observation that although the neo-minichromosome
carries only one functional centromere, both ends of the
minichromosome are heterochromatic, and mouse satellite DNA
sequences were found in these heterochromatic regions by in situ
hybridization.
[0104] Mouse cells containing the minichromosome, which contains
multiple repeats of the heterologous DNA, which in the exemplified
embodiment is .lambda. DNA and the neomycin-resistance gene, can be
used as recipient cells in cell transformation. Donor DNA, such as
selected heterologous DNA containing .lambda. DNA linked to a
second selectable marker, such as the gene encoding hygromycin
phosphotransferase which confers hygromycin resistance [hyg], can
be introduced into the mouse cells and integrated into the
minichromosomes by homologous recombination of .lambda. DNA in the
donor DNA with that in the minichromosomes. Integration is verified
by in situ hybridization and Southern blot analyses. Transcription
and translation of the heterologous DNA is confirmed by primer
extension and immunoblot analyses.
[0105] For example, DNA has been targeted into the
neo-minichromosome in EC3/7C5 cells using a .lambda. DNA-containing
construct [pNem1ruc] that also contains DNA encoding hygromycin
resistance and the Renilla luciferase gene linked to a promoter,
such as the cytomegalovirus [CMV] early promoter, and the bacterial
neomycin resistance-encoding DNA. Integration of the donor DNA into
the chromosome in selected cells [designated PHN4] was confirmed by
nucleic acid amplification [PCR] and in situ hybridization. Events
that would produce a neo-minichromosome are depicted in FIG. 1.
[0106] The resulting engineered minichromosome that contains the
heterologous DNA can then be transferred by cell fusion into a
recipient cell line, such as Chinese hamster ovary cells [CHO] and
correct expression of the heterologous DNA can be verified.
Following production of the cells, metaphase chromosomes are
obtained, such as by addition of colchicine, and the chromosomes
purified by addition of AT- and GC-specific dyes on a dual laser
beam based cell sorter (see Example 10 B for a description of
methods of isolating artificial chromosomes). Preparative amounts
of chromosomes [5.times.10.sup.4-5.times.10.sup.7 chromosomes/ml]
at a purity of 95% or higher can be obtained. The resulting
chromosomes are used for delivery to cells by methods such as
microinjection and liposome-mediated transfer.
[0107] Thus, the neo-minichromosome is stably maintained in cells,
replicates autonomously, and permits the persistent long-term
expression of the neo gene under non-selective culture conditions.
It also contains megabases of heterologous known DNA [.lambda. DNA
in the exemplified embodiments] that serves as target sites for
homologous recombination and integration of DNA of interest. The
neo-minichromosome is, thus, a vector for genetic engineering of
cells. It has been introduced into SCID mice, and shown to
replicate in the same manner as endogenous chromosomes.
[0108] The methods herein provide means to induce the events that
lead to formation of the neo-minichromosome by introducing
heterologous DNA with a selective marker [preferably a dominant
selectable marker] into cells and culturing the cells under
selective conditions. As a result, cells that contain a
multicentric, e.g., dicentric chromosome, or fragments thereof,
generated by amplification are produced. Cells with the dicentric
chromosome can then be treated to destabilize the chromosomes with
agents, such as BrdU and/or culturing under selective conditions,
resulting in cells in which the dicentric chromosome has formed two
chromosomes, a so-called minichromosome, and a formerly dicentric
chromosome that has typically undergone amplification in the
heterochromatin where the heterologous DNA has integrated to
produce a SATAC or a sausage chromosome [discussed below]. These
cells can be fused with other cells to separate the minichromosome
from the formerly dicentric chromosome into different cells so that
each type of MAC can be manipulated separately.
[0109] 4. Preparation of SATACs
[0110] An exemplary protocol for preparation of SATACs is
illustrated in FIG. 2 [particularly D, E and F] and FIG. 3 [see,
also the EXAMPLES, particularly EXAMPLES 4-7].
[0111] To prepare a SATAC, the starting materials are cells,
preferably a stable cell line, such as a fibroblast cell line, and
a DNA fragment that includes DNA that encodes a selective marker.
The DNA fragment is introduced into the cell by methods of DNA
transfer, including but not limited to direct uptake using calcium
phosphate, electroporation, and lipid-mediated transfer. To insure
integration of the DNA fragment in the heterochromatin, it is
preferable to start with DNA that will be targeted to the
pericentric heterochromatic region of the chromosome, such as
.lambda.CM8 and vectors provided herein, such as pTEMPUD [FIG. 5]
and pHASPUD (see Example 12) that include satellite DNA, or
specifically into rDNA in the centromeric regions of chromosomes
containing rDNA sequences. After introduction of the DNA, the cells
are grown under selective conditions. The resulting cells are
examined and any that have multicentric, particularly dicentric,
chromosomes [or heterochromatic chromosomes or sausage chromosomes
or other such structure; see, FIG. 2D, 2E and 2F] are selected.
[0112] In particular, if a cell with a dicentric chromosome is
selected, it can be grown under selective conditions, or,
preferably, additional DNA encoding a second selectable marker is
introduced, and the cells grown under conditions selective for the
second marker. The resulting cells should include chromosomes that
have structures similar to those depicted in FIGS. 2D, 2E, 2F.
Cells with a structure, such as the sausage chromosome, FIG. 2D,
can be selected and fused with a second cell line to eliminate
other chromosomes that are not of interest. If desired, cells with
other chromosomes can be selected and treated as described herein.
If a cell with a sausage chromosome is selected, it can be treated
with an agent, such as BrdU, that destabilizes the chromosome so
that the heterochromatic arm forms a chromosome that is
substantially heterochromatic [i.e., a megachromosome, see, FIG.
2F]. Structures such as the gigachromosome in which the
heterochromatic arm has amplified but not broken off from the
euchromatic arm, will also be observed. The megachromosome is a
stable chromosome. Further manipulation, such as fusions and growth
in selective conditions and/or BrdU treatment or other such
treatment, can lead to fragmentation of the megachromosome to form
smaller chromosomes that have the amplicon as the basic repeating
unit.
[0113] The megachromosome can be further fragmented in vivo using a
chromosome fragmentation vector, such as pTEMPUD [see, FIG. 5 and
EXAMPLE 12], pHASPUD or pTERPUD (see Example 12) to ultimately
produce a chromosome that comprises a smaller stable replicable
unit, about 15 Mb-60 Mb, containing one to four megareplicons.
[0114] Thus, the stable chromosomes formed de novo that originate
from the short arm of mouse chromosome 7 have been analyzed. This
chromosome region shows a capacity for amplification of large
chromosome segments, and promotes de novo chromosome formation.
Large-scale amplification at the same chromosome region leads to
the formation of dicentric and multicentric chromosomes, a
minichromosome, the 150-200 Mb size .lambda. neo-chromosome, the
"sausage" chromosome, the 500-1000 Mb gigachromosome, and the
stable 250-400 Mb megachromosome.
[0115] A clear segmentation is observed along the arms of the
megachromosome, and analyses show that the building units of this
chromosome are amplicons of .about.30 Mb composed of mouse major
satellite DNA with the integrated "foreign" DNA sequences at both
ends. The .about.30 Mb amplicons are composed of two .about.15 Mb
inverted doublets of .about.7.5 Mb mouse major satellite DNA
blocks, which are separated from each other by a narrow band of
non-satellite sequences [see, e.g., FIG. 3]. The wider
non-satellite regions at the amplicon borders contain integrated,
exogenous [heterologous] DNA, while the narrow bands of
non-satellite DNA sequences within the amplicons are integral parts
of the pericentric heterochromatin of mouse chromosomes. These
results indicate that the .about.7.5 Mb blocks flanked by
non-satellite DNA are the building units of the pericentric
heterochromatin of mouse chromosomes, and the .about.15 Mb size
pericentric regions of mouse chromosomes contain two .about.7.5 Mb
units.
[0116] Apart from the euchromatic terminal segments, the whole
megachromosome is heterochromatic, and has structural homogeneity.
Therefore, this large chromosome offers a unique possibility for
obtaining information about the amplification process, and for
analyzing some basic characteristics of the pericentric
constitutive heterochromatin, as a vector for heterologous DNA, and
as a target for further fragmentation.
[0117] As shown herein, this phenomenon is generalizable and can be
observed with other chromosomes. Also, although these de novo
formed chromosome segments and chromosomes appear different, there
are similarities that indicate that a similar amplification
mechanism plays a role in their formation: (i) in each case, the
amplification is initiated in the centromeric region of the mouse
chromosomes and large (Mb size) amplicons are formed; (ii) mouse
major satellite DNA sequences are constant constituents of the
amplicons, either by providing the bulk of the heterochromatic
amplicons [H-type amplification], or by bordering the aeuchromatic
amplicons [E-type amplification]; (iii) formation of inverted
segments can be demonstrated in the .lambda. neo-chromosome and
megachromosome; (iv) chromosome arms and chromosomes formed by the
amplification are stable and functional.
[0118] The presence of inverted chromosome segments seems to be a
common phenomenon in the chromosomes formed de novo at the
centromeric region of mouse chromosome 7. During the formation of
the neo-minichromosome, the event leading to the stabilization of
the distal segment of mouse chromosome 7 that bears the
neo-centromere may have been the formation of its inverted
duplicate. Amplicons of the megachromosome are inverted doublets of
.about.7.5 Mb mouse major satellite DNA blocks.
[0119] 5. Cell Lines
[0120] Cell lines that contain MACs, such as the minichromosome,
the .lambda.-neo chromosome, and the SATACs are provided herein or
can be produced by the methods herein. Such cell lines provide a
convenient source of these chromosomes and can be manipulated, such
as by cell fusion or production of microcells for fusion with
selected cell lines, to deliver the chromosome of interest into
hybrid cell lines. Exemplary cell lines are described herein and
some have been deposited with the ECACC.
[0121] a. EC3/7C5 and EC3/7C6
[0122] Cell lines EC3/7C5 and EC3/7C6 were produced by single cell
cloning of EC3/7. For exemplary purposes EC3/7C5 has been deposited
with the ECACC. These cell lines contain a minichromosome and the
formerly dicentric chromosome from EC3/7. The stable
minichromosomes in cell lines EC3/7C5 and EC3/7C6 appear to be the
same and they seem to be duplicated derivatives of the .about.10-15
Mb "broken-off" fragment of the dicentric chromosome. Their similar
size in these independently generated cell lines might indicate
that .about.20-30 Mb is the minimal or close to the minimal
physical size for a stable minichromosome.
[0123] b. TF1004G19
[0124] Introduction of additional heterologous DNA, including DNA
encoding a second selectable marker, hygromycin phosphotransferase,
i.e., the hygromycin-resistance gene, and also a detectable marker,
.beta.-galactosidase (i.e., encoded by the lacZ gene), into the
EC3/7C5 cell line and growth under selective conditions produced
cells designated TF1004G19. In particular, this cell line was
produced from the EC3/7C5 cell line by cotransfection with plasmids
pH132, which contains an anti-HIV ribozyme and
hygromycin-resistance gene, pCH110 [encodes .beta.-galactosidase]
and .lambda. phage [.lambda.cl 875 Sam 7] DNA and selection with
hygromycin B.
[0125] Detailed analysis of the TF1004G19 cell line by in situ
hybridization with .lambda. phage and plasmid DNA sequences
revealed the formation of the sausage chromosome. The formerly
dicentric chromosome of the EC3/7C5 cell line translocated to the
end of another acrocentric chromosome. The heterologous DNA
integrated into the pericentric heterochromatin of the formerly
dicentric chromosome and is amplified several times with megabases
of mouse pericentric heterochromatic satellite DNA sequences [FIG.
2D] forming the "sausage" chromosome. Subsequently the acrocentric
mouse chromosome was substituted by a euchromatic telomere.
[0126] In situ hybridization with biotin-labeled subfragments of
the hygromycin-resistance and .beta.-galactosidase genes resulted
in a hybridization signal only in the heterochromatic arm of the
sausage chromosome, indicating that in TF1004G19 transformant cells
these genes are localized in the pericentric heterochromatin.
[0127] A high level of gene expression, however, was detected. In
general, heterochromatin has a silencing effect in Drosophila,
yeast and on the HSV-tk gene introduced into satellite DNA at the
mouse centromere. Thus, it was of interest to study the TF1004G19
transformed cell line to confirm that genes located in the
heterochromatin were indeed expressed, contrary to recognized
dogma.
[0128] For this purpose, subclones of TF1004G19, containing a
different sausage chromosome [see FIG. 2D], were established by
single cell cloning. Southern hybridization of DNA isolated from
the subclones with subfragments of hygromycin phosphotransferase
and lacZ genes showed a close correlation between the intensity of
hybridization and the length of the sausage chromosome. This
finding supports the conclusion that these genes are localized in
the heterochromatic arm of the sausage chromosome.
[0129] (1) TF1004G-19C5
[0130] TF1004G-19C5 is a mouse LMTK.sup.- fibroblast cell line
containing neo-minichromosomes and stable "sausage" chromosomes. It
is a subclone of TF1004G19 and was generated by single-cell cloning
of the TF1004G19 cell line. It has been deposited with the ECACC as
an exemplary cell line and exemplary source of a sausage
chromosome. Subsequent fusion of this cell line with CHO K20 cells
and selection with hygromycin and G418 and HAT (hypoxanthine,
aminopteria, and thymidine medium; see Szybalski et al. (1962)
Proc. Natl. Acad. Sci. 48:2026) resulted in hybrid cells
(designated 19C5.times.Ha4) that carry the sausage chromosome and
the neo-minichromosome. BrdU treatment of the hybrid cells,
followed by single cell cloning and selection with G418 and/or
hygromycin produced various cells that carry chromosomes of
interest, including GB43 and G3D5.
[0131] (2) Other Subclones
[0132] Cell lines GB43 and G3D5 were obtained by treating
19C5.times.Ha4 cells with BrdU followed by growth in
G418-containing selective medium and retreatment with BrdU. The two
cell lines were isolated by single cell cloning of the selected
cells. GB43 cells contain the neo-minichromosome only. G3D5, which
has been deposited with the ECACC, carries the neo-minichromosome
and the megachromosome. Single cell cloning of this cell line
followed by growth of the subclones in G418- and
hygromycin-containing medium yielded subclones such as the GHB42
cell line carrying the neo-minichromosome and the megachromosome.
H1D3 is a mouse-hamster hybrid cell line carrying the
megachromosome, but no neo-minichromosome, and was generated by
treating 19C5.times.Ha4 cells with BrdU followed by growth in
hygromycin-containing selective medium and single cell subcloning
of selected cells. Fusion of this cell line with the CD4.sup.+ HeLa
cell line that also carries DNA encoding an additional selection
gene, the neomycin-resistance gene, produced cells [designated
H1.times.HE41 cells] that carry the megachromosome as well as a
human chromosome that carries CD4neo. Further BrdU treatment and
single cell cloning produced cell lines, such as 1B3, that include
cells with a truncated megachromosome.
[0133] 5. DNA Constructs Used to Transform the Cells
[0134] Heterologous DNA can be introduced into the cells by
transfection or other suitable method at any stage during
preparation of the chromosomes [see, e.g., FIG. 4]. In general,
incorporation of such DNA into the MACs is assured through
site-directed integration, such as may be accomplished by inclusion
of .lambda.-DNA in the heterologous DNA (for the exemplified
chromosomes), and also an additional selective marker gene. For
example, cells containing a MAC, such as the minichromosome or a
SATAC, can be cotransfected with a plasmid carrying the desired
heterologous DNA, such as DNA encoding an HIV ribozyme, the cystic
fibrosis gene, and DNA encoding a second selectable marker, such as
hygromycin resistance. Selective pressure is then applied to the
cells by exposing them to an agent that is harmful to cells that do
not express the new selectable marker. In this manner, cells that
include the heterologous DNA in the MAC are identified. Fusion with
a second cell line can provide a means to produce cell lines that
contain one particular type of chromosomal structure or MAC.
[0135] Various vectors for this purpose are provided herein [see,
Examples] and others can be readily constructed. The vectors
preferably include DNA that is homologous to DNA contained within a
MAC in order to target the DNA to the MAC for integration therein.
The vectors also include a selectable marker gene and the selected
heterologous gene(s) of interest. Based on the disclosure herein
and the knowledge of the skilled artisan, one of skill can
construct such vectors.
[0136] Of particular interest herein is the vector pTEMPUD and
derivatives thereof that can target DNA into the heterochromatic
region of selected chromosomes. These vectors can also serve as
fragmentation vectors [see, e.g., Example 12].
[0137] Heterologous genes of interest include any gene that encodes
a therapeutic product and DNA encoding gene products of interest.
These genes and DNA include, but are not limited to: the cystic
fibrosis gene [CF], the cystic fibrosis transmembrane regulator
(CFTR) gene [see, e.g., U.S. Pat. No. 5,240,846; Rosenfeld et al.
(1992) Cell 68:143-155; Hyde et al. (1993) Nature 362: 250-255;
Kerem et al. (1989) Science 245:1073-1080; Riordan et al. (1989)
Science 245:1066-1072; Rommens et al. (1989) Science 245:1059-1065;
Osborne et al. (1991) Am. J. Hum. Genetics 48:6089-6122; White et
al. (1990) Nature 344:665-667; Dean et al. (1990) Cell 61:863-870;
Erlich et al. (1991) Science 252:1643; and U.S. Pat. Nos.
5,453,357, 5,449,604, 5,434,086, and 5,240,846, which provides a
retroviral vector encoding the normal CFTR gene].
[0138] B. Isolation of Artificial Chromosomes
[0139] The MACs provided herein can be isolated by any suitable
method known to those of skill in the art. Also, methods are
provided herein for effecting substantial purification,
particularly of the SATACs. SATACs have been isolated by
fluorescence-activated cell sorting [FACS]. This method takes
advantage of the nucleotide base content of the SATACs, which, by
virtue of their high heterochromatic DNA content, will differ from
any other chromosomes in a cell. In particular embodiment,
metaphase chromosomes are isolated and stained with base-specific
dyes, such as Hoechst 33258 and chromomycin A3.
Fluorescence-activated cell sorting will separate the SATACs from
the endogenous chromosomes. A dual-laser cell sorter [FACS Vantage
Becton Dickinson Immunocytometry Systems] in which two lasers were
set to excite the dyes separately, allowed a bivariate analysis of
the chromosomes by base-pair composition and size. Cells containing
such SATACs can be similarly sorted.
[0140] Additional methods provided herein for isolation of
artificial chromosomes from endogenous chromosomes include
procedures that are particularly well suited for large-scale
isolation of artificial chromosomes such as SATACs. In these
methods, the size and density differences between SATACs and
endogenous chromosomes are exploited to effect separation of these
two types of chromosomes. Such methods involve techniques such as
swinging bucket centrifugation, zonal rotor centrifugation, and
velocity sedimentation. Affinity-, particularly immunoaffinity-,
based methods for separation of artificial from endogenous
chromosomes are also provided herein. For example, SATACs, which
are predominantly heterochromatin, may be separated from endogenous
chromosomes through immunoaffinity procedures involving antibodies
that specifically recognize heterochromatin, and/or the proteins
associated therewith, when the endogenous chromosomes contain
relatively little heterochromatin, such as in hamster cells.
[0141] C. In vitro Construction of Artificial Chromosomes
[0142] Artificial chromosomes can be constructed in vitro by
assembling the structural and functional elements that contribute
to a complete chromosome capable of stable replication and
segregation alongside endogenous chromosomes in cells. The
identification of the discrete elements that in combination yield a
functional chromosome has made possible the in vitro generation of
artificial chromosomes. The process of in vitro construction of
artificial chromosomes, which can be rigidly controlled, provides
advantages that may be desired in the generation of chromosomes
that, for example, are required in large amounts or that are
intended for specific use in transgenic animal systems.
[0143] For example, in vitro construction may be advantageous when
efficiency of time and scale are important considerations in the
preparation of artificial chromosomes. Because in vitro
construction methods do not involve extensive cell culture
procedures, they may be utilized when the time and labor required
to transform, feed, cultivate, and harvest cells used in in vivo
cell-based production systems is unavailable.
[0144] In vitro construction may also be rigorously controlled with
respect to the exact manner in which the several elements of the
desired artificial chromosome are combined and in what sequence and
proportions they are assembled to yield a chromosome of precise
specifications. These aspects may be of significance in the
production of artificial chromosomes that will be used in live
animals where it is desirable to be certain that only very pure and
specific DNA sequences in specific amounts are being introduced
into the host animal.
[0145] The following describes the processes involved in the
construction of artificial chromosomes in vitro, utilizing a
megachromosome as exemplary starting material.
[0146] 1. Identification and Isolation of the Components of the
Artificial Chromosome
[0147] The MACs provided herein, particularly the SATACs, are
elegantly simple chromosomes for use in the identification and
isolation of components to be used in the in vitro construction of
artificial chromosomes. The ability to purify MACs to a very high
level of purity, as described herein, facilitates their use for
these purposes. For example, the megachromosome, particularly
truncated forms thereof [i.e. cell lines, such as 1B3 and mM2C1,
which are derived from H1D3 (deposited at the European Collection
of Animal Cell Culture (ECACC) under Accession No. 96040929, see
EXAMPLES below) serve as starting materials.
[0148] For example, the mM2C1 cell line contains a
micro-megachromosome (.about.50-60 kB), which advantageously
contains only one centromere, two regions of integrated
heterologous DNA with adjacent rDNA sequences, with the remainder
of the chromosomal DNA being mouse major satellite DNA. Other
truncated megachromosomes can serve as a source of telomeres, or
telomeres can be provided (see, Examples below regarding
construction of plasmids containing tandemly repeated telomeric
sequences). The centromere of the mM2C1 cell line contains mouse
minor satellite DNA, which provides a useful tag for isolation of
the centromeric DNA.
[0149] Additional features of particular SATACs provided herein,
such as the micro-megachromosome of the mM2C1 cell line, that make
them uniquely suited to serve as starting materials in the
isolation and identification of chromosomal components include the
fact that the centromeres of each megachromosome within a single
specific cell line are identical. The ability to begin with a
homogeneous centromere source (as opposed to a mixture of different
chromosomes having differing centromeric sequences) greatly
facilitates the cloning of the centromere DNA. By digesting
purified megachromosomes, particularly truncated megachromosomes,
such as the micro-megachromosome, with appropriate restriction
endonucleases and cloning the fragments into the commercially
available and well known YAC vectors (see, e.g., Burke et al.
(1987) Science 236:806-812), BAC vectors (see, e.g., Shizuya et al.
(1992) Proc. Natl. Acad. Sci. U.S.A. 89: 8794-8797 bacterial
artificial chromosomes which have a capacity of incorporating 0.9-1
Mb of DNA) or PAC vectors (the P1 artificial chromosome vector
which is a P1 plasmid derivative that has a capacity of
incorporating 300 kb of DNA and that is delivered to E. coli host
cells by electroporation rather than by bacteriophage packaging;
see, e.g., Ioannou et al. (1994) Nature Genetics 6:84-89; Pierce et
al. (1992) Meth. Enzymol. 216:549-574; Pierce et al. (1992) Proc.
Natl. Acad. Sci. U.S.A. 89:2056-2060; U.S. Pat. No. 5,300,431 and
International PCT application No. WO 92/14819) vectors, it is
possible for as few as 50 clones to represent the entire
micro-megachromosome.
[0150] a. Centromeres
[0151] An exemplary centromere for use in the construction of a
mammalian artificial chromosome is that contained within the
megachromosome of any of the megachromosome-containing cell lines
provided herein, such as, for example, H1D3 and derivatives
thereof, such as mM2C1 cells. Megachromosomes are isolated from
such cell lines utilizing, for example, the procedures described
herein, and the centromeric sequence is extracted from the isolated
megachromosomes. For example, the megachromosomes may be separated
into fragments utilizing selected restriction endonucleases that
recognize and cut at sites that, for instance, are primarily
located in the replication and/or heterologous DNA integration
sites and/or in the satellite DNA. Based on the sizes of the
resulting fragments, certain undesired elements may be separated
from the centromere-containing sequences. The centromere-containing
DNA, which could be as large as 1 Mb.
[0152] Probes that specifically recognize the centromeric
sequences, such as mouse minor satellite DNA-based probes [see,
e.g., Wong et al. (1988) Nucl. Acids Res. 16:11645-11661], may be
used to isolate the centromere-containing YAC, BAC or PAC clones
derived from the megachromosome. Alternatively, or in conjunction
with the direct identification of centromere-containing
megachromosomal DNA, probes that specifically recognize the
non-centromeric elements, such as probes specific for mouse major
satellite DNA, the heterologous DNA and/or rDNA, may be used to
identify and eliminate the non-centromeric DNA-containing
clones.
[0153] Additionally, centromere cloning methods described herein
may be utilized to isolate the centromere-containing sequence of
the megachromosome. For example, Example 12 describes the use of
YAC vectors in combination with the murine tyrosinase gene and
NMRI/Han mice for identification of the centromeric sequence.
[0154] Once the centromere fragment has been isolated, it may be
sequenced and the sequence information may in turn be used in PCR
amplification of centromere sequences from megachromosomes or other
sources of centromeres. Isolated centromeres may also be tested for
function in vivo by transferring the DNA into a host mammalian
cell. Functional analysis may include, for example, examining the
ability of the centromere sequence to bind centromere-binding
proteins. The cloned centromere will be transferred to mammalian
cells with a selectable marker gene and the binding of a
centromere-specific protein, such as anti-centromere antibodies
(eq., LU851, see, Hadlaczky et al. (1986) Exp. Cell Res. 167:1-15)
can be used to assess function of the centromeres.
[0155] b. Telomeres
[0156] Preferred telomeres are the 1 kB synthetic telomere provided
herein (see, Examples). A double synthetic telomere construct,
which contains a 1 kB synthetic telomere linked to a dominant
selectable marker gene that continues in an inverted orientation
may be used for ease of manipulation. Such a double construct
contains a series of TTAGGG repeats 3' of the marker gene and a
series of repeats of the inverted sequence, i.e., GGGATT, 5' of the
marker gene as follows:
[0157] (GGGATTT).sub.n--dominant marker gene--(TTAGGG).sub.n. Using
an inverted marker provides an easy means for insertion, such as by
blunt end ligation, since only properly oriented fragments will be
selected.
[0158] C. Megareplicator
[0159] The megareplicator sequences, such as the rDNA, provided
herein are preferred for use in in vitro constructs. The rDNA
provides an origin of replication and also provides sequences that
facilitate amplification of the artificial chromosome in vivo to
increase the size of the chromosome to, for example accommodate
increasing copies of a heterologous gene of interest as well as
continuous high levels of expression of the heterologous genes.
[0160] d. Filler Heterochromatin
[0161] Filler heterochromatin, particularly satellite DNA, is
included to maintain structural integrity and stability of the
artificial chromosome and provide a structural base for carrying
genes within the chromosome. The satellite DNA is typically
A/T-rich DNA sequence, such as mouse major satellite DNA, or
G/C-rich DNA sequence, such as hamster natural satellite DNA.
Sources of such DNA include any eukaryotic organisms that carry
non-coding satellite DNA with sufficient A/T or G/C composition to
promote ready separation by sequence, such as by FACS, or by
density gradients. The satellite DNA may also be synthesized by
generating sequence containing monotone, tandem repeats of highly
A/T- or G/C-rich DNA units.
[0162] The most suitable amount of filler heterochromatin for use
in construction of the artificial chromosome may be empirically
determined by, for example, including segments of various lengths,
increasing in size, in the construction process. Fragments that are
too small to be suitable for use will not provide for a functional
chromosome, which may be evaluated in cell-based expression
studies, or will result in a chromosome of limited functional
lifetime or mitotic and structural stability.
[0163] e. Selectable Marker
[0164] Any convenient selectable marker may be used and at any
convenient locus in the MAC.
[0165] 2. Combination of the Isolated Chromosomal Elements
[0166] Once the isolated elements are obtained, they may be
combined to generate the complete, functional artificial
chromosome. This assembly can be accomplished for example, by in
vitro ligation either in solution, LMP agarose or on microbeads.
The ligation is conducted so that one end of the centromere is
directly joined to a telomere. The other end of the centromere,
which serves as the gene-carrying chromosome arm, is built up from
a combination of satellite DNA and rDNA sequence and may also
contain a selectable marker gene. Another telomere is joined to the
end of the gene-carrying chromosome arm. The gene-carrying arm is
the site at which any heterologous genes of interest, for example,
in expression of desired proteins encoded thereby, are incorporated
either during in vitro construction of the chromosome or sometime
thereafter.
[0167] 3. Analysis and Testing of the Artificial Chromosome
[0168] Artificial chromosomes constructed in vitro may be tested
for functionality in in vivo mammalian cell systems, using any of
the methods described herein for the SATACs, minichromosomes, or
known to those of skill in the art.
[0169] 4. Introduction of Desired Heterologous DNA Into the in
vitro Synthesized Chromosome
[0170] Heterologous DNA may be introduced into the in vitro
synthesized chromosome using routine methods of molecular biology,
may be introduced using the methods described herein for the
SATACs, or may be incorporated into the in vitro synthesized
chromosome as part of one of the synthetic elements, such as the
heterochromatin. The heterologous DNA may be linked to a selected
repeated fragment, and then the resulting construct may be
amplified in vitro using the methods for such in vitro
amplification provided herein (see the Examples).
[0171] D. Introduction of Artificial Chromosomes into Cells,
Tissues, Animals and Plants
[0172] Suitable hosts for introduction of the MACs provided herein,
include, but are not limited to, any animal or plant, cell or
tissue thereof, including, but not limited to: mammals, birds,
reptiles, amphibians, insects, fish, arachnids, tobacco, tomato,
wheat, plants and algae. The MACs, if contained in cells, may be
introduced by cell fusion or microcell fusion or, if the MACs have
been isolated from cells, they may be introduced into host cells by
any method known to those of skill in this art, including but not
limited to: direct DNA transfer, electroporation, lipid-mediated
transfer, e.g., lipofection and liposomes, microprojectile
bombardment, microinjection in cells and embryos, protoplast
regeneration for plants, and any other suitable method [see, e.g.,
Weissbach et al. (1988) Methods for Plant Molecular Biology,
Academic Press, N.Y., Section VIII, pp. 421-463; Grierson et al
(1988) Plant Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9;
see, also U.S. Pat. Nos. 5,491,075; 5,482,928; and 5,424,409; see,
also, e.g., U.S. Pat. No. 5,470,708, which describes
particle-mediated transformation of mammalian unattached
cells].
[0173] Other methods for introducing DNA into cells include nuclear
microinjection and bacterial protoplast fusion with intact cells.
Polycations, such as polybrene and polyornithine, may also be used.
For various techniques for transforming mammalian cells, see e.g.,
Keown et al. Methods in Enzymology (1990) Vol. 185, pp. 527-537;
and Mansour et al. (1988) Nature 336:348-352.
[0174] For example, isolated, purified artificial chromosomes can
be injected into an embryonic cell line such as a human kidney
primary embryonic cell line [ATCC accession number CRL 1573] or
embryonic stem cells [see, e.g., Hogan et al. (1994) Manipulating
the Mouse Embryo, A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., see, especially, pages
255-264 and Appendix 3].
[0175] Preferably the chromosomes are introduced by microinjection,
using a system such as the Eppendorf automated microinjection
system, and grown under selective conditions, such as in the
presence of hygromycin B or neomycin.
[0176] 1. Methods for Introduction of Chromosomes Into Hosts
[0177] Depending on the host cell used, transformation is done
using standard techniques appropriate to such cells. These methods
include any, including those described herein, known to those of
skill in the art.
[0178] a. DNA Uptake
[0179] For mammalian cells that do not have cell walls, the calcium
phosphate precipitation method for introduction of exogenous DNA
[see, e.g., Graham et al. (1978) Virology 52:456-457; Wigler et al.
(1979) Proc. Natl. Acad. Sci. U.S.A. 76:1373-1376; and Current
Protocols in Molecular Biology, Vol. 1, Wiley Inter-Science,
Supplement 14, Unit 9.1.1-9.1.9 (1990)] is often preferred. DNA
uptake can be accomplished by DNA alone or in the presence of
polyethylene glycol [PEG-mediated gene transfer], which is a fusion
agent, or by any variations of such methods known to those of skill
in the art [see, e.g., U.S. Pat. No. 4,684,611].
[0180] Lipid-mediated carrier systems are also among the preferred
methods for introduction of DNA into cells [see, e.g., Teifel et
al. (1995) Biotechniques 19:79-80; Albrecht et al. (1996) Ann.
Hematol. 72:73-79; Holmen et al. (1995) In Vitro Cell Dev. Biol.
Anim. 31:347-351; Remy et al. (1994) Bioconiug. Chem. 5:647-654; Le
Bolc'h et al. (1995) Tetrahedron Lett. 36:6681-6684; Loeffler et al
(1993) Meth. Enzymol. 217:599-618]. Lipofection [see, e.g., Strauss
(1996) Meth. Mol. Biol. 54:307-327] may also be used to introduce
DNA into cells. This method is particularly well-suited for
transfer of exogenous DNA into chicken cells (e.g., chicken
blastodermal cells and primary chicken fibroblasts; see Brazolot et
al. (1991) Mol. Repro. Dev. 30:304-312). In particular, DNA of
interest can be introduced into chickens in operative linkage with
promoters from genes, such as lysozyme and ovalbumin, that are
expressed in the egg, thereby permitting expression of the
heterologous DNA in the egg.
[0181] Additional methods useful in the direct transfer of DNA into
cells include particle gun electrofusion [see, e.g., U.S. Pat. Nos.
4,955,378, 4,923,814, 4,476,004, 4,906,576 and 4,441,972] and
virion-mediated gene transfer.
[0182] A commonly used approach for gene transfer in land plants
involves the direct introduction of purified DNA into protoplasts.
The three basic methods for direct gene transfer into plant cells
include: 1) polyethylene glycol [PEG]-mediated DNA uptake, 2)
electroporation-mediate- d DNA uptake and 3) microinjection. In
addition, plants may be transformed using ultrasound treatment
[see, e.g., International PCT application publication No. WO
91/00358].
[0183] b. Electroporation
[0184] Electroporation involves providing high-voltage electrical
pulses to a solution containing a mixture of protoplasts and
foreign DNA to create reversible pores in the membranes of plant
protoplasts as well as other cells. Electroporation is generally
used for prokaryotes or other cells, such as plants that contain
substantial cell-wall barriers. Methods for effecting
electroporation are well known [see, e.g., U.S. Pat. Nos.
4,784,737, 5,501,967, 5,501,662, 5,019,034, 5,503,999; see, also
Frommet al. (1985) Proc. Natl. Acad. Sci. U.S.A. 82:5824-5828].
[0185] For example, electroporation is often used for
transformation of plants [see, e.g., Ag Biotechnology News 7:3 and
17 (September/October 1990)]. In this technique, plant protoplasts
are electroporated in the presence of the DNA of interest that also
includes a phenotypic marker. Electrical impulses of high field
strength reversibly permeabilize biomembranes allowing the
introduction of the plasmids. Electroporated plant protoplasts
reform the cell wall, divide, and form plant callus. Transformed
plant cells will be identified by virtue of the expressed
phenotypic marker. The exogenous DNA may be added to the
protoplasts in any form such as, for example, naked linear,
circular or supercoiled DNA, DNA encapsulated in liposomes, DNA in
spheroplasts, DNA in other plant protoplasts, DNA complexed with
salts, and other methods.
[0186] C. Microcells
[0187] The chromosomes can be transferred by preparing microcells
containing an artificial chromosome and then fusing with selected
target cells. Methods for such preparation and fusion of microcells
are well known [see the Examples and also see, e.g., U.S. Pat. Nos.
5,240,840, 4,806,476, 5,298,429, 5,396,767, Fournier (1981) Proc.
Natl. Acad. Sci. U.S.A. 78:6349-6353; and Lambert et al. (1991)
Proc. Natl. Acad. Sci. U.S.A. 88:5907-59]. Microcell fusion, using
microcells that contain an artificial chromosome, is a particularly
useful method for introduction of MACs into avian cells, such as
DT40 chicken pre-B cells [for a description of DT40 cell fusion,
see, e.g., Dieken et al. (1996) Nature Genet. 12:174-182].
[0188] 2. Hosts
[0189] Suitable hosts include any host known to be useful for
introduction and expression of heterologous DNA. Of particular
interest herein, animal and plant cells and tissues, including, but
not limited to insect cells and larvae, plants, and animals,
particularly transgenic (non-human) animals, and animal cells.
Other hosts include, but are not limited to mammals, birds,
particularly fowl such as chickens, reptiles, amphibians, insects,
fish, arachnids, tobacco, tomato, wheat, monocots, dicots and
algae, and any host into which introduction of heterologous DNA is
desired. Such introduction can be effected using the MACs provided
herein, or, if necessary by using the MACs provided herein to
identify species-specific centromeres and/or functional chromosomal
units and then using the resulting centromeres or chromosomal units
as artificial chromosomes, or alternatively, using the methods
exemplified herein for production of MACs to produce
species-specific artificial chromosomes.
[0190] a. Introduction of DNA into Embryos for Production of
Transgenic (Non-human) Animals and Introduction of DNA Into Animal
Cells
[0191] Transgenic (non-human) animals can be produced by
introducing exogenous genetic material into a pronucleus of a
mammalian zygote by microinjection [see, e.g., U.S. Pat. Nos.
4,873,191 and 5,354,674; see, also, International PCT application
publication No. WO 95/14769, which is based on U.S. application
Ser. No. 08/159,084]. The zygote is capable of development into a
mammal. The embryo or zygote is transplanted into a host female
uterus and allowed to develop. Detailed protocols and examples are
set forth below.
[0192] Nuclear transfer [see, Wilmut et al. (1997) Nature
385:810-813, International PCT application Nos. WO 97/07669 and WO
97/07668]. Briefly in this method, the SATAC containing the genes
of interest is introduced by any suitable method, into an
appropriate donor cell, such as a mammary gland cell, that contains
totipotent nuclei. The diploid nucleus of the cell, which is either
in G0 or G1 phase, is then introduced, such as by cell fusion or
microinjection, into an unactivated oocyte, preferably enucleated
cell, which is arrested in the metaphase of the second meiotic
division. Enucleation may be effected by any suitable method, such
as actual removal, or by treating with means, such as ultraviolet
light, that functionally remove the nucleus. The oocyte is then
activated, preferably after a period of contact, about 6-20 hours
for cattle, of the new nucleus with the cytoplasm, while
maintaining correct ploidy, to produce a reconstituted embryo,
which is then introduced into a host. Ploidy is maintained during
activation, for example, by incubating the reconstituted cell in
the presence of a microtubule inhibitor, such as nocodazole,
colchicine, cocemid, and taxol, whereby the DNA replicates
once.
[0193] Transgenic chickens can be produced by injection of
dispersed blastodermal cells from Stage X chicken embryos into
recipient embryos at a similar stage of development [see e.g.,
Etches et al. (1993) Poultry Sci. 72:882-889; Petitte et al. (1990)
Development 108:185-189]. Heterologous DNA is first introduced into
the donor blastodermal cells using methods such as, for example,
lipofection [see, e.g., Brazolot et al. (1991) Mol. Repro. Dev.
30:304-312] or microcell fusion [see, e.g., Dieken et al. (1996)
Nature Genet. 12:174-182]. The transfected donor cells are then
injected into recipient chicken embryos [see e.g., Carsience et al.
(1993) Development 117: 669-675]. The recipient chicken embryos
within the shell are candled and allowed to hatch to yield a
germline chimeric chicken.
[0194] DNA can be introduced into animal cells using any known
procedure, including, but not limited to: direct uptake, incubation
with polyethylene glycol [PEG], microinjection, electroporation,
lipofection, cell fusion, microcell fusion, particle bombardment,
including microprojectile bombardment [see, e.g., U.S. Pat. No.
5,470,708, which provides a method for transforming unattached
mammalian cells via particle bombardment], and any other such
method. For example, the transfer of plasmid DNA in liposomes
directly to human cells in situ has been approved by the FDA for
use in humans [see, e.g., Nabel, et al. (1990) Science
249:1285-1288 and U.S. Pat. No. 5,461,032].
[0195] b. Introduction of Heterologous DNA Into Plants
[0196] Numerous methods for producing or developing transgenic
plants are available to those of skill in the art. The method used
is primarily a function of the species of plant. These methods
include, but are not limited to: direct transfer of DNA by
processes, such as PEG-induced DNA uptake, protoplast fusion,
microinjection, electroporation, and microprojectile bombardment
[see, e.g., Uchimiya et al. (1989) J. of Biotech. 12: 1-20 for a
review of such procedures, see, also, e.g., U.S. Pat. Nos.
5,436,392 and 5,489,520 and many others]. For purposes herein, when
introducing a MAC, microinjection, protoplast fusion and particle
gun bombardment are preferred.
[0197] Plant species, including tobacco, rice, maize, rye, soybean,
Brassica napus, cotton, lettuce, potato and tomato, have been used
to produce transgenic plants. Tobacco and other species, such as
petunias, often serve as experimental models in which the methods
have been developed and the genes first introduced and
expressed.
[0198] DNA uptake can be accomplished by DNA alone or in the
presence of PEG, which is a fusion agent, with plant protoplasts or
by any variations of such methods known to those of skill in the
art [see, e.g., U.S. Pat. No. 4,684,611 to Schilperoot et al.].
Electroporation, which involves high-voltage electrical pulses to a
solution containing a mixture of protoplasts and foreign DNA to
create reversible pores, has been used, for example, to
successfully introduce foreign genes into rice and Brassica napus.
Microinjection of DNA into plant cells, including cultured cells
and cells in intact plant organs and embryoids in tissue culture
and microprojectile bombardment [acceleration of small high density
particles, which contain the DNA, to high velocity with a particle
gun apparatus, which forces the particles to penetrate plant cell
walls and membranes] have also been used. All plant cells into
which DNA can be introduced and that can be regenerated from the
transformed cells can be used to produce transformed whole plants
which contain the transferred artificial chromosome. The particular
protocol and means for introduction of the DNA into the plant host
may need to be adapted or refined to suit the particular plant
species or cultivar.
[0199] C. Insect Cells
[0200] Insects are useful hosts for introduction of artificial
chromosomes for numerous reasons, including, but not limited to:
(a) amplification of genes encoding useful proteins can be
accomplished in the artificial chromosome to obtain higher protein
yields in insect cells; (b) insect cells support required
post-translational modifications, such as glycosylation and
phosphorylation, that can be required for protein biological
functioning; (c) insect cells do not support mammalian viruses,
and, thus, eliminate the problem of cross-contamination of products
with such infectious agents; (d) this technology circumvents
traditional recombinant baculovirus systems for production of
nutritional, industrial or medicinal proteins in insect cell
systems; (e) the low temperature optimum for insect cell growth
(28.degree. C.) permits reduced energy cost of production; (f)
serum-free growth medium for insect cells permits lower production
costs; (g) artificial chromosome-containing cells can be stored
indefinitely at low temperature; and (h) insect larvae will be
biological factories for production of nutritional, medicinal or
industrial proteins by microinjection of fertilized insect eggs
[see, e.g., Joy et al. (1991) Current Science 66:145-150, which
provides a method for microinjecting heterologous DNA into Bombyx
mori eggs].
[0201] Either MACs or insect-specific artificial chromosomes
[BUGACS] will be used to introduce genes into insects. As described
in the Examples, it appears that MACs will function in insects to
direct expression of heterologous DNA contained thereon. For
example, as described in the Examples, a MAC containing the B. mori
actin gene promoter fused to the lacZ gene has been generated by
transfection of EC3/7C5 cells with a plasmid containing the fusion
gene. Subsequent fusion of the B. mori cells with the transfected
EC3/7C5 cells that survived selection yielded a MAC-containing
insect-mouse hybrid cell line in which .beta.-galactosidase
expression was detectable.
[0202] Insect host cells include, but are not limited to, hosts
such as Spodoptera frugiperda [caterpillar], Aedes aegypti
[mosquito], Aedes albopictus [mosquito], Drosphila melanogaster
[fruitfly], Bombyx mori [silkworm], Manduca sexta [tomato horn
worm] and Trichoplusia ni [cabbage looper]. Efforts have been
directed toward propagation of insect cells in culture. Such
efforts have focused on the fall armyworm, Spodoptera frugiperda.
Cell lines have been developed also from other insects such as the
cabbage looper, Trichoplusia ni and the silkworm, Bombyx mori. It
has also been suggested that analogous cell lines can be created
using the tomato hornworm, Manduca sexta. To introduce DNA into an
insect, it should be introduced into the larvae, and allowed to
proliferate, and then the hemolymph recovered from the larvae so
that the proteins can be isolated therefrom.
[0203] The preferred method herein for introduction of artificial
chromosomes into insect cells is microinjection [see, e.g., Tamura
et al. (1991) Bio Ind. 8:26-31; Nikolaev et al. (1989) Mol. Biol.
(Moscow) 23:1177-87; and methods exemplified and discussed
herein].
[0204] E. Applications For and Uses of Artificial Chromosomes
[0205] Artificial chromosomes provide convenient and useful
vectors, and in some instances [e,g,, in the case of very large
heterologous genes] the only vectors, for introduction of
heterologous genes into hosts. Virtually any gene of interest is
amenable to introduction into a host via artificial chromosomes.
Such genes include, but are not limited to, genes that encode
receptors, cytokines, enzymes, proteases, hormones, growth factors,
antibodies, tumor suppressor genes, therapeutic products and
multigene pathways.
[0206] The artificial chromosomes provided herein will be used in
methods of protein and gene product production, particularly using
insects as host cells for production of such products, and in
cellular (e.g., mammalian cell) production systems in which the
artificial chromomsomes (particularly MACs) provide a reliable,
stable and efficient means for optimizing the biomanufacturing of
important compounds for medicine and industry. They are also
intended for use in methods of gene therapy, and for production of
transgenic plants and animals [discussed above, below and in the
EXAMPLES].
[0207] 1. Gene Therapy
[0208] Any nucleic acid encoding a therapeutic gene product or
product of a multigene pathway may be introduced into a host
animal, such as a human, or into a target cell line for
introduction into an animal, for therapeutic purposes. Such
therapeutic purposes include, genetic therapy to cure or to provide
gene products that are missing or defective, to deliver agents,
such as anti-tumor agents, to targeted cells or to an animal, and
to provide gene products that will confer resistance or reduce
susceptibility to a pathogen or ameliorate symptoms of a disease or
disorder. The following are some exemplary genes and gene products.
Such exemplification is not intended to be limiting.
[0209] a. Anti-HIV Ribozymes
[0210] As exemplified below, DNA encoding anti-HIV ribozymes can be
introduced and expressed in cells using MACs, including the
euchromatin-based minichromosomes and the SATACs. These MACs can be
used to make a transgenic mouse that expresses a ribozyme and,
thus, serves as a model for testing the activity of such ribozymes
or from which ribozyme-producing cell lines can be made. Also,
introduction of a MAC that encodes an anti-HIV ribozyme into human
cells will serve as treatment for HIV infection. Such systems
further demonstrate the viability of using any disease-specific
ribozyme to treat or ameliorate a particular disease.
[0211] b. Tumor Suppressor Genes
[0212] Tumor suppressor genes are genes that, in their wild-type
alleles, express proteins that suppress abnormal cellular
proliferation. When the gene coding for a tumor suppressor protein
is mutated or deleted, the resulting mutant protein or the complete
lack of tumor suppressor protein expression may result in a failure
to correctly regulate cellular proliferation. Consequently,
abnormal cellular proliferation may take place, particularly if
there is already existing damage to the cellular regulatory
mechanism. A number of well-studied human tumors and tumor cell
lines have been shown to have missing or nonfunctional tumor
suppressor genes.
[0213] Examples of tumor suppression genes include, but are not
limited to, the retinoblastoma susceptibility gene or RB gene, the
p53 gene, the gene that is deleted in colon carcinoma [i.e., the
DCC gene] and the neurofibromatosis type 1 [NF-1] tumor suppressor
gene [see, e.g., U.S. Pat. No. 5,496,731; Weinberg et al. (1991)
254:1138-1146]. Loss of function or inactivation of tumor
suppressor genes may play a central role in the initiation and/or
progression of a significant number of human cancers.
[0214] The p53 Gene
[0215] Somatic cell mutations of the p53 gene are said to be the
most frequent of the gene mutations associated with human cancer
[see, e.g., Weinberg et al. (1991) Science 254:1138-1146]. The
normal or wild-type p53 gene is a negative regulator of cell
growth, which, when damaged, favors cell transformation. The p53
expression product is found in the nucleus, where it may act in
parallel or cooperatively with other gene products. Tumor cell
lines in which p53 has been deleted have been successfully treated
with wild-type p53 vector to reduce tumorigenicity [see, Baker et
al. (1990) Science 249:912-915].
[0216] DNA encoding the p53 gene and plasmids containing this DNA
are well known [see, e.g., U.S. Pat. No. 5,260,191; see, also Chen
et al. (1990) Science 250:1576; Farrel et al. (1991) EMBO J.
10:2879-2887; plasmids containing the gene are available from the
ATCC, and the sequence is in the GenBank Database, accession nos.
X54156, X60020, M14695, M16494, K03199].
[0217] C. The CFTR Gene
[0218] Cystic fibrosis [CF] is an autosomal recessive disease that
affects epithelia of the airways, sweat glands, pancreas, and other
organs. It is a lethal genetic disease associated with a defect in
chloride ion transport, and is caused by mutations in the gene
coding for the cystic fibrosis transmembrane conductance regulator
[CFTR], a 1480 amino acid protein that has been associated with the
expression of chloride conductance in a variety of eukaryotic cell
types. Defects in CFTR destroy or reduce the ability of epithelial
cells in the airways, sweat glands, pancreas and other tissues to
transport chloride ions in response to cAMP-mediated agonists and
impair activation of apical membrane channels by cAMP-dependent
protein kinase A [PKA]. Given the high incidence and devastating
nature of this disease, development of effective CF treatments is
imperative.
[0219] The CFTR gene [.about.250 kb] can be transferred into a MAC
for use, for example, in gene therapy as follows. A CF-YAC [see
Green et al. Science 250:94-98] may be modified to include a
selectable marker, such as a gene encoding a protein that confers
resistance to puromycin or hygromycin, and .lambda.-DNA for use in
site-specific integration into a neo-minichromosome or a SATAC.
Such a modified CF-YAC can be introduced into MAC-containing cells,
such as EC3/7C5 or 19C5.times.Ha4 cells, by fusion with yeast
protoplasts harboring the modified CF-YAC or microinjection of
yeast nuclei harboring the modified CF-YAC into the cells. Stable
transformants are then selected on the basis of antibiotic
resistance. These transformants will carry the modified CF-YAC
within the MAC contained in the cells.
[0220] 2. Animals, Birds, Fish and Plants That Are Genetically
Altered to Possess Desired Traits Such as Resistance to Disease
[0221] Artificial chromosomes are ideally suited for preparing
animals, including vertebrates and invertebrates, including birds
and fish as well as mammals, that possess certain desired traits,
such as, for example, disease resistance, resistance to harsh
environmental conditions, altered growth patterns, and enhanced
physical characteristics.
[0222] One example of the use of artificial chromosomes in
generating disease-resistant organisms involves the preparation of
multivalent vaccines. Such vaccines include genes encoding multiple
antigens that can be carried in a MAC, or species-specific
artificial chromosome, and either delivered to a host to induce
immunity, or incorporated into embryos to produce transgenic
(non-human) animals and plants that are immune or less susceptible
to certain diseases.
[0223] Disease-resistant animals and plants may also be prepared in
which resistance or decreased susceptibility to disease is
conferred by introduction into the host organism or embryo of
artificial chromosomes containing DNA encoding gene products (eq.,
ribozymes and proteins that are toxic to certain pathogens) that
destroy or attenuate pathogens or limit access of pathogens to the
host.
[0224] Animals and plants possessing desired traits that might, for
example, enhance utility, processibility and commercial value of
the organisms in areas such as the agricultural and ornamental
plant industries may also be generated using artificial chromosomes
in the same manner as described above for production of
disease-resistant animals and plants. In such instances, the
artificial chromosomes that are introduced into the organism or
embryo contain DNA encoding gene products that serve to confer the
desired trait in the organism.
[0225] Birds, particularly fowl such as chickens, fish and
crustaceans will serve as model hosts for production of genetically
altered organisms using artificial chromosomes.
[0226] 3. Use of MACs and Other Artificial Chromosomes for
Preparation and Screening of Libraries
[0227] Since large fragments of DNA can be incorporated into each
artificial chromosome, the chromosomes are well-suited for use as
cloning vehicles that can accommodate entire genomes in the
preparation of genomic DNA libraries, which then can be readily
screened. For example, MACs may be used to prepare a genomic DNA
library useful in the identification and isolation of functional
centromeric DNA from different species of organisms. In such
applications, the MAC used to prepare a genomic DNA library from a
particular organism is one that is not functional in cells of that
organism. That is, the MAC does not stably replicate, segregate or
provide for expression of genes contained within it in cells of the
organism. Preferably, the MACs contain an indicator gene (e.g., the
lacZ gene encoding .beta.-galactosidase or genes encoding products
that confer resistance to antibiotics such as neomycin, puromycin,
hygromycin) linked to a promoter that is capable of promoting
transcription of the indicator gene in cells of the organism.
Fragments of genomic DNA from the organism are incorporated into
the MACs, and the MACs are transferred to cells from the organism.
Cells that contain MACs that have incorporated functional
centromeres contained within the genomic DNA fragments are
identified by detection of expression of the marker gene.
[0228] 4. Use of MACs and Other Artificial Chromosomes for Stable,
High-level Protein Production
[0229] Cells containing the MACs and/or other artificial
chromosomes provided herein are advantageously used for production
of proteins, particularly several proteins from one cell line, such
as multiple proteins involved in a biochemical pathway or
multivalent vaccines. The genes encoding the proteins are
introduced into the artificial chromosomes which are then
introduced into cells. Alternatively, the heterologous gene(s) of
interest are transferred into a production cell line that already
contains artificial chromosomes in a manner that targets the
gene(s) to the artificial chromosomes. The cells are cultured under
conditions whereby the heterologous proteins are expressed. Because
the proteins will be expressed at high levels in a stable permanent
extra-genomic chromosomal system, selective conditions are not
required.
[0230] Any transfectable cells capable of serving as recombinant
hosts adaptable to continuous propagation in a cell culture system
[see, e.g., McLean (1993) Trends In Biotech. 11:232-238] are
suitable for use in an artificial chromosome-based protein
production system. Exemplary host cell lines include, but are not
limited to, the following: Chinese hamster ovary (CHO) cells [see,
e.g., Zang et al. (1995) Biotechnology 13:389-392], HEK 293,
Ltk.sup.-, COS-7, DG44, and BHK cells. CHO cells are particularly
preferred host cells. Selection of host cell lines for use in
artificial chromosome-based protein production systems is within
the skill of the art, but often will depend on a variety of
factors, including the properties of the heterologous protein to be
produced, potential toxicity of the protein in the host cell, any
requirements for post-translational modification (e.g.,
glycosylation, amination, phosphorylation) of the protein,
transcription factors available in the cells, the type of promoter
element(s) being used to drive expression of the heterologous gene,
whether production will be completely intracellular or the
heterologous protein will preferably be secreted from the cell, and
the types of processing enzymes in the cell.
[0231] The artificial chromosome-based system for heterologous
protein production has many advantageous features. For example, as
described above, because the heterologous DNA is located in an
independent, extra-genomic artificial chromosome (as opposed to
randomly inserted in an unknown area of the host cell genome or
located as extrachromosomal element(s) providing only transient
expression) it is stably maintained in an active transcription unit
and is not subject to ejection via recombination or elimination
during cell division. Accordingly, it is unnecessary to include a
selection gene in the host cells and thus growth under selective
conditions is also unnecessary. Furthermore, because the artificial
chromosomes are capable of incorporating large segments of DNA,
multiple copies of the heterologous gene and linked promoter
element(s) can be retained in the chromosomes, thereby providing
for high-level expression of the foreign protein(s). Alternatively,
multiple copies of the gene can be linked to a single promoter
element and several different genes may be linked in a fused
polygene complex to a single promoter for expression of, for
example, all the key proteins constituting a complete metabolic
pathway [see, e.g., Beck von Bodman et al. (1995) Biotechnology
13:587-591]. Alternatively, multiple copies of a single gene can be
operatively linked to a single promoter, or each or one or several
copies may be linked to different promoters or multiple copies of
the same promoter. Additionally, because artificial chromosomes
have an almost unlimited capacity for integration and expression of
foreign genes, they can be used not only for the expression of
genes encoding end-products of interest, but also for the
expression of genes associated with optimal maintenance and
metabolic management of the host cell, e.g., genes encoding growth
factors, as well as genes that may facilitate rapid synthesis of
correct form of the desired heterologous protein product, e.g.,
genes encoding processing enzymes and transcription factors. The
MACS are suitable for expression of any proteins or peptides,
including proteins and peptides that require in vivo
posttranslational modification for their biological activity. Such
proteins include, but are not limited to antibody fragments,
full-length antibodies, and multimeric antibodies, tumor suppressor
proteins, naturally occurring or artificial antibodies and enzymes,
heat shock proteins, and others.
[0232] Thus, such cell-based "protein factories" employing MACs can
generated using MACs constructed with multiple copies
[theoretically an unlimited number or at least up to a number such
that the resulting MAC is about up to the size of a genomic
chromosome (i.e., endogenous)] of protein-encoding genes with
appropriate promoters, or multiple genes driven by a single
promoter, i.e., a fused gene complex [such as a complete metabolic
pathway in plant expression system; see, e.g., Beck von Bodman
(1995) Biotechnology 13:587-591]. Once such MAC is constructed, it
can be transferred to a suitable cell culture system, such as a CHO
cell line in protein-free culture medium [see, e.g., (1995)
Biotechnology 13:389-39] or other immortalized cell lines [see,
e.g., (1993) TIBTECH 11:232-238] where continuous production can be
established.
[0233] The ability of MACs to provide for high-level expression of
heterologous proteins in host cells is demonstrated, for example,
by analysis of the H1D3 and G3D5 cell lines described herein and
deposited with the ECACC. Northern blot analysis of mRNA obtained
from these cells reveals that expression of the
hygromycin-resistance and .beta.-galactosidase genes in the cells
correlates with the amplicon number of the megachromosome(s)
contained therein.
[0234] F. Methods for the Synthesis of DNA Sequences Containing
Repeated DNA Units
[0235] Generally, assembly of tandemly repeated DNA poses
difficulties such as unambiguous annealing of the complementary
oligos. For example, separately annealed products may ligate in an
inverted orientation. Additionally, tandem or inverted repeats are
particularly susceptible to recombination and deletion events that
may disrupt the sequence. Selection of appropriate host organisms
(e.g., rec.sup.- strains) for use in the cloning steps of the
synthesis of sequences of tandemly repeated DNA units may aid in
reduction and elimination of such events.
[0236] Methods are provided herein for the synthesis of extended
DNA sequences containing repeated DNA units. These methods are
particularly applicable to the synthesis of arrays of tandemly
repeated DNA units, which are generally difficult or not possible
to construct utilizing other known gene assembly strategies. A
specific use of these methods is in the synthesis of sequences of
any length containing simple (e.g., ranging from 2-6 nucleotides)
tandem repeats (such as telomeres and satellite DNA repeats and
trinucleotide repeats of possible clinical significance) as well as
complex repeated DNA sequences. An particular example of the
synthesis of a telomere sequence containing over 150 successive
repeated hexamers utilizing these methods is provided herein.
[0237] The methods provided herein for synthesis of arrays of
tandem DNA repeats are based in a series of extension steps in
which successive doublings of a sequence of repeats results in an
exponential expansion of the array of tandem repeats. These methods
provide several advantages over previously known methods of gene
assembly. For instance, the starting oligonucleotides are used only
once. The intermediates in, as well as the final product of, the
construction of the DNA arrays described herein may be obtained in
cloned form in a microbial organism (e.g., E. coli and yeast). Of
particular significance, with regard to these methods is the fact
that sequence length increases exponentially, as opposed to
linearly, in each extension step of the procedure even though only
two oligonucleotides are required in the methods. The construction
process does not depend on the compatibility of restriction enzyme
recognition sequences and the sequence of the repeated DNA because
restriction sites are used only temporarily during the assembly
procedure. No adaptor is necessary, though a region of similar
function is located between two of the restriction sites employed
in the process. The only limitation with respect to restriction
site use is that the two sites employed in the method must not be
present elsewhere in the vector utilized in any cloning steps.
These procedures can also be used to construct complex repeats with
perfectly identical repeat units, such as the variable number
tandem repeat (VNTR) 3' of the human apolipoprotein B100 gene (a
repeat unit of 30 bp, 100% AT) or alphoid satellite DNA.
[0238] The method of synthesizing DNA sequences containing tandem
repeats may generally be described as follows.
[0239] 1. Starting Materials
[0240] Two oligonucleotides are utilized as starting materials.
Oligonucleotide 1 is of length k of repeated sequence (the flanks
of which are not relevant) and contains a relatively short stretch
(60-90 nucleotides) of the repeated sequence, flanked with
appropriately chosen restriction sites:
[0241]
5'-S1>>>>>>>>>>>>>>>&g-
t;>>>>>>>>>>>S2_-3'
[0242] wherein S1 is restriction site 1 cleaved by E1 [preferably
an enzyme producing a 3'-overhang (e.g., PacI, PstI, SphI, NsiI,
etc.) or blunt-end], S2 is a second restriction site cleaved by E2
(preferably an enzyme producing a 3'-overhang or one that cleaves
outside the recognition sequence, such as TspRI), > represents a
simple repeat unit, and `_` denotes a short (8-10) nucleotide
flanking sequence complementary to oligonucleotide 2:
[0243] 3'-_S3-5'
[0244] wherein S3 is a third restriction site for enzyme E3 and
which is present in the vector to be used during the
construction.
[0245] Because there is a large variety of restriction enzymes that
recognize many different DNA sequences as cleavage sites, it should
always be possible to select sites and enzymes (preferably those
that yield a 3'-protruding end) suitable for these methods in
connection with the synthesis of any one particular repeat arrary.
In most cases, only 1 (or perhaps 2) nucleotide(s) has of a
restriction site is required to be present in the repeat sequence,
and the remaining nucleotides of the restriction site can be
removed, for example:
1 PacI: TTAAT/TAA-- (Klenow/dNTP) TAA-- PstI: CTGCA/G--
(Klenow/dNTP) G-- NsiI: ATGCA/T-- (Klenow/dNTP) T-- KpnI: GGTAC/C--
(Klenow/dNTP) C--
[0246] Though there is no known restriction enzyme leaving a single
A behind, this problem can be solved with enzymes leaving behind
none at all, for example:
2 TaiI: ACGT/ (Klenow/dNTP) -- NlaIII: CATG/ (Klenow/dNTP) --
[0247] Additionally, if mung bean nuclease is used instead of
Klenow, then the following
[0248] XbaI: T/CTAGA Mung bean nuclease A--
[0249] Furthermore, there are a number of restriction enzymes that
cut outside of the recognition sequence, and in this case, there is
no limitation at all:
3 TspRI NNCAGTGNN/-- (Klenow/dNTP) -- BsmI GAATG CN/--
(Klenow/dNTP) -- CTTAC/GN -- (Klenow/dNTP) --
[0250] 2. Step 1--Annealing
[0251] Oligonucleotides 1 and 2 are annealed at a temperature
selected depending on the length of overlap (typically in the range
of 30-65.degree. C.).
[0252] 3. Step 2--Generating a Double-stranded Molecule
[0253] The annealed oligonucleotides are filled-in with Klenow
polymerase in the presence of dNTP to produce a double-stranded
(ds) sequence:
[0254]
5'-S1>>>>>>>>>>>>>>>&g-
t;>>>>>>>>>>>>>>>>>S2_S-
3-3'
[0255]
3'-S1<<<<<<<<<<<<<<<&l-
t;<<<<<<<<<<<<<<<<<S2_S-
3-5'
[0256] 4. Step 3--Incorporation of Double-stranded DNA Into a
Vector
[0257] The double-stranded DNA is cleaved with restriction enzymes
E1 and E3 and subsequently ligated into a vector (e.g., pUC19 or a
yeast vector) that has been cleaved with the same enzymes E1 and
E3. The ligation product is used to transform competent host cells
compatible with the vector being used (e.g., when pUC19 is used,
bacterial cells such as E. coli DH5.alpha. are suitable hosts)
which are then plated onto selection plates. Recombinants can be
identified either by color (e.g., by X-gal staining for
.beta.-galactosidase expression) or by colony hybridization using
.sup.32P-labeled oligonucleotide 2 (detection by hybridization to
oligonucleotide 2 is preferred because its sequence is removed in
each of the subsequent extension steps and thus is present only in
recombinants that contain DNA that has undergone successful
extension of the repeated sequence).
[0258] 5. Step 4--Isolation of Insert From the Plasmid
[0259] An aliquot of the recombinant plasmid containing k
nucleotides of the repeat sequence is digested with restriction
enzymes E1 and E3, and the insert is isolated on a gel (native
polyacrylamide while the insert is short, but agarose can be used
for isolation of longer inserts in subsequent steps). A second
aliquot of the recombinant plasmid is cut with enzymes E2 (treated
with Klenow and dNTP to remove the 3'-overhang) and E3, and the
large fragment (plasmid DNA plus the insert) is isolated.
[0260] 6. Step 5--Extension of the DNA Sequence of k Repeats
[0261] The two DNAs (the S1-S3 insert fragment and the vector plus
insert) are ligated, plated to selective plates, and screened for
extended recombinants as in Step 3. Now the length of the repeat
sequence between restriction sites is twice that of the repeat
sequence in the previous step, i.e., 2.times.k.
[0262] 7. Step 6--Extension of the DNA Sequence of 2.times.k
Repeats
[0263] Steps 4 and 5 are repeated as many times as needed to
achieve the desired repeat sequence size. In each extension cycle,
the repeat sequence size doubles, i.e., if m is the number of
extension cycles, the size of the repeat sequence will be
k.times.2.sup.m nucleotides.
[0264] The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
invention.
EXAMPLE 1
[0265] General Materials and Methods
[0266] The following materials and methods are exemplary of methods
that are used in the following Examples and that can be used to
prepare cell lines containing artificial chromosomes. Other
suitable materials and methods known to those of skill in the art
may used. Modifications of these materials and methods known to
those of skill in the art may also be employed.
[0267] A. Culture of Cell Lines, Cell Fusion, and Transfection of
Cells
[0268] 1. Chinese hamster K-20 cells and mouse A9 fibroblast cells
were cultured in F-12 medium. EC3/7 [see, U.S. Pat. No. 5,288,625,
and deposited at the European Collection of Animal cell Culture
(ECACC) under accession no. 90051001; see, also Hadlaczky et al.
(1991) Proc. Natl. Acad. Sci. U.S.A. 88:8106-8110 and U.S.
application Ser. No. 08/375,271] and EC3/7C5 [see, U.S. Pat. No.
5,288,625 and Praznovszky et al. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:11042-11046] mouse cell lines, and the KE1-2/4 hybrid
cell line were maintained in F-12 medium containing 400 .mu.g/ml
G418 [SIGMA, St. Louis, Mo.].
[0269] 2. TF1004G19 and TF1004G-19C5 mouse cells, described below,
and the 19C5.times.Ha4 hybrid, described below, and its sublines
were cultured in F-12 medium containing up to 400 .mu.g/ml
Hygromycin B [Calbiochem]. LP11 cells were maintained in F-12
medium containing 3-15 .mu.g/ml Puromycin [SIGMA, St. Louis,
Mo.].
[0270] 3. Cotransfection of EC3/7C5 cells with plasmids [pH132,
pCH110 available from Pharmacia, see, also Hall et al. (1983) J.
Mol. Appl. Gen. 2:101-109] and with .lambda. DNA was conducted
using the calcium phosphate DNA precipitation method [see, e.g.,
Chen et al. (1987) Mol. Cell. Biol. 7:2745-2752], using 2-5 .mu.g
plasmid DNA and 20 .mu.g .lambda. phage DNA per 5.times.10.sup.6
recipient cells.
[0271] 4. Cell Fusion
[0272] Mouse and hamster cells were fused using polyethylene glycol
[Davidson et al. (1976) Som. Cell Genet. 2:165-176]. Hybrid cells
were selected in HAT medium containing 400 .mu.g/ml Hygromycin
B.
[0273] Approximately 2.times.10.sup.7 recipient and
2.times.10.sup.6 donor cells were fused using polyethylene glycol
[Davidson et al. (1976) Som. Cell Genet. 2:165-176]. Hybrids were
selected and maintained in F-12/HAT medium [Szybalsky et al. (1962)
Natl. Cancer Inst. Monogr. 7:75-89] containing 10% FCS and 400
.mu.g/ml G418. The presence of "parental" chromosomes in the hybrid
cell lines was verified by in situ hybridization with
species-specific probes using biotin-labeled human and hamster
genomic DNA, and a mouse long interspersed repetitive DNA
[pMCPE1.51].
[0274] 5. Microcell Fusion
[0275] Microcell-mediated transfer of artificial chromosomes from
EC3/7C5 cells to recipient cells was done according to Saxon et al.
[(1985) Mol. Cell. Biol. 1 :140-146] with the modifications of
Goodfellow et al. [(1989) Techniques for mammalian genome transfer.
In Genome Analysis a Practical Approach. K. E. Davies, ed., IRL
Press, Oxford, Washington D.C. pp. 1-17] and Yamada et al. [(1990)
Oncogene 5:1141-1147]. Briefly, 5.times.10.sup.6 EC3/7C5 cells in a
T25 flask were treated first with 0.05 .mu.g/ml colcemid for 48 hr
and then with 10 .mu.g/ml cytochalasin B for 30 min. The T25 flasks
were centrifuged on edge and the pelleted microcells were suspended
in serum free DME medium. The microcells were filtered through
first a 5 micron and then a 3 micron polycarbonate filter, treated
with 50 .mu.g/ml of phytohemagglutin, and used for polyethylene
glycol mediated fusion with recipient cells. Selection of cells
containing the MMCneo was started 48 hours after fusion in medium
containing 400-800 .mu.g/ml G418.
[0276] Microcells were also prepared from 1B3 and GHB42 donor cells
as follows in order to be fused with E2D6K cells [a CHO K-20 cell
line carrying the puromycin N-acetyltransferase gene, i.e., the
puromycin resistance gene, under the control of the SV40 early
promoter]. The donor cells were seeded to achieve 60-75% confluency
within 24-36 hours. After that time, the cells were arrested in
mitosis by exposure to colchicine (10 .mu.g/ml) for 12 or 24 hours
to induce micronucleation. To promote micronucleation of GHB42
cells, the cells were exposed to hypotonic treatment (10 min at
37.degree. C.). After colchicine treatment, or after colchicine and
hypotonic treatment, the cells were grown in colchicine-free
medium.
[0277] The donor cells were trypsinized and centrifuged and the
pellets were suspended in a 1:1 Percoll medium and incubated for
30-40 min at 37.degree. C. After the incubation, 1-3.times.10.sup.7
cells (60-70% micronucleation index) were loaded onto each Percoll
gradient (each fusion was distributed on 1-2 gradients). The
gradients were centrifuged at 19,000 rpm for 80 min in a Sorvall
SS-34 rotor at 34-37.degree. C. After centrifugation, two visible
bands of cells were removed, centrifuged at 2000 rpm, 10 min at
4.degree. C., resuspended and filtered through 8 .mu.m pore size
nucleopore filters.
[0278] The microcells prepared from the 1B3 and GHB42 cells were
fused with E2D6K. The E2D6K cells were generated by CaPO.sub.4
transfection of CHO K-20 cells with pCHTV2. Plasmid pCHTV2 contains
the puromycin-resistance gene linked to the SV40 promoter and
polyadenylation signal, the Saccharomyces cerevisiae URA3 gene,
2.4- and 3.2-kb fragments of a Chinese hamster chromosome
2-specific satellite DNA (HC-2 satellite; see Fatyol et al. (1994)
Nuc. Acids Res. 22:3728-3736), two copies of the diptheria toxin-A
chain gene (one linked to the herpes simplex virus thymidine kinase
(HSV-TK) gene promoter and SV40 polyadenylation signal and the
other linked to the HSV-TK promoter without a polyadenylation
signal), the ampicillin-resistance gene and the ColE1 origin of
replication. Following transfection, puromycin-resistant colonies
were isolated. The presence of the pCHTV2 plasmid in the E2D6K cell
line was confirmed by nucleic acid amplification of DNA isolated
from the cells.
[0279] The purified microcells were centrifuged as described above
and resuspended in 2 ml of phytohemagglutinin-P (PHA-P, 100
.mu.g/ml). The microcell suspension was then added to a 60-70%
confluent recipient culture of E2D6K cells. The preparation was
incubated at room temperature for 30-40 min to agglutinate the
microcells. After the PHA-P was removed, the cells were incubated
with 1 ml of 50% polyethylene-glycol (PEG) for one min. The PEG was
removed and the culture was washed three times with F-12 medium
without serum. The cells were incubated in non-selective medium for
48-60 hours. After this time, the cell culture was trypsinized and
plated in F-12 medium containing 400 .mu.g/ml hygromycin B and 10
g/ml puromycin to select against the parental cell lines.
[0280] Hybrid clones were isolated from the cells that had been
cultured in selective medium. These clones were then analyzed for
expression of .beta.-galactosidase by the X-gal staining method.
Four of five hybrid clones analyzed that had been generated by
fusion of GHB42 microcells with E2D6K cells yielded positive
staining results indicating expression of .beta.-galactosidase from
the lacZ gene contained in the megachromosome contributed by the
GHB42 cells. Similarly, a hybrid clone that had been generated by
fusion of 1B3 microcells with E2D6K cells yielded positive staining
results indicating expression of .beta.-galactosidase from the lacZ
gene contained in the megachromosome contributed by the 1B3 cells.
In situ hybridization analysis of the hybrid clones is also
performed to analyze the mouse chromosome content of the
mouse-hamster hybrid cells.
[0281] B. Chromosome Banding
[0282] Trypsin G-banding of chromosomes was performed using the
method of Wang & Fedoroff [(1972) Nature 235:52-54], and the
detection of constitutive heterochromatin with the BSG. C-banding
method was done according to Sumner [(1972) Exp. Cell Res.
75:304-306]. For the detection of chromosome replication by
bromodeoxyuridine [BrdU] incorporation, the Fluorescein Plus Giemsa
[FPG] staining method of Perry & Wolff [(1974) Nature
251:156-158] was used.
[0283] C. Immunolabelling of Chromosomes and in situ
Hybridization
[0284] Indirect immunofluorescence labelling with human
anti-centromere serum LU851 [Hadlaczky et al. (1986) Exp. Cell Res.
167:1-15], and indirect immunofluorescence and in situ
hybridization on the same preparation were performed as described
previously [see, Hadlaczky et al. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:8106-8110, see, also U.S. application Ser. No.
08/375,271]. Immunolabelling with fluorescein-conjugated anti-BrdU
monoclonal antibody [Boehringer] was performed according to the
procedure recommended by the manufacturer, except that for
treatment of mouse A9 chromosomes, 2 M hydrochloric acid was used
at 37.degree. C. for 25 min, and for chromosomes of hybrid cells, 1
M hydrochloric acid was used at 37.degree. C. for 30 min.
[0285] D. Scanning Electron Microscopy
[0286] Preparation of mitotic chromosomes for scanning electron
microscopy using osmium impregnation was performed as described
previously [Sumner (1991) Chromosoma 100:410-418]. The chromosomes
were observed with a Hitachi S-800 field emission scanning electron
microscope operated with an accelerating voltage of 25 kV.
[0287] E. DNA Manipulations, Plasmids and Probes
[0288] 1. General Methods
[0289] All general DNA manipulations were performed by standard
procedures [see, e.g., Sambrook et al. (1989) Molecular cloning: A
Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.]. The mouse major satellite probe was provided by Dr.
J. B. Rattner [University of Calgary, Alberta, Canada]. Cloned
mouse satellite DNA probes [see Wong et al. (1988) Nucl. Acids Res.
16:11645-11661], including the mouse major satellite probe, were
gifts from Dr. J. B. Rattner, University of Calgary. Hamster
chromosome painting was done with total hamster genomic DNA, and a
cloned repetitive sequence specific to the centromeric region of
chromosome 2 [Ftyol et al. (1994) Nucl. Acids Res. 22:3728-3736]
was also used. Mouse chromosome painting was done with a cloned
long interspersed repetitive sequence [pMCP1.51] specific for the
mouse euchromatin.
[0290] For cotransfection and for in situ hybridization, the pCH
110 .beta.-galactosidase construct [Pharmacia or Invitrogen], and
.lambda.cl 875 Sam7 phage DNA [New England Biolabs] were used.
[0291] 2. Construction of Plasmid pPuroTel
[0292] Plasmid pPuroTel, which carries a Puromycin-resistance gene
and a cloned 2.5 kb human telomeric sequence [see SEQ ID No. 3],
was constructed from the pBabe-puro retroviral vector [Morgenstern
et al. (1990) Nucl. Acids Res. 18:3587-3596; provided by Dr. L.
Szkely (Microbiology and Tumorbiology Center, Karolinska
Institutet, Stockholm); see, also Tonghua et al. (1995) Chin. Med.
J. (Beijing, Engl. Ed.) 108:653-659; Couto et al. (1994) Infect.
Immun. 62:2375-2378; Dunckley et al. (1992) FEBS Lett. 296:128-34;
French et al. (1995) Anal. Biochem. 228:354-355; Liu et al. (1995)
Blood 85:1095-1103; International PCT application Nos. WO 9520044;
WO 9500178, and WO 9419456].
[0293] F. Deposited Cell Lines
[0294] Cell lines KE1-2/4, EC3/7C5, TF1004G19C5, 19C5.times.Ha4,
G3D5 and H1D3 have been deposited in accord with the Budapest
Treaty at the European Collection of Animal Cell Culture (ECACC)
under Accession Nos. 96040924, 96040925, 96040926, 96040927,
96040928 and 96040929, respectively. The cell lines were deposited
on Apr. 9, 1996, at the European Collection of Animal Cell Cultures
(ECACC) Vaccine Research and Production Laboratory, Public Health
Laboratory Service, Centre for Appliced Microbiology and Research,
Porton Down, Salisbury, Wiltshire SP4 0JG, United Kingdom. The
deposits were made in the name of Gyula Hadlaczky of H. 6723,
SZEGED, SZAMOS U.1.A. IX. 36. HUNGARY, who has authorized reference
to the deposited cell lines in this application.
EXAMPLE 2
[0295] Preparation of EC3/7, EC3/7C5 and Related Cell Lines
[0296] The EC3/7 cell line is an LMTK.sup.- mouse cell line that
contains the neo-centromere. The EC3/7C5 cell line is a single-cell
subclone of EC3/7 that contains the neo-minichromosome.
[0297] A. EC3/7 Cell Line
[0298] As described in U.S. Pat. No. 5,288,625 [see, also
Praznovszky et al. (1991) Proc. Natl. Acad. Sci. U.S.A.
88:11042-11046 and Hadlaczky etal. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:8106-8110] de novo centromere formation occurs in a
transformed mouse LMTK.sup.- fibro-blast cell line [EC3/7] after
cointegration of .lambda. constructs [.lambda.CM8 and
.lambda.gtWESneo] carrying human and bacterial DNA.
[0299] By cotransfection of a 14 kb human DNA fragment cloned in
.lambda. [.lambda.CM8] and a dominant marker gene
[.lambda.gtWESneo], a selectable centromere linked to a dominant
marker gene [neo-centromere] was formed in mouse LMTK.sup.- cell
line EC3/7 [Hadlaczky et al. (1991) Proc. Natl. Acad. Sci. U.S.A.
88:8106-8110, see FIG. 1]. Integration of the heterologous DNA [the
.lambda. DNA and marker gene-encoding DNA] occurred into the short
arm of an acrocentric chromosome [chromosome 7 (see, FIG. 1B)],
where an amplification process resulted in the formation of the new
centromere [neo-centromere (see FIG. 1C)]. On the dicentric
chromosome (FIG. 1C), the newly formed centromere region contains
all the heterologous DNA (human, .lambda., and bacterial)
introduced into the cell and an active centromere.
[0300] Having two functionally active centromeres on the same
chromosome causes regular breakages between the centromeres [see,
FIG. 1E]. The distance between the two centromeres on the dicentric
chromosome is estimated to be .about.10-15 Mb, and the breakage
that separates the minichromosome occurred between the two
centromeres. Such specific chromosome breakages result in the
appearance [in approximately 10% of the cells] of a chromosome
fragment that carries the neo-centromere [FIG. 1F]. This chromosome
fragment is principally composed of human, .lambda., plasmid, and
neomycin-resistance gene DNA, but it also has some mouse
chromosomal DNA. Cytological evidence suggests that during the
stabilization of the MMCneo, there was an inverted duplication of
the chromosome fragment bearing the neo-centromere. The size of
minichromosomes in cell lines containing the MMCneo is
approximately 20-30 Mb; this finding indicates a two-fold increase
in size.
[0301] From the EC3/7 cell line, which contains the dicentric
chromosome [FIG. 1E], two sublines [EC3/7C5 and EC3/7C6] were
selected by repeated single-cell cloning. In these cell lines, the
neo-centromere was found exclusively on a small chromosome
[neo-minichromosome], while the formerly dicentric chromosome
carried detectable amounts of the exogenously-derived DNA sequences
but not an active neo-centromere [FIGS. 1F and 1G].
[0302] The minichromosomes of cell lines EC3/7C5 and EC3/7C6 are
similar. No differences are detected in their architectures at
either the cytological or molecular level. The minichromosomes were
indistinguishable by conventional restriction endonuclease mapping
or by long-range mapping using pulsed field electrophoresis and
Southern hybridization. The cytoskeleton of cells of the EC3/7C6
line showed an increased sensitivity to colchicine, so the EC3/7C5
line was used for further detailed analysis.
[0303] B. Preparation of the EC3/7C5 and EC3/7C6 Cell Lines
[0304] The EC3/7C5 cells, which contain the neo-minichromosome,
were produced by sucloning the EC3/7 cell line in high
concentrations of G418 [40-fold the lethal dose] for 350
generations. Two single cell-derived stable cell lines [EC3/7C5 and
EC3/7C6] were established. These cell lines carry the
neo-centromere on minichromosomes and also contain the remaining
fragment of the dicentric chromosome. Indirect immunofluorescence
with anti-centromere antibodies and subsequent in situ
hybridization experiments demonstrated that the minichromosomes
derived from the dicentric chromosome. In EC3/7C5 and EC3/7C6 cell
lines (140 and 128 metaphases, respectively) no intact dicentric
chromosomes were found, and minichromosomes were detected in 97.2%
and 98.1% of the cells, respectively. The minichromosomes have been
maintained for over 150 cell generations. They do contain the
remaining portion of the formerly dicentric chromosome.
[0305] Multiple copies of telomeric DNA sequences were detected in
the marker centromeric region of the remaining portion of the
formerly dicentric chromosome by in situ hybridization. This
indicates that mouse telomeric sequences were coamplified with the
foreign DNA sequences. These stable minichromosome-carrying cell
lines provide direct evidence that the extra centromere is
functioning and is capable of maintaining the minichromosomes [see,
U.S. Pat. No. 5,288,625].
[0306] The chromosome breakage in the EC3/7 cells, which separates
the neo-centromere from the mouse chromosome, occurred in the
G-band positive "foreign" DNA region. This is supported by the
observation of traces of .lambda. and human DNA sequences at the
broken end of the formerly dicentric chromosome. Comparing the
G-band pattern of the chromosome fragment carrying the
neo-centromere with that of the stable neo-minichromosome, reveals
that the neo-minichromosome is an inverted duplicate of the
chromosome fragment that bears the neo-centromere. This is also
evidenced by the observation that although the neo-minichromosome
carries only one functional centromere, both ends of the
minichromosome are heterochromatic, and mouse satellite DNA
sequences were found in these heterochromatic regions by in situ
hybridization.
[0307] These two cell lines, EC3/7C5 and EC3/7C6, thus carry a
selectable mammalian minichromosome [MMCneo] with a centromere
linked to a dominant marker gene [Hadlaczky et al. (1991) Proc.
Natl. Acad. Sci. U.S.A. 88:8106-8110]. MMCneo is intended to be
used as a vector for minichromosome-mediated gene transfer and has
been used as model of a minichromosome-based vector system.
[0308] Long range mapping studies of the MMCneo indicated that
human DNA and the neomycin-resistance gene constructs integrated
into the mouse chromosome separately, followed by the amplification
of the chromosome region that contains the exogenous DNA. The
MMCneo contains about 30-50 copies of the .lambda.CM8 and
.lambda.gtWESneo DNA in the form of approximately 160 kb repeated
blocks, which together cover at least a 3.5 Mb region. In addition
to these, there are mouse telomeric sequences [Praznovszky et al.
(1991) Proc. Natl. Acad. Sci. U.S.A. 88:11042-11046] and any DNA of
mouse origin necessary for the correct higher-ordered structural
organization of chromatids.
[0309] Using a chromosome painting probe mCPE1.51 [mouse long
interspersed repeated DNA], which recognizes exclusively
euchromatic mouse DNA, detectable amounts of interspersed repeat
sequences were found on the MMCneo by in situ hybridization. The
neo-centromere is associated with a small but detectable amount of
satellite DNA. The chromosome breakage that separates the
neo-centromere from the mouse chromosome occurs in the "foreign"
DNA region. This is demonstrated by the presence of .lambda. and
human DNA at the broken end of the formerly dicentric chromosome.
At both ends of the MMCneo, however, there are traces of mouse
major satellite DNA as evidenced by in situ hybridization. This
observation suggests that the doubling in size of the chromosome
fragment carrying the neo-centromere during the stabilization of
the MMCneo is a result of an inverted duplication. Although mouse
telomere sequences, which coamplified with the exogenous DNA
sequences during the neo-centromere formation, may provide
sufficient telomeres for the MMCneo, the duplication could have
supplied the functional telomeres for the minichromosome.
[0310] The nucleotide sequence of portions of the
neo-minichromosomes was determined as follows. Total DNA was
isolated from EC3/7C5 cells according to standard procedures. The
DNA was subjected to nucleic acid amplification using the Expand
Long Template PCR system [Boehringer Mannheim] according to the
manufacturer's procedures. The amplification procedure required
only a single 33-mer oligonucleotide primer corresponding to
sequence in a region of the phage .lambda. right arm, which is
contained in the neo-minichromosome. The sequence of this
oligonucleotide is set forth as the first 33 nucleotides of SEQ ID
No. 13. Because the neo-minichromosome contains a series of
inverted repeats of this sequence, the single oligonucleotide was
used as a forward and reverse primer resulting in amplification of
DNA positioned between sets of inverted repeats of the phage
.lambda. DNA. Three products were obtained from the single
amplification reaction, which suggests that the sequence of the DNA
located between different sets of inverted repeats may differ. In a
repeating nucleic acid unit within an artificial chromosome, minor
differences may be present and may occur during culturing of cells
containing the artificial chromosome. For example, base pair
changes may occur as well as integration of mobile genetic elements
and deletions of repeated sequences.
[0311] Each of the three products was subjected to DNA sequence
analysis. The sequences of the three products are set forth in SEQ
ID Nos. 13, 14, and 15, respectively. To be certain that the
sequenced products were amplified from the neo-minichromosome,
control amplifications were conducted using the same primers on DNA
isolated from negative control cell lines (mouse Ltk.sup.- cells)
lacking minichromosomes and the formerly dicentric chromosome, and
positive control cell lines [the mouse-hamster hybrid cell line
GB43 generated by treating 19C5.times.Ha4 cells (see FIG. 4) with
BrdU followed by growth in G418-containing selective medium and
retreatment with BrdU] containing the neo-minichromosome only. Only
the positive control cell line yielded the three amplification
products; no amplification product was detected in the negative
control reaction. The results obtained in the positive control
amplification also demonstrate that the neo-minichromosome DNA, and
not the fragment of the formerly dicentric mouse chromosome, was
amplified.
[0312] The sequences of the three amplification products were
compared to those contained in the Genbank/EMBL database. SEQ ID
Nos. 13 and 14 showed high (.about.96%) homology to portions of DNA
from intracisternal A-particles from mouse. SEQ ID No. 15 showed no
significant homology with sequences available in the database. All
three of these sequences may be used for generating gene targeting
vectors as homologous DNAs to the neo-minichromosome.
[0313] C. Isolation and Partial Purification of Minichromosomes
[0314] Mitotic chromosomes of EC3/7C5 cells were isolated as
described by Hadlaczky et al. [(1981) Chromosoma 81:537-555], using
a glycine-hexylene glycol buffer system [Hadlaczky et al. (1982)
Chromosoma 86:643-659]. Chromosome suspensions were centrifuged at
1,200.times.g for 30 minutes. The supernatant containing
minichromosomes was centrifuged at 5,000.times.g for 30 minutes and
the pellet was resuspended in the appropriate buffer. Partially
purified minichromosomes were stored in 50% glycerol at -20.degree.
C.
[0315] D. Stability of the MMCneo Maintenance and Neo
Expression
[0316] EC3/7C5 cells grown in non-selective medium for 284 days and
then transferred to selective medium containing 400 .mu.g/ml G418
showed a 96% plating efficiency (colony formation) compared to
control cells cultured permanently in the presence of G418.
Cytogenetic analysis indicated that the MMCneo is stably maintained
at one copy per cell under selective and non-selective culture
conditions. Only two metaphases with two MMCneo were found in 2,270
metaphases analyzed.
[0317] Southern hybridization analysis showed no detectable changes
in DNA restriction patterns, and similar hybridization intensities
were observed with a neo probe when DNA from cells grown under
selective or non-selective culture conditions were compared.
[0318] Northern analysis of RNA transcripts from the neo gene
isolated from cells grown under selective and non-selective
conditions showed only minor and not significant differences.
Expression of the neo gene persisted in EC3/7C5 cells maintained in
F-12 medium free of G418 for 290 days under non-selective culture
conditions. The long-term expression of the neo gene(s) from the
minichromosome may be influenced by the nuclear location of the
MMCneo. In situ hybridization experiments revealed a preferential
peripheral location of the MMCneo in the interphase nucleus. In
more than 60% of the 2,500 nuclei analyses, the minichromosome was
observed at the perimeter of the nucleus near the nuclear
envelope.
EXAMPLE 3
Minichromosome Transfer and Production of the
.lambda.-neo-chromosome
[0319] A. Minichromosome Transfer
[0320] The neo-minichromosome [referred to as MMCneo, FIG. 2C] has
been used for gene transfer by fusion of minichromosome-containing
cells [EC3/7C5 or EC317C6] with different mammalian cells,
including hamster and human. Thirty-seven stable hybrid cell lines
have been produced. All established hybrid cell lines proved to be
true hybrids as evidenced by in situ hybridization using
biotinylated human, and hamster genomic, or pMCPE1.51 mouse long
interspersed repeated DNA probes for "chromosome painting". The
MMCneo has also been successfully transferred into mouse A9, L929
and pluripotent F9 teratocarcinoma cells by fusion of microcells
derived from EC3/7C5 cells. Transfer was confirmed by PCR, Southern
blotting and in situ hybridization with minichromosome-specific
probes. The cytogenetic analysis confirmed that, as expected for
microcell fusion, a few cells [1-5%] received [or retained] the
MMCneo.
[0321] These results demonstrate that the MMCneo is tolerated by a
wide range of cells. The prokaryotic genes and the extra dosage for
the human and .lambda. sequences carried on the minichromosome seem
to be not disadvantageous for tissue culture cells.
[0322] The MMCneo is the smallest chromosome of the EC3/7C5 genome
and is estimated to be approximately 20-30 Mb, which is
significantly smaller than the majority of the host cell (mouse)
chromosomes. By virtue of the smaller size, minichromosomes can be
partially purified from a suspension of isolated chromosomes by a
simple differential centrifugation. In this way, minichromosome
suspensions of 15-20% purity have been prepared. These enriched
minichromosome preparations can be used to introduce, such as by
microinjection or lipofection, the minichromosome into selected
target cells. Target cells include therapeutic cells that can be
use in methods of gene therapy, and also embryonic cells for the
preparation of transgenic (non-human) animals.
[0323] The MMCneo is capable of autonomous replication, is stably
maintained in cells, and permits persistent expression of the neo
gene(s), even after long-term culturing under non-selective
conditions. It is a non-integrative vector that appears to occupy a
territory near the nuclear envelope. Its peripheral localization in
the nucleus may have an important role in maintaining the
functional integrity and stability of the MMCneo. Functional
compartmentalization of the host nucleus may have an effect on the
function of foreign sequences. In addition, MMCneo contains
megabases of .lambda. DNA sequences that should serve as a target
site for homologous recombination and thus integration of desired
gene(s) into the MMCneo. It can be transferred by cell and
microcell fusion, microinjection, electroporation, lipid-mediated
carrier systems or chromosome uptake. The neo-centromere of the
MMCneo is capable of maintaining and supporting the normal
segregation of a larger 150-200 Mb .lambda.neo-chromosome. This
result demonstrates that the MMCneo chromosome should be useful for
carrying large fragments of heterologous DNA.
[0324] B. Production of the .lambda.neo-chromosome
[0325] In the hybrid cell line KE1-2/4 made by fusion of EC3/7 and
Chinese hamster ovary cells [FIG. 2], the separation of the
neo-centromere from the dicentric chromosome was associated with a
further amplification process. This amplification resulted in the
formation of a stable chromosome of average size [i.e., the
.lambda.neo-chromosome; see, Praznovszky et al. (1991) Proc. Natl.
Acad. Sci. U.S.A. 88:11042-11046]. The .lambda.neo-chromosome
carries a terminally located functional centromere and is composed
of seven large amplicons containing multiple copies of .lambda.,
human, bacterial, and mouse DNA sequences [see FIG. 2]. The
amplicons are separated by mouse major satellite DNA [Praznovszky
et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88:11042-11046] which
forms narrow bands of constitutive heterochromatin between the
amplicons.
EXAMPLE 4
[0326] Formation of the "Sausage Chromosome" [SC]
[0327] The findings set forth in the above EXAMPLES demonstrate
that the centromeric region of the mouse chromosome 7 has the
capacity for large-scale amplification [other results indicate that
this capacity is not unique to chromosome 7]. This conclusion is
further supported by results from cotransfection experiments, in
which a second dominant selectable marker gene and a non-selected
marker gene were introduced into EC3/7C5 cells carrying the
formerly dicentric chromosome 7 and the neo-minichromosome. The
EC3/7C5 cell line was transformed with .lambda. phage DNA, a
hygromycin-resistance gene construct [pH132], and a
.beta.-galactosidase gene construct [pCH110]. Stable transformants
were selected in the presence of high concentrations [400 .mu.g/ml]
Hygromycin B, and analyzed by Southern hybridization. Established
transformant cell lines showing multiple copies of integrated
exogenous DNA were studied by in situ hybridization to localize the
integration site(s), and by LacZ staining to detect
.beta.-galactosidase expression.
[0328] A. Materials and Methods
[0329] 1. Construction of pH 132
[0330] The pH132 plasmid carries the hygromycin B resistance gene
and the anti-HIV-1 gag ribozyme [see, SEQ ID NO. 6 for DNA sequence
that corresponds to the sequence of the ribozyme] under control of
the .beta.-actin promoter. This plasmid was constructed from pHyg
plasmid [Sugden et al. (1985) Mol. Cell. Biol. 5:410-413; a gift
from Dr. A. D. Riggs, Beckman Research Institute, Duarte; see,
also, e.g., U.S. Pat. No. 4,997,764], and from pPC-RAG12 plasmid
[see, Chang et al. (1990) Clin Biotech 2:23-31; provided by Dr. J.
J. Rossi, Beckman Research Institute, Duarte; see, also U.S. Pat.
Nos. 5,272,262, 5,149,796 and 5,144,019, which describes the
anti-HIV gag ribozyme and construction of a mammalian expression
vector containing the ribozyme insert linked to the .beta.-actin
promoter and SV40 late gene transcriptional termination and polyA
signals]. Construction of pPC-RAG12 involved insertion of the
ribozyme insert flanked by BamHl linkers was into BamHi-digested
pH.beta.-Apr-1gpt [see, Gunning et al. (1987) Proc. Natl. Acad.
Sci. U.S.A. 84:4831-4835, see, also U.S. Pat. No. 5,144,019].
[0331] Plasmid pH132 was constructed as follows. First, pPC-RAG12
[described by Chang et al. (1990) Clin. Biotech. 2:23-31] was
digested with BamHI to excise a fragment containing an anti-HIV
ribozyme gene [referred to as ribozyme D by Chang et al. [(1990)
Clin. Biotech. 2:23-31]; see also U.S. Pat. No. 5,144,019 to Rossi
et al., particularly FIG. 4 of the patent] flanked by the human
.beta.-actin promoter at the 5' end of the gene and the SV40 late
transcriptional termination and polyadenylation signals at the 3'
end of the gene. As described by Chang et al. [(1990) Clin.
Biotech. 2:23-31], ribozyme D is targeted for cleavage of the
translational initiation region of the HIV gag gene. This fragment
of pPC-RAG12 was subcloned into pBluescript-KS(+) [Stratagene, La
Jolla, Calif.] to produce plasmid 132. Plasmid 132 was then
digested with XhoI and EcoRI to yield a fragment containing the
ribozyme D gene flanked by the .beta.-actin promoter at the 5' end
and the SV40 termination and polyadenylation signals at the 3' end
of the gene. This fragment was ligated to the largest fragment
generated by digestion of pHyg [Sugden et al. (1985) Mol. Cell.
Biol. 5:410-413] with EcoRI and SalI to yield pH132. Thus, pH132 is
an .about.9.3 kb plasmid containing the following elements: the
.beta.-actin promoter linked to an anti-HIV ribozyme gene followed
by the SV40 termination and polyadenylation signals, the thymidine
kinase gene promoter linked to the hygromycin-resistance gene
followed by the thymidine kinase gene polyadenylation signal, and
the E. coli ColE1 origin of replication and the
ampicillin-resistance gene.
[0332] The plasmid pHyg [see, e., U.S. Pat. Nos. 4,997,764,
4,686,186 and 5,162,215], which confers resistance to hygromycin B
using transcriptional controls from the HSV-1 tk gene, was
originally constructed from pKan2 [Yates et al. (1984) Proc. Natl.
Acad. Sci. U.S.A. 81:3806-3810] and pLG89 [see, Gritz et al. (1983)
Gene 25:179-188]. Briefly pKan2 was digested with SmaI and BglII to
remove the sequences derived from transposon Tn5. The
hygromycin-resistance hph gene was inserted into the digested pKan2
using blunt-end ligation at the SnaI site and "sticky-end" ligation
[using 1 Weiss unit of T4 DNA ligase (BRL) in 20 microliter volume]
at the BglII site. The SmaI and BglII sites of pKan2 were lost
during ligation.
[0333] The resulting plasmid pH132, produced from introduction of
the anti-HIV ribozyme construct with promoter and polyA site into
pHyg, includes the anti-HIV ribozyme under control of the
.beta.-actin promoter as well as the hygromycin-resistance gene
under control of the TK promoter.
[0334] 2. Chromosome Banding
[0335] Trypsin G-banding of chromosomes was performed as described
in EXAMPLE 1.
[0336] 3. Cell Cultures
[0337] TF1004G19 and TF1004G-19C5 mouse cells and the
19C5.times.Ha4 hybrid, described below, and its sublines were
cultured in F-12 medium containing 400 .mu.g/ml Hygromycin B
[Calbiochem].
[0338] B. Cotransfection of EC3/7C5 to Produce TF1004G19
[0339] Cotransfection of EC3/7C5 cells with plasmids [pH132, pCH110
available from Pharmacia, see, also Hall et al. (1983) J. Mol.
Appl. Gen. 2:101-109] and with .lambda. DNA [.lambda.cl 875 Sam
7(New England Biolabs)] was conducted using the calcium phosphate
DNA precipitation method [see, e.g., Chen et al. (1987) Mol. Cell.
Biol. 7:2745-2752], using 2-5 .mu.g plasmid DNA and 20 .mu.g
.lambda. phage DNA per 5.times.10.sup.6 recipient cells.
[0340] C. Cell Lines Containing the Sausage Chromosome
[0341] Analysis of one of the transformants, designated TF1004G19,
revealed that it has a high copy number of integrated pH132 and
pCH110 sequences, and a high level of .beta.-galactosidase
expression. G-banding and in situ hybridization with a human probe
[CM8; see, e.g., U.S. application Ser. No. 08/375,271] revealed
unexpectedly that integration had occurred in the formerly
dicentric chromosome 7 of the EC3/7C5 cell line. Furthermore, this
chromosome carried a newly formed heterochromatic chromosome arm.
The size of this heterochromatic arm varied between .about.150 and
.about.800 Mb in individual metaphases.
[0342] By single cell cloning from the TF1004G19 cell line, a
subclone TF1004G-19C5 [FIG 2D], which carries a stable chromosome 7
with a .about.100-150 Mb heterochromatic arm [the sausage
chromosome] was obtained. This cell line has been deposited in the
ECACC under Accession No. 96040926. This chromosome arm is composed
of four to five satellite segments rich in satellite DNA, and
evenly spaced integrated heterologous "foreign" DNA sequences. At
the end of the compact heterochromatic arm of the sausage
chromosome, a less condensed euchromatic terminal segment is
regularly observed. This subclone was used for further
analyses.
[0343] D. Demonstration that the Sausage Chromosome is Derived from
the Formerly Dicentric Chromosome
[0344] In situ hybridization with .lambda. phage and pH132 DNA on
the TF1004G-19C5 cell line showed positive hybridization only on
the minichromosome and on the heterochromatic arm of the "sausage"
chromosome [FIG. 2D]. It appears that the "sausage" chromosome
[herein also referred to as the SC] developed from the formerly
dicentric chromosome (FD) of the EC3/7C5 cell line.
[0345] To establish this, the integration sites of pCH110 and pH132
plasmids were determined. This was accomplished by in situ
hybridization on these cells with biotin-labeled subfragments of
the hygromycin-resistance gene and the .beta.-galactosidase gene.
Both experiments resulted in narrow hybridizing bands on the
heterochromatic arm of the sausage chromosome. The same
hybridization pattern was detected on the sausage chromosome using
a mixture of biotin-labeled .lambda. probe and pH132 plasmid,
proving the cointegration of .lambda. phages, pH132 and pCH 110
plasmids.
[0346] To examine this further, the cells were cultured in the
presence of the DNA-binding dye Hoechst 33258. Culturing of mouse
cells in the presence of this dye results in under-condensation of
the pericentric heterochromatin of metaphase chromosomes, thereby
permitting better observation of the hybridization pattern. Using
this technique, the heterochromatic arm of the sausage chromosome
of TF1004G-19C5 cells showed regular under-condensation revealing
the details of the structure of the "sausage" chromosome by in situ
hybridization. Results of in situ hybridization on Hoechst-treated
TF1004G-19C5 cells with biotin-labeled subfragments of
hygromycin-resistance and .beta.-galactosidase genes shows that
these genes are localized only in the heterochromatic arm of the
sausage chromosome. In addition, an equal banding hybridization
pattern was observed. This pattern of repeating units [amplicons]
clearly indicates that the sausage chromosome was formed by an
amplification process and that the .lambda. phage, pH132 and pCH110
plasmid DNA sequences border the amplicons.
[0347] In another series of experiments using fluorescence in situ
hybridization [FISH] carried out with mouse major satellite DNA,
the main component of the mouse pericentric heterochromatin, the
results confirmed that the amplicons of the sausage chromosome are
primarily composed of satellite DNA.
[0348] E. The Sausage Chromosome Has One Centromere
[0349] To determine whether mouse centromeric sequences had
participated in the amplification process forming the "sausage"
chromosome and whether or not the amplicons carry inactive
centromeres, in situ hybridization was carried out with mouse minor
satellite DNA. Mouse minor satellite DNA is localized specifically
near the centromeres of all mouse chromosomes. Positive
hybridization was detected in all mouse centromeres including the
sausage chromosome, which, however, only showed a positive signal
at the beginning of the heterochromatic arm.
[0350] Indirect immunofluorescence with a human anti-centromere
antibody [LU 851] which recognizes only functional centromeres
[see, e.g., Hadlaczky et al. (1989) Chromosoma 97:282-288] proved
that the sausage chromosome has only one active centromere. The
centromere comes from the formerly dicentric part of the chromosome
and co-localizes with the in situ hybridization signal of the mouse
minor DNA probe.
[0351] F. The Selected and Non-selected Heterologous DNA in the
Heterochromatin of the Sausage Chromosome is Expressed
[0352] 1. High Levels of the Heterologous Genes are Expressed
[0353] The TF1004G-19C5 cell line thus carries multiple copies of
hygromycin-resistance and .beta.-galactosidase genes localized only
in the heterochromatic arm of the sausage chromosome. The
TF1004G-19C5 cells can grow very well in the presence of 200
.mu.g/ml or even 400 .mu.g/ml hygromycin B. [The level of
expression was determined by Northern hybridization with a
subfragment of the hygromycin-resistance gene and single copy
gene.]
[0354] The expression of the non-selected .beta.-galactosidase gene
in the TF1004G-19C5 transformant was detected with LacZ staining of
the cells. By this method one hundred percent of the cells stained
dark blue, showing that there is a high level of
.beta.-galactosidase expression in all of TF1004G-19C5 cells.
[0355] 2. The Heterologous Genes That Are Expressed Are In the
Heterochromatin of the Sausage Chromosome
[0356] To demonstrate that the genes localized in the constitutive
heterochromatin of the sausage chromosome provide the hygromycin
resistance and the LacZ staining capability of TF1004G-19C5
transformants [i.e. .beta.-gal expression], PEG-induced cell fusion
between TF1004G-19C5 mouse cells and Chinese hamster ovary cells
was performed. The hybrids were selected and maintained in HAT
medium containing G418 [400 .mu.g/ml] and hygromycin [200
.mu.g/ml]. Two hybrid clones designated 19C5.times.Ha3 and
19C5.times.Ha4, which have been deposited in the ECACC under
Accession No. 96040927, were selected. Both carry the sausage
chromosome and the minichromosome.
[0357] Twenty-seven single cell derived colonies of the
19C5.times.Ha4 hybrid were maintained and analyzed as individual
subclones. In situ hybridization with hamster and mouse chromosome
painting probes and hamster chromosome 2-specific probes verified
that the 19C5.times.Ha4 clone contains the complete Chinese hamster
genome and a partial mouse genome. All 19C5.times.Ha4 subclones
retained the hamster genome, but different subclones showed
different numbers of mouse chromosomes indicating the preferential
elimination of mouse chromosomes.
[0358] To promote further elimination of mouse chromosomes, hybrid
cells were repeatedly treated with BrdU. The BrdU treatments, which
destabilize the genome, result in significant loss of mouse
chromosomes. The BrdU-treated 19C5.times.Ha4 hybrid cells were
divided to three groups. One group of the hybrid cells (GH) were
maintained in the presence of hygromycin (200 .mu.g/ml) and G418
(400 .mu.g/ml), and the other two groups of the cells were cultured
under G418 (G) or hygromycin (H) selection conditions to promote
the elimination of the sausage chromosome or minichromosome.
[0359] One month later, single cell derived subclones were
established from these three subcultures of the 19C5.times.Ha4
hybrid line. The subclones were monitored by in situ hybridization
with biotin-labeled .lambda. phage and hamster chromosome painting
probes. Four individual clones [G2B5, G3C5, G4D6, G2B4] selected in
the presence of G418 that had lost the sausage chromosome but
retained the minichromosome were found. Under hygromycin selection
only one subclone [H1D3] lost the minichromosome. In this clone the
megachromosome [see Example 5] was present.
[0360] Since hygromycin-resistance and .beta.-galactosidase genes
were thought to be expressed from the sausage chromosome, the
expression of these genes was analyzed in the four subclones that
had lost the sausage chromosome. In the presence of 200 .mu.g/ml
hygromycin, one hundred percent of the cells of four individual
subclones died. In order to detect the .beta.-galactosidase
expression hybrid, subclones were analyzed by LacZ staining. One
hundred percent of the cells of the four subclones that lost the
sausage chromosome also lost the LacZ staining capability. All of
the other hybrid subclones that had not lost the sausage chromosome
under the non-selective culture conditions showed positive LacZ
staining.
[0361] These findings demonstrate that the expression of
hygromycin-resistance and .beta.-galactosidase genes is linked to
the presence of the sausage chromosome. Results of in situ
hybridizations show that the heterologous DNA is expressed from the
constitutive heterochromatin of the sausage chromosome.
[0362] In situ hybridization studies of three other hybrid
subclones [G2C6, G2D1, and G4D5] did not detect the presence of the
sausage chromosome. By the LacZ staining method, some stained cells
were detected in these hybrid lines, and when these subclones were
transferred to hygromycin selection some colonies survived.
Cytological analysis and in situ hybridization of these
hygromycin-resistant colonies revealed the presence of the sausage
chromosome, suggesting that only the cells of G2C6, G2D1 and G4D5
hybrids that had not lost the sausage chromosome were able to
preserve the hygromycin resistance and .beta.-galactosidase
expression. These results confirmed that the expression of these
genes is linked to the presence of the sausage chromosome. The
level of .beta.-galactosidase expression was determined by the
immunoblot technique using a monoclonal antibody.
[0363] Hygromycin resistance and .beta.-galactosidase expression of
the cells which contained the sausage chromosome were provided by
the genes localized in the mouse pericentric heterochromatin. This
was demonstrated by performing Southern DNA hybridizations on the
hybrid cells that lack the sausage chromosome using PCR-amplified
subfragments of hygromycin-resistance and .beta.-galactosidase
genes as probes. None of the subclones showed hybridization with
these probes; however, all of the analyzed clones contained the
minichromosome. Other hybrid clones that contain the sausage
chromosome showed intense hybridization with these DNA probes.
These results lead to the conclusion that hygromycin resistance and
.beta.-galactosidase expression of the cells that contain the
sausage chromosome were provided by the genes localized in the
mouse pericentric heterochromatin.
EXAMPLE 5
[0364] The Gigachromosome
[0365] As described in Example 4, the sausage chromosome was
transferred into Chinese hamster cells by cell fusion. Using
Hygromycin B/HAT and G418 selection, two hybrid clones
19C5.times.Ha3 and 19C5.times.Ha4 were produced that carry the
sausage chromosome. In situ hybridization, using hamster and mouse
chromosome-painting probes and a hamster chromosome 2-specific
probe, verified that clone 19C5.times.Ha4 contains a complete
Chinese hamster genome as well as partial mouse genomes.
Twenty-seven separate colonies of 19C5.times.Ha4 cells were
maintained and analyzed as individual subclones. Twenty-six out of
27 subclones contained a morphologically unchanged sausage
chromosome.
[0366] In one subclone of the 19C5.times.Ha3 cell line,
19C5.times.Ha47 [see FIG. 2E], the heterochromatic arm of the
sausage chromosome became unstable and showed continuous
intrachromosomal growth. In extreme cases, the amplified chromosome
arm exceeded 1000 Mb in size (gigachromosome).
EXAMPLE 6
[0367] The Stable Megachromosome
[0368] A. Generation of Cell Lines Containing the
Megachromosome
[0369] All 19C5.times.Ha4 subclones retained a complete hamster
genome, but different subclones showed different numbers of mouse
chromosomes, indicating the preferential elimination of mouse
chromosomes. As described in Example 4, to promote further
elimination of mouse chromosomes, hybrid cells were treated with
BrdU, cultured under G418 (G) or hygromycin (H) selection
conditions followed by repeated treatment with 10.sup.-4 M BrdU for
16 hours and single cell subclones were established. The BrdU
treatments appeared to destabilize the genome, resulting in a
change in the sausage chromosome as well. A gradual increase in a
cell population in which a further amplification had occurred was
observed. In addition to the .about.100-150 Mb heterochromatic arm
of the sausage chromosome, an extra centromere and a .about.150-250
Mb heterochromatic chromosome arm were formed, which differed from
those of mouse chromosome 7. By the acquisition of another
euchromatic terminal segment, a new submetacentric chromosome
(megachromosome) was formed. Seventy-nine individual subclones were
established from these BrdU-treated cultures by single-cell
cloning: 42 subclones carried the intact megachromosome, 5
subclones carried the sausage chromosome, and in 32 subclones
fragments or translocated segments of the megachromosome were
observed. Twenty-six subclones that carried the megachromosome were
cultured under non-selective conditions over a two-month period. In
19 out of 26 subclones, the megachromosome was retained. Those
subclones which lost the megachromosomes all became sensitive to
Hygromycin B and had no .beta.-galactosidase expression, indicating
that both markers were linked to the megachromosome.
[0370] Two sublines (G3D5 and H1D3), which were chosen for further
experiments, showed no changes in the morphology of the
megachromosome during more than 100 generations under selective
conditions. The G3D5 cells had been obtained by growth of
19C5.times.Ha4 cells in G418-containing medium followed by repeated
BrdU treatment, whereas H1D3 cells had been obtained by culturing
19C5.times.Ha4 cells in hygromycin-containing medium followed by
repeated BrdU treatment.
[0371] B. Structure of the Megachromosome
[0372] The following results demonstrate that, apart from the
euchromatic terminal segments, the integrated foreign DNA (and as
in the exemplified embodiments, rDNA sequence), the whole
megachromosome is constitutive heterochromatin, containing a tandem
array of at least 40 [.about.7.5 Mb] blocks of mouse major
satellite DNA [see FIGS. 2 and 3]. Four satellite DNA blocks are
organized into a giant palindrome [amplicon] carrying integrated
exogenous DNA sequences at each end. The long and short arms of the
submetacentric megachromosome contains 6 and 4 amplicons,
respectively. It is of course understood that the specific
organization and size of each component can vary among species, and
also the chromosome in which the amplification event initiates.
[0373] 1. The Megachromosome is Composed Primarily of
Heterochromatin
[0374] Except for the terminal regions and the integrated foreign
DNA, the megachromosome is composed primarily of heterochromatin.
This was demonstrated by C-banding of the megachromosome, which
resulted in positive staining characteristic of constitutive
heterochromatin. Apart from the terminal regions and the integrated
foreign DNA, the whole megachromosome appears to be
heterochromatic. Mouse major satellite DNA is the main component of
the pericentric, constitutive heterochromatin of mouse chromosomes
and represents .about.10% of the total DNA [Waring et al. (1966)
Science 154:791-794]. Using a mouse major satellite DNA probe for
in situ hybridization, strong hybridization was observed throughout
the megachromosome, except for its terminal regions. The
hybridization showed a segmented pattern: four large blocks
appeared on the short arm and usually 4-7 blocks were seen on the
long arm. By comparing these segments with the pericentric regions
of normal mouse chromosomes that carry .about.15 Mb of major
satellite DNA, the size of the blocks of major satellite DNA on the
megachromosome was estimated to be .about.30 Mb.
[0375] Using a mouse probe specific to euchromatin [pMCPE1.51; a
mouse long interspersed repeated DNA probe], positive hybridization
was detected only on the terminal segments of the megachromosome of
the H1D3 hybrid subline. In the G3D5 hybrids, hybridization with a
hamster-specific probe revealed that several megachromosomes
contained terminal segments of hamster origin on the long arm. This
observation indicated that the acquisition of the terminal segments
on these chromosomes happened in the hybrid cells, and that the
long arm of the megachromosome was the recently formed one arm.
When a mouse minor satellite probe was used, specific to the
centromeres of mouse chromosomes [Wong et al. (1988) Nucl. Acids
Res. 16:11645-11661], a strong hybridization signal was detected
only at the primary constriction of the megachromosome, which
colocalized with the positive immuno-fluorescence signal produced
with human anti-centromere serum [LU851].
[0376] In situ hybridization experiments with pH132, pCH110, and
.lambda. DNA probes revealed that all heterologous DNA was located
in the gaps between the mouse major satellite DNA segments. Each
segment of mouse major satellite DNA was bordered by a narrow band
of integrated heterologous DNA, except at the second segment of the
long arm where a double band of heterologous DNA existed,
indicating that the major satellite DNA segment was missing or
considerably reduced in size here. This chromosome region served as
a useful cytological marker in identifying the long arm of the
megachromosome. At a frequency of 10.sup.-4, "restoration" of these
missing satellite DNA blocks was observed in one chromatid, when
the formation of a whole segment on one chromatid occurred.
[0377] After Hoechst 33258 treatment (50 .mu.g/ml for 16 hours),
the megachromosome showed undercondensation throughout its length
except for the terminal segments. This made it possible to study
the architecture of the megachromosome at higher resolution. In
situ hybridization with the mouse major satellite probe on
undercondensed megachromosomes demonstrated that the .about.30 Mb
major satellite segments were composed of four blocks of .about.7.5
Mb separated from each other by a narrow band of non-hybridizing
sequences [FIG. 3]. Similar segmentation can be observed in the
large block of pericentric heterochromatin in metacentric mouse
chromosomes from the LMTK.sup.- and A9 cell lines.
[0378] 2. The Megachromosome is Composed of Segments Containing Two
Tandem .about.7.5 Mb Blocks Followed by Two Inverted Blocks
[0379] Because of the asymmetry in thymidine content between the
two strands of the DNA of the mouse major satellite, when mouse
cells are grown in the presence of BrdU for a single S phase, the
constitutive heterochromatin shows lateral asymmetry after FPG
staining. Also, in the 19C5.times.Ha4 hybrids, the thymidine-kinase
[Tk] deficiency of the mouse fibroblast cells was complemented by
the hamster Tk gene, permitting BrdU incorporation experiments.
[0380] A striking structural regularity in the megachromosome was
detected using the FPG technique. In both chromatids, alternating
dark and light staining that produced a checkered appearance of the
megachromosome was observed. A similar picture was obtained by
labelling with fluorescein-conjugated anti-BrdU antibody. Comparing
these pictures to the segmented appearance of the megachromosome
showed that one dark and one light FPG band corresponded to one
.about.30 Mb segment of the megachromosome. These results suggest
that the two halves of the .about.30 Mb segment have an inverted
orientation. This was verified by combining in situ hybridization
and immunolabelling of the incorporated BrdU with
fluorescein-conjugated anti-BrdU antibody on the same chromosome.
Since the .about.30 Mb segments [or amplicons] of the
megachromosome are composed of four blocks of mouse major satellite
DNA, it can be concluded that two tandem .about.7.5 Mb blocks are
followed by two inverted blocks within one segment.
[0381] Large-scale mapping of megachromosome DNA by pulsed-field
electrophoresis and Southern hybridization with "foreign" DNA
probes revealed a simple pattern of restriction fragments. Using
endonucleases with none, or only a single cleavage site in the
integrated foreign DNA sequences, followed by hybridization with a
hyg probe, 1-4 predominant fragments were detected. Since the
megachromosome contains 10-12 amplicons with an estimated 3-8
copies of hyg sequences per amplicon (30-90 copies per
megachromosome), the small number of hybridizing fragments
indicates the homogeneity of DNA in the amplified segments.
[0382] 3. Scanning Electron Microscopy of the Megachromosome
Confirmed the Above Findings
[0383] The homogeneous architecture of the heterochromatic arms of
the megachromosome was confirmed by high resolution scanning
electron microscopy. Extended arms of megachromosomes, and the
pericentric heterochromatic region of mouse chromosomes, treated
with Hoechst 33258, showed similar structure. The constitutive
heterochromatic regions appeared more compact than the euchromatic
segments. Apart from the terminal regions, both arms of the
megachromosome were completely extended, and showed faint grooves,
which should correspond to the border of the satellite DNA blocks
in the non-amplified chromosomes and in the megachromosome. Without
Hoechst treatment, the grooves seemed to correspond to the amplicon
borders on the megachromosome arms. In addition, centromeres showed
a more compact, finely fibrous appearance than the surrounding
heterochromatin.
[0384] 4. The Megachromosome of 1B3 Cells Contains rRNA Gene
Sequence
[0385] The sequence of the megachromosome in the region of the
sites of integration of the heterologous DNA was investigated by
isolation of these regions through using cloning methods and
sequence analysis of the resulting clones. The results of this
analysis revealed that the heterologous DNA was located near mouse
ribosomal RNA gene (i.e., rDNA) sequences contained in the
megachromosome.
[0386] a. Cloning of Regions of the Megachromosomes In Which
Heterologous DNA Had Integrated
[0387] Megachromosomes were isolated from 1B3 cells (which were
generated by repeated BrdU treatment and single cell cloning of
H1.times.HE41 cells (see FIG. 4) and which contain a truncated
megachromosome) using fluorescence-activated cell sorting methods
as described herein (see Example 10). Following separation of the
SATACs (megachromosomes) from the endogenous chromosomes, the
isolated megachromosomes were stored in GH buffer (100 mM glycine,
1% hexylene glycol, pH 8.4-8.6 adjusted with saturated calcium
hydroxide solution; see Example 10) and centrifuged into an agarose
bed in 0.5 M EDTA.
[0388] Large-scale mapping of the megachromosome around the area of
the site of integration of the heterologous DNA revealed that it is
enriched in sequence containing rare-cutting enzyme sites, such as
the recognition site for NotI. Additionally, mouse major satellite
DNA (which makes up the majority of the megachromosome) does not
contain Noti recognition sites. Therefore, to facilitate isolation
of regions of the megachromosome associated with the site of
integration of the heterologous DNA, the isolated megachromosomes
were cleaved with NotI, a rare cutting restriction endonuclease
with an 8-bp GC recognition site. Fragments of the megachromosome
were inserted into plasmid pWE15 (Stratagene, La Jolla, Calif.) as
follows. Half of a 100-.mu.l low melting point agarose block
(mega-plug) containing the isolated SATACs was digested with NotI
overnight at 37.degree. C. Plasmid pWE15 was similarly digested
with NotI overnight. The mega-plug was then melted and mixed with
the digested plasmid, ligation buffer and T4 ligase. Ligation was
conducted at 16.degree. C. overnight. Bacterial DH5.alpha. cells
were transformed with the ligation product and transformed cells
were plated onto LB/Amp plates. Fifteen to twenty colonies were
grown on each plate for a total of 189 colonies. Plasmid DNA was
isolated from colonies that survived growth on LB/Amp medium and
was analyzed by Southern blot hybridization for the presence of DNA
that hybridized to a pUC19 probe. This screening methodology
assured that all clones, even clones lacking an insert but yet
containing the pWE15 plasmid, would be detected. Any clones
containing insert DNA would be expected to contain contain
non-satellite, GC-rich megachromosome DNA sequences located at the
site of integration of the heterologous DNA. All colonies were
positive for hybridizing DNA.
[0389] Liquid cultures of all 189 transformants were used to
generate cosmid minipreps for analysis of restriction sites within
the insert DNA. Six of the original 189 cosmid clones conatained an
insert. These clones were designated as follows: 28 (.about.9-kb
insert), 30 (.about.9-kb insert), 60 (.about.4-kb insert), 113
(.about.9-kb insert), 157 (.about.9-kb insert) and 161 (.about.9-kb
insert). Restriction enzyme analysis indicated that three of the
clones (113, 157 and 161) contained the same insert.
[0390] 5 b. In situ Hybridization Experiments Using Isolated
Segments of the Megachromosome as Probes
[0391] Insert DNA from clones 30, 113, 157 and 161 was purified,
labeled and used as probes in in situ hybridization studies of
several cell lines. Counterstaining of the cells with propidium
iodide facilitated identification of the cytological sites of the
hybridization signals. The locations of the signals detected within
the cells are summarized in the following table:
4 CELL TYPE PROBE LOCATION OF SIGNAL Human Lymphocyte No. 161 4-5
pairs of acrocentic chromosomes (male) at centromeric regions.
Mouse Spleen No. 161 Acrocentric ends of 4 pairs of chromosomes.
EC3/7C5 Cells No. 161 Minichromosome and the end of the formerly
dicentric chromosome. Pericentric heterochromatin of one of the
metacentric mouse chromosomes. Centromeric region of some of the
other mouse chromosomes. K20 Chinese No. 30 Ends of at least 6
pairs of Hamster Cells chromosomes. An interstitial signal on a
short chromosome. HB31 Cells No. 30 Acrocentric ends of at least 12
pairs (mouse-hamster hybrid of chromosomes. Centromeres of cells
derived from H1D3 certain chromosomes and the cells by repeated
BrdU megachromosome. Borders of the treatment and single cell
amplicons of the megachromosome. cloning which carries the mega
chromosome) Mouse Spleen Cells No. 30 Similar to signal observed
for probe no. 161. Centromeres of 5 pairs of chromosomes. Weak
cross- hybridization to pericentric heterochromatin. HB31 Cells No.
113 Similar to signal observed for probe no. 30. Mouse Spleen Cells
No. 113 Centromeric region of 5 pairs of chromosomes. K20 Cells No.
113 At least 6 pairs of chromosomes. Weak signal at some telomeres
and several interspersed signals. Human Lymphocyte No. 157 Similar
to signal observed for probe Cells (male) no. 161.
[0392] c. Southern Blot Hybridization Using Isolated Segments of
the Megachromosome as Probes
[0393] DNA was isolated from mouse spleen tissue, mouse LMTK.sup.-
cells, K20 Chinese hamster ovary cells, EJ30 human fibroblast cells
and H1D3 cells. The isolated DNA and lambda phage DNA, was
subjected to Southern blot hybridization using inserts isolated
from megachromosome clone nos. 30, 113, 157 and 161 as probes.
Plasmid pWE15 was used as a negative control probe. Each of the
four megachromosome clone inserts hybridized in a multi-copy manner
(as demonstrated by the intensity of hybridization and the number
of hybridizing bands) to all of the DNA samples, except the lambda
phage DNA. Plasmid pWE15 hybridized to lambda DNA only.
[0394] d. Sequence Analysis of Megachromosome Clone No. 161
[0395] Megachromosome clone no. 161 appeared to show the strongest
hybridization in the in situ and Southern hybridization experiments
and was chosen for analysis of the insert sequence. The sequence
analysis was approached by first subcloning the insert of cosmid
clone no. 161 to obtain five subclones as follows.
[0396] To obtain the end fragments of the insert of clone no. 161,
the clone was digested with Noti and BamHI and ligated with
NotI/BamHI-digested pBluescript KS (Stratagene, La Jolla, Calif.).
Two fragments of the insert of clone no. 161 were obtained: a
0.2-kb and a 0.7-kb insert fragment. To subclone the internal
fragment of the insert of clone no. 161, the same digest was
ligated with BamHI-digested pUC19. Three fragments of the insert of
clone no. 161 were obtained: a 0.6-kb, a 1.8-kb and a 4.8-kb insert
fragment.
[0397] The ends of all the subcloned insert fragments were first
sequenced manually. However, due to their extremely high GC
content, autoradiographs were difficult to interpret and sequencing
was repeated using an ABI sequencer and the dye-terminator cycle
protocol. A comparison of the sequence data to sequences in the
GENBANK database revealed that the insert of clone no. 161
corresponds to an internal section of the mouse ribosomal RNA gene
(rDNA) repeat unit between positions 7551-15670 as set forth in
GENBANK accession no. X82564, which is provided as SEQ ID NO. 16
herein. The sequence data obtained for the insert of clone no. 161
is set forth in SEQ ID NOS. 18-24. Specifically, the individual
subclones corresponded to the following positions in GENBANK
accession no. X82564 (i.e., SEQ ID NO. 16) and in SEQ ID NOs.
18-24:
5 Start End Subclone in X82564 Site SEQ ID No. 161k1 7579 7755
NotI, BamHI 18 161m5 7756 8494 BamHI 19 161m7 8495 10231 BamHI 20
(shows only sequence corresponding to nt. 8495-8950), 21 (shows
only sequence corresponding to nt. 9851-10231) 161m12 10232 15000
BamHI 22 (shows only sequence corresponding to nt. 10232-10600), 23
(shows only sequence corresponding to nt. 14267-15000), 161k2 15001
15676 NotI, BamHI 24
[0398] The sequence set forth in SEQ ID NOs. 18-24 diverges in some
positions from the sequence presented in positions 7551-15670 of
GENBANK accession no. X82564. Such divergence may be attributable
to random mutations between repeat units of rDNA. The results of
the sequence analysis of clone no. 161, which reveal that it
corresponds to rDNA, correlate with the appearance of the in situ
hybridization signal it generated in human lymphocytes and mouse
spleen cells. The hybridization signal was clearly observed on
acrocentric chromosomes in these cells, and such types of
chromosomes are known to include rDNA adjacent to the pericentric
satellite DNA on the short arm of the chromosome. Furthermore, rRNA
genes are highly conserved in mammals as supported by the
cross-species hybridization of clone no. 161 to human chromosomal
DNA.
[0399] To isolate amplification-replication control regions such as
those found in rDNA, it may be possible to subject DNA isolated
from megachromosome-containing cells, such as H1D3 cells, to
nucleic acid amplification using, e.g., the polymerase chain
reaction (PCR) with the following primers:
[0400] amplification control element forward primer (1-30)
5'-GAGGAATTCCCCATCCCTAATCCAGATTGGTG-3' (SEQ ID NO. 25)
[0401] amplification control element reverse primer (2142-2111)
5'-AAACTGCAGGCCGAGCCACCTCTCTTCTGTGTTTG-3' (SEQ ID NO. 26)
[0402] origin of replication region forward primer (2116-2141)
5'-AGGAATTCACAGAAGAGAGGTGGCTCGGCCTGC-3' (SEQ ID NO. 27)
[0403] origin of replication region reverse primer (5546-5521)
5'-AGCCTGCAGGAAGTCATACCTGGGGAGGTGGCCC-3' (SEQ ID NO. 28)
[0404] C. Summary of the Formation of the Megachromosome
[0405] FIG. 2 schematically sets forth events leading to the
formation of a stable megachromosome beginning with the generation
of a dicentric chromosome in a mouse LMTK.sup.- cell line: (A) A
single E-type amplification in the centromeric region of the mouse
chromosome 7 following transfection of LMTK.sup.- cells with
.lambda.CM8 and .lambda.gtWESneo generates the neo-centromere
linked to the integrated foreign DNA, and forms a dicentric
chromosome. Multiple E-type amplification forms the
.lambda.neo-chromosome, which was derived from chromosome 7 and
stabilized in a mouse-hamster hybrid cell line; (B) Specific
breakage between the centromeres of a dicentric chromosome 7
generates a chromosome fragment with the neo-centromere, and a
chromosome 7 with traces of foreign DNA at the end; (C) Inverted
duplication of the fragment bearing the neo-centromere results in
the formation of a stable neo-minichromosome; (D) Integration of
exogenous DNA into the foreign DNA region of the formerly dicentric
chromosome 7 initiates H-type amplification, and the formation of a
heterochromatic arm. By capturing a euchromatic terminal segment,
this new chromosome arm is stabilized in the form of the "sausage"
chromosome; (E) BrdU treatment and/or drug selection appears to
induce further H-type amplification, which results in the formation
of an unstable gigachromosome: (F) Repeated BrdU treatments and/or
drug selection induce further H-type amplification including a
centromere duplication, which leads to the formation of another
heterochromatic chromosome arm. It is split off from the chromosome
7 by chromosome breakage and acquires a terminal segment to form
the stable megachromosome.
[0406] D. Expression of .beta.-galactosidase and Hygromycin
Transferase Genes in Cell Lines Carrying the Megachromosome or
Derivatives Thereof
[0407] The level of heterologous gene (i.e., .beta.-galactosidase
and hygromycin transferase genes) expression in cell lines
containing the megachromosome or a derivative thereof was
quantitatively measured. The relationship between the copy-number
of the heterologous genes and the level of protein expressed
therefrom was also determined.
[0408] 1. Materials and Methods
[0409] a. Cell Lines
[0410] Heterologous gene expression levels of H1D3 cells, carrying
a 250-400 Mb megachromosome as decribed above, and mM2C1 cells,
carrying a 50-60 Mb micro-megachromosome, were quantitatively
evaluated. mM2C1 cells were generated by repeated BrdU treatment
and single cell cloning of the H1.times.He41 cell line
(mouse-hamster-human hybrid cell line carrying the megachromosome
and a single human chromosome with CD4 and neo.sup.r genes; see
FIG. 4). The cell lines were grown under standard conditions in F12
medium under selective (120 .mu.g/ml hygromycin) or non-selective
conditions.
[0411] b. Preparation of Cell Extract for .beta.-galactosidase
Assays
[0412] Monolayers of mM2C1 or H1D3 cell cultures were washed three
times with phosphate-buffered saline (PBS). Cells were scraped by
rubber policemen and suspended and washed again in PBS. Washed
cells were resuspended into 0.25 M Tris-HCl, pH 7.8, and disrupted
by three cycles of freezing in liquid nitrogen and thawing at
37.degree. C. The extract was clarified by centrifugation at 12,000
rpm for 5 min. at 4.degree. C.
[0413] C. .beta.-galacosidase Assay
[0414] The .beta.-galactosidase assay mixture contained 1 mM
MgC1.sub.2, 45 mM .beta.-mercaptoethanol, 0.8 mg/ml
o-nitrophenyl-.beta.-D-galactopyr- anoside and 66 mM sodium
phosphate, pH 7.5. After incubating the reaction mixture with the
cell extract at 37.degree. C. for increasing time, the reaction was
terminated by the addition of three volumes of 1M Na.sub.2CO.sub.3,
and the optical density was measured at 420 nm. Assay mixture
incubated without cell extract was used as a control. The linear
range of the reaction was determined to be between 0.1-0.8
OD.sub.420. One unit of .beta.-galactosidase activity is defined as
the amount of enzyme that will hydrolyse 3 nmoles of
o-nitrophenyl-.beta.-D-galactopyra- noside in 1 minute at
37.degree. C.
[0415] d. Preparation of Cell Extract for Hygromycin
Phosphotransferase Assay
[0416] Cells were washed as described above and resuspended into 20
mM Hepes buffer, pH 7.3, 100 mM potassium acetate, 5 mM Mg acetate
and 2 mM dithiothreitol). Cells were disrupted at 0.degree. C. by
six 10 sec bursts in an MSE ultrasonic disintegrator using a
microtip probe. Cells were allowed to cool for 1 min after each
ultrasonic burst. The extracts were clarified by centrifuging for 1
min at 2000 rpm in a microcentrifuge.
[0417] e. Hygromycin Phosphotransferase Assay
[0418] Enzyme activity was measured by means of the
phosphocellulose paper binding assay as described by Haas and
Dowding [(1975). Meth. Enzymol. 43:611-6281. The cell extract was
upplemented with 0.1 M ammonium chloride and 1 mM
adenosine-.gamma.-.sup.32P-triphosphate (specific activity: 300
Ci/mmol). The reaction was initiated by the addition of 0.1 mg/ml
hygromycin and incubated for increasing time at 37.degree. C. The
reaction was terminated by heating the samples for 5 min at
75.degree. C. in a water bath, and after removing the precipitated
proteins by centrifugation for 5 min in a microcentrifuge, an
aliquot of the supernatant was spotted on a piece of Whatman P-81
phosphocellulose paper (2 cm.sup.2). After 30 sec at room
temperature the papers are placed into 500 ml of hot (75.degree.
C.) distilled water for 3 min. While the radioactive ATP remains in
solution under these conditions, hygromycin phosphate binds
strongly and quantitatively to phosphocellulose. The papers are
rinsed 3 times in 500 ml of distilled water and the bound
radioactivity was measured in toluene scintillation cocktail in a
Beckman liquid scintillation counter. Reaction mixture incubated
without added hygromycin served as a control.
[0419] f. Determination of the Copy-number of the Heterologous
Genes
[0420] DNA was prepared from the H1D3 and mM2C1 cells using
standard purification protocols involving SDS lysis of the cells
followed by Proteinase K treatment and phenol/chloroform
extractions. The isolated DNA was digested with an appropriate
restriction endonuclease, fractionated on agarose gels, blotted to
nylon filters and hybridized with a radioactive probe derived
either from the .beta.-galactosidase or the hygromycin
phosphotransferase genes. The level of hybridization was quantified
in a Molecular Dynamics PhosphorImage Analyzer. To control the
total amount of DNA loaded from the different cells lines, the
filters were reprobed with a single copy gene, and the
hydridization of .beta.-galactosidase and hygromycin
phosphotransferase genes was normalized to the single copy gene
hybridization.
[0421] g. Determination of Protein Concentration
[0422] The total protein content of the cell extracts was measured
by the Bradford colorimetric assay using bovine serum albumin as
standard.
[0423] 2. Characterization of the .beta.-galactosidase and
Hygromycin Phsophotransferase Activity Expressed in H1D3 and mM2C1
Cells
[0424] In order to establish quantative conditions, the most
important kinetic parameters of .beta.-galactosidase and hygromycin
phosphotransferase activity have been studied. The
.beta.-galactosidase activity measured with a colorimetric assay
was linear between the 0.1-0.8 OD.sub.420 range both for the nM2C1
and H1D3 cell lines. The .beta.-galactosidase activity was also
proportional in both cell lines with the amount of protein added to
the reaction mixture within 5-100 .mu.g total protein concentration
range. The hygromycin phosphotransferase activity of nM2C1 and H1D3
cell lines was also proportional with the reaction time or the
total amount of added cell extract under the conditions described
for the .beta.-galactosidase.
[0425] a. Comparison of .beta.-galactosidase Activity of mM2C1 and
H1D3 Cell Lines
[0426] Cell extracts prepared from logarithmically growing mM2C1
and H1D3 cell lines were tested for .beta.-galactosidase activity,
and the specific activities were compared in 10 independent
experiments. The .beta.-galactosidase activity of H1D3 cell
extracts was 440.+-.25 U/mg total protein. Under identical
conditions the .beta.-galactosidase activity of the mM2C1 cell
extracts was 4.8 times lower: 92.+-.13 U/mg total protein.
.beta.-galactosidase activities of highly subconfluent,
subconfluent and nearly confluent cultures of H1D3 and mM2C1 cell
lines were also compared. In these experiments different numbers of
logarithmic H1D3 and mM2C1 cells were seeded in constant volume of
culture medium and grown for 3 days under standard conditions. No
significant difference was found in the .beta.-galactosidase
specific activities of cell cultures grown at different cell
densities, and the ratio of H1D3/mM2C1 .beta.-galactosidase
specific activities was also similar for all three cell densities.
In confluent, stationary cell cultures of H1D3 or mM2C1 cells,
however, the expression of .beta.-galactosidase significantly
decreased due likely to cessation of cell division as a result of
contact inhibition.
[0427] b. Comparison of Hygromycin Phosphotransferase Activity of
H1D3 and mM2C1 Cell Lines
[0428] The bacterial hygromycin phosphotransferase is present in a
membrane-bound form in H1D3 or mM2C1 cell lines. This follows from
the observation that the hygromycin phosphotransferase activity can
be completely removed by high speed centrifugation of these cell
extracts, and the enzyme activity can be recovered by resuspending
the high speed pellet.
[0429] The ratio of the enzyme's specific activity in H1D3 and
mM2C1 cell lines was similar to that of .beta.-galactosidase
activity, i.e., H1D3 cells have 4.1 times higher specific activity
compared with mM2C1 cells.
[0430] c. Hygromycin Phosphotransferase Activity in H1D3 and mM2C1
Cells Grown Under Non-selective Conditions
[0431] The level of expression of the hygromycin phosphotransferase
gene was measured on the basis of quantitation of the specific
enzyme activities in H1D3 and mM2C1 cell lines grown under
non-selective conditions for 30 generations. The absence of
hygromycin in the medium did not influence the expression of the
hygromycin phosphotransferase gene.
[0432] 3. Quantitation of the Number of .beta.-galactosidase and
Hygromycin Phosphotransferase Gene Copies in H1D3 and mM2C1 Cell
Lines
[0433] As described above, the .beta.-galactosidase and hygromycin
phosphotransferase genes are located only within the
megachromosome, or micro-megachromosome in H1D3 and mM2C1 cells.
Quantitative analysis of genomic Southern blots of DNA isolated
from H1D3 and mM2C1 cell lines with the Phosphorlmage Analyzer
revealed that the copy number of .beta.-galactosidase genes
integrated into the megachromosome is approximately 10 times higher
in H1D3 cells than in mM2C1 cells. The copy-number of hygromycin
phosphotransferase genes is approximately 7 times higher in H1D3
cells than in mM2C1 cells.
[0434] 4. Summary and Conclusions of Results of Quantitation of
Heterologous Gene Expression in Cells Containing Megachromosomes or
Derivatives Thereof
[0435] Quantitative determination of .beta.-galactosidase activity
of higher eukaryotic cells (e.g., H1D3 cells) carrying the
bacterial .beta.-galactosidase gene in heterochromatic
megachromosomes confirmed the observed high-level expression of the
integrated bacterial gene detected by cytological staining methods.
It has generally been established in reports of studies of the
expression of foreign genes in transgenic animals that, although
transgene expression shows correct tissue and developmental
specificity, the level of expression is typically low and shows
extensive position-dependent variabliity (i.e., the level of
transgene expression depends on the site of chromosomal
integration). It is has been assumed that the low-level transgene
expression may be due to the absence of special DNA sequences which
can insulate the transgene from the inhibitory effect of the
surrounding chromatin and promote the formation of active chromatin
structure required for efficient gene expression. Several
cis-activing DNA sequence elements have been identified that
abolish this position-dependent variability, and can ensure
high-level expression of the transgene locus activing region (LAR)
sequences in higher eukaryotes and specific chromatin structure
(scs) elements in lower eukaryotes (see, et al. Eissenberg and
Elgin (1991) Trends in Genet. 7:335-340). If these cis-acting DNA
sequences are absent, the level of transgene expression is low and
copy-number independent.
[0436] Although the bacterial .beta.-galactosidase reporter gene
contained in the heterochromatic megachromosomes of H1D3 and mM2C1
cells is driven by a potent eukaryotic promoter-enhancer element,
no specific cis-acting DNA sequence element was designed and
incorporated into the bacterial DNA construct which could function
as a boundary element. Thus, the high-level .beta.-galactosidase
expression measured in these cells is of significance, particularly
because the .beta.-galactosidase gene in the megachromosome is
located in a long, compact heterochromatic environment, which is
known to be able to block gene expression. The megachromosome
appears to contain DNA sequence element(s) in association with the
bacterial DNA sequences that function to override the inhibitory
effect of heterochromatin on gene expression.
[0437] The specificity of the heterologous gene expression in the
megachromosome is further supported by the observation that the
level of .beta.-galactosidase expression is copy-number dependent.
In the H1D3 cell line, which carries a full-size megachromosome,
the specific activity of .beta.-galactosidase is about 5-fold
higher than in mM2C1 cells, which carry only a smaller, truncated
version of the megachromosome. A comparison of the number of
.beta.-galactosidase gene copies in H1D3 and mM2C1 cell lines by
quantitative hybridization techniques confirmed that the expression
of .beta.-galactosidase is copy-number dependent. The number of
integrated .beta.-galactosidase gene copies is approximately
10-fold higher in the H1D3 cells than in mM2C1 cells. Thus, the
cell line containing the greater number of copies of the
.beta.-galactosidase gene also yields higher levels of
.beta.-galactosidase activity, which supports the copy-number
dependency of expression. The copy number dependency of the
.beta.-galactosidase and hygromycin phosphotransferase enzyme
levels in cell lines carrying different derivatives of the
megachromosome indicates that neither the chromatin organization
surrounding the site of integration of the bacterial genes, nor the
heterochromatic environment of the megachromosome suppresses the
expression of the genes.
[0438] The relative amount of .beta.-galactosidase protein
expressed in H1D3 cells can be estimated based on the V.sub.max of
this enzyme [500 for homogeneous, crystallized bacterial
.beta.-galactosidase (Naider et al. (1972) Biochemistry
11:3202-3210)] and the specific activity of H1D3 cell protein. A
V.sub.max of 500 means that the homogeneous .beta.-galactosidase
protein hydrolyzes 500 .mu.moles of substrate per minute per mg of
enzyme protein at 37.degree. C. One mg of total H1D3 cell protein
extract can hydrolyze 1.4 .mu.moles of substrate per minute at
37.degree. C., which means that 0.28% of the protein present in the
H1D3 cell extract is .beta.-galactosidase.
[0439] The hygromycin phosphotransferase is present in a
membrane-bound form in H1D3 and mM2C1 cells. The tendency of the
enzyme to integrate into membranes in higher eukaryotic cells may
be related to its periplasmic localization in prokaryotic cells.
The bacterial hygromycin phosphotransferase has not been purified
to homogeneity; thus, its V.sub.max has not been determined.
Therefore, no estimate can be made on the total amount of
hygromycin phosphotransferase protein expressed in these cell
lines. The 4-fold higher specific activity of hygromycin
phosphotransferase in H1D3 cells as compared to mM2C1 cells,
however, indicates that its expression is also copy number
dependent.
[0440] The constant and high level expression of the
.beta.-galactosidase gene in H1D3 and mM2C1 cells, particularly in
the absence of any selective pressure for the expression of this
gene, clearly indicates the stability of the expression of genes
carried in the heterochromatic megachromosomes. This conclusion is
further supported by the observation that the level of hygromycin
phosphotransferase expression did not change when H1D3 and mM2C1
cells were grown under non-selective conditions. The consistent
high-level, stable, and copy-number dependent expression of
bacterial marker genes clearly indicates that the megachromosome is
an ideal vector system for expression of foreign genes.
EXAMPLE 7
[0441] Summary of Some of the Cell Lines With SATACS and
Minichromosomes That Have Been Constructed
[0442] 1. EC3/7-Derived Cell Lines
[0443] The LMTK.sup.--derived cell line, which is a mouse
fibroblast cell line, was transfected with .lambda.CM8 and
.lambda.gtWESneo DNA [see, EXAMPLE 2] to produce transformed cell
lines. Among these, was was EC3/7, deposited at the European
Collection of Animal cell Culture (ECACC) under Accession No.
90051001 [see, U.S. Pat. No. 5,288,625; see, also Hadlaczky et al.
(1991) Proc. Natl. Acad. Sci. U.S.A. 88:8106-8110 and U.S.
application Ser. No. 08/375,271]. This cell line contains the
dicentric chromosome with the neo-centromere. Recloning and
selection produced cell lines such as EC3/7C5, which are cell lines
with the stable neo-minichromosome and the formerly dicentric
chromosome [see, FIG. 2C].
[0444] 2. KE1-2/4 Cells
[0445] Fusion of EC3/7 with CHO-K20 cells and selection with
G418/HAT produced hybrid cell lines, among these was KE1-214, which
has been deposited with the ECACC under Accession No. 96040924.
KE1-2/4 is a stable cell line that contains the
.lambda.neo-chromosome [see, FIG. 2D; see, also U.S. Pat. No.
5,288,625], produced by E-type amplifications. KE1-2/4 has been
transfected with vectors containing .lambda. DNA, selectable
markers, such as the puromycin-resistance gene, and genes of
interest, such as p53 and the anti-HIV ribozyme gene. These vectors
target the gene of interest into the .lambda.neo-chromosome by
virtue of homologous recombination with the heterologous DNA in the
chromosome.
[0446] 3. C5pMCT53 Cells
[0447] The EC3/7C5 cell line has been co-transfected with pH132,
pCH110 and .lambda. DNA [see, EXAMPLE 2] as well as other
constructs. Various clones and subclones have been selected. For
example transformation with a construct that includes p53 encoding
DNA, produced cells designated C5pMCT53.
[0448] 4. TF1004G24 Cells
[0449] As discussed above, cotransfection of EC3/7C5 cells with
plasmids [pH132, pCH110 available from Pharmacia, see, also Hall et
al. (1983) J. Mol. Appl. Gen. 2:101-1091 and with .lambda. DNA
[.lambda.cl 875 Sam 7 (New England Biolabs)] produced transformed
cells. Among these is TF1004G24, which contains the DNA encoding
the anti-HIV ribozyme in the neo-mini-chromosome. Recloning of
TF1004G24 produced numerous cell lines. Among these is the NHHL24
cell line. This cell line also has the anti-HIV ribozyme in the
neo-minichromosome and expresses high levels of .beta.-gal. It has
been fused with CHO-K20 cells to produce various hybrids.
[0450] 5. TF1004G19-Derived Cells
[0451] Recloning and selection of the TF1004G transformants
produced the cell line TF1004G19, discussed above in EXAMPLE 4,
which contains the unstable sausage chromosome and the
neo-minichromosome. Single cell cloning produced the TF1004G-19C5
[see FIG. 4] cell line, which has a stable sausage chromosome and
the neo-minchromosome. TF1004G-19C5 has been fused with CHO cells
and the hybrids grown under selective conditions to produce the
19C5.times.Ha4 and 19C5.times.Ha3 cell lines [see, EXAMPLE 4] and
others. Recloning of the 19C5.times.Ha3 cell line yielded a cell
line containing a gigachromosome, i.e., cell line 19C5.times.Ha47,
see FIG. 2E. BrdU treatment of 19C5.times.Ha4 cells and growth
under selective conditions [neomycin (G) and/or hygromycin (H)] has
produced hybrid cell lines such as the G3D5 and G4D6 cell lines and
others. G3D5 has the neo-minichromosome and the megachromosome.
G4D6 has only the neo-minichromosome.
[0452] Recloning of 19C5.times.Ha4 cells in H medium produced
numerous clones. Among these is H1D3 [see FIG. 4], which has the
stable megachromosome. Repeated BrdU treatment and recloning of
H1D3 cells has produced the HB31 cell line, which has been used for
transformations with the pTEMPUD, pTEMPU, pTEMPU3, and pCEPUR-132
vectors [see, Examples 12 and 14, below].
[0453] H1D3 has been fused with a CD4.sup.+ Hela cell line that
carries DNA encoding CD4 and neomycin resistance on a plasmid [see,
e.g., U.S. Pat. Nos. 5,413,914, 5,409,810, 5,266,600, 5,223,263,
5,215,914 and 5,144,019, which describe these Hela cells].
Selection with GH has produced hybrids, including H1.times.HE41
[see FIG. 4], which carries the megachromosome and also a single
human chromosome that includes the CD4neo construct. Repeated BrdU
treatment and single cell cloning has produced cell lines with the
megachromosome [cell line 1B3, see FIG. 4]. About 25% of the 1B3
cells have a truncated megachromosome [.about.90-120 Mb]. Another
of these subclones, designated 2C5, was cultured on
hygromycin-containing medium and megachromosome-free cell lines
were obtained and grown in G418-containing medium. Recloning of
these cells yielded cell lines such as IB4 and others that have a
dwarf megachromosome [.about.150-200 Mb], and cell lines, such as
I1C3 and mM2C1, which have a micro-megachromosome [.about.50-90
Mb]. The micro-megachromosome of cell line mM2C1 has no telomeres;
however, if desired, synthetic telomeres, such as those described
and generated herein, may be added to the mM2C1 cell
micro-megachromosomes. Cell lines containing smaller truncated
megachromosomes, such as the mM2C1 cell line containing the
micro-megachromosome, can be used to generate even smaller
megachromosomes, e.g., .about.10-30 Mb in size. This may be
accomplished, for example, by breakage and fragmentation of the
micro-megachromosome in these cells through exposing the cells to
X-ray irradiation, BrdU or telomere-directed in vivo chromosome
fragmentation.
EXAMPLE 8
[0454] Replication of the Megachromosome
[0455] The homogeneous architecture of the megachromomes provides a
unique opportunity to perform a detailed analysis of the
replication of the constitutive heterochromatin.
[0456] A. Materials and Methods
[0457] 1. Culture of Cell Lines
[0458] H1D3 mouse-hamster hybrid cells carrying the megachromosome
[see, EXAMPLE 4] were cultured in F-12 medium containing 10% fetal
calf serum [FCS] and 400 .mu.g/ml Hygromycin B [Calbiochem]. G3D5
hybrid cells [see, Example 4] were maintained in F-12 medium
containing 10% FCS, 400 .mu.g/ml Hygromycin B (Calbiochem), and 400
.mu.g/ml G418 [SIGMA]. Mouse A9 fibroblast cells were cultured in
F-12 medium supplemented with 10% FCS.
[0459] 2. BrdU Labelling
[0460] In typical experiments, 20-24 parallel semi-confluent cell
cultures were set up in 10 cm Petri dishes. Bromodeoxyuridine
(BrdU) (Fluka) was dissolved in distilled water alkalized with a
drop of NaOH, to make a 10.sup.-2 M stock solution. Aliquots of
10-50 .mu.l of this BrdU stock solution were added to each 10 ml
culture, to give a final BrdU concentration of 10-50 .mu.M. The
cells were cultured in the presence of BrdU for 30 min, and then
washed with warm complete medium, and incubated without BrdU until
required. At this point, 5 .mu.g/ml colchicine was added to a
sample culture every 1 or 2 h. After 1-2 h colchicine treatment,
mitotic cells were collected by "shake-off" and regular chromosome
preparations were made for immunolabelling.
[0461] 3. Immunolabelling of Chromosomes and in situ
Hybridization
[0462] Immunolabelling with fluorescein-conjugated anti-BrdU
monoclonal antibody (Boehringer) was done according to the
manufacturer's recommendations, except that for mouse A9
chromosomes, 2 M hydrochloric acid was used at 37.degree. C. for 25
min, while for chromosomes of hybrid cells, 1 M hydrochloric acid
was used at 37.degree. C. for 30 min. In situ hybridization with
biotin-labelled probes, and indirect immunofluorescence and in situ
hybridization on the same preparation, were performed as described
previously [Hadlaczky et al. (1991) Proc. Natl. Acad. Sci. U.S.A.
88:8106-8110, see, also U.S. Pat. No. 5,288,625].
[0463] 4. Microscopy
[0464] All observations and microphotography were made by using a
Vanox AHBS (Olympus) microscope. Fujicolor 400 Super G or Fujicolor
1600 Super HG high-speed colour negatives were used for
photographs.
[0465] B. Results
[0466] The replication of the megachromosome was analyzed by BrdU
pulse labelling followed by immunolabelling. The basic parameters
for DNA labelling in vivo were first established. Using a 30-min
pulse of 50 .mu.M BrdU in parallel cultures, samples were taken and
fixed at 5 min intervals from the beginning of the pulse, and every
15 min up to 1 h after the removal of BrdU. Incorporated BrdU was
detected by immunolabelling with fluorescein-conjugated anti-BrdU
monoclonal antibody. At the first time point (5 min) 38% of the
nuclei were labelled, and a gradual increase in the number of
labelled nuclei was observed during incubation in the presence of
BrdU, culminating in 46% in the 30-min sample, at the time of the
removal of BrdU. At further time points (60, 75, and 90 min) no
significant changes were observed, and the fraction of labelled
nuclei remained constant [44.5-46%].
[0467] These results indicate that (i) the incorporation of the
BrdU is a rapid process, (ii) the 30 min pulse-time is sufficient
for reliable labelling of S-phase nuclei, and (iii) the BrdU can be
effectively removed from the cultures by washing.
[0468] The length of the cell cycle of the H1D3 and G3D5 cells was
estimated by measuring the time between the appearance of the
earliest BrdU signals on the extreme late replicating chromosome
segments and the appearance of the same pattern only on one of the
chromatids of the chromosomes after one completed cell cycle. The
length of G2 period was determined by the time of the first
detectable BrdU signal on prophase chromosomes and by the labelled
mitoses method [Qastler et al. (1959) Exp. Cell Res. 17:420-438].
The length of the S-phase was determined in three ways: (i) on the
basis of the length of cell cycle and the fraction of nuclei
labelled during the 30-120 min pulse; (ii) by measuring the time
between the very end of the replication of the extreme late
replicating chromosomes and the detection of the first signal on
the chromosomes at the beginning of S phase; (iii) by the labelled
mitoses method. In repeated experiments, the duration of the cell
cycle was found to be 22-26 h, the S phase 10-14 h, and the G2
phase 3.5-4.5 h.
[0469] Analyses of the replication of the megachromosome were made
in parallel cultures by collecting mitotic cells at two hour
intervals following two hours of coichicine treatment. In a repeat
experiment, the same analysis was performed using one hour sample
intervals and one hour coichicine treatment. Although the two
procedures gave comparable results, the two hour sample intervals
were viewed as more appropriate since approximately 30% of the
cells were found to have a considerably shorter or longer cell
cycle than the average. The characteristic replication patterns of
the individual chromosomes, especially some of the late replicating
hamster chromosomes, served as useful internal markers for the
different stages of S-phase. To minimize the error caused by the
different lengths of cell cycles in the different experiments,
samples were taken and analyzed throughout the whole cell cycle
until the appearance of the first signals on one chromatid at the
beginning of the second S-phase.
[0470] The sequence of replication in the megachromosome is as
follows. At the very beginning of the S-phase, the replication of
the megachromosome starts at the ends of the chromosomes. The first
initiation of replication in an interstitial position can usually
be detected at the centromeric region. Soon after, but still in the
first quarter of the S-phase, when the terminal region of the short
arm has almost completed its replication, discrete initiation
signals appear along the chromosome arms. In the second quarter of
the S-phase, as replication proceeds, the BrdU-labelled zones
gradually widen, and the checkered pattern of the megachromosome
becomes clear (see, e.g., FIG. 2F]. At the same time, pericentric
regions of mouse chromosomes also show intense incorporation of
BrdU. The replication of the megachromosome peaks at the end of the
second quarter and in the third quarter of the S-phase. At the end
of the third quarter, and at the very beginning of the last quarter
of the S-phase, the megachromosome and the pericentric
heterochromatin of the mouse chromosomes complete their
replication. By the end of S-phase, only the very late replicating
segments of mouse and hamster chromosomes are still incorporating
BrdU.
[0471] The replication of the whole genome occurs in distinct
phases. The signal of incorporated BrdU increased continuously
until the end of the first half of the S-phase, but at the
beginning of the third quarter of the S-phase chromosome segments
other than the heterochromatic regions hardly incorporated BrdU. In
the last quarter of the S-phase, the BrdU signals increased again
when the extreme late replicating segments showed very intense
incorporation.
[0472] Similar analyses of the replication in mouse A9 cells were
performed as controls. To increase the resolution of the
immunolabelling pattern, pericentric regions of A9 chromosomes were
decondensed by treatment with Hoechst 33258. Because of the intense
replication of the surrounding euchromatic sequences, precise
localization of the initial BrdU signal in the heterochromatin was
normally difficult, even on undercondensed mouse chromosomes. On
those chromosomes where the initiation signal(s) were localized
unambiguously, the replication of the pericentric heterochromatin
of A9 chromosomes was similar to that of the megachromosome.
Chromosomes of A9 cells also exhibited replication patterns and
sequences similar to those of the mouse chromosomes in the hybrid
cells. These results indicate that the replicators of the
megachromosome and mouse chromosomes retained their original timing
and specificity in the hybrid cells.
[0473] By comparing the pattern of the initiation sites obtained
after BrdU incorporation with the location of the integration sites
of the "foreign" DNA in a detailed analysis of the first quarter of
the S-phase, an attempt was made to identify origins of replication
(initiation sites) in relation to the amplicon structure of the
megachromosome. The double band of integrated DNA on the long arm
of the megachromosome served as a cytological marker. The results
showed a colocalization of the BrdU and in situ hybridization
signals found at the cytological level, indicating that the
"foreign" DNA sequences are in close proximity to the origins of
replication, presumably integrated into the non-satellite sequences
between the replicator and the satellite sequences [see, FIG. 3].
As described in Example 6.B.4, the rDNA sequences detected in the
megachromosome are also localized at the amplicon borders at the
site of integration of the "foreign" DNA sequences, suggesting that
the origins of replication responsible for initiation of
replication of the megachromosome involve rDNA sequences. In the
pericentric region of several other chromosomes, dot-like BrdU
signals can also be observed that are comparable to the initiation
signals on the megachromosome. These signals may represent similar
initiation sites in the heterochromatic regions of normal
chromosomes.
[0474] At a frequency of 10.sup.-4, "uncontrolled" amplification of
the integrated DNA sequences was observed in the megachromosome.
Consistent with the assumption (above) that "foreign" sequences are
in proximity of the replicators, this spatially restricted
amplification is likely to be a consequence of uncontrolled
repeated firings of the replication origin(s) without completing
the replication of the whole segment.
[0475] C. Discussion
[0476] It has generally been thought that the constitutive
heterochromatin of the pericentric regions of chromosomes is late
replicating [see, e.g., Miller (1976) Chromosoma 55:165-170]. On
the contrary, these experiments evidence that the replication of
the heterochromatic blocks starts at a discrete initiation site in
the first half of the S-phase and continues through approximately
three-quarters of S-phase. This difference can be explained in the
following ways: (i) in normal chromosomes, actively replicating
euchromatic sequences that surround the satellite DNA obscure the
initiation signals, and thus the precise localization of initiation
sites is obscured; (ii) replication of the heterochromatin can only
be detected unambiguously in a period during the second half of the
S-phase, when the bulk of the heterochromatin replicates and most
other chromosomal regions have already completed their replication,
or have not yet started it. Thus, low resolution cytological
techniques, such as analysis of incorporation of radioactively
labelled precursors by autoradiography, only detect prominent
replication signals in the heterochromatin in the second half of
S-phase, when adjacent euchromatic segments are no longer
replicating.
[0477] In the megachromosome, the primary initiation sites of
replication colocalize with the sites where the "foreign" DNA
sequences and rDNA sequences are integrated at the amplicon
borders. Similar initiation signals were observed at the same time
in the pericentric heterochromatin of some of the mouse chromosomes
that do not have "foreign" DNA, indicating that the replication
initiation sites at the borders of amplicons may reside in the
non-satellite flanking sequences of the satellite DNA blocks. The
presence of a primary initiation site at each satellite DNA doublet
implies that this large chromosome segment is a single huge unit of
replication [megareplicon] delimited by the primary initiation site
and the termination point at each end of the unit. Several lines of
evidence indicate that, within this higher-order replication unit,
"secondary" origins and replicons contribute to the complete
replication of the megareplicon:
[0478] 1. The total replication time of the heterochromatic regions
of the megachromosome was .about.9-11 h. At the rate of movement of
replication forks, 0.5-5 kb per minute, that is typical of
eukaryotic chromosomes [Kornberg et al. (1992) DNA Replication.
2nd. ed., New York: W. H. Freeman and Co, p. 474], replication of a
.about.15 Mb replicon would require 50-500 h. Alternatively, if
only a single replication origin was used, the average replication
speed would have to be 25 kb per minute to complete replication
within 10 h. By comparing the intensity of the BrdU signals on the
euchromatic and the heterochromatic chromosome segments, no
evidence for a 5- to 50-fold difference in their replication speed
was found.
[0479] 2. Using short BrdU pulse labelling, a single origin of
replication would produce a replication band that moves along the
replicon, reflecting the movement of the replication fork. In
contrast, a widening of the replication zone that finally gave rise
to the checkered pattern of the megachromosome was observed, and
within the replication period, the most intensive BrdU
incorporation occurred in the second half of the S-phase. This
suggests that once the megareplicator has been activated, it
permits the activation and firing of "secondary" origins, and that
the replication of the bulk of the satellite DNA takes place from
these "secondary" origins during the second half of the S-phase.
This is supported by the observation that in certain stages of the
replication of the megachromosome, the whole amplicon can
apparently be labelled by a short BrdU pulse.
[0480] Megareplicators and secondary replication origins seem to be
under strict temporal and spatial control. The first initiation
within the megachromosomes usually occurred at the centromere, and
shortly afterward all the megareplicators become active. The last
segment of the megachromosome to complete replication was usually
the second segment of the long arm. Results of control experiments
with mouse A9 chromosomes indicate that replication of the
heterochromatin of mouse chromosomes corresponds to the replication
of the megachromosome amplicons. Therefore, the pre-existing
temporal control of replication in the heterochromatic blocks is
preserved in the megachromosome. Positive [Hassan et al. (1994) J.
Cell. Sci. 107:425-434] and negative [Haase et al. (1994) Mol.
Cell. Biol. 14:2516-2524] correlations between transcriptional
activity and initiation of replication have been proposed. In the
megachromosome, transcription of the integrated genes seems to have
no effect on the original timing of the replication origins. The
concerted, precise timing of the megareplicator initiations in the
different amplicons suggests the presence of specific, cis-acting
sequences, origins of replication.
[0481] Considering that pericentric heterochromatin of mouse
chromosomes contains thousands of short, simple repeats spanning
7-15 Mb, and the centromere itself may also contain hundreds of
kilobases, the existence of a higher-order unit of replication
seems probable. The observed uncontrolled intrachromosomal
amplification restricted to a replication initiation region of the
megachromosome is highly suggestive of a rolling-circle type
amplification, and provides additional evidence for the presence of
a replication origin in this region.
[0482] The finding that a specific replication initiation site
occurs at the boundaries of amplicons suggests that replication
might play a role in the amplification process. These results
suggest that each amplicon of the megachromosome can be regarded as
a huge megareplicon defined by a primary initiation site
[megareplicator] containing "secondary" origins of replication.
Fusion of replication bubbles from different origins of
bi-directional replication [DePamphilis (1993) Ann. Rev. Biochem.
62:29-63] within the megareplicon could form a giant replication
bubble, which would correspond to the whole megareplicon. In the
light of this, the formation of megabase-size amplicons can be
accommodated by a replication-directed amplification mechanism. In
H and E-type amplifications, intrachromosomal multiplication of the
amplicons was observed [see, above EXAMPLES], which is consistent
with the unequal sister chromatid exchange model. Induced or
spontaneous unscheduled replication of a megareplicon in the
constitutive heterochromatin may also form new amplicon(s) leading
to the expansion of the amplification or to the heterochromatic
polymorphism of "normal" chromosomes. The "restoration" of the
missing segment on the long arm of the megachromosome may well be
the result of the re-replication of one amplicon limited to one
strand.
[0483] Taken together, without being bound by any theory, a
replication-directed mechanism is a plausible explanation for the
initiation of large-scale amplifications in the centromeric regions
of mouse chromosomes, as well as for the de novo chromosome
formations. If specific [amplificator, i.e., sequences controlling
amplification] sequences play a role in promoting the amplification
process, sequences at the primary replication initiation site
[megareplicator] of the megareplicon are possible candidates.
[0484] The presence of rRNA gene sequence at the amplicon borders
near the foreign DNA in the megachromosome suggests that this
sequence contributes to the primary replication initiation site and
participates in large-scale amplification of the pericentric
heterochromatin in de novo formation of SATACs. Ribosomal RNA genes
have an intrinsic amplification mechanism that provides for
multiple copies of tandem genes. Thus, for purposes herein, in the
construction of SATACs in cells, rDNA will serve as a region for
targeted integration, and as components of SATACs constructed in
vitro.
EXAMPLE 9
[0485] Generation of Chromosomes With Amplified Regions Derived
From Mouse Chromosome 1
[0486] To show that the events described in EXAMPLES 2-7 are not
unique to mouse chromosome 7 and to show that the EC7/3 cell line
is not required for formation of the artificial chromosomes, the
experiments have been repeated using different initial cell lines
and DNA fragments. Any cell or cell line should be amenable to use
or can readily be determined that it is not.
[0487] A. Materials
[0488] The LP11 cell line was produced by the "scrape-loading"
transfection method [Fechheimer et al. (1987) Proc. Natl. Acad.
Sci. U.S.A. 84:8463-8467] using 25 .mu.g plasmid DNA for
5.times.10.sup.6 recipient cells. LP11 cells were maintained in
F-12 medium containing 3-15 /.mu.g/ml Puromycin [SIGMA].
[0489] B. Amplification in LP11 cells
[0490] The large-scale amplification described in the above
Examples is not restricted to the transformed EC3/7 cell line or to
the chromosome 7 of mouse. In an independent transformation
experiment, LMTK.sup.- cells were transfected using the calcium
phosphate precipitation procedure with a selectable
puromycin-resistance gene-containing construct designated pPuroTel
[see Example 1.E.2. for a description of this plasmid], to
establish cell line LP11. Cell line LP11 carries chromosome(s) with
amplified chromosome segments of different lengths [.about.150-600
Mb]. Cytological analysis of the LP11 cells indicated that the
amplification occurred in the pericentric region of the long arm of
a submetacentric chromosome formed by Robertsonian translocation.
This chromosome arm was identified by G-banding as chromosome 1.
C-banding and in situ hybridization with mouse major satellite DNA
probe showed that an E-type amplification had occurred: the newly
formed region was composed of an array of euchromatic chromosome
segments containing different amounts of heterochromatin. The size
and C-band pattern of the amplified segments were heterogeneous. In
several cells, the number of these amplified units exceeded 50;
single-cell subclones of LP11 cell lines, however, carry stable
marker chromosomes with 10-15 segments and constant C-band
patterns.
[0491] Sublines of the thymidine kinase-deficient LP11 cells (e.g.,
LP11-15P 1C5/7 cell line) established by single-cell cloning of
LP11 cells were transfected with a thymidine kinase gene construct.
Stable TK.sup.+ transfectants were established.
EXAMPLE 10
[0492] Isolation of SATACS and Other Chromosomes With Atypical Base
Content and/or Size
[0493] I. Isolation of Artificial Chromosomes From Endogenous
Chromosomes
[0494] Artificial chromosomes, such as SATACs, may be sorted from
endogenous chromosomes using any suitable procedures, and typically
involve isolating metaphase chromosomes, distinguishing the
artificial chromosomes from the endogenous chromosomes, and
separating the artificial chromosomes from endogenous chromosomes.
Such procedures will generally include the following basic steps:
(1) culture of a sufficient number of cells (typically about
2.times.10.sup.7 mitotic cells) to yield, preferably on the order
of 1.times.10.sup.6 artificial chromosomes, (2) arrest of the cell
cycle of the cells in a stage of mitosis, preferrably metaphase,
using a mitotic arrest agent such as colchicine, (3) treatment of
the cells, particularly by swelling of the cells in hypotonic
buffer, to increase susceptibility of the cells to disruption, (4)
by application of physical force to disrupt the cells in the
presence of isolation buffers for stabilization of the released
chromosomes, (5) dispersal of chromosomes in the presence of
isolation buffers for stabilization of free chromosomes, (6)
separation of artificial from endogenous chromosomes and (7)
storage (and shipping if desired) of the isolated artificial
chromosomes in appropriate buffers. Modifications and variations of
the general procedure for isolation of artificial chromosomes, for
example to accommodate different cell types with differing growth
characteristics and requirements and to optimize the duration of
mitotic block with arresting agents to obtain the desired balance
of chromosome yield and level of debris, may be empirically
determined.
[0495] Steps 1-5 relate to isolation of metaphase chromosomes. The
separation of artificial from endogenous chromosomes (step 6) may
be accomplished in a variety of ways. For example, the chromosomes
may be stained with DNA-specific dyes such as Hoeschst 33258 and
chromomycin A.sub.3 and sorted into artificial and endogenous
chromosomes on the basis of dye content by employing
fluorescence-activated cell sorting (FACS). To facilitate larger
scale isolation of the artificial chromosomes, different separation
techiniques may be employed such as swinging bucket centrifugation
(to effect separation based on chromosome size and density) [see,
e.g., Mendelsohn et al. (1968) J. Mol. Biol. 32:101-108], zonal
rotor centrifugation (to effect separation on the basis of
chromosome size and density) [see, e.g., Burki et al. (1973) Prep.
Biochem. 3:157-182; Stubblefield et al. (1978) Biochem. Biophys.
Res. Commun. 83:1404-1414, velocity sedimentation (to effect
separation on the basis of chromosome size and shape) [see e.g.,
Collard et al. (1984) Cytometry 5:9-19]. Immuno-affinity
purification may also be employed in larger scale artificial
chromosome isolation procedures. In this process, large populations
of artificial chromosome-containing cells (asynchronous or
mitotically enriched) are harvested en masse and the mitotic
chromosomes (which can be released from the cells using standard
procedures such as by incubation of the cells in hypotonic buffer
and/or detergent treatment of the cells in conjunction with
physical disruption of the treated cells) are enriched by binding
to antibodies that are bound to solid state matrices (e.g. column
resins or magnetic beads). Antibodies suitable for use in this
procedure bind to condensed centromeric proteins or condensed and
DNA-bound histone proteins. For example, autoantibody LU851 (see
Hadlaczky et al. (1989) Chromosoma 97:282-288), which recognizes
mammalian centromeres may be used for large-scale isolation of
chromosomes prior to subsequent separation of artificial from
endogenous chromosomes using methods such as FACS. The bound
chromosomes would be washed and eventually eluted for sorting.
Immunoaffinity purification may also be used directly to separate
artificial chromosomes from endogenous chromosomes. For example,
SATACs may be generated in or transferred to (e.g., by
microinjection or microcell fusion as described herein) a cell line
that has chromosomes that contain relatively small amounts of
heterochromatin, such as hamster cells (e.g., V79 cells or CHO-K1
cells). The SATACs, which are predominantly heterochromatiri, are
then separated from the endogenous chromosomes by utilizing
anti-heterochromatin binding protein (Drosophila HP-1) antibody
conjugated to a solid matrix. Such matrix preferentially binds
SATACs relative to hamster chromosomes. Unbound hamster chromosomes
are washed away from the matrix and the SATACs are eluted by
standard techniques.
[0496] A. Cell Lines and Cell Culturing Procedures
[0497] In one isolation procedure, 1B3 mouse-hamster-human hybrid
cells [see, FIG. 4] carrying the megachromosome or the truncated
megachromosome were grown in F-12 medium supplemented with 10%
fetal calf serum, 150 .mu.g/ml hygromycin B and 400 .mu.g/ml G418.
GHB42 [a cell line recloned from G3D5 cells] mouse-hamster hybrid
cells carrying the megachromosome and the minichromosome were also
cultured in F-12 medium containing 10% fetal calf serum, 150
.mu.g/ml hygromycin B and 400 .mu.g/ml G418. The doubling time of
both cell lines was about 24-40 hours, typically about 32
hours.
[0498] Typically, cell monolayers are passaged when they reach
about 60-80% confluence and are split every 48-72 hours. Cells that
reach greater than 80% confluence senesce in culture and are not
preferred for chromosome harvesting. Cells may be plated in 100-200
100-mm dishes at about 50-70% confluency 12-30 hours before mitotic
arrest (see, below).
[0499] Other cell lines that may be used as hosts for artificial
chromosomes and from which the artificial chromosomes may be
isolated include, but are not limited to, PtK1 (NBL-3) marsupial
kidney cells (ATCC accession no. CCL35), CHO-K1 Chinese hamster
ovary cells (ATCC accession no. CCL61), V79-4 Chinese hamster lung
cells (ATCC accession no. CCL93), Indian muntjac skin cells (ATCC
accession no. CCL157), LMTK(-) thymidine kinase deficient murine L
cells (ATCC accession no. CCL1.3), Sf9 fall armyworm (Spodoptera
frugiperda) ovary cells (ATCC accession no. CRL 1711) and any
generated heterokaryon (hybrid) cell lines, such as, for example,
the hamster-murine hybrid cells described herein, that may be used
to construct MACs, particularly SATACs.
[0500] Cell lines may be selected, for example, to enhance
efficiency of artificial chromosome production and isolation as may
be desired in large-scale production processes. For instance, one
consideration in selecting host cells may be the artificial
chromosome-to-total chromosome ratio of the cells. To facilitate
separation of artificial chromosomes from endogenous chromosomes, a
higher artificial chromosome-to-total chromosome ratio might be
desirable. For example, for H1D3 cells (a murine/hamster
heterokaryon; see FIG. 4), this ratio is 1:50, i.e., one artificial
chromosome (the megachromosome) to 50 total chromosomes. In
contrast, Indian muntjac skin cells (ATCC accession no. CCL157)
contain a smaller total number of chromosomes (a diploid number of
chromosomes of 7), as do kangaroo rat cells (a diploid number of
chromosomes of 12) which would provide for a higher artificial
chromosome-to-total chromosome ratio upon introduction of, or
generation of, artificial chromosomes in the cells.
[0501] Another consideration in selecting host cells for production
and isolation of artificial chromosomes may be size of the
endogenous chromosomes as compared to that of the artificial
chromosomes. Size differences of the chromosomes may be exploited
to facilitate separation of artificial chromosomes from endogenous
chromosomes. For example, because Indian muntjac skin cell
chromosomes are considerably larger than minichromosomes and
truncated megachromosomes, separation of the artificial chromosome
from the muntjac chromosomes may possibly be accomplished using
univariate (one dye, either Hoechst 33258 or Chromomycin A3) FACS
separation procedures.
[0502] Another consideration in selecting host cells for production
and isolation of artificial chromosomes may be the doubling time of
the cells. For example, the amount of time required to generate a
sufficient number of artificial chromosome-containing cells for use
in procedures to isolate artificial chromosomes may be of
significance for large-scale production. Thus, host cells with
shorter doubling times may be desirable. For instance, the doubling
time of V79 hamster lung cells is about 9-10 hours in comparison to
the approximately 32-hour doubling time of H1D3 cells.
[0503] Accordingly, several considerations may go into the
selection of host cells for the production and isolation of
artificial chromosomes. It may be that the host cell selected as
the most desirable for de novo formation of artificial chromosomes
is not optimized for large-scale production of the artificial
chromosomes generated in the cell line. In such cases, it may be
possible, once the artificial chromosome has been generated in the
initial host cell line, to transfer it to a production cell line
more well suited to efficient, high-level production and isolation
of the artificial chromosome. Such transfer may be accomplished
through several methods, for example through microcell fusion, as
described herein, or microinjection into the production cell line
of artificial chromosomes purified from the generating cell line
using procedures such as described herein. Production cell lines
preferably contain two or more copies of the artificial artificial
chromosome per cell.
[0504] B. Chromosome Isolation
[0505] In general, cells are typically cultured for two generations
at exponential growth prior to mitotic arrest. To accumulate
mitotic 1B3 and GHB42 cells in one particular isolation procedure,
5 .mu.g/ml colchicine was added for 12 hours to the cultures. The
mitotic index obtained was 60-80%. The mitotic cells were harvested
by selective detachment by gentle pipetting of the medium on the
monolayer cells. It is also possible to utilize mechanical
shake-off as a means of releasing the rounded-up (mitotic) cells
from the plate. The cells were sedimented by centrifugation at
200.times.g for 10 minutes.
[0506] Cells (grown on plastic or in suspension) may be arrested in
different stages of the cell cycle with chemical agents other than
colchicine, such as hydroxyurea, vinblastine, colcemid or
aphidicolin. Chemical agents that arrest the cells in stages other
than mitosis, such as hydroxyurea and aphidicolin, are used to
synchronize the cycles of all cells in the population and then are
removed from the cell medium to allow the cells to proceed, more or
less simultaneously, to mitosis at which time they may be harvested
to disperse the chromosomes. Mitotic cells could be enriched for a
mechanical shake-off (adherent cells). The cell cycles of cells
within a population of MAC-containing cells may also be
synchronized by nutrient, growth factor or hormone deprivation
which leads to an accumulation of cells in the G.sub.1 or G.sub.0
stage; readdition of nutrients or growth factors then allows the
quiescent cells to re-enter the the cell cycle in synchrony for
abot one generation. Cell lines that are known to respond to
hormone deprivation in this manner, and which are suitable as hosts
for artificial chromosomes, include the Nb2 rat lymphoma cell line
which is absolutely dependent on prolactin for stimulation of
proliferation (see Gout et al. (1980) Cancer Res. 40:2433-2436).
Culturing the cells in prolactin-deficient medium for 18-24 hours
leads to arrest of proliferation, with cells accumulating early in
the G.sub.1 phase of the cell cycle. Upon addition of prolactin,
all the cells progress through the cell cycle until M phase at
which point greater than 90% of the cells would be in mitosis
(addition of colchicine could increase the amount of the mitotic
cells to greater than 95%). The time between reestablishing
proliferation by prolactin addition and harvesting mitotic cells
for chromosome separation may be empirically determined.
[0507] Alternatively, adherent cells, such as V79 cells, may be
grown in roller bottles and mitotic cells released from the plastic
surface by rotating the roller bottles at 200 rpm or greater
(Shwarchuk et al. (1993) Int. J. Radiat. Biol. 64:601-612). At any
given time, approximately 1% of the cells in an exponentially
growing asynchronous population is in M-phase. Even without the
addition of colchicine, 2.times.10.sup.7 mitotic cells have been
harvested from four 1750-cm.sup.2 roller bottles after a 5-min spin
at 200 rpm. Addition of colchicine for 2 hours may increase the
yield to 6.times.10.sup.8 mitotic cells.
[0508] Several procedures may be used to isolate metaphase
chromosomes from these cells, including, but not limited to, one
based on a polyamine buffer system [Cram et al. (1990) Methods in
Cell Biology 33:377-382], one on a modified hexylene glycol buffer
system [Hadlaczky et al. (1982) Chromosoma 86:643-65], one on a
magnesium sulfate buffer system [Van den Engh et al. (1988)
Cytometry 9:266-270 and Van den Engh et al. (1984) Cytometry
5:108], one on an acetic acid fixation buffer system [Stoehr et al.
(1982) Histochemistry 74:57-61], and one on a technique utilizing
hypotonic KCl and propidium iodide [Cram et al. (1994) XVII meeting
of the International Society for Analytical Cytology, October
16-21, Tutorial IV Chromosome Analysis and Sorting with Commerical
Flow Cytometers; Cram et al. (1990) Methods in Cell Biology
33:376].
[0509] 1. Polyamine Procedure
[0510] In the polyamine procedure that was used in isolating
artificial chromosomes from either 1B3 or GHB42 cells, about
10.sup.7 mitotic cells were incubated in 10 ml hypotonic buffer (75
mM KCl, 0.2 mM spermine, 0.5 mM spermidine) for 10 minutes at room
temperature to swell the cells. The cells are swollen in hypotonic
buffer to loosen the metaphase chromosomes but not to the point of
cell lysis. The cells were then centrifuged at 100.times.g for 8
minutes, typically at room temperature. The cell pellet was drained
carefully and about 10.sup.7 cells were resuspended in 1 ml
polyamine buffer [15 mM Tris-HCl, 20 mM NaCl, 80 mM KCl, 2 mM EDTA,
0.5 mM EGTA, 14 mM fl-mercaptoethanol, 0.1% digitonin, 0.2 mM
Spermine, 0.5 mM spermidine] for physical dispersal of the
metaphase chromosomes. Chromosomes were then released by gently
drawing the cell suspension up and expelling it through a 22 G
needle attached to a 3 ml plastic syringe. The chromosome
concentration was about 1-3.times.108 chromosomes/ml.
[0511] The polyamine buffer isolation protocol is well suited for
obtaining high molecular weight chromosomal DNA [Sillar and Young
(1981) J. Histochem. Cytochem. 29:74-78; VanDilla et al. (1986)
Biotechnology 4:537-552; Bartholdi et al. (1988) In "Molecular
Genetics of Mammalian Cells" (M. Goettsman, ed.), Methods in
Enzymology 151:252-267. Academic Press, Orlando]. The chromosome
stabilizing buffer uses the polyamines spermine and spermidine to
stabilize chromosome structure [Blumenthal et al. (1979) J. Cell
Biol. 81:255-259; Lalande et al. (1985) Cancer Genet. Cytogenet.
23:151-157] and heavy metals chelators to reduce nuclease
activity.
[0512] The polyamine buffer protocol has wide applicability,
however, as with other protocols, the following variables must be
optimized for each cell type: blocking time, cell concentration,
type of hypotonic swelling buffer, swelling time, volume of
hypotonic buffer, and vortexing time. Chromosomes prepared using
this protocol are typically highly condensed.
[0513] There are several hypotonic buffers that may be used to
swell the cells, for example buffers such as the following: 75 mM
KCl; 75 mM KCl, 0.2 mM spermine, 0.5 mM spermidine; Ohnuki's buffer
of 16.2 mM sodium nitrate, 6.5 mM sodium acetate, 32.4 mM KCl
[Ohnuki (1965) Nature 208:916-917 and Ohnuki (1968) Chromosoma
25:402-428]; and a variation of Ohnuki's buffer that additionally
contains 0.2 mM spermine and 0.5 mM spermidine. The amount and
hypotonicity of added buffer vary depending on cell type and cell
concentration. Amounts may range from 2.5-5.5 ml per 10.sup.7 cells
or more. Swelling times may vary from 10-90 minutes depending on
cell type and which swelling buffer is used.
[0514] The composition of the polyamine isolation buffer may also
be varied. For example, one modified buffer contains 15 mM
Tris-HCl, pH 7.2, 70 mM NaCl, 80 mM KCl, 2 mM EDTA, 0.5 mM EGTA, 14
mM beta-mercaptoethanol, 0.25% Triton-X, 0.2 mM spermine and 0.5 mM
spermidine.
[0515] Chromosomal dispersal may also be accomplished by a variety
of physical means. For example, cell suspension may be gently drawn
up and expelled in a 3-ml syringe fitted with a 22-gauge needle
[Cram et al. (1990) Methods in Cell Biology 33:377-382], cell
suspension may be agitated on a bench-top vortex [Cram et al.
(1990) Methods in Cell Biology 33:377-382], cell suspension may be
disrupted with a homogenizer [Sillar and Young (1981) J. Histochem.
Cytochem. 29:74-78; Carrano et al. (1979) Proc. Natl. Acad. Sci.
U.S.A. 76:1382-1384] and cell suspension may be disrupted with a
bench-top ultrasonic bath [Stoehr et al. (1982) Histochemistry
74:57-61].
[0516] 2. Hexylene Glycol Buffer System
[0517] In the hexylene glycol buffer procedure that was used in
isolating artificial chromosomes from either 1B3 or GHB42 cells,
about 8.times.10.sup.6 mitotic cells were resuspended in 10 ml
glycine-hexylene glycol buffer [100 mM glycine, 1% hexylene glycol,
pH 8.4-8.6 adjusted with saturated Ca-hydroxide solution] and
incubated for 10 minutes at 37.degree. C., followed by
centrifugation for 10 minutes to pellet the nuclei. The supernatant
was centrifuged again at 200.times.g for 20 minutes to pellet the
chromosomes. Chromosomes were resuspended in isolation buffer
(1-3.times.10.sup.8 chromosomes/ml).
[0518] The hexylene glycol buffer composition may also be modified.
For example, one modified buffer contains 25 mM Tris-HCl, pH 7.2,
750 mM hexylene glycol, 0.5 mM CaCl.sub.2, 1.0 mM MgCl.sub.2
[Carrano et al. (1979) Proc. Natl. Acad. Sci. U.S.A.
76:1382-1384].
[0519] 3. Magnesium-sulfate Buffer System
[0520] This buffer system may be used with any of the methods of
cell swelling and chromosomal dispersal, such as described above in
connection with the polyamine and hexylene glycol buffer systems.
In this procedure, mitotic cells are resuspended in the following
buffer: 4.8 mM HEPES, pH 8.0, 9.8 mM MgSO.sub.4, 48 mM KCl, 2.9 mM
dithiothreitol [Van den Engh et al. (1985) Cytometry 6:92 and Van
den Engh et al. (1984) Cytometry 5:108].
[0521] 4. Acetic Acid Fixation Buffer System
[0522] This buffer system may be used with any of the methods of
cell swelling and chromosomal dispersal, such as described above in
connection with the polyamine and hexylene glycol buffer systems.
In this procedure, mitotic cells are resuspended in the following
buffer: 25 mM Tris-HCl, pH 3.2, 750 mM (1,6)-hexandiol, 0.5 mM
CaCl.sub.2, 1.0% acetic acid [Stoehr et al. (1982) Histochemistry
74:57-61].
[0523] 5. KCl-propidium Iodide Buffer System
[0524] This buffer system may be used with any of the methods of
cell swelling and chromosomal dispersal, such as described above in
connection with the polyamine and hexylene glycol buffer systems.
In this procedure, mitotic cells are resuspended in the following
buffer: 25 mM KCl, 50 .mu.g/ml propidium iodide, 0.33% Triton
X-100, 333 .mu.g/ml RNase [Cram et al. (1990) Methods in Cell
Biology 33:376].
[0525] The fluorescent dye propidium iodide is used and also serves
as a chromosome stabilizing agent. Swelling of the cells in the
hypotonic medium (which may also contain propidium iodide) may be
monitored by placing a small drop of the suspension on a microscope
slide and observing the cells by phase/fluorescent microscopy. The
cells should exclude the propidium iodide while swelling, but some
may lyse prematurely and show chromosome fluorescence. After the
cells have been centrifuged and resuspended in the KCl-propidium
iodide buffer system, they will be lysed due to the presence of the
detergent in the buffer. The chromosomes may then be dispersed and
then incubated at 37.degree. C. for up to 30 minutes to permit the
RNase to act. The chromosome preparation is then analyzed by flow
cytometry. The propidium iodide fluorescence can be excited at the
488 nm wavelength of an argon laser and detected through an OG 570
optical filter by a single photomultiplier tube. The single pulse
may be integrated and acquired in an univariate histogram. The flow
cytometer may be aligned to a CV of 2% or less using small (1.5
.mu.m diameter) microspheres. The chromosome preparation is
filtered through 60 .mu.m nylon mesh before analysis.
[0526] C. Staining of Chromosomes With DNA-specific Dyes
[0527] Subsequent to isolation, the chromosome preparation was
stained with Hoechst 33258 at 6 .mu.g/ml and chromomycin A3 at 200
.mu.g/ml. Fifteen minutes prior to analysis, 25 mM Na-sulphite and
10 mM Na-citrate were added to the chromosome suspension.
[0528] D. Flow Sorting of Chromosomes
[0529] Chromosomes obtained from 1B3 and GHB42 cells and maintained
were suspended in a polyamine-based sheath buffer (0.5 mM EGTA, 2.0
mM EDTA, 80 mM KCl, 70 mM NaCl, 15 mM Tris-HCl, pH 7.2, 0.2 mM
spermine and 0.5 mM spermidine) [Sillar and Young (1981) J.
Histochem. Cytochem. 29:74-78]. The chromosomes were then passed
through a dual-laser cell sorter [FACStar Plus or FAXStar Vantage
Becton Dickinson Immunocytometry System; other dual-laser sorters
may also be used, such as those manufactured by Coulter Electronics
(Elite ESP) and Cytomation (MoFlo)] in which two lasers were set to
excite the dyes separately, allowing a bivariate analysis of the
chromosome by size and base-pair composition. Because of the
difference between the base composition of the SATACs and the other
chromosomes and the resulting difference in interaction with the
dyes, as well as size differences, the SATACs were separated from
the other chromosomes.
[0530] E. Storage of the Sorted Artificial Chromosomes
[0531] Sorted chromosomes may be pelleted by centrifugation and
resuspended in a variety of buffers, and stored at 4.degree. C. For
example, the isolated artificial chromosomes may be stored in GH
buffer (100 mM glycine, 1% hexylene glycol pH 8.4-8.6 adjusted with
saturated Ca-hydroxide solution) [see, e.g., Hadlaczky et al.
(1982) Chromosoma 86:643-659] for one day and embedded by
centrifugation into agarose. The sorted chromosomes were
centrifuged into an agarose bed and the plugs are stored in 500 mM
EDTA at 4.degree. C. Additional storage buffers include
CMB-I/polyamine buffer (17.5 mM Tris-HCl, pH 7.4, 1.1 mM EDTA, 50
mM epsilon-amino caproic acid, 5 mM benzamide-HCl, 0.40 mM
spermine, 1.0 mM spermidine, 0.25 mM EGTA, 40 mM KCl, 35 mM NaCl)
and CMB-II/polyamine buffer (100 mM glycine, pH 7.5, 78 mM hexylene
glycol, 0.1 mM EDTA, 50 mM epsilon-amino caproic acid, 5 mM
benzamide-HCl, 0.40 mM spermine, 1.0 mM spermidine, 0.25 mM EGTA,
40 mM KCl, 35 mM NaCl).
[0532] When microinjection is the intended use, the sorted
chromosomes are stored in 30% glycerol at -20.degree. C. Sorted
chromosomes may also be stored without glycerol for short periods
of time (3-6 days) in storage buffers at 4.degree. C. Exemplary
buffers for microinjection include CBM-I (10 mM Tris-HCl, pH 7.5,
0.1 mM EDTA, 50 mM epsilon-amino caproic acid, 5 mM benzamide-HCl,
0.30 mM spermine, 0.75 mM spermidine), CBM-II (100 mM glycine, pH
7.5, 78 mM hexylene glycol, 0.1 mM EDTA, 50 mM epsilon-amino
caproic acid, 5 mM benzamide-HCl, 0.30 mM spermine, 0.75 mM
spermidine).
[0533] For long-term storage of sorted chromosomes, the above
buffers are preferably supplemented with 50% glycerol and stored at
-20.degree. C.
[0534] F. Quality Control
[0535] 1. Analysis of the Purity
[0536] The purity of the sorted chromosomes was checked by
fluorescence in situ hybridization (FISH) with a biotin-labeled
mouse satellite DNA probe [see, Hadlaczky et al. (1991) Proc. Natl.
Acad. Sci. U.S.A. 88:8106-8110]. Purity of the isolated chromosomes
was about 97-99%.
[0537] 2. Characteristics of the Sorted Chromosomes
[0538] Pulsed field gel electrophoresis and Southern hybridization
were carried out to determine the size distribution of the DNA
content of the sorted artificial chromosomes.
[0539] G. Functioning of the Purified Artificial Chromosomes
[0540] To check whether their activity is preserved, the purified
artificial chromosomes may be microinjected (using methods such as
those described in Example 13) into primary cells, somatic cells
and stem cells which are then analyzed for expression of the
heterologous genes carried by the artificial chromosomes, e.g.,
such as analysis for growth on selective medium and assays of
.beta.-galactosidase activity.
[0541] II. Sorting of Mammalian Artificial Chromosome-containing
Microcells
[0542] A. Micronucleation
[0543] Cells were grown to 80-90% confluency in 4 T150 flasks.
Colcemid was added to a final concentration of 0.06 .mu.g/ml, and
then incubated with the cells at 37.degree. C. for 24 hours.
[0544] B. Enucleation
[0545] Ten .mu.g/ml cytochalasin B was added and the resulting
microcells were centrifuged at 15,000 rpm for 70 minutes at
28-33.degree. C.
[0546] C. Purification of Microcells by Filtration
[0547] The microcells were purified using Swinnex filter units and
Nucleopore filters [5 .mu.m and 3 .mu.m].
[0548] D. Staining and Sorting Microcells
[0549] As above, the cells were stained with Hoechst and
chromomycin A3 dyes. The microcells were sorted by cell sorter to
isolate the microcells that contain the mammalian artificial
chromosomes.
[0550] E. Fusion
[0551] The microcells that contain the artificial chromosome are
fused, for example, as described in Example 1.A.5., to selected
primary cells, somatic cells, embryonic stem cells to generate
transgenic (non-human) animals and for gene therapy purposes, and
to other cells to deliver the chromosomes to the cells.
EXAMPLE 11
[0552] Introduction of Mammalian Artificial Chromosomes Into Insect
Cells
[0553] Insect cells are useful hosts for MACs, particularly for use
in the production of gene products, for a number of reasons,
including:
[0554] 1. A mammalian artificial chromosome provides an
extra-genomic specific integration site for introduction of genes
encoding proteins of interest [reduced chance of mutation in
production system].
[0555] 2. The large size of an artificial chromosome permits
megabase size DNA integration so that genes encoding an entire
pathway leading to a protein or nonprotein of therapeutic value,
such as an alkaloid [digitalis, morphine, taxol] can be accomodated
by the artificial chromosome.
[0556] 3. Amplification of genes encoding useful proteins can be
accomplished in the artificial mammalian chromosome to obtain
higher protein yields in insect cells.
[0557] 4. Insect cells support required post-translational
modifications (glycosylation, phosphorylation) essential for
protein biological function.
[0558] 5. Insect cells do not support mammalian viruses--eliminates
cross-contamination of product with human infectious agents.
[0559] 6. The ability to introduce chromosomes circumvents
traditional recombinant baculovirus systems for production of
nutritional, industrial or medicinal proteins in insect cell
systems.
[0560] 7. The low temperature optimum for insect cell growth
(28.degree. C.) permits reduced energy cost of production.
[0561] 8. Serum free growth medium for insect cells will result in
lower production costs.
[0562] 9. Artificial chromosome-containing cells can be stored
indefinitely at low temperature.
[0563] 10. Insect larvae will serve as biological factories for the
production of nutritional, medicinal or industrial proteins by
microinjection of fertilized insect eggs.
[0564] A. Demonstration That Insect Cells Recognize Mammalian
Promoters
[0565] Gene constructs containing a mammalian promoter, such as the
CMV promoter, linked to a detectable marker gene [Renilla
luciferase gene (see, e.g., U.S. Pat. No. 5,292,658 for a
description of DNA encoding the Renilla luciferase, and plasmid
pTZrLuc-1, which can provide the starting material for construction
of such vectors, see also SEQ ID No. 10]and also including the
simian virus 40 (SV40) promoter operably linked to the
.beta.-galactosidase gene were introduced into the cells of two
species Trichoplusia ni [cabbage looper] and Bombyx mori [silk
worm].
[0566] After transferring the constructs into the insect cell lines
either by electroporation or by microinjection, expression of the
marker genes was detected in luciferase assays (see e.g., Example
12.C.3) and in .beta.-galactosidase assays (such as lacZ staining
assays) after a 24-h incubation. In each case a positive result was
obtained in the samples containing the genes which was absent in
samples in which the genes were omitted. In addition, a B. mori
.beta.-actin promoter-Renilla luciferase gene fusion was introduced
into the T. ni and B. mori cells which yielded light emission after
transfection. Thus, certain mammalian promoters function to direct
expression of these marker genes in insect cells. Therefore, MACs
are candidates for expression of heterologous genes in insect
cells.
[0567] B. Construction of Vectors For Use In Insect Cells and
Fusion With Mammalian Cells
[0568] 1. Transform LMTK.sup.- cells with expression vector
with:
[0569] a. B. mori .beta.-actin promoter--Hyg.sup.r selectable
marker gene for insect cells, and
[0570] b. SV40 or CMV promoters controlling a puromycin.sup.r
selectable marker gene for mammalian cells.
[0571] 2. Detect expression of the mammalian promoter in LMTK cells
(puromycin.sup.r LMTK cells)
[0572] 3. Use puromycin.sup.r cells in fusion experiments with
Bombyx and Trichoplusia cells, select Hyg.sup.r cells.
[0573] C. Insertion of the MACs Into Insect Cells
[0574] These experiments are designed to detect expression of a
detectable marker gene [such as the .beta.-galactosidase gene
expressed under the control of a mammalian promoter, such as
pSV40]located on a MAC that has been introduced into an insect
cell. Data indicate that .beta.-gal was expressed.
[0575] Insect cells are fused with mammalian cells containing
mammalian artificial chromosomes, e.g., the minichromosome
[EC3/7C5] or the mini and the megachromosome [such as GHB42, which
is a cell line recloned from G3D5] or a cell line that carries only
the megachromosome [such as H1D3 or a redone therefrom]. Fusion is
carried out as follows:
[0576] 1. mammalian+insect cells (50/50%) in log phase growth are
mixed;
[0577] 2. calcium/PEG cell fusion: (10 min-0.5 h);
[0578] 3. heterokaryons (+72 h) are selected.
[0579] The following selection conditions to select for insect
cells that contain a MAC can be used: [+=positive selection;
-=negative selection]:
[0580] 1. growth at 28.degree. C. (+insect cells, -mammalian
cells);
[0581] 2. Graces insect cell medium [SIGMA] (-mammalian cells);
[0582] 3. no exogenous CO.sub.2 (-mammalian cells); and/or
[0583] 4. antibiotic selection (Hyg or G418) (+transformed insect
cells).
[0584] Immediately following the fusion protocol, many
heterokaryons [fusion events] are observed between the mammalian
and each species of insect cells [up to 90% heterokaryons]. After
growth [2+ weeks] on insect medium containing G418 and/or
hygromycin at selection levels used for selection of transformed
mammalian cells, individual colonies are detected growing on the
fusion plates. By virtue of selection for the antibiotic resistance
conferred by the MAC and selection for insect cells, these colonies
should contain MACs.
[0585] The B. mori .beta.-actin gene promoter has been shown to
direct expression of the .beta.-galactosidase gene in B. mori cells
and mammalian cells (e.g., EC3/7C5 cells). The B. mori .beta.-actin
gene promoter is, thus, particularly useful for inclusion in MACs
generated in mammalian cells that will subsequently be transferred
into insect cells because the presence of any marker gene linked to
the promoter can be determined in the mammalian and resulting
insect cell lines.
EXAMPLE 12
[0586] Preparation of Chromosome Fragmentation Vectors and Other
Vectors For Targeted Integration of DNA Into MACs
[0587] Fragmentation of the megachromosome should ultimately result
in smaller stable chromosomes that contain about 15 Mb to 50 Mb
that will be easily manipulated for use as vectors. Vectors to
effect such fragmentation should also aid in determination and
identification of the elements required for preparation of an in
vitro-produced artificial chromosome.
[0588] Reduction in the size of the megachromosome can be achieved
in a number of different ways including: stress treatment, such as
by starvation, or cold or heat treatment; treatment with agents
that destabilize the genome or nick DNA, such as BrdU, coumarin,
EMS and others; treatment with ionizing radiation [see, e.g., Brown
(1992) Curr. Opin. Genes Dev. 2:479-486]; and telomere-directed in
vivo chromosome fragmentation [see, e.g., Farr et al. (1995) EMBO
J. 14:5444-5454].
[0589] A. Preparation of Vectors For Fragmentation of the
Artificial Chromosome and Also For Targeted Integration of Selected
Gene Products
[0590] 1. Construction of pTEMPUD
[0591] Plasmid pTEMPUD [see FIG. 5] is a mouse homologous
recombination "killer" vector for in vivo chromosome fragmentation,
and also for inducing large-scale amplification via site-specific
integration. With reference to FIG. 5, the .about.3,625-bp
SalI-PstI fragment was derived from the pBabe-puro retroviral
vector [see, Morgenstern et al. (1990) Nucleic Acids Res.
18:3587-3596]. This fragment contains DNA encoding ampicillin
resistance, the pUC origin of replication, and the puromycin
N-acetyl transferase gene under control of the SV40 early promoter.
The URA3 gene portion comes from the pYAC5 cloning vector [SIGMA].
URA3 was cut out of pYAC5 with SalI-XhoI digestion, cloned into
pNEB193 [New England Biolabs], which was then cut with EcoRI-SalI
and ligated to the SalI site of pBabepuro to produce pPU.
[0592] A 1293-bp fragment [see SEQ ID No. 1] encoding the mouse
major satellite, was isolated as an EcoRI fragment from a DNA
library produced from mouse LMTK.sup.- fibroblast cells and
inserted into the EcoRI site of pPU to produce pMPU.
[0593] The TK promoter-driven diphtheria toxin gene [DT-A] was
derived from pMC1DT-A [see, Maxwell et al. (1986) Cancer Res.
46:4660-4666] by BgIII-XhoI digestion and cloned into the pMC1neo
poly A expression vector [STRATAGENE, La Jolla, Calif.] by
replacing the neomycin-resistance gene coding sequence. The TK
promoter, DT-A gene and poly A sequence were removed from this
vector, cohesive ends were filled with Klenow and the resulting
fragment blunt end-ligated and ligated into the SnaBI [TACGTA] of
pMPU to produce pMPUD.
[0594] The Hutel 2.5-kb fragment [see SEQ ID No.3] was inserted at
the PstI site [see the 6100 PstI-3625 PstI fragment on pTEMPUD] of
pMPUD to produce pTEMPUD. This fragment includes a human telomere.
It includes a unique BgIII site [see nucleotides 1042-1047 of SEQ
ID No.3], which will be used as a site for introduction of a
synthetic telomere that includes multiple repeats [80] of TTAGGG
with BamHI and BqIII ends for insertion into the BgIII site which
will then remain unique, since the BamHI overhang is compatible
with the BgIII site. Ligation of a BamHI fragment to a BgIII
destroys the BgIII site, so that only a single BgIII site will
remain. Selection for the unique BgIII site insures that the
synthetic telomere will be inserted in the correct orientation. The
unique BgIII site is the site at which the vector is
linearized.
[0595] To generate a synthetic telomere made up of multiple repeats
of the sequence TTAGGG, attempts were made to clone or amplify
ligation products of 30-mer oligonucleotides containing repeats of
the sequence. Two 30-mer oligonucleotides, one containing four
repeats of TTAGGG bounded on each end of the complete run of
repeats by half of a repeat and the other containing five repeats
of the complement AATCCC, were annealed. The resulting
double-standed molecule with 3-bp protruding ends, each
representing half of a repeat, was expected to ligate with itself
to yield concatamers of n.times.30 bp. However, this approach was
unsuccessful, likely due to formation of quadruplex DNA from the
G-rich strand. Similar difficulty has been encountered in attempts
to generate long repeats of the pentameric human satellite II and
III units. Thus, it appears that, in general, any oligomer sequence
containing periodically spaced consecutive series of guanine
nucleotides is likely to form undesired quadruplex formation that
hinders construction of long double-stranded DNAs containing the
sequence.
[0596] Therefore, in another attempt to construct a synthetic
telomere for insertion into the BgIII site of pTEMPUD, the starting
material was based on the complementary C-rich repeat sequence
(i.e., AATCCC) which would not be susceptible to quadruplex
structure formation. Two plasmids, designated pTEL280110 and
pTel280111, were constructed as follows to serve as the starting
materials.
[0597] First, a long oligonucleotide containing 9 repeats of the
sequence AATCCC (i.e., the complement of telomere sequence TTAGGG)
in reverse order bounded on each end of the complete run of repeats
by half of a repeat (therefore, in essence, containing 10 repeats),
and recognition sites for PstI and PacI restriction enzymes was
synthesized using standard methods. The oligonucleotide sequence is
as follows:
[0598] 5'-AAACTGCAGGTTAATTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTAACCCTAACCCTAACCCGGGAT-3' (SEQ ID NO. 29)
[0599] A partially complementary short oligonucleotide of sequence
3'-TTGGGCCCTAGGCTTAAGG-5' (SEQ ID NO. 30) was also synthesized. The
oligonucleotides were gel-purified, annealed, repaired with Kienow
polymerase and digested with EcoRI and PstI. The resulting
EcoRI/PstI fragment was ligated with EcoRI/PstI-digested pUC19. The
resulting plasmid was used to transform E. coli DH5.alpha.
competent cells and plasmid DNA (pTel102) from one of the
transformants surviving selection on LB/ampicillin was digested
with PacI, rendered blunt-ended by Klenow and dNTPs and digested
with HindIII. The resulting 2.7-kb fragment was gel-purified.
[0600] Simultaneously, the same plasmid was amplified by the
polymerase chain reaction using extended and more distal 26-mer M13
sequencing primers. The amplification product was digested with
SmaI and HindIII, the double-stranded 84-bp fragment containing the
60-bp telomeric repeat (plus 24 bp of linker sequence) was isolated
on a 6% native polyacrylamide gel, and ligated with the
double-digested pTel102 to yield a 120-bp telomeric sequence. This
plasmid was used to transform DH5.alpha. cells. Plasmid DNA from
two of the resulting recombinants that survived selection on
ampicillin (100 .mu.g/ml) was sequenced on an ABI DNA sequencer
using the dye-termination method. One of the plasmids, designated
pTel29, contained a sequence of 20 repeats of the sequence TTAGGG
(i.e., 19 successive repeats of TTAGGG bounded on each end of the
complete run of repeats with half of a repeat). The other plasmid,
designated pTel28, had undergone a deletion of 2 bp (TA) at the
junction where the two sequences, each containing, in essence, 10
repeats of the TTAGGG sequence, that had been ligated to yield the
plasmid. This resulted in a GGGTGGG motif at the junction in
pTel28. This mutation provides a useful tag in telomere-directed
chromosome fragmentation experiments. Therefore, the pTel29 insert
was amplified by PCR using pUC/M13 sequencing primers based on
sequence somewhat longer and farther from the polylinker than usual
as follows:
[0601] 5'-GCCAGGGTTTTCCCAGTCACGACGT-3' (SEQ ID NO. 31) or in some
experiments
[0602] 5'-GCTGCAAGGCGATTAAGTTGGGTAAC-3' (SEQ ID NO. 32) as the m13
forward primer, and
[0603] 5'-TATGTTGTGTGGAATTGTGAGCGGAT-3' (SEQ ID NO. 33) as the m13
reverse primer.
[0604] The amplification product was digested with SmaI and
HindIII. The resulting 144-bp fragment was gel-purified on a 6%
native polyacrylamide gel and ligated with pTel28 that had been
digested with PacI, blunt-ended with Klenow and dNTP and then
digested with HindIII to remove linker. The ligation yielded a
plasmid designated pTel2801 containing a telomeric sequence of 40
repeats of the sequence TTAGGG in which one of the repeats (i.e.,
the 30th repeat) lacked two nucleotides (TA), due to the deletion
that had occurred in pTel28, to yield a repeat as follows:
TGGG.
[0605] In the next extension step, pTel2801 was digested with SmaI
and HindIII and the 264-bp insert fragment was gel-purified and
ligated with pTel2801 which had been digested with PacI,
blunt-ended and digested with HindIII. The resulting plasmid was
transformed into DH5.alpha. cells and plasmid DNA from 12 of the
resulting transformants that survived selection on ampicillin was
examined by restriction enzyme analysis for the presence of a
0.5-kb EcoRI/PstI insert fragment. Eleven of the recombinants
contained the expected 0.5-kb insert. The inserts of two of the
recombinants were sequenced and found to be as expected. These
plasmids were designated pTel280110 and pTel280111. These plasmids,
which are identical, both contain 80 repeats of the sequence
TTAGGG, in which two of the repeats (i.e., the 30th and 70th
repeats) lacked two nucleotides (TA), due to the deletion that had
occurred in pTel28, to yield a repeat as follows: TGGG. Thus, in
each of the cloning steps (except the first), the length of the
synthetic telomere doubled; that is, it was increasing in size
exponentially. Its length was 60.times.2.sup.n bp, wherein n is the
number of extension cloning steps undertaken. Therefore, in
principle (assuming E. coli, or any other microbial host, e.g.,
yeast, tolerates long tandem repetitive DNA), it is possible to
assemble any desirable size of safe telomeric repeats.
[0606] In a further extension step, pTel280110 was digested with
PacI, blunt-ended with Klenow polymerase in the presence of dNTP,
then digested with HindIII. The resulting 0.5-kb fragment was gel
purified. Plasmid pTel280111 was cleaved with SmaI and HindIII and
the 3.2-kb fragment was gel-purified and ligated to the 0.5-kb
fragment from pTel280110. The resulting plasmid was used to
transform DH5.alpha. cells. Plasmid DNA was purified from
transformants surviving ampicillin selection. Nine of the selected
recombinants were examined by restriction enzyme analysis for the
presence of a 1.0-kb EcoRI/PstI fragment. Four of the recombinants
(designated pTlk2, pTlk6, pTlk7 and pTlk8) were thus found to
contain the desired 960 bp telomere DNA insert sequence that
included 160 repeats of the sequence TTAGGG in which four of the
repeats lacked two nucleotides (TA), due to the deletion that had
occurred in pTel28, to yield a repeat as follows: TGGG. Partial DNA
sequence analysis of the EcoRI/PstI fragment of two of these
plasmids (i.e., pTlk2 and pTlk6), in which approximately 300 bp
from both ends of the fragment were elucidated, confirmed that the
sequence was composed of successive repeats of the TTAGGG
sequence.
[0607] In order to add PmeI and BgIII sites to the synthetic
telomere sequence, pTlk2 was digested with PacI and PstI and the
3.7-kb fragment (i.e., 2.7-kb pUC19 and 1.0-kb repeat sequence) was
gel-purified and ligated at the PstI cohesive end with the
following oligonucleotide 5'-GGGTTTAAACAGATCTCTGCA-3' (SEQ ID NO.
34). The ligation product was subsequently repaired with Klenow
polymerase and dNTP, ligated to itself and transformed into E. coli
strain DH5.alpha.. A total of 14 recombinants surviving selection
on ampicillin were obtained. Plasmid DNA from each recombinant was
able to be cleaved with BgIII indicating that this added unique
restriction site had been retained by each recombinant. Four of the
14 recombinants contained the complete 1-kb synthetic telomere
insert, whereas the insert of the remaining 10 recombinants had
undergone deletions of various lengths. The four plasmids in which
the 1-kb synthetic telomere sequence remained intact were
designated pTlkV2, pTlkV5, pTlkV8 an pTlkV2. Each of these plasmids
could also be digested with PmeI; in addition the presence of both
the BgIII nad PmeI sites was verified by sequence analysis. Any of
these four plasmids can be digested with BamHI and BgIII to release
a fragment containing the 1-kb synthetic telomere sequence which is
then ligated with BgIII-digested pTEMPUD.
[0608] 2. Use of pTEMPUD For in vivo Chromosome Fragmentation
[0609] Linearization of pTEMPUD by BgIII results in a linear
molecule with a human telomere at one end. Integration of this
linear fragment into the chromosome, such as the megachromosome in
hybrid cells or any mouse chromosome which contains repeats of the
mouse major satellite sequence results in integration of the
selectable marker puromycin-resistance gene and cleavage of the
plasmid by virtue of the telomeric end. The DT gene prevents that
entire linear fragment from integrating by random events, since
upon integration and expression it is toxic. Thus random
integration will be toxic, so site-directed integration into the
targeted DNA will be selected. Such integration will produce
fragmented chromosomes.
[0610] The fragmented truncated chromosome with the new telomere
will survive, and the other fragment without the centromere will be
lost. Repeated in vivo fragmentations will ultimately result in
selection of the smallest functioning artificial chromosome
possible. Thus, this vector can be used to produce minichromosomes
from mouse chromosomes, or to fragment the megachromosome. In
principle, this vector can be used to target any selected DNA
sequence in any chromosome to achieve fragmentation.
[0611] 3. Construction of pTERPUD
[0612] A fragmentation/targeting vector analogous to pTEMPUD for in
vivo chromosome fragmentation, and also for inducing large-scale
amplification via site-specific integration but which is based on
mouse rDNA sequence instead of mouse major satellite DNA has been
designated pTERPUD. In this vector, the mouse major satellite DNA
sequence of pTEMPUD has been replaced with a 4770-bp BamHI fragment
of megachromosome clone 161 which contains sequence corresponding
to nucleotides 10,232-15,000 in SEQ ID NO. 16.
[0613] 4. pHASPUD and pTEMPhu3
[0614] Vectors that specifically target human chromosomes can be
constructed from pTEMPUD. These vectors can be used to fragment
specific human chromosomes, depending upon the selected satellite
sequence, to produce human minichromosomes, and also to isolate
human centromeres.
[0615] a. pHASPUD
[0616] To render pTEMPUD suitable for fragmenting human
chromosomes, the mouse major satellite sequence is replaced with
human satellite sequences. Unlike mouse chromosomes, each human
chromosome has a unique satellite sequence. For example, the mouse
major satellite has been replaced with a human hexameric
.alpha.-satellite [or alphoid satellite] DNA sequence. This
sequence is an 813-bp fragment [nucleotide 232-1044 of SEQ ID No.
2] from clone pS12, deposited in the EMBL database under Accession
number X60716, isolated from a human colon carcinoma cell line
Colo320 [deposited under Accession No. ATCC CCL 220.1]. The 813-bp
alphoid fragment can be obtained from the pS12 clone by nucleic
acid amplification using synthetic primers, each of which contains
an EcoRI site, as follows:
[0617] GGGGAATTCAT TGGGATGTTT CAGTTGA forward primer [SEQ ID No.
4]
[0618] CGAAAGTCCCC CCTAGGAGAT CTTAAGGA reverse primer [SEQ ID No.
5].
[0619] Digestion of the amplified product with EcoRI results in a
fragment with EcoRI ends that includes the human .alpha.-satellite
sequence. This sequence is inserted into pTEMPUD in place of the
EcoRI fragment that contains the mouse major satellite to yield
pHASPUD.
[0620] Vector pHASPUD was linearized with BgIII and used to
transform EJ30 (human fibroblast) cells by scrape loading.
Twenty-seven puromycin-resistant transformant strains were
obtained.
[0621] b. pTEMPhu3
[0622] In pTEMPhu3, the mouse major satellite sequence is replaced
by the 3 kb human chromosome 3-specific .alpha.-satellite from D3Z1
[deposited under ATCC Accession No. 85434; see, also Yrokov (1989)
Cytogenet. Cell Genet. 51:1114].
[0623] 5. Use of the pTEMPHU3 to Induce Amplification on Human
Chromosome #3
[0624] Each human chromosome contains unique chromosome-specific
alphoid sequence. Thus, pTEMPHU3, which is targeted to the
chromosome 3-specific .alpha.-satellite, can be introduced into
human cells under selective conditions, whereby large-scale
amplification of the chromosome 3 centromeric region and production
of a de novo chromosome ensues. Such induced large-scale
amplification provides a means for inducing de novo chromosome
formation and also for in vivo cloning of defined human chromosome
fragments up to megabase size.
[0625] For example, the break-point in human chromosome 3 is on the
short arm near the centromere. This region is involved in renal
cell carcinoma formation. By targeting pTEMPhu3 to this region, the
induced large-scale amplification may contain this region, which
can then be cloned using the bacterial and yeast markers in the
pTEMPhu3 vector.
[0626] The pTEMPhu3 cloning vector allows not only selection for
homologous recombinants, but also direct cloning of the integration
site in YACS. This vector can also be used to target human
chromosome 3, preferably with a deleted short arm, in a mouse-human
monochromosomal microcell hybrid line. Homologous recombinants can
be screened by nucleic acid amplification (PCR), and amplification
can be screened by DNA hybridization, Southern hybridization, and
in situ hybridization. The amplified region can be cloned into a
YAC. This vector and these methods also permit a functional
analysis of cloned chromosome regions by reintroducing the cloned
amplified region into mammalian cells.
[0627] B. Preparation of Libraries in YAC Vectors For Cloning of
Centromeres and Identification of Functional Chromosomal Units
[0628] Another method that may be used to obtain smaller-sized
functional mammalian artificial chromosome units and to clone
centromeric DNA involves screening of mammalian DNA YAC
vector-based libraries and functional analysis of potential
positive clones in a transgenic mouse model system. A mammalian DNA
library is prepared in a YAC vector, such as YRT2 [see Schedl et
al. (1993) Nuc. Acids Res. 21:4783-4787], which contains the murine
tyrosinase gene. The library is screened for hybridization to
mammalian telomere and centromere sequence probes. Positive clones
are isolated and microinjected into pronuclei of fertilized oocytes
of NMRI/Han mice following standard techniques. The embryos are
then transferred into NMRI/Han foster mothers. Expression of the
tyrosinase gene in transgenic offspring confers an identifiable
phenotype (pigmentation). The clones that give rise to
tyrosinase-expressing transgenic mice are thus confirmed as
containing functional mammalian artificial chromosome units.
[0629] Alternatively, fragments of SATACs may be introduced into
the YAC vectors and then introduced into pronuclei of fertilized
oocytes of NMRI/Han mice following standard techniques as above.
The clones that give rise to tyrosinase-expressing transgenic mice
are thus confirmed as containing functional mammalian artificial
chromosome units, particularly centromeres.
[0630] C. Incorporation of Heterologous Genes into Mammalian
Artificial Chromosomes Through the Use of Homology Targeting
Vectors
[0631] As described above, the use of mammalian artificial
chromosomes for expression of heterologous genes obviates certain
negative effects that may result from random integration of
heterologous plasmid DNA into the recipient cell genome. An
essential feature of the mammalian artificial chromosome that makes
it a useful tool in avoiding the negative effects of random
integration is its presence as an extra-genomic gene source in
recipient cells. Accordingly, methods of specific, targeted
incorporation of heterologous genes exclusively into the mammalian
artificial chromosome, without extraneous random integration into
the genome of recipient cells, are desired for heterologous gene
expression from a mammalian artificial chromosome.
[0632] One means of achieving site-specific integration of
heterologous genes into artificial chromosomes is through the use
of homology targeting vectors. The heterologous gene of interest in
subcloned into a targeting vector which contains nucleic acid
sequences that are homologous to nucleotides present in the
artificial chromosome. The vector is then introduced into cells
containing the artificial chromosome for specific site-directed
integration into the artificial chromosome through a recombination
event at sites of homology between the vector and the chromosome.
The homology targeting vectors may also contain selectable markers
for ease of identifying cells that have incorporated the vector
into the artificial chromosome as well as lethal selection genes
that are expressed only upon extraneous integration of the vector
into the recipient cell genome. Two exemplary homology targeting
vectors, .lambda.CF-7 and p.lambda.CF-7-DTA, are described
below.
[0633] 1. Construction of Vector .lambda.CF-7
[0634] Vector .lambda.CF-7 contains the cystic fibrosis
transmembrane conductance regulator [CFTR] gene as an exemplary
therapeutic molecule-encoding nucleic acid that may be incorporated
into mammalian artificial chromosomes for use in gene therapy
applications. This vector, which also contains the
puromycin-resistance gene as a selectable marker, as well as the
Saccharomyces cerevisiae ura3 gene [orotidine-5-phosphate
decarboxylase], was constructed in a series of steps as
follows.
[0635] a. Construction of pURA
[0636] Plasmid pURA was prepared by ligating a 2.6-kb SalI/XhoI
fragment from the yeast artificial chromosome vector pYAC5 [Sigma;
see also Burke et al. (1987) Science 236:806-812 for a description
of YAC vectors as well as GenBank Accession no. U01086 for the
complete sequence of pYAC5] containing the S. cerevisiae ura3 gene
with a 3.3-kb SalI/SmaI fragment of pHyg [see, e.g., U.S. Pat. Nos.
4,997,764, 4,686,186 and 5,162,215,. and the description above].
Prior to ligation the XhoI end was treated with Klenow polymerase
for blunt end ligation to the SmaI end of the 3.3 kb fragment of
pHyyg. Thus, pURA contains the S. cerevisiae ura3 gene, and the E.
coli ColE1 origin of replication and the ampicillin-resistance
gene. The uraE gene is included to provide a means to recover the
integrated construct from a mammalian cell as a YAC clone.
[0637] b. Construction of pUP2
[0638] Plasmid pURA was digested with Sail and ligated to a 1.5-kb
SalI fragment of pCEPUR. Plasmid pCEPUR is produced by ligating the
1.1 kb SnaBI-NhaI fragment of pBabe-puro [Morgenstern et al. (1990)
Nucl. Acids Res. 18:3587-3596; provided by Dr. L. Szkely
(Microbiology and Tumorbiology Center, Karolinska Institutet,
Stockholm); see, also Tonghua et al. (1995) Chin. Med. J. (Beijing,
Engl. Ed.) 108:653-659; Couto et al. (1994) Infect. Immun.
62:2375-2378; Dunckley et al. (1992) FEBS Lett. 296:128-34; French
et al. (1995) Anal. Biochem. 228:354-355; Liu et al. (1995) Blood
85:1095-1103; International PCT application Nos. WO 9520044; WO
9500178, and WO 94194561 to the NheI-NruI fragment of pCEP4
[Invitrogen].
[0639] The resulting plasmid, pUP2, contains the all the elements
of pURA plus the puromycin-resistance gene linked to the SV40
promoter and polyadenylation signal from pCEPUR.
[0640] C. Construction of pUP-CFTR
[0641] The intermediate plasmid pUP-CFTR was generated in order to
combine the elements of pUP2 into a plasmid along with the CFTR
gene. First, a 4.5-kb SalI fragment of pCMV-CFTR that contains the
CFTR-encoding DNA [see, also, Riordan et al. (1989) Science
245:1066-1073, U.S. Pat. No. 5,240,846, and Genbank Accession no.
M28668 for the sequence of the CFTR gene] containing the CFTR gene
only was ligated to XhoI-digested pCEP4 [Invitrogen and also
described herein] in order to insert the CFTR gene in the multiple
cloning site of the Epstein Barr virus-based (EBV) vector pCEP4
[Invitrogen, San Diego, Calif.; see also Yates et al. (1985) Nature
313:812-815; see, also U.S. Pat. No. 5,468,615] between the CMV
promoter and SV40 polyadenylation signal. The resulting plasmid was
designated pCEP-CFTR. Plasmid pCEP-CFTR was then digested with SalI
and the 5.8-kb fragment containing the CFTR gene flanked by the CMV
promoter and SV40 polyadenylation signal was ligated to
SalI-digested pUP2 to generate pUP-CFTR. Thus, pUP-CFTR contains
all elements of pUP2 plus the CFTR gene linked to the CMV promoter
and SV40 polyadenylation signal.
[0642] d. Construction of .lambda.CF-7
[0643] Plasmid pUP-CFTR was then linearized by partial digestion
with EcoRI and the 13 kb fragment containing the CFTR gene was
ligated with EcoRI-digested Charon 4A.lambda. [see Blattner et al.
(1977) Science 196:161; Williams and Blattner (1979) J. Virol.
29:555 and Sambrook et al. (1989) Molecular Cloning, A Laboratory
Manual, Second Ed., Cold Spring Harbor Laboratory Press, Volume 1,
Section 2.18, for descriptions of Charon 4A.lambda.]. The resulting
vector, .lambda.CF8, contains the Charon 4A.lambda. bacteriophage
left arm, the CFTR gene linked to the CMV promoter and SV40
polyadenylation signal, the ura3 gene, the puromycin-resistance
gene linked to the SV40 promoter and polyadenylation signal, the
thymidine kinase promoter [TK], the ColE1 origin of replicaton, the
amplicillan resistance gene and the Charon 4A.lambda. bacteriophage
right arm. The .lambda.CF8 construct was then digested with XhoI
and the resulting 27.1 kb was ligated to the 0.4kb XhoI/EcoRI
fragment of pJBP86 [described below], containing the SV40 polyA
signal and the EcoRI-digested Charon 4A.lambda. right arm. The
resulting vector .lambda.CF-7 contains the Charon 4A.lambda. left
arm, the CFTR encoding DNA linked to the CMV promoter and SV40
polyA signal, the ura3 gene, the puromycin resistance gene linked
to the SV40 promoter and polyA signal and the Charon 4A.lambda.
right arm. The .lambda. DNA fragments provide encode sequences
homologous to nucleotides present in the exemplary artificial
chromosomes.
[0644] The vector is then introduced into cells containing the
artificial chromosomes exemplified herein. Accordingly, when the
linear .lambda.CF-7 vector is introduced into
megachromosome-carrying fusion cell lines, such as described
herein, it will be specifically integrated into the megachromosome
through recombination between the homologous bacteriophage .lambda.
sequences of the vector and the artificial chromosome.
[0645] 2. Construction of Vector .lambda.CF-7-DTA
[0646] Vector .lambda.CF-7-DTA also contains all the elements
contained in .lambda.CF-7, but additionally contains a lethal
selection marker, the diptheria toxin-A (DT-A) gene as well as the
ampicillin-resistance gene and an origin of replication. This
vector was constructed in a series of steps as follows.
[0647] a. Construction of pJBP86
[0648] Plasmid pJBP86 was used in the construction of .lambda.CF-7,
above. A 1.5-kb SalI fragment of pCEPUR containing the
puromycin-resistance gene linked to the SV40 promoter and
polyadenylation signal was ligated to HindIII-digested pJB8 [see,
e.g., Ish-Horowitz et al. (1981) Nucleic Acids Res. 9:2989-2998;
available from ATCC as Accession No. 37074; commercially available
from Amersham, Arlington Heights, Ill.]. Prior to ligation the SalI
ends of the 1.5 kb fragment of pCEPUR and th4 HindIII linearized
pJB8 ends were treated with Klenow polymerase. The resulting vector
pJBP86 contains the puromycin resistance gene linked to the SV40
promoter and polyA signal, the 1.8 kb COS region of Charon
4A.lambda., the ColE1 origin of replication and the ampicillin
resistance gene.
[0649] b. Construction of pMEP-DTA
[0650] A 1.1-kb XhoI/SalI fragment of pMC1-DT-A [see, e.g., Maxwell
et al. (1986) Cancer Res. 46:4660-4666] containing the diptheria
toxin-A gene was ligated to XhoI-digested pMEP4 [Invitrogen, San
Diego, Calif.] to generate pMEP-DTA. To produce pMC1-DT-A, the
coding region of the DTA gene was isolated as a 800 bp PstIHindIII
fragment from p2249-1 and inserted into pMC1neopolyA [pMC1
available from Stratagene] in place of the neo gene and under the
control of the TK promotoer. The resulting construct pMC1DT-A was
digested with HindIII, the ends filled by Klenow and SalI linkers
were ligated to produce a 1061 bp TK-DTA gene cassette with an XhoI
end [5'] and a SalI end containing the 270 bp TK promoter and the
.about.790 bp DT-A fragment. This fragment was ligated into
XhoI-digested pMEP4.
[0651] Plasmid pMEP-DTA thus contains the DT-A gene linked to the
TK promoter and SV40, ColE1 origin of replication and the
ampicillin-resistance gene.
[0652] C. Construction of pJB83-DTA9
[0653] Plasmid pJB8 was digested with HindIII and ClaI and ligated
with an oligonucleotide [see SEQ ID NOs. 7 and 8 for the sense and
antisense strands of the oligonucleotide, respectively] to generate
pJB83. The oligonucleotide that was ligated to
ClaI/HindIII-digested pJB8 contained the recognition sites of SwaI,
PacI and SrfI restriction endonucleases. These sites will permit
ready linearization of the p.lambda.CF-7-DTA construct.
[0654] Next, a 1.4-kb XhoI/SalI fragment of pMEP-DTA, containing
the DT-A gene was ligated to SalI-digested pJB83 to generate
pJB83-DTA9.
[0655] d. Construction of .lambda.CF-7-DTA
[0656] The 12-bp overhangs of .lambda.CF-7 were removed by Mung
bean nuclease and subsequent T4 polymerase treatments. The
resulting 41.1-kb linear .lambda.CF-7 vector was then ligated to
pFB83-DTA9 which had been digested with ClaI and treated with T4
polymerase. The resulting vector, .lambda.CF-7-DTA, contains all
the elements of .lambda.CF-7 as well as the DT-A gene linked to the
TK promoter and the SV40 polyadenylation signal, the 1.8 kB Charon
4A .lambda. COS region, the ampicillin-resistance gene [from
pJB83-DTA9] and the Col E1 origin of replication [from
pJB83-DT9A].
[0657] D. Targeting Vectors Using Luciferase Markers: Plasmid
pMCT-RUC
[0658] Plasmid pMCT-RUC [14 kbp] was constructed for site-specific
targeting of the Renilla luciferase [see, e.g., U.S. Pat. Nos.
5,292,658 and 5,418,155 for a description of DNA encoding Renilla
luciferase, and plasmid pTZrLuc-1, which can provide the starting
material for construction of such vectors] gene to a mammalian
artificial chromosome. The relevant features of this plasmid are
the Renilla luciferase gene under transcriptional control of the
human cytomegalovirus immediate-early gene enhancer/promoter; the
hygromycin-resistance gene a, positive selectable marker, under the
transcriptional control of the thymidine kinase promoter. In
particular, this plasmid contains plasmid pAG60 [see, e.g., U.S.
Pat. Nos. 5,118,620, 5,021,344, 5,063,162 and 4,946,952; see, also
Colbert-Garapin et al. (1981) J. Mol. Biol. 150:1-14], which
includes DNA (i.e., the neomycin-resistance gene) homologous to the
minichromosome, as well as the Renilla and hygromycin-resistance
genes, the HSV-tk gene under control of the tk promoter as a
negative selectable marker for homologous recombination, and a
unique HpaI site for linearizing the plasmid.
[0659] This construct was introduced, via calcium phosphate
transfection, into EC3/7C5 cells [see, Lorenz et al. (1996) J.
Biolum. Chemilum. 11:31-37]. The EC3/7C5 cells were maintained as a
monolayer [see, Gluzman (1981) Cell 23:175-183]. Cells at 50%
confluency in 100 mm Petri dishes were used for calcium phosphate
transfection [see, Harper et al. (1981) Chromosoma 83:431-439]
using 10 .mu.g of linearized pMCT-RUC per plate. Colonies
originating from single transfected cells were isolated and
maintained in F-12 medium containing hygromycin (300 .mu.g/mL) and
10% fetal bovine serum. Cells were grown in 100 mm Petri dishes
prior to the Renilla luciferase assay.
[0660] The Renilla luciferase assay was performed [see, e.g.,
Matthews et al. (1977) Biochemistry 16:85-91]. Hygromycin-resistant
cell lines obtained after transfection of EC3/7C5 cells with
linearized plasmid pMCT-RUC ["B" cell lines] were grown to 100%
confluency for measurements of light emission in vivo and in vitro.
Light emission was measured in vivo after about 30 generations as
follows: growth medium was removed and replaced by 1 mL RPMI 1640
containing coelenterazine [1 mmol/L final concentration]. Light
emission from cells was then visualized by placing the Petri dishes
in a low light video image analyzer [Hamamatsu Argus-100]. An image
was formed after 5 min. of photon accumulation using 100%
sensitivity of the photon counting tube. For measuring light
emission in vitro, cells were trypsinized and harvested from one
Petri dish, pelleted, resuspended in 1 mL assay buffer [0.5 mol/L
NaCl, 1 mmol/L EDTA, 0.1 mol/L potassium phosphate, pH 7.4] and
sonicated on ice for 10 s. Lysates were than assayed in a Turner
TD-20e luminometer for 10 s after rapid injection of 0.5 mL of 1
mmol/L coelenterazine, and the average value of light emission was
recorded as LU [1 LU=1.6.times.106 hu/s for this instrument].
[0661] Independent cell lines of EC3/7C5 cells transfected with
linearized plasmid pMCT-RUC showed different levels of Renilla
luciferase activity. Similar differences in light emission were
observed when measurements were performed on lysates of the same
cell lines. This variation in light emission was probably due to a
position effect resulting from the random integration of plasmid
pMCT-RUC into the mouse genome, since enrichment for site targeting
of the luciferase gene was not performed in this experiment.
[0662] To obtain transfectant populations enriched in cells in
which the luciferase gene had integrated into the minichromosome,
transfected cells were grown in the presence of ganciclovis. This
negative selection medium selects against cells in which the added
pMCT-RUC plasmid integrated into the host EC3/7C5 genome. This
selection thereby enriches the surviving transfectant population
with cells containing pMCT-RUC in the minichromosome. The cells
surviving this selection were evaluated in luciferase assays which
revealed a more uniform level of luciferase expression.
Additionally, the results of In situ hybridization assays indicated
that the Renilla luciferase gene was contained in the
minichromosome in these cells, which further indicates successful
targeting of pMCT-RUC into the minichromosome.
[0663] Plasmid pNEM-1, a variant of pMCT-RUC which also contains
.lambda. DNA to provide an extended region of homology to the
minichromosome [see, other targeting vectors, below], was also used
to transfect EC3/7C5 cells. Site-directed targeting of the Renilla
luciferase gene and the hygromycin-resistance gene in pNEM-1 to the
minichromosome in the recipient EC3/7C5 cells was achieved. This
was verified by DNA amplification analysis and by in situ
hybridization. Additionally, luciferase gene expression was
confirmed in luciferase assays of the transfectants.
[0664] E. Protein Secretion Targeting Vectors
[0665] Isolation of heterologous proteins produced intracellularly
in mammalian cell expression systems requires cell disruption under
potentially harsh conditions and purification of the recombinant
protein from cellular contaminants. The process of protein
isolation may be greatly facilitated by secretion of the
recombinantly produced protein into the extracellular medium where
there are fewer contaminants to remove during purification.
Therefore, secretion targeting vectors have been constructed for
use with the mammalian artificial chromosome system.
[0666] A useful model vector for demonstrating production and
secretion of heterologous protein in mammalian cells contains DNA
encoding a readily detectable reporter protein fused to an
efficient secretion signal that directs transport of the protein to
the cell membrane and secretion of the protein from the cell.
Vectors pLNCX-ILRUC and pLNCX-ILRUC.lambda., described below, are
examples of such vectors. These vectors contain DNA encoding an
interleukin-2 (IL2) signal peptide-Renilla reniformis luciferase
fusion protein. The IL-2 signal peptide [encoded by the sequence
set forth in SEQ ID No. 9] directs secretion of the luciferase
protein, to which it is linked, from mammalian cells. Upon
secretion from the host mammalian cell, the IL-2 signal peptide is
cleaved from the fusion protein to deliver mature, active,
luciferase protein to the extracellular medium. Successful
production and secretion of this heterologous protein can be
readily detected by performing luciferase assays which measure the
light emitted upon exposure of the medium to the bioluminescent
luciferin substrate of the luciferase enzyme. Thus, this feature
will be useful when artificial chromosomes are used for gene
therapy. The presence of a functional artificial chromosome
carrying an IL-Ruc fusion with the accompanying therapeutic genes
will be readily monitored. Body fluids or tissues can be sampled
and tested for luciferase expression by adding luciferin and
appropriate cofactors and observing the bioluminescence.
[0667] 1. Construction of Protein Secretion Vector pLNCX-ILRUC
[0668] Vector pLNCX-ILRUC contains a human IL-2 signal peptide-R.
reniformis fusion gene linked to the human cytomegalovirus (CMV)
immediate early promoter for constitutive expression of the gene in
mammalian cells. The construct was prepared as follows.
[0669] a. Preparation of the IL-2 Signal Sequence-encoding DNA
[0670] A 69-bp DNA fragment containing DNA encoding the human IL-2
signal peptide was obtained through nucleic acid amplification,
using appropriate primers for IL-2, of an HEK 293 cell line [see,
e.g., U.S. Pat. No. 4,518,584 for an IL-2 encoding DNA; see, also
SEQ ID No. 9; the IL-2 gene and corresponding amino acid sequence
is also provided in the Genbank Sequence Database as accession nos.
K02056 and J00264]. The signal peptide includes the first 20 amino
acids shown in the translations provided in both of these Genbank
entries and in SEQ ID NO. 9. The corresponding nucleotide sequence
encoding the first 20 amino acids is also provided in these entries
[see, e.g., nucleotides 293-52 of accession no. K02056 and
nucleotides 478-537 of accession no. J00264], as well as in SEQ ID
NO. 9. The amplification primers included an EcoRI site [GAATTC]
for subcloning of the DNA fragment after ligation into pGEMT
[Promega]. The forward primer is set forth in SEQ ID No. 11 and the
sequence of the reverse primer is set forth in SEQ ID No. 12.
[0671] TTTGAATTCATGTACAGGATGCAACTCCTG forward [SEQ ID No. 11]
[0672] TTTGAATTCAGTAGGTGCACTGTTTGTGAC revserse [SEQ ID No. 12]
[0673] b. Preparation of the R. reniformis Luciferase-encoding
DNA
[0674] The initial source of the R. reniformis luciferase gene was
plasmid pLXSN-RUC. Vector pLXSN [see, e.g., U.S. Pat. Nos.
5,324,655, 5,470,.730, 5,468,634, 5,358,866 and Miller et al.
(1989) Biotechniques 7:980] is a retroviral vector capable of
expressing heterologous DNA under the transcriptional control of
the retroviral LTR; it also contains the neomycin-resistance gene
operatively linked for expression to the SV40 early region
promoter. The R. reniformis luciferase gene was obtained from
plasmid pTZrLuc-1 [see, e.g., U.S. Pat. No. 5,292,658; see also the
Genbank Sequence Database accession no. M63501; and see also Lorenz
et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88:4438-4442] and is
shown as SEQ ID NO. 10. The 0.97 kb EcoRI/SmaI fragment of
pTZrLuc-1 contains the coding region of the Renilla
luciferase-encodig DNA. Vector pLXSN was digested with and ligated
with the luciferase gene contained on a pLXSN-RUC, which contains
the luciferase gene located operably linked to the viral LTR and
upstream of the SV40 promoter, which directs expression of the
neomycin-resistance gene.
[0675] C. Fusion of DNA Encoding the IL-2 Signal Peptide and the R.
reniformis Luciferase Gene to Yield pLXSN-ILRUC
[0676] The pGEMT vector containing the IL-2 signal peptide-encoding
DNA described in 1.a. above was digested with EcoRI, and the
resulting fragment encoding the signal peptide was ligated to
EcoRI-digested pLXSN-RUC. The resulting plasmid, called
pLXSN-ILRUC, contains the IL-2 signal peptide-encoding DNA located
immediately upstream of the R. reniformis gene in pLXSN-RUC.
Plasmid pLXSN-ILRUC was then used as a template for nucleic acid
amplification of the fusion gene in order to add a SmaI site at the
3' end of the fusion gene. The amplification product was subcloned
into linearized [EcoRI/SmaI-digested] pGEMT [Promega] to generate
ILRUC-pGEMT.
[0677] d. Introduction of the Fusion Gene into a Vector Containing
Control Elements for Expression in Mammalian Cells
[0678] Plasmid ILRUC-pGEMT was digested with KspI and SmaI to
release a fragment containing the IL-2 signal peptide-luciferase
fusion gene which was ligated to HpaI-digested pLNCX. Vector pLNCX
[see, e.g., U.S. Pat. Nos. 5,324,655 and 5,457,182; see, also
Miller and Rosman (1989) Biotechniques 7:980-990] is a retroviral
vector for expressing heterologous DNA under the control of the CMV
promoter; it also contains the neomycin-resistance gene under the
transcriptional control of a viral promoter. The vector resulting
from the ligation reaction was designated pLNCX-ILRUC. Vector
pLNCX-ILRUC contains the IL-2 signal peptide-luciferase fusion gene
located immediately downstream of the CMV promoter and upstream of
the viral 3' LTR and polyadenylation signal in pLNCX. This
arrangement provides for expression of the fusion gene under the
control of the CMV promoter. Placement of the heterologous
protein-encoding DNA [i.e., the luciferase gene] in operative
linkage with the IL-2 signal peptide-encoding DNA provides for
expression of the fusion in mammalian cells transfected with the
vector such that the heterologous protein is secreted from the host
cell into the extracellular medium.
[0679] 2. Construction of Protein Secretion Targeting Vector
pLNCX-ILRUC.lambda.
[0680] Vector pLNCX-ILRUC may be modified so that it can be used to
introduce the IL-2 signal peptide-luciferase fusion gene into a
mammalian artificial chromosome in a host cell. To facilitate
specific incorporation of the pLNCX-ILRUC expression vector into a
mammalian artificial chromosome, nucleic acid sequences that are
homologous to nucleotides present in the artificial chromosome are
added to the vector to permit site directed recombination.
[0681] Exemplary artificial chromosomes described herein contain
.lambda. phage DNA. Therefore, protein secretion targeting vector
pLNCX-ILRUC.lambda. was prepared by addition of .lambda. phage DNA
[from Charon 4A arms] to produce the secretion vector
pLNCX-ILRUC.
[0682] 3. Expression and Secretion of R. reniformis Luciferase from
Mammalian Cells
[0683] a. Expression of R. reniformis Luciferase Using
pLNCX-ILRUC
[0684] Mammalian cells [LMTK.sup.- from the ATCC] were transiently
transfected with vector pLNCX-ILRUC [.about.10 .mu.g] by
electroporation [BIORAD, performed according to the manufacturer's
instructions]. Stable transfectants produced by growth in G418 for
neo selection have also been prepared.
[0685] Transfectants were grown and then analyzed for expression of
luciferase. To determine whether active luciferase was secreted
from the transfected cells, culture media were assayed for
luciferase by addition of coelentrazine [see, e.g., Matthews et al.
(1977) Biochemistry 16:85-91].
[0686] The results of these assays establish that vector
pLNCX-ILRUC is capable of providing constitutive expression of
heterologous DNA in mammalian host cells. Furthermore, the results
demonstrate that the human IL-2 signal peptide is capable of
directing secretion of proteins fused to the C-terminus of the
peptide. Additionally, these data demonstrate that the R.
reniformis luciferase protein is a highly effective reporter
molecule, which is stable in a mammalian cell environment, and
forms the basis of a sensitive, facile assay for gene
expression.
[0687] b. Renilla reniformis Luciferase Appears to be Secreted From
LMTK.sup.- Cells
[0688] (i) Renilla Luciferase Assay of Cell Pellets
[0689] The following cells were tested:
[0690] cells with no vector: LMTK.sup.- cells without vector as a
negative control;
[0691] cells transfected with pLNCX only;
[0692] cells transfected with RUC-pLNCX [Renilla luciferase gene in
pLNCX vector];
[0693] cells transfected with pLNCX-ILRUC [vector containing the
IL-2
[0694] leader sequence+Renilla luciferase fusion gene in pLNCX
vector].
[0695] Forty-eight hours after electroporation, the cells and
culture medium were collected. The cell pellet from 4 plates of
cells was resuspended in 1 ml assay buffer and was lysed by
sonication. Two hundred .mu.l of the resuspended cell pellet was
used for each assay for luciferase activity [see, e.g., Matthews et
al. (1977) Biochemistry 16:85-91]. The assay was repeated three
times and the average bioluminescence measurement was obtained.
[0696] The results showed that there was relatively low background
bioluminescence in the cells transformed with pLNCX or the negative
control cells; there was a low level observed in the cell pellet
from cells containing the vector with the IL-2 leader
sequence-luciferase gene fusion and more than 5000 RLU in the
sample from cells containing RUC-pLNCX.
[0697] (ii) Renilla Luciferase Assay of Cell Medium
[0698] Forty milliliters of medium from 4 plates of cells were
harvested and spun down. Two hundred microliters of medium was used
for each luciferase activity assay. The assay was repeated several
times and the average bioluminescence measurement was obtained.
These results showed that a relatively high level of
bioluminescence was detected in the cell medium from cells
transformed with pLNCX-ILRUC; about 10-fold lower levels [slightly
above the background levels in medium from cells with no vector or
transfected with pLNCX only] was detected in the cells transfected
with RUC-pLNCX.
[0699] (iii) Conclusions
[0700] The results of these experiments demonstrated that Renilla
luciferase appears to be secreted from LMTK.sup.- cells under the
direction of the IL-2 signal peptide. The medium from cells
transfected with Renilla luciferase-encoding DNA linked to the DNA
encoding the IL-2 secretion signal had substantially higher levels
of Renilla luciferase activity than controls or cells containing
luciferase-encoding DNA without the signal peptide-encoding DNA.
Also, the differences between the controls and cells containing
luciferase encoding-DNA demonstrate that the luciferase activity is
specifically from luciferase, not from a non-specific reaction. In
addition, the results from the medium of RUC-pLNCX transfected
cells, which is similar to background, show that the luciferase
activity in the medium does not come from cell lysis, but from
secreted luciferase.
[0701] c. Expression of R. reniformis Luciferase Using
pLNCX-ILRUC.lambda.
[0702] To express the IL-2 signal peptide-R. reniformis fusion gene
from an mammalian artificial chromosome, vector pLNCX-ILRUC.lambda.
is targeted for site-specific integration into a mammalian
artificial chromosome through homologous recombination of the
.lambda. DNA sequences contained in the chromosome and the vector.
This is accomplished by introduction of pLNCX-ILRUC.lambda. into
either a fusion cell line harboring mammalian artificial
chromosomes or mammalian host cells that contain mammalian
artificial chromosomes. If the vector is introduced into a fusion
cell line harboring the artificial chromosomes, for example through
microinjection of the vector or transfection of the fusion cell
line with the vector, the cells are then grown under selective
conditions. The artificial chromosomes, which have incorporated
vector pLNCX-ILRUC.lambda., are isolated from the surviving cells,
using purification procedures as described above, and then injected
into the mammalian host cells.
[0703] Alternatively, the mammalian host cells may first be
injected with mammalian artificial chromosomes which have been
isolated from a fusion cell line. The host cells are then
transfected with vector pLNCX-ILRUC.lambda. and grown.
[0704] The recombinant host cells are then assayed for luciferase
expression as described above.
[0705] F. Other Targeting Vectors
[0706] These vectors, which are based on vector pMCT-RUC, rely on
positive and negative selection to insure insertion and selection
for the double recombinants. A single crossover results in
incorporation of the DT-A, which kills the cell, double crossover
recombinations delete the DT-1 gene.
6 1. Plasmid pNEM1 contains: DT-A: Diphtheria toxin gene (negative
selectable marker) Hyg: Hygromycin gene (positive selectable
marker) ruc: Renilla luciferase gene (non-selectable marker) 1:
LTR-MMTV promoter 2: TK promoter 3: CMV promoter MMR: Homology
region (plasmid pAG60) 2. plasmid pNEM-2 and -3 are similar to pNEM
1 except for different negative selectable markers: pNEM-1:
diphtheria toxin gene as "--" selectable marker pNEM-2: hygromycin
antisense gene as "--" selectable marker pNEM-3: thymidine kinase
HSV-1 gene as "--" selectable marker 3. Plasmid--.lambda. DNA based
homology: pNEM.lambda.-1: base vector pNEM.lambda.-2: base vector
containing p5 = gene 1: LTR MMTV promoter 2: SV40 promoter 3: CMV
promoter 4: .mu.TIIA promoter (metallothionein gene promoter) --
homology region (plasmid pAG60) .lambda. L.A. and .lambda. R.A.
homology regions for .lambda. left and right arms (.lambda.
gt-WES).
EXAMPLE 13
[0707] Microinjection of Mammalian Cells With Plasmid DNA
[0708] These procedures will be used to microinject MACs into
eukaryotic cells, including mammalian and insect cells.
[0709] The microinjection technique is based on the use of small
glass capillaries as a delivery system into cells and has been used
for introduction of DNA fragments into nuclei [see, e.g., Chalfie
et al. (1994) Science 263:802-804]. It allows the transfer of
almost any type of molecules, e.g., hormones, proteins, DNA and
RNA, into either the cytoplasm or nuclei of recipient cells This
technique has no cell type restriction and is more efficient than
other methods, including Ca.sup.2+-mediated gene transfer and
liposome-mediated gene transfer. About 20-30% of the injected cells
become successfully transformed.
[0710] Microinjection is performed under a phase-contrast
microscope. A glass microcapillary, prefilled with the DNA sample,
is directed into a cell to be injected with the aid of a
micromanipulator. An appropriate sample volume (1-10 pl) is
transferred into the cell by gentle air pressure exerted by a
transjector connected to the capillary. Recipient cells are grown
on glass slides imprinted with numbered squares for convenient
localization of the injected cells.
[0711] a. Materials and Equipment
[0712] Nunclon tissue culture dishes 35.times.10 mm, mouse cell
line EC3/7C5 Plasmid DNA pCH110 [Pharmacia], Purified Green
Florescent Protein (GFP) [GFPs from Aequorea and Renilla have been
purified and also DNA encoding GFPs has been cloned; see, e.g.,
Prasher et al. (1992) Gene 111:229-233; International PCT
Application No. WO 95/07463, which is based on U.S. application
Ser. No. 08/119,678 and U.S. application Ser. No. 08/192,274],
ZEISS Axiovert 100 microscope, Eppendorf transjector 5246,
Eppendorf micromanipulator 5171, Eppendorf Cellocate coverslips,
Eppendorf microloaders, Eppendorf femtotips and other standard
equipment.
[0713] b. Protocol for Injecting
[0714] (1) Fibroblast cells are grown in 35 mm tissue culture
dishes (37.degree. C., 5% CO.sub.2) until the cell density reaches
80% confluency. The dishes are removed from the incubator and
medium is added to about a 5 mm depth.
[0715] (2) The dish is placed onto the dish holder and the cells
observed with 10.times.objective; the focus is desirably above the
cell surface.
[0716] (3) Plasmid or chromosomal DNA solution [1 ng/.mu.l) and GFP
protein solution are further purified by centrifuging the DNA
sample at a force sufficient to remove any particular debris
[typically about 10,000 rpm for 10 minutes in a
microcentrifuge].
[0717] (4) Two 2 .mu.l of the DNA solution (1 ng/.mu.l) is loaded
into a microcapillary with an Eppendorf microloader. During
loading, the loader is inserted to the tip end of the
microcapillary. GFP (1 mg/ml) is loaded with the same
procedure.
[0718] (5) The protecting sheath is removed from the microcapillary
and the microcapillary is fixed onto the capillary holder connected
with the micromanipulator.
[0719] (6) The capillary tip is lowered to the surface of the
medium and is focussed on the cells gradually until the tip of the
capillary reaches the surface of a cell. The capillary is lowered
further so that the it is inserted into the cell. Various
parameters, such as the level of the capillary, the time and
pressure, are determined for the particular equipment. For example,
using the fibroblast cell line C5 and the above-noted equipment,
the best conditions are: injection time 0.4 second, pressure 80
psi. DNA can then be automatically injected into the nuclei of the
cells.
[0720] (7) After injection, the cells are returned to the
incubator, and incubated for about 18-24 hours.
[0721] (8) After incubation the number of transformants can be
determined by a suitable method, which depends upon the selection
marker. For example, if green fluorescent protein is used, the
assay can be performed using UV light source and fluorescent filter
set at 0-24 hours after injection. If .beta.-gal-containing DNA,
such as DNA-derived from pHC110, has been injected, then the
transformants can be assayed for .beta.-gal.
[0722] (c) Detection of .beta.-galactosidase in Cells Injected With
Plasmid DNA
[0723] The medium is removed from the culture plate and the cells
are fixed by addition of 5 ml of fixation Solution I: (1%
glutaraldehyde; 0.1 M sodium phosphate buffer, pH 7.0; 1 mM
MgCl.sub.2), and incubated for 15 minutes at 37.degree. C. Fixation
Solution I is replaced with 5 ml of X-gal Solution II: [0.2% X-gal,
10 mM sodium phosphate buffer (pH 7.0), 150 mM NaCl, 1 mM
MgCl.sub.2, 3.3 mM K.sub.4Fe(CN).sub.6H.sub.2O, 3.3 mM
K.sub.3Fe(CN).sub.6], and the plates are incubated for 30-60
minutes at 37.degree. C. The X-gal solution is removed and 2 ml of
70% glycerol is added to each dish. Blue stained cells are
identified under a light microscope.
[0724] This method will be used to introduce a MAC, particularly
the MAC with the anti-HIV megachromosome, to produce a mouse model
for anti-HIV activity.
EXAMPLE 14
[0725] Transgenic (Non-human) Animals
[0726] Transgenic (non-human) animals can be generated that express
heterologous genes which confer desired traits, e.g., disease
resistance, in the animals. A transgenic mouse is prepared to serve
as a model of a disease-resistant animal. Genes that encode
vaccines or that encode therapeutic molecules can be introduced
into embryos or ES cells to produce animals that express the gene
product and thereby are resistant to or less susceptible to a
particular disorder.
[0727] The mammalian artificial megachromosome and others of the
artificial chromosomes, particularly the SATACs, can be used to
generate transgenic (non-human) animals, including mammals and
birds, that stably express genes conferring desired traits, such as
genes conferring resistance to pathogenic viruses. The artificial
chromosomes can also be used to produce transgenic (non-human)
animals, such as pigs, that can produce immunologically humanized
organs for xenotransplantation.
[0728] For example, transgenic mice containing a transgene encoding
an anti-HIV ribozyme provide a useful model for the development of
stable transgenic (non-human) animals using these methods. The
artificial chromosomes can be used to produce transgenic
(non-human) animals, particularly, cows, goats, mice, oxen, camels,
pigs and sheep, that produce the proteins of interest in their
milk; and to produce transgenic chickens and other egg-producing
fowl, that produce therapeutic proteins or other proteins of
interest in their eggs. For example, use of mammary gland-specific
promoters for expression of heterologous DNA in milk is known [see,
e.g. U.S. Pat. No. 4,873,316]. In particular, a milk-specific
promoter or a promoter, preferably linked to a milk-specific signal
peptide, specifically activated in mammary tissue is operatively
linked to the DNA of interest, thereby providing expression of that
DNA sequence in milk.
[0729] 1. Development of Control Transgenic Mice Expressing
Anti-HIV Ribozyme
[0730] Control transgenic mice are generated in order to compare
stability and amounts of transgene expression in mice developed
using transgene DNA carried on a vector (control mice) with
expression in mice developed using transgenes carried in an
artificial megachromosome.
[0731] a. Development of Control Transgenic Mice Expressing
.beta.-galactosidase
[0732] One set of control transgenic mice was generated by
microinjection of mouse embryos with the .beta.-galactosidase gene
alone. The microinjection procedure used to introduce the plasmid
DNA into the mouse embryos is as described in Example 13, but
modified for use with embryos [see, e.g., Hogan et al. (1994)
Manipulating the Mouse Embryo, A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., see, especially
pages 255-264 and Appendix 3]. Fertilized mouse embryos [Strain CB6
obtained from Charles River Co.] were injected with 1 ng of plasmid
pCH110 (Pharmacia) which had been linearized by digestion with
BamHI. This plasmid contains the .beta.-galactosidase gene linked
to the SV40 late promoter. The .beta.-galactosidase gene product
provides a readily detectable marker for successful transgene
expression. Furthermore, these control mice provide confirmation of
the microinjection procedure used to introduce the plasmid into the
embryos. Additionally, because the megachromosome that is
transferred to the mouse embryos in the model system (see below)
also contains the 8-galactosidase gene, the control transgenic mice
that have been generated by injection of pCH110 into embryos serve
as an analogous system for comparison of heterologous gene
expression from a plasmid versus from a gene carried on an
artifical chromosome.
[0733] After injection, the embryos are cultured in modified HTF
medium under 5% CO.sub.2 at 37.degree. C. for one day until they
divide to form two cells. The two-cell embryos are then implanted
into surrogate mother female mice [for procedures see, Manipulating
the Mouse Embryo, A Laboratory Manual (1994) Hogan et al., eds.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp.
127 et seq.].
[0734] b. Development of Control Transgenic Mice Expressing
Anti-HIV Ribozyme
[0735] One set of anti-HIV ribozyme gene-containing control
transgenic mice was generated by microinjection of mouse embryos
with plasmid pCEPUR-132 which contains three different genes: (1)
DNA encoding an anti-HIV ribozyme, (2) the puromycin-resistance
gene and (3) the hygromycin-resistance gene. Plasmid pCEPUR-132 was
constructed by ligating portions of plasmid pCEP-132 containing the
anti-HIV ribozyme gene (referred to as ribozyme D by Chang et al.
[(1990) Clin. Biotech. 2:23-31]; see also U.S. Pat. No. 5,144,019
to Rossi et al.., particularly FIG. 4 of the patent) and the
hygromycin-resistance gene with a portion of plasmid pCEPUR
containing the puromycin-resistance gene.
[0736] Plasmid pCEP-132 was constructed as follows. Vector pCEP4
(Invitrogen, San Diego, Calif.; see also Yates et al. (1985) Nature
313:812-815) was digested with XhoI which cleaves in the multiple
cloning site region of the vector. This .about.10.4-kb vector
contains the hygromycin-resistance gene linked to the thymidine
kinase gene promoter and polyadenylation signal, as well as the
ampicillin-resistance gene and ColE1 origin of replication and
EBNA-1 (Epstein-Barr virus nuclear antigen) genes and OriP. The
multiple cloning site is flanked by the cytomegalovirus promoter
and SV40 polyadenylation signal.
[0737] XhoI-digested pCEP4 was ligated with a fragment obtained by
digestion of plasmid 132 (see Example 4 for a description of this
plasmid) with XhoI and Sail. This XhoI/SalI fragment contains the
anti-HIV ribozyme gene linked at the 3' end to the SV40
polyadenylation signal. The plasmid resulting from this ligation
was designated pCEP-132. Thus, in effect, pCEP-132 comprises pCEP4
with the anti-HIV ribozyme gene and SV40 polyadenylation signal
inserted in the multiple cloning site for CMV promoter-driven
expression of the anti-HIV ribozyme gene.
[0738] To generate pCEPUR-132, pCEP-132 was ligated with a fragment
of pCEPUR. pCEPUR was prepared by ligating a 7.7-kb fragment
generated upon NheI/NruI digestion of pCEP4 with a 1.1-kb
NheI/SnaBI fragment of pBabe [see Morgenstern and Land (1990)
Nucleic Acids Res. 18:3587-3596 for a description of pBabe] that
contains the puromycin-resistance gene linked at the 5' end to the
SV40 promoter. Thus, pCEPUR is made up of the ampicillin-resistance
and EBNA1 genes, as well as the ColE1 and OriP elements from pCEP4
and the puromycin-resistance gene from pBabe. The
puromycin-resistance gene in pCEPUR is flanked by the SV40 promoter
(from pBabe) at the 5' end and the SV40 polyadenylation signal
(from pCEP4) at the 3' end.
[0739] Plasmid pCEPUR was digested with XhoI and SalI and the
fragment containing the puromycin-resistance gene linked at the 5'
end to the SV40 promoter was ligated with XhoI-digested pCEP-132 to
yield the .about.12.1-kb plasmid designated pCEPUR-132. Thus,
pCEPUR-132, in effect, comprises pCEP-132 with puromycin-resistance
gene and SV40 promoter inserted at the XhoI site. The main elements
of pCEPUR-132 are the hygromycin-resistance gene linked to the
thymidine kinase promoter and polyadenylation signal, the anti-HIV
ribozyme gene linked to the CMV promoter and SV40 polyadenylation
signal, and the puromycin-resistance gene linked to the SV40
promoter and polyadenylation signal. The plasmid also contains the
ampicillin-resistance and EBNA1 genes and the ColE1 origin of
replication and OriP.
[0740] Zygotes were prepared from (C57BL/6J.times.CBA/J) F1 female
mice [see, e.g., Manipulating the Mouse Embryo, A Laboratory Manual
(1994) Hogan et al, eds., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y., p. 429], which had been previously mated with
a (C57BL/6J.times.CBA/J) F1 male. The male pronuclei of these F2
zygotes were injected [see, Manipulating the Mouse Embryo, A
Laboratory Manual (1994) Hogan et al., eds., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.] with pCEPUR-132
(.about.3 .mu.g/ml), which had been linearized by digestion with
NruI. The injected eggs were then implanted in surrogate mother
female mice for development into transgenic offspring.
[0741] These primary carrier offspring were analyzed (as described
below) for the presence of the transgene in DNA isolated from tail
cells. Seven carrier mice that contained transgenes in their tail
cells (but that may not carry the transgene in all their cells,
i.e., they may be chimeric) were allowed to mate to produce
non-chimeric or germ-line heterozygotes. The heterozygotes were, in
turn, crossed to generate homozygote transgenic offspring.
[0742] 2. Development of Model Transgenic Mice Using Mammalian
Artificial Chromosomes
[0743] Fertilized mouse embryos are microinjected (as described
above) with megachromosomes (1-10 pL containing 0-1 chromosomes/pL)
isolated from fusion cell line G3D5 or H1D3 (described above). The
megachromosomes are isolated as described herein. Megachromosomes
isolated from either cell line carry the anti-HIV ribozyme
(ribozyme D) gene as well as the hygromycin-resistance and
.beta.-galactosidase genes. The injected embryos are then developed
into transgenic mice as described above.
[0744] Alternatively, the megachromosome-containing cell line G3D5*
or H1D3* is fused with mouse embryonic stem cells [see, e.g., U.S.
Pat. No. 5,453,357, commerically available; see Manipulating the
Mouse Embryo, A Laboratory Manual (1994) Hogan et al., eds., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pages
253-289] following standard procedures see also, e.g., Guide to
Techniques in Mouse Development in Methods in Enzymology Vol. 25,
Wassarman and De Pamphilis, eds. (1993), pages 803-932]. (It is
also possible to deliver isolated megachromosomes into embryonic
stem cells using the Microcell procedure [such as that described
above].) The stem cells are cultured in the presence of a
fibroblast [e.g., STO fibroblasts that are resistant to hygromycin
and puromycin]. Cells of the resultant fusion cell line, which
contains megachromosomes carrying the transgenes [i.e., anti-HIV
ribozyme, hygromycin-resistance and .beta.-galactosidase genes],
are then transplanted into mouse blastocysts, which are in turn
implanted into a surrogate mother female mouse where development
into a transgenic mouse will occur.
[0745] Mice generated by this method are chimeric; the transgenes
will be expressed in only certain areas of the mouse, e.g., the
head, and thus may not be expressed in all cells.
[0746] 3. Analysis of Transgenic Mice for Transgene Expression
[0747] Beginning when the transgenic mice, generated as described
above, are three-to-four weeks old, they can be analyzed for stable
expression of the transgenes that were transferred into the embryos
[or fertilized eggs] from which they develop. The transgenic mice
may be analyzed in several ways as follows.
[0748] a. Analysis of Cells Obtained from the Transgenic Mice
[0749] Cell samples [e.g., spleen, liver and kidney cells,
lymphocytes, tail cells] are obtained from the transgenic mice. Any
cells may be tested for transgene expression. If, however, the mice
are chimeras generated by microinjection of fertilized eggs or by
fusion of embryonic stem cells with megachromosome-containing
cells, only cells from areas of the mouse that carry the transgene
are expected to express the transgene. If the cells survive growth
on hygromycin [or hygromycin and puromycin or neomycin, if the
cells are obtained from mice generated by transfer of both
antibiotic-resistance genes], this is one indication that they are
stably expressing the transgenes. RNA isolated from the cells
according to standard methods may also be analyzed by northern blot
procedures to determine if the cells express transcripts that
hybridize to nucleic acid probes based on the antibiotic-resistance
genes. Additionally, cells obtained from the transgenic mice may
also be analyzed for .beta.-galactosidase expression using standard
assays for this marker enzyme [for example, by direct staining of
the product of a reaction involving .beta.-galactosidase and the
X-gal substrate, see, e.g., Jones (1986) EMBO 105:3133-3142, or by
measurement of .beta.-galactosidase activity, see, e.g., Miller
(1972) in Experiments in Molecular Genetics pp. 352-355, Cold
Spring Harbor Press]. Analysis of .beta.-galactosidase expression
is particularly used to evaluate transgene expression in cells
obtained from control transgenic mice in which the only transgene
transferred into the embryo was the .beta.-galactosidase gene.
[0750] Stable expression of the anti-HIV ribozyme gene in cells
obtained from the transgenic mice may be evaluated in several ways.
First, DNA isolated from the cells according to standard procedures
may be subjected to nucleic acid amplification using primers
corresponding to the ribozyme gene sequence. If the gene is
contained within the cells, an amplified product of pre-determined
size is detected upon hybridization of the reaction mixture to a
nucleic acid probe based on the ribozyme gene sequence.
Furthermore, DNA isolated from the cells may be analyzed using
Southern blot methods for hybridization to such a nucleic acid
probe. Second, RNA isolated from the cells may be subjected to
northern blot hybridization to determine if the cells express RNA
that hybridizes to nucleic acid probes based on the ribozyme gene.
Third, the cells may be analyzed for the presence of anti-HIV
ribozyme activity as described, for example, in Chang et al. (1990)
Clin. Biotech. 2:23-31. In this analysis, RNA isolated from the
cells is mixed with radioactively labeled HIV gag target RNA which
can be obtained by in vitro transcription of gag gene template
under reaction conditions favorable to in vitro cleavage of the gag
target, such as those described in Chang et al. (1990) Clin.
Biotech. 2:23-31. After the reaction has been stopped, the mixture
is analyzed by gel electrophoresis to determine if cleavage
products smaller in size than the whole template are detected;
presence of such cleavage fragments is indicative of the presence
of stably expressed ribozyme.
[0751] b. Analysis of Whole Transgenic Mice
[0752] Whole transgenic mice that have been generated by transfer
of the anti-HIV ribozyme gene [as well as selection and marker
genes] into embryos or fertilized eggs can additionally be analyzed
for transgene expression by challenging the mice with infection
with HIV. It is possible for mice to be infected with HIV upon
intraperitoneal injection with high-producing HIV-infected U937
cells [see, e.g., Locardi et al. (1992) J. Virol. 66:1649-1654].
Successful infection may be confirmed by analysis of DNA isolated
from cells, such as peripheral blood mononuclear cells, obtained
from transgenic mice that have been injected with HIV-infected
human cells. The DNA of infected transgenic mice cells will contain
HIV-specific gag and env sequences, as demonstrated by, for
example, nucleic acid amplification using HIV-specific primers. If
the cells also stably express the anti-HIV ribozyme, then analysis
of RNA extracts of the cells should reveal the smaller gag
fragments arising by cleavage of the gag transcript by the
ribozyme.
[0753] Additionally, the transgenic mice carrying the anti-HIV
ribozyme gene can be crossed with transgenic mice expressing human
CD4 (i.e., the cellular receptor for HIV) [see Gillespie et al.
(1993) Mol. Cell. Biol. 13:2952-2958; Hanna et al. (1994) Mol.
Cell. Biol. 14:1084-1094; and Yeung et al. (1994) J. Exp. Med.
180:1911-1920, for a description of transgenic mice expressing
human CD4]. The offspring of these crossed transgenic mice
expressing both the CD4 and anti-HIV ribozyme transgenes should be
more resistant to infection [as a result of a reduction in the
levels of active HIV in the cells] than mice expressing CD4 alone
[without expressing anti-HIV ribozyme].
[0754] 4. Development of Transgenic Chickens Using Artificial
Chromosomes
[0755] The development of transgenic chickens has many applications
in the improvement of domestic poultry, an agricultural species of
commercial significance, such as disease resistance genes and genes
encoding therapeutic proteins. It appears that efforts in the area
of chicken transgenesis have been hampered due to difficulty in
achieving stable expression of transgenes in chicken cells using
conventional methods of gene transfer via random introduction into
recipient cells. Artificial chromosomes are, therefore,
particularly useful in the development of transgenic chickens
because they provide for stable maintenance of transgenes in host
cells.
[0756] a. Preparation of Artificial Chromosomes for Introduction of
Transgenes Into Recipient Chicken Cells
[0757] (i) Mammalian Artificial Chromosomes
[0758] Mammalian artificial chromosomes, such as the SATACs and
minichromosomes described herein, can be modified to incorporate
detectable reporter genes and/or transgenes of interest for use in
developing transgenic chickens. Alternatively, chicken-specific
artifical chromosomes can be constructed using the methods herein.
In particular, chicken artificial chromosomes [CACs] can be
prepared using the methods herein for preparing MACs; or, as
described above, the chicken librarires can be introduced into MACs
provided herein and the resulting MACs introduced into chicken
cells and those that are functional in chicken cells selected.
[0759] As described in Examples 4 and 7, and elsewhere herein,
artificial chromosome-containing mouse LMTK-derived cell lines, or
minichromosome-containing cell lines, as well as hybrids thereof,
can be transfected with selected DNA to generate MACs [or CACs]
that have integrated the foreign DNA for functional expression of
heterologous genes contained within the DNA.
[0760] To generate MACs or CACs containing transgenes to be
expressed in chicken cells, the MAC-containing cell lines may be
transfected with DNA that includes .lambda. DNA and transgenes of
interest operably linked to a promoter that is capable of driving
expression of genes in chicken cells. Alternatively, the
minichromosomes or MACs [or CACs], produced as described above, can
be isolated and introduced into cells, followed by targeted
integration of selected DNA. Vectors for targeted integration are
provided herein or can be constructed as described herein.
[0761] Promoters of interest include constitutive, inducible and
tissue (or cell)-specific promoters known to those of skill in the
art to promote expression of genes in chicken cells. For example,
expression of the lacZ gene in chicken blastodermal cells and
primary chicken fibroblasts has been demonstrated using a mouse
heat-shock protein 68 (hsp 68) promoter [phspPTlacZpA; see Brazolot
et al. (1991) Mol. Reprod. Devel. 30:304-312], a
Zn.sup.2+-inducible chicken metallothionein (cMt) promoter
[pCBcMtlacZ; see Brazolot et al. (1991) Mol. Reprod. Devel.
30:304-312], the constitutive Rous sarcoma virus and chicken
.beta.-actin promoters in tandem [pmiwZ; see Brazolot et al. (1991)
Mol. Reprod. Devel. 30:304-312] and the constitutive
cytomegalovirus (CMV) promoter. Of particular interest herein are
egg-specific promoters that are derived from genes, such as
ovalbumin and lysozyme, that are expressed in eggs.
[0762] The choice of promoter will depend on a variety of factors,
including, for example, whether the transgene product is to be
expressed throughout the transgenic chicken or restricted to
certain locations, such as the egg. Cell-specific promoters
functional in chickens include the steroid-responsive promoter of
the egg ovalbumin protein-encoding gene [see Gaub et al. (1987)
EMBO J. 6:2313-2320; Tora et al. (1988) EMBO J. 7:3771-3778; Park
et al. (1995) Biochem. Mol. Biol. lnt. (Australia) 36:811-816].
[0763] (ii) Chicken Artificial Chromosomes
[0764] Additionally, chicken artificial chromosomes may be
generated using methods described herein. For example, chicken
cells, such as primary chicken fibroblasts [see Brazolot et al.
(1991) Mol. Reprod. Devel. 30:304-312], may be transfected with DNA
that encodes a selectable marker [such as a protein that confers
resistance to antibiotics] and that includes DNA (such as chicken
satellite DNA) that targets the introduced DNA to the pericentric
region of the endogenous chicken chromosomes. Transfectants that
survive growth on selection medium are then analyzed, using methods
described herein, for the presence of artificial chromosomes,
including minichromosomes, and particularly SATACs. An artificial
chromosome-containing transfectant cell line may then be
transfected with DNA encoding the transgene of interest [fused to
an appropriate promoter] along with DNA that targets the foreign
DNA to the chicken artificial chromosome.
[0765] b. Introduction of Artificial Chromosomes Carrying
Transgenes of Interest Into Recipient Chicken Cells
[0766] Cell lines containing artificial chromosomes that harbor
transgene(s) of interest (i.e., donor cells) may be fused with
recipient chicken cells in order to transfer the chromosomes into
the recipient cells. Alternatively, the artificial chromosomes may
be isolated from the donor cells, for example, using methods
described herein [see, e.g., Example 10], and directly introduced
into recipient cells.
[0767] Exemplary chicken recipient cell lines include, but are not
limited to, stage X blastoderm cells [see, e.g., Brazolot et al.
(1991) Mol. Reprod. Dev. 30:304-312; Etches et al (1993) Poultry
Sci. 72:882-889; Petitte et al. (1990) Development 108:185-189] and
chick zygotes [see, e.g., Love et al. (1994) Biotechnology
12:60-63].
[0768] For example, microcell fusion is one method for introduction
of artificial chromosomes into avian cells [see, e., Dieken et al.
[(1996) Nature Genet. 12:174-182 for methods of fusing microcells
with DT40 chicken pre-B cells]. In this method, microcells are
prepared [for example, using procedures described in Example 1.A.5]
from the artificial chromosome-containing cell lines and fused with
chicken recipient cells.
[0769] Isolated artificial chromosomes may be directly introduced
into chicken recipient cell lines through, for example,
lipid-mediated carrier systems, such as lipofection procedures
[see, e.g., Brazolot et al. (1991) Mol. Reprod. Dev. 30:304-312] or
direct microinjection. Microinjection is generally preferred for
introduction of the artificial chromosomes into chicken zygotes
[see, e.g., Love et al. (1994) Biotechnology 12:60-63].
[0770] C. Development of Transgenic Chickens
[0771] Transgenic chickens may be developed by injecting recipient
Stage X blastoderm cells (which have received the artificial
chromosomes) into embryos at a similar stage of development [see,
e.g., Etches et al. (1993) Poultry Sci. 72:882-889; Petitte et al.
(1990) Development 108:185-189; and Carsience et al. (1993)
Development 117: 669-675]. The recipient chicken embryos within the
shell are candled and allowed to hatch to yield a germline chimeric
chicken that will express the transgene(s) in some of its
cells.
[0772] Alternatively, the artificial chromosomes may be introduced
into chick zygotes, for example through direct microinjection [see,
e.g., Love et al. (1994) Biotechnology 12:60-63], which thereby are
incorporated into at least a portion of the cells in the chicken.
Inclusion of a tissue-specific promoter, such an an egg-specific
promoter, will ensure appropriate expression of operatively-linked
heterologous DNA.
[0773] The DNA of interest may also be introduced into a
minichromosome, by methods provided herein. The minichromosome may
either be one provided herein, or one generated in chicken cells
using the methods herein. The heterologous DNA will be introduced
using a targeting vector, such as those provided herein, or
constructed as provided herein.
[0774] Since modifications will be apparent to those of skill in
this art, it is intended that this invention be limited only by the
scope of the appended claims.
Sequence CWU 0
0
* * * * *