U.S. patent application number 10/084700 was filed with the patent office on 2002-10-31 for hubub3 gene involved in human cancers.
This patent application is currently assigned to Chiron Corporation. Invention is credited to Seeley, Todd W..
Application Number | 20020160403 10/084700 |
Document ID | / |
Family ID | 27490687 |
Filed Date | 2002-10-31 |
United States Patent
Application |
20020160403 |
Kind Code |
A1 |
Seeley, Todd W. |
October 31, 2002 |
huBUB3 gene involved in human cancers
Abstract
Methods are provided for assessing mutations and/or loss of the
huBUB3 gene in human tumors. Loss of wild-type huBUB3 genes is
involved in neoplastic development. Therapeutic regimens can be
planned on the basis of the mutational status of huBUB3.
Inventors: |
Seeley, Todd W.; (Moraga,
CA) |
Correspondence
Address: |
Chiron Corporation
Intellectual Property R338
PO Box 8097
Emeryville
CA
94662-8097
US
|
Assignee: |
Chiron Corporation
4560 Horton Street
Emeryville
CA
94608-2916
|
Family ID: |
27490687 |
Appl. No.: |
10/084700 |
Filed: |
February 27, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10084700 |
Feb 27, 2002 |
|
|
|
09208743 |
Dec 10, 1998 |
|
|
|
60068102 |
Dec 19, 1997 |
|
|
|
60049068 |
Jun 11, 1997 |
|
|
|
60070182 |
Dec 30, 1997 |
|
|
|
60088991 |
Jun 11, 1998 |
|
|
|
Current U.S.
Class: |
435/6.18 ;
435/226; 435/320.1; 435/325; 435/69.1; 536/23.2 |
Current CPC
Class: |
C07K 14/47 20130101;
C12Q 2600/136 20130101; C12Q 2600/106 20130101; C07K 2319/00
20130101; C12Q 1/6886 20130101 |
Class at
Publication: |
435/6 ; 435/226;
435/69.1; 435/320.1; 435/325; 536/23.2 |
International
Class: |
C12Q 001/68; C07H
021/04; C12N 009/64; C12P 021/02; C12N 005/06 |
Claims
1. An isolated and purified huBUB3 protein having an amino acid
sequence which is at least 85% identical to SEQ ID NO: 2, wherein
percent identity is determined using a Smith-Waterman homology
search algorithm using an affine gap search with a gap open penalty
of 12 and a gap extension penalty of 1.
2. The isolated and purified huBUB3 protein of claim 1 which has
the amino acid sequence shown in SEQ ID NO: 2.
3. An isolated and purified polypeptide comprising at least 8
contiguous amino acids as shown in SEQ ID NO: 2.
4. A huBUB3 fusion protein comprising a first protein segment and a
second protein segment fused together by means of a peptide bond,
wherein the first protein segment consists of at least 8 contiguous
amino acids of a huBUB3 protein as shown in SEQ ID NO: 2.
5. A preparation of antibodies which specifically bind to a huBUB3
protein having an amino acid sequence as shown in SEQ ID NO: 2.
6. A cDNA molecule which encodes a huBUB3 protein having an amino
acid sequence which is at least 85% identical to SEQ ID NO: 2,
wherein percent identity is determined using a Smith-Waterman
homology search algorithm using an affine gap search with a gap
open penalty of 12 and a gap extension penalty of 1.
7. A cDNA molecule which encodes at least 8 contiguous amino acids
of SEQ ID NO: 2.
8. The cDNA molecule of claim 7 which encodes SEQ ID NO: 2.
9. The cDNA molecule of claim 8 which comprises SEQ ID NO: 1.
10. A cDNA molecule comprising at least 12 contiguous nucleotides
of SEQ ID NO: 1.
11. A cDNA molecule which is at least 85% identical to the
nucleotide sequence shown in SEQ ID NO: 1, wherein percent identity
is determined using a Smith-Waterman homology search algorithm
using an affine gap search with a gap open penalty of 12 and a gap
extension penalty of 1.
12. An isolated and purified subgenomic polynucleotide comprising a
nucleotide sequence which hybridizes to SEQ ID NO: 1 after washing
with 0.2.times.SSC at 65.degree. C., wherein the nucleotide
sequence encodes a huBUB3 protein having the amino acid sequence of
SEQ ID NO: 2.
13. A construct comprising: a promoter; and a polynucleotide
segment encoding at least 8 contiguous amino acids of a huBUB3
protein as shown in SEQ ID NO: 2, wherein the polynucleotide
segment is located downstream from the promoter, wherein
transcription of the polynucleotide segment initiates at the
promoter.
14. A host cell comprising a construct which comprises: a promoter
and: a polynucleotide segment encoding at least 8 contiguous amino
acids of a huBUB3 protein having an amino acid sequence as shown in
SEQ ID NO: 2.
15. A recombinant host cell comprising a new transcription
initiation unit, wherein the new transcription initiation unit
comprises in 5' to 3' order: (a) an exogenous regulatory sequence;
(b) an exogenous exon; and (c) a splice donor site, wherein the new
transcription initiation unit is located upstream of a coding
sequence of a huBUB3 gene as shown in SEQ ID NO: 1, wherein the
exogenous regulatory sequence controls transcription of the coding
sequence of the huBUB3 gene.
16. A pair of single-stranded DNA primers, said set allowing
synthesis of all or part of a huBUB3 gene coding sequence.
17. The pair of claim 16 wherein the primers have restriction
enzyme sites at each 5' end.
18. A nucleic acid probe complementary to a wild-type huBUB3 gene
as shown in SEQ ID NO: 1.
19. A method of diagnosing a neoplastic tissue of a human,
comprising the step of: detecting loss of a wild-type huBUB3 gene
or an expression product of the wild-type huBUB3 gene from a tissue
suspected of being neoplastic, wherein the wild-type huBUB3 gene
has the coding sequence shown in SEQ ID NO: 1, wherein the loss
indicates neoplasia of the tissue.
20. The method of claim 19 wherein the expression product is an
mRNA molecule.
21. The method of claim 19 wherein the expression product is a
protein molecule.
22. The method of claim 19 wherein the loss of the wild-type huBUB3
gene is detected by sequencing all or part of a huBUB3 gene.
23. The method of claim 19 wherein the loss of the wild-type huBUB3
gene is detected by amplification of huBUB3 gene sequences and
hybridization of the amplified huBUB3 sequences to nucleic acid
probes which are complementary to mutant huBUB3 alleles.
24. The method of claim 19 wherein the loss of the wild-type huBUB3
gene is detected by sequencing all or part of a huBUB3 gene.
25. The method of claim 21 wherein the loss of the wild-type huBUB3
protein molecule is detected by detecting a loss of ability of a
huBUB3 protein to complex with a BUB1 protein.
26. The method of claim 19 wherein detection of the loss of the
wild-type huBUB3 gene comprises screening for a point mutation.
27. The method of claim 26 wherein the point mutation is a missense
mutation.
28. The method of claim 19 wherein detection of the loss of the
wild-type huBUB3 gene comprises screening for a frameshift
mutation.
29. The method of claim 19 wherein the detection of the loss of the
wild-type huBUB3 gene comprises screening for a deletion
mutation.
30. The method of claim 19 wherein the tissue suspected of being
neoplastic is selected from the group consisting of lung, breast,
brain, colorectal, bladder, prostate, liver, and stomach.
31. A method of identifying a neoplastic tissue of a human,
comprising the step of: comparing expression of a first huBUB3 gene
in a first tissue of a human suspected of being neoplastic with
expression of a second huBUB3 gene in a second tissue of the human
which is normal, wherein the second huBUB3 gene has the coding
sequence shown in SEQ ID NO: 1, wherein decreased expression of the
first huBUB3 gene relative to the second huBUB3 gene identifies the
first tissue as being neoplastic.
32. A method to aid in the diagnosis or prognosis of neoplasia in a
human, comprising the step of: comparing a first huBUB3 gene, mRNA,
or protein in a first tissue of a human suspected of being
neoplastic with a second huBUB3 gene, mRNA, or protein in a second
tissue of a human which is normal, wherein a difference between the
first and second huBUB3 genes, mRNAs, or proteins indicates the
presence of neoplastic cells in the first tissue.
33. A method to aid in detecting a genetic predisposition to
neoplasia in a human, comprising the step of: comparing a huBUB3
gene, mRNA, or protein in the fetal tissue of a human with a
wild-type huBUB3 gene, mRNA, or protein, wherein a difference
between the huBUB3 gene, mRNA, or protein in the fetal tissue of
the human and the wild-type human huBUB3 gene, mRNA, or protein
indicates a genetic predisposition to neoplasia in the human.
34. A method of screening test compounds for the ability to
interfere with the binding of a huBUB3 protein to a huBUB1 protein,
comprising the steps of: (a) contacting a test compound with at
least a huBUB3-binding domain of a huBUB1 protein as shown in SEQ
ID NO: 4 and at least a huBUB1-binding domain of a huBUB3 protein
as shown in SEQ ID NO: 2, wherein the huBUB3-binding domain binds
to the huBUB1-binding domain in the absence of the test compound;
and (b) determining the amount of the huBUB1-binding domain which
is bound or unbound to the huBUB3-binding domain or determining the
amount of the huBUB3-binding domain which is bound or unbound to
the huBUB1-binding domain in the presence of the test compound,
wherein a test compound which decreases the amount of bound huBUB1-
or huBUB3-binding domains or which increases the amount of unbound
huBUB1- and huBUB3-binding domains is a potential inducer of
mitosis or cell cycle progression.
35. The method of claim 34 wherein the huBUB1- and the
huBUB3-binding domains are prebound prior to the step of
contacting.
36. The method of claim 34 wherein the test compound is contacted
with either of the huBUB1- or huBUB3-binding domains prior to the
step of contacting.
37. A method of screening test compounds for the ability to
interfere with the binding of a huBUB1 protein to a huBUB3 protein,
comprising the steps of: (a) contacting a cell with a test
compound, wherein the cell comprises: I) a first fusion protein
comprising (1) at least a huBUB1-binding domain of a huBUB3 protein
as shown in SEQ ID NO: 2 and (2) either a DNA binding domain or a
transcriptional activating domain; ii) a second fusion protein
comprising at least a huBUB3-binding domain of a huBUB1 protein as
shown in SEQ ID NO: 4, wherein the huBUB1-binding domain binds to
the huBUB3-binding domain, wherein if the first fusion protein
comprises a DNA binding domain, then the second fusion protein
comprises a transcriptional activating domain, wherein if the first
fusion protein comprises a transcriptional activating domain, then
the second fusion protein comprises a DNA binding domain, wherein
the interaction of the first and second fusion proteins
reconstitutes a sequence-specific transcription activating factor;
and iii) a reporter gene comprising a DNA sequence to which the DNA
binding domain specifically binds; and (b) measuring the expression
of the reporter gene, wherein a test compound which decreases the
expression of the reporter gene is a potential inducer of mitosis
or cell cycle progression.
38. A method of identifying compounds which interfere with the
binding of a huBUB3 protein to a huBUB1 protein, comprising the
steps of: providing a cell which comprises three recombinant DNA
constructs, wherein a first construct encodes a first polypeptide
fused to a sequence-specific DNA-binding domain, wherein a second
construct encodes a second polypeptide fused to a transcriptional
activation domain, and wherein a third construct comprises a
reporter gene downstream from a DNA element which is recognized by
the sequence-specific DNA-binding domain, wherein the first
polypeptide comprises a huBUB1-binding domain of a huBUB3 protein
as shown in SEQ ID NO: 2 and the second polypeptide comprises a
huBUB3-binding domain of a huBUB1 protein as shown in SEQ ID NO: 4
or the first polypeptide comprises a huBUB3-binding domain of a
huBUB1 protein as shown in SEQ ID NO: 4 and the second polypeptide
comprises a huBUB1-binding domain of a huBUB3 protein as shown in
SEQ ID NO: 2; contacting the cell with a test compound; and
determining expression of the reporter gene in the presence of the
test compound, wherein a test compound which decreases expression
of the reporter gene is identified as a candidate therapeutic
agent.
39. A cell which comprises three recombinant DNA constructs,
wherein a first construct encodes a first polypeptide fused to a
sequence-specific DNA-binding domain, wherein a second construct
encodes a second polypeptide fused to a transcriptional activation
domain, and wherein a third construct comprises a reporter gene
downstream from a DNA element which is recognized by the
sequence-specific DNA-binding domain, wherein the first polypeptide
comprises a a huBUB1-binding domain of a huBUB3 protein as shown in
SEQ ID NO: 2 and the second polypeptide comprises a huBUB3-binding
domain of a huBUB1 protein as shown in SEQ ID NO: 4, or the first
polypeptide comprises a huBUB3-binding domain of a huBUB1 protein
as shown in SEQ ID NO: 4 and the second polypeptide comprises a
huBUB1-binding domain of a huBUB3 protein as shown in SEQ ID NO:
2.
40. A method of determining the quantity of huBUB1 which binds to
huBUB3, or of huBUB3 which binds to huBUB1, comprising the steps
of: contacting a first protein and a second protein, wherein if the
first protein is huBUB3 the the second protein is huBUB1 and if the
first protein is huBUB1 the the second protein is huBUB3; and
determining the quantity of the first protein which is bound to the
second protein.
41. A method for identifying compounds which decrease the kinase
activity of a huBUB1-huBUB3 complex, comprising the steps of:
contacting a huBUB1-huBUB3 complex with a test compound; and
determining the kinase activity of the huBUB1-huBUB3 complex,
wherein a compound which decreases kinase activity of the
huBUB1-huBUB3 complex is identified as a candidate therapeutic
agent.
Description
[0001] This application claims the benefit of and incorporates by
reference co-pending provisional applications Serial Nos.
60/068,102, filed Dec. 19, 1997, and 60/070,182, filed Dec. 30,
1997.
TECHNICAL AREA OF THE INVENTION
[0002] The invention relates to the area of cancer diagnostics.
More particularly, the invention relates to detection of the loss
and or alteration of wild-type huBUB3 genes in tumor tissues.
BACKGROUND OF THE INVENTION
[0003] Genes and proteins involved in cell cycle regulation and
apoptosis have been found to be important in the development of
cancers. There is a continuing need in the art for identification
of components of cells which control the cell cycle and apoptosis.
These components can be used both diagnostically and
therapeutically to identify and detect neoplasms as well as to
treat them.
SUMMARY OF THE INVENTION
[0004] It is an object of the present invention to provide methods
and tools for diagnosing and treating neoplasia. These and other
objects of the invention are provided by one or more of the
embodiments which are described below.
[0005] One embodiment of the invention is an isolated and purified
huBUB3 protein having an amino acid sequence which is at least 85%
identical to SEQ ID NO: 2. Percent identity is determined using a
Smith-Waterman homology search algorithm using an affine gap search
with a gap open penalty of 12 and a gap extension penalty of 1.
[0006] Another embodiment of the invention is an isolated and
purified polypeptide comprising at least 8 contiguous amino acids
as shown in SEQ ID NO: 2.
[0007] Even another embodiment of the invention is a huBUB3 fusion
protein comprising a first protein segment and a second protein
segment fused together by means of a peptide bond. The first
protein segment consists of at least 8 contiguous amino acids of a
huBUB3 protein as shown in SEQ ID NO: 2.
[0008] Still another embodiment of the invention is a preparation
of antibodies which specifically bind to a huBUB3 protein having an
amino acid sequence as shown in SEQ ID NO: 2.
[0009] A further embodiment of the invention is a cDNA molecule
which encodes a huBUB3 protein having an amino acid sequence which
is at least 85% identical to SEQ ID NO: 2. Percent identity is
determined using a Smith-Waterman homology search algorithm using
an affine gap search with a gap open penalty of 12 and a gap
extension penalty of 1.
[0010] Yet another embodiment of the invention is a cDNA molecule
which encodes at least 8 contiguous amino acids of SEQ ID NO:
2.
[0011] Another embodiment of the invention is a cDNA molecule
comprising at least 12 contiguous nucleotides of SEQ ID NO: 1.
[0012] Still another embodiment of the invention is a cDNA molecule
which is at least 85% identical to the nucleotide sequence shown in
SEQ ID NO: 1. Percent identity is determined using a Smith-Waterman
homology search algorithm using an affine gap search with a gap
open penalty of 12 and a gap extension penalty of 1.
[0013] Even another embodiment of the invention is an isolated and
purified subgenomic polynucleotide comprising a nucleotide sequence
which hybridizes to SEQ ID NO: 1 after washing with 0.2.times.SSC
at 65.degree. C. The nucleotide sequence encodes a huBUB3 protein
having the amino acid sequence of SEQ ID NO: 2.
[0014] Yet another embodiment of the invention is a construct
comprising a promoter and a polynucleotide segment encoding at
least 8 contiguous amino acids of a huBUB3 protein as shown in SEQ
ID NO: 2. The polynucleotide segment is located downstream from the
promoter. Transcription of the polynucleotide segment initiates at
the promoter.
[0015] Even another embodiment of the invention is a host cell
comprising a construct which comprises a promoter and a
polynucleotide segment encoding at least 8 contiguous amino acids
of a huBUB3 protein having an amino acid sequence as shown in SEQ
ID NO: 2.
[0016] A further embodiment of the invention is a recombinant host
cell comprising a new transcription initiation unit. The new
transcription initiation unit comprises in 5' to 3' order an
exogenous regulatory sequence, an exogenous exon, and a splice
donor site. The new transcription initiation unit is located
upstream of a coding sequence of a huBUB3 gene as shown in SEQ ID
NO: 1. The exogenous regulatory sequence controls transcription of
the coding sequence of the huBUB3 gene.
[0017] Still another embodiment of the invention is a pair of
single stranded DNA primers. The set allows synthesis of all or
part of a huBUB3 gene coding sequence.
[0018] Yet another embodiment of the invention is a nucleic acid
probe complementary to a wild-type huBUB3 gene as shown in SEQ ID
NO: 1.
[0019] Even another embodiment of the invention is a method of
diagnosing a neoplastic tissue of a human. Loss of a wild-type
huBUB3 gene or an expression product of the wild-type huBUB3 gene
from a tissue suspected of being neoplastic is detected. The
wild-type huBUB3 gene has the coding sequence shown in SEQ ID NO:
1. The loss indicates neoplasia of the tissue.
[0020] Another embodiment of the invention is a method of
identifying a neoplastic tissue of a human. Expression of a first
huBUB3 gene in a first tissue of a human suspected of being
neoplastic is compared with expression of a second huBUB3 gene in a
second tissue of the human which is normal. The second huBUB3 gene
has the coding sequence shown in SEQ ID NO: 1. Decreased expression
of the first huBUB3 gene relative to the second huBUB3 gene
identifies the first tissue as being neoplastic.
[0021] Still another embodiment of the invention is a method to aid
in the diagnosis or prognosis of neoplasia in a human. A first
huBUB3 gene, mRNA, or protein in a first tissue of a human
suspected of being neoplastic is compared with a second huBUB3
gene, mRNA, or protein in a second tissue of a human which is
normal. The second huBUB3 gene has the coding sequence shown in SEQ
ID NO: 1. A difference between the first and second huBUB3 genes,
mRNAs, or proteins indicates the presence of neoplastic cells in
the first tissue.
[0022] Even another embodiment of the invention is a method to aid
in detecting a genetic predisposition to neoplasia in a human. A
huBUB3 gene, mRNA, or protein in the fetal tissue of a human is
compared with a wild-type huBUB3 gene, mRNA, or protein. The
wild-type huBUB3 gene has the coding sequence shown in SEQ ID NO:
1. A difference between the huBUB3 gene, mRNA, or protein in the
fetal tissue of the human and the wild-type huBUB3 gene, mRNA, or
protein indicates a genetic predisposition to neoplasia in the
human.
[0023] Yet another embodiment of the invention is a method of
screening test compounds for the ability to interfere with the
binding of a huBUB3 protein to a huBUB1 protein. A test compound is
contacted with at least a huBUB3-binding domain of a huBUB1 protein
as shown in SEQ ID NO: 4 and at least a huBUB1-binding domain of a
huBUB3 protein as shown in SEQ ID NO: 2. The huBUB3-binding domain
binds to the huBUB1-binding domain in the absence of the test
compound. The amount of the huBUB1-binding domain which is bound or
unbound to the huBUB3-binding domain or the amount of the
huBUB3-binding domain which is bound or unbound to the
huBUB1-binding domain in the presence of the test compound is
determined. A test compound which decreases the amount of bound
huBUB1- or huBUB3-binding domains or which increases the amount of
unbound huBUB1- and huBUB3-binding domains is a potential inducer
of mitosis or cell cycle progression.
[0024] Even another embodiment of the invention is a method of
screening test compounds for the ability to interfere with the
binding of a huBUB1 protein to a huBUB3 protein. A cell is with a
test compound. The cell comprises a first fusion protein, a second
fusion protein, and a reporter gene. The first fusion protein
comprises (1) at least a huBUB1-binding domain of a huBUB3 protein
as shown in SEQ ID NO: 2 and (2) either a DNA binding domain or a
transcriptional activating domain. The second fusion protein
comprises at least a huBUB3-binding domain of a huBUB1 protein as
shown in SEQ ID NO: 4. The huBUB1-binding domain binds to the
huBUB3-binding domain. If the first fusion protein comprises a DNA
binding domain, then the second fusion protein comprises a
transcriptional activating domain. If the first fusion protein
comprises a transcriptional activating domain, then the second
fusion protein comprises a DNA binding domain. The interaction of
the first and second fusion proteins reconstitutes a
sequence-specific transcription activating factor. The reporter
gene comprises a DNA sequence to which the DNA binding domain
specifically binds. Expression of the reporter gene is measured. A
test compound which decreases the expression of the reporter gene
is a potential inducer of mitosis or cell cycle progression.
[0025] Another embodiment of the invention is a method of
identifying compounds which interfere with the binding of a huBUB3
protein to a huBUB1 protein. A cell which comprises three
recombinant DNA constructs is provided. A first construct encodes a
first polypeptide fused to a sequence-specific DNA-binding domain,
a second construct encodes a second polypeptide fused to a
transcriptional activation domain, and a third construct comprises
a reporter gene downstream from a DNA element which is recognized
by the sequence-specific DNA-binding domain. The first polypeptide
comprises a huBUB1-binding domain of a huBUB3 protein as shown in
SEQ ID NO: 2 and the second polypeptide comprises a huBUB3-binding
domain of a huBUB1 protein as shown in SEQ ID NO: 4 or the first
polypeptide comprises a huBUB3-binding domain of a huBUB1 protein
as shown in SEQ ID NO: 4 and the second polypeptide comprises a
huBUB1-binding domain of a huBUB3 protein as shown in SEQ ID NO: 2.
The cell is contacted with a test compound. Expression of the
reporter gene in the presence of the test compound is determined. A
test compound which decreases expression of the reporter gene is
identified as a candidate therapeutic agent.
[0026] Yet another embodiment of the invention is a cell which
comprises three recombinant DNA constructs. A first construct
encodes a first polypeptide fused to a sequence-specific
DNA-binding domain, a second construct encodes a second polypeptide
fused to a transcriptional activation domain, and a third construct
comprises a reporter gene downstream from a DNA element which is
recognized by the sequence-specific DNA-binding domain. The first
polypeptide comprises a huBUB1-binding domain of a huBUB3 protein
as shown in SEQ ID NO: 2 and the second polypeptide comprises a
huBUB3-binding domain of a huBUB1 protein as shown in SEQ ID NO: 4,
or the first polypeptide comprises a huBUB3-binding domain of a
huBUB1 protein as shown in SEQ ID NO: 4 and the second polypeptide
comprises a huBUB1-binding domain of a huBUB3 protein as shown in
SEQ ID NO: 2.
[0027] Even another embodiment of the invention is a method of
determining the quantity of huBUB1 which binds to huBUB3, or of
huBUB3 which binds to huBUB1. A first protein and a second protein
are contacted. If the first protein is huBUB3 then the second
protein is huBUB1 and if the first protein is huBUB1 the second
protein is huBUB3. The quantity of the first protein which is bound
to the second protein is determined.
[0028] Still another embodiment of the invention is a method for
identifying compounds which decrease the kinase activity of a
huBUB1-huBUB3 complex. A huBUB1-huBUB3 complex is contacted with a
test compound. The kinase activity of the huBUB1-huBUB3 complex is
determined. A compound which decreases kinase activity of the
huBUB1-huBUB3 complex is identified as a candidate therapeutic
agent.
[0029] The present invention thus provides the art with the
sequence of the human BUB3 gene and protein. This information
allows highly specific assays to be done to assess the neoplastic
status of a particular tumor tissue.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1. Compiled huBUB3 .about.2.7 kb cDNA sequence. (A)
ESTs and experimentally determined sequence data are arrayed
relative to the final cDNA sequence, along with the annealing
positions of some of the primers described in the text. (B)
Nucleotide sequence data describing huBUB3 .about.2.7 kb cDNA. By
omitting DNA sequence between the exon junctions
CCAAG.vertline.TCACC (SEQ ID NO: 16) and TGCAG.vertline.GTCCA (SEQ
ID NO: 17), this sequence also describes the .about.1.4 kb huBUB3
cDNA sequence (see text).
[0031] FIG. 2. Alignment of predicted huBUB3 gene products from
.about.1.4 kb cDNA and .about.2.7 kb cDNA.
[0032] FIG. 3. Alignment of related proteins scBUB3, muBUB3, huBUB3
(2.7), hu-rae1, rae-1 (Schizosaccharomyces pombe), scYET7. scBUB3,
hu-rae1, sp-rae1 and scYET7 sequences were obtained from Genbank.
The murine sequence is derived from Genbank entry U67327, corrected
using overlapping murine EST entries for a reading frame error
which truncated the predicted reading frame at the N-terminus.
Predicted WD40 repeat regions are indicated with roman numerals.
Conserved residues are indicated below the alignments.
[0033] FIG. 4. FLAG-huBUB3 binds to huBUB1. (A) Plasmids with
various inserts were transcribed and translated in the presence of
.sup.35S with the aid of a T7 RNAP-based transcription/translation
kit (Promega). Translation products were then separated on 10-20%
SDS-PAGE gels and autoradiographed. (B) Co-immunoprecipitation
assay. Combinations of plasmids were co-translated and soluble
translation products were subjected to FLAG immunoprecipitation,
using M1 anti-FLAG monoclonal antibody conjugated to agarose
(Kodak). Fractions of supernatant and agarose bead pellet fractions
were separated by SDS-PAGE and autoradiographed, as indicated.
[0034] FIG. 5. mRNA expression of BUB/MAD homologs in various
tissues. In separate experiments, .sup.32P-labeled probes were
prepared from cDNA fragments from indicated genes and annealed to a
blot prepared from polyA.sup.+ mRNA from various tissues. Actin
cDNA probe (Clontech) was also annealed as a control. Lane 1,
spleen; lane 2, thymus; lane 3, prostate; lane 4 testis; lane 5,
ovary; lane 6, small intestine; lane 7, colon (mucosal lining);
lane 8, peripheral blood leukocytes.
DETAILED DESCRIPTION
[0035] It is a discovery of the present invention that the human
BUB3 protein (huBUB3) is involved in cell cycle control and
apoptosis. huBUB3 protein also binds to a human BUB1 (huBUB1)
protein, and this complex has kinase activity. The huBUB3 gene has
the coding sequence shown in SEQ ID NO: 1. Mutations in huBUB3 are
diagnostic of neoplasia. In addition, the mutational status of
huBUB3 can be determined to indicate which chemotherapeutic regimes
should be used. For example, because wild-type huBUB3 confers
resistance to microtubule poisons such as vincristine, vinblastine,
taxol, and taxotere, the finding of a mutation in huBUB3 will
indicate that these agents can be used efficaciously. In contrast,
finding a wild-type huBUB3 will suggest the use of other
agents.
[0036] A huBUB3 protein has the amino acid sequence shown in SEQ ID
NO: 2. huBUB3 polypeptides differ in length from full-length huBUB3
and contain 6, 8, 10, 12, 15, 18, 20, 25, 30, 35, 40, 45, 50, 75,
80, 90, 100, 125, 150, 175, 200, 225, 250, or 275 or more
contiguous amino acids of a huBUB3 protein.
[0037] Variants of huBUB3 protein and huBUB3 polypeptides can also
occur. Biologically active variants of full-length huBUB3 bind to
huBUB1. huBUB3 variants can be naturally or non-naturally
occurring. Naturally occurring huBUB3 variants are found in humans
or other species and comprise amino acid sequences which are
substantially identical to the amino acid sequence shown in SEQ ID
NO: 2. Species homologs of huBUB3 can be obtained using huBUB3
subgenomic polynucleotides of the invention, described below, to
make suitable probes or primers to screening cDNA expression
libraries from other species, such as mice, monkeys, yeast, or
bacteria, identifying cDNAs which encode homologs of huBUB3, and
expressing the cDNAs as is known in the art.
[0038] Non-naturally occurring huBUB3 variants which retain
substantially the same biological activities, such as the ability
to bind to huBUB1, as naturally occurring huBUB3 variants are also
included here. Preferably, naturally or non-naturally occurring
huBUB3 variants have amino acid sequences which are at least 85%,
90%, or 95% identical to amino acid sequences shown in SEQ ID NO:
2. More preferably, the molecules are at least 98% or 99%
identical. Percent identity between a putative huBUB3 variant and
the amino acid sequence of SEQ ID NO: 2 is determined using the
Smith-Waterman homology search algorithm using an affine gap search
with a gap open penalty of 12 and a gap extension penalty of 1. The
Smith-Waterman homology search algorithm is taught in Smith and
Waterman, Adv. Appl. Math. (1981) 2:482-489.
[0039] Guidance in determining which amino acid residues can be
substituted, inserted, or deleted without abolishing biological or
immunological activity can be found using computer programs well
known in the art, such as DNASTAR software. Preferably, amino acid
changes in huBUB3 variants are conservative amino acid changes,
i.e., substitutions of similarly charged or uncharged amino acids.
A conservative amino acid change involves substitution of one of a
family of amino acids which are related in their side chains.
Naturally occurring amino acids are generally divided into four
families: acidic (aspartate, glutamate), basic (lysine, arginine,
histidine), non-polar (alanine, valine, leucine, isoleucine,
proline, phenylalanine, methionine, tryptophan), and uncharged
polar (glycine, asparagine, glutamine, cystine, serine, threonine,
tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are
sometimes classified jointly as aromatic amino acids.
[0040] It is reasonable to expect that an isolated replacement of a
leucine with an isoleucine or valine, an aspartate with a
glutamate, a threonine with a serine, or a similar replacement of
an amino acid with a structurally related amino acid will not have
a major effect on the biological properties of the resulting huBUB3
variant.
[0041] Whether an amino acid change results in a functional huBUB3
protein or polypeptide can readily be determined by assaying its
ability to bind to huBUB1 and the ability of the huBUB3-huBUB1
complex to phosphorylate a substrate such as huBUB1, huBUB3, or
histone H1. Other in vitro kinase substrates, such as myelin basic
protein, casein, and myosin light chain, can also be used. In vitro
kinase assays are taught, for example, in WO 96/36642, which is
incorporated herein by reference. Binding of a huBUB3 variant to
huBUB1 can be detected, for example, using specific antibodies,
which are disclosed herein.
[0042] huBUB3 variants include glycosylated forms of huBUB3,
aggregative conjugates of huBUB3 with other molecules, and covalent
conjugates of huBUB3 with unrelated chemical moieties. Covalent
variants can be prepared by linking functionalities to groups which
are found in the amino acid chain or at the N- or C-terminal
residue, as is known in the art. huBUB3 variants also include
allelic variants, species variants, and muteins. Truncations or
deletions of regions which do not affect the binding of huBUB3 to
huBUB1 are also huBUB3 variants.
[0043] A subset of mutants, called muteins, is a group of
polypeptides in which neutral amino acids, such as serines, are
substituted for cysteine residues which do not participate in
disulfide bonds. These mutants may be stable over a broader
temperature range than native huBUB3. See Mark et al., U.S. Pat.
No. 4,959,314.
[0044] huBUB3 can be extracted from huBUB3-producing human cells,
such as spleen, thymus, prostate, testis, small intestine, colon,
peripheral blood lymphocytes, heart, brain, placenta, lung, liver,
skeletal muscle, kidney, or pancreas using standard biochemical
methods. These methods include, but are not limited to, size
exclusion chromatography, ammonium sulfate fractionation, ion
exchange chromatography, affinity chromatography, crystallization,
electrofocusing, and preparative gel electrophoresis. An isolated
and purified huBUB3 protein or polypeptide is separated from other
compounds which normally associate with a huBUB3 protein or
polypeptide in a cell, such as certain proteins, carbohydrates,
lipids, or subcellular organelles. A preparation of isolated and
purified huBUB3 proteins or polypeptides is at least 80% pure;
preferably, the preparations are 90%, 95%, or 99% pure. Purity of
the preparations can be assessed by any means known in the art,
such as SDS-polyacrylamide gel electrophoresis.
[0045] huBUB3 proteins, polypeptides, and variants can also be
produced by recombinant DNA methods or by synthetic chemical
methods. For production of recombinant huBUB3 proteins,
polypeptides, or variants, coding sequences selected from the
huBUB3 nucleotide sequence shown in SEQ ID NO: 1, or variants of
that sequence which encode huBUB3 protein, can be expressed in
known prokaryotic or eukaryotic expression systems (see below).
Bacterial, yeast, insect, or mammalian expression systems can be
used, as is known in the art.
[0046] Alternatively, synthetic chemical methods, such as solid
phase peptide synthesis, can be used to synthesize a huBUB3 protein
or polypeptide. General means for the production of peptides,
analogs or derivatives are outlined in CHEMISTRY AND BIOCHEMISTRY
OF AMINO ACIDS, PEPTIDES, AND PROTEINS--A SURVEY OF RECENT
DEVELOPMENTS, B. Weinstein, (1983). Substitution of D-amino acids
for the normal L-stereoisomer can be carried out to increase the
half-life of the molecule. huBUB3 variants can be similarly
produced.
[0047] Fusion proteins comprising at least 6, 8, 10, 12, 15, 18,
20, 25, 50, 60, 75, 80, 90, 100, 125, 150, 175, 200, 225, 250, or
275 or more contiguous huBUB3 amino acids can also be constructed.
huBUB3 fusion proteins are useful for generating antibodies against
huBUB3 amino acid sequences and for use in various assay systems.
For example, huBUB3 fusion proteins can be used to identify
proteins which interact with huBUB3 protein or which interfere with
the binding of huBUB3 to huBUB1. Physical methods, such as protein
affinity chromatography, or library-based assays for
protein-protein interactions, such as the yeast two-hybrid or phage
display systems, can also be used for this purpose. Such methods
are well known in the art and can also be used as drug screens.
[0048] A huBUB3 fusion protein comprises two protein segments fused
together by means of a peptide bond. The first protein segment
comprises at least 6, 8, 10, 12, 15, 18, 20, 25, 30, 35, 40, 50,
60, 75, 80, 90, 100, 125, 150, 175, 200, 225, 250, or 275 or more
contiguous amino acids of a huBUB3 protein. For example, a huBUB3
fusion protein can comprise the huBUB1 binding site. huBUB3 amino
acids can be selected from the amino acid sequence shown in SEQ ID
NO: 2 or from a biologically active variant of that sequence, such
as those described above. The first protein segment can also
comprise full-length huBUB3.
[0049] The second protein segment can be a full-length protein or a
protein fragment or polypeptide. Proteins commonly used in fusion
protein construction include .beta.-galactosidase,
.beta.-glucuronidase, green fluorescent protein (GFP),
autofluorescent proteins, including blue fluorescent protein (BFP),
glutathione-S-transferase (GST), luciferase, horseradish peroxidase
(HRP), and chloramphenicol acetyltransferase (CAT). Additionally,
epitope tags are used in fusion protein constructions, including
histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags,
Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Other fusion
constructions can include maltose binding protein (MBP), S-tag, Lex
a DNA binding domain (DBD) fusions, GAL4 DNA binding domain
fusions, and herpes simplex virus (HSV) BP16 protein fusions.
[0050] These fusions can be made, for example, by covalently
linking two protein segments or by standard procedures in the art
of molecular biology. Recombinant DNA methods can be used to
prepare huBUB3 fusion proteins, for example, by making a DNA
construct which comprises coding sequences selected from SEQ ID NO:
1 in proper reading frame with nucleotides encoding the second
protein segment and expressing the DNA construct in a host cell, as
is known in the art. Many kits for constructing fusion proteins are
available from companies that supply research labs with tools for
experiments, including, for example, Promega Corporation (Madison,
Wis.), Stratagene (La Jolla, Calif.), Clontech (Mountain View,
Calif.), Santa Cruz Biotechnology (Santa Cruz, Calif.), MBL
International Corporation (MIC; Watertown, Mass.), and Quantum
Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
[0051] Isolated and purified huBUB3 proteins, polypeptides,
variants, or fusion proteins can be used as immunogens, to obtain
preparations of antibodies which specifically bind to huBUB3
protein. The antibodies can be used, inter alia, to detect
wild-type huBUB3 protein or huBUB3-huBUB1 complexes in human tissue
and fractions thereof. The antibodies can also be used to detect
the presence of mutations in the huBUB3 gene which result in under-
or over-expression of a huBUB3 protein or in expression of a huBUB3
protein with altered size or electrophoretic mobility. Antibodies
which specifically bind to huBUB3 protein can be similarly used and
prepared, as described below for huBUB3 antibodies.
[0052] Any type of antibody known in the art can be generated to
bind specifically to huBUB3 epitopes. For example, preparations of
polyclonal and monoclonal antibodies can be made using standard
methods which are well known in the art. Similarly, single-chain
antibodies can also be prepared. Single-chain antibodies which
specifically bind to huBUB3 epitopes can be isolated, for example,
from single-chain immunoglobulin display libraries, as is known in
the art. The library is "panned" against huBUB3 amino acid
sequences, and a number of single chain antibodies which bind with
high-affinity to different epitopes of huBUB3 protein can be
isolated. Hayashi et al., 1995, Gene 160: 129-30. Single-chain
antibodies can also be constructed using a DNA amplification
method, such as the polymerase chain reaction (PCR), using
hybridoma cDNA as a template. Thirion et al., 1996, Eur. J. Cancer
Prev. 5: 507-11.
[0053] Single-chain antibodies can be mono- or bispecific, and can
be bivalent or tetravalent. Construction of tetravalent, bispecific
single-chain antibodies is taught, for example, in Coloma and
Morrison, 1997, Nat. Biotechnol. 15: 159-63. Construction of
bivalent, bispecific single-chain antibodies is taught inter alia
in Mallender and Voss, 1994, J. Biol. Chem. 269: 199-206.
[0054] A nucleotide sequence encoding a single-chain antibody can
be constructed using manual or automated nucleotide synthesis,
cloned into an expression construct using standard recombinant DNA
methods, and introduced into a cell to express the coding sequence,
as described below. Alternatively, single-chain antibodies can be
produced directly using, for example, filamentous phage technology.
Verhaar et al., 1995, Int. J. Cancer 61: 497-501; Nicholls etal.,
1993, J. Immunol. Meth. 165: 81-91.
[0055] Monoclonal and other antibodies can also be "humanized" in
order to prevent a patient from mounting an immune response against
the antibody when it is used therapeutically. Such antibodies may
be sufficiently similar in sequence to human antibodies to be used
directly in therapy or may require alteration of a few key
residues. Sequence differences between, for example, rodent
antibodies and human sequences can be minimized by replacing
residues which differ from those in the human sequences, for
example, by site directed mutagenesis of individual residues, or by
grating of entire complementarity determining regions.
Alternatively, one can produce humanized antibodies using
recombinant methods, as described in GB2188638B. Antibodies which
specifically bind to huBUB3 epitopes can contain antigen binding
sites which are either partially or fully humanized, as disclosed
in U.S. Pat. No. 5,565,332.
[0056] Other types of antibodies can be constructed and used
therapeutically in methods of the invention. For example, chimeric
antibodies can be constructed as disclosed in WO 93/03151. Binding
proteins which are derived from immunoglobulins and which are
multivalent and multispecific, such as the "diabodies" described in
WO 94/13804, can also be prepared.
[0057] Antibodies of the invention can be purified by methods well
known in the art. For example, antibodies can be affinity purified
by passing the antibodies over a column to which a huBUB3 protein,
polypeptide, variant, or fusion protein is bound. The bound
antibodies can then be eluted from the column, using a buffer with
a high salt concentration.
[0058] huBUB3-specific antibodies specifically bind to epitopes
present in a full-length huBUB3 protein having the amino acid
sequence shown in SEQ ID NO: 2, to huBUB3 polypeptides, or to
huBUB3 variants, either alone or as part of a fusion protein.
Preferably, huBUB3 epitopes are not present in other human
proteins. Typically, at least 6, 8, 10, or 12 contiguous amino
acids are required to form an epitope. However, epitopes which
involve non-contiguous amino acids may require more, e.g., at least
15, 25, or 50 amino acids.
[0059] Antibodies which specifically bind to epitopes of huBUB3
proteins, polypeptides, fusion proteins, or biologically active
variants can be used in immunochemical assays, including but not
limited to Western blots, ELISAs, radioimmunoassays,
immunohistochemical assays, immunoprecipitations, or other
immunochemical assays known in the art. Typically, antibodies of
the invention provide a detection signal at least 5-, 10-, or
20-fold higher than a detection signal provided with other proteins
when used in such immunochemical assays. Preferably, antibodies
which specifically bind to huBUB3 epitopes do not detect other
proteins in immunochemical assays and can immunoprecipitate huBUB3
protein or polypeptides from solution.
[0060] Antibodies can be purified by methods well known in the art.
Preferably, the antibodies are affinity purified, by passing the
antibodies over a column to which a huBUB3 protein, polypeptide,
variant, or fusion protein is bound. The bound antibodies can then
be eluted from the column, for example, using a buffer with a high
salt concentration.
[0061] The huBUB3 gene has the coding sequence shown in SEQ ID NO:
1. Subgenomic polynucleotides of the invention contain less than a
whole chromosome and can be single- or double-stranded. Preferably,
the polynucleotides are intron-free. Isolated huBUB3 subgenomic
polynucleotides can comprise at least 6, 8, 10, 12, 15, 20, 25, 30,
35, 40, 45, 50, 75, 100, 125, 150, 175, 200, 300, 400, 500, 600,
700, 800, 900, 1000, 1250, 1500, 1750, 2000, 2250, or 2500 or more
contiguous nucleotides selected from the nucleotide sequence shown
in SEQ ID NO: 1 or its complement. In one embodiment, a huBUB3
subgenomic polynucleotide comprises nucleotides which encode the
huBUB1-binding site.
[0062] The complement of the nucleotide sequence shown in SEQ ID
NO: 1 is a contiguous nucleotide sequence which forms Watson-Crick
base pairs with the contiguous nucleotide sequence shown in SEQ ID
NO: 1. The complement of the nucleotide sequence shown in SEQ ID
NO: 1 (the antisense strand) is also a subgenomic polynucleotide
and can be used provide huBUB3 antisense oligonucleotides. huBUB3
subgenomic polynucleotides also include polynucleotides which
encode huBUB3-specific single-chain antibodies and ribozymes or
which encode fusion proteins comprising huBUB3 amino acid
sequences.
[0063] Degenerate nucleotide sequences encoding amino acid
sequences of huBUB3 protein and or variants, as well as homologous
nucleotide sequences which are at least 65%, 75%, 85%, 90%, 95%,
98%, or 99% identical to the nucleotide sequence shown in SEQ ID
NO: 1, are also huBUB3 subgenomic polynucleotides. Percent sequence
identity between the sequence of a wild-type huBUB3 subgenomic
polynucleotide and a homologous huBUB3 nucleotide sequence is
determined using computer programs which employ the Smith-Waterman
algorithm, for example as implemented in the MPSRCH program (Oxford
Molecular), using an affine gap search with the following
parameters: a gap open penalty of 12 and a gap extension penalty of
1.
[0064] Typically, homologous huBUB3 sequences can be confirmed by
hybridization under stringent conditions, as is known in the art.
For example, using the following wash conditions--2.times.SSC (0.3
M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature
twice, 30 minutes each; then 2.times.SSC, 0.1% SDS, 50.degree. C.
once, 30 minutes; then 2.times.SSC, room temperature twice, 10
minutes each--homologous sequences can be identified which contain
at most about 25-30% basepair mismatches. More preferably,
homologous nucleic acid strands contain 15-25% basepair mismatches,
even more preferably 5-15% basepair mismatches.
[0065] Species homologs of huBUB3 subgenomic polynucleotides of the
invention can also be identified by making suitable probes or
primers and screening cDNA expression libraries from other species,
such as mice, monkeys, yeast, or bacteria, as well as human cDNA
expression libraries. It is well known that the T.sub.m of a
double-stranded DNA decreases by 1-1.5.degree. C. with every 1%
decrease in homology (Bonner et al., J. Mol. Biol. 81, 123 (1973).
Homologous huBUB3 human polynucleotides or huBUB3 polynucleotides
of other species can therefore be identified, for example, by
hybridizing a putative homologous huBUB3 polynucleotide with a
polynucleotide having the nucleotide sequence of SEQ ID NO: 1 to
form a test hybrids, comparing the melting temperature of the test
hybrid with the melting temperature of a hybrid comprising a
polynucleotide having SEQ ID NO: 1 and a polynucleotide which is
perfectly complementary to SEQ ID NO: 1, and calculating the number
or percent of basepair mismatches within the test hybrid.
[0066] Nucleotide sequences which hybridize to the coding sequence
shown in SEQ ID NO: 1 or its complement following stringent
hybridization and/or wash conditions are also huBUB3 subgenomic
polynucleotides of the invention. Stringent wash conditions are
well known and understood in the art and are disclosed, for
example, in Sambrook et al., MOLECULAR CLONING: A LABORATORY
MANUAL, 2d ed., 1989, at pages 9.50-9.51.
[0067] Typically, for stringent hybridization conditions a
combination of temperature and salt concentration should be chosen
that is approximately 12-20.degree. C. below the calculated T.sub.m
of the hybrid under study. The T.sub.m of a hybrid between the
huBUB3 sequence shown in SEQ ID NO: 1 and a polynucleotide sequence
which is 65%, 75%, 85%, 90%, 95%, 96%,97%, 98%, or 99% identical to
SEQ ID NO: 1 can be calculated, for example, using the equation of
Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390
(1962):
T.sub.m=81.5.degree.
C.-16.6(log.sub.10[Na.sup.+])+0.41(%G+C)-0.63(%formam- ide)-600/l),
where l=the length of the hybrid in basepairs.
[0068] Stringent wash conditions include, for example, 4.times.SSC
at 65.degree. C., or 50% formamide, 4.times.SSC at 42.degree. C.,
or 0.5.times.SSC, 0.1% SDS at 65.degree. C. Highly stringent wash
conditions include, for example, 0.2.times.SSC at 65.degree. C.
[0069] huBUB3 subgenomic polynucleotides can be isolated and
purified free from other nucleotide sequences using standard
nucleic acid purification techniques. For example, restriction
enzymes and probes can be used to isolate polynucleotide fragments
which comprise nucleotide sequences encoding a huBUB3 protein.
Isolated and purified subgenomic polynucleotides are in
preparations which are free or at least 90% free of other
molecules.
[0070] Complementary DNA (cDNA) molecules which encode huBUB3
proteins are also huBUB3 subgenomic polynucleotides of the
invention. huBUB3 cDNA molecules can be made with standard
molecular biology techniques, using huBUB3 mRNA as a template.
huBUB3 cDNA molecules can thereafter be replicated using molecular
biology techniques known in the art and disclosed in manuals such
as Sambrook et al., 1989. An amplification technique, such as the
polymerase chain reaction (PCR), can be used to obtain additional
copies of subgenomic polynucleotides of the invention, using either
human genomic DNA or cDNA as a template.
[0071] Alternatively, synthetic chemistry techniques can be used to
synthesize huBUB3 subgenomic polynucleotide molecules of the
invention. The degeneracy of the genetic code allows alternate
nucleotide sequences to be synthesized which will encode a huBUB3
protein having the amino acid sequence shown in SEQ ID NO: 2 or a
biologically active variant of that sequence. All such nucleotide
sequences are within the scope of the present invention.
[0072] The invention also provides polynucleotide probes which can
be used to detect huBUB3 sequences, for example, in hybridization
protocols such as Northern or Southern blotting or in situ
hybridizations. Polynucleotide probes of the invention comprise at
least 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, or 40 or more
contiguous nucleotides selected from SEQ ID NO: 1. Polynucleotide
probes of the invention can comprise a detectable label, such as a
radioisotopic, fluorescent, enzymatic, or chemiluminescent
label.
[0073] huBUB3 subgenomic polynucleotides can be used as primers to
obtain additional copies of huBUB3 polynucleotides. huBUB3
subgenomic polynucleotides can also be used to express huBUB3 mRNA,
protein, polypeptides, antibodies, or fusion proteins and to
generate huBUB3 antisense oligonucleotides and ribozymes.
[0074] A huBUB3 subgenomic polynucleotide comprising huBUB3 coding
sequences can be used in a construct, such as a DNA or RNA
construct. huBUB3 constructs can be used, for example, to express
all or a portion of a huBUB3 protein in a host cell. Preferably,
the huBUB3 subgenomic polynucleotide is inserted into an expression
plasmid (for example, the Ecdyson system, pIND, In Vitro Gene).
huBUB3 subgenomic polynucleotides can be propagated in vectors and
cell lines using techniques well known in the art. huBUB3
subgenomic polynucleotides can be on linear or circular molecules.
They can be on autonomously replicating molecules or on molecules
without replication sequences. They can be regulated by their own
or by other regulatory sequences, as is known in the art.
[0075] A host cell comprising a huBUB3 expression construct can
then be used to express all or a portion of a huBUB3 protein. Host
cells comprising huBUB3 expression constructs can be prokaryotic or
eukaryotic. A variety of host cells are available for use in
bacterial, yeast, insect, and human expression systems and can be
used to express or to propagate huBUB3 expression constructs (see
below). Expression constructs can be introduced into host cells
using any technique known in the art. These techniques include
transferrin-polycation-mediated DNA transfer, transfection with
naked or encapsulated nucleic acids, liposome-mediated cellular
fusion, intracellular transportation of DNA-coated latex beads,
protoplast fusion, viral infection, electroporation, "gene gun,"
and calcium phosphate-mediated transfection.
[0076] A huBUB3 expression construct comprises a promoter which is
functional in a chosen host cell. The skilled artisan can readily
select an appropriate promoter from the large number of cell
type-specific promoters known and used in the art. The expression
construct can also contain a transcription terminator which is
functional in the host cell. The expression construct comprises a
polynucleotide segment which encodes all or a portion of the huBUB3
protein, variant, fusion protein, antibody, or ribozyme. The
polynucleotide segment is located downstream from the promoter.
Transcription of the polynucleotide segment initiates at the
promoter. The expression construct can be linear or circular and
can contain sequences, if desired, for autonomous replication.
[0077] Bacterial systems for expressing huBUB3 expression
constructs include those described in Chang et al., Nature (1978)
275: 615, Goeddel et al., Nature (1979) 281: 544, Goeddel et al.,
Nucleic Acids Res. (1980) 8: 4057, EP 36,776, U.S. Pat. No.
4,551,433, deBoer et al., Proc. Natl. Acad. Sci. USA (1983) 80:
21-25, and Siebenlist et al., Cell (1980) 20: 269.
[0078] Expression systems in yeast include those described in
Hinnen et al., Proc. Natl. Acad. Sci. USA (1978) 75: 1929; Ito et
al., J. Bacteriol. (1983) 153: 163; Kurtz et al., Mol. Cell. Biol.
(1986) 6: 142; Kunze et al., J. Basic Microbiol. (1985) 25: 141;
Gleeson et al., J. Gen. Microbiol. (1986) 132: 3459, Roggenkamp et
al., Mol. Gen. Genet. (1986) 202: 302) Das et al., J. Bacteriol.
(1984) 158: 1165; De Louvencourt et al., J. Bacteriol. (1983) 154:
737, Van den Berg et al., Bio/Technology (1990) 8: 135; Kunze et
al., J. Basic Microbiol. (1985) 25: 141; Cregg et al., Mol. Cell.
Biol. (1985) 5: 3376, U.S. Pat. No. 4,837,148, U.S. Pat. No.
4,929,555; Beach and Nurse, Nature (1981) 300: 706; Davidow et al.,
Curr. Genet. (1985) 10: 380, Gaillardin et al., Curr. Genet. (1985)
10: 49, Ballance et al., Biochem. Biophys. Res. Commun. (1983) 112:
284-289; Tilburn et al., Gene (1983) 26: 205-221, Yelton et al.,
Proc. Natl. Acad. Sci. USA (1984) 81: 1470-1474, Kelly and Hynes,
EMBO J. (1985) 4: 475479; EP 244,234, and WO 91/00357.
[0079] Expression of huBUB3 expression constructs in insects can be
carried out as described in U.S. Pat. No. 4,745,051, Friesen et al.
(1986) "The Regulation of Baculovirus Gene Expression" in: THE
MOLECULAR BIOLOGY OF BACULOVIRUSES (W. Doerfler, ed.), EP 127,839,
EP 155,476, and Vlak et al., J. Gen. Virol. (1988) 69: 765-776,
Miller et al., Ann. Rev. Microbiol. (1988) 42: 177, Carbonell et
al., Gene (1988) 73: 409, Maeda et al., Nature (1985) 315: 592-594,
Lebacq-Verheyden et al., Mol. Cell. Biol. (1988) 8: 3129; Smith et
al., Proc. Natl. Acad. Sci. USA (1985) 82: 8404, Miyajima et al.,
Gene (1987) 58: 273; and Martin et al., DNA (1988) 7: 99. Numerous
baculoviral strains and variants and corresponding permissive
insect host cells from hosts are described in Luckow et al.,
Bio/Technology (1988) 6: 47-55, Miller et al., in GENETIC
ENGINEERING (Setlow, J. K. et al. eds.), Vol. 8 (Plenum Publishing,
1986), pp. 277-279, and Maeda et al., Nature, (1985) 315:
592-594.
[0080] Mammalian expression of huBUB3 expression constructs can be
achieved as described in Dijkema et al., EMBO J. (1985) 4: 761,
Gorman et al., Proc. Natl. Acad. Sci. USA (1982b) 79: 6777, Boshart
et al., Cell (1985) 41: 521 and U.S. Pat. No. 4,399,216. Other
features of mammalian expression of huBUB3 expression constructs
can be facilitated as described in Ham and Wallace, Meth. Enz.
(1979) 58: 44, Barnes and Sato, Anal. Biochem. (1980) 102: 255,
U.S. Pat. No. 4,767,704, U.S. Pat. No. 4,657,866, U.S. Pat. No.
4,927,762, U.S. Pat. No. 4,560,655, WO 90/103430, WO 87/00195, and
U.S. Pat. No. RE 30,985.
[0081] Subgenomic polynucleotides of the invention can also be used
in gene delivery vehicles, for the purpose of delivering a huBUB3
mRNA or oligonucleotide (either with the sequence of native huBUB3
mRNA or its complement), full-length huBUB3 protein, huBUB3 fusion
protein, huBUB3 polypeptide, or huBUB3-specific ribozyme or
single-chain antibody into a cell, preferably a eukaryotic cell.
According to the present invention, a gene delivery vehicle can be,
for example, naked plasmid DNA, a viral expression vector
comprising a huBUB3 subgenomic polynucleotide, or a huBUB3
subgenomic polynucleotide in conjunction with a liposome or a
condensing agent.
[0082] In one embodiment of the invention, the gene delivery
vehicle comprises a promoter and a huBUB3 subgenomic
polynucleotide. Preferred promoters are tissue-specific promoters
and promoters which are activated by cellular proliferation, such
as the thymidine kinase and thymidylate synthase promoters. Other
preferred promoters include promoters which are activatable by
infection with a virus, such as the .alpha.- and .beta.-interferon
promoters, and promoters which are activatable by a hormone, such
as estrogen. Other promoters which can be used include the Moloney
virus LTR, the CMV promoter, and the mouse albumin promoter.
[0083] A huBUB3 gene delivery vehicle can comprise viral sequences
such as a viral origin of replication or packaging signal. These
viral sequences can be selected from viruses such as astrovirus,
coronavirus, orthomyxovirus, papovavirus, paramyxovirus,
parvovirus, picomavirus, poxvirus, retrovirus, togavirus or
adenovirus. In a preferred embodiment, the huBUB3 gene delivery
vehicle is a recombinant retroviral vector. Recombinant
retroviruses and various uses thereof have been described in
numerous references including, for example, Mann et al., Cell 33:
153, 1983, Cane and Mulligan, Proc. Nat'l. Acad. Sci. USA 81: 6349,
1984, Miller et al., Human Gene Therapy 1: 5-14, 1990, U.S. Pat.
Nos. 4,405,712, 4,861,719, and 4,980,289, and PCT Application Nos.
WO 89/02,468, WO 89/05,349, and WO 90/02,806. Numerous retroviral
gene delivery vehicles can be utilized in the present invention,
including for example those described in EP 0,415,731; WO 90/07936;
WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5,219,740; WO
9311230; WO 9310218; Vile and Hart, Cancer Res. 53: 3860-3864,
1993; Vile and Hart, Cancer Res. 53: 962-967, 1993; Ram et al.,
Cancer Res. 53: 83-88, 1993; Takamiya et al., J. Neurosci. Res. 33:
493-503, 1992; Baba et al., J. Neurosurg. 79: 729-735, 1993 (U.S.
Pat. No. 4,777,127, GB 2,200,651, EP 0,345,242 and WO91/02805).
[0084] Particularly preferred retroviruses are derived from
retroviruses which include avian leukosis virus (ATCC Nos. VR-535
and VR-247), bovine leukemia virus (VR-1315), murine leukemia virus
(MLV), mink-cell focus-inducing virus (Koch et al., J. Vir. 49:
828, 1984; and Oliff et al., J. Vir. 48: 542, 1983), murine sarcoma
virus (ATCC Nos. VR-844, 45010 and 45016), reticuloendotheliosis
virus (ATCC Nos VR-994, VR-770 and 45011), Rous sarcoma virus,
Mason-Pfizer monkey virus, baboon endogenous virus, endogenous
feline retrovirus (e.g., RD114), and mouse or rat gL30 sequences
used as a retroviral vector. Particularly preferred strains of MLV
from which recombinant retroviruses can be generated include 4070A
and 1504A (Hartley and Rowe, J. Vir. 19: 19, 1976), Abelson (ATCC
No. VR-999), Friend (ATCC No. VR-245), Graffi (Ru et al., J. Vir.
67: 4722, 1993; and Yantchev Neoplasma 26: 397, 1979), Gross (ATCC
No. VR-590), Kirsten (Albino et al., J. Exp. Med. 164: 1710, 1986),
Harvey sarcoma virus (Manly et al., J. Vir. 62: 3540, 1988; and
Albino et al., J. Exp. Med. 164: 1710, 1986) and Rauscher (ATCC No.
VR-998), and Moloney MLV (ATCC No. VR-190). A particularly
preferred non-mouse retrovirus is Rous sarcoma virus. Preferred
Rous sarcoma viruses include Bratislava (Manly et al., J. Vir. 62:
3540, 1988; and Albino et al., J. Exp. Med. 164: 1710, 1986), Bryan
high titer (e.g., ATCC Nos. VR-334, VR-657, VR-726, VR-659, and
VR-728), Bryan standard (ATCC No. VR-140), Carr-Zilber (Adgighitov
et al., Neoplasma 27: 159, 1980), Engelbreth-Holm (Laurent et al.,
Biochem Biophys Acta 908: 241, 1987), Harris, Prague (e.g., ATCC
Nos. VR-772, and 45033), and Schmidt-Ruppin (e.g. ATCC Nos. VR-724,
VR-725, VR-354) viruses.
[0085] Any of the above retroviruses can be readily utilized in
order to assemble or construct retroviral huBUB3 gene delivery
vehicles given the disclosure provided herein and standard
recombinant techniques (e.g., Sambrook et al., MOLECULAR CLONING: A
LABORATORY MANUAL, 2d ed., Cold Spring Harbor Laboratory Press,
1989, and Kunkle, Proc. Natl. Acad. Sci. U.S.A. 82: 488, 1985)
known in the art. Portions of retroviral huBUB3 expression vectors
can be derived from different retroviruses. For example,
retrovector LTRs can be derived from a murine sarcoma virus, a tRNA
binding site from a Rous sarcoma virus, a packaging signal from a
murine leukemia virus, and an origin of second strand synthesis
from an avian leukosis virus. These recombinant retroviral vectors
can be used to generate transduction competent retroviral vector
particles by introducing them into appropriate packaging cell lines
(see Ser. No. 07/800,921, filed Nov. 29, 1991). Recombinant
retroviruses can be produced which direct the site-specific
integration of the recombinant retroviral genome into specific
regions of the host cell DNA. Such site-specific integration can be
mediated by a chimeric integrase incorporated into the retroviral
particle (see Ser. No. 08/445,466 filed May 22, 1995). It is
preferable that the recombinant viral gene delivery vehicle is a
replication-defective recombinant virus.
[0086] Packaging cell lines suitable for use with the
above-described retroviral gene delivery vehicles can be readily
prepared (see Ser. No. 08/240,030, filed May 9, 1994; see also WO
92/05266) and used to create producer cell lines (also termed
vector cell lines or "VCLs") for production of recombinant viral
particles. In particularly preferred embodiments of the present
invention, packaging cell lines are made from human (e.g., HT1080
cells) or mink parent cell lines, thereby allowing production of
recombinant retroviral gene delivery vehicles which are capable of
surviving inactivation in human serum. The construction of
recombinant retroviral gene delivery vehicles is described in
detail in WO 91/02805. These recombinant retroviral gene delivery
vehicles can be used to generate transduction competent retroviral
particles by introducing them into appropriate packaging cell lines
(see Ser. No. 07/800,921). Similarly, adenovirus gene delivery
vehicles can also be readily prepared and utilized given the
disclosure provided herein (see also Berkner, Biotechniques 6:
616-627, 1988, and Rosenfeld et al., Science 252: 431-434, 1991, WO
93/07283, WO 93/06223, and WO 93/07282).
[0087] A huBUB3 gene delivery vehicle can also be a recombinant
adenoviral gene delivery vehicle. Such vehicles can be readily
prepared and utilized given the disclosure provided herein (see
Berkner, Biotechniques 6: 616, 1988, and Rosenfeld et al., Science
252: 431, 1991, WO 93/07283, WO 93/06223, and WO 93/07282).
Adeno-associated viral huBUB3 gene delivery vehicles can also be
constructed and used to deliver huBUB3 amino acids or nucleotides.
The use of adeno-associated viral gene delivery vehicles in vitro
is described in Chatterjee et al., Science 258: 1485-1488 (1992),
Walsh et al., Proc. Nat'l. Acad. Sci. 89: 7257-7261 (1992), Walsh
et al., J. Clin. Invest. 94: 1440-1448 (1994), Flotte et al., J.
Biol. Chem. 268: 3781-3790 (1993), Ponnazhagan et al., J. Exp. Med.
179: 733-738 (1994), Miller et al., Proc. Nat'l Acad. Sci. 91:
10183-10187 (1994), Einerhand et al., Gene Ther. 2: 336-343 (1995),
Luo et al., Exp. Hematol. 23: 1261-1267 (1995), and Zhou et al.,
Gene Therapy 3: 223-229 (1996). In vivo use of these vehicles is
described in Flotte et al., Proc. Nat'l Acad. Sci. 90: 10613-10617
(1993), and Kaplitt et al., Nature Genet. 8: 148-153 (1994).
[0088] In another embodiment of the invention, a huBUB3 gene
delivery vehicle is derived from a togavirus. Preferred togaviruses
include alphaviruses, in particular those described in U.S. Ser.
No. 08/405,627, filed Mar. 15, 1995, WO 95/07994. Alpha viruses,
including Sindbis and ELVS viruses can be gene delivery vehicles
for huBUB3 polynucleotides. Alpha viruses are described in WO
94/21792, WO 92/10578 and WO 95/07994. Several different alphavirus
gene delivery vehicle systems can be constructed and used to
deliver huBUB3 subgenomic polynucleotides to a cell according to
the present invention. Representative examples of such systems
include those described in U.S. Pat. Nos. 5,091,309 and 5,217,879.
Particularly preferred alphavirus gene delivery vehicles for use in
the present invention include those which are described in WO
95/07994, and U.S. Ser. No. 08/405,627.
[0089] Preferably, the recombinant viral vehicle is a recombinant
alphavirus viral vehicle based on a Sindbis virus. Sindbis
constructs, as well as numerous similar constructs, can be readily
prepared essentially as described in U.S. Ser. No. 08/198,450.
Sindbis viral gene delivery vehicles typically comprise a 5'
sequence capable of initiating Sindbis virus transcription, a
nucleotide sequence encoding Sindbis non-structural proteins, a
viral junction region inactivated so as to prevent subgenomic
fragment transcription, and a Sindbis RNA polymerase recognition
sequence. Optionally, the viral junction region can be modified so
that subgenomic polynucleotide transcription is reduced, increased,
or maintained. As will be appreciated by those in the art,
corresponding regions from other alphaviruses can be used in place
of those described above.
[0090] The viral junction region of an alphavirus-derived gene
delivery vehicle can comprise a first viral junction region which
has been inactivated in order to prevent transcription of the
subgenomic polynucleotide and a second viral junction region which
has been modified such that subgenomic polynucleotide transcription
is reduced. An alphavirus-derived vehicle can also include a 5'
promoter capable of initiating synthesis of viral RNA from cDNA and
a 3' sequence which controls transcription termination.
[0091] Other recombinant togaviral gene delivery vehicles which can
be utilized in the present invention include those derived from
Semliki Forest virus (ATCC VR-67; ATCC VR-1247), Middleberg virus
(ATCC VR-370), Ross River virus (ATCC VR-373; ATCC VR-1246),
Venezuelan equine encephalitis virus (ATCC VR923; ATCC VR-1250;
ATCC VR-1249; ATCC VR-532), and those described in U.S. Pat. Nos.
5,091,309 and 5,217,879 and in WO 92/10578. The Sindbis vehicles
described above, as well as numerous similar constructs, can be
readily prepared essentially as described in U.S. Ser. No.
08/198,450.
[0092] Other viral gene delivery vehicles suitable for use in the
present invention include, for example, those derived from
poliovirus (Evans et al., Nature 339: 385, 1989, and Sabin et al.,
J. Biol. Standardization 1: 115, 1973) (ATCC VR-58); rhinovirus
(Arnold et al., J. Cell. Biochem. L401, 1990) (ATCC VR- 1110); pox
viruses, such as canary pox virus or vaccinia virus (Fisher-Hoch et
al., Proc. Natl. Acad. Sci. U.S.A. 86: 317, 1989; Flexner et al.,
Ann. N.Y. Acad. Sci. 569: 86, 1989; Flexner et al., Vaccine 8: 17,
1990; U.S. Pat. No. 4,603,112 and U.S. Pat. No. 4,769,330; WO
89/01973) (ATCC VR-111; ATCC VR-2010); SV40 (Mulligan et al.,
Nature 277: 108, 1979) (ATCC VR-305), (Madzak et al., J. Gen. Vir.
73: 1533, 1992); influenza virus (Luytjes et al., Cell 59: 1107,
1989; McMicheal et al., The New England Journal of Medicine 309:
13, 1983; and Yap et al., Nature 273: 238, 1978) (ATCC VR-797);
parvovirus such as adeno-associated virus (Samulski et al., J. Vir.
63: 3822, 1989, and Mendelson et al., Virology 166: 154, 1988)
(ATCC VR-645); herpes simplex virus (Kit et al., Adv. Exp. Med
Biol. 215: 219, 1989) (ATCC VR-977; ATCC VR-260); Nature 277: 108,
1979); human immunodeficiency virus (EPO 386,882, Buchschacher et
al., J. Vir. 66: 2731, 1992); measles virus (EPO 440,219) (ATCC
VR-24); a (ATCC VR-67; ATCC VR-1247), Aura (ATCC VR-368), Bebaru
virus (ATCC VR-600; ATCC VR-1240), Cabassou (ATCC VR-922),
Chikungunya virus (ATCC VR-64; ATCC VR-1241), Fort Morgan (ATCC
VR-924), Getah virus (ATCC VR-369; ATCC VR-1243), Kyzylagach (ATCC
VR-927), Mayaro (ATCC VR-66), Mucambo virus (ATCC VR-580; ATCC
VR-1244), Ndumu (ATCC VR-371), Pixuna virus (ATCC VR-372; ATCC
VR-1245), Tonate (ATCC VR-925), Triniti (ATCC VR-469), Una (ATCC
VR-374), Whataroa (ATCC VR-926), Y-62-33 (ATCC VR-375), O'Nyong
virus, Eastern encephalitis virus (ATCC VR-65; ATCC VR-1242),
Western encephalitis virus (ATCC VR-70; ATCC VR- 1251; ATCC VR-622;
ATCC VR- 1252), and coronavirus (Hamre et al., Proc. Soc. Exp.
Biol. Med. 121: 190, 1966) (ATCC VR-740).
[0093] A huBUB3 subgenomic polynucleotide of the invention can also
be combined with a condensing agent to form a gene delivery
vehicle. In a preferred embodiment, the condensing agent is a
polycation, such as polylysine, polyarginine, polyornithine,
protamine, spermine, spermidine, and putrescine. Many suitable
methods for making such linkages are known in the art (see, for
example, Ser. No. 08/366,787, filed Dec. 30, 1994).
[0094] In an alternative embodiment, a huBUB3 subgenomic
polynucleotide is associated with a liposome to form a gene
delivery vehicle. Liposomes are small, lipid vesicles comprised of
an aqueous compartment enclosed by a lipid bilayer, typically
spherical or slightly elongated structures several hundred
Angstroms in diameter. Under appropriate conditions, a liposome can
fuse with the plasma membrane of a cell or with the membrane of an
endocytic vesicle within a cell which has internalized the
liposome, thereby releasing its contents into the cytoplasm. Prior
to interaction with the surface of a cell, however, the liposome
membrane acts as a relatively impermeable barrier which sequesters
and protects its contents, for example, from degradative enzymes.
Additionally, because a liposome is a synthetic structure,
specially designed liposomes can be produced which incorporate
desirable features. See Stryer, Biochemistry, pp. 236-240, 1975 (W.
H. Freeman, San Francisco, Calif.); Szoka et al., Biochim. Biophys.
Acta 600: 1, 1980; Bayer et al., Biochim. Biophys. Acta. 550: 464,
1979; Rivnay et al., Meth. Enzymol. 149: 119, 1987; Wang et al.,
Proc. Natl. Acad. Sci. U.S.A. 84: 7851, 1987, Plant et al., Anal.
Biochem. 176: 420, 1989, and U.S. Pat. No. 4,762,915. Liposomes can
encapsulate a variety of nucleic acid molecules including DNA, RNA,
plasmids, and expression constructs comprising huBUB3 subgenomic
polynucleotides such those disclosed in the present invention.
[0095] Liposomal preparations for use in the present invention
include cationic (positively charged), anionic (negatively charged)
and neutral preparations. Cationic liposomes have been shown to
mediate intracellular delivery of plasmid DNA (Felgner et al.,
Proc. Natl. Acad. Sci. USA 84: 7413-7416, 1987), mRNA (Malone et
al., Proc. Natl. Acad. Sci. USA 86: 6077-6081, 1989), and purified
transcription factors (Debs et al., J. Biol. Chem. 265:
10189-10192, 1990), in functional form. Cationic liposomes are
readily available. For example, N[1-2,3-dioleyloxy)propyl]--
N,N,N-triethylammonium (DOTMA) liposomes are available under the
trademark Lipofectin, from GIBCO BRL, Grand Island, N.Y. See also
Felgner et al., Proc. Natl. Acad. Sci. USA 91: 5148-5152.87, 1994.
Other commercially available liposomes include Transfectace
(DDAB/DOPE) and DOTAP/DOPE (Boerhinger). Other cationic liposomes
can be prepared from readily available materials using techniques
well known in the art. See, e.g., Szoka et al, Proc. Natl. Acad.
Sci. USA 75: 4194-4198, 1978, and WO 90/11092 for descriptions of
the synthesis of DOTAP
(1,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes.
[0096] Similarly, anionic and neutral liposomes are readily
available, for example, from Avanti Polar Lipids (Birmingham,
Ala.), or can be easily prepared using readily available materials.
Such materials include phosphatidyl choline, cholesterol,
phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC),
dioleoylphosphatidyl glycerol (DOPG), dioleoylphosphatidyl
ethanolamine (DOPE), among others. These materials can also be
mixed with the DOTMA and DOTAP starting materials in appropriate
ratios. Methods for making liposomes using these materials are well
known in the art.
[0097] The liposomes can comprise multilammelar vesicles (MLVs),
small unilamellar vesicles (SUVs), or large unilamellar vesicles
(LUVs). The various liposome-nucleic acid complexes are prepared
using methods known in the art. See, e.g., Straubinger et al.,
METHODS OF IMMUNOLOGY (1983), Vol.101, pp. 512-527; Szoka et al.,
Proc. Natl. Acad. Sci. USA 87: 3410-3414, 1990; Papahadjopoulos et
al., Biochim. Biophys. Acta 394: 483, 1975; Wilson et al., Cell 17:
77, 1979; Deamer and Bangham, Biochim. Biophys. Acta 443: 629,
1976; Ostro et al., Biochem. Biophys. Res. Commun. 76: 836 , 1977;
Fraley et al., Proc. Natl. Acad Sci. USA 76: 3348, 1979; Enoch and
Strittmatter, Proc. Natl. Acad. Sci. USA 76: 145, 1979; Fraley et
al, J. Biol. Chem. 255: 10431, 1980; Szoka and Papahadjopoulos,
Proc. Natl. Acad. Sci. USA 75: 145, 1979; and Schaefer-Ridder et
al., Science 215: 166, 1982.
[0098] In addition, lipoproteins can be included with a huBUB3
subgenomic polynucleotide for delivery to a cell. Examples of such
lipoproteins include chylomicrons, HDL, IDL, LDL, and VLDL.
Mutants, fragments, or fusions of these proteins can also be used.
Modifications of naturally occurring lipoproteins can also be used,
such as acetylated LDL. These lipoproteins can target the delivery
of polynucleotides to cells expressing lipoprotein receptors.
Preferably, if lipoproteins are included with a polynucleotide, no
other targeting ligand is included in the composition.
[0099] In another embodiment, naked huBUB3 subgenomic
polynucleotide molecules are used as gene delivery vehicles, as
described in WO 90/11092 and U.S. Pat. No. 5,580,859. Such gene
delivery vehicles can be either huBUB3 DNA or RNA and, in certain
embodiments, are linked to killed adenovirus. Curiel et al., Hum.
Gene. Ther. 3: 147-154, 1992. Other suitable vehicles include
DNA-ligand (Wu et al., J. Biol. Chem. 264: 16985-16987, 1989),
lipid-DNA combinations (Felgner et al., Proc. Natl. Acad. Sci. USA
84: 7413 7417, 1989), liposomes (Wang et al., Proc. Natl. Acad.
Sci. 84: 7851-7855, 1987) and microprojectiles (Williams et al.,
Proc. Natl. Acad. Sci. 88: 2726-2730, 1991).
[0100] One can increase the efficiency of naked huBUB3 subgenomic
polynucleotide uptake into cells by coating the polynucleotides
onto biodegradable latex beads. This approach takes advantage of
the observation that latex beads, when incubated with cells in
culture, are efficiently transported and concentrated in the
perinuclear region of the cells. The beads will then be transported
into cells when injected into muscle. huBUB3 subgenomic
polynucleotide-coated latex beads will be efficiently transported
into cells after endocytosis is initiated by the latex beads and
thus increase gene transfer and expression efficiency. This method
can be improved further by treating the beads to increase their
hydrophobicity, thereby facilitating the disruption of the endosome
and release of huBUB3 subgenomic polynucleotides into the
cytoplasm.
[0101] huBUB3 or huBUB1 activity can be decreased in a cell by
contacting the cell with a reagent which binds to an expression
product of huBUB3 or huBUB1, respectively. In one embodiment of the
invention, the reagent is a ribozyme, an RNA molecule with
catalytic activity. See, e.g., Cech, Science 236: 1532-1539; 1987;
Cech, Ann. Rev. Biochem. 59: 543-568; 1990, Cech, Curr. Opin.
Struct. Biol. 2: 605-609; 1992, Couture and Stinchcomb, Trends
Genet. 12: 510-515, 1996. Ribozymes can be used to inhibit gene
function by cleaving an RNA sequence, as is known in the art (e.g.,
Haseloff et al., U.S. Pat. No. 5,641,673).
[0102] The coding sequence of a huBUB1 or huBUB3 genes can be used
to generate ribozymes which will specifically bind to mRNA
transcribed from the huBUB1 or huBUB3 genes. Methods of designing
and constructing ribozymes which can cleave other RNA molecules in
trans in a highly sequence specific manner have been developed and
described in the art (see Haseloff, J. et al. Nature 334: 585-591,
1988). For example, the cleavage activity of ribozymes can be
targeted to specific RNAs by engineering a discrete "hybridization"
region into the ribozyme. The hybridization region contains a
sequence complementary to the target RNA and thus specifically
hybridizes with the target (see, for example, Gerlach et al., EP
321,201). The nucleotide sequences shown in SEQ ID NOS: 1 and 3
provide a source of suitable hybridization region sequences. Longer
complementary sequences can be used to increase the affinity of the
hybridization sequence for the target. The hybridizing and cleavage
regions of the ribozyme can be integrally related; thus, upon
hybridizing to the target RNA through the complementary regions,
the catalytic region of the ribozyme can cleave the target.
[0103] Ribozymes can be introduced into cells as part of a DNA
construct, as is known in the art and described above. Mechanical
methods, such as microinjection, liposome-mediated transfection,
electroporation, or calcium phosphate precipitation, can be used to
introduce the ribozyme-containing DNA construct into cells in which
it is desired to decrease huBUB1 or huBUB3 expression, as described
above. Alternatively, if it is desired that the cells stably retain
the DNA construct, it can be supplied on a plasmid and maintained
as a separate element or integrated into the genome of the cells,
as is known in the art. The DNA construct can include
transcriptional regulatory elements, such as a promoter element, an
enhancer or UAS element, and a transcriptional terminator signal,
for controlling transcription of ribozymes in the cells.
[0104] As taught in Haseloff et al., U.S. Pat. No. 5,641,673,
ribozymes can be engineered so that ribozyme expression will occur
in response to factors which induce expression of a target gene.
Ribozymes can also be engineered to provide an additional level of
regulation, so that destruction of mRNA occurs only when both a
ribozyme and a target gene are induced in the cells.
[0105] In another embodiment of the invention, the level of huBUB1
or huBUB3 gene expression is decreased using an antisense
oligonucleotide sequence. The antisense sequence is complementary
to at least a portion of the sequence encoding huBUB1 or huBUB3
selected from the nucleotide sequences shown in SEQ ID NOS: 1 or 3.
Preferably, the antisense oligonucleotide sequence is at least 11
nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35,
40, 45, or 50 or more nucleotides long. Longer sequences can also
be used. Antisense oligonucleotide molecules can be provided in a
DNA construct and introduced into cells as described above to
decrease the level of huBUB1 or huBUB3 in the cells.
[0106] Antisense oligonucleotides can be deoxyribonucleotides,
ribonucleotides, or a combination of both. Oligonucleotides can be
synthesized manually or by an automated synthesizer, by covalently
linking the 5' end of one nucleotide with the 3' end of another
nucleotide with non-phosphodiester internucleotide linkages such
alkylphosphonates, phosphorothioates, phosphorodithioates,
alkylphosphonothioates, alkylphosphonates, phosphoramidates,
phosphate esters, carbamates, acetamidate, carboxymethyl esters,
carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol.
20: 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26: 1-72, 1994; Uhlmann
et al., Chem. Rev. 90: 543-583, 1990.
[0107] Precise complementarity is not required for successful
duplex formation between an antisense molecule and the
complementary coding sequence of a huBUB1 or huBUB3 gene. Antisense
molecules which comprise, for example, 2, 3, 4, or 5 or more
stretches of contiguous nucleotides which are precisely
complementary to a huBUB1 or huBUB3 coding sequence, each separated
by a stretch of contiguous nucleotides which are not complementary
to adjacent huBUB1 or huBUB3 coding sequences, can provide
targeting specificity for huBUB1 or huBUB3 mRNA. Preferably, each
stretch of contiguous nucleotides is at least 4, 5, 6, 7, or 8 or
more nucleotides in length. Non-complementary intervening sequences
are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in
the art can easily use the calculated melting point of an
antisense-sense pair to determine the degree of mismatching which
will be tolerated between a particular antisense oligonucleotide
and a particular huBUB1 or huBUB3 coding sequence.
[0108] Antisense oligonucleotides can be modified without affecting
their ability to hybridize to a huBUB1 or huBUB3 coding sequence.
These modifications can be internal or at one or both ends of the
antisense molecule. For example, internucleoside phosphate linkages
can be modified by adding cholesteryl or diamine moieties with
varying numbers of carbon residues between the amino groups and
terminal ribose. Modified bases and/or sugars, such as arabinose
instead of ribose, or a 3', 5'-substituted oligonucleotide in which
the 3' hydroxyl group or the 5' phosphate group are substituted,
can also be employed in a modified antisense oligonucleotide. These
modified oligonucleotides can be prepared by methods well known in
the art. See, e.g., Agrawal et al., Trends Biotechnol. 10: 152-158,
1992; Uhlmann et al., Chem. Rev. 90: 543-584, 1990; Uhlmann et al.,
Tetrahedron. Lett. 215: 3539-3542, 1987.
[0109] Antibodies of the invention which specifically bind to
huBUB3, particularly single-chain antibodies, can also be used to
alter levels of huBUB3. Antibodies similarly prepared against
huBUB3 can be used to alter levels of huBUB3. The antibodies
prevent huBUB3 and huBUB1 from binding. Polynucleotides encoding
single-chain antibodies of the invention can be introduced into
cells as described above.
[0110] Preferably, the mechanism used to decrease the level of
huBUB1 or huBUB3 expression, whether ribozyme, antisense
oligonucleotide sequence, or antibody, decreases the level of gene
expression by at least 50%, 60%, 70%, or 80%. Most preferably, the
level of gene expression is decreased by at least 90%, 95%, 99%, or
100%. The effectiveness of the mechanism chosen to decrease the
level of gene expression can be assessed using methods well known
in the art, such as hybridization of nucleotide probes to huBUB1 or
huBUB3 mRNA, quantitative RT-PCR, or detection of huBUB1 or huBUB3
protein using specific antibodies of the invention.
[0111] Compositions comprising huBUB1 or huBUB3 antibodies,
ribozymes, or antisense oligonucleotides can optionally comprise a
pharmaceutically acceptable carrier. Pharmaceutically acceptable
carriers are well known to those in the art. Such carriers include,
but are not limited to, large, slowly metabolized macromolecules,
such as proteins, polysaccharides, polylactic acids, polyglycolic
acids, polymeric amino acids, amino acid copolymers, and inactive
virus particles. Pharmaceutically acceptable salts can also be used
in huBUB1 or huBUB3 compositions, for example, mineral salts such
as hydrochlorides, hydrobromides, phosphates, or sulfates, as well
as salts of organic acids such as acetates, proprionates,
malonates, or benzoates. huBUB1 or huBUB3 compositions can also
contain liquids, such as water, saline, glycerol, and ethanol, as
well as substances such as wetting agents, emulsifying agents, or
pH buffering agents. Liposomes, such as those described in U.S.
Pat. No. 5,422,120, WO 95/13796, WO 91/14445, or EP 524,968 B1, can
also be used as a carrier for a huBUB3 composition.
[0112] Typically, a huBUB1 or huBUB3 composition is prepared as an
injectable, either as a liquid solution or suspension; however,
solid forms suitable for solution or suspension in liquid vehicles
prior to injection can also be prepared. A huBUB1 or huBUB3
composition can also be formulated into an enteric coated tablet or
gel capsule according to known methods in the art, such as those
described in U.S. Pat. No. 4,853,230, EP 225,189, AU 9,224,296, and
AU 9,230,801.
[0113] According to one diagnostic method of the invention, loss of
a wild-type huBUB3 gene is detected. The loss can be due to
deletional, missense, frameshift, and/or point mutational events.
If only a single huBUB3 allele is mutated, an early neoplastic
state is indicated. However, if both alleles are mutated then a
late neoplastic state is indicated. Point mutational events can
occur in regulatory regions, such as in the promoter of the huBUB3
gene, leading to loss or diminution of expression of the huBUB3
mRNA. This can be determined using assays for quantitating huBUB3
expression.
[0114] In order to detect the loss of a wild-type huBUB3 gene in a
tissue, it is helpful to isolate the tissue free from surrounding
normal tissues. Means for enriching a tissue preparation for tumor
(or cancer) cells are known in the art. For example, the tissue can
be isolated from paraffin or cryostat sections. Cancer cells can
also be separated from normal cells by flow cytometry. These as
well as other techniques for separating tumor from normal cells are
well known in the art. If the tumor tissue is highly contaminated
with normal cells, detection of mutations is more difficult.
[0115] Detection of point mutations can be accomplished by
molecular cloning of the huBUB3 allele (or alleles) present in the
tumor tissue and sequencing the allele(s) using techniques well
known in the art. Alternatively, an amplification technique, such
as the polymerase chain reaction, can be used to amplify huBUB3
gene sequences directly from a genomic DNA preparation from tumor
tissue. The DNA sequence of the amplified sequences can then be
determined. The polymerase chain reaction itself is well known in
the art. See, e.g., Saiki et al., Science 239, 487, 1988; U.S. Pat.
No. 4,683,203; and U.S. Pat. No. 4,683,195. Specific primers which
can be used in order to amplify the huBUB3 gene will be discussed
in more detail below.
[0116] Specific deletions of huBUB3 genes can also be detected. For
example, restriction fragment length polymorphism (RFLP) probes for
the huBUB3 gene or surrounding marker genes can be used to score
loss of a huBUB3 allele. Any other techniques for detecting
deletions known in the art can be used.
[0117] Loss of wild-type huBUB3 genes can also be detected on the
basis of the loss of a wild-type expression product of the huBUB3
gene. Such expression products include both the mRNA as well as the
huBUB3 protein product itself. Point mutations can be detected by
sequencing the mRNA directly or via molecular cloning of cDNA made
from the mRNA. The sequence of the cloned cDNA can be determined
using DNA sequencing techniques which are well known in the art.
See Sambrook et al., 1989.
[0118] Alternatively, mismatch detection can be used to detect
point mutations in the huBUB3 gene or its mRNA product. While these
techniques are less sensitive than sequencing, they are simpler to
perform on a large number of tumors. An example of a mismatch
cleavage technique is the RNase protection method, which is
described in detail in Winter et al., Proc. Natl. Acad. Sci. U.S.A.
82, 7575 (1985) and Meyers et al., Science 230, 1242(1985). In the
practice of the present invention, the method involves the use of a
labeled riboprobe which is complementary to the human wild-type
huBUB3 gene. The riboprobe and either mRNA or DNA isolated from the
tumor tissue are hybridized together and subsequently digested with
the enzyme RNase a, which is able to detect some mismatches in a
duplex RNA structure. If a mismatch is detected by RNase a, it
cleaves at the site of the mismatch. When the hybridized RNA
preparation is separated on an electrophoretic gel matrix, a
mismatch which has been detected and cleaved by RNase a will be
evidenced by an RNA product which is smaller than the full-length
duplex RNA for the riboprobe and the huBUB3 mRNA or DNA. The
riboprobe need not be the full length of the huBUB3 mRNA or gene
but can be a segment of either. If the riboprobe comprises only a
segment of the huBUB3 mRNA or gene it will be desirable to use a
number of these probes to screen the whole mRNA sequence for
mismatches.
[0119] In similar fashion, DNA probes can be used to detect
mismatches through enzymatic or chemical cleavage. See, e.g.,
Cotton et al., Proc. Natl. Acad. Sci. U.S.A. 85, 4397 (1988) and
Shenk et al., Proc. Natl. Acad. Sci. U.S.A. 72, 989 (1975).
Alternatively, mismatches can be detected by shifts in the
electrophoretic mobility of mismatched duplexes relative to matched
duplexes. See, e.g., Cariello, Human Genetics 42, 726 (1988). With
either riboprobes or DNA probes, the cellular mRNA or DNA which
might contain a mutation can be amplified before hybridization
using PCR or other amplification techniques, as is known in the
art.
[0120] DNA sequences of the huBUB3 gene from the tumor tissue which
have been amplified can also be screened using allele-specific
probes. These probes are nucleic acid oligomers, each of which
contains a region of the huBUB3 gene sequence harboring a known
mutation. For example, one oligomer can be at least about 15, 18,
20, 30, or 50 nucleotides in length, corresponding to a portion of
the huBUB3 gene sequence. By use of a battery of such
allele-specific probes, amplification products can be screened to
identify the presence of a previously identified mutation in the
huBUB3 gene. Hybridization of allele-specific probes with amplified
huBUB3 sequences can be performed, for example, on a solid support,
such as a nitrocellulose or nylon filter. Hybridization to a
particular probe indicates the presence of the same mutation in the
tumor tissue as in the allele-specific probe.
[0121] Loss of wild-type huBUB3 genes can also be detected by
screening for loss of wild-type huBUB3 protein function. Although
all of the functions which the huBUB3 protein undoubtedly possesses
have yet to be elucidated, at least one specific function is known.
The huBUB3 protein binds to huBUB1. Loss of the ability of the
huBUB3 protein to bind to huBUB1 indicates a mutational alteration
in the protein which reflects a mutational alteration of the huBUB3
gene itself. Similarly, loss of kinase activity of huBUB3 can be
monitored as a means of detecting mutations. Alternatively, a panel
of monoclonal or single-chain antibodies can be used in which
epitopes involved in huBUB3 functions are represented by a
monoclonal or single-chain antibody. Loss or perturbation of
binding of huBUB3 to a monoclonal antibody in the panel would
indicate mutational alteration of the huBUB3 protein and thus of
the huBUB3 gene itself. Any means for detecting an altered huBUB3
protein can be used to detect loss of wild-type huBUB3 genes.
[0122] Mutant huBUB3 genes or gene products can also be detected in
body samples, such as serum or stool, or other body fluids, such as
urine and sputum. The same techniques discussed above for detection
of mutant huBUB3 genes or gene products in tissues can be applied
to other body samples. By screening such body samples, a simple
early diagnosis can be achieved for many types of cancers. In
addition, the progress of chemotherapy can be monitored more easily
by testing such body samples for mutant huBUB3 genes or gene
products.
[0123] It appears that the huBUB3 gene has a role in the
development of a broad range of tumors. The diagnostic methods of
the invention are therefore applicable to any tumor in which huBUB3
has a role in tumorigenesis. These include lung, breast, brain,
colorectal, bladder, mesenchyme, prostate, liver, stomach,
leukemias, osteosarcomas. The diagnostic method of the invention is
useful for clinicians so that they can decide upon an appropriate
course of treatment. For example, a tumor displaying loss of
wild-type huBUB3 alleles suggests the use of mitotic poison-type
chemotherapy. Wild-type huBUB3 in a tumor suggests that other types
of anti-cancer therapies should be used.
[0124] The invention also provides diagnostic kits. A kit of the
present invention is useful for determination of the nucleotide
sequence of a huBUB3 gene using the polymerase chain reaction or
other amplification technique. A kit comprises one or a set of
pairs of single-stranded DNA primers which can be annealed to
sequences within or surrounding the huBUB3 gene in order to prime
amplifying DNA synthesis of the huBUB3 gene itself. The complete
set allows synthesis of all of the nucleotides of the huBUB3 gene
coding sequences, although isolated primers for selected portions
can also be used. The set of primers may or may not allow synthesis
of both intron and exon sequences. However, it should allow
synthesis of all exon sequences. Instructions for using the
primer(s) in the appropriate amplification method, as well as
reagents required for the method, such as buffers and polymerase,
can also be provided.
[0125] In order to facilitate subsequent cloning of amplified
sequences, primers may have restriction enzyme sites appended to
their 5' ends. Thus, all nucleotides of the primers are derived
from huBUB3 sequences or sequences adjacent to huBUB3 except the
few nucleotides necessary to form a restriction enzyme site. Such
enzymes and sites are well known in the art. The primers themselves
can be synthesized using techniques which are well known in the
art. Generally, the primers can be made using synthesizing machines
which are commercially available. In a preferred embodiment, the
primer pairs comprise: sense primer TWS95 (GGGAGCCCAAGATGACCGGTT)
(SEQ ID NO: 5) and antisense primer TWS96
(AAATCCACCATTGGGGAGTACGAATTGT) (SEQ ID NO: 6).
[0126] Nucleotide probes according to the present invention
comprise at least about 10, 12, 14, 16, 18, 20, 25, or 30
contiguous nucleotides of huBUB3. The probes can also contain
labeling moieties with which the probes can be detected, including
but not limited to radiolabels, fluorescent labels, and enzymatic
labels. Nucleotide probes provided by the present invention are
useful in the RNase protection method, for detecting point
mutations already discussed above. Probes can also be used to
detect mismatches with a huBUB3 gene or mRNA using other
techniques. Mismatches can be detected using other enzymes (e.g.,
S1 nuclease), chemicals (e.g., hydroxylamine or osmium tetroxide
and piperidine), or changes in electrophoretic mobility of
mismatched hybrids as compared to totally matched hybrids. These
techniques are known in the art. See Cotton; Shenk; Myers; Winter;
and Novack et al., Proc. Natl. Acad. Sci. U.S.A. 83, 586
(1986).
[0127] If a riboprobe is used to detect mismatches with mRNA, it is
complementary to the mRNA of the human wild-type huBUB3 gene. The
riboprobe thus is an anti-sense probe in that it does not code for
the huBUB3 protein because it is of the opposite polarity to the
sense strand. The riboprobe generally will be radioactively
labeled; such labeling can be accomplished by any means known in
the art. If the riboprobe is used to detect mismatches with DNA it
can be of either polarity, sense or anti-sense. Similarly, DNA
probes also may be used to detect mismatches. Probes may also be
complementary to mutant alleles of huBUB3. These probes are useful
to detect similar mutations in other patients on the basis of
hybridization rather than mismatches. These probes are discussed
above and referred to as allele-specific probes.
[0128] Genetic predisposition to cancers or neoplasia can be
ascertained by testing normal tissues of humans, including prenatal
humans. For example, a person who has inherited a germline huBUB3
mutation would be prone to develop cancers. This predisposition can
be determined by testing DNA from any tissue of the person's body.
Most simply, blood can be drawn and DNA extracted from cells of the
blood. Loss of a wild-type huBUB3 allele, either by point mutation,
deletion, or insertion can be detected by any of the means
discussed above. DNA can also be extracted and tested from fetal
tissues for this purpose.
[0129] According to the present invention a method is also provided
of supplying wild-type huBUB3 function to a cell which carries
mutant huBUB3 alleles. The wild-type huBUB3 gene or a part of the
gene can be introduced into the cell in a vector such that the gene
remains extrachromosomal. In such a situation the gene will be
expressed by the cell from the extrachromosomal location. If a gene
portion is introduced and expressed in a cell carrying a mutant
huBUB3 allele, the gene portion should encode a part of the huBUB3
protein which is required for non-neoplastic growth of the cell.
The portion of huBUB3 protein which is required for non-neoplastic
growth can be readily determined, for example, by transfecting DNA
expression constructs comprising portions of huBUB3 protein, such
as the huBUB1 binding domain, into neoplastic cell lines in vitro
and observing alterations in cellular morphology or lowered rates
of cell division, as is known in the art.
[0130] More preferred is the situation where the wild-type huBUB3
gene or a part of it is introduced into the mutant cell in such a
way that it recombines with the endogenous mutant huBUB3 gene
present in the cell. Such recombination would require a double
recombination event which would result in the correction of the
huBUB3 gene mutation. Vectors and gene delivery vehicles for
introduction of genes both for recombination and for
extrachromosomal maintenance are known in the art and any suitable
method, such as those described in detail above, can be used.
[0131] A composition comprising all or a portion of a huBUB3
subgenomic polynucleotide or polypeptide or other molecule which
has huBUB3 activity can be supplied to cells which carry mutant
huBUB3 alleles. The active molecules can be introduced into the
cells by local or systemic administration, including injection,
oral administration, particle gun, or catheterized administration,
and topical administration. Alternatively, some such active
molecules can be taken up by the cells, actively or by
diffusion.
[0132] Various methods can be used to administer a huBUB3
therapeutic composition directly to a specific site in the body.
For treatment of a tumor, for example, an appropriate huBUB3
composition injected several times in several different locations
within the body of the tumor. Alternatively, arteries which serve
the tumor can be identified, and a huBUB3 composition can be
injected into such an artery in order to deliver the composition to
the tumor.
[0133] A tumor which has a necrotic center can be aspirated, and a
huBUB3 composition can be injected directly into the now empty
center of the tumor. A huBUB3 composition can also be administered
directly to the surface of a tumor, for example, by topical
application of the composition. X-ray imaging can be used to assist
in certain of these delivery methods. Combination therapeutic
agents, including a huBUB3 protein or polypeptide or a huBUB3
subgenomic polynucleotide, can be administered simultaneously or
sequentially together with other therapeutic agents.
[0134] huBUB3 compositions can also be delivered to specific
tissues using receptor-mediated targeted delivery.
Receptor-mediated DNA delivery techniques are taught in, for
example, Findeis et al. Trends in Biotechnol. 11, 202-05, (1993);
Chiou et al., GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT
GENE TRANSFER (J. A. Wolff, ed.) (1994); Wu & Wu, J. Biol.
Chem. 263, 621-24, 1988; Wu et al., J. Biol. Chem. 269, 542-46,
1994; Zenke et al., Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59,
1990; Wu et al., J. Biol. Chem. 266, 338-42, 1991.
[0135] Both the dose of a particular huBUB3 composition and the
means of administering the composition can be determined based on
specific qualities of the huBUB3 composition, the condition, age,
and weight of the patient, the progression of the particular
disease being treated, and other relevant factors. If the
composition contains huBUB3 proteins, polypeptides, or antibodies,
effective dosages of the composition are in the range of about 5
.mu.g to about 50 .mu.g/kg of patient body weight, about 50 .mu.g
to about 5 mg/kg, about 100 .mu.g to about 500 .mu.g/kg of patient
body weight, and about 200 to about 250 .mu.g/kg.
[0136] Compositions containing huBUB3 subgenomic polynucleotides,
including antisense oligonucleotides and ribozyme- or
antibody-encoding sequences, can be administered in a range of
about 100 ng to about 200 mg of DNA for local administration.
Suitable concentrations range from about 500 ng to about 50 mg,
about 1 .mu.g to about 2 mg, about 5 .mu.g to about 500 .mu.g, and
about 20 .mu.g to about 100 .mu.g of DNA. Factors such as method of
action and efficacy of transformation and expression are
considerations which will affect the dosage required for ultimate
efficacy of the huBUB3 composition. If greater expression is
desired over a larger area of tissue, larger amounts of a huBUB3
composition or the same amount administered successively, or
several administrations to different adjacent or close tissue
portions of, for example, a tumor site, may be required to effect a
positive therapeutic outcome. In all cases, routine experimentation
in clinical trials will determine specific ranges for optimal
therapeutic effect.
[0137] Expression of an endogenous huBUB3 gene in a cell can be
altered by introducing in frame with the endogenous huBUB3 gene a
DNA construct comprising a huBUB3 targeting sequence, a regulatory
sequence, an exon, and an unpaired splice donor site by homologous
recombination, such that a homologously recombinant cell comprising
a new huBUB3 transcription unit is formed. The new transcription
unit can be used to turn the huBUB3 gene on or off as desired. This
method of affecting endogenous gene expression is taught in U.S.
Pat. No. 5,641,670.
[0138] The targeting sequence is a segment of at least 10, 12, 15,
20, or 50 contiguous nucleotides selected from the nucleotide
sequence shown in SEQ ID NO: 1. The transcription unit is located
upstream of a coding sequence of the endogenous huBUB3 gene. The
exogenous regulatory sequence directs transcription of the coding
sequence of the huBUB3 gene.
[0139] According to another aspect of the invention, test compounds
can be screened for utility as anti-cancer agents by the ability to
suppress the expression or function of human huBUB3 protein.
Potential drugs can be contacted with cells and the expression of
huBUB3 mRNA or protein monitored. This can be accomplished by well
known techniques in the art, such as Northern blots,
immunoprecipitation, immunoblots, etc. Any technique which utilizes
a huBUB3 nucleic acid probe or an antibody specific for huBUB3
protein can be used. Other techniques, such as quantitative reverse
PCR can also be employed.
[0140] In addition, in vitro techniques can be employed for testing
the ability of candidate drugs to inhibit huBUB3 binding to huBUB1.
Such assays are well within the skill of the art, once provided
with the full sequences of the huBUB3 and huBUB1 genes and
proteins. In addition, a yeast two-hybrid system can be used
wherein one of the partners is huBUB3 and one of the partners is
huBUB1. A cell which contains both of these partners can be
contacted with test compounds and the loss or diminution of
transactivation of the reporter gene can be monitored.
[0141] Inhibitors of huBUB1-huBUB3 binding can be, for example,
polypeptides, small peptides, peptoids, or other peptide analogs or
other chemical inhibitors. Some of these inhibitors, such as
related peptides or fusion proteins, can be developed rationally on
the basis of knowledge of the sequences of huBUB1 and huBUB3 which
are disclosed herein. Alternatively, a random array of compounds
can be screened for the ability to compete in a huBUB1-huBUB3
binding assay.
[0142] The test compounds can be pharmacologic agents already known
in the art or can be compounds previously unknown to have any
pharmacological activity. The compounds can be naturally occurring
or designed in the laboratory. They can be isolated from
microorganisms, animals, or plants, and can be produced
recombinantly, or synthesized by chemical methods known in the
art.
[0143] A test compound can be contacted with a mixture of at least
a huBUB1-binding domain of a huBUB3 protein and at least a
huBUB3-binding domain of a huBUB1 protein. These molecules can be
produced recombinantly or can be synthesized using standard
chemical methods. The binding domains or proteins can be pre-bound
prior to the step of contacting the test compound. Alternatively,
the test compound can contact one of the binding domains or
proteins before the second binding domain or protein is added.
[0144] The binding domains or proteins can be in solution or one
binding domain or protein can be bound to a solid support. The
binding domains or proteins can be unlabeled or labeled, for
example, with a radioactive, fluorescent, or other detectable
marker. They can be fusion proteins comprising huBUB1 or huBUB3
fused to another protein with or without a detectable enzymatic
activity.
[0145] In one embodiment, the amount of at least one of the two
binding domains or proteins that is bound or unbound in the
presence of the test compound is then measured. A number of methods
can be used to measure the amount of binding domains or proteins or
dimers. For example, the relative concentration of binding domains
or proteins bound to unbound can be detected by examining the
apparent molecular masses of the molecules by size exclusion
chromatography or by polyacrylamide gel electrophoresis under
non-reducing conditions. Other methods of measuring binding or
dissociation of the binding domains or proteins will readily occur
to those of ordinary skill in the art and can be used. A test
compound which diminishes the quantity of one binding domain or
protein bound to a second binding domain or protein, or which
displaces one binding domain or protein bound to a second binding
domain or protein, or which prevents one binding domain or protein
from binding to a second binding domain or protein is identified as
a candidate therapeutic agent.
[0146] According to the present invention a method is also provided
of using the yeast two-hybrid technique to screen for test
compounds which interfere with huBUB1-huBUB3 binding. The yeast
two-hybrid technique is taught in Fields & Song, Nature 340,
245-46, 1989.
[0147] In a preferred embodiment, a cell is contacted with a test
compound. The cell comprises two fusion proteins, which can be
supplied to the cell by means of recombinant DNA constructs. The
first fusion protein comprises a DNA-binding domain. The second
fusion protein comprises a transcriptional activating domain. The
first fusion protein also comprises either (I) a binding domain of
huBUB1 that binds to huBUB3 or (ii) a binding domain of huBUB3 that
binds to huBUB1. If the first fusion protein comprises a binding
domain of huBUB1 that binds to huBUB3, then the second fusion
protein comprises a binding domain of huBUB3 that binds to huBUB1.
If the first fusion protein comprises a binding domain of huBUB3
that binds to huBUB1, then the second fusion protein comprises a
binding domain of huBUB1 that binds to huBUB3. The cell also
comprises a reporter gene comprising a DNA sequence downstream from
a DNA element to which the DNA binding domain of the first fusion
protein binds.
[0148] When the huBUB3 and huBUB1 binding domains are bound
together, the DNA binding domain and the transcriptional activating
domain will be in close enough proximity to reconstitute a
transcriptional activator capable of initiating transcription of a
detectable reporter gene in the cell. The expression of the
reporter gene in the presence of the test compound is then
measured. A test compound that increases the expression of the
reporter gene is a potential drug for increasing huBUB1-huBUB3
binding. A test compound that decreases the expression of the
reporter gene is a potential drug for decreasing huBUB1-huBUB3
binding.
[0149] Many DNA binding domains and transcriptional activating
domains can be used in this system, including the DNA binding
domains of GAL4, LexA, and the human estrogen receptor paired with
the acidic transcriptional activating domains of GAL4 or the herpes
virus simplex protein VP 16 (see, e.g., Hannon et al., Genes Dev.
7, 2378, 1993; A. S. Zervos et al., Cell 72, 223, 1993; A. B.
Votjet et al., Cell 74, 205, 1993; Harper et al., Cell 75, 805,
1993; B. Le Douarin et al., Nucl. Acids Res. 23, 876, 1995). A
number of plasmids known in the art can be constructed to contain
the coding sequences for the fusion proteins using standard
laboratory techniques for manipulating DNA (see, e.g., Example 1,
below).
[0150] Suitable detectable reporter genes include the E. coli lacZ
gene, whose expression can be measured calorimetrically (see, e.g.,
Fields and Song), and yeast selectable genes such as HIS3 (Harper
et al.; Votjet et al.; Hannon et al.) or URA3 (Le Douarin et al.).
Methods for transforming cells are also well known in the art. See,
e.g., a. Hinnen et al., Proc. Natl. Acad. Sci. U.S.A. 75,
1929-1933, 1978. The test compound can comprise part of the cell
culture medium or it may be added separately.
[0151] For example, compounds which decrease the kinase activity of
huBUB1 or of a huBUB1-huBUB3 complex can be identified by
contacting huBUB1 or a huBUB1-huBUB3 complex with a test compound
and determining the kinase activity of the huBUB1 or huBUB1-huBUB3
complex. Any in vitro kinase assay known in the art, such as taught
in WO96/36642, can be used for this purpose. Phosphorylation of a
substrate, such as huBUB1 itself or a synthetic peptide substrate
based on huBUB1 sequences shown in SEQ ID NO: 2, or a kinase
substrate such as PHAS-1, can be measured. Optionally, the
substrate can comprise a detectable label, such as biotin, for use
in a purification or separation step. A test compound which
decreases kinase activity of huBUB1 or of the huBUB1-huBUB3 complex
is identified as a candidate therapeutic agent.
[0152] The huBUB3-binding domain of huBUB1 and the huBUB1-binding
domain of huBUB3 can be readily determined, for example, by testing
various portions of each protein for the ability to bind to its
partner. A variety of techniques can be used for this purpose,
including but not limited to the yeast two-hybrid assay, affinity
column chromatography, and polyacrylamide gel electrophoresis under
non-reducing conditions.
[0153] The invention also provides methods of increasing the
sensitivity of a tumor to a metabolic inhibitor. Normal cell
division includes a highly controlled segregation of subcellular
components, especially chromosomes and spindle pole bodies, a
process which requires the function of microtubules. In normal
cells, the presence of microtubule poisons arrests cell division
prior to segregation of these components. In this manner, cells
refrain from attempting to segregate these components under
conditions which might affect the normal fidelity of this
segregation.
[0154] In mutant cells lacking huBUB3 (and/or other genes known to
function in this pathway such as huBUB1), a signal transduction
pathway which senses proper microtubule function is absent. Thus,
mutant cells treated with these drugs fail to regulate cell cycle
progression. In this case, cell division occurs without proper
segregation of subcellular components, and progeny cells may
inherit a random fraction of genetic material (ranging from none to
all), and may inherit one, none or both spindle poles. If progeny
cells retain a less than complete complement of chromosomes and
none or two spindle pole bodies, resulting cells are fated to die,
either through loss of essential genes, through lack of spindle
pole bodies, or through the catastrophic effects of a subsequent
multipolar mitosis. This phenomenon is termed "mitotic
catastrophe."
[0155] Mitotic catastrophe can be exploited to enhance the
cytotoxic effect of anti-tumor agents on cancer cells to known
microtubule poisons. Specifically, mutations in huBUB3 and
functionally related genes (e.g., huBUB1) can determine the
relative sensitivity of cells to microtubule poisons. In humans,
the mutant status of huBUB3 and/or other genes can determine the
relative cytotoxic effect of microtubule poison treatment in cancer
chemotherapy. Such an effect may account for the difference between
partial response and a complete remission in microtubule
poison-mediated cancer chemotherapy. At the present time, the
precise mechanism of tumor cytotoxicity by microtubule poisons in
cancer chemotherapy is relatively poorly understood. Inactivation
of huBUB3 and/or other genes can be used to increase the relative
sensitivity of many tumors to microtubule poisons, such as
vinblastin, taxol, vincristine, and taxotere. Treatment of tumors
comprising huBUB3 mutant cells with these agents can induce gross
failure of mitotic segregation of subcellular components, thereby
producing profound cytotoxicity. In contrast, treatment of
non-mutant cells can induce transient cell cycle delay, from which
cells can immediately recover following termination of treatment.
The mutational status of huBUB3 can therefore be determined to
indicate which chemotherapeutic regimes should be used. For
example, since wild-type huBUB3 confers resistance to microtubule
poisons, the finding of a mutation in huBUB3 in a tumor indicates
that such agents could be employed effectively to treat the tumor.
In contrast, finding a wild-type huBUB3 will suggest use of other
agents.
[0156] The invention also provides a novel chemotherapeutic regimen
for treating neoplasia or its symptoms, in which tumor cells with a
wild-type copy of the huBUB3 gene can be induced to undergo a
lethal mitotic catastrophe effect in the presence of microtubule
inhibitors. This can be accomplished by administering one or more
biochemical inhibitors of huBUB3 and/or huBUB1 function, as well as
one or more microtubule poisons. Inhibitors of huBUB3 and/or huBUB1
generate a transient loss of huBUB3 function analogous to that seen
in genetically huBUB3-mutant cells, thereby generating a failure to
properly regulate cell cycle when confronted with a microtubule
poison. The resulting cytotoxicity resulting from failure of
mitotic segregation would parallel that seen in huBUB3 mutant
cells, with the added benefit that upon removal of the
huBUB1/huBUB3 inhibitor, cells would return to a genetically stable
state. In this manner, a transient inhibition of this pathway can
be used to exploit the normal requirement of loss of huBUB3
function for the chemotherapeutic efficacy of microtubule
poisons.
[0157] huBUB1 or huBUB3 inhibitors can be identified, for example,
by kinase screening assays or by interference with huBUB1-huBUB3
binding, as described herein. Inhibitors can be added together,
separately, or sequentially with the microtubule poison(s), as is
desired. It is expected that the class of compounds including
huBUB1/huBUB3 biochemical inhibitors described here would be used
as adjuvants to normal cancer chemotherapy. Treated cells would
therefore not be expected to express the constitutive genetic
instability commonly observed in cancer cells. Cells transiently
treated with huBUB1/huBUB3 inhibitors would be expected to return
to a genetically stable state following cessation of treatment.
[0158] According to another aspect of the invention, potential
drugs can be screened for utility as anti-cancer agents by the
ability to suppress the expression or function of huBUB3 protein.
Thus potential drugs can be contacted with cells and the expression
of huBUB3 mRNA or protein monitored. This can be accomplished by
well known techniques in the art, such as Northern blots,
immunoprecipitation, immunoblots, etc. Any technique which utilizes
a huBUB3 nucleic acid probe or an antibody specific for huBUB3
protein can be used. Other techniques, such as quantitative RT PCR
can also be employed. In addition, in vitro techniques can be
employed for testing the ability of candidate drugs to inhibit
huBUB3 binding to huBUB1. Such assays are well within the skill of
the art, once provided with the full sequence of the huBUB3 gene
and protein. In addition, a yeast two-hybrid system can be used
wherein one of the partners comprises all or a portion of huBUB1
and one of the partners comprises all or a portion of huBUB3. A
cell which contains both of these partners can be contacted with
test compounds and the loss or diminution of transactivation of the
reporter gene can be monitored.
[0159] A huBUB3 subgenomic polynucleotide can also be delivered to
subjects for the purpose of screening test compounds for those
which are useful for enhancing transfer of huBUB3 subgenomic
polynucleotides to the cell or for enhancing subsequent biological
effects of huBUB3 subgenomic polynucleotides within the cell. Such
biological effects include hybridization to complementary huBUB3
mRNA and inhibition of its translation, expression of a huBUB3
subgenomic polynucleotide to form huBUB3 mRNA and/or huBUB3
protein, and replication and integration of a huBUB3 subgenomic
polynucleotide. The subject can be a cell culture or an animal,
preferably a mammal, more preferably a human.
[0160] Test compounds which can be screened include any substances,
whether natural products or synthetic, which can be administered to
the subject. Libraries or mixtures of compounds can be tested. The
compounds or substances can be those for which a pharmaceutical
effect is previously known or unknown. The compounds or substances
can be delivered before, after, or concomitantly with a huBUB3
subgenomic polynucleotide. They can be administered separately or
in admixture with a huBUB3 subgenomic polynucleotide.
[0161] Integration of a delivered huBUB3 subgenomic polynucleotide
can be monitored by any means known in the art. For example,
Southern blotting of the delivered huBUB3 subgenomic polynucleotide
can be performed. A change in the size of the fragments of a
delivered polynucleotide indicates integration. Replication of a
delivered polynucleotide can be monitored inter alia by detecting
incorporation of labeled nucleotides combined with hybridization to
a huBUB3 probe. Expression of a huBUB3 subgenomic polynucleotide
can be monitored by detecting production of huBUB3 mRNA which
hybridizes to the delivered polynucleotide or by detecting huBUB3
protein. huBUB3 protein can be detected immunologically. Thus, the
delivery of huBUB3 subgenomic polynucleotides according to the
present invention provides an excellent system for screening test
compounds for their ability to enhance transfer of huBUB3
subgenomic polynucleotides to a cell, by enhancing delivery,
integration, hybridization, expression, replication or integration
in a cell in vitro or in an animal, preferably a mammal, more
preferably a human.
[0162] The complete contents of all references cited in this
disclosure are expressly incorporated herein.
[0163] The following examples are provided for exemplification
purposes only and are not intended to limit the scope of the
invention which has been described in broad terms above.
EXAMPLE 1
Tissue Distribution
[0164] We initially found a .about.1.4 kb human cDNA fragment with
homology to the Saccharomyces cerevisiae scBUB3 gene, which we
designated huBUB3. A .about.1.1 kb PCR fragment encompassing the
predicted open reading frame (ORF) from this predicted cDNA
fragment was amplified from a testis cDNA pool, using sense primer
TWS95 (5'.GGGAGCCCAAGATGACCGGTT) (SEQ ID NO: 5) and antisense
primer TWS96 (AAATCCACCATTGGGGAGTACGAATTGT) (SEQ ID NO: 6). This
fragment was cloned (p291-45). The sequence of this cloned fragment
matched the anticipated sequence derived from EST arraying,
demonstrating that these ESTs are linked in the manner originally
postulated.
[0165] Tissue distribution of the huBUB3 mRNA was examined using a
.sup.32-P labeled hybridization probe derived from a 1.1 kb EcoRI
fragment from p291-45. This probe was hybridized to a commercial
multiple tissue Northern blot (Clontech, #7759-1), consisting of
poly-a.sup.+ mRNA samples from human spleen, thymus, prostate,
testis, ovary, small intestine, colon (mucosal lining), and
peripheral blood leukocyte. Results indicated that three human mRNA
species, of .about.1.4, 2.7 and 4.0 kb each hybridize to this
probe. Strongest huBUB3 signal was detected with testis mRNA,
specifically from the .about.1.4 kb transcript. Testis is
recognized as a highly proliferative tissue in adults. The next
highest expression was exhibited by thymus, followed by spleen and
colon, with lower but detectable expression observed in other
tissues. The relative abundance of the three species of mRNA varied
significantly between tissues. While in testis the .about.1.4
transcript was responsible for the majority of the hybridization
signal, many tissues demonstrated an equal or higher hybridization
signal from the .about.2.7 kb transcript. Hybridization signal from
the .about.4.0 transcript was generally equal or less than that
observed with the .about.2.7 transcript. An actin cDNA probe
(Clontech, #9800-1), labeled and hybridized to the same blot,
indicated that poly-a.sup.+ mRNA was equally represented on the
blot.
[0166] huBUB3 mRNA expression patterns were compared to those of
other human homologs of BUB/MAD pathway genes, including BUB1, MAD2
and ttk, a candidate S. cerevisiae MPS1 homolog (FIG. 5). In these
experiments, BUB1, MAD2 and ttk exhibited a characteristic
expression pattern, with highest expression in testis, followed by
thymus, and lower expression in colon mucosal lining and small
intestine. This coordinated expression pattern suggests
co-regulation of the expression of these three genes. Of the
various BUB3 transcripts, the .about.1.4 kb transcript follows this
pattern most closely, with highest expression in testis. Testis is
generally regarded as a highly proliferative tissue, and may
suggest a link between mitotic activity and expression of these
genes.
EXAMPLE 2
Characterization of huBUB3 mRNA
[0167] By combination of RACE (Rapid Amplification of cDNA Ends)
and DNA sequencing of cloned RACE PCR products, we have further
characterized the mRNA species hybridizing to the huBUB3 probe. The
relationship of these species to the original 1.4 kb huBUB3 cDNA
fragment we found has also been determined. Conclusions from these
experiments have been confirmed by new EST entries subsequently
deposited. The sequence of .about.2.7 kb transcript-related cDNA
clones suggest that the original 1.4 kb cDNA fragment described in
our invention disclosure is derived from the .about.2.7 kb
transcript (FIG. 1). TWS95, a sense primer used to synthesize the
ORF fragment, appears to exist as part of the sequence of the
.about.1.4, 2.7 and 4.0 transcripts. The antisense primer ORF
primer TWS96 binds to a sequence in an exon identified in the 2.7
kb transcript. This exon is absent from the 1.4 kb transcript. The
following paragraphs describe the experiments leading to these
conclusions, and other details describing the characterization of
cDNA products.
[0168] Using the sequence of the cloned huBUB3 ORF (plasmid
p291-2), sense and antisense RACE primers were designed across the
huBUB3 ORF. RACE is a PCR-based method for characterizing 5' and/or
3' ends of a cDNA. In current versions of this technique, a common
primer is designed to anneal to an arbitrary adaptor sequence
ligated to cDNA ends. When a single gene-specific RACE primer is
paired with the common primer, preferential amplification of
sequences between the single gene specific primer and the common
primer occurs. Commercial cDNA pools specifically modified for use
in RACE are widely available.
[0169] 5' RACE PCRs were performed using antisense primers and
modified cDNA templates from spleen and testis (Clontech
"Marathon"). Each antisense primer produced single discrete
products, suggesting a single shared 5' end for all three
transcripts. In contrast, sense RACE primers produced multiple
bands, suggesting variable ends for the 3' terminus. Given the
known annealing sites of these primers, 3' RACE products were
judged as sufficient to account for the synthesis of each of the
.about.1.4, 2.7 and 4.0 kb hybridizing transcripts. This was
particularly apparent using the spleen cDNA pool, where expression
of the .about.1.4 kb transcript is expected to be low by previous
Northern blotting analysis. From these results it was concluded
that the three hybridizing huBUB3 bands arise from transcription of
the same gene.
[0170] 5' RACE products were cloned and sequenced, from reactions
containing RACE-modified testis cDNA template and antisense huBUB3
primer TWS131 (5'.CCCTGCTTGTTTGGAAACGCTCGTATG) (SEQ ID NO: 7). The
sequence of these cloned 5' RACE products overlapped with public
EST sequences, and suggested transcriptional initiation at variable
sites within a region extending .about.22-86 nucleotides upstream
from the huBUB3 ATG start codon. Two 5' RACE clones, p320-1 and
p320-3, exhibited additional but divergent upstream sequence.
Portions of these sequences matched separate EST entries, making
the identification of the 5'-most transcriptional initiation sites
difficult. In three independent clones, p320-1, p320-3, and p320-8,
a NotI cleavage sequence was identified near the 5' terminus. This
NotI sequence is present in one overlapping EST sequence (aa305778)
but is absent from 6 overlapping EST sequences, and is therefore a
likely artifact. NotI sites are especially rare and the probability
of identifying a site at the 5' end of a transcript is highly
improbable. NotI sequence was also present in the RACE primer and
may have served as a template for conversion of huBUB3 5' sequence
during PCR synthesis. Consistent with this interpretation, a
similar anomalous NotI sequence was found at a different position
26 nucleotides upstream in a separate clone (320-5). The final
huBUB3 sequence (FIG. 1) is compiled without a NotI site.
[0171] We attempted to confirm the sequence of the 5'-most end of
the huBUB3 transcript using genomic DNA sequence. A huBUB3 genomic
fragment was amplified from a modified PvuII restricted genomic DNA
pool (Genomewalker, Clontech), using primer TWS170
(5'.CGGGTGGCTGGTTCAGCTTGAAC- TCGT) (SEQ ID NO: 8) in single sided
PCR reactions, as described in Siebert et al. (1995). TWS170 binds
in an antisense orientation to a site 10 nucleotides to the 3' side
of the predicted huBUB3 ATG initiation codon. Cloned fragments were
sequenced (p347-1, p347-3) and found to retain huBUB3 cDNA sequence
for only 15 nucleotides before encountering a divergent DNA
sequence. From these results, we conclude that the huBUB3 mRNA
transcript includes an exon junction close to the 5' end of the
transcript. A consensus sequence compiled from known splice
junctions has been described [(CA)AG.vertline.G](SEQ ID NO: 9).
Using this consensus, an exon junction can be defined within the 5'
huBUB3 cDNA sequence at the site CCAAG.vertline.ATGAC (SEQ ID NO:
10), where the ATG in this sequence corresponds to the predicted
huBUB3 translation initiation codon.
[0172] On the basis of RACE and EST data, we propose that huBUB3
transcripts initiate primarily in a region .about.11 to 54
nucleotides upstream of the predicted huBUB3 ATG start codon. The
exact locations of transcription initiation sites have not been
determined, but can be precisely located by established methods
including RNASE protection or primer extension assay. In eight ESTs
and three RACE sequences, the huBUB3 ATG start codon is preceded 12
nucleotides upstream by an stop codon (TGA) in the same reading
frame. This appears to preclude the possibility that an alternative
mRNA transcript can encode a protein with an extended C-terminus
sharing the predicted huBUB3 ORF.
[0173] Variability of huBUB3 transcripts at the 3' terminus can
result from alternative mRNA splicing, variable transcriptional
termination sites, or specific mRNA degradation. To determine which
of these mechanisms is responsible for the formation of the various
observed huBUB3 transcripts, the sequence of the .about.2.7 kb
transcript was characterized using cloned spleen cDNA-derived 3'
RACE products. Two highly-related clones (p331-2 and p331-1) with a
size consistent with a .about.2.7 kb transcript origin were
obtained with sense primer TWS130 (5'.ACCCTCTCAGTGTCTGGAGACCGGCT)
(SEQ ID NO: 11). These fragments matched huBUB3 ORF sequence at the
5' end and exhibited poly-a tracts at the 3' end. The sequence
immediately adjacent to the poly-a tracts was used in homology
searches to identify a series of overlapping ESTs, resulting in a
well-defined EST contig of 995 nt extending from the presumed 3'
end of the .about.2.7 kb transcript. Additional sequence data was
then obtained from p331-2 and p331-1 using huBUB3 sense strand
sequencing primers TWS128 (5'.CGACGGTTTCCAAACAAGCAGGGTTATG, SEQ ID
NO: 12); TWS148 (5'.TGATGATAATAAAACAATTCGTACTCCCCA, SEQ ID NO: 13),
and TWS149, (GACTCAAACAATTTGCCCTTCTGGGATCA, SEQ ID NO: 14), an
antisense primer derived from the EST contig, which demonstrated
that this EST contig is linked to huBUB3 ORF sequences. The full
predicted sequence of the .about.2.7 kb huBUB3 transcript was
compiled by combining this sequence with the EST contig and known
5' huBUB3 sequence (FIG. 1B). A recent search of EST databanks
reveals new entries which also serve to bridge the gap between the
EST contig and 3' sequence data (FIG. 1A).
[0174] huBUB3 mRNA expression was also examined with the 3'-most
end of the .about.2.7 kb transcript, using a .about.1.3 kb fragment
derived from a PstI-EcoRI digest of p331-1. This fragment shares
.about.300 nt of 3' terminal sequence with the .about.1.4 kb
transcript, as discussed later. Probe prepared from this fragment
was hybridized to a second commercial Northern blot (Clontech),
consisting of poly-a.sup.+ mRNA samples from 8 neoplastic cell
lines including: promyelocytic leukemia HL-60, HeLa cell S3,
chronic myelogenous leukemia K562, lymphoblastic leukemia MOLT-4,
Burkitt's lymphoma Raji, colorectal adenocarcinoma SW480, lung
carcinoma A549, and melanoma G361. This probe again detected
.about.1.4, 2.7 and 4.0 kb bands, indicating that portions of this
probe are shared by these transcripts. Strongest hybridization
signal was obtained from HeLa S3, CML K562 and colorectal
adenocarcinoma SW480, though hybridization was detected in all
neoplastic tissues examined. Again, the relative signals from the
.about.1.4, 2.7 and 4.0 species were variable, with the .about.2.7
kb transcript providing the strongest signal in the SW480 sample,
but with equal signal from the 1.4 and 2.7 kb transcripts in HeLa.
In these samples, the signal from the .about.4.0 transcript was
weakest. Again, hybridization with an actin probe indicated that
poly-a.sup.+ mRNA was equally represented on the blot.
[0175] To characterize the nature of the .about.1.4 kb huBUB3
transcript, 3' RACE products obtained using testis cDNA template
and sense primer TWS132 (5.GGAGCCCAAGATGACCGGTTCTAACGA) (SEQ ID NO:
15) were cloned and sequenced. Two independent but closely matched
clones, p341-3 and p341-6, exhibited clear poly-a tracts at one end
of a fragment of a size consistent with an origin from the 3' end
of .about.1.4 kb huBUB3 transcript. Six additional EST sequences
can be identified with overlapping sequence. These data can be
combined to define a cDNA corresponding to the .about.1.4 kb
transcript.
[0176] A comparison of the predicted .about.2.7 kb and .about.1.4
kb huBUB3 transcripts reveals that these transcripts share a 3'
end, with an insertion of additional sequence (e.g., additional
exon sequence) into the .about.2.7 kb transcript, at a position
.about.1000 nucleotides from the predicted transcriptional
initiation region. Thus, the .about.1.4 kb transcript consists of
sequence from the .about.2.7 transcript. Using the previously
described exon junction consensus sequence [(CA)AG.vertline.G](SEQ
ID NO: 9), the likely splice junctions at which additional exon
sequence appears in the .about.2.7 transcript can be defined, with
a 3' exon junction within the .about.2.7 sequence defined as
CCAAG.vertline.TCACC (SEQ ID NO: 16), and a 5' junction defined as
TGCAG.vertline.GTCCA (SEQ ID NO: 17). The .about.1.4 kb transcript
then joins these sequences directly, forming the predicted exon
junction CCAAG.vertline.GTCCA (SEQ ID NO: 17). Because of this
alternative exon structure, the .about.1.4 and .about.2.7 kb huBUB3
transcripts specify the production of proteins that share the first
324 amino acids, and are terminated by either 6 additional amino
acids in the case of the .about.1.4 transcript or 4 alternative
amino acids in the case of the .about.2.7 transcript. Thus, these
two cDNAs predict the synthesis of essentially similar proteins,
with a few divergent amino acids at the C-terminal ends (FIG.
2).
[0177] By RACE analysis, the 4.0 transcript appears closely related
to the 1.4 and 2.7 kb transcripts, with a shared 5' end and
additional sequence, (e.g., alternative or additional exons) at the
3' end. Cloning all the cDNA products which define the .about.4.0
transcript can be completed using RACE and other tools known in the
art.
[0178] A complete characterization of the huBUB3 gene, including
associated intron/exon boundaries, promoters, enhancers, and other
regulatory sites, will require cloning and characterization of
additional huBUB3 genomic DNA. The identification of large,
overlapping cloned human genomic fragments, including BACs and/or
YACs, is relatively straightforward, and be readily identified by
the ability to produce huBUB3-specific products in PCR-based
screening reactions.
[0179] The proteins encoded by the .about.1.4 and .about.2.7 kb
huBUB3 transcripts are structurally similar to scBUB3, retaining a
WD40 repeat structure and other conserved residues (FIG. 3). A
murine BUB3-like sequence was identified (Genbank U67327) with a
truncated reading frame. Many huBUB3 EST databank entries (FIG. 1A)
were annotated with homology to Schizosaccharomyces pombe rae1
gene. A human homolog of the sp-rae1 (hu-rae1) was previously
identified in the databanks. A sequence comparison indicates this
gene is clearly distinct from the huBUB3 gene. Based on analogy
from known yeast gene functions, we anticipated a partner to the
previously disclosed huBUB1 gene would exist. We have now
identified a physical interaction between the product of this
huBUB3 gene with the huBUB1 gene product (see below), confirming
that the huBUB3 gene described here is the anticipated ligand for
huBUB1. Based on sequence comparisons, we propose that the closely
related rae1 genes from human and S. pombe may be functionally
related to the structurally related S. cerevisiae YET7 gene
product.
EXAMPLE 3
Developmental Expression
[0180] Human EST deposits of clear huBUB3 origin include numerous
fetal cDNA sequences, strongly suggestive of expression in these
tissues. This is consistent with our earlier conclusions that
huBUB3 may be active in proliferating tissues.
EXAMPLE 4
Chromosomal Locus of huBUB3
[0181] huBUB3 was successfully mapped to a chromosomal locus in our
lab. These results indicate that huBUB3 is located at a site known
by other work to be frequently mutated in cancer cells. This
chromosomal location appears to be involved in the genesis of
cancers from a wide variety of tissue types, producing both solid
and hematologic neoplasms. Experiments leading to these conclusions
are described in the following paragraphs.
[0182] a huBUB3 cDNA sequence search of the NCBI Sequence Tagged
Site (STS) database to determine if huBUB3 is associated with known
STS sequences produced negative results. The huBUB3 map position
(10q24) was subsequently identified by Radiation Hybrid (RH)
mapping (Walter et al., 1994, Nature Genetics 7: 22-28).
Commercially prepared genomic DNAs from individual hybrid hamster
cell lines harboring human irradiated chromosomal fragments
(Stanford G3 panel, Research Genetics) were used as templates in
PCR reactions to identify individual hybrid cell lines carrying
huBUB3 DNA. Three separate mapping experiments were conducted,
using primer pairs engineered from 3' untranslated (UTS) .about.2.7
kb huBUB3 transcript sequence data (TWS157/TWS158, TWS172/TWS173,
and TWS176/TWS177).
1 Primer sequence TWS157 5'.TCATTGCAGGTCCACCTAATCATCCTGTGAAAGTGGTT
(SEQ ID NO:18) TWS158 5'.ACTAGGGGACAGAAGGGGAAATACGTCAGACTACT (SEQ
ID NO:19) TWS172 5'.TTTGGGCAAACAAAATTGGAGGGCAAGTGAC (SEQ ID NO:20)
TWS173 5'.ACCAGCAAAAGAAACAAATGGCTCACGAGCCT (SEQ ID NO:21) TWS176
5'.TGCAGGTCCACCTAATCATCCTGT- GAAAGTGGTT (SEQ ID NO:22) TWS177
5'.ACAGAAGGGGAAATACGTCAGACTACTGTACAGGG (SEQ ID NO:23)
[0183] In each experiment, human/hamster hybrid genomic templates
which produced the anticipated huBUB3 genomic PCR products were
recorded. For scoring purposes, results were submitted to the
Stanford Human Genome Center (SHGC) Web server
(http://www-shgc.stanford.edu/rhserver2/rhserver- _form.htm1). Data
from each of the three primer pairs produced similar map locations,
indicating strong linkage of huBUB3 sequences to STS locus
SHGC-13269. Using the SHGC Web server, STS markers D10S216 and
D10S244E were identified as closely linked markers for SHGC-13269.
Using the Entrez genome feature of the NCBI web site
(http://www.ncbi.nlm.nih.gov/E- ntrez/Genome/org.htm1), SHGC-13269
and linked markers were all found to map to chromosomal locus
10q24, indicating that this is the chromosomal location of the
huBUB3 gene.
[0184] 10q24 is the known chromosomal location of recurrent
cancer-related genetic rearrangements, as cataloged in Mitelman et
al. Nature Genet. (Supp.) pp.417-74 (1997). A literature search
indicated that other potential cancer-related genes mapped in and
near 10q24 include Wnt8B, FGF8, Fas, HOX11, LYT10, MXI1.
Cancer-related genes are functionally classified as either
oncogenes or tumor suppressor genes depending on the known role of
the gene product in cancer. In cancer, HOX11 and LYT10 function as
oncogenes, and can each be transcriptionally activated by
cancer-related chromosomal translocations. These translocations
serve to bring an active promoter into the region of these normally
quiescent genes, resulting in abnormal accumulation of a gene
product which would normally be absent. Thus, the abnormal presence
of an activity associated with an oncogene product contributes to
the phenotype of a cancer cell. In contrast, the phenotypes of
tumor suppressor genes suggest that they are active in normal
cells, and that in cancer cells their gene products are
non-functional. Cancer-related mutations in a tumor suppressor gene
are generally inactivating mutations, commonly including deletions,
truncations, and other mutations.
[0185] By analogy to the known function of scBUB3 in yeast, we
anticipate that the absence of huBUB3 activity in human cells
should reduce the fidelity of mitosis, possibly resulting in
increased aneuploidy and genetic instability. Aneuploidy, a state
which describes the absence of a correct genetic complement of
chromosomes in a given cell, is exceptionally rare in normal human
cells, but is observed at much higher frequencies in cancerous
cells. The function of huBUB3 may be required in normal cells for
suppressing aneuploidy. Cancer-related mutations in huBUB3 might
therefore increase the genetic instability of cells, contributing
to an unstable phenotype and karyotype commonly observed in tumor
cells. We propose that the huBUB3 gene may behave in human cells as
a tumor suppressor gene, such that cancer-related alterations in
the huBUB3 gene would inactivate the huBUB3 gene product.
Inactivating mutations, including chromosomal deletions, might
therefore be expected to be associated with the huBUB3 locus in
cancer cells.
[0186] In cancer, recurrent deletions of chromosomal loci have been
used to infer the locations of important tumor suppressor genes. We
find that the chromosomal site of huBUB3, 10q24, is recorded in the
literature as the most heavily modified site of cancer-related
karyotypic variation on chromosome 10. The resolution of karyotypic
analysis is limited to relatively gross chromosomal deletions, and
the frequency of cancer-related mutations of individual genes
within this region are likely to be much higher. Recurrent
karyotypic deletions of this site have been observed in neoplasms
of both solid and hematological origin (Mitelman et al. 1997).
[0187] Hematological neoplasms exhibiting recurrent deletions of
10q24 include: Chronic Lymphoproliferative Disorder (CLD),
Non-Hodgkins Lymphoma (NHL), Acute Lymphoblastic Leukemia (ALL),
and Acute Myeloid Leukemia (AML). Non-hematological neoplasms with
recurrent 10q24 deletions include: malignant epithelial neoplasms
consisting of various adenocarcinomas originating in ovary, breast,
large intestine, and prostate; transitional cell carcinomas of
bladder tissue; and germ cell tumors of testis tissue. Recurrent
10q24 deletions have been recorded in malignant mesenchymal
neoplasms (mesothelioma) and neuroglial neoplasms (astrocytoma).
Recurrent 10q24 deletions have also been recorded from benign
mesenchymal neoplasms of the uterus (leiomyoma). Of these
deletions, many were recorded as the sole karyotypic abnormality
detected in the neoplasm.
[0188] In the cases of malignant meningioma, prostate
adenocarcinoma and glioma, the role and extent of modification of
this chromosomal region was examined by extensive karyotyping and
by Loss-Of-Heterozygosity (LOH) mapping . The minimal LOH region
defined in a study of 117 gliomas included STS markers D10S587 and
D10S216 (Rasheed et al. 1995). As previously noted, D10S216 was
identified by RH mapping as within the immediate region of the
huBUB3 gene. This suggests that the huBUB3 locus is subject to
recurrent deletions and other potential modifications in
cancer.
[0189] Genes are present in two copies in normal human diploid
cells. In cancers exhibiting karyotypic deletions of a tumor
suppressor gene locus, a single allele may be subject to deletion,
and the remaining allele may be inactivated through point mutation.
Occasionally, a tumor suppressor gene is inactivated by a
dominant-negative mutation, in which a single mutated allele may
suppress the activity of a second, non-mutated allele. This effect
can occur through interaction of a mutant gene product with the
gene product of the remaining allele, or through interaction with
other proteins in a multi-protein complex. In these scenarios,
these interactions block the activity of the product from the
non-mutated allele. With respect to huBUB3, both scenarios are
possible. In this work, we have demonstrated that huBUB3 protein
forms a multi-protein complex, through interaction with huBUB1 gene
product, as described in the following section.
[0190] Of known genes mapped to 10q24, MXI1 has been suggested as a
potential tumor suppressor gene. One study associated mutations of
MXI1 with prostate cancer, while a separate study of 40 pancreatic
adenocarcinomas failed to find any correlation with MXI1
inactivation . These results suggest MXI1 inactivation is
insufficient to explain the general tumor suppressor effect
associated with deletions in this region.
[0191] The precise role of huBUB3 in the genesis of individual
cancers remains to be determined, but this mapping data provides
strong inferential support for the idea that the huBUB3 locus may
function as a tumor suppressor gene in cancer.
EXAMPLE 5
Chromosomal Locus of huBUB1
[0192] Using somatic cell hybrids, chromosome 2 has been identified
as the location of the huBUB1 gene, mapped more specifically using
RH (radiation hybrid) mapping to a site near STS marker D2S176
(Pangilinan et al. 1997). Another study independently mapped BUB1
to 2q12-14 by FISH (Cahill et al. 1998). We RH mapped the 3' end of
BUB1 using primer pair TWS169
(5.dbd..ACCAAGAGGGTCATTGCCCTTGTAGCTCTGCATGT) (SEQ ID NO: 25) and
TWS185 (5'.GGATGCAGAGTTCTCTGGGAGCTCTGTGGCTGATT) SEQ ID NO: 26),
which anneals to intron sequence near the 5' end of the BUB1 ORF.
Our own BUB1 RH data produced significant scores when a chromosome
2 localization was included, suggesting linkage (50
cR.sub.--10,000, LOD 3.5) to STS locus SHGC-37233. Markers
SHGC-37233 and D2S176 are separated by a gap in the current
Stanford G3 RH map, suggesting BUB1 may lie within this interval.
SHGC-37233 and D2S176 are assigned to 2p13-14, suggesting huBUB1
lies very near the centromere of Chr. 2.
EXAMPLE 6
Antisense Constructs
[0193] We engineered an antisense construct of the huBUB3 gene
(p291-45), consisting of a .about.1.0 kb PCR fragment corresponding
to the huBUB3 ORF cloned into a commercial expression plasmid
vector pCR3.1 (Invitrogen). This .about.1.0 kb PCR fragment was
amplified from a RACE-modified testis cDNA pool using sense primer
TWS95 (5'-GGGAGCCCAAGATGACCGGTT) (SEQ ID NO: 5) and antisense
primer TWS96 (5'-AAATCCACCATTGGGGAGTACGAATTGT) (SEQ ID NO: 6). Upon
characterization of various cDNAs, it was determined that the
.about.1.4 kb transcript lacks a priming site for TWS96. TWS96
matches sequence present in the .about.2.7 kb cDNA (and possibly
also the .about.4.0 transcript, which has not been fully
characterized as of yet). p291-45 is designed to utilize the strong
viral CMV promoter and the bGH transcriptional terminator in
transfected mammalian cells for antisense huBUB3 expression and
transcriptional termination. The vector includes a neomycin
resistance marker gene for selection of stable transfectants in
mammalian cell lines, along with additional sequences required for
propagation in bacteria.
[0194] This construct, and an essentially similar sense huBUB3
expression construct (p291-2), are being tested in cell lines to
determine their ability to produce relevant phenotypes in various
assays. Relevant phenotypes are discussed below. Additional
constructs expressing huBUB3 fusion proteins have been produced as
well. These plasmids, including sense, antisense and fusion protein
constructs, can be used for gene therapy. We have injected p291-2
directly into mice, and results suggest that huBUB3 was expressed
in murine tissue. Expression of a huBUB3 gene in tissues can be
exploited for therapeutic effect.
EXAMPLE 7
Therapeutic Applications of the Gene/Protein
[0195] To aid in defining therapeutic applications, we are
currently examining cells for any or all of four phenotypes that we
anticipate may be associated with huBUB3; (1) cell viability, (2)
cell cycle control, (3) apoptosis, and (4) transcriptional
regulation. Cell viability phenotypes are anticipated based on the
known function of yeast scBUB3 in maintaining cell viability in the
presence of microtubule poisons. Cell cycle phenotypes are also
anticipated based on studies of yeast scBUB3. Research on the p53
and ATM genes, which function in a functionally analogous pathway
activated in response to DNA damaging agents, suggest to us that in
multicellular organisms, including humans, huBUB3 may be associated
with apoptosis and transcriptional regulation. Cell cycle arrest
and apoptosis are known consequences of treatment of cultured human
cells with microtubule poisons, and we anticipate these phenotypes
may require the function of the huBUB3 gene. In various tests,
these cellular phenotypes and associated potential therapeutic
applications may prove to be either microtubule-poison drug
dependent, or drug independent.
[0196] Normal human and yeast cells pause in cell cycle in the
presence of microtubule poisons. Microtubule poisons interfere with
the proper formation and dynamics of the microtubule organizing
centers (also called centrosomes, spindle pole bodies), associated
microtubules, and other microtubule-associated proteins. Late in
each cell division, microtubules become attached to paired
chromosomes at a chromosomal structure termed the kinetochore.
These microtubules in turn become associated with centrosomes at
the opposite poles of a cell. In preparation for mitosis, these
microtubules interact with the opposed centrosomes within the cell,
forming what is termed a mitotic spindle. During the metaphase
stage of mitosis, microtubules direct the migration of the
individual chromosomes towards a point midway between the
centrosomes, forming the metaphase plate. Following proper
arrangement of the chromosomes to form the metaphase plate, a
signal is generated which allows the paired chromosomes to separate
and migrate towards opposite centrosomes (chromosome segregation),
in a microtubule-dependent process. Once chromosomes have been
properly segregated to opposite poles of a cell, cells begin
cytokinesis, the process of dividing the cell into two progeny
cells. Cytokinesis is the process by which the cytoskeleton of a
cell is modified to cause a constriction of the plasma membrane in
the region between the segregated chromosomes, as a precursor to
the formation of two independent progeny cells. The cytoskeleton of
cells consists of actin and other protein components. The
cytoskeleton exists independently from microtubules. Any effect of
microtubule poisons on cytoskeletal dynamics is therefore
indirect.
[0197] Microtubule poisons disrupt the formation and dynamics of
microtubules, and in normal cells, a cell cycle delay ensues. Thus,
the process of cytokinesis is inhibited in response to microtubule
poisons in normal cells. This delay presumably exists to allow time
for the mitotic spindle to be repaired prior to attempting
cytokinesis.
[0198] The mechanism by which disruption of microtubule function
results in inhibition of later mitotic events including cytokinesis
has been studied genetically in the budding yeast, Saccharomyces
cerevisiae. Yeast cell cycle response to microtubule poisons
requires the activity of S. cerevisiae scBUB3. Yeast cells
defective in scBUB3 function are sensitized to the presence of
microtubule poisons. These mutant scBUB3 cells fail to detect the
absence of mitotic spindle function, and proceed directly into
cytokinesis in the absence of chromosome segregation. The result of
cytokinesis in the absence of proper chromosome segregation is the
production of progeny cells that inherit a random assortment of
genetic material. Since many individual genes are essential for
viability of cells, failure to inherit an accurate and complete
complement of chromosomes results in subsequent loss of viability
and death of progeny cells. This loss of viability of scBUB3-mutant
yeast cells in the presence of microtubule poisons is therefore
directly associated with a failure of cell cycle control. This
process of cell death through failure to regulate cell cycle
progression in response to control signals has been generally
termed "mitotic catastrophe".
[0199] In humans, the huBUB3 protein or gene or variants thereof
can be used in therapeutic applications to stimulate a cell cycle
response. A delivery method which resulted in an excess of huBUB3
activity in recipient cells may cause a permanent cell cycle
arrest, for example, without a requirement for microtubule poisons.
Alternatively, delivery of huBUB3 augments the cell cycle delay
phenotype of microtubule poison-treated cells. This can be useful
in inhibiting the growth and division of hyperplastic tissues,
including cancer. Any application where inhibition of cell growth
is desired can be achieved through methods which increase the
activity of huBUB3 in cells. In these therapeutic applications, DNA
or protein can be used directly, delivered by injection, by gene
gun using huBUB3 protein, RNA or DNA coated particles, by
electroporation, or by a variety of other recognized methods
designed to increase uptake of exogenously provided materials into
cells. Gene-specific delivery methods for delivery of huBUB3 DNA
and/or RNA can include viral-based gene delivery vectors, e.g.,
retroviral, AAV and other hybrid vectors.
[0200] We expect that knowledge of the nucleotide sequence of
huBUB3 will be useful in the design and identification of huBUB3
small-molecule agonists, through random screening of chemical
libraries for compound which modify the activity of huBUB3 protein
or huBUB3 transcription, or through rational chemical design
approaches using the structure of huBUB3 protein and known huBUB3
ligands (e.g., huBUB1). In mutant huBUB3 cells, as may occur in
cancer or other hyperplastic syndromes, cells may respond to huBUB3
protein or DNA by cell cycle arrest. This can be used
therapeutically to retard the growth of cancer or other
hyperplastic tissues. Alternatively, huBUB3 protein or gene may
restore normal huBUB3 function to mutant human cells, allowing cell
cycle arrest in a drug-dependent fashion. Genetic syndromes
resulting from germ-line transmission of huBUB3 mutations may be
treatable by huBUB3 gene therapy in utero, for example, with huBUB3
genes or variants thereof.
[0201] Knowledge of the huBUB3 gene may allow the rational design
of viral vectors which require the absence of huBUB3 function. An
instance of use of modified adenoviral vectors which requires
absence of p53 function has been described. In this cases, viral
replication and death of infected cells is restricted to mutant
cells, sparing normal tissue.
[0202] Additional arguments can be made for therapeutic
applications based on apoptotic response of cells to huBUB3
activity. Many cell types have been described which undergo an
apoptotic response to microtubule poisons. Cells which cannot
repair damaged mitotic spindles may be targeted for programmed cell
death by apoptotic signaling pathways that may involve the huBUB3
gene. Delivery of huBUB3 gene, protein or small molecule agonist
may be sufficient to trigger apoptosis in cells. This can be useful
in eliminating hyperplastic tissues, including cancer, though
apoptotic cell death, for example. Alternatively, delivery of
huBUB3 gene, protein or small molecule agonist may sensitize cells
to the apoptotic effects of microtubule poisons, resulting in
enhanced cell death in combined treatments involving these
agents.
[0203] Similar therapeutic applications based on transcriptional
response of cells to huBUB3 activity may also be used. While
transcriptional targets of huBUB3 regulation have not been
identified, the functions of these transcriptional targets may
prove essential to cell viability, cell cycle control, apoptosis
and/or other uncharacterized phenotypes. Delivery of huBUB3 gene,
protein or small molecule agonist may be sufficient to trigger
transcriptional regulation of target genes in cells, the utility of
which is currently unknown with respect to therapeutic
applications. The constructs described here can be used to
facilitate discovery of transcriptionally regulated genes, by using
PCR differential display or other techniques to identify
differential representation of specific mRNAs in cells in which
huBUB3 activity is over-expressed, or under-expressed, as may occur
using antisense constructs.
[0204] An alternative approach to the design of huBUB3-based
therapeutics involves the engineering of versions of the huBUB3
protein or gene which inhibit the function of the native huBUB3
gene within cells (dominant negative phenotypes). These constructs
can be used to confer a "mitotic catastrophe" on cells treated with
microtubule poisons. Alternatively, small molecule inhibitors that
interact with huBUB3 and prevent binding of ligands (e.g., huBUB1)
can be developed with similar applications in mind. This is likely
the most promising avenue for development of huBUB3-based
therapies. Modified huBUB3 proteins or genes of this class might
include huBUB3 antisense constructs, transcript-specific ribozymes,
truncation variants, point mutants, insertion mutants, and/or
fusions with other proteins, to produce variant huBUB3-derived
molecules which inhibit the activity of native huBUB3 within cells.
These genes or proteins can be delivered directly, as previously
described, or in the form of nucleic acid constructs, including
recognized gene therapy vectors and other nucleic acid delivery
vehicles. By inhibiting the activity of native huBUB3 in cells,
huBUB3-associated phenotypes can be blocked.
[0205] Because in yeast scBUB3 is required for cell viability
following treatment with microtubule poisons, these inhibitors of
huBUB3 function may induce selective cell death upon exposure to
microtubule poisons. In cancer cells expressing native huBUB3
protein, enhanced cell death upon exposure to microtubule poisons
can be of great clinical utility. Other applications include
treatment of other hyperplastic disorders in combination with
microtubule poisons.
EXAMPLE 8
Diagnosis, Prognosis, Therapeutics, and Drug Screening
[0206] huBUB3-based diagnosis of tumor samples can predict the
outcome of treatment with microtubule poisons and can therefore be
used to decide an appropriate therapeutic regimen, tailored to the
individual patient. huBUB3 diagnostic tests can include Protein
Truncation Test, SSCP analysis, sequence analysis of PCR products,
and other tests. If diagnostic tests determine that the huBUB3
locus is inactivated through mutation of both alleles, or through
production of dominant negative mutations, treatment of patients
with commonly used microtubule poisons may result in severe
regression of the tumor through the effects of "mitotic
catastrophe" on cell viability, as described in the therapeutic
applications section. Alternatively, if diagnostic tests determine
that the BUB3 locus is functionally active in tumor cells,
transient or prolonged treatment of patients with microtubule
poisons may result in a delay in tumor progression, through the
anticipated cell cycle effects of huBUB3 activity, rather than
producing substantial tumor regression. In this instance, a
clinician may elect to omit microtubule poison drug treatment, as
side effects of treatment with these drugs may limit their
therapeutic value in this instance. In a third instance, the huBUB3
locus is diagnosed as functionally active in a tumor, and based on
this diagnosis, a decision may be made to treat patients with a
combination therapy consisting of huBUB3 inhibitors and microtubule
poisons. This would serve to induce a mitotic catastrophe effect in
cells which normally would be resistant to this effect. This
treatment can be repeated for additional reductions in tumor
burden, as upon recovery from treatment cells retain wild-type
huBUB3 genes.
[0207] With respect to discovery of novel drugs, the protein
product of huBUB3 or variants thereof can be produced, and
biochemical assays can be designed based on knowledge of this gene
and gene products. These drugs can include chemical inhibitors of
huBUB1 and huBUB3 interaction, or inhibitors of a huBUB1/huBUB3
kinase.
EXAMPLE 9
Antibodies
[0208] Antibodies directed against huBUB3 protein were produced in
mice by direct DNA immunization. These antibodies may be useful in
diagnostic tests, including Protein Truncation Test, and in various
assays of huBUB3 function, including study of interacting proteins,
and in assays of huBUB3 function in cells, cell extracts and other
in vitro tests. Diagnostic and therapeutic applications may also be
identified for antibodies or antibody fragments which recognize
huBUB3. It may be possible to produce huBUB3-reactive antibodies
using muBUB3 sequences.
[0209] To produce antibodies, plasmid 291-2, a huBUB3 expression
construct, was purified from E. coli host strain XL-1-blue
(Invitrogen) and used to immunize mice. Direct DNA immunization
allows the production of highly-specific antibody in the absence of
protein immunogen. Typical protein-based immunizations require
highly-purified protein, and may result in the production of serum
with antibody with affinity to minor protein contaminants in the
immunogen preparation. In contrast, immunization with purified
nucleic acids has the advantage that antibodies are produced only
to the proteins encoded on the plasmid. Any residual contaminating
bacterial nucleic acids are not expressed due to the lack of
specific regulatory sequences required for expression in mammalian
cells. Previous published data has shown that muscle tissue is
competent for expression of injected DNAs.
[0210] p291-2 is based on expression plasmid pCR3.1 (Invitrogen),
and includes necessary mammalian expression elements to allow the
production of huBUB3 (.about.2.7 kb variant) and the neomycin
resistance gene product within recipient cells. Endotoxin-free DNA
was prepared using a kit (Qiagen). Following collection of
pre-bleed serum samples, 5 Balb/c mice were immunized via
intra-muscular injection of 100 .mu.g of purified DNA, on three
separate occasions (50 .mu.g per each tibialis anterior muscle per
injection). The second and third immunizations followed 28 and 56
days after the first injection, respectively. Two production bleed
samples were collected from each mouse, at days 42 and 72 following
the first injection.
[0211] Serum samples were used in Western blotting assays of
cultured human cell extracts to determine if huBUB3 antibodies were
produced in animals. Extracts from DU145 prostate carcinoma cells
were separated by SDS-PAGE and transferred to a support membrane.
Second production bleed serum from one immunized mouse was found to
strongly react with a single band from these extracts. This band
was not detected in parallel experiments using pre-immune serum
from the same animal and was absent or barely detectable using
post-immunization serum samples from the other animals. Because
untransfected DU145 cells are not expected to express neomycin
resistance gene product, this band is interpreted to represent the
presence of antibodies directed against huBUB3 in the serum from
this animal. These antibodies are presumed to arise from expression
of huBUB3 in mouse tissues.
[0212] huBUB3-reactive antibodies can be used in
immuno-precipitations to identify interacting proteins, which can
become targets for further discovery efforts and therapeutics and
diagnostics. huBUB3 antibodies may be used to immuno-precipitate
huBUB1/huBUB3 complexes from cell extracts for use in in vitro
kinase assays to identify potential huBUB1 kinase substrates and
kinase inhibitors in a small molecule screening effort. Additional
proteins bound to huBUB1 and/or huBUB3 may be identified in
extracts using these reagents and purified by recognized techniques
to identify and characterize novel proteins or to assign novel
activities to known proteins which function in a complex with
huBUB3. Antibodies can be used to examine huBUB3 from tumor cells
directly, for mutations which produce protein truncation variants
in Western blotting experiments (protein truncation test). Also,
huBUB3-reactive antibodies may have a therapeutic effect in humans.
Cells which overexpress huBUB3 in a patient may react with
antibody, allowing the selective elimination of these cells through
normal immunological response. Antibody production might be
achieved though DNA immunization of humans, as described above, or
through treatment with antibody produced in cultured cells or
animals. The production of huBUB3-reactive monoclonal antibodies is
also possible, through recognized techniques for isolation and
propagation of huBUB3 antibody-producing cells. The advantages of
monoclonal antibodies are well recognized and documented elsewhere.
Gene therapy vectors based on the expression of huBUB3-reactive
antibodies or antibody fragments or fusion proteins may be produced
for intracellular expression of huBUB3-reactive proteins. Within
cells, these antibody-related proteins can be used in the same
manner as dominant-negative nucleic acid and protein variant
inhibitors of huBUB3 and small molecule chemical inhibitors of
huBUB3 function.
EXAMPLE 10
huBUB1 Binds to huBUB3
[0213] We have found evidence for the physical interaction between
huBUB3 and huBUB1 gene products. This interaction was predicted
from yeast data, where huBUB1 and huBUB3 form a protein complex
with kinase activity. The huBUB1 gene displays a conserved domain
at the C-terminus proposed to be required for interaction with
huBUB3. By demonstrating this physical interaction, we confirm that
the huBUB3 gene product is the appropriate ligand for the huBUB1
protein. This experiment serves to illustrate the utility of
knowledge of the huBUB3 sequence in discovery purposes in the
discovery of novel protein-protein interactions. This discovery may
also serve as the basis for a biochemical assay for inhibitors of
huBUB1/huBUB3 interaction.
[0214] As part of these experiments, a huBUB3-FLAG fusion
expression construct (p322-1) was produced, by insertion of
synthetic FLAG immuno-peptide coding sequences between the PinAI
and HindIII sites of p291-2. In this construct, a synthetic
N-terminal methionine codon is followed by sequence coding for
three "FLAG" immuno-peptide repeats separated by glycine codons.
This segment is in turn immediately followed by 5 glycine codons
and is fused in-frame to the second codon of the native huBUB3
N-terminus, replacing the native N-met residue. The product is a
plasmid encoding a FLAG-huBUB3 protein fusion. Monoclonal antibody
reagents which recognize the FLAG sequence (DYKDDDK) (SEQ ID NO:
24) are commercially available (Kodak).
[0215] Various huBUB3 and huBUB1 plasmids were subjected to coupled
in vitro transcription/translation reactions in the presence of
35-S labeled methionine (T7 polymerase-directed TnT kit, Promega),
to produce radioactive protein products which can be followed in
various assays (FIG. 4). The vector for these plasmids includes a
bacteriophage T7 binding site which allows in vitro synthesis of
transcripts of the genes under study. 5 .mu.l labeling reactions
contained 15 to 100 ng of each plasmid. Following incubation at 30
C for .about.1.5 hr, 3 .mu.l of TNES buffer (50 mM Tris-Cl pH 7.5,
2 mM EDTA, 100 mM NaCl, 1% NP-40) was added and insoluble material
was removed by centrifugation. Agarose beads with anti-FLAG
monoclonal antibody coupled to them (Kodak) were washed with TNE
(equivalent to TNES without NP-40) and added to the soluble
fraction. Antibody binding reactions were incubated at room
temperature .about.1 hr, then briefly centrifuged and a 5 .mu.l
supernatant fraction was collected. Pellets were washed once with
TNES and twice with TNE before resuspension in SDS-PAGE sample
buffer. Aliquots of supernatant and washed pellet fractions were
then analyzed by SDS-PAGE on 10-20% gradient gels. Dried gels were
then autoradiographed (FIG. 4).
[0216] .sup.35S labeled protein corresponding to the products of
various genes of interest was produced in in vitro translation
reactions. Proteins were expressed either singly (FIG. 4A) or in
combinations (FIG. 4B). Preliminary experiments demonstrated that
of the various plasmids analyzed, only the plasmid coding for the
FLAG-epitope tagged huBUB3 fusion protein (p322-1) produced
material that was enriched in pellets following anti-FLAG
immuno-precipitation. In reactions where plasmids were combined,
again, only reactions which included the FLAG-huBUB3 plasmid
produced enrichment of labeled protein in immuno-precipitation
pellets (FIG. 4B). When FLAG-huBUB3 plasmid was combined with a
huBUB1 coding plasmid (p337-50), huBUB1 was co-precipitated along
with the FLAG-huBUB3. This indicates that huBUB3 is a ligand for
huBUB1. When plasmid encoding huBUB3 was added to reaction
containing FLAG-huBUB3 and huBUB1 plasmids, only labeled
FLAG-huBUB3 and huBUB1 were observed to be enriched in the pellet.
These results are consistent with a model in which huBUB3/huBUB1
complexes retain a single monomer of huBUB3 per complex. In this
manner, the labeled FLAG-huBUB3 protein competes with huBUB3 for a
single binding site in the complex, such that prior binding of
labeled FLAG-huBUB3 precludes association with huBUB3 protein.
These results are also consistent with a model in which huBUB3 does
not self-associate.
[0217] In yeast, scMAD2, scMPS1, scBUB1 and scBUB3 are each
proposed to function in a microtubule poison signaling pathway. We
also determined whether the known gene hsMAD2, a structural homolog
of scMAD2, can interact with huBUB1 and FLAG-huBUB3 in a ternary
protein complex. We did not detect any binding of the hsMAD2 gene
product to FLAG-huBUB3/BUB1 complexes in these experiments.
Co-translation of the hsMAD2 gene was not required for assembly of
huBUB1/FLAG-huBUB3 complexes, shown in other experiments.
[0218] These results can be used to develop small molecule
inhibitors based on activity in a huBUB1/huBUB3 interaction assay.
The huBUB1 and scBUB1 genes exhibit strong homology to known
kinases. In yeast, the scBUB1/scBUB3 complex is known exhibit
protein kinase activity, with literature references recording
scBUB1 auto-phosphorylation activity and kinase activity towards
scBUB3. Our intent is to develop protocols which make use of some
of the reagents and interactions described here to identify
inhibitors or activators of huBUB1/huBUB3 signaling, and anticipate
the development of in vitro kinase assays using huBUB1/huBUB3
protein complexes.
EXAMPLE 11
Subcellular Localization of Over-expressed BUB1 and BUB3
[0219] Anti-huBUB3 serum was generated directly by genetic
immunization with huBUB3 expression plasmid p291-2. We find that
genetic immunization with naked DNA provides a useful alternative
strategy for generating antibody when protein immunogen is
limiting. With this serum, BUB3 expression was monitored in DU154
prostate carcinoma cells transiently transfected with either BUB3
or FLAG-BUB3. In both cases, bright BUB3 staining was limited to
mitotic nuclei, as evidenced by the presence of condensed
DAPI-stained chromatin. Pre-immune serum failed to produced bright
staining in BUB3-transfected cells. Similarly, bright staining was
absent in cells transfected with pCR3.1 vector. Among brightly
stained mitotic nucleic, clear prometaphase, metaphase, and
telophase forms could be identified.
[0220] Cells were also transiently transfected with HA-BUB1 plasmid
and the relative distribution of HA-BUB1 was determined using
anti-HA antibody. Brightly HA-BUB1 stained cells also consisted
entirely of mitotic nucleic. Control cells transfected with pCR3.1
vector failed to exhibit bright HA-BUB1 staining. These results
suggest HA-BUB1 expression is also limited to mitotic nuclei.
[0221] The observation of a mitosis specific staining pattern for
these proteins was somewhat surprising. Transcription from the
pCR3.1 expression vector is not known to be cell cycle regulated.
HA-BUB1 and BUB3 overexpression may each cause accumulation of
cells in mitosis. The mitotic indices of HA-BUB1, BUB3 and pCR3.1
vector transfected cells in these experiments were therefore
compared. These indices were similar, suggesting that expression of
these proteins did not induce an excess of mitotic cells.
[0222] Alternatively, these proteins may be regulated by
posttranslational processing. This possibility is intriguing, as
numerous cell cycle regulatory proteins are known to be subject to
cell cycle-regulated proteolytic degradation. In both HA-huBUB1 and
-huBUB3 transfected cells, bright staining of clear telophase
figures was seen, suggesting that regulation of these proteins may
occur after anaphase chromosome separation.
EXAMPLE 12
huBUB1 and huBUB3 are Nuclear Antigens
[0223] DU145 prostate carcinoma cells were transiently transfected
with various plasmids in the presence of LT-1 transfection reagent
(Mirus). After two days of growth, cells were fixed 5 min in cold
methanol, shifted to room temperature, washed with PBS/0.1% Triton
X-100 three times, then blocked and permeabilized with 1% BSA in
PBS/0.1% Triton X-100 for 30 min at room temperature. Cells were
sequentially incubated with primary and secondary antibodies in 1%
BSA in PBS/0.1% Triton X-100. Following antibody reactions, slides
were washed with PBS/0.1% Triton X-100.
[0224] Nuclei were stained by 10 min incubation in 0.05 mg/ml
4'-6-diamidono-2-phenylindole (DAPI). Stained cells were imaged
digitally using a Zeiss axiovert fluorescence microscope equipped
with a high-resolution CCD camera (Xillix Corporation). Image data
was processed using SCILImage (Delft, Netherlands) to subtract
background fluorescence and enhance contrast. Cytometric
classification for cell cycle distribution was done using nuclear
morphology and DAPI staining distribution and intensity.
[0225] The site of accumulation of HA-huBUB1, -huBUB3, and
FLAG-huBUB3 proteins was determined in these cells. Results suggest
that these proteins accumulate in the nucleus, consistent with the
formation of huBUB1 and huBUB3 complexes.
[0226] Relatively diffuse HA-huBUB1 and huBUB3 nuclear staining was
observed, likely due to relatively high expression levels. Somewhat
surprisingly, bright huBUB1 and huBUB3 immunostaining was
restricted to M phase cells, in which condensed chromatin was
readily observed. Because in both cases proteins were expressed
from a non-native CMV promoter, these results suggest that
accumulation of huBUB1 and huBUB3 proteins may be regulated. The
widespread role of the APC in turnover of mitotic regulatory
proteins suggests a potential role for ubiquitin-mediated
proteolysis in regulating the accumulation of huBUB1 and huBUB3 in
the cell cycle. huBUB1 and huBUB3 overexpression were each detected
in clear telophase figures, suggesting that degradation of these
proteins was not required for anaphase initiation.
[0227] These staining patterns differ from those reported by Taylor
et al., who reported that a GFP-BUB3 fusion protein was expressed
as a diffuse nuclear antigen in interphase cells, becoming
specifically localized to kinetochores during prophase and
prometaphase, and finally becoming diffusely localized throughout
the cell in metaphase and anaphase (Taylor et a. 1998).
Overexpression of murine BUB1 disrupted these patterns, causing
accumulation of overexpressed huBUB3 in the cytoplasm. These
differences in staining patterns are not mutually exclusive and
likely result from different expression levels, cell types, and use
of fusion proteins. Together, these data are consistent with the
notion that huBUB1 and huBUB3 exist together as components of a
multi-protein kinetochore complex.
EXAMPLE 13
huBUB1 is a Protein Kinase
[0228] The huBUB1 gene product functions as a kinase which
auto-phosphorylates in the presence of a labeled ATP substrate.
This phosphorylation is an inherent activity of the huBUB1 protein,
as demonstrated by a requirement for lysine 821 in the huBUB1
kinase motif. In the context of a huBUB1/huBUB3 complex, only
huBUB1 auto-phosphorylation was observed. This result is in
contrast to that reported for S cerevisiae BUB1/BUB3 complexes
(Roberts et al. 1994).
[0229] This result could be related to some requirement for prior
activation of huBUB1 before exogenous substrates (i.e., huBUB3) are
phosphorylated. We therefore tested the activity of the huBUB1
kinase towards a variety of test proteins, and identified PHAS-I as
an in vitro substrate of the huBUB1 kinase. Absence of huBUB3
phosphorylation in kinase reactions could therefore not be
attributed to any inability of huBUB1 to phosphorylate exogenous
substrates. We tested the idea that the FLAG epitope tag might
alter the activity of huBUB3 as a substrate. Although HA-huBUB1
efficiently retains both huBUB3 and FLAG-huBUB3, only HA-huBUB1
auto-phosphorylation was observed in kinase reactions containing
these proteins. Thus, we conclude that under these conditions
huBUB3 is not a significant huBUB1 substrate.
[0230] In other experiments, we did not detect any requirement for
huBUB3 association for huBUB1 kinase activity. HA-huBUB1 prepared
in the absence of cotranslated huBUB3 functions as an
auto-phosphorylating kinase. Co-translation of huBUB3 sufficient to
produce stoichiometric huBUB1/huBUB3 association did not
reproducibly stimulate or inhibit huBUB1 auto-phosphorylation.
These results are similar to those reported in S. cerevisiae, where
BUB1 auto-phosphorylation was observed in extracts prepared from
strains carrying a deletion of the BUB3 gene (Roberts et al.).
[0231] Relevant substrates of the huBUB1 kinase might include the
human homolog of the S. cerevisiae MAD1 protein, which is
phosphorylated in the presence of microtubule poisons (Jin et al.
1998). In S. cerevisiae, this phosphorylation has been attributed
to the MPS1 kinase (Hardwick et al. 1996). The human kinase ttk
(Mills et al. 1992) exhibits structural similarity to the MPS1 gene
(see Sorger et al. 1997), and therefore also represents a candidate
human MAD1 kinase. We find that ttk exhibits a tissue-specific mRNA
expression pattern very similar to that of huBUB1 and MAD2 (FIG.
5).
[0232] Other BUB/MAD phosphorylation substrates may include the
apoptosis inhibitor protein Bcl-2 and the kinase c-raf, each
reported to be phosphorylated in mammalian cells treated with
microtubule poisons (Blagosklonny et al. 1996; Haldar et al. 1996).
BUB/MAD-mediated regulation of Bcl-2 may explain the apoptotic
effects of microtubule poisons. In HeLa cells expressing an
N-terminal domain of murine BUB1, this apoptotic effect is blocked
(Taylor and McKeon 1997), suggesting that apoptosis is a downstream
component of BUB/MAD signaling in human cells. Apoptotic death may
be one cellular response to prolonged mitotic arrests caused by
microtubule poisons. Indeed, enrichment of huBUB1 mutations in
tumors may occur due to the ability of cells to escape apoptotic
death caused by induction of the BUB/MAD signaling pathway, as
might occur during cancer chemotherapeutic drug treatment or by
stochastic errors of chromosome segregation experienced by rapidly
dividing cells. Phosphorylation of c-raf may represent a means
whereby growth regulatory signals are linked to BUB/MAD-mediated
cell cycle regulation.
REFERENCES
[0233] Blagosklonny et al., Taxol-induced apoptosis and
phosphorylation of Bcl-2 protein involves c-Raf-1 and represents a
novel c-Raf-1 signal transduction pathway. Cancer Res 56: 1851-54
(1996).
[0234] Cahill et al., Mutations of mitotic checkpoint genes in
human cancers. Nature 39: 300-03 (1998).
[0235] Haldar et al. Taxol induces bcl-2 phosphorylation and death
of prostate cancer cells. Cancer Res 56: 1253-55 (1996).
[0236] Hardwick et al., Activation of the budding yeast spindle
assembly checkpoint without mitotic spindle disruption. Science
273: 953-56 (1996).
[0237] Jin et al., Human T cell leukemia virus type 1 oncoprotein
Tax targets the human mitotic checkpoint protein MAD1. Cell 93:
81-91 (1998).
[0238] Mills et al., Expression of TTK, a novel human protein
kinase, is associated with cell proliferation. J. Biol. Chem 267:
16000-06 (1992).
[0239] Pangilinan et al., Mammalian BUB1 protein kinases: map
positions and in vivo. Genomics 46: 379-88 (1997).
[0240] Roberts et al., The Saccharomyces cerevisiae checkpoint gene
BUB1 encodes a novel protein kinase. Mol Cell Biol 14: 8282-91
(1994).
[0241] Sorger et al., Coupling cell division and cell death to
microtubule dynamics. Curr Opin Cell Biol 9: 807-14 (1997).
[0242] Taylor et al., The Human Homologue of Bub3 is Required for
Kinetochore Localization of Bub1 and a Mad3/Bub1-related Protein
Kinase. J. Cell Biol 142: 1-11 (1998).
[0243] Taylor & McKeon, Kinetochore localization of murine Bub1
is required for normal mitotic timing and checkpoint response to
spindle damage. Cell 89: 727-735 (1997).
Sequence CWU 1
1
32 1 2619 DNA Homo sapien 1 gaagcaagga ggcggcggcg gccgagcgag
tggcgagtag tggaaacgtt gcttctgagg 60 ggagcccaag atgaccggtt
ctaacgagtt caagctgaac cagccacccg aggatggcat 120 ctcctccgtg
aagttcagcc ccaacacctc ccagttcctg cttgtctcct cctgggacac 180
gtccgtgcgt ctctacgatg tgccggccaa ctccatgcgg ctcaagtacc agcacaccgg
240 cgccgtcctg gactgcgcct tctacgatcc aacgcatgcc tggagtggag
gactagatca 300 tcaattgaaa atgcatgatt tgaacactga tcaagaaaat
cttgttggga cccatgatgc 360 ccctatcaga tgtgttgaat actgtccaga
agtgaatgtg atggtcactg gaagttggga 420 tcagacagtt aaactgtggg
atcccagaac tccttgtaat gctgggacct tctctcagcc 480 tgaaaaggta
tataccctct cagtgtctgg agaccggctg attgtgggaa cagcaggccg 540
cagagtgttg gtgtgggact tacggaacat gggttacgtg cagcagcgca gggagtccag
600 cctgaaatac cagactcgct gcatacgagc gtttccaaac aagcagggtt
atgtattaag 660 ctctattgaa ggccgagtgg cagttgagta tttggaccca
agccctgagg tacagaagaa 720 gaagtatgcc ttcaaatgtc acagactaaa
agaaaataat attgagcaga tttacccagt 780 caatgccatt tcttttcaca
atatccacaa tacatttgcc acaggtggtt ctgatggctt 840 tgtaaatatt
tgggatccat ttaacaaaaa gcgactgtgc caattccatc ggtaccccac 900
gagcatcgca tcacttgcct tcagtaatga tgggactacg cttgcaatag cgtcatcata
960 tatgtatgaa atggatgaca cagaacatcc tgaagatggt atcttcattc
gccaagtgac 1020 agatgcagaa acaaaaccca agtcaccatg tacttgacaa
gatttcattt acttaagtgc 1080 catgttgatg ataataaaac aattcgtact
ccccaatggt ggatttatta ctattaaaga 1140 aaccagggaa aatattaatt
ttaatattat aacaacctga aaataatgga aaagaggttt 1200 ttgaattttt
ttttttaaat aaacaccttc ttaagtgcat gagatggttt gatggtttgc 1260
tgcattaaag gtatttgggc aaacaaaatt ggagggcaag tgactgcagt tttgagaatc
1320 agttttgacc ttgatgattt tttgtttcca ctgtggaaat aaatgtttgt
aaataagtgt 1380 aataaaaatc cctttgcatt ctttctggac cttaaatggt
agaggaaaag gctcgtgagc 1440 catttgtttc ttttgctggt tatagttgct
aattctaaag ctgcttcaga ctgcttcatg 1500 aggaggttaa tctacaatta
aacaatattt cctcttggcc gtccattatt ttctgaagca 1560 gatggttcat
catttcctgg gctgttaaac aaagcgaggt taaggttaga ctcttgggaa 1620
tcagctagtt ttcaatctta ttagggtgca gaaggaaaac taataagaaa acctcctaat
1680 atcattttgt gactgtaaac aattatttat tagcaaacaa ttgatcccag
aagggcaaat 1740 tgtttgagtc agtaatgagc tgagaaaaga cagagcatat
ctgtgtattt ggaaaaataa 1800 ttgtaacgta attgcagtgc atttagacag
gcatctattt ggacctgttt ctatctctaa 1860 atgaattttt ggaaacatta
atgaggttta catatttctc tgacatttat atagttctta 1920 tgtccatttc
agttgaccag ccgctggtga ttaaagttaa aaagaaaaaa attatagtga 1980
gaatgagatt catttcaatg taatgcacta aagcagaaca cgaacttagc ttggcctatt
2040 ctaggtagtt ccaaatagta tttttgttgt caaactttaa aatttatatt
aatttgcaaa 2100 tgtatgtctc tgagtaggac ttggaccttt cctgagattt
attttatccg tgatgtattt 2160 tttttaattc ttttgataca gagaagggtc
tttttttttt taagtatttc agtgaaaact 2220 tggtgtaagt ctgaacccat
cttttgaaat gtattttctt cattgcaggt ccacctaatc 2280 atcctgtgaa
agtggtttct ctatggaaag ctttgtttgc ttcctacaaa tacatgctta 2340
ttccttaagg gatgtgttag agttactgtg gatttctctg ttttctgtct tacaagaaac
2400 ttgtctatgt accttaatac tttgtttagg atgaggagtc tttgtgtccc
tgtacagtag 2460 tctgacgtat ttccccttct gtcccctagt aagcccagtt
gctgtatctg aacagtttga 2520 gctctttttg taatatactc taaacctgtt
atttctgtgc taataaacga gatgcagaac 2580 ccttgaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaa 2619 2 328 PRT Homo sapien 2 Met Thr Gly Ser
Asn Glu Phe Lys Leu Asn Gln Pro Pro Glu Asp Gly 1 5 10 15 Ile Ser
Ser Val Lys Phe Ser Pro Asn Thr Ser Gln Phe Leu Leu Val 20 25 30
Ser Ser Trp Asp Thr Ser Val Arg Leu Tyr Asp Val Pro Ala Asn Ser 35
40 45 Met Arg Leu Lys Tyr Gln His Thr Gly Ala Val Leu Asp Cys Ala
Phe 50 55 60 Tyr Asp Pro Thr His Ala Trp Ser Gly Gly Leu Asp His
Gln Leu Lys 65 70 75 80 Met His Asp Leu Asn Thr Asp Gln Glu Asn Leu
Val Gly Thr His Asp 85 90 95 Ala Pro Ile Arg Cys Val Glu Tyr Cys
Pro Glu Val Asn Val Met Val 100 105 110 Thr Gly Ser Trp Asp Gln Thr
Val Lys Leu Trp Asp Pro Arg Thr Pro 115 120 125 Cys Asn Ala Gly Thr
Phe Ser Gln Pro Glu Lys Val Tyr Thr Leu Ser 130 135 140 Val Ser Gly
Asp Arg Leu Ile Val Gly Thr Ala Gly Arg Arg Val Leu 145 150 155 160
Val Trp Asp Leu Arg Asn Met Gly Tyr Val Gln Gln Arg Arg Glu Ser 165
170 175 Ser Leu Lys Tyr Gln Thr Arg Cys Ile Arg Ala Phe Pro Asn Lys
Gln 180 185 190 Gly Tyr Val Leu Ser Ser Ile Glu Gly Arg Val Ala Val
Glu Tyr Leu 195 200 205 Asp Pro Ser Pro Glu Val Gln Lys Lys Lys Tyr
Ala Phe Lys Cys His 210 215 220 Arg Leu Lys Glu Asn Asn Ile Glu Gln
Ile Tyr Pro Val Asn Ala Ile 225 230 235 240 Ser Phe His Asn Ile His
Asn Thr Phe Ala Thr Gly Gly Ser Asp Gly 245 250 255 Phe Val Asn Ile
Trp Asp Pro Phe Asn Lys Lys Arg Leu Cys Gln Phe 260 265 270 His Arg
Tyr Pro Thr Ser Ile Ala Ser Leu Ala Phe Ser Asn Asp Gly 275 280 285
Thr Thr Leu Ala Ile Ala Ser Ser Tyr Met Tyr Glu Met Asp Asp Thr 290
295 300 Glu His Pro Glu Asp Gly Ile Phe Ile Arg Gln Val Thr Asp Ala
Glu 305 310 315 320 Thr Lys Pro Lys Ser Pro Cys Thr 325 3 3441 DNA
Homo sapien 3 caggtttggc cgctgccggc cagcgtcctc tggccatgga
caccccggaa aatgtccttc 60 agatgcttga agcccacatg cagagctaca
agggcaatga ccctcttggt gaatgggaaa 120 gatacataca gtgggtagaa
gagaattttc ctgagaataa agaatacttg ataactttac 180 tagaacattt
aatgaaggaa tttttagata agaagaaata ccacaatgac ccaagattca 240
tcagttattg tttaaaattt gctgagtaca acagtgacct ccatcaattt tttgagtttc
300 tgtacaacca tgggattgga accctgtcat cccctctgta cattgcctgg
gcggggcatc 360 tggaagccca aggagagctg cagcatgcca gtgctgtcct
tcagagagga attcaaaacc 420 aggctgaacc cagagagttc ctgcaacaac
aatacaggtt atttcagaca cgcctcactg 480 aaacccattt gccagctcaa
gctagaacct cagaacctct gcataatgtt caggttttaa 540 atcaaatgat
aacatcaaaa tcaaatccag gaaataacat ggcctgcatt tctaagaatc 600
agggttcaga gctttctgga gtgatatctt cagcttgtga taaagagtca aatatggaac
660 gaagagtgat cacgatttct aaatcagaat attctgtgca ctcatctttg
gcatccaaag 720 ttgatgttga gcaggttgtt atgtattgca aggagaagct
tattcgtggg gaatcagaat 780 tttcctttga agaattgaga gcccagaaat
acaatcaacg gagaaagcat gagcaatggg 840 taaatgaaga cagacattat
atgaaaagga aagaagcaaa tgcttttgaa gaacagctat 900 taaaacagaa
aatggatgaa cttcataaga agttgcatca ggtggtggag acatcccatg 960
aggatctgcc cgcttcccag gaaaggtccg aggttaatcc agcacgtatg gggccaagtg
1020 taggctccca gcaggaactg agagcgccat gtcttccagt aacctatcag
cagacaccag 1080 tgaacatgga aaagaaccca agagaggcac ctcctgttgt
tcctcctttg gcaaatgcta 1140 tttctgcagc tttggtgtcc ccagccacca
gccagagcat tgctcctcct gttcctttga 1200 aagcccagac agtaacagac
tccatgtttg cagtggccag caaagatgct ggatgtgtga 1260 ataagagtac
tcatgaattc aagccacaga gtggagcaga gatcaaagaa gggtgtgaaa 1320
cacataaggt tgccaacaca agttcttttc acacaactcc aaacacatca ctgggaatgg
1380 ttcaggcaac gccatccaaa gtgcagccat cacccaccgt gcacacaaaa
gaagcattag 1440 gtttcatcat gaatatgttt caggctccta cacttcctga
tatttctgat gacaaagatg 1500 aatggcaatc tctagatcaa aatgaagatg
catttgaagc ccagtttcaa aaaaatgtaa 1560 ggtcatctgg ggcttgggga
gtcaataaga tcatctcttc tttgtcatct gcttttcatg 1620 tgtttgaaga
tggaaacaaa gaaaattatg gattaccaca gcctaaaaat aaacccacag 1680
gagccaggac ctttggagaa cgctctgtca gcagacttcc ttcaaaacca aaggaggaag
1740 tgcctcatgc tgaagagttt ttggatgact caactgtatg gggtattcgc
tgcaacaaaa 1800 ccctggcacc cagtcctaag agcccaggag acttcacatc
tgctgcacaa cttgcgtcta 1860 caccattcca caagcttcca gtggagtcag
tgcacatttt agaagataaa gaaaatgtgg 1920 tagcaaaaca gtgtacccag
gcgactttgg attcttgtga ggaaaacatg gtggtgcctt 1980 caagggatgg
aaaattcagt ccaattcaag agaaaagccc aaaacaggcc ttgtcgtctc 2040
acatgtattc agcatcctta cttcgtctga gccagcctgc tgcaggtggg gtacttacct
2100 gtgaggcaga gttgggcgtt gaggcttgca gactcacaga cactgacgct
gccattgcag 2160 aagatccacc agatgctatt gctgggctcc aagcagaatg
gatgcagatg agttcacttg 2220 ggactgttga tgctccaaac ttcattgttg
ggaacccatg ggatgataag ctgattttca 2280 aacttttatc tgggctttct
aaaccagtga gttcctatcc aaatactttt gaatggcaat 2340 gtaaacttcc
agccatcaag cccaagactg aatttcaatt gggttctaag ctggtctatg 2400
tccatcacct tcttggagaa ggagcctttg cccaggtgta cgaagctacc cagggagatc
2460 tgaatgatgc taaaaataaa cagaaatttg ttttaaaggt ccaaaagcct
gccaacccct 2520 gggaattcta cattgggacc cagttgatgg aaagactaaa
gccatctatg cagcacatgt 2580 ttatgaagtt ctattctgcc cacttattcc
agaatggcag tgtattagta ggagagctct 2640 acagctatgg aacattatta
aatgccatta acctctataa aaatacccct gaaaaagtga 2700 tgcctcaagg
tcttgtcatc tcttttgcta tgagaatgct ttacatgatt gagcaagtgc 2760
atgactgtga aatcattcat ggagacatta aaccagacaa tttcatactt ggaaacggat
2820 ttttggaaca ggatgatgaa gatgatttat ctgctggctt ggcactgatt
gacctgggtc 2880 agagtataga tatgaaactt tttccaaaag gaactatatt
cacagcaaag tgtgaaacat 2940 ctggttttca gtgtgttgag atgctcagca
acaaaccatg gaactaccag atcgattact 3000 ttggggttgc tgcaacagta
tattgcatgc tctttggcac ttacatgaaa gtgaaaaatg 3060 aaggaggaga
gtgtaagcct gaaggtcttt ttagaaggct tcctcatttg gatatgtgga 3120
atgaattttt tcatgttatg ttgaatattc cagattgtca tcatcttcca tctttggatt
3180 tgttaaggca aaagctgaag aaagtatttc aacaacacta tactaacaag
attagggccc 3240 tacgtaatag gctaattgta ctgctcttag aatgtaagcg
ttcacgaaaa taaaatttgg 3300 atatagacag tccttaaaaa tcacactgta
aatatgaatc tgctcacttt aaacctgttt 3360 ttttttcatt tattgtttat
gtaaatgttt gttaaaaata aatcccatgg aatatttcca 3420 tgtaaaaaaa
aaaaaaaaaa a 3441 4 1085 PRT Homo sapien 4 Met Asp Thr Pro Glu Asn
Val Leu Gln Met Leu Glu Ala His Met Gln 1 5 10 15 Ser Tyr Lys Gly
Asn Asp Pro Leu Gly Glu Trp Glu Arg Tyr Ile Gln 20 25 30 Trp Val
Glu Glu Asn Phe Pro Glu Asn Lys Glu Tyr Leu Ile Thr Leu 35 40 45
Leu Glu His Leu Met Lys Glu Phe Leu Asp Lys Lys Lys Tyr His Asn 50
55 60 Asp Pro Arg Phe Ile Ser Tyr Cys Leu Lys Phe Ala Glu Tyr Asn
Ser 65 70 75 80 Asp Leu His Gln Phe Phe Glu Phe Leu Tyr Asn His Gly
Ile Gly Thr 85 90 95 Leu Ser Ser Pro Leu Tyr Ile Ala Trp Ala Gly
His Leu Glu Ala Gln 100 105 110 Gly Glu Leu Gln His Ala Ser Ala Val
Leu Gln Arg Gly Ile Gln Asn 115 120 125 Gln Ala Glu Pro Arg Glu Phe
Leu Gln Gln Gln Tyr Arg Leu Phe Gln 130 135 140 Thr Arg Leu Thr Glu
Thr His Leu Pro Ala Gln Ala Arg Thr Ser Glu 145 150 155 160 Pro Leu
His Asn Val Gln Val Leu Asn Gln Met Ile Thr Ser Lys Ser 165 170 175
Asn Pro Gly Asn Asn Met Ala Cys Ile Ser Lys Asn Gln Gly Ser Glu 180
185 190 Leu Ser Gly Val Ile Ser Ser Ala Cys Asp Lys Glu Ser Asn Met
Glu 195 200 205 Arg Arg Val Ile Thr Ile Ser Lys Ser Glu Tyr Ser Val
His Ser Ser 210 215 220 Leu Ala Ser Lys Val Asp Val Glu Gln Val Val
Met Tyr Cys Lys Glu 225 230 235 240 Lys Leu Ile Arg Gly Glu Ser Glu
Phe Ser Phe Glu Glu Leu Arg Ala 245 250 255 Gln Lys Tyr Asn Gln Arg
Arg Lys His Glu Gln Trp Val Asn Glu Asp 260 265 270 Arg His Tyr Met
Lys Arg Lys Glu Ala Asn Ala Phe Glu Glu Gln Leu 275 280 285 Leu Lys
Gln Lys Met Asp Glu Leu His Lys Lys Leu His Gln Val Val 290 295 300
Glu Thr Ser His Glu Asp Leu Pro Ala Ser Gln Glu Arg Ser Glu Val 305
310 315 320 Asn Pro Ala Arg Met Gly Pro Ser Val Gly Ser Gln Gln Glu
Leu Arg 325 330 335 Ala Pro Cys Leu Pro Val Thr Tyr Gln Gln Thr Pro
Val Asn Met Glu 340 345 350 Lys Asn Pro Arg Glu Ala Pro Pro Val Val
Pro Pro Leu Ala Asn Ala 355 360 365 Ile Ser Ala Ala Leu Val Ser Pro
Ala Thr Ser Gln Ser Ile Ala Pro 370 375 380 Pro Val Pro Leu Lys Ala
Gln Thr Val Thr Asp Ser Met Phe Ala Val 385 390 395 400 Ala Ser Lys
Asp Ala Gly Cys Val Asn Lys Ser Thr His Glu Phe Lys 405 410 415 Pro
Gln Ser Gly Ala Glu Ile Lys Glu Gly Cys Glu Thr His Lys Val 420 425
430 Ala Asn Thr Ser Ser Phe His Thr Thr Pro Asn Thr Ser Leu Gly Met
435 440 445 Val Gln Ala Thr Pro Ser Lys Val Gln Pro Ser Pro Thr Val
His Thr 450 455 460 Lys Glu Ala Leu Gly Phe Ile Met Asn Met Phe Gln
Ala Pro Thr Leu 465 470 475 480 Pro Asp Ile Ser Asp Asp Lys Asp Glu
Trp Gln Ser Leu Asp Gln Asn 485 490 495 Glu Asp Ala Phe Glu Ala Gln
Phe Gln Lys Asn Val Arg Ser Ser Gly 500 505 510 Ala Trp Gly Val Asn
Lys Ile Ile Ser Ser Leu Ser Ser Ala Phe His 515 520 525 Val Phe Glu
Asp Gly Asn Lys Glu Asn Tyr Gly Leu Pro Gln Pro Lys 530 535 540 Asn
Lys Pro Thr Gly Ala Arg Thr Phe Gly Glu Arg Ser Val Ser Arg 545 550
555 560 Leu Pro Ser Lys Pro Lys Glu Glu Val Pro His Ala Glu Glu Phe
Leu 565 570 575 Asp Asp Ser Thr Val Trp Gly Ile Arg Cys Asn Lys Thr
Leu Ala Pro 580 585 590 Ser Pro Lys Ser Pro Gly Asp Phe Thr Ser Ala
Ala Gln Leu Ala Ser 595 600 605 Thr Pro Phe His Lys Leu Pro Val Glu
Ser Val His Ile Leu Glu Asp 610 615 620 Lys Glu Asn Val Val Ala Lys
Gln Cys Thr Gln Ala Thr Leu Asp Ser 625 630 635 640 Cys Glu Glu Asn
Met Val Val Pro Ser Arg Asp Gly Lys Phe Ser Pro 645 650 655 Ile Gln
Glu Lys Ser Pro Lys Gln Ala Leu Ser Ser His Met Tyr Ser 660 665 670
Ala Ser Leu Leu Arg Leu Ser Gln Pro Ala Ala Gly Gly Val Leu Thr 675
680 685 Cys Glu Ala Glu Leu Gly Val Glu Ala Cys Arg Leu Thr Asp Thr
Asp 690 695 700 Ala Ala Ile Ala Glu Asp Pro Pro Asp Ala Ile Ala Gly
Leu Gln Ala 705 710 715 720 Glu Trp Met Gln Met Ser Ser Leu Gly Thr
Val Asp Ala Pro Asn Phe 725 730 735 Ile Val Gly Asn Pro Trp Asp Asp
Lys Leu Ile Phe Lys Leu Leu Ser 740 745 750 Gly Leu Ser Lys Pro Val
Ser Ser Tyr Pro Asn Thr Phe Glu Trp Gln 755 760 765 Cys Lys Leu Pro
Ala Ile Lys Pro Lys Thr Glu Phe Gln Leu Gly Ser 770 775 780 Lys Leu
Val Tyr Val His His Leu Leu Gly Glu Gly Ala Phe Ala Gln 785 790 795
800 Val Tyr Glu Ala Thr Gln Gly Asp Leu Asn Asp Ala Lys Asn Lys Gln
805 810 815 Lys Phe Val Leu Lys Val Gln Lys Pro Ala Asn Pro Trp Glu
Phe Tyr 820 825 830 Ile Gly Thr Gln Leu Met Glu Arg Leu Lys Pro Ser
Met Gln His Met 835 840 845 Phe Met Lys Phe Tyr Ser Ala His Leu Phe
Gln Asn Gly Ser Val Leu 850 855 860 Val Gly Glu Leu Tyr Ser Tyr Gly
Thr Leu Leu Asn Ala Ile Asn Leu 865 870 875 880 Tyr Lys Asn Thr Pro
Glu Lys Val Met Pro Gln Gly Leu Val Ile Ser 885 890 895 Phe Ala Met
Arg Met Leu Tyr Met Ile Glu Gln Val His Asp Cys Glu 900 905 910 Ile
Ile His Gly Asp Ile Lys Pro Asp Asn Phe Ile Leu Gly Asn Gly 915 920
925 Phe Leu Glu Gln Asp Asp Glu Asp Asp Leu Ser Ala Gly Leu Ala Leu
930 935 940 Ile Asp Leu Gly Gln Ser Ile Asp Met Lys Leu Phe Pro Lys
Gly Thr 945 950 955 960 Ile Phe Thr Ala Lys Cys Glu Thr Ser Gly Phe
Gln Cys Val Glu Met 965 970 975 Leu Ser Asn Lys Pro Trp Asn Tyr Gln
Ile Asp Tyr Phe Gly Val Ala 980 985 990 Ala Thr Val Tyr Cys Met Leu
Phe Gly Thr Tyr Met Lys Val Lys Asn 995 1000 1005 Glu Gly Gly Glu
Cys Lys Pro Glu Gly Leu Phe Arg Arg Leu Pro His 1010 1015 1020 Leu
Asp Met Trp Asn Glu Phe Phe His Val Met Leu Asn Ile Pro Asp 1025
1030 1035 1040 Cys His His Leu Pro Ser Leu Asp Leu Leu Arg Gln Lys
Leu Lys Lys 1045 1050 1055 Val Phe Gln Gln His Tyr Thr Asn Lys Ile
Arg Ala Leu Arg Asn Arg 1060 1065 1070 Leu Ile Val Leu Leu Leu Glu
Cys Lys Arg Ser Arg Lys 1075 1080 1085 5 21 DNA Artificial Sequence
Sense PCR primer 5 gggagcccaa gatgaccggt t 21 6 28 DNA Artificial
Sequence Antisense PCR primer 6 aaatccacca ttggggagta
cgaattgt 28 7 27 DNA Artificial Sequence Antisense PCR primer 7
ccctgcttgt ttggaaacgc tcgtatg 27 8 27 DNA Artificial Sequence PCR
primer 8 cgggtggctg gttcagcttg aactcgt 27 9 5 DNA Unknown Consensus
sequence 9 caagg 5 10 10 DNA Homo sapien 10 ccaagatgac 10 11 26 DNA
Artificial Sequence PCR primer 11 accctctcag tgtctggaga ccggct 26
12 28 DNA Artificial Sequence PCR primer 12 cgacggtttc caaacaagca
gggttatg 28 13 30 DNA Artificial Sequence PCR primer 13 tgatgataat
aaaacaattc gtactcccca 30 14 29 DNA Artificial Sequence PCR primer
14 gactcaaaca atttgccctt ctgggatca 29 15 27 DNA Artificial Sequence
Sense PCR primer 15 ggagcccaag atgaccggtt ctaacga 27 16 10 DNA Homo
sapien 16 ccaagtcacc 10 17 10 DNA Homo sapien 17 tgcaggtcca 10 18
38 DNA Artificial Sequence PCR primer 18 tcattgcagg tccacctaat
catcctgtga aagtggtt 38 19 35 DNA Artificial Sequence PCR primer 19
actaggggac agaaggggaa atacgtcaga ctact 35 20 31 DNA Artificial
Sequence PCR primer 20 tttgggcaaa caaaattgga gggcaagtga c 31 21 32
DNA Artificial Sequence PCR primer 21 accagcaaaa gaaacaaatg
gctcacgagc ct 32 22 34 DNA Artificial Sequence PCR primer 22
tgcaggtcca cctaatcatc ctgtgaaagt ggtt 34 23 35 DNA Artificial
Sequence PCR primer 23 acagaagggg aaatacgtca gactactgta caggg 35 24
7 PRT Homo sapien 24 Asp Tyr Lys Asp Asp Asp Lys 1 5 25 35 DNA
Artificial Sequence PCR primer 25 accaagaggg tcattgccct tgtagctctg
catgt 35 26 35 DNA Artificial Sequence PCR primer 26 ggatgcagag
ttctctggga gctctgtggc tgatt 35 27 330 PRT Homo sapien 27 Met Thr
Gly Ser Asn Glu Phe Lys Leu Asn Gln Pro Pro Glu Asp Gly 1 5 10 15
Ile Ser Ser Val Lys Phe Ser Pro Asn Thr Ser Gln Phe Leu Leu Val 20
25 30 Ser Ser Trp Asp Thr Ser Val Arg Leu Tyr Asp Val Pro Ala Asn
Ser 35 40 45 Met Arg Leu Lys Tyr Gln His Thr Gly Ala Val Leu Asp
Cys Ala Phe 50 55 60 Tyr Asp Pro Thr His Ala Trp Ser Gly Gly Leu
Asp His Gln Leu Lys 65 70 75 80 Met His Asp Leu Asn Thr Asp Gln Glu
Asn Leu Val Gly Thr His Asp 85 90 95 Ala Pro Ile Arg Cys Val Glu
Tyr Cys Pro Glu Val Asn Val Met Val 100 105 110 Thr Gly Ser Trp Asp
Gln Thr Val Lys Leu Trp Asp Pro Arg Thr Pro 115 120 125 Cys Asn Ala
Gly Thr Phe Ser Gln Pro Glu Lys Val Tyr Thr Leu Ser 130 135 140 Val
Ser Gly Asp Arg Leu Ile Val Gly Thr Ala Gly Arg Arg Val Leu 145 150
155 160 Val Trp Asp Leu Arg Asn Met Gly Tyr Val Gln Gln Arg Arg Glu
Ser 165 170 175 Ser Leu Lys Tyr Gln Thr Arg Cys Ile Arg Ala Phe Pro
Asn Lys Gln 180 185 190 Gly Tyr Val Leu Ser Ser Ile Glu Gly Arg Val
Ala Val Glu Tyr Leu 195 200 205 Asp Pro Ser Pro Glu Val Gln Lys Lys
Lys Tyr Ala Phe Lys Cys His 210 215 220 Arg Leu Lys Glu Asn Asn Ile
Glu Gln Ile Tyr Pro Val Asn Ala Ile 225 230 235 240 Ser Phe His Asn
Ile His Asn Thr Phe Ala Thr Gly Gly Ser Asp Gly 245 250 255 Phe Val
Asn Ile Trp Asp Pro Phe Asn Lys Lys Arg Leu Cys Gln Phe 260 265 270
His Arg Tyr Pro Thr Ser Ile Ala Ser Leu Ala Phe Ser Asn Asp Gly 275
280 285 Thr Thr Leu Ala Ile Ala Ser Ser Tyr Met Tyr Glu Met Asp Asp
Thr 290 295 300 Glu His Pro Glu Asp Gly Ile Phe Ile Arg Gln Val Thr
Asp Ala Glu 305 310 315 320 Thr Lys Pro Lys Val His Leu Ile Ile Leu
325 330 28 341 PRT Saccharomyces cerevisiae 28 Met Gln Ile Val Gln
Ile Glu Gln Ala Pro Lys Asp Tyr Ile Ser Asp 1 5 10 15 Ile Lys Ile
Ile Pro Ser Lys Ser Leu Leu Leu Ile Thr Ser Trp Asp 20 25 30 Gly
Ser Leu Thr Val Tyr Lys Phe Asp Ile Gln Ala Lys Asn Val Asp 35 40
45 Leu Leu Gln Ser Leu Arg Tyr Lys His Pro Leu Leu Cys Cys Asn Phe
50 55 60 Ile Asp Asn Thr Asp Leu Gln Ile Tyr Val Gly Thr Val Gln
Gly Glu 65 70 75 80 Ile Leu Lys Val Asp Leu Ile Gly Ser Pro Ser Phe
Gln Ala Leu Thr 85 90 95 Asn Asn Glu Ala Asn Leu Gly Ile Cys Arg
Ile Cys Lys Tyr Gly Asp 100 105 110 Asp Lys Leu Ile Ala Ala Ser Trp
Asp Gly Leu Ile Glu Val Ile Asp 115 120 125 Pro Arg Asn Tyr Gly Asp
Gly Val Ile Ala Val Lys Asn Leu Asn Ser 130 135 140 Asn Asn Thr Lys
Val Lys Asn Lys Ile Phe Thr Met Asp Thr Asn Ser 145 150 155 160 Ser
Arg Leu Ile Val Gly Met Asn Asn Ser Gln Val Gln Trp Phe Arg 165 170
175 Leu Pro Leu Cys Glu Asp Asp Asn Gly Thr Ile Glu Glu Ser Gly Leu
180 185 190 Lys Tyr Gln Ile Arg Asp Val Ala Leu Leu Pro Lys Glu Gln
Glu Gly 195 200 205 Tyr Ala Cys Ser Ser Ile Asp Gly Arg Val Ala Val
Glu Phe Phe Asp 210 215 220 Asp Gln Gly Asp Asp Tyr Asn Ser Ser Lys
Arg Phe Ala Phe Arg Cys 225 230 235 240 His Arg Leu Asn Leu Lys Asp
Thr Asn Leu Ala Tyr Pro Val Asn Ser 245 250 255 Ile Glu Phe Ser Pro
Arg His Lys Phe Leu Tyr Thr Ala Gly Ser Asp 260 265 270 Gly Ile Ile
Ser Cys Trp Asn Leu Gln Thr Arg Lys Lys Ile Lys Asn 275 280 285 Phe
Ala Lys Phe Asn Glu Asp Ser Val Val Lys Ile Ala Cys Ser Asp 290 295
300 Asn Ile Leu Cys Leu Ala Thr Ser Asp Asp Thr Phe Lys Thr Asn Ala
305 310 315 320 Ala Ile Asp Gln Thr Ile Glu Leu Asn Ala Ser Ser Ile
Tyr Ile Ile 325 330 335 Phe Asp Tyr Glu Asn 340 29 326 PRT Mus
musculus 29 Met Thr Gly Ser Asn Glu Phe Lys Leu Asn Gln Pro Pro Glu
Asp Gly 1 5 10 15 Ile Ser Ser Val Lys Phe Ser Pro Asn Thr Ser Gln
Phe Leu Leu Val 20 25 30 Ser Ser Trp Asp Thr Ser Val Arg Leu Tyr
Asp Val Pro Ala Asn Ser 35 40 45 Met Arg Leu Lys Tyr Gln His Thr
Gly Ala Val Leu Asp Cys Ala Phe 50 55 60 Tyr Asp Pro Thr His Ala
Trp Ser Gly Gly Leu Asp His Gln Leu Lys 65 70 75 80 Met His Asp Leu
Asn Thr Asp Gln Glu Asn Leu Val Gly Thr His Asp 85 90 95 Ala Pro
Ile Arg Cys Val Glu Tyr Cys Pro Glu Val Asn Val Met Val 100 105 110
Thr Gly Ser Trp Asp Gln Thr Val Lys Leu Trp Asp Pro Arg Thr Pro 115
120 125 Cys Asn Ala Gly Thr Phe Ser Gln Pro Glu Lys Val Tyr Thr Leu
Ser 130 135 140 Val Ser Gly Asp Arg Leu Ile Val Gly Thr Ala Gly Arg
Arg Val Leu 145 150 155 160 Val Trp Asp Leu Trp Asn Met Gly Tyr Val
Gln Gln Arg Arg Glu Ser 165 170 175 Ser Leu Lys Tyr Gln Thr Arg Cys
Ile Arg Ala Phe Pro Asn Lys Gln 180 185 190 Gly Tyr Val Leu Ser Ser
Ile Glu Gly Arg Val Ala Val Glu Tyr Leu 195 200 205 Asp Pro Ser Pro
Glu Val Gln Lys Lys Lys Tyr Ala Phe Lys Cys His 210 215 220 Arg Leu
Lys Glu Asn Asn Ile Glu Gln Ile Tyr Pro Val Asn Ala Ile 225 230 235
240 Ser Phe His Asn Ile His Asn Thr Phe Ala Thr Gly Gly Ser Asp Gly
245 250 255 Phe Val Asn Ile Trp Asp Pro Phe Asn Lys Lys Arg Leu Cys
Gln Phe 260 265 270 His Arg Tyr Pro Thr Ser Ile Ala Ser Leu Ala Phe
Ser Asn Asp Gly 275 280 285 Thr Thr Leu Ala Ile Ala Ser Ser Tyr Met
Tyr Glu Met Asp Asp Thr 290 295 300 Glu His Pro Glu Asp Gly Ile Phe
Ile Arg Gln Val Thr Asp Ala Glu 305 310 315 320 Thr Lys Pro Lys Ser
Thr 325 30 368 PRT Homo sapien 30 Met Ser Leu Phe Gly Thr Thr Ser
Gly Phe Gly Thr Ser Gly Thr Ser 1 5 10 15 Met Phe Gly Ser Ala Thr
Thr Asp Asn His Asn Pro Met Lys Asp Ile 20 25 30 Glu Val Thr Ser
Ser Pro Asp Asp Ser Ile Gly Cys Leu Ser Phe Ser 35 40 45 Pro Pro
Thr Leu Pro Gly Asn Phe Leu Ile Ala Gly Ser Trp Ala Asn 50 55 60
Asp Val Arg Cys Trp Glu Val Gln Asp Ser Gly Gln Thr Ile Pro Lys 65
70 75 80 Ala Gln Gln Met His Thr Gly Pro Val Leu Asp Val Cys Trp
Ser Asp 85 90 95 Asp Gly Ser Lys Val Phe Thr Ala Ser Cys Asp Lys
Thr Ala Lys Met 100 105 110 Trp Asp Leu Ser Ser Asn Gln Ala Ile Gln
Ile Ala Gln His Asp Ala 115 120 125 Pro Val Lys Thr Ile His Trp Ile
Lys Ala Pro Asn Tyr Ser Cys Val 130 135 140 Met Thr Gly Ser Trp Asp
Lys Thr Leu Lys Phe Trp Asp Thr Arg Ser 145 150 155 160 Ser Asn Pro
Met Met Val Leu Gln Leu Pro Glu Arg Cys Tyr Cys Ala 165 170 175 Asp
Val Ile Tyr Pro Met Ala Val Val Ala Thr Ala Glu Arg Gly Leu 180 185
190 Ile Val Tyr Gln Leu Glu Asn Gln Pro Ser Glu Phe Arg Arg Ile Glu
195 200 205 Ser Pro Leu Lys His Gln His Arg Cys Val Ala Ile Phe Lys
Asp Lys 210 215 220 Gln Asn Lys Pro Thr Gly Phe Ala Leu Gly Ser Ile
Glu Gly Arg Val 225 230 235 240 Ala Ile His Tyr Ile Asn Pro Pro Asn
Pro Ala Lys Asp Asn Phe Thr 245 250 255 Phe Lys Cys His Arg Ser Asn
Gly Thr Asn Thr Ser Ala Pro Gln Asp 260 265 270 Ile Tyr Ala Val Asn
Gly Ile Ala Phe His Pro Val His Gly Thr Leu 275 280 285 Ala Thr Val
Gly Ser Asp Gly Arg Phe Ser Phe Trp Asp Lys Asp Ala 290 295 300 Arg
Thr Lys Leu Lys Thr Ser Glu Gln Leu Asp Gln Pro Ile Ser Ala 305 310
315 320 Cys Cys Phe Asn His Asn Gly Asn Ile Phe Ala Tyr Ala Ser Ser
Tyr 325 330 335 Asp Trp Ser Lys Gly His Glu Phe Tyr Asn Pro Gln Lys
Lys Asn Tyr 340 345 350 Ile Phe Leu Arg Asn Ala Ala Glu Glu Leu Lys
Pro Arg Asn Lys Lys 355 360 365 31 352 PRT Schizosaccharomyces
pombe 31 Met Ser Leu Phe Gly Gln Ala Thr Thr Ser Thr Val Ser Asn
Ala Thr 1 5 10 15 Gly Asp Leu Lys Lys Asp Val Glu Val Ala Gln Pro
Pro Glu Asp Ser 20 25 30 Ile Ser Asp Leu Ala Phe Ser Pro Gln Ala
Glu Tyr Leu Ala Ala Ser 35 40 45 Ser Trp Asp Ser Lys Val Arg Ile
Tyr Glu Val Gln Ala Thr Gly Gln 50 55 60 Ser Ile Gly Lys Ala Leu
Tyr Glu His Gln Gly Pro Val Leu Ser Val 65 70 75 80 Asn Trp Ser Arg
Asp Gly Thr Lys Val Ala Ser Gly Ser Val Asp Lys 85 90 95 Ser Ala
Lys Val Phe Asp Ile Gln Thr Gly Gln Asn Gln Gln Val Ala 100 105 110
Ala His Asp Asp Ala Val Arg Cys Val Arg Phe Val Glu Ala Met Gly 115
120 125 Thr Ser Pro Ile Leu Ala Thr Gly Ser Trp Asp Lys Thr Leu Lys
Tyr 130 135 140 Trp Asp Leu Arg Gln Ser Thr Pro Ile Ala Thr Val Ser
Leu Pro Glu 145 150 155 160 Arg Val Tyr Ala Met Asp Cys Val His Pro
Leu Leu Thr Val Ala Thr 165 170 175 Ala Glu Arg Asn Ile Cys Val Ile
Asn Leu Ser Glu Pro Thr Lys Ile 180 185 190 Phe Lys Leu Ala Met Ser
Pro Leu Lys Phe Gln Thr Arg Ser Leu Ala 195 200 205 Cys Phe Ile Lys
Gly Asp Gly Tyr Ala Ile Gly Ser Val Glu Gly Arg 210 215 220 Cys Ala
Ile Gln Asn Ile Asp Glu Lys Asn Ala Ser Gln Asn Phe Ser 225 230 235
240 Phe Arg Cys His Arg Asn Gln Ala Gly Asn Ser Ala Asp Val Tyr Ser
245 250 255 Val Asn Ser Ile Ala Phe His Pro Gln Tyr Gly Thr Phe Ser
Thr Ala 260 265 270 Gly Ser Asp Gly Thr Phe Ser Phe Trp Asp Lys Asp
Ser His Gln Arg 275 280 285 Leu Lys Ser Tyr Pro Asn Val Gly Gly Thr
Ile Ser Cys Ser Thr Phe 290 295 300 Asn Arg Thr Gly Asp Ile Phe Ala
Tyr Ala Ile Ser Tyr Asp Trp Ser 305 310 315 320 Lys Gly Tyr Thr Phe
Asn Asn Ala Gln Leu Pro Asn Lys Ile Met Leu 325 330 335 His Pro Val
Pro Gln Asp Glu Ile Lys Pro Arg Pro Lys Lys Gly Arg 340 345 350 32
365 PRT Saccharomyces cerevisiae 32 Met Ser Phe Phe Asn Arg Ser Asn
Thr Thr Ser Ala Leu Gly Thr Ser 1 5 10 15 Thr Ala Met Ala Asn Glu
Lys Asp Leu Ala Asn Asp Ile Val Ile Asn 20 25 30 Ser Pro Ala Glu
Asp Ser Ile Ser Asp Ile Ala Phe Ser Pro Gln Gln 35 40 45 Asp Phe
Met Phe Ser Ala Ser Ser Trp Asp Gly Lys Val Arg Ile Trp 50 55 60
Asp Val Gln Asn Gly Val Pro Gln Gly Arg Ala Gln His Glu Ser Ser 65
70 75 80 Ser Pro Val Leu Cys Thr Arg Trp Ser Asn Asp Gly Thr Lys
Val Ala 85 90 95 Ser Gly Gly Cys Asp Asn Ala Leu Lys Leu Tyr Asp
Ile Ala Ser Gly 100 105 110 Gln Thr Gln Gln Ile Gly Met His Ser Ala
Pro Ile Lys Val Leu Arg 115 120 125 Phe Val Gln Cys Gly Pro Ser Asn
Thr Glu Cys Ile Val Thr Gly Ser 130 135 140 Trp Asp Lys Thr Ile Lys
Tyr Trp Asp Met Arg Gln Pro Gln Pro Val 145 150 155 160 Ser Thr Val
Met Met Pro Glu Arg Val Tyr Ser Met Asp Asn Lys Gln 165 170 175 Ser
Leu Leu Val Val Ala Thr Ala Glu Arg His Ile Ala Ile Ile Asn 180 185
190 Leu Ala Asn Pro Thr Thr Ile Phe Lys Ala Thr Thr Ser Pro Leu Lys
195 200 205 Trp Gln Thr Arg Cys Val Ala Cys Tyr Asn Glu Ala Asp Gly
Tyr Ala 210 215 220 Ile Gly Ser Val Glu Gly Arg Cys Ser Ile Arg Tyr
Ile Asp Asp Gly 225 230 235 240 Met Gln Lys Lys Ser Gly Phe Ser Phe
Lys Cys His Arg Gln Thr Asn 245 250 255 Pro Asn Arg Ala Pro Gly Ser
Asn Gly Gln Ser Leu Val Tyr Pro Val 260 265 270 Asn Ser Ile Ala Phe
His Pro Leu Tyr Gly Thr Phe Val Thr Ala Gly 275 280 285 Gly Asp Gly
Thr Phe Asn Phe Trp Asp Lys Asn Gln Arg His Arg Leu 290 295 300 Lys
Gly Tyr Pro Thr Leu Gln Ala Ser Ile Pro Val Cys Ser Phe Asn 305 310
315 320 Arg Asn Gly Ser Val Phe Ala Tyr Ala Leu Ser Tyr Asp Trp His
Gln 325 330 335 Gly His Met Gly Asn Arg Pro Asp Tyr Pro Asn Val Ile
Arg Leu His 340 345 350 Ala Thr Thr Asp Glu Glu Val Lys Glu Lys Lys
Lys Arg 355 360 365
* * * * *
References