U.S. patent application number 09/996140 was filed with the patent office on 2002-10-24 for plant having altered environmental stress tolerance.
Invention is credited to Gilmour, Sarah Jane, Jaglo-Ottosen, Kirsten, Jiang, Cai-Zhong, Stockinger, Eric J., Thomashow, Michael F., Zarka, Daniel.
Application Number | 20020157136 09/996140 |
Document ID | / |
Family ID | 27567571 |
Filed Date | 2002-10-24 |
United States Patent
Application |
20020157136 |
Kind Code |
A1 |
Thomashow, Michael F. ; et
al. |
October 24, 2002 |
Plant having altered environmental stress tolerance
Abstract
A transformed plant is provided which comprises one or more
environmental stress tolerance genes; a DNA regulatory sequence
which regulates expression of the one or more environmental stress
tolerance genes; a sequence encoding a binding protein capable of
binding to the DNA regulatory sequence and inducing expression of
the one or more environmental stress tolerance genes; and a
recombinant promoter which regulates expression of the gene
encoding the binding protein. A method for altering an
environmental stress tolerance of a plant is also provided which
comprises the steps of transforming a plant with a promoter which
regulates expression of at least one copy of a gene encoding a
binding protein capable of binding to a DNA regulatory sequence
which regulates one or more environmental stress tolerance genes in
the plant; expressing the binding protein encoded by the gene; and
stimulating expression of at least one environmental stress
tolerance gene through binding of the binding protein to the DNA
regulatory sequence.
Inventors: |
Thomashow, Michael F.; (East
Lansing, MI) ; Stockinger, Eric J.; (East Lansing,
MI) ; Jaglo-Ottosen, Kirsten; (Lansing, MI) ;
Gilmour, Sarah Jane; (Leslie, MI) ; Zarka,
Daniel; (Lansing, MI) ; Jiang, Cai-Zhong;
(Davis, CA) |
Correspondence
Address: |
Mendel Biotechnology, Inc.
21375 Cabot Boulevard
Hayward
CA
94545
US
|
Family ID: |
27567571 |
Appl. No.: |
09/996140 |
Filed: |
November 26, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09996140 |
Nov 26, 2001 |
|
|
|
09198119 |
Nov 23, 1998 |
|
|
|
09198119 |
Nov 23, 1998 |
|
|
|
09018233 |
Feb 3, 1998 |
|
|
|
09198119 |
Nov 23, 1998 |
|
|
|
09017816 |
Feb 3, 1998 |
|
|
|
09198119 |
Nov 23, 1998 |
|
|
|
09018235 |
Feb 3, 1998 |
|
|
|
09198119 |
Nov 23, 1998 |
|
|
|
09017575 |
Feb 3, 1998 |
|
|
|
09198119 |
Nov 23, 1998 |
|
|
|
09018227 |
Feb 3, 1998 |
|
|
|
09198119 |
Nov 23, 1998 |
|
|
|
09018234 |
Feb 3, 1998 |
|
|
|
09198119 |
Nov 23, 1998 |
|
|
|
08706270 |
Sep 4, 1996 |
|
|
|
5892009 |
|
|
|
|
Current U.S.
Class: |
800/289 ;
435/199 |
Current CPC
Class: |
C12N 15/8222 20130101;
C07K 14/415 20130101; C12N 15/8237 20130101; C12N 15/8216 20130101;
C12N 15/8273 20130101; C07K 14/395 20130101 |
Class at
Publication: |
800/289 ;
435/199 |
International
Class: |
A01H 005/00; C12N
009/22 |
Claims
We claim:
1. A progeny plant derived from a parental plant, comprising: (a)
at least one environmental stress tolerance gene; (b) a DNA
regulatory sequence comprising CCG which regulates expression of
the environmental stress tolerance gene; and (c) a polynucleotide
encoding a DNA binding protein that binds to the DNA regulatory
sequence and inducing expression of the environmental stress
tolerance gene; wherein the progeny plant is characterized by an
increase in environmental stress resistance compared to the
parental plant.
2. A progeny plant derived from a parental plant, comprising: (a)
at least one environmental stress tolerance gene; (b) a DNA
regulatory sequence comprising CCG which regulates expression of
the environmental stress tolerance gene; (c) a polynucleotide
encoding a DNA binding protein that binds to the DNA regulatory
sequence and inducing expression of the environmental stress
tolerance gene; and (d) a recombinant promoter operably linked to
the polynucleotide encoding the DNA binding protein, wherein the
progeny plant is characterized by an increase in environmental
stress resistance compared to the parental plant.
3. The progeny plant of claim 1 wherein the progeny plant is a
transgenic plant.
4. The progeny plant of claim 1 wherein the progeny plant is a
transformed plant.
5. The progeny plant of claim 1 wherein the progeny plant is a
non-naturally occurring plant.
6. The plant of claim 1 wherein the DNA binding protein comprises
an amino acid sequence homologous to a sequence selected from an
amino acid sequence depicted in FIG. 19A, 19B, 19C, 19D, or 19E
that binds to the DNA regulatory sequence that induces expression
of the environmental stress tolerance gene.
7. The plant of claim 6 wherein the amino acid sequence comprises
consecutive amino acid residues of
Thr-Xaa.sub.(13)-Ala-Xaa.sub.(12)-Ser, wherein Xaa represents any
amino acid residue.
8. The plant of claim 6 wherein the amino acid sequence comprises
consecutive amino acid residues of
Asn-Xaa.sub.(12)-Thr-Xaa.sub.(13)-Ala--
Leu-Arg-Xaa.sub.(8)-Ala-Xaa-Ser, wherein Xaa represents any amino
acid residue.
9. The plant of claim 6 wherein the amino acid sequence comprises
consecutive amino acid residues of
Gly-Val-Arg-Xaa-Arg-Tyr-Xaa.sub.(4-5)--
Trp-Val-Xaa-Glu-Xaa-Arg-Glu-Xaa.sub.(6)-Arg-Glu-Xaa-Asn-Lys-Xaa.sub.(2)-Ar-
g-Ile-Trp-Xaa-Gly-Thr-Phe-Xaa.sub.(5)-Ala-Ala-Xaa-Ala-Xaa-Asp-Xaa-Ala-Ala--
Xaa.sub.(4)-Gly-Xaa.sub.(2)-Ala-Xaa-Leu-Asn, wherein Xaa represents
any amino acid residue.
10. The plant of claim 6 wherein the amino acid sequence comprises
consecutive amino acid residues of
Gly-Val-Arg-Xaa-Arg-Tyr-Xaa.sub.(4-5)--
Trp-Val-Xaa-Glu-Xaa-Arg-Glu-Xaa.sub.(6)-Arg-Glu-Xaa-Asn-Lys-Xaa.sub.(2)-Ar-
g-Ile-Trp-Xaa-Gly-Thr-Phe-Xaa-Thr-Xaa.sub.(3)-Ala-Ala-Xaa-Ala-Xaa-Asp-Xaa--
Ala-Ala-Xaa-Ala-Xaa.sub.(2)-Gly-Xaa.sub.(2)-Ala-Xaa-Leu-Asn-Xaa.sub.(3)-Se-
r, wherein Xaa represents any amino acid residue.
11. The plant of claim 6 wherein the amino acid sequence comprises
consecutive amino acid residues of
His-Pro-Xaa-Tyr-Gly-Val-Arg-Xaa-Arg-Ty-
r-Xaa.sub.(4-5)-Trp-Val-Xaa-Glu-Xaa-Arg-Glu-Xaa-Asn-Lys-Xaa.sub.(2)-Arg-Gl-
u-Xaa-Asn-Lys-Xaa.sub.(2)-Arg-Ile-Trp-Xaa-Gly-Thr-Phe-Xaa-Thr-Xaa-Glu-Xaa--
Ala-Ala-Arg-Ala-Asp-His-Asp-Val-Ala-Ala-Xaa-Ala-Leu-Arg-Gly-Xaa.sub.(2)-Al-
a-Xaa-Leu-Asn-Xaa-Ala-Asp-Ser, wherein Xaa represents any amino
acid residue.
12. The plant of claim 6 wherein the amino acid sequence comprises
a nuclear localization signal, an AP2 activator domain, and an
acidic transcriptional activator domain homologous to a sequence of
amino acid residues 32 through 213 of SEQ ID NO:2 that binds to the
DNA regulatory sequence that induces expression of the
environmental stress tolerance gene.
13. The plant of claim 1 wherein the plant is selected from the
group consisting of corn, soy, wheat, rice, rye, triticale,
bentgrass, sorghum, barley, millet, bluegrass, turfgrass,
sugarcane, potato, Arabidopsis, oilseed rape, sunflower, tobacco,
poplar, pine, eucalyptus, and citrus.
14. The plant of claim 1 wherein the plant is a monocot.
15. The plant of claim 1 wherein the plant is a dicot.
16. The plant of claim 1 wherein the plant is selected from the
group consisting of corn, soy, wheat, rice, rye, triticale,
bentgrass, sorghum, barley, millet, bluegrass, turfgrass, and
sugarcane.
17. The plant of claim 1 wherein the plant is selected from the
group consisting of potato, Arabidopsis, oilseed rape, sunflower
and tobacco.
18. The plant of claim 1 wherein the plant is selected from the
group consisting of poplar, pine, eucalyptus, and citrus.
19. The plant of claim 1 wherein the plant is corn.
20. The plant of claim 1 wherein the plant is soy.
21. The plant of claim 1 wherein the plant is wheat.
22. The plant of claim 1 wherein the plant is rice.
23. The plant of claim 1 wherein the plant is rye.
24. The plant of claim 1 wherein the plant is triticale.
25. The plant of claim 1 wherein the plant is bentgrass.
26. The plant of claim 1 wherein the plant is sorghum.
27. The plant of claim 1 wherein the plant is barley.
28. The plant of claim 1 wherein the plant is millet.
29. The plant of claim 1 wherein the plant is bluegrass.
30. The plant of claim 1 wherein the plant is turfgrass.
31. The plant of claim 1 wherein the plant is sugarcane.
32. The plant of claim 1 wherein the plant is potato.
33. The plant of claim 1 wherein the plant is Arabidopsis.
34. The plant of claim 1 wherein the plant is oilseed rape.
35. The plant of claim 1 wherein the plant is sunflower.
36. The plant of claim 1 wherein the plant is tobacco.
37. The plant of claim 1 wherein the plant is pine.
38. The plant of claim 1 wherein the plant is eucalyptus.
39. The plant of claim 1 wherein the plant is poplar.
40. The plant of claim 1 wherein the plant is citrus.
41. The plant of claim 1 wherein the polynucleotide encodes a
binding protein native to the plant.
42. Isolated plant material of the progeny plant of claim 1 wherein
the plant material is: (a) plant tissue; (b) fruit; (c) seed; (d)
plant cell; (e) embryo; (f) protoplast; or (g) pollen.
43. The plant of claim 1 wherein expression of the polynucleotide
is increased as compared to expression of endogenous
polynucleotide.
44. The plant of claim 1 wherein expression of the DNA binding
protein is increased by the expression of the polynucleotide as
compared to expression of endogenous DNA binding protein.
45. The plant of claim 1 wherein transcriptional activation
activity of the DNA binding protein is increased as compared to
transcriptional activation activity of endogenous DNA binding
protein.
46. The plant of claim 1 wherein transcribed messenger RNA levels
induced by the DNA binding protein is increased as compared to
transcribed messenger RNA levels induced by endogenous DNA binding
protein.
47. A progeny plant derived from a parental plant wherein the
progeny plant exhibits at least three fold greater messenger RNA
levels than the parental plant, wherein the messenger RNA encodes a
DNA binding protein which is capable of binding to a DNA regulatory
sequence comprising CCG and inducing expression of an environmental
stress tolerance gene, wherein the progeny plant is characterized
by an increase in environmental stress resistance compared to the
parental plant.
48. The progeny plant of claim 47 wherein the progeny plant
exhibits at least ten fold greater messenger RNA levels than the
parental plant.
49. The progeny plant of claim 47 wherein the progeny plant
exhibits at least fifty fold greater messenger RNA levels than the
parental plant.
50. The progeny plant of claim 47 wherein the progeny plant is a
transgenic plant.
51. The progeny plant of claim 47 wherein the progeny plant is a
transformed plant.
52. The progeny plant of claim 47 wherein the progeny plant is a
non-naturally-occurring plant.
53. A progeny plant derived from a parental plant wherein the
progeny plant exhibits at least three fold greater protein levels
than the parental plant, wherein the protein is a DNA binding
protein which is capable of binding to a DNA regulatory sequence
comprising CCG and inducing expression of an environmental stress
tolerance gene, wherein the progeny plant is characterized by an
increase in environmental stress resistance compared to the
parental plant.
54. The progeny plant of claim 53 wherein the progeny plant
exhibits at least ten fold greater protein levels than the parental
plant.
55. The progeny plant of claim 53 wherein the progeny plant
exhibits at least fifty fold greater protein levels than the
parental plant.
56. The progeny plant of claim 53 wherein the progeny plant is a
trangenic plant.
57. The progeny plant of claim 53 wherein the progeny plant is a
transformed plant.
58. The progeny plant of claim 53 wherein the progeny plant is a
non-naturally-occurring plant.
59. A progeny plant derived from a parental plant wherein the
progeny plant exhibits at least three fold greater transcriptional
activation activity of a protein than the parental plant, wherein
the protein is a DNA binding protein which is capable of binding to
a DNA regulatory sequence comprising CCG and inducing expression of
an environmental stress tolerance gene, wherein the progeny plant
is characterized by an increase in environmental stress resistance
compared to the parental plant.
60. The plant of claim 59 wherein the progeny plant exhibits at
least ten fold greater transcriptional activation activity of a
protein than the parental plant.
61. The plant of claim 59 wherein the progeny plant exhibits at
least fifty fold greater transcriptional activation activity of a
protein than the parental plant.
62. The plant of claim 1 wherein the DNA binding protein is a
protein in a signal transduction pathway wherein binding of the DNA
binding protein to the DNA regulatory sequence results in an
increase in environmental stress tolerance.
63. The plant of claim 62 wherein binding of the DNA binding
protein to the DNA regulatory sequence is activated by the signal
transduction pathway.
64. The plant of claim 62 wherein binding of the DNA binding
protein to the DNA regulatory sequence activates the signal
transduction pathway.
65. A method for increasing environmental stress resistance in a
plant comprising: a) introducing into a parental plant a
polynucleotide operably linked to a recombinant promoter to produce
a transgenic plant; and b) expressing the polynucleotide in the
transgenic plant whereby the expression of the polynucleotide
increases the expression of a DNA binding protein that binds to a
DNA regulatory sequence comprising CCG that induces expression of
an environmental stress tolerance gene whereby the transgenic plant
is characterized by an increase in environmental stress resistance
compared to the parental plant.
66. The method of claim 65 wherein the DNA binding protein
comprises an amino acid sequence homologous to a sequence selected
from an amino acid sequence depicted in FIG. 19A, 19B, 19C, 19D, or
19E that binds to the DNA regulatory sequence that induces
expression of the environmental stress tolerance gene.
67. A progeny plant produced by the method of claim 65.
68. The progeny plant of claim 65 wherein the progeny plant is a
transgenic plant.
69. The progeny plant of claim 65 wherein the progeny plant is a
transformed plant.
70. The progeny plant of claim 65 wherein the progeny plant is a
non-naturally-occurring plant.
71. A progeny plant derived from a parental plant wherein the
progeny plant exhibits at least three fold greater protein levels
than the parental plant, wherein the protein is a DNA binding
protein capable of binding to a DNA regulatory sequence comprising
CCG and inducing expression of an environmental stress tolerance
gene, wherein the progeny plant is characterized by an increase in
environmental stress resistance compared to the parental plant.
72. A progeny plant produced by the method of claim 71.
73. The progeny plant of claim 72 wherein the progeny plant is a
trangenic plant.
74. The progeny plant of claim 72 wherein the progeny plant is a
transformed plant.
75. The progeny plant of claim 72 wherein the progeny plant is a
non-naturally-occurring plant.
76. The plant of claim 1 wherein the environmental stress tolerance
is selected from the group consisting of: (a) increased tolerance
to freezing; (b) increased tolerance to cold stress; (c) increased
tolerance to dehydration stress; (d) increased tolerance to high
salinity stress; or (e) increased tolerance to osmotic stress.
77. Seed produced by the progeny plant of claim 1.
78. An essentially homogeneous population of plants produced by
growing seed of the plant of claim 1.
79. Seed produced by the plant of claim 78.
80. Progeny seed produced from crossing the plant of claim 78 with
another plant or by self-pollinating the plant of claim 78.
81. A plant produced from the seed of claim 65.
82. A process of producing seed, comprising self-pollinating a
plant of claim 1 or crossing a first parent plant with a parent
plant, wherein the first or second plant is the plant of claim
1.
83. The process of claim 82, wherein crossing comprises the steps
of (a) planting in pollinating proximity seeds of the first and
second plants; (b) cultivating the seeds of the first and second
plants into plants that bear flowers; (c) emasculating the male
flowers of the first or second plant to produce an emasculated
plant; (d) allowing cross-pollination to occur between the first
and second plants; and (e) harvesting hybrid seeds produced on the
emasculated plant.
84. The process of claim 83, further comprising growing the
harvested seed to produce a hybrid plant.
85. Hybrid seed produced by the process of claim 83.
86. A hybrid plant produced by the process of claim 84.
87. The hybrid plant of claim 86, wherein the plant is a first
generation (F1) hybrid plant.
Description
RELATIONSHIP TO COPENDING APPLICATIONS
[0001] This application is a continuation-in-part of the following
U.S. applications: U.S. application Ser. No. 09/018,233, filed:
Feb. 3, 1998 entitled "ISOLATED DNA ENCODING ENVIRONMENTAL STRESS
TOLERANCE REGULATORY BINDING PROTEIN;"U.S. application Ser. No.
09/017,816, filed: Feb. 3, 1998 entitled "CONSTRUCT FOR
TRANSFORMING CELL WITH SEQUENCE ENCODING ENVIRONMENTAL STRESS
TOLERANCE REGULATORY BINDING PROTEIN;" U.S. application Ser. No.
09/018,235, filed: Feb. 3, 1998 entitled "ENVIRONMENTAL STRESS
TOLERANCE REGULATORY BINDING PROTEIN TRANSFORMED CELL EXPRESSING
ENVIRONMENTAL;" U.S. application Ser. No. 09/017,575 filed: Feb. 3,
1998 entitled "STRESS TOLERANCE REGULATORY BINDING PROTEIN;" U.S.
application Ser. No. 09/018,227, filed: Feb. 3, 1998 entitled
"TRANSFORMED PLANT WITH MODIFIED ENVIRONMENTAL STRESS TOLERANCE
GENE EXPRESSION;" U.S. application Ser. No. 09/018,234, filed: Feb.
3, 1998 entitled "METHOD FOR REGULATING EXPRESSION OF STRESS
TOLERANCE GENES IN A TRANSFORMED PLANT;" and U.S. application Ser.
No. 08/706,270; filed: Sep. 4, 1996, entitled "DNA AND ENCODED
PROTEIN WHICH REGULATES COLD AND DEHYDRATION REGULATED GENES," each
of which are incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to the regulatory response of
plants to environmental stresses such as cold and to drought. More
specifically, the present invention relates to genes which regulate
the response of a plant to environmental stresses such as cold or
drought and their use to enhance the stress tolerance of
recombinant plants into which these genes are introduced.
BACKGROUND OF THE INVENTION
[0003] Environmental factors serve as cues to trigger a number of
specific changes in plant growth and development. One such factor
is low temperature. Prominent examples of cold-regulated processes
include cold acclimation, the increase in freezing tolerance that
occurs in response to low non-freezing temperatures (Guy, C. L.,
Annu. Rev. Plant Physiol. Plant Mol. Biol. 41:187-223 (1990));
vernalization, the shortening of time to flowering induced by low
temperature (Lang, A., in Encyclopedia of Plant Physiology, Vol.
15-1, ed. Ruhland, W. (Springer, Berlin), pp. 1489-1536 (1965));
and stratification, the breaking of seed dormancy by low
temperature (Berry, J. A. and J. K. Raison, in Encyclopedia of
Plant Physiology, Vol. 12A, eds. Lange, O. L., Nobel, P. S.,
Osmond, C. B. and Ziegler, H. (Springer, Berlin), pp. 277-338
(1981)). Due to the fundamental nature and agronomic importance of
these processes, there is interest in understanding how plants
sense and respond to low temperature. One approach being taken is
to determine the signal transduction pathways and regulatory
mechanisms involved in cold-regulated gene expression.
[0004] Strong evidence exists for calcium having a role in low
temperature signal transduction and regulation of at least some COR
(cold-regulated) genes. Dhindsa and colleagues (Monroy, A. F., et
al, Plant Physiol. 102:1227-1235 (1993); Monroy, A. F., and R. S.,
The Plant Cell, 7:321-331 (1995)) have shown that, in alfalfa,
calcium chelators and calcium channel blockers prevent low
temperature induction of COR genes and that calcium ionophores and
calcium channel agonists induce expression of COR genes at normal
growth temperatures. Similarly, Knight et al (The Plant Cell
8:489-503 (1996)) have shown that cold-induced expression of the
Arabidopsis thaliana COR gene KINI is inhibited by calcium
chelators and calcium channel blockers. These results suggest that
low temperature triggers an influx of extracellular calcium that
activates a signal transduction pathway that induces the expression
of COR genes. Consistent with this notion is the finding that low
temperature evokes transient increases in cytosolic calcium levels
in plants (Knight, M. R. et al, Nature 352:524-526 (1991); Knight,
H., et al., The Plant Cell 8:489-503 (1996)). In addition, low
temperatures have been shown to stimulate the activity of
mechanosensitive calcium-selective cation channels in plants (Ding,
J. P. and B. G. Pickard, Plant J. 3:713-720 (1993)).
[0005] Recent efforts have led to the identification of a
cis-acting cold-regulatory element in plants, the C-repeat/DRE
(Yamaguchi-Shinozaki, et al., The Plant Cell 6:251-264 (1994);
Baker, S. S., et al., Plant. Mol. Biol. 24:701-713 (1994); Jiang,
C., et al., Plant Mol. Biol. 30:679-684 (1996)). The element, which
has a 5 base pair core sequence for CCGAC, is present once to
multiple times in all plant cold-regulated promoters that have been
described to date; these include the promoters of the COR15a
(Baker, S. S., et al, Plant. Mol. Biol. 24:701-713 (1994)),
COR78/RD29A (Horvath, D. P., et al, Plant Physiol. 103:1047-1053
(1993); Yamaguchi-Shinozaki, K., et al., The Plant Cell 6:251-264
(1994)), COR6.6 (Wang, H., et al., Plant Mol. Biol. 28:605-617
(1995)) and KINI (Wang, H., et al, Plant Mol. Biol. 28:605-617
(1995)) genes of Arabidopsis and the BN115 gene of Brassica napus
(White, T. C., et al, Plant Physiol. 106:917-928 (1994)). Deletion
analysis of the Arabidopsis COR15a gene suggested that the CCGAC
sequence, designated the C-repeat, might be part of a cis-acting
cold-regulatory element (Baker, S. S., et al., Plant Mol. Biol.
24:701-713 (1994)). That this was the case was first demonstrated
by Yamaguchi-Shinozaki and Shinozaki (Yamaguchi-Shinozaki, K., et
al., The Plant Cell 6:251-264 (1994)) who showed that two of the
C-repeat sequences present in the promoter of COR78/RD29A induced
cold-regulated gene expression when fused to a reporter gene. It
was also found that these two elements stimulate transcription in
response to dehydration and high salinity and thus, was designated
the DRE (dehydration, low temperature and high salt regulatory
element). Recent studies by Jiang et al (Jiang, C., et al., Plant
Mol. Biol. 30:679-684 (1996)) indicate that the C-repeats (referred
to as low temperature response elements) present in the promoter of
the B. napus BN115 gene also impart cold-regulated gene
expression.
[0006] U.S. Pat. Nos. 5,296,462 and 5,356,816 to Thomashow describe
the genes encoding the proteins involved in cold adaptation in
Arabidopsis thaliana. In particular the DNA encoding the COR15
proteins is described. These proteins are significant in promoting
cold tolerance in plants.
[0007] A need exists for the identification of genes which regulate
the expression of cold tolerance genes and drought tolerance genes.
A further need exists for DNA constructs useful for introducing
these regulatory genes into a plant in order to cause the plant to
begin expressing or enhance their expression of native or
non-native cold tolerance genes and drought tolerance genes. These
and other needs are provided by the present invention.
SUMMARY OF THE INVENTION
[0008] DNA in isolated form is provided which includes a sequence
encoding a binding protein capable of selectively binding to a DNA
regulatory sequence which regulates expression of one or more
environmental stress tolerance genes in a plant. The binding
protein is preferably capable of regulating expression of one or
more environmental stress tolerance genes in a plant by selectively
binding to a DNA regulatory sequence which regulates the one or
more environmental stress tolerance genes. In one embodiment, the
binding protein is a non-naturally occurring protein formed by
combining an amino acid sequence capable of binding to a CCG
regulatory sequence, preferably a CCGAC regulatory sequence with an
amino acid sequence which forms a transcription activation region
which regulates expression of one or more environmental stress
tolerance genes in a plant by regulating expression of one or more
environmental stress tolerance genes when the binding protein binds
to the regulatory region.
[0009] DNA in isolated form is also provided which includes a
promoter and the sequence encoding the binding protein. In one
variation, the promoter causes expression of the binding protein in
a manner which is different than how the binding protein is
expressed in its native state. For example, the promoter may
increase the level at which the binding protein is expressed,
express the binding protein without being induced by an
environmental stress and/or express the binding protein in response
to a different form or degree of environmental stress than would
otherwise be needed to induce expression of the binding protein.
The promoter may also be inducible by an exogenous agent. The
promoter can also be selected with regard to the type or types of
plant tissues that the binding protein will be expressed as well as
when in the plant's life the promoter will function to regulate
expression of the binding protein.
[0010] A nucleic acid construct capable of transforming a plant is
also provided which includes a sequence encoding a binding protein
capable of selectively binding to a DNA regulatory sequence which
regulates expression of one or more environmental stress tolerance
genes in a plant. The binding protein is preferably capable of
regulating expression of one or more environmental stress tolerance
genes in a plant by selectively binding to a DNA regulatory
sequence which regulates the one or more environmental stress
tolerance genes. The nucleic acid construct may be an RNA or DNA
construct. Examples of types of constructs include, but are not
limited to DNA and RNA viral vectors and plasmids.
[0011] A nucleic acid construct capable of transforming a plant is
also provided which includes a sequence which when transformed into
a plant expresses a binding protein capable of selectively binding
to a DNA regulatory sequence which regulates one or more
environmental stress tolerance genes in the plant. The binding
protein preferably regulates expression of one or more
environmental stress tolerance genes in the plant by selectively
binding to a DNA regulatory sequence which regulates the one or
more environmental stress tolerance genes.
[0012] In one variation of the above constructs, the construct also
includes a promoter which regulates expression of the binding
protein encoding sequence. The promoter may optionally be
homologous or heterologous relative to the binding protein encoding
sequence. The promoter and binding protein encoding sequence may
also optionally be native to the same or a different plant species.
In one variation, the promoter causes expression of the binding
protein in a manner which is different than how the binding protein
is expressed in its native state. For example, the promoter may
increase the level at which the binding protein is expressed,
express the binding protein without being induced by an
environmental stress and/or express the binding protein in response
to a different form or degree of environmental stress than would
otherwise be needed to induce expression of the binding protein.
The promoter may also be inducible by an exogenous agent. The
promoter can also be selected with regard to the type or types of
plant tissues that the binding protein will be expressed as well as
when in the plant's life the promoter will function to regulate
expression of the binding protein.
[0013] A binding protein in isolated form is also provided which is
capable of selectively binding to a DNA regulatory sequence which
regulates expression of one or more environmental stress tolerance
genes in a plant. The binding protein is preferably capable of
regulating expression of one or more environmental stress tolerance
genes in the plant by selectively binding to a DNA regulatory
sequence which regulates the one or more environmental stress
tolerance genes.
[0014] A recombinant binding protein expressed within a plant is
also provided which is capable of selectively binding to a DNA
regulatory sequence in the plant which regulates expression of one
or more environmental stress tolerance genes in the plant. The
recombinant binding protein is preferably capable of regulating
expression of one or more environmental stress tolerance genes in
the plant by selectively binding to a DNA regulatory sequence which
regulates the one or more environmental stress tolerance genes. The
recombinant binding protein may be native or non-native to the
plant. Further, the recombinant binding protein may be homologous
or heterologous relative to the DNA binding protein present in the
plant in which the binding protein is expressed.
[0015] A transformed cell of an organism is also provided which
includes a recombinant sequence encoding a binding protein capable
of selectively binding to a DNA regulatory sequence which regulates
expression of one or more environmental stress tolerance genes in a
plant. The binding protein is preferably capable of regulating
expression of one or more environmental stress tolerance genes in a
plant by selectively binding to a DNA regulatory sequence which
regulates the one or more environmental stress tolerance genes. The
transformed cell may be a unicellular organism such as a bacterium,
yeast or virus, or from a multicellular organism such as a fungus
or a plant.
[0016] A transformed cell is also provided which includes a
promoter and a sequence encoding a binding protein where at least
one of the promoter and sequence under regulatory control of the
promoter is recombinant. Optionally, one or both of the promoter
and sequence under regulatory control of the promoter is not native
to the cell. In one variation, the promoter causes expression of
the binding protein in a manner which is different than how the
binding protein is expressed in its native state. For example, the
promoter may increase the level at which the binding protein is
expressed, express the binding protein without being induced by an
environmental stress and/or express the binding protein in response
to a different form or degree of environmental stress than would
otherwise be needed to induce expression of the binding protein.
The promoter may also be inducible by an exogenous agent. The
promoter can also be selected with regard to the type or types of
plant tissues that the binding protein will be expressed as well as
when in the plant's life the promoter will function to regulate
expression of the binding protein.
[0017] A transformed cell is also provided which includes a
recombinant binding protein expressed within the cell which is
capable of selectively binding to a DNA regulatory sequence in the
plant which regulates expression of one or more environmental
stress tolerance genes in the plant. The binding protein is
preferably capable of regulating expression of one or more
environmental stress tolerance genes in the plant by selectively
binding to a DNA regulatory sequence which regulates the one or
more environmental stress tolerance genes. The binding protein may
be native or non-native to the cell.
[0018] A transformed plant with modified environmental stress
tolerance gene expression is also provided. In one embodiment, the
transformed plant includes one or more environmental stress
tolerance genes; a DNA regulatory sequence which regulates
expression of the one or more environmental stress tolerance genes;
and a recombinant sequence encoding a binding protein capable of
selectively binding to the DNA regulatory sequence.
[0019] In another embodiment, the transformed plant includes one or
more environmental stress tolerance genes; a DNA regulatory
sequence which regulates expression of the one or more
environmental stress tolerance genes; a sequence encoding a binding
protein capable of selectively binding to the DNA regulatory
sequence; and a recombinant promoter which regulates expression of
the sequence encoding the binding protein.
[0020] In yet another embodiment, the transformed plant includes
one or more environmental stress tolerance genes; a recombinant DNA
regulatory sequence which regulates expression of the one or more
environmental stress tolerance genes; and a sequence encoding a
binding protein capable of selectively binding to the DNA
regulatory sequence.
[0021] In yet another embodiment, the transformed plant includes at
least one recombinant environmental stress tolerance gene; a DNA
regulatory sequence which regulates expression of the at least one
environmental stress tolerance gene; and a sequence encoding a
binding protein capable of selectively binding to the DNA
regulatory sequence.
[0022] In yet another embodiment, the transformed plant includes at
least one recombinant environmental stress tolerance gene; a DNA
regulatory sequence which regulates expression of the at least one
environmental stress tolerance gene; and a recombinant binding
protein expressed by the plant which is capable of selectively
binding to the DNA regulatory sequence.
[0023] A method for altering an environmental stress tolerance of a
plant is also provided. In one embodiment, the method includes
transforming a plant with at least one copy of a gene encoding a
binding protein capable of binding to a DNA regulatory sequence
which regulates one or more environmental stress tolerance genes in
the plant; expressing the binding protein encoded by the gene; and
stimulating expression of at least one environmental stress
tolerance gene through binding of the binding protein to the DNA
regulatory sequence. In another embodiment, the method includes
transforming a plant with a promoter which regulates expression of
at least one copy of a gene encoding a binding protein capable of
binding to a DNA regulatory sequence which regulates one or more
environmental stress tolerance genes in the plant; expressing the
binding protein encoded by the gene; and stimulating expression of
at least one environmental stress tolerance gene through binding of
the binding protein to the DNA regulatory sequence.
[0024] In another embodiment, the method includes transforming a
plant with one or more environmental stress tolerance genes whose
expression is regulated by a DNA regulatory sequence; and
expressing a binding protein capable of binding to the DNA
regulatory sequence and activating expression of the one or more
environmental stress tolerance genes.
[0025] According to any one of the above embodiments of the present
invention, the binding protein may optionally be selected such that
it selectively binds to a member of a class of DNA regulatory
sequences which includes the subsequence CCG or more particularly
one of the following subsequences: CCGM, CCGAT, CCGAC, CCGAG,
CCGTA, CCGTT, CCGTC, CCGTG, CCGCA, CCGCT, CCGCG, CCGCC, CCGGA,
CCGGT, CCGGC, CCGGG, AACCG, ATCCG, ACCCG, AGCCG, TACCG, TTCCG,
TCCCG, TGCCG, CACCG CCCG, GACCG, GTCCG, GCCCG, GGCCG, ACCGA, ACCGT,
ACCGC, ACCGG, TCCGA, TCCGT, TCCGC, TCCGG, CCCGA, CCCGT, CCCGC,
CCCGG, GCCGA, GCCGT, GCCGC, and GCCGG. The binding protein may also
be selected such that the binding protein includes an AP2
domain.
[0026] In each of the above embodiments, the level of expression of
the binding protein may be the same or different than the level of
expression of the binding protein in its native state. Expression
of the binding protein in the transformed cell may be regulated by
a recombinant promoter which may have the effect of increasing the
level at which the binding protein is expressed, expressing the
binding protein without being induced by an environmental stress
and/or expressing the binding protein in response to a different
form or degree of environmental stress than is otherwise needed to
induce expression of the binding protein. Expression may also be
induced by an exogenous agent. Expression may also be limited to
selected types of plant tissues or selected periods in the plant's
life based on which promoter is used. By selecting in what tissues
and when in a plant's life the binding protein is expressed, in
combination with the selecting how the binding protein is expressed
(level of expression and/or type of environmental or chemical
induction), an incredible range of control over the environmental
stress responses of a plant can be achieved by the present
invention.
[0027] In each of the above embodiments, the binding protein
comprises an amino acid sequence which is capable of binding to a
DNA regulatory sequence which regulates one or more environmental
stress tolerance genes. In a preferred embodiment, the binding
protein further comprises a transcription activation region which
acts in concert with the binding sequence to regulate expression of
one or more environmental stress tolerance genes in the plant by
regulating expression of one or more environmental stress tolerance
genes. The environmental stress tolerance gene, DNA regulatory
sequence, sequence encoding the binding sequence, and the sequence
encoding the transcription activation region may each independently
be native or non-native to the plant and may each independently be
homologous or heterologous relative to each other.
[0028] Optionally, the binding protein satisfies one or more of the
following requirements:
[0029] the binding protein comprises an AP2 domain which comprises
a consensus sequence sufficiently homologous to any one of the
consensus sequences shown in FIGS. 19A, 19B, or 19C that the
binding protein is capable of binding to a CCG regulatory sequence,
preferably a CCGAC regulatory sequence;
[0030] the binding protein comprises an AP2 domain which comprises
a consensus sequence shown in FIGS. 19A, 19B or 19C;
[0031] the binding protein comprises an AP2 domain which comprises
the amino acid residues shown in FIGS. 19D or 19E;
[0032] the binding protein comprises an AP2 domain which is
sufficiently homologous to at least one of the AP2 domains shown in
the application such that it is capable of binding to a CCG
regulatory sequence, preferably a CCGAC regulatory sequence;
[0033] the binding protein comprises one of the AP2 domain
sequences shown in this application, including, but not limited to
SEQ. I.D. Nos. 2, 13, 15, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57,
59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91,
93, and 95;
[0034] the binding protein comprises a sequence which comprises one
of the amino terminus domains shown in FIG. 20 (it is noted that
the sequence need not be at the amino terminus of the binding
protein);
[0035] the binding protein comprises the consensus sequence for the
amino terminus domains shown in FIG. 20, (it is noted that the
sequence need not be at the amino terminus of the binding
protein);
[0036] the binding protein comprises a sequence which comprises one
of the carboxy terminus domains shown in FIG. 21A (it is noted that
the sequence need not be at the carboxy terminus of the binding
protein);
[0037] the binding protein comprises the consensus sequence for the
carboxy terminus domains shown in FIG. 21A (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein); and
[0038] the binding protein comprises the consensus sequence for the
carboxy terminus domains shown in FIG. 21B (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein).
[0039] The amino acid sequence encoding the binding protein may be
a naturally occurring sequence such as the ones shown in SEQ. ID.
Nos. 2, 13, 15, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63,
65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, and 95
or may be a non-naturally occurring sequence. It is noted, however,
that binding proteins according to the present invention are
intended to encompass non-naturally occurring sequences which are
derivatives of the classes of binding proteins taught herein. For
example, additional binding proteins may be constructed using one
of the AP2 domains taught herein or the consensus sequence of these
AP2 domains. It may be desirable to include with the AP2 domain a
transcription activation region. The transcription activation
region may be native to the plant or non-native to the plant in
which the binding protein will be used. For example, the sequence
may include a subsequence which encodes a binding domain for the
DNA regulatory sequence fused to a transcription activating region,
such as the transcription activating region of VP16 or GAL4.
[0040] Optionally, one can include in the binding protein one of
the amino terminus domains, the consensus sequence for the amino
terminus domain, one of the carboxy terminus domains and/or the
consensus sequence for the carboxy terminus domains. It is noted
that the amino terminus domain may be positioned away from the
amino terminus of the new binding protein and the carboxy terminus
domain may be positioned away from the carboxy terminus of the new
binding protein.
[0041] Optionally, the binding protein can be viewed as comprising
one of the amino terminus domains, the consensus sequence for the
amino terminus domain, one of the carboxy terminus domains and/or
the consensus sequence for the carboxy terminus domains. It is
noted that the amino terminus domain may be positioned away from
the amino terminus of the new binding protein and the carboxy
terminus domain may be positioned away from the carboxy terminus of
the new binding protein.
[0042] A method is also provided for identifying from a cDNA
library of at least a portion of a plant genome a gene sequence
encoding a protein capable of binding to a target DNA regulatory
sequence. In one embodiment, the method comprises
[0043] taking a microorganism which includes a target DNA
regulatory sequence for one or more environmental stress tolerance
genes, a transcription activator for activating expression of a
reporter gene, and a reporter gene whose expression is activated by
a protein which includes a binding domain capable of binding to the
target DNA regulatory sequence and an activation domain capable of
activating the transcription activator;
[0044] fusing sequences from a cDNA library of at least a portion
of a plant genome to a sequence which encodes a functional
activation domain in the microorganism;
[0045] introducing the fused sequences into the microorganism;
and
[0046] selecting microorganisms which express the reporter gene,
expression of the reporter gene indicating expression of a fusion
protein which includes a binding domain for the target DNA
regulatory sequence and the activation domain; and
[0047] identifying the gene sequence from the cDNA library
introduced into the microorganism. The target DNA regulatory
sequence may optionally include the subsequence CCG or the
subsequence CCGAC. This embodiment of the invention also relates to
DNA in substantially isolated form, nucleic acid constructs capable
of transforming a plant, cells, and transformed plants which
include a gene sequence identified by this method.
[0048] While the present invention is described with regard to the
use of binding proteins which can bind to a DNA regulatory sequence
that regulates environmental stress tolerance genes in a plant, it
is noted that these same binding proteins can also be used to
regulate genes other than environmental stress tolerance genes by
placing these other genes under the regulatory control of the DNA
regulatory sequence. For example, protein kinases that induce cold
and drought inducible genes can be regulated by placing a protein
kinase gene under the control of a promoter whose expression is
regulated by the DNA regulatory sequence. PCT/US97/23019 (Intl
Publication Number WO 98/26045) describes protein kinases that when
constitutively expressed, induce cold and drought inducible genes.
The ATCDPK1a and the ATCDPK1 constitutive protein kinase coding
regions (PCT/US97/23019) can be isolated by PCR and inserted into
the drought and cold inducible promoters described in Example 8 by
one skilled in the art. The expression of these ATCDPK1
constitutive protein kinase coding regions (PCT/US97/23019) from
the drought and cold inducible promoters will increase the drought
and cold tolerance of plants and should be synergistic with the the
drought and cold tolerance induced by CBF expression under
inducible promoters.
BRIEF DESCRIPTION OF THE DRAWINGS
[0049] FIGS. 1A and 1B show how the yeast reporter strains were
constructed.
[0050] FIG. 1A is a schematic diagram showing the screening
strategy.
[0051] FIG. 1B is a chart showing activity of the "positive" cDNA
clones in yeast reporter strains.
[0052] FIGS. 2A, 2B, 2C and 2D provide an analysis of the pACT-11
cDNA clone.
[0053] FIG. 2A is a schematic drawing of the pACT-11 cDNA insert
indicating the location and 5' to 3' orientation of the 24 kDa
polypeptide and 25s rRNA sequences.
[0054] FIG. 2B is a DNA and amino acid sequence of the 24 kDa
polypeptide (SEQ ID NO:1 and SEQ ID NO:2).
[0055] FIG. 2C is a schematic drawing indicating the relative
positions of the potential nuclear localization signal (NLS), the
AP2 domain and the acidic region of the 24 kDa polypeptide.
[0056] FIG. 2D is a chart showing comparison of the AP2 domain of
the 24 kDa polypeptide with that of the tobacco DNA binding protein
EREBP2.
[0057] FIG. 3 is a chart showing activation of reporter genes by
the 24 kDa polypeptide.
[0058] FIG. 4 is a photograph of an electrophoresis gel showing
expression of the recombinant 24 kDa polypeptide in E. coli.
[0059] FIG. 5 is a photograph of a gel for shift assays indicating
that CBF1 binds to the C-repeat/DRE.
[0060] FIG. 6 is a photograph of a southern blot analysis
indicating CBF1 is a unique or low copy number gene.
[0061] FIGS. 7A, 7B and 7C relate to CBF1 transcripts in control
and cold-treated Arabidopsis.
[0062] FIG. 7A is a photograph of a membrane RNA isolated from
Arabidopsis plants that were grown at 22 C or grown at 22 C and
transferred to 2.5 C for the indicated times.
[0063] FIG. 7B is a graph showing relative transcript levels of
CBF1 in control and cold-treated plants.
[0064] FIG. 7C is a graph showing relative transcript levels of
COR15a in control and cold-treated plants.
[0065] FIG. 8 is a Northern blot showing CBF1 and COR transcript
levels in RLD and transgenic Arabidopsis plants.
[0066] FIG. 9 is an immunoblot showing COR15am protein levels in
RLD and transgenic Arabidopsis plants.
[0067] FIGS. 10A and 10B are graphs showing freezing tolerance of
leaves from RLD and transgenic Arabidopsis plants.
[0068] FIG. 11 is a photograph showing freezing survival of RLD and
A6 Arabidopsis plants.
[0069] FIG. 12 shows the DNA sequence for CBF2 encoding CBF2.
[0070] FIG. 13 shows the DNA sequence for CBF3 encoding CBF3.
[0071] FIG. 14 shows the amino acid alignment of proteins CBF1,
CBF2 and CBF3.
[0072] FIG. 15 is a graph showing transcription regulation of COR
genes by CBF1, CBF2 and CBF3 genes in yeast.
[0073] FIG. 16 shows the amino acid sequence of a canola homolog
and its alignment to the amino acid sequence of CBF1.
[0074] FIGS. 17A, 17B, 17C, 17D, 17E, 17F and 17G show restriction
maps of plasmids pMB12008, pMB12009, pMB12010, pMB12011, pMB12012,
pMB12013, and pMB12014, respectively.
[0075] FIG. 18A shows the DNA sequences for the CBF homologs from
Brassica juncea, Brassica napus, Brassica oleracea, Brassica rapa,
Glycine max, Raphanus sativus and Zea Maize.
[0076] FIG. 18B shows the amino acid sequences (one-letter
abbreviations) encoded by the DNA sequences (shown in FIG. 18A) for
CBF homologs from Brassica juncea, Brassica napus, Brassica
oleracea, Brassica rapa, Glycine max, Raphanus sativus and Zea
Maize.
[0077] FIG. 19A shows an amino acid alignment of the AP2 domains of
several CBF proteins with the consensus sequence between the
proteins highlighted as well as a comparison of the AP2 domains
with that of the tobacco DNA binding protein EREBp2.
[0078] FIG. 19B shows an amino acid alignment of the AP2 domains of
several CBF proteins including dreb2a and dreb2b with the consensus
sequence between the proteins highlighted.
[0079] FIG. 19C shows an amino acid alignment of the AP2 domains of
several CBF proteins including dreb2a, dreb2b, and tiny with the
consensus sequence between the proteins highlighted.
[0080] FIG. 19D shows a difference between the consensus sequence
shown in FIG. 19A and tiny.
[0081] FIG. 19E shows a difference between the consensus sequence
shown in FIG. 19B and tiny.
[0082] FIG. 20 shows an amino acid alignment of the amino terminus
of several CBF proteins with their consensus sequence
highlighted.
[0083] FIGS. 21A and 21B show an amino acid alignment of the
carboxy terminus of several CBF proteins, with their consensus
sequences highlighted.
DETAILED DESCRIPTION
[0084] The present invention relates to DNA encoding binding
proteins capable of binding to a DNA regulatory sequence which
regulates expression of one or more environmental stress tolerance
genes in a plant. The present invention also relates to the binding
proteins encoded by the DNA. The DNA and binding proteins may be
native or non-native relative to the DNA regulatory sequence of the
plant. The DNA and binding proteins may also be native or
non-native relative to environmental stress tolerance genes of the
plant which are regulated by the DNA regulatory sequence.
[0085] The present invention also relates to methods for using the
DNA and binding proteins to regulate expression of one or more
native or non-native environmental stress tolerance genes in a
plant. These methods may include introducing DNA encoding a binding
protein capable of binding to a DNA regulatory sequence into a
plant, introducing a promoter into a plant which regulates
expression of the binding protein, introducing a DNA regulatory
sequence into a plant to which a binding protein can bind, and/or
introducing one or more environmental stress tolerance genes into a
plant whose expression is regulated by a DNA regulatory
sequence.
[0086] The present invention also relates to recombinant cells,
plants and plant materials (e.g., plant tissue, seeds) into which
one or more gene sequences encoding a binding protein have been
introduced as well as cells, plants and plant materials within
which recombinant binding proteins encoded by these gene sequences
are expressed. By introducing a gene sequence encoding a binding
protein into a plant, a binding protein can be expressed within the
plant which regulates expression of one or more stress tolerance
genes in the plant. Regulation of expression can include causing
one or more stress tolerance genes to be expressed under different
conditions than those genes would be in the plant's native state,
increasing a level of expression of one or more stress tolerance
genes, and/or causing the expression of one or more stress
tolerance genes to be inducible by an exogenous agent. Expression
of the binding protein can be under the control of a variety of
promoters. For example, promoters can be used to overexpress the
binding protein, change the environment conditions under which the
binding protein is expressed, or enable the expression of the
binding protein to be induced, for example by the addition of an
exogenous inducing agent.
[0087] The present invention also relates to cells, recombinant
plants and plant materials into which a recombinant promoter is
introduced which controls a level of expression of one or more gene
sequences encoding a binding protein. The one or more gene
sequences may be recombinant native or non-native sequences or may
be native, non-recombinant gene sequences whose expression is
altered by the introduction of the recombinant promoter.
[0088] The present invention also relates to cells, recombinant
plants and plant materials into which a recombinant native or
non-native DNA regulatory sequence is introduced which regulates
expression of one or more native or non-native environmental stress
tolerance genes.
[0089] Examples of environmental stresses for which stress
tolerance genes are known to exist include, but are not limited to,
cold tolerance, dehydration tolerance, and salinity tolerance. As
used herein, environmental stress tolerance genes refer to genes
which function to acclimate a plant to an environment stress. For
example, cold tolerance genes, also referred to as COR genes (COld
Regulated), refer to genes which function to acclimate a plant to a
cold temperature environment. These genes typically are activated
when a plant is exposed to cold temperatures. Dehydration tolerance
genes refer to genes which function to acclimate a plant to
dehydration stress. These genes typically are activated in response
to dehydration conditions which can be associated with drought or
cold temperatures which cause water in the plant to freeze and
thereby dehydrate the plant tissue. It is noted that some cold
tolerance genes may function to provide a plant with a degree of
dehydration tolerance and visa versa. For example, COR genes are
known to also be activated by dehydration stress. This application
is intended to encompass genes which regulate one or more
environmental stress tolerance genes such as cold tolerance genes,
dehydration tolerance genes, and genes which perform a dual
function of cold and dehydration tolerance.
[0090] One embodiment of the invention relates to a DNA sequence in
isolated form which includes a sequence encoding a binding protein
capable of selectively binding to a DNA regulatory sequence which
regulates expression of one or more environmental stress tolerance
genes in a plant. The binding protein is preferably capable of
regulating expression of one or more environmental stress tolerance
genes in a plant by selectively binding to a DNA regulatory
sequence which regulates the one or more environmental stress
tolerance genes. In one variation, the binding protein is a
non-naturally occurring protein formed by combining an amino acid
sequence capable of binding to a CCG regulatory sequence,
preferably a CCGAC regulatory sequence with an amino acid sequence
which forms a transcription activation region which regulates
expression of one or more environmental stress tolerance genes in a
plant by regulating expression of one or more environmental stress
tolerance genes when the binding protein binds to the regulatory
region.
[0091] The DNA sequence may exist in a variety of forms including a
plasmid or vector and can include sequences unrelated to the gene
sequence encoding the binding protein. For example, the DNA
sequence can include a promoter which regulates expression of the
regulatory gene.
[0092] In one variation of this embodiment, the DNA regulatory
sequence is a C-repeat cold and drought regulation element
(C-repeat/DRE). As will be explained and demonstrated herein,
C-repeat/DRE regulatory sequences appear to be conserved in plants
with some degree of variability plant to plant. Using the teachings
of the present invention, C-repeat/DRE regulatory sequences native
to different plants can be identified as well as the native stress
tolerance regulatory genes which encode for proteins which bind to
the C-repeat/DRE DNA regulatory sequences. Hence, although the
examples provided herein to describe the present invention are
described with regard to the Arabadopsis C-repeat/DRE DNA
regulatory sequence, the present invention is not intended to be
limited to the Arabadopsis C-repeat/DRE DNA regulatory sequence.
Rather, the Arabadopsis C-repeat/DRE DNA regulatory sequence is
believed to be a member of a class of environmental stress response
regulatory elements which includes the subsequence CCGAC which in
turn is believed to be a member of a class of environmental stress
response regulatory elements which includes the subsequence CCG.
Other different classes of environmental stress response regulatory
elements may also exist. The teachings of the present invention may
be used to identify sequences which bind to these and other classes
of environmental stress response regulatory elements once they are
identified.
[0093] In one variation of this embodiment, the gene sequence
encodes a binding protein which selectively binds to a member of a
class of DNA regulatory sequences which includes the subsequence
CCG. In another variation, the gene sequence encodes a binding
protein which selectively binds to a member of a class of DNA
regulatory sequences which includes the subsequence CCGAC. The
CCGAC subsequence has been found to present in the C-repeat/DRE DNA
regulatory sequences of Arabadopsis and Brassica and to function in
Tobacco based on the ability of the C-repeat/DRE to direct cold and
tolerance regulated gene expression.
[0094] In yet another variation, the stress tolerance regulatory
gene sequence encodes a binding protein which includes an AP2
domain. It is believed that a significant class of environmental
stress tolerance regulatory genes encode for binding proteins with
an AP2 domain capable of binding to the DNA regulatory sequence.
The AP2 domain of the binding protein is preferably a homolog of
the AP2 domain of one of the CBF binding proteins described herein.
The subsequence encoding the AP2 domain is preferably a homolog of
a subsequence of one of the CBF genes described herein which
encodes an AP2 domain.
[0095] In another variation, the DNA sequence encoding the binding
protein satisfies one or more of the following requirements:
[0096] the binding protein comprises an AP2 domain which comprises
a consensus sequence sufficiently homologous to any one of the
consensus sequences shown in FIGS. 19A, 19B, or 19C that the
binding protein is capable of binding to a CCG regulatory sequence,
preferably a CCGAC regulatory sequence;
[0097] the binding protein comprises an AP2 domain which comprises
a consensus sequence shown in FIGS. 19A, 19B or 19C;
[0098] the binding protein comprises an AP2 domain which comprises
the amino acid residues shown in FIGS. 19D or 19E;
[0099] the binding protein comprises an AP2 domain which is
sufficiently homologous to at least one of the AP2 domains shown in
the application such that it is capable of binding to a CCG
regulatory sequence, preferably a CCGAC regulatory sequence; the
binding protein comprises one of the AP2 domain sequences shown in
this application, including, but not limited to SEQ. I.D. Nos. 2,
13, 15, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67,
69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, and 95;
[0100] the binding protein comprises a sequence which comprises one
of the amino terminus domains shown in FIG. 20 (it is noted that
the sequence need not be at the amino terminus of the binding
protein);
[0101] the binding protein comprises the consensus sequence for the
amino terminus domains shown in FIG. 20, (it is noted that the
sequence need not be at the amino terminus of the binding
protein);
[0102] the binding protein comprises a sequence which comprises one
of the carboxy terminus domains shown in FIG. 21A (it is noted that
the sequence need not be at the carboxy terminus of the binding
protein);
[0103] the binding protein comprises the consensus sequence for the
carboxy terminus domains shown in FIG. 21A (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein);
[0104] the binding protein comprises the consensus sequence for the
carboxy terminus domains shown in FIG. 21B (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein);
[0105] one of SEQ. I.D. Nos. 1, 12, 14, 40, 42, 44, 46, 48, 50, 52,
54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86,
88, 90, 92, and 94; or
[0106] a sequence which has substantially the same degree of
homology to SEQ. I.D. Nos. 1, 12, 14, 40, 42, 44, 46, 48, 50, 52,
54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86,
88, 90, 92, and 94 as these sequences have with each other.
[0107] The present invention also relates to a method for
identifying gene sequences from at least a portion of a plant
genome which encode binding proteins capable of binding to a target
DNA regulatory sequence which regulates expression of one or more
stress tolerance genes in a plant.
[0108] In one embodiment, the method includes:
[0109] taking a microorganism which includes a target DNA
regulatory sequence for one or more environmental stress tolerance
genes, a transcription activator for activating expression of a
reporter gene, and a reporter gene whose expression is activated by
a protein which includes a binding domain capable of binding to the
target DNA regulatory sequence and an activation domain capable of
activating the transcription activator;
[0110] fusing sequences from a cDNA library of at least a portion
of a plant genome to a sequence which encodes a functional
activation domain in the microorganism;
[0111] introducing the fused sequences into the microorganism;
and
[0112] selecting microorganisms which express the reporter gene,
expression of the reporter gene indicating expression of a fusion
protein which includes a binding domain for the target DNA
regulatory sequence and the activation domain; and
[0113] identifying the gene sequence from the cDNA library
introduced into the microorganism.
[0114] In one variation of the method, the target DNA regulatory
sequence includes the subsequence CCG and in another embodiment
includes the subsequence CCGAC. In yet another variation, the
target DNA regulatory sequence is the C-repeat/DRE for Arabadopsis.
According to the above method, the target DNA regulatory sequence
is preferably native to the plant family and more preferably to the
plant species from which the cDNA library is derived.
[0115] In another variation of this embodiment, the cDNA library
used in the method consists of sequences which encode for a protein
having an AP2 domain since it is believed that a significant class
of genes encoding binding proteins for stress tolerance genes
encode an AP2 domain. As will be explained herein, screening for
DNA sequences from a plant genome which exhibit this functional
feature has been shown to be effective for isolating gene sequences
encoding binding proteins of the present invention.
[0116] In another variation of this method, the sequences from the
cDNA library are fused to a sequence which includes a selectable
marker, the method further including the step of selecting for
microorganisms expressing the selectable marker.
[0117] While the above methodology of the present invention is
described herein with regard to identifying binding protein gene
sequences from Arabidopsis cDNA using the C-repeat/DRE regulatory
sequence for Arabidopsis, it is noted that this methodology can be
readily used to identify regulatory binding protein gene sequences
for other plants by using a DNA regulatory sequence native to those
plants. Alternatively, different permutations of the CCG
subsequence can be used as the target DNA regulatory sequence.
[0118] An example of a microorganism which may be used in the above
method is yeast. cDNA can be introduced into the microorganism by a
variety of mechanisms including plasmids and vectors. In one
particular embodiment, the reporter gene is beta-galactosidase.
[0119] The present invention also relates to any DNA sequences and
binding proteins encoded by those DNA sequences which are
identified by the above screening method.
[0120] The present invention also relates to a protein expressed by
an environmental stress tolerance regulatory gene according to the
present invention which can function in vivo in a plant to regulate
expression of one or more environmental stress tolerance genes.
[0121] According to one embodiment, the protein is a recombinant
binding protein expressed by a copy of a recombinant gene which is
either not native to the plant or is native to the plant but
introduced into the plant by recombinant methodology. For example,
one might wish to introduce one or more copies of a regulatory gene
which is native to the plant but is under the control of a promoter
which overexpresses the binding protein, expresses the binding
protein independent of an environmental stress, expresses the
binding protein at a higher level in response to the same
environmental stress than would a plant in its native state,
expresses the binding protein in response to different
environmental stress conditions, and/or be induced to express the
binding protein by an exogenous agent to which the plant can be
exposed. Alternatively, one might wish to introduce one or more
copies of a regulatory gene which is not native to the plant. For
example, the non-native regulatory gene may be used to alter the
way in which native environmental stress tolerance genes are
regulated. Alternatively, the non-native regulatory gene may be
used to regulate environmental stress tolerance genes which are
also not native to the plant. The non-native regulatory gene may be
used to bind to a DNA regulatory region which is not native to the
plant.
[0122] In another embodiment, the proteins have been isolated from
a recombinant organism. The organism may be a microorganism (e.g.,
bacteria, yeast) or a multicellular organism such as a plant. In
one variation, the protein is in substantially isolated form.
[0123] In yet another embodiment, the protein is a native,
non-recombinant binding protein whose expression is regulated
within a plant by a recombinant native or non-native promoter. For
example, one might wish to replace a native promoter with a
recombinant promoter which overexpresses the binding protein,
expresses the binding protein independent of an environmental
stress, expresses the binding protein at a higher level in response
to the same environmental stress than would a plant in its native
state, expresses the binding protein in response to different
environmental stress conditions, and/or be induced to express the
binding protein by an exogenous agent to which the plant can be
exposed.
[0124] In one variation of the above embodiments, the protein is
capable of selectively binding to a DNA regulatory sequence for one
or more environmental stress tolerance genes in a plant. In another
variation, the protein includes an AP2 domain which is capable of
selectively binding to a DNA regulatory sequence for one or more
environmental stress tolerance genes in a plant. One method which
may be used to determine whether the protein binds selectively to
the DNA regulatory sequence is a gel shift assay. The DNA
regulatory sequence may optionally include a CCG subsequence, a
CCGAC subsequence and optionally the C-repeat/DRE sequence of
Arabadopsis.
[0125] In another variation of the above embodiments, the binding
protein satisfies one or more of the following requirements:
[0126] the binding protein comprises an AP2 domain which comprises
a consensus sequence sufficiently homologous to any one of the
consensus sequences shown in FIGS. 19A, 19B, or 19C that the
binding protein is capable of binding to a CCG regulatory sequence,
preferably a CCGAC regulatory sequence;
[0127] the binding protein comprises an AP2 domain which comprises
a consensus sequence shown in FIGS. 19A, 19B or 19C;
[0128] the binding protein comprises an AP2 domain which comprises
the amino acid residues shown in FIGS. 19D or 19E;
[0129] the binding protein comprises an AP2 domain which is
sufficiently homologous to at least one of the AP2 domains shown in
the application such that it is capable of binding to a CCG
regulatory sequence, preferably a CCGAC regulatory sequence;
[0130] the binding protein comprises one of the AP2 domain
sequences shown in this application, including, but not limited to
SEQ. I.D. Nos. 2, 13, 15, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57,
59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91,
93, and 95;
[0131] the binding protein comprises a sequence which comprises one
of the amino terminus domains shown in FIG. 20 (it is noted that
the sequence need not be at the amino terminus of the binding
protein);
[0132] the binding protein comprises the consensus sequence for the
amino terminus domains shown in FIG. 20, (it is noted that the
sequence need not be at the amino terminus of the binding
protein);
[0133] the binding protein comprises a sequence which comprises one
of the carboxy terminus domains shown in FIG. 21A (it is noted that
the sequence need not be at the carboxy terminus of the binding
protein);
[0134] the binding protein comprises the consensus sequence for the
carboxy terminus domains shown in FIG. 21A (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein); and
[0135] the binding protein comprises the consensus sequence for the
carboxy terminus domains shown in FIG. 21B (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein).
[0136] The sequence of the binding protein may be a naturally
occurring sequence such as the ones shown in SEQ. ID. Nos. 2, 13,
15, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69,
71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, and 95 or may be a
non-naturally occurring sequence. It is noted, however, that
binding proteins according to the present invention are intended to
encompass non-naturally occurring sequences which are derivatives
of the classes of binding proteins taught herein. For example,
additional binding proteins may be constructed using one of the AP2
domains taught herein or the consensus sequence of these AP2
domains. It may be desirable to include with the AP2 domain a
transcription activation region. The transcription activation
region may be native to the plant or non-native to the plant in
which the binding protein will be used. For example, the sequence
may include a subsequence which encodes a binding domain for the
DNA regulatory sequence fused to a transcription activating region,
such as the transcription activating region of VP16 or GAL4.
Optionally, one can include in the binding protein one of the amino
terminus domains, the consensus sequence for the amino terminus
domain, one of the carboxy terminus domains and/or the consensus
sequence for the carboxy terminus domains. It is noted that the
amino terminus domain may be positioned away from the amino
terminus of the new binding protein and the carboxy terminus domain
may be positioned away from the carboxy terminus of the new binding
protein.
[0137] Optionally, the binding protein can be viewed as comprising
one of the amino terminus domains, the consensus sequence for the
amino terminus domain, one of the carboxy terminus domains and/or
the consensus sequence for the carboxy terminus domains. It is
noted that the amino terminus domain may be positioned away from
the amino terminus of the new binding protein and the carboxy
terminus domain may be positioned away from the carboxy terminus of
the new binding protein.
[0138] In another embodiment, the binding protein is an isolated
protein or a recombinantly produced protein which has a molecular
weight of about 26 kDa as measured in an electrophoresis gel and
binds to a DNA regulatory sequence which regulates a cold or
dehydration regulated gene of Arabidopsis thaliana.
[0139] The present invention also relates to DNA and RNA
constructs, such as plasmids, vectors, and the like, which are
capable of transforming a plant. The constructs include a sequence
which encodes a binding protein capable of selectively binding to a
DNA regulatory sequence which regulates the one or more
environmental stress tolerance genes. The binding protein is
preferably able to regulate expression of one or more environmental
stress tolerance genes in a plant by selectively binding to the DNA
regulatory sequence. More preferably, when transformed into a
plant, the sequence regulates expression of one or more
environmental stress tolerance genes in the plant by expressing the
binding protein. In one embodiment, the DNA construct includes a
promoter and a regulatory gene sequence whose expression is under
the control of the promoter. Different promoters may be used to
select the degree of expression or conditions under which the
regulatory gene is expressed. For example, the promoter can be used
to cause overexpression of the regulatory gene, expression of the
regulatory gene independent of an environmental stress, expression
of the regulatory gene at a higher level in response to the same
environmental stress than would a plant in its native state,
expression of the regulatory gene in response to different
environmental stress conditions, and/or induction of expression of
the regulatory gene by an exogenous agent to which the plant can be
exposed.
[0140] In another embodiment, the DNA construct comprises a
sequence which encodes:
[0141] a binding protein comprising an AP2 domain which comprises a
consensus sequence sufficiently homologous to any one of the
consensus sequences shown in FIGS. 19A, 19B, or 19C that the
binding protein is capable of binding to a CCG regulatory sequence,
preferably a CCGAC regulatory sequence;
[0142] a binding protein comprising an AP2 domain which comprises a
consensus sequence shown in FIGS. 19A, 19B or 19C;
[0143] a binding protein comprising an AP2 domain which comprises
the amino acid residues shown in FIGS. 19D or 19E;
[0144] a binding protein comprising an AP2 domain which is
sufficiently homologous to at least one of the AP2 domains shown in
the application such that it is capable of binding to a CCG
regulatory sequence, preferably a CCGAC regulatory sequence;
[0145] a binding protein comprising one of the AP2 domain sequences
shown in this application, including, but not limited to SEQ. I.D.
Nos. 2, 13, 15, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63,
65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, and
95;
[0146] a binding protein comprising a sequence which comprises one
of the amino terminus domains shown in FIG. 20 (it is noted that
the sequence need not be at the amino terminus of the binding
protein);
[0147] a binding protein comprising the consensus sequence for the
amino terminus domains shown in FIG. 20, (it is noted that the
sequence need not be at the amino terminus of the binding
protein);
[0148] a binding protein comprising a sequence which comprises one
of the carboxy terminus domains shown in FIG. 21A (it is noted that
the sequence need not be at the carboxy terminus of the binding
protein);
[0149] a binding protein comprising the consensus sequence for the
carboxy terminus domains shown in FIG. 21A (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein);
[0150] a binding protein comprising the consensus sequence for the
carboxy terminus domains shown in FIG. 21B (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein);
[0151] one of SEQ. I.D. Nos. 1, 12, 14, 40, 42, 44, 46, 48, 50, 52,
54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86,
88, 90, 92, and 94; or
[0152] a sequence which has substantially the same degree of
homology to SEQ. I.D. Nos. 1, 12, 14, 40, 42, 44, 46, 48, 50, 52,
54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86,
88, 90, 92, and 94 as these sequences have with each other.
[0153] The present invention also relates to plasmids pCBF1 (ATCC
98063), pCBF2, and pCBF3.
[0154] The present invention also relates to a recombinant
microorganism, such as a bacterium, yeast, fungus, virus, into
which at least one copy of a regulatory gene encoding a binding
protein of the present invention has been introduced by a
recombinant methodology.
[0155] The present invention also relates to recombinant plants
into which at least one copy of a regulatory gene encoding a
binding protein of the present invention has been introduced by a
recombinant methodology. The recombinant copy of the regulatory
gene may be native or non-native to the plant and express a binding
protein which is either native or non-native to the plant.
[0156] Expression of the recombinant copy of the regulatory gene
may be under the control of the promoter. The promoter may increase
the level at which the regulatory gene is expressed, express the
regulatory gene without being induced by an environmental stress
and/or express the regulatory gene in response to a different form
or degree of environmental stress than would otherwise be needed to
induce expression of the regulatory gene. For example, a promoter
can be used which turns on at a temperature that is warmer than the
temperature at which the plant normally exhibits cold tolerance.
This would enable the cold tolerance thermostat of a plant to be
altered. Similarly, a promoter can be used which turns on at a
dehydration condition that is wetter than the dehydration condition
at which the plant normally exhibits dehydration tolerance.
[0157] This would enable the level at which a plant responds to
dehydration to be altered. A promoter can also be used which causes
a higher level of expression to occur at a given environmental
condition (e.g. temperature and/or dryness) than the plant would
express in its native state. The promoter may also be inducible by
an exogenous agent, i.e., express the regulatory gene in response
to the presence of an agent to which the promoter is exposed. This
would enable stress tolerance to be induced by applying an inducing
agent to the plant.
[0158] Selection of the promoter can also be used to determine what
tissues in the plant express the binding protein as well as when
expression occurs in the plant's lifecycle. By selecting a promoter
which regulates in what tissues and when in a plant's life the
promoter functions to regulate expression of the binding protein,
in combination with the selecting how that promoter regulates
expression (level of expression and/or type of environmental or
chemical induction), an incredible range of control over the
environmental stress responses of a plant can be achieved according
to the present invention. The environmental stress tolerance gene
regulated by the recombinantly expressed regulatory gene may be
native or non-native to the plant. Hence, in one embodiment, the
plant includes a recombinant copy of a regulatory gene which is
native to the plant and expresses a native protein which functions
within the plant to regulate expression of a native environmental
stress tolerance gene. In this embodiment, the recombinant plant
expresses a higher level of the native regulatory gene than the
plant would otherwise.
[0159] In another embodiment, at least one of the regulatory genes
and the environmental stress tolerance genes is not native to the
plant. For example, the regulatory gene can be native and the
environmental stress tolerance gene is non-native, or the
regulatory gene is non-native and the environmental stress
tolerance gene is native to the plant.
[0160] In yet another embodiment, the plant can include a
recombinant copy of a regulatory gene which is not native to the
plant as well as a recombinant copy of one or more environmental
stress tolerance genes which also is not native to the plant.
According to this embodiment, the non-native regulatory gene
expresses a non-native binding protein which functions within the
plant to regulate expression of the one or more non-native
environmental stress tolerance genes. In this regard, it is
envisioned that the present invention can be used to introduce,
change and/or augment the environmental stress tolerance of a plant
by introducing and causing the expression of environmental stress
tolerance which the plant does not have in its native form.
Accordingly, plants from warmer climates can be engineered to
include one or more cold tolerance genes along with a regulatory
gene needed to cause expression of the cold tolerance genes in the
plant so that the engineered plant can survive better in a colder
climate. Similarly, a plant can be engineered to include one or
more dehydration tolerance genes along with a regulatory gene
needed to cause expression of the dehydration tolerance gene so
that the engineered plant can grow better in a dryer climate. In
this regard, it should be possible to take a plant which grows well
in a first climate and engineer it to include stress tolerance
genes and regulatory genes native to a second climate so that the
plant can grow well in the second climate.
[0161] The present invention also relates to a method for changing
or enhancing the environmental stress tolerance of a plant.
[0162] In one embodiment, the method includes introducing at least
one copy of a regulatory gene encoding a binding protein of the
present invention into a plant; expressing the binding protein
encoded by the regulatory gene; and using the expressed binding
protein to stimulate expression of at least one environmental
stress tolerance gene through binding to a DNA regulatory sequence.
According to this embodiment, the regulatory gene may be
non-recombinant or recombinant native or non-native to the plant.
Similarly, the DNA regulatory sequence and the environmental stress
tolerance gene may each independently be native or non-native to
the plant. In one variation of this embodiment, the method further
includes recombinantly introducing an environmental stress
tolerance gene into the plant which is regulated by the recombinant
regulatory gene.
[0163] In another embodiment, the method includes introducing a
recombinant promoter which regulates expression of a regulatory
gene encoding a binding protein of the present invention into a
plant; expressing the binding protein under the control of the
recombinant promoter; and using the expressed binding protein to
stimulate expression of at least one environmental stress tolerance
gene through binding to a DNA regulatory sequence. According to
this embodiment, the regulatory gene, the DNA regulatory sequence
and the environmental stress tolerance gene may each independently
be non-recombinant or recombinant native or non-native to the
plant.
[0164] In yet another embodiment, the method includes introducing
at least one recombinant environmental stress tolerance gene into a
plant; expressing a binding protein; and using the expressed
binding protein to stimulate expression of the recombinant
environmental stress tolerance gene through binding to a DNA
regulatory sequence. According to this embodiment, the gene
encoding the regulatory protein, and the DNA regulatory sequence
may each independently be non-recombinant or recombinant native or
non-native to the plant. The recombinant environmental stress
tolerance gene may be either native or non-native to the plant.
[0165] 1. Definitions
[0166] The term "C-repeat cold and drought regulation element" or
"C-repeat/DRE" refers to a sequence which includes CCG and
functions as a binding domain in a plant to regulate expression of
one or more environmental stress tolerance genes, such as cold or
dehydration stress tolerance genes.
[0167] The term "cold stress" refers to a decrease in ambient
temperature, including a decrease to freezing temperatures, which
causes a plant to attempt to acclimate itself to the decreased
ambient temperature.
[0168] The term "dehydration stress" refers to drought, high
salinity and other conditions which cause a decrease in cellular
water potential in a plant.
[0169] Transformation means the process for changing the genotype
of a recipient organism by the stable introduction of DNA by
whatever means.
[0170] A transgenic plant is a plant containing DNA sequences which
were introduced by transformation. Horticultural and crop plants
particularly benefit from the present invention.
[0171] Translation means the process whereby the genetic
information in an mRNA molecule directs the order of specific amino
acids during protein synthesis.
[0172] The term "essentially homologous" means that the DNA or
protein is sufficiently duplicative of that set forth in FIG. 2B to
produce the same result. Such DNA can be used as a probe to isolate
DNA's in other plants.
[0173] A promoter is a DNA fragment which causes transcription of
genetic material. For the purposes described herein, promoter is
used to denote DNA fragments that permit transcription in plant
cells.
[0174] A poly-A addition site is a nucleotide sequence which causes
certain enzymes to cleave mRNA at a specific site and to add a
sequence of adenylic acid residues to the 3'-end of the mRNA.
[0175] The phrase "DNA in isolated form" refers to DNA sequence
which has been at least partially separated from other DNA present
in its native state in an organism. A cDNA library of genomic DNA
is not "DNA in isolated form" whereas DNA which has been at least
partially purified by gel electrophoresis corresponds to "DNA in
isolated form".
[0176] 2. C-Repeat/DRE Regulatory Elements In Plants
[0177] C-repeat cold and drought regulation elements (C-repeat/DRE)
are sequences which function as a cis-acting regulatory element
that stimulates transcription in response to an environmental
stress, such as low temperature (Yamaguchi-Shinozaki, K., et al.,
The Plant Cell 6:251-264 (1994); and Baker, S. S., et al., Plant
Mol. Biol. 24:701-713 (1994); Jiang, C., et al., Plant Mol. Biol.
30:679-684 (1996)) or dehydration stress and high salinity
(Yamaguchi-Shinozaki, K., et al., The Plant Cell 6:251-264 (1994)).
An object of the research leading to the present invention was the
determination of how a C-repeat/DRE stimulates gene expression in
response to these environmental factors, and whether cold,
dehydration and high salinity affect independent or overlapping
regulatory systems.
[0178] The first step toward determining how a C-repeat/DRE
regulation element stimulates gene expression was the
identification of the C-repeat cold and drought regulation element
itself. The 5 base pair core sequence, CCGAC, has been found to be
present once to multiple times in a variety of plant cold-regulated
promoters in Arabidopsis and Brassica including the COR15a (Baker,
S. S., et al, Plant. Mol. Biol. 24:701-713 (1994)); COR78/RD29A
(Horvath, D. P., et al, Plant Physiol. 103:1047-1053 (1993) and
Yamaguchi-Shinozaki, K., et al., The Plant Cell 6:251-264 (1994));
COR6.6 (Wang, H., et al., Plant Mol. biol. 28:605-617 (1995)); and
KINI (Wang, H., et al, Plant Mol. Biol. 28:605-617 (1995)) genes of
Arabidopsis and the BN115 gene of Brassica napus (White, T. C., et
al, Plant Physiol. 106:917-928 (1994)). As shown in the examples
herein, core sequence CCGAC was used to identify proteins encoded
by genes within the Arabidopsis genome which bind to this core
sequence.
[0179] Applicants believe that the CCGAC core sequence is a member
of family of core sequences having the common subsequence CCG. The
binding of CBF1 to the C-repeat/DRE involves the AP2 domain. In
this regard, it is germane to note that the tobacco ethylene
response element, AGCCGCC, closely resembles the C-repeat/DRE
sequences present in the promoters of the Arabidopsis genes COR15a,
GGCCGAC, and COR781RD29A, TACCGAC.
[0180] While the specific teachings in the present invention used
only a DNA regulatory sequence which includes a CCGAC subsequence
as the C-repeat/DRE core regulatory sequence, Applicants believe
that other C-repeat/DRE regulatory sequences exist which belong to
a broader CCG family of regulatory sequences. By screening plant
genomes according to the methodology taught herein using other
members of the CCG family, additional regulatory sequences as well
as the binding proteins which bind to these regulatory sequences
can be identified. For example, plants which are known to exhibit a
form of environmental stress tolerance can be screened according to
the blue colony assay and other screening methodologies used in the
present invention with other members of the CCG family in order to
identify other binding proteins and their gene sequences. Examples
of other members of the CCG family include, but are not limited to,
environmental stress response regulatory elements which include one
of the following sequences: CCGAA, CCGAT, CCGAC, CCGAG, CCGTA,
CCGTT, CCGTC, CCGTG, CCGCA, CCGCT, CCGCG, CCGCC, CCGGA,
CCGGT,CCGGC, CCGGG, AACCG, ATCCG, ACCCG, AGCCG, TACCG, TTCCG,
TCCCG, TGCCG, CACCG, CTCCG, CGCCG, CCCCG, GACCG, GTCCG, GCCCG,
GGCCG, ACCGA, PCCGT, ACCGC, ACCGG, TCCGA, TCCGT, TCCGC, TCCGG,
CCCGA, CCCGT, CCCGC, CCCGG, GCCGA, GCCGT, GCCGC, and GCCGG.
[0181] Applicants also believe that other families of environmental
stress tolerance DNA regulatory sequences, other than the CCG
family may exist. The methodologies of the present invention may be
used once such other families are identified in order to identify
specific environmental stress tolerance DNA regulatory sequences
and associated binding proteins.
[0182] 3. Identification of Environmental Stress Tolerance
Regulatory Gene Sequences Using Target Regulatory Sequence
[0183] It is possible to take a cDNA library of at least a portion
of a plant genome and screen the cDNA library for the presence of
regulatory gene sequences which encode binding proteins capable of
binding to a target regulatory sequence. As used here, a target DNA
regulatory sequence refers to a sequence to which a binding protein
for one or more environmental stress tolerance genes binds.
Permutations of the CCG and CCGAC families of DNA regulatory
sequences represent examples of target DNA regulatory sequences. As
detailed in Example 1 herein, this was the approach was used to
identify CBF1, a sequence which encodes a binding protein for the
Arabadopsis DNA regulatory sequence, from an Arabadopsis cDNA
library.
[0184] First a target regulatory sequence is selected. The target
regulatory sequence is preferably native to the plant from which
the cDNA library being screened is derived.
[0185] Once a target regulatory sequence is selected, the target
regulatory sequence is fused to a reporter gene and introduced into
a microorganism. Expression of the reporter gene can be activated
by a protein which includes a binding domain capable of binding to
the target DNA regulatory sequence and an activation domain capable
of activating transcription.
[0186] Sequences from a cDNA library of at least a portion of a
plant genome are then fused to a sequence which encodes a
functional activation domain in the microorganism. The fused
sequences are then introduced into the microorganism. It is
possible that the sequence from the cDNA library may already encode
a functional activation domain, for example as described herein in
Example 1.
[0187] Microorganisms which express the reporter gene are then
selected. Since only those microorganisms which express a fusion
protein which includes a binding domain for the target DNA
regulatory sequence and an activation domain will stimulate
expression of the reporter gene, expression of the reporter gene
indicates expression of such a fusion protein.
[0188] The gene sequence from the cDNA library introduced into the
microorganism which stimulates expression of the reporter gene is
then identifed.
[0189] According to the above method, the target DNA regulatory
sequence preferably includes the subsequence CCG and more
preferably includes the subsequence CCGAC.
[0190] The "one-hybrid" strategy described in Li, J. J. and I.
Herskowitz, Science 262:1870-1874 (1993) and used in Example 1 to
screen Arabidopsis cDNA is an example of this method. This method
can be used to screen any plant species for cDNAs that encode a
target regulatory sequence, such as a C-repeat/DRE regulatory
sequence. According to the "one hybrid" strategy, yeast strains are
constructed that contain a lacZ reporter gene with either wild-type
or mutant versions of target regulatory sequences in place of the
normal UAS (upstream activator sequence) of the GALL promoter.
Yeast strains carrying these reporter constructs produce low levels
of .beta.beta-galactosidase and form white colonies on filters
containing X-gal. Reporter strains carrying wild-type target
regulatory sequences are transformed with a cDNA expression library
that contains random cDNA inserts fused to the acidic activator
domain of the yeast GAL4 transcription factor "GAL4-ACT".
Recombinant plasmids in the expression library that contain a cDNA
insert encoding a C-repeat/DRE binding domain fused to GAL4-ACT
will express fusion proteins which bind upstream of the lacZ
reporter genes carrying the wild-type target regulatory sequence,
activate transcription of the lacZ gene, and result in yeast
forming blue colonies on X-gal-treated filters. Alternatively, the
sequence from the cDNA library introduced into the microorganism
may, as was observed in Example 1, include a sequence encoding an
activator domain and thus not utilize the acidic activator domain
of the yeast GAL4 transcription factor "GAL4-ACT".
[0191] Recombinant plasmids from such "blue yeast" are then
isolated and transformed back into reporter strains that contain
either a wild-type or mutant version of target regulatory sequence
fused to the lacZ gene. The plasmids that are desired are those
that turn the former strains blue, but not the later, indicating
that the cloned DNA binding domain is specific for the target
regulatory sequence.
[0192] Based on presence of an AP2 binding domain in CBF1, CBF2 and
CBF3, Applicants believe that an AP2 binding domain is present in a
significant number of the environmental stress tolerance regulatory
binding proteins. Accordingly, it is believed that the specificity
of the above method for screening for gene sequences encoding a
regulatory binding protein can optionally be improved by first
selecting cDNA from a plant genome library which includes a
potential AP2 domain site. This can be routinely done by selecting
probes for selecting sequences in the library which include
potential AP2 domain sequences.
[0193] 4. Screening for Expression Of Environmental Stress
Tolerance Regulatory Protein
[0194] Once one or more microorganisms are selected which are
believed to express a protein capable of binding to the target
regulatory element and activate expression of the reporter gene,
further analysis can be performed to identify and isolate full
length cDNAs; i.e. cDNAs that encode the entire protein that binds
to the target regulatory sequence. The coding sequence for the
protein can then cloned into an expression vector, such as the pET
bacterial expression vectors (Novagen), and used to produce the
protein at high levels. The protein can then be analyzed by gel
retardation experiments (See Example 1F) to confirm that it binds
specifically to the target regulatory sequence.
[0195] Potential sequences can be further screened using known
regulatory gene sequences, such as CBF1, CB2, and CBF3, or the
presence of an AP2 domain which is believed to be common to a
significant class of this genes. Once identified, particular
sequences can be transformed into yeast to test for activation of
expression of a reporter gene, for example as described in Example
1E.
[0196] 5. Screening for Binding to Target Regulatory Sequence
[0197] Once a regulatory gene sequence is identified, the sequence
can be introduced into a microorganism in order to express the
protein encoded by the sequence. A gel shift assay, such as the one
described in Example 1F, can then be used to test for in vitro
binding of the expressed protein to the target DNA regulatory
sequence.
[0198] Mutagenesis of the target DNA regulatory sequence can also
be performed in order to evaluate the binding selectivity of the
expressed protein. It is preferred that the expressed protein
selectively bind to the target DNA regulatory sequence over related
sequences with one or more base differences from the target DNA
regulatory sequence. For example, FIG. 5 is a photograph of a gel
from a shift assay in which CBF1 was shown to selectively bind to
the wild-type C-repeat/DRE CCGAC.
[0199] 6. Altering the Environmental Stress Tolerance of a
Plant.
[0200] The present invention also provides a method for recombinant
engineered plants with a new or altered response to one or more
environmental stresses.
[0201] According to one embodiment, a copy of a gene native to a
plant which encodes a binding protein according to the present
invention is recombinantly introduced into the plant such that the
plant expresses a recombinant binding protein encoded by the
recombinant copy of the gene.
[0202] According to another embodiment, a non-native gene which
encodes a binding protein according to the present invention is
recombinantly introduced into a plant such that the plant expresses
a recombinant binding protein encoded by the recombinant non-native
gene.
[0203] According to yet another embodiment, a native or non-native
DNA regulatory sequence is recombinantly introduced into a plant
such that the recombinant DNA regulatory sequence regulates the
expression of one or more environmental stress tolerance genes in
the plant. The plant includes a gene which encodes a binding
protein capable of binding to the recombinant DNA regulatory
sequence.
[0204] In yet another embodiment, a native or non-native promoter
is recombinantly introduced into a plant such that the recombinant
promoter regulates the expression of a binding protein which binds
to a DNA regulatory sequence.
[0205] According to each of the above embodiments, unless otherwise
specified, the gene encoding the binding protein, the promoter
promoting the expression of the binding protein, the DNA regulatory
sequence, and the environmental stress tolerance genes may be
non-recombinant or recombinant sequences. The recombinant sequences
may be native to the plant or may be non-native to the plant. All
the above permutations are intended to fall within the scope of the
present invention.
[0206] As an example, many plants increase in freezing tolerance in
response to low non-freezing temperatures, a process known as cold
acclimation. A large number of biochemical changes occur during
cold acclimation including the activation of COR (COld Regulated)
genes. These genes, which are also expressed in response to
dehydration (e.g., drought and high salinity), are thought to help
protect plant cells against the potentially deleterious effects of
dehydration associated with freezing, drought and high salinity
stress. Indeed, expression of the COR15a gene in plants grown at
normal temperatures (22.degree. C.) enhances the freezing tolerance
of chloroplasts.
[0207] By manipulating the expression of COR genes, the stress
tolerance of crop and horticultural plants could be improved, e.g.,
engineer broader climate ranges; target stress resistance to
stress-sensitive parts of plants; render plants stress-resistant
when a stress condition (frost and drought) is imminent. To bring
about these effects, however, the expression of the COR genes must
be manipulated. The gene, CBF1, that encodes the transcription
factor that binds to the C-repeat/DRE regulatory element present in
the promoters of all COR genes described to date has been isolated.
CBF1 in yeast activates expression of reporter genes that have been
fused to the C-repeat/DRE element. Further, expression of CBF1 in
plants has been shown to activate the expression of COR genes.
[0208] By introducing modified versions of sequences encoding
regulatory binding proteins, such as CBF1, into plants, the
expression of COR genes can be modified, and thereby enhance the
freezing and dehydration tolerance of plants.
[0209] In each of the above embodiments, expression of the
recombinant copy of the regulatory gene may be under the control of
a promoter. The promoter may be recombinant or non-recombinant. In
the case of recombinant promoters, the promoter may be native or
non-native to the plant.
[0210] When a recombinant promoter is used, the promoter can be
selected to cause expression of the binding protein in a manner
which is different than how the binding protein is expressed by the
plant in its native state. For example, the promoter may increase
the level at which the binding protein is expressed, express the
binding protein without being induced by an environmental stress
and/or express the binding protein in response to a different form
or degree of environmental stress than would otherwise be needed to
induce expression of the binding protein. The promoter may also be
inducible by an exogenous agent. For example, a strong constitutive
promoter could be used to cause increased levels of COR gene
expression in both non-stress and stressed plants which in turn,
results in enhanced freezing and dehydration tolerance. A tissue
specific promoter could be used to alter COR gene expression in
tissues that are highly sensitive to stress (and thereby enhance
the stress tolerance of these tissues). Examples of such strong
constitutive promoters include but are not limited to the nopaline
synthase (NOS) and octopine synthase (OCS) promoters, the
cauliflower mosaic virus (CaMV) 19S and 35S (Odell et al., Nature
313: 810-812 (1985)) promoters or the enhanced CaMV 35S promoters
(Kay et al., Science 236: 1299-1302 (1987)).
[0211] A tissue-specific promoter could also be used to alter COR
gene expression in tissues that are highly sensitive to stress,
thereby enhancing the stress tolerance of these tissues. Examples
tissue-specific promoters include, but are not limited to,
seed-specific promoters for the B. napus napin gene (U.S. Pat. No.
5,420,034), the soybean 7S promoter, the Arabidopsis 12S globulin
(cruiferin) promoter (Pang, et al. Plant Molecular Biology 11:
805-820 (1988)), the maize 27 kd zein promoter, the rice glutelin 1
promoter and the phytohemaglutinin gene, fruit active promoters
such as the E8 promoter from tomatoes, tuber-specific promoters
such as the patatin promoter, and the promoter for the small
subunit of ribuloe-1,5-bis-phosphate carboxylase (ssRUBISCO) whose
expression is activated in photosynthetic tissues such as
leaves.
[0212] Alternatively, an inducible promoter may be used to control
the expression of the regulatory binding protein, such as CBF1, in
plants. Because, in some cases, constitutive expression of higher
levels of CBF proteins may have some detrimental effects on plant
growth and development, the controlled expression of CBF genes is
especially advantageous. For example, a promoter could be used to
induce the expression of CBF proteins only at a proper time, such
as prior to a frost that may occur earlier or later in the growing
season of a plant, thereby prolonging the growing season of a crop
and increasing the productivity of the land. This may be
accomplished by applying an exogenous inducer by a grower whenever
desired. Alternatively, a promoter could be used which turns on at
a temperature that is warmer than the temperature at which the
plant normally exhibits cold tolerance. This would enable the cold
tolerance thermostat of a plant to be altered. Similarly, a
promoter can be used which turns on at a dehydration condition that
is wetter than the dehydration condition at which the plant
normally exhibits dehydration tolerance. This would enable the
level at which a plant responds to dehydration to be altered.
[0213] Promoters which are known or are found to cause inducible
transcription of the DNA into mRNA in plant cells can be used in
the present invention. Such promoters may be obtained from a
variety of sources such as plant and inducible microbial sources,
and may be activated by a variety of exogenous stimuli, such as
cold, heat, dehydration, pathogenesis and chemical treatment. The
particular promoter selected is preferably capable of causing
sufficient expression of the regulatory binding protein, such as
CBF1, to enhance plant tolerance to environmental stresses.
Examples of promoters which may be used include, but are not
limited to, the promoter for the DRE (C-repeat) binding protein
gene dreb2a (Liu, et al. Plant Cell 10: 1391-1406 (1998)) that is
activated by dehydration and high-salt stress, the promoter for
delta 1-pyrroline-5-carboxylate synthetase (P5CS) whose expression
is induced by dehydration, high salt and treatment with plant
hormone abscisic acid (ABA) (Yoshiba, et al., Plant J. 7 751-760
(1987)), the promoters for the rd22 gene from Arabidopsis whose
transcription is induced under by salt stress, water deficit and
endogenous ABA (Yamaguchi-Shinozaki and Shinozaki, Mol Gen Genet
238 17-25 (1993)), the promoter for the rd29b gene
(Yamaguchi-Shinizaki and Shinozaki, Plant Physiol., 101 1119-1120
(1993)) whose expression is induced by desiccation, salt stress and
exogenous ABA treatment (Ishitani et al., Plant Cell 10 1151-1161
(1998)), the promoter for the rab18 gene from Arabidopsis whose
transcripts accumulate in plants exposed to water deficit or
exogenous ABA treatment, and the promoter for the
pathogenesis-related protein 1a (PR-1a) gene whose expression is
induced by pathogenesis organisms or by chemicals such as salicylic
acid and polyacrylic acid.
[0214] It should be noted that the promoters described above may be
further modified to alter their expression characteristics. For
example, the drought/ABA inducible promoter for the rab18 gene may
be incorporated into seed-specific promoters such that the rab18
promoter is drought/ABA inducible only when developing seeds.
Similarly, any number of chimeric promoters can be created by
ligating a DNA fragment sufficient to confer environmental stress
inducibility from the promoters described above to constitute
promoters with other specificities such as tissue-specific
promoters, developmentally regulated promoters, light-regulated
promoters, hormone-responsive promoters, etc. This should result in
the creation of chimeric promoters capable of being used to cause
expression of the regulatory binding proteins in any plant tissue
or combination of plant tissues. Expression can also be made to
occur either at a specific time during a plant's life cycle or
throughout the plant's life cycle.
[0215] According to the present invention, an expression vector can
be constructed to express the regulatory binding protein in the
transformed plants to enhance their tolerance to environmental
stresses. In one embodiment, the DNA construct may contain (1) an
inducible promoter that activates expression of the regulatory
binding protein in response to environmental stimuli; (2) a
sequence encoding the regulatory binding protein; and (3) a 3'
non-translated region which enables 3' transcriptional termination
and polyadenylation of the mRNA transcript. The inducible promoter
may be any one of the natural or recombinant promoters described
above. The gene encoding the regulatory binding protein can be any
one disclosed in the present invention. The 3' region downstream
from this gene should be capable of providing a polyadenylation
signal and other regulatory sequences that may be required for the
proper expression and processing of a mRNA may be operably linked
to the 3'end of a structural gene to accomplish the invention. This
may include the native 3' end of the homologous gene form which the
regulatory binding protein and/or the inducible promoter is
derived, the 3' end from a heterologous gene encoding the same
protein from other species, the 3' end from viral genes such as the
3' end of the 35S or the 19S cauliflower mosaic virus transcripts,
the 3' end of the opine synthesis genes of Agrobacterium
tumefaciens, or the 3' end sequences from any source such that the
sequence employed provides the necessary regulatory information
within its nucleic acid sequence to result in the proper expression
of the promoter/coding region combination to which the 3' end
sequence is operably linked.
[0216] A variety of expression vectors can be used to transfer the
gene encoding the regulatory binding protein as well as the desired
promoter into the plant. Examples include but not limited to those
derived from a Ti plasmid of Agrobacterium tumefaciens, as well as
those disclosed by Herrera-Estrella, L., et al., Nature 303:
209(1983), Bevan, M., Nucl. Acids Res. 12: 8711-8721 (1984), Klee,
H. J., Bio/Technology 3: 637-642 (1985), and EPO Publication
120,516 (Schilperoort et al.) for dicotyledonous plants.
Alternatively, non-Ti vectors can be used to transfer the DNA
constructs of this invention into monotyledonous plants and plant
cells by using free DNA delivery techniques. Such methods may
involve, for example, the use of liposomes, electroporation,
microprojectile bombardment, silicon carbide wiskers, viruses and
pollen. By using these methods transgenic plants such as wheat,
rice (Christou, P., Bio/Technology 9: 957-962 (1991)) and corn
(Gordon-Kamm, W., Plant Cell 2: 603-618 (1990)) are produced. An
immature embryo can also be a good target tissue for monocots for
direct DNA delivery techniques by using the particle gun (Weeks, T.
et al., Plant Physiol. 102: 1077-1084 (1993); Vasil, V.,
Bio/Technology 10: 667-674 (1993); Wan, Y. and Lemeaux, P., Plant
Physiol. 104: 37-48 (1994), and for Agrobacterium-mediated DNA
transfer (Hiei et al., Plant J. 6: 271-282 (1994); Rashid et al.,
Plant Cell Rep. 15: 727-730 (1996); Dong, J., et al., Mol. Breeding
2: 267-276 (1996); Aldemita, R. and Hodges, T., Planta 199: 612-617
(1996); Ishida et al., Nature Biotech. 14: 745-750 (1996)).
[0217] In one embodiment, the plasmid vector pMEN020 is preferred,
which is derived from a Ti plasmid pMON10098 which is the type of
binary vector described in U.S. Pat. Nos. 5,773,701 and 5,773,696.
PMEN20 differs from pMON10098 by the substitution of a KpnI, SalI,
SacI, SacI, NotI, and XbaI restriction sites between the ECaMV 35S
promoter and the E9 3' region.
[0218] Plasmid pMON10098 contains the following DNA segments.
Starting at the bottom of the plasmid map is the origin of
bacterial replication for maintenance in E. coli (ori-322). Moving
in a counter-clockwise direction on the map, next is ori-V, which
is the vegetative origin of replication (Stalker et al. Mol. Gen.
Genet. 181:8-12 (1981)). Next is the left border of the T-DNA. Next
is the chimeric gene used as the selectable marker. The chimera
includes the 0.35 kilobase (kb) of the cauliflower mosaic virus 35S
promoter (P-35S) (Odell et al. (1985) Nature 313:810-812). , a 0.84
kb neomycin phosphotransferase type 11 gene (KAN) and a 0.25 kb 3'
non-translated region of the nopaline synthase gene (NOS 3')
(Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:1803-1807). The
next sequence contains the enhanced CaMV 35S promoter and E9 3'
region gene cassette and restriction sites for inserting genes such
as the coding region of CBF genes. This chimeric gene cassette ends
with the 0.65 kb of the E9 3' region from the pea small subunit of
RUBISCO gene (U.S. Pat. No. 5,773,701). Next is the right border of
the T-DNA. Next is the 0.93 kb fragment isolated from transposon
Tn7 that encodes the bacterial spectinomycin/streptomycin
resistance (Spc/Str), which is a determinant for selection in E.
coli and Agrobacterium tumefaciens (Fling et al., Nucl. Acids Res.
13:7095-7106 (1985)).
[0219] The pMEN020 plasmid construct is a binary cloning vector
that contains both E. coli and Agrobacterium tumefaciens origins of
DNA replication but no vir genes encoding proteins essential for
the transfer and integration of the target gene inserted in the
T-DNA region. PMEN020 requires the trfA gene product to replicate
in Agrobacterium. The strain of Agrobacterium containing this trfA
gene is called the ABI strain and is described below and in U.S.
Pat. Nos. 5,773,701 and 5,773,696. This cloning vector serves as an
E. coli-Agrobacterium tumefaciens shuttle vector. All of the
cloning steps are carried out in E. coli before the vector is
introduced into ABI strain of Agribacterium tumefaciens.
[0220] The recipient ABI strain of Agribacterium carries a modified
defective Ti plasmid that serves as a helper plasmid containing a
complete set of vir genes but lacks portions or all of the T-DNA
region. ABI is the A208 Agrobacterium tumefaciens strain carrying
the disarmed pTiC58 plasmid pMP9ORK (Koncz et al. Mol. Gen. Genet.
204:383-396 (1986)). The disarmed Ti plasmid provides the trfA gene
functions that are required for autonomous replication of the
binary vectors after transfer into the ABI strain. When plant
tissue is incubated with the ABI:binary vector strains, the vectors
are transferred to the plant cells by the vir functions encoded by
the disarmed pMP9ORK Ti plasmid. After the introduction of the
binary vector into the recipient Agribacterium, the vir gene
products mobilize the T-DNA region of the pMEN020 plasmid to insert
the target gene, e.g. the gene encoding the regulatory binding
protein, into the plant chromosomal DNA, thus transforming the
cell.
[0221] After transformation of cells or protoplasts, the choice of
methods for regenerating fertile plants is not particularly
important. Suitable protocols are available for Leguminosae
(alfalfa, soybean, clover, etc.), Umbelliferae (Carrot, celery,
parsnip), Cruciferae (cabbage, radish, rapeseed, broccoli, etc.),
Curcurbitaceae (melons and cucumber), Gramineae (wheat, corn, rice,
barley, millet, etc.), Solanaceae (potato, tomato, tobacco,
peppers, etc.), and various other crops See protocols described in
Ammirato et al. (1984) Handbook of Plant Cell Culture--Crop
Species. Macmillan Publ. Co. Shimamoto et al. Nature 338:274-276
(1989); Fromm et al., Bio/Technology 8:833-839 (1990); Vasil et al.
Bio/Technology 8:429-434 (1990).
[0222] It is envisioned that the present invention can be used to
introduce, change and/or augment the environmental stress tolerance
of a plant by introducing and causing the expression of
environmental stress tolerance in a manner which the plant does not
exhibit in its native form. For example, by using different
promoters in combination with recombinant regulatory genes, native
environmental stress tolerance genes can be expressed independent
of environmental stress, made responsive to different levels or
types of environmental stress, or rendered inducible independent of
an environmental stress. Further, selection of the promoter can
also be used to determine what tissues in the plant express the
binding protein as well as when the expression occurs in the
plant's lifecycle. By selecting a promoter which regulates in what
tissues and when in a plant's life the promoter functions to
regulate expression of the binding protein, in combination with the
selecting how that promoter regulates expression (level of
expression and/or type of environmental or chemical induction), an
incredible range of control over the environmental stress responses
of a plant can be achieved using the present invention.
[0223] By recombinantly introducing a native environmental stress
tolerance gene into a plant in combination with a recombinant
regulatory gene under the control of an inducible promoter, a plant
can be engineered which includes its native environmental stress
tolerance as well as inducible environmental stress tolerance. This
might be useful for inducing a cold stress tolerance reaction in
anticipation of a frost.
[0224] By recombinantly introducing a non-native environmental
stress tolerance gene into a plant in combination with a
recombinant regulatory gene, a plant can be engineered which
includes environmental stress tolerance properties that the plant
would not otherwise have. In this regard, plants from warmer
climates can be engineered to include one or more cold tolerance
genes along with a regulatory gene needed to cause expression of
the cold tolerance genes in the plant so that the engineered plant
can survive better in a colder climate. Similarly, a plant can be
engineered to include one or more dehydration tolerance genes along
with a regulatory gene needed to cause expression of the
dehydration tolerance gene so that the engineered plant can grow
better in a dryer climate. In this regard, it should be possible to
take a plant which grows well in a first climate and engineer it to
include stress tolerance genes and regulatory genes native to a
second climate so that the plant can grow well in the second
climate.
[0225] By modifying the promoter controlling the expression of the
gene encoding a binding protein which regulates the expression of
environmental stress tolerance genes, the operation of native,
non-recombinant environmental stress tolerance genes and regulatory
genes can be changed. For example, the conditions under which the
stress tolerance genes are expressed can be changed. Expression can
also be rendered inducible by an exogenous agent.
[0226] 7. Methods for Detecting Stress Tolerance Regulatory Gene
Homologs.
[0227] Once one DNA sequence encoding an environmental stress
tolerance regulatory binding protein has been identified, several
methods are available for using that sequence and knowledge about
the protein it encodes to identify homologs of that sequence from
the same plant or different plant species. For example, let us
assume that a cDNA encoding a first target binding domain has been
isolated from plant species "A." The DNA sequence encoding the
first target DNA regulatory sequence could be radiolabeled and used
to screen cDNA libraries of plant species "A," or any other plant
species, for DNA inserts that encode proteins related to the first
target DNA regulatory sequence. This could be done by screening
colony or phage "lifts" using either high (Tm of about -10.degree.
C.) or low (Tm of about -30.degree. C. or lower) stringency DNA
hybridization conditions (Sambrook, J. et al, Molecular Cloning. A
Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 2nd Ed. (1989)). cDNA inserts that hybridize with the
first target DNA regulatory sequence could be sequenced and
compared to the original first target DNA regulatory sequence. If
the insert is confirmed to encode a polypeptide similar to the
first target DNA regulatory sequence, the insert could be cloned
into an expression vector to produce the encoded protein. The
protein would then be analyzed by gel retardation experiments to
confirm that it binds specifically to the first target DNA
regulatory sequence.
[0228] It is recognized that not all proteins that bind to a first
target DNA regulatory sequence will be transcriptional activators.
However, a number of routine tests may be performed in order to
determine whether a particular protein is in fact a transcriptional
activator. One test involves expressing the protein in yeast
strains which contain the target DNA regulatory sequence fused to
the lacZ reporter gene, as described above. If the protein is a
transcriptional activator, it should activate expression of the
reporter gene and result in blue colonies.
[0229] Another test is a plant transient assay. In this case, a
reporter gene, such as GUS, carrying the target DNA regulatory
sequence as an upstream activator is introduced into plant cells
(e.g. by particle bombardment) with or without a the putative
transcriptional activator under control of a constitutive promoter.
If the protein is an activator, it will stimulate expression of the
reporter (this may be further enhanced if the plant material is
placed at low temperature or is subjected to water stress as the
C-repeat/DRE is responsive to low temperature and dehydration).
[0230] Significantly, once a target DNA regulatory sequence is
identified, the sequence can be fused to any potential activator or
repressor sequence to modify expression of plant genes that carry
the target regulatory sequence as a control element. That is, the
DNA regulatory sequence can be used to target "managed" expression
of the battery of environmental stress tolerance related genes in a
given plant species.
[0231] It is possible that the target DNA regulatory sequence of
the regulatory element that imparts environmental stress tolerance
related gene expression in plant species "A" might be slightly
different from the analogous target DNA regulatory element that
imparts environmental stress tolerance in species "B." Thus,
optimal regulation of the battery of environmental stress tolerance
related genes in a given species may require the use of the
regulatory binding proteins from that or a closely related plant
species. Knowledge of gene sequences which encode for proteins
which bind to the DNA regulatory sequence of the regulatory
element, in combination with knowledge of the DNA regulatory
sequence, greatly simplify the identification of sequences encoding
binding proteins native to the plant species.
[0232] With the advent of fast and efficient DNA sequencing
technologies, the number of plant genomes recorded on computer
databases is growing rapidly. These computer databases can be used
to search for homologs to CBF sequences identified in this
application as well as other sequences which encode binding
proteins which regulate cold tolerance genes. As more and more
binding protein sequences are identified and the number of
computerized plant genome databases increase, searching computer
databases for additional sequences encoding binding proteins which
regulate cold tolerance genes will become increasingly
simplified.
[0233] 8. Preparation of Binding Proteins Derivatives Using
Sequences Identified in this Application.
[0234] According to the present invention, the binding protein is a
protein which is capable of binding to a DNA regulatory sequence
which regulates expression of one or more environmental stress
tolerance genes in a plant. These DNA regulatory sequences are
preferably a member of the CCG family of regulatory sequences and
more preferably a member of the CCGAC family of regulatory
sequences.
[0235] Numerous amino acid sequences for CBF binding protein
homologs are disclosed in this application including those shown in
FIGS. 2B, 14, and 18B and listed in SEQ. I.D. Nos. 2, 13, 15, 39,
41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73,
75, 77, 79, 81, 83, 85, 87, 89, 91, 93, and 95. Nucleic acid
sequences encoding these CBF binding protein homologs are disclosed
in this application in FIGS. 2B, 12, 13, and 18A and listed in SEQ.
I.D. Nos. 1, 12, 14, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60,
62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, and
94. These sequences were derived from a variety of different plant
species including Arabidopsis, Brassica juncea, Brassica napus,
Brassica oleracea, Brassica rapa, Glycine max, Raphanus sativus and
Zea Maize.
[0236] The sequences identified in these figures may generally be
divided into three regions: AP2 domain, amino terminus domain, and
carboxy terminus domain. FIGS. 19A-19E show different AP2 domains
from these homologs and consensus sequences between the different
AP2 domains shown. FIG. 19A shows an amino acid alignment of the
AP2 domains of several CBF proteins with the consensus sequence
between the proteins highlighted as well as a comparison of the AP2
domains with that of the tobacco DNA binding protein EREBp2. FIG.
19B shows an amino acid alignment of the AP2 domains of several CBF
proteins including dreb2a and dreb2b with the consensus sequence
between the proteins highlighted. FIG. 19C shows an amino acid
alignment of the AP2 domains of several CBF proteins including
dreb2a, dreb2b, and tiny with the consensus sequence between the
proteins highlighted. FIG. 19D shows a consensus sequence
corresponding to the difference between the consensus sequence
shown in FIGS. 19A and tiny. FIG. 19E shows a consensus sequence
corresponding to the difference between the consensus sequence
shown in FIGS. 19B and tiny.
[0237] FIGS. 21A and 21B show different carboxy terminus domains
from these homologs and consensus sequences between the different
carboxy terminus domains shown.
[0238] The binding proteins utilized in the present invention
include classes of binding proteins which satisfy one or more of
the following requirements:
[0239] the binding protein comprises an AP2 domain which comprises
a consensus sequence sufficiently homologous to any one of the
consensus sequences shown in FIGS. 19A, 19B, or 19C that the
binding protein is capable of binding to a CCG regulatory sequence,
preferably a CCGAC regulatory sequence;
[0240] the binding protein comprises an AP2 domain which comprises
a consensus sequence shown in FIG. 19A, 19B or 19C;
[0241] the binding protein comprises an AP2 domain which comprises
the amino acid residues shown in FIG. 19D or 19E;
[0242] the binding protein comprises an AP2 domain which is
sufficiently homologous to at least one of the AP2 domains shown in
the application such that it is capable of binding to a CCG
regulatory sequence, preferably a CCGAC regulatory sequence;
[0243] the binding protein comprises one of the AP2 domain
sequences shown in this application, including, but not limited to
SEQ. I.D. Nos. 2, 13, 15, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57,
59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91,
93, and 95;
[0244] the binding protein comprises a sequence which comprises one
of the amino terminus domains shown in FIG. 20 (it is noted that
the sequence need not be at the amino terminus of the binding
protein);
[0245] the binding protein comprises the consensus sequence for the
amino terminus domains shown in FIG. 20, (it is noted that the
sequence need not be at the amino terminus of the binding
protein);
[0246] the binding protein comprises a sequence which comprises one
of the carboxy terminus domains shown in FIG. 21A (it is noted that
the sequence need not be at the carboxy terminus of the binding
protein);
[0247] the binding protein comprises the consensus sequence for the
carboxy terminus domains shown in FIG. 21A (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein); and
[0248] the binding protein comprises the consensus sequence for the
carboxy terminus domains shown in FIG. 21B (it is noted that the
sequence need not be at the carboxy terminus of the binding
protein).
[0249] The sequence of the binding protein may be a naturally
occurring sequence such as the ones shown in SEQ. ID. Nos. 2, 13,
15, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69,
71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, and 95 or may be a
non-naturally occurring sequence. It is noted, however, that
binding proteins according to the present invention are intended to
encompass non-naturally occurring sequences which are derivatives
of the classes of binding proteins taught herein.
[0250] Additional binding proteins may be constructed using one of
the AP2 domains taught herein or the consensus sequence of these
AP2 domains. It may be desirable to include with the AP2 domain a
transcription activation region. The transcription activation
region may be native to the plant or non-native to the plant in
which the binding protein will be used. For example, the sequence
may include a subsequence which encodes a binding domain for the
DNA regulatory sequence fused to a transcription activating region,
such as the transcription activating region of VP16 or GAL4.
Optionally, one can include in the binding protein one of the amino
terminus domains, the consensus sequence for the amino terminus
domain, one of the carboxy terminus domains and/or the consensus
sequence for the carboxy terminus domains. It is noted that the
amino terminus domain may be positioned away from the amino
terminus of the new binding protein and the carboxy terminus domain
may be positioned away from the carboxy terminus of the new binding
protein.
[0251] Optionally, the binding protein can be viewed as comprising
one of the amino terminus domains, the consensus sequence for the
amino terminus domain, one of the carboxy terminus domains and/or
the consensus sequence for the carboxy terminus domains. It is
noted that the amino terminus domain may be positioned away from
the amino terminus of the new binding protein and the carboxy
terminus domain may be positioned away from the carboxy terminus of
the new binding protein.
EXAMPLES
[0252] 1. Isolation and Analysis of Arabidopsis thaliana cDNA Clone
(CBF1) Encoding C-repeat/DRE Binding Factor
[0253] The following example describes the isolation of an
Arabidopsis thaliana cDNA clone that encodes a C-repeat/DRE binding
factor, CBF1 (C-repeat/DRE Binding Factor 1). Expression of CBF1 in
yeast was found to activate transcription of reporter genes
containing the C-repeat/DRE (CCGAC) as an upstream activator
sequence. Meanwhile, CBF1 did not activate transcription of mutant
versions of the CCGAC binding element, indicating that CBF1 is a
transcription factor that binds to the C-repeat/DRE. Binding of
CBF1 to the C-repeat/DRE was also demonstrated in gel shift assays
using recombinant CBF1 protein expressed in Escherichia coli.
Analysis of the deduced CBF1 amino acid sequence indicated that the
protein has a potential nuclear localization sequence, a possible
acidic activation domain and an AP2 domain, a DNA-binding motif of
about 60 amino acids that is similar to those present in
Arabidopsis proteins APETALA2, AINTEGUMENTA and TINY, the tobacco
ethylene response element binding proteins, and numerous other
plant proteins of unknown function.
[0254] A. Materials
[0255] Plant Material and Cold Treatment.
[0256] A thaliana (L.) Heyn. ecotype RLD plants were grown in pots
in controlled environment chambers at 22.degree. C. under constant
illumination with cool-white fluorescent lamps (100 .mu.mol
m.sup.-2s.sup.-1) essentially as described (Gilmour, S. J., Plant
Physiol. 87:745-750 (1988)). Plants were cold-treated by placing
pots in a cold room at 2.5.degree. C. under constant illumination
with cool-white florescent lamps (25 .mu.mol m.sup.-2s.sup.-1) for
the indicated times.
[0257] Arabidopsis cDNA Expression Library.
[0258] The Arabidopsis pACT cDNA expression library was constructed
by John Walker and colleagues (NSF/DOE/USDA Collaborative Research
in Plant Biology Program grant USDA 92-37105-7675) and deposited in
the Arabidopsis Biological Resource Center (stock #CD4-10).
[0259] Yeast Reporter Strains.
[0260] Oligonucleotides (Table 1) (synthesized at the MSU
Macromolecular Structure Facility) encoding either wild-type or
mutant versions of the C-repeat/DRE were ligated into the BglII
site of the lacZ reporter vector pBgl-lacZ (Li, J. J. and I.
Herskowitz, Science 262:1870-1874 (1993); kindly provided by
Joachim Li). The resulting reported constructs were integrated into
the ura3 locus of Saccharomyces cerevisiae strain GGY1 (MAT gal4
gal80 ura3 leu2 his3 ade2 tyr) (Li, J. J. and I. Herskowitz,
Science 262:1870-1874 (1993); provided by Joachim Li) by
transformation and selection for uracil prototrophy.
[0261] E. coli Strains.
[0262] Escherichia coli strain GM2163 containing plasmid pEJS251
was deposited under the Budapest Treaty on May 17, 1996 with the
American Type Culture Collection, Rockville, Md. as ATCC 98063. It
is available by name and number pursuant to the provisions of the
Budapest Treaty.
1TABLE I Oligonucleotides encoding wild type and mutant versions of
the C-repeat/DRE Oligonucleotide C-repeat/DRE* Sequence SEQ ID NO:
MT50 COR15a GatcATTTCATGGCCGACCTGCTTTTT 3 MT52 M1COR15a
CACAATTTCAaGaattcaCTGCTTTTTT 4 MT80 M2COR15a
GatcATTTCATGGtatgtCTGCTTTTT 5 MT125 M3COR15a
GatcATTTCATGGaatcaCTGCTTTTT 6 MT68 COR15b
GatcACTTGATGGCCGACCTCTTTTTT 7 MT66 COR78-1
GatcAATATACTACCGACATGAGTTCT 8 MT86 COR78-2
ACTACCGACATGAGTTCCAAAAAGC 9 *The C-repeat/DRE sequences tested are
either wild-type found in the promoters of COR15a (Baker, S. S., et
al., Plant. mol. Biol. 24: 701-713 (1994)), COR15b or COR78/RD29A
(Horvath, D. P., et al., Plant Physiol. 103: 1047-1053 (1993);
Yamaguchi-shinozaki, K., et al., The Plant Cell 6: 251-264 (1994))
or are mutant versions of the COR15a C-repeat/DRE (M1 COR15a,
M2COR15a and M3COR15a). #Uppercase letters designate bases in wild
type C-repeat/DRE sequences. The core CCGAC sequence common to the
above sequences is indicated in bold type. Lowercase letters at the
beginning of a sequence indicate bases added to facilitate cloning.
The lowercase letters that are underlined indicated the mutations
in the C-repeat/DRE sequence of COR15a.
[0263] #Uppercase letters designate bases in wild type C-repeat/DRE
sequences. The core CCGAC sequence common to the above sequences is
indicated in bold type. Lowercase letters at the beginning of a
sequence indicate bases added to facilitate cloning. The lowercase
letters that are underlined indicate the mutations in the
C-repeat/DRE sequence of COR15a.
[0264] B. Methods
[0265] Screen of Arabidopsis cDNA Library.
[0266] The Arabidopsis pACT cDNA expression library was screened
for clones encoding C-repeat/DRE environmental stress response
regulatory elements by the following method. The cDNA library,
harbored in Escherichia coli BNN132, was amplified by inoculating
0.5 ml of the provided glycerol stock into 1 L of M9 minimal
glucose medium (Sambrook, J. et al, Molecular Cloning. A Laboratory
Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., 2nd Ed. (1989)) and shaking the bacteria for 20 h at
37.degree. C. Plasmid DNA was isolated and purified by cesium
chloride density gradient centrifugation (Sambrook et al (1989))
and transformed into the yeast GGY1 reporter strains selecting for
leucine prototrophy. Yeast transformants that had been grown for 2
or 3 days at 30.degree. C. were overlaid with either a
nitrocellulose membrane filter (Schleicher and Schuell, Keene,
N.H.) or Whatman #50 filter paper (Hillsboro, Oreg.) and incubated
overnight at 30.degree. C. The yeast impregnated filters were then
lifted from the plate and treated with X-gal
(5-bromo-4-chloro-3-indolyl-D-galactosidase) to assay colonies for
beta-galactosidase activity (Li, J. J. and I. Herskowitz, Science
262:1870-1874 (1993)). Plasmid DNA from "positive" transformants
(those forming blue colonies on the X-gal-treated filters) was
recovered (Strathern, J. N., and D. R. Higgens, Methods Enzymol.
194:319-329 (1991)), propagated in E. coli DH5.alpha. and
transformed back into the yeast reporter strains to confirm
activity.
[0267] Yeast Transformation and Quantitative Beta-Galactosidase
Assays.
[0268] Yeast were transformed by either electroporation (Becker, D.
M., et al., Methods Enzymol. 194:182-187 (1991)) or the lithium
acetate/carrier DNA method (Schiestl, R. H., et al., Current
Genetics 16:339-346 (1989)). Quantitative in vitro
beta-galactosidase assays were done as described (Rose, M., et al.,
Methods Enzymol. 101:167-180 (1983)).
[0269] Expression of CBF1 Protein in E. coli and Yeast.
[0270] CBF1 was expressed in E. coli using the pET-28a(+) vector
(Novagen, Madison, Wis.). The BglII-BclI restriction fragment of
pACT-11 encoding CBF1 was ligated into the BamHI site of the vector
bringing CBF1 under control of the T7 phage promoter. The construct
resulted in a "histidine tag," a thrombin recognition sequence and
a "T7 epitope tag" being fused to the amino terminus of CBF1. The
construct was transformed into E. coli BL21 (DE3) and the
recombinant CBF1 protein was expressed as recommended by the
supplier (Novagen). Expression of CBF1 in yeast was accomplished by
ligating restriction fragments encoding CBF1 (the BclI-BglII and
BglII-BglII fragments from pACT-11) into the BglII site of pDB20.1
(Berger, S. L., et al., Cell 70:251-265 (1992); kindly provided by
Steve Triezenberg) bringing CBF1 under control of the constitutive
ADC1 (alcohol dehydrogenase constitutive 1) promoter.
[0271] Gel Shift Assays.
[0272] The presence of expressed protein which binds to a
C-repeat/DRE binding domain was evaluated using the following gel
shift assay. Total soluble E. coli protein (40 ng) was incubated at
room temperature in 10 .mu.l of 1.times. binding buffer [15 mM
HEPES (pH 7.9), 1 mM EDTA, 30 mM KCl, 5% glycerol, 5% BSA, 1 mM
DTT) plus 50 ng poly(dl-dC):poly(dl-dC) (Pharmacia, Piscataway,
N.J.) with or without 100 ng competitor DNA. After 10 min, probe
DNA (1 ng) that was .sup.32P-labeled by end-filling (Sambrook et
al, 1989) was added and the mixture incubated for an additional 10
min. Samples were loaded onto polyacrylamide gels (4% w/v) and
fractionated by electrophoresis at 150V for 2h (Sambrook et al).
Probes and competitor DNAs were prepared from oligonucleotide
inserts ligated into the BamHI site of pUC118 (Vieira, J., et al.,
Methods Enzymol. 153:3-11 (1987)). Orientation and concatenation
number of the inserts were determined by dideoxy DNA sequence
analysis (Sambrook, et al, (1989)). Inserts were recovered after
restriction digestion with EcoRI and HindIII and fractionation on
polyacrylamide gels (12% w/v) (Sambrook et al, 1989).
[0273] Northern and Southern Analysis.
[0274] Northern and southern analysis was performed as follows.
Total RNA was isolated from Arabidopsis (Gilmour, S. J., et al.,
Plant Physiol. 87:745-750 (1988)) and the poly(A) fraction purified
using oligo dT cellulose (Sambrook, et al (1989)). Northern
transfers were prepared and hybridized as described (Hajela, R. K.,
et al., Plant Physiol. 93:1246-1252 (1990)) except that high
stringency wash conditions were at 50 C in 0.1.times. SSPE [.times.
SSPE is 3.6 M NaCl, 20 mM EDTA, 0.2 M Na.sub.2--HPO.sub.4 (pH7.7)],
0.5% SDS. Membranes were stripped in 0.1.times. SSPE, 0.5% SDS at
95.degree. C. for 15 min prior to re-probing. Total Arabidopsis
genomic DNA was isolated (Stockinger, E. J., et al., J. Heredity,
87:214-218 (1996)) and southern transfers prepared (Sambrook et al
1989) using nylon membranes (MSI, Westborough, Mass.). High
stringency hybridization and wash conditions were as described by
Walling et al (Walling, L. L., et al., Nucleic Acids Res.
16:10477-10492 (1988)). Low stringency hybridization was in
6.times. SSPE, 0.5% SDS, 0.25% low fat dried milk at 60.degree. C.
Low stringency washes were in 1.times. SSPE, 0.5% SDS at 50.degree.
C. Probes used for the entire CBF1 coding sequence and 3' end of
CBF1 were the BclI/BglII and EcoRV/BglII restriction fragments from
pACT-11, respectively, that had been gel purified (Sambrook et al
(1989)). DNA probes were radiolabeled with .sup.32P-nucleotides by
random priming (Sambrook). Autoradiography was performed using
hyperfilm-MP (Amersham, Arlington Heights, Ill.). Radioactivity was
quantified using a Betascope 603 blot analyzer (Betagen Corp.,
Waltham, Mass.).
[0275] C. Screen of Arabidopsis cDNA library for Sequence Encoding
a C-repeat/DRE Binding Domain.
[0276] The "one-hybrid" strategy (Li, J. J. and 1. Herskowitz,
Science 262:1870-1874 (1993)) was used to screen for Arabidopsis
cDNA clones encoding a C-repeat/DRE binding domain. In brief, yeast
strains were constructed that contained a lacZ reporter gene with
either wild-type or mutant C-repeat/DRE sequences in place of the
normal UAS (upstream activator sequence) of the GALL promoter.
[0277] FIGS. 1A and 1B show how the yeast reporter strains were
constructed. FIG. 1A is a schematic diagram showing the screening
strategy. Yeast reporter strains were constructed that carried
C-repeat/DRE sequences as UAS elements fused upstream of a lacZ
reporter gene with a minimal GAL1 promoter. The strains were
transformed with an Arabidopsis expression library that contained
random cDNA inserts fused to the GAL4 activation domain (GAL4-ACT)
and screened for blue colony formation on X-gal-treated filters.
FIG. 1B is a chart showing activity of the "positive" cDNA clones
in yeast reporter strains. The oligonucleotides (oligos) used to
make the UAS elements, and their number and direction of insertion,
are indicated by the arrows.
[0278] Yeast strains carrying these reporter constructs produced
low levels of beta-galactosidase and formed white colonies on
filters containing X-gal. The reporter strains carrying the
wild-type C-repeat/DRE sequences were transformed with a DNA
expression library that contained random Arabidopsis cDNA inserts
fused to the acidic activator domain of the yeast GAL4
transcription factor, "GAL4-ACT" (FIG. 1A). The notion was that
some of the clones might contain a cDNA insert encoding a
C-repeat/DRE binding domain fused to GLA4-ACT and that such a
hybrid protein could potentially bind upstream of the lacZ reporter
genes carrying the wild type C-repeat/DRE sequence, activate
transcription of the lacZ gene and result in yeast forming blue
colonies on X-gal-treated filters.
[0279] Upon screening about 2.times.10.sup.6 yeast transformants,
three "positive" cDNA clones were isolated; i.e., clones that
caused yeast strains carrying lacZ reporters fused to wild-type
C-repeat/DRE inserts to form blue colonies on X-gal-treated filters
(FIG. 1B). The three cDNA clones did not cause a yeast strain
carrying a mutant C-repeat/DRE fused to LacZ to turn blue (FIG.
1B). Thus, activation of the reporter genes by the cDNA clones
appeared to be dependent on the C-repeat/DRE sequence. Restriction
enzyme analysis and DNA sequencing indicated that the three cDNA
clones had an identical 1.8 kb insert (FIG. 2A). One of the clones,
designated pACT-11, was chosen for further study.
[0280] D. Identification of 24 kDa Polypeptide With an AP2 Domain
Encoded by pACT-11.
[0281] FIGS. 2A, 2B, 2C and 2D provide an analysis of the pACT-11
cDNA clone. FIG. 2A is a schematic drawing of the pACT-11 cDNA
insert indicating the location and 5' to 3' orientation of the 24
kDa polypeptide and 25s rRNA sequences. The cDNA insert was cloned
into the Xhol site of the pACT vector. FIG. 2B is a DNA and amino
acid sequence of the 24 kDa polypeptide (SEQ ID NO:1 and SEQ ID
NO:2). The AP2 domain is indicated by a double underline. The basic
amino acids that potentially act as a nuclear localization signal
are indicated with asterisks. The BclI site immediately upstream of
the 24 kDa polypeptide used in subcloning the 24 kDa polypeptide
and the EcoRV site used in subcloning the 3' end of CBF1 are
indicated by single underlines. FIG. 2C is a schematic drawing
indicating the relative positions of the potential nuclear
localization signal (NLS), the AP2 domain and the acidic region of
the 24 kDa polypeptide. Numbers indicate amino acid residues. FIG.
2D is a chart showing comparison of the AP2 domain of the 24 kDa
polypeptide with that of the tobacco DNA binding protein EREBP2
(Okme-Takagi, M., et al., The Plant Cell 7:173-182 (1995) SEQ ID
NOS: 10 and 11). Identical amino acids are indicated with single
lines; similar amino acids are indicated by double dots; amino
acids that are invariant in AP2 domains are indicated with
asterisks (Klucher, K. M., et al., The Plant Cell 8:137-153
(1996)); and the histidine residues present in CBF1 and TINY
(Wilson, K., et al., The Plant Cell 8:659-671 (1996)) that are
tyrosine residues in all other described AP2 domains are indicated
with a caret. A single amino acid gap in the CBF1 sequence is
indicated by a single dot.
[0282] Our expectation was that the cDNA insert in pACT-11 would
have a C-repeat/DRE binding domain fused to the yeast GAL4-ACT
sequence. However, DNA sequence analysis indicated that an open
reading frame of only nine amino acids had been added to the
C-terminus of GAL4-ACT. It seemed highly unlikely that such a short
amino acid sequence could comprise a DNA binding domain. Also
surprising was the fact that about half of the cDNA insert in
pACT-11 corresponded to 25s rRNA sequences (FIG. 2A). Further
analysis, however, indicated that the insert had an open reading
frame, in opposite orientation to the GAL4-ACT sequence, deduced to
encode a 24 kDa polypeptide (FIGS. 2A-C). The polypeptide has a
basic region that could potentially serve as a nuclear localization
signal (Raikhel, N., Plant Physiol. 100:1627-1632 (1992)) and an
acidic C-terminal half (pl of 3.6) that could potentially act as an
acidic transcription activator domain (Hahn, S., Cell 72:481-483
(1993)). A search of the nucleic acid and protein sequence
databases indicated that there was no previously described homology
of the 24 kDa polypeptide. However, the polypeptide did have an AP2
domain (Jofuku, K. D., et al., The Plant Cell 6:1211-1225 (1994))
(FIGS. 2B, D), a DNA binding motif of about 60 amino acids
(Ohme-Takagi, M., et al., The Plant Cell 7:173-182 (1994)) that is
present in numerous plant proteins including the APETALA2 (Jofuku,
K. D., et al., The Plant Cell 6:1211-1225 (1994)), AINTEGUMENTA
(Klucher, K. M., et al., The Plant Cell 8:137-153 (1996); Elliot,
R. C., et al., The Plant Cell 8:155-168 (1996)) and TINY (Wilson,
K., et al., The Plant Cell 8:659-671 (1996)) proteins of
Arabidopsis and the EREBPs (ethylene response element binding
proteins) of tobacco (Ohme-Takagi, M., et al., The Plant Cell
7:173-182 (1995)).
[0283] E. 24 kDa Polypeptide Binds to the C-repeat/DRE and
Activates Transcription in Yeast.
[0284] We hypothesized that the 24 kDa polypeptide was responsible
for activating the lacZ reporter genes in yeast. To test this, the
BclI-BglII fragment of pACT-11 containing the 24 kDa polypeptide,
and the BglII-BglII fragment containing the 24 kDa polypeptide plus
a small portion of the 25s rRNA sequence, was inserted into the
yeast expression vector pDB20.1 FIG. 3 is a chart showing
activation of reporter genes by the 24 kDa polypeptide. Restriction
fragments of pACT-11 carrying the 24 kDa polypeptide (BclI-BglII)
or the 24 kDa polypeptide plus a small amount of 25s RNA sequence
(BglII-BglII) were inserted in both orientations into the yeast
expression vector pDB20.1 (see FIGS. 2A and 2B for location of BclI
and BglII restriction sites). These "expression constructs" were
transformed into yeast strains carrying the lacZ reporter gene
fused to direct repeat dimers of either the wild-type COR15a
C-repeat/DRE (oligonucleotide MT50) or the mutant M2COR15a
C-repeat/DRE (oligonucleotide MT80). The specific activity of
beta-galactosidase (nmoles o-nitrophenol produced/min.times.mg
protein.sup.-1) was determined from cultures grown in triplicate.
Standard deviations are indicated. Abbreviations: pADC1, ADC1
promoter; tADC1, ADC1 terminator.
[0285] Plasmids containing either insert in the same orientation as
the ADC1 promoter stimulated synthesis of beta-galactosidase when
transformed into yeast strains carrying the lacZ reporter gene
fused to a wild-type COR15a C-repeat/DRE (FIG. 3). The plasmids did
not, however, stimulate synthesis of beta-galactosidase when
transformed into yeast strains carrying lacZ fused to a mutant
version of the COR15a C-repeat/DRE (FIG. 3). These data indicated
that the 24 kDa polypeptide could bind to the wild-type
C-repeat/DRE and activate expression for the lacZ reporter gene in
yeast. Additional experiments indicated that the 24 kDa polypeptide
could activate expression of the lacZ reporter gene fused to either
a wild-type COR78 C-repeat/DRE (dimer of MT66) or a wild-type
COR15b C-repeat/DRE (dimer of MT 68) (not shown). A plasmid
containing the BclI-BglII fragment (which encodes only the 24 kDa
polypeptide) cloned in opposite orientation to the ADC1 promoter
did not stimulate synthesis of beta-galactosidase in reporter
strains carrying the wild-type COR15a C-repeat/DRE fused to lacZ
(FIG. 3). In contrast, a plasmid carrying the BglII-BglII fragment
(containing the 24 kDa polypeptide plus some 25s rRNA sequences)
cloned in opposite orientation to the ADC1 promoter produced
significant levels of beta-galactosidase in reporter strains
carrying the wild-type COR15a C-repeat/DRE (FIG. 3). Thus, a
sequence located closely upstream of the 24 kDa polypeptide was
able to serve as a cryptic promoter in yeast, a result that offered
an explanation for how the 24 kDa polypeptide was expressed in the
original pACT-11 clone.
[0286] F. Gel Shift Analysis Indicates that the 24 kDa Polypeptide
Binds to the C-repeat/DRE.
[0287] Gel shift experiments were conducted to demonstrate further
that the 24 kDa polypeptide bound to the C-repeat/DRE.
Specifically, the open reading frame for the 24 kDa polypeptide was
inserted into the pET-28a(+) bacterial expression vector (see
Materials and Methods) and the resulting 28 kDa fusion protein was
expressed at high levels in E. coli. (FIG. 4).
[0288] FIG. 4 is a photograph of an electrophoresis gel showing
expression of the recombinant 24 kDa polypeptide in E. coli. Shown
are the results of SDS-PAGE analysis of protein extracts prepared
from E. coli harboring either the expression vector alone (vector)
or the vector plus an insert encoding the 24 kDa polypeptide in
sense (sense insert) or antisense (antisense insert) orientation.
The 28 kDa fusion protein (see Materials and Methods) is indicated
by an arrow.
[0289] FIG. 5 is a photograph of a gel for shift assays indicating
that CBF1 binds to the C-repeat/DRE. The C-repeat/DRE probe (1 ng)
used in all reactions was a .sup.32P-labeled dimer of the
oligonucleotide MT50 (wild type C-repeat/DRE from COR15a). The
protein extracts used in the first four lanes were either bovine
serum albumin (BSA) or the indicated CBF1 sense, antisense and
vector extracts described in FIG. 4. The eight lanes on the right
side of the figure used the CBF1 sense protein extract plus the
indicated competitor C-repeat/DRE sequences (100 ng). The numbers
1.times., 2.times. and 3.times. indicate whether the
oligonucleotides were monomers, dimers or trimers, respectively, of
the indicated C-repeat/DRE sequences.
[0290] Protein extracts prepared from E. coli expressing the
recombinant protein produced a gel shift when a wild-type COR15a
C-repeat/DRE was used as probe (FIG. 5). No shift was detected with
BSA or E. coli extracts prepared from strains harboring the vector
alone, or the vector with an antisense insert for the 24 kDa
polypeptide. Oligonucleotides encoding wild-type C-repeat/DRE
sequences from COR15a or COR78 competed effectively for binding to
the COR15a C-repeat/DRE probe, but mutant version of the COR15a
C-repeat/DRE did not (FIG. 5). These in vitro results corroborated
the in vivo yeast expression studies indicating that the 24 kDa
polypeptide binds to the C-repeat/DRE sequence. The 24 kDa
polypeptide was thus designated CBF1 (C-repeat/DRE binding factor
1) and the gene encoding it named CBF1.
[0291] G. CBF1 is a Unique or Low Copy Number Gene.
[0292] FIG. 6 is a photograph of a southern blot analysis
indicating CBF1 is a unique or low copy number gene. Arabidopsis
DNA (1 .mu.g) was digested with the indicated restriction
endonucleases and southern transfers were prepared and hybridized
with a .sup.32P-labeled probe encoding the entire CBF1
polypeptide.
[0293] The hybridization patterns observed in southern analysis of
Arabidopsis DNA using the entire CBF1 gene as probe were relatively
simple indicating that CBF1 is either a unique or low copy number
gene (FIG. 6). The hybridization patterns obtained were not altered
if only the 3' end of the gene was used as the probe (the
EcoRV/BglII restriction fragment from pACT-11 encoding the acidic
region of CBF1, but not the AP2 domain) or if hybridization was
carried out at low stringency (not shown).
[0294] H. CBF1 Transcript Level Response to Low Temperature.
[0295] FIGS. 7A, 7B and 7C relate to CBF1 transcripts in control
and cold-treated Arabidopsis. FIG. 7A is a photograph of a membrane
RNA isolated from Arabidopsis plants that were grown at 22.degree.
C. or grown at 22.degree. C. and transferred to 2.5.degree. C. for
the indicated times. FIGS. 7B and 7C are graphs showing relative
transcript levels of CBF1 and COR15a in control and cold-treated
plants. The radioactivity present in the samples described in FIG.
7A were quantified using a Betascope 603 blot analyzer and plotted
as relative transcript levels (the values for the 22.degree. C.
grown plants being arbitrarily set as 1) after adjusting for
differences in loading using the values obtained with the pHH25
probe.
[0296] Based on FIGS. 7A-7C, northern analysis indicated that the
level of CBF1 transcripts increased about 2 to 3 fold in response
to low temperature (FIG. 7B). In contrast, the transcript levels
for COR15a increased approximately 35 fold in cold-treated plants
(FIG. 7C). Only a singly hybridizing band was observed for CBF1 at
either high or low stringency with probes for either the entire
CBF1 coding sequence or the 3' end of the gene (the EcoRV/BglII
fragment of pACT-1 1) (not shown). The size of the CBF1 transcripts
was about 1.0 kb.
[0297] I. Discussion of Experimental Results.
[0298] The above example regarding CBF1 represents the first
identification of a gene sequence which encodes a protein capable
of binding to the C-repeat/DRE sequence CCGAC. The experimental
results presented evidence that CBF1 binds to the C-repeat/DRE both
in vitro via gel shift assays and in vivo via yeast expression
assays. Further, the results demonstrate that CBF1 can activate
transcription of reporter genes in yeast that contain the
C-repeat/DRE.
[0299] The results of the southern analysis indicate that CBF1 is a
unique or low copy number gene in Arabidopsis. However, the CBF1
protein contains a 60 amino acid motif, the AP2 domain, that is
evolutionary conserved in plants (Weigel, D., The plant Cell
7:388-389 (1995)). It is present in the APETALA2 (Jofuku, K. D., et
al., The Plant Cell 6:1211-1225 (1994)), AINTEGUMENTA (Klucher, K.
M., et al., the Plant Cell 8:137-153 (1996; and Elliot, R. C., et
al., The Plant Cell 8:155-168 (1996)), TINY (Wilson, K., et al.,
The Plant Cell 8:659-671 (1996)) and cadmium-induced (Choi, S. -Y.,
et al., Plant Physiol. 108:849 (1995)) proteins of Arabidopsis and
the EREBPs of tobacco (Ohme-Takagi, M. et al., The Plant Cell
7:173-182 (1995)). In addition, a search of the GenBank expressed
sequence tagged cDNA database indicates that there is one cDNA from
B. napus, two from Ricinus communes, and more than 25 from
Arabidopsis and from rice, that are deduced to encode proteins with
AP2 domains. The results of Ohme-Takagi and Shinshi (Ohme-Takagi,
M., et al., The Plant Cell 7:173-182 (1995)) indicate that the
function of the AP2 domain is DNA-binding; this region of the
putative tobacco transcription factor EREBP2 is responsible for its
binding to the cis-acting ethylene response element referred to as
the GCC-repeat. As discussed by Ohme-Takagi and Shinshi
(Ohme-Takagi, M., et al., the Plant Cell 7:173-182 (1995)), the
DNA-binding domain of EREBP2 (the AP2 domain) contains no
significant amino acid sequence similarities or obvious structural
similarities with other known transcription factors or DNA binding
motifs. Thus, the domain appears to be a novel DNA-binding motif
that to date, has only been found in plant proteins.
[0300] It is believed that the binding of CBF1 to the C-repeat/DRE
involves the AP2 domain. In this regard, it is germane to note that
the tobacco ethylene response element, AGCCGCC, closely resembles
the C-repeat/DRE sequences present in the promoters of the
Arabidopsis genes COR15a, GGCCGAC, and COR781RD29A, TACCGAC.
Applicants believe that CBF1, the EREBPs and other AP2 domain
proteins are members of a superfamily of DNA binding proteins that
recognize a family of cis-acting regulatory elements having CCG as
a common core sequence. Differences in the sequence surrounding the
CCG core element could result in recruitment of different AP2
domain proteins which, in turn, could be integrated into signal
transduction pathways activated by different environmental,
hormonal and developmental cues. Such a scenario is akin to the
situation that exists for the ACGT-family of cis-acting elements
(Foster et al., FASEB J. 8:192-200 (1994)). In this case,
differences in the sequence surrounding the ACGT core element
result in the recruitment of different bZIP transcription factors
involved in activating transcription in response to a variety of
environmental and developmental signals.
[0301] The results of the yeast transformation experiments indicate
that CBF1 has a domain that can serve as a transcriptional
activator. The most likely candidate for this domain is the acidic
C-terminal half of the polypeptide. Indeed, random acidic amino
acid peptides from E. coli have been shown to substitute for the
GAL4 acidic activator domain of GAL4 in yeast (Ma, J. and M.
Ptashne, Cell 51:113-199 (1987)). Moreover, acidic activator
domains have been found to function across kingdoms (Hahn, S., Cell
72:481-483 (1993)); the yeast GAL4 acidic activator, for instance,
can activate transcription in tobacco (Ma, J., et al., Nature
334:631-633 (1988)). It has also been shown that certain plant
transcription factors, such as Vp1 (McCarty, D. R., et al., Cell
66:895-905 (1991)), have acidic domains that function as
transcriptional activators in plants. Significantly, the acidic
activation domains of the yeast transcription factors VP16 and GCN4
require the "adaptor" proteins ADA2, ADA3, and GCN5 for full
activity (see Guarente, L., Trends Biochem. Sci. 20:517-521
(1995)). These proteins form a heteromeric complex (Horiuchi, J.,
et al., Mol. Cell Biol. 15:1203-1209 (1995)) that bind to the
relevant activation domains. The precise mechanism of
transcriptional activation is not known, but appears to involve
histone acetylation: there is a wealth of evidence showing a
positive correlation between histone acetylation and the
transcriptional activity of chromatin (Wolffe, A. P., Trends
Biochem. Sci. 19:240-244 (1994)) and recently, the GCN5 protein has
been shown to have histone acetyltransferase activity (Brownell, J.
E., et al., Cell 84:843-851 (1996)). Genetic studies indicate that
CBF1, like VP16 and GCN4, requires ADA2, ADA3 and GCN5 to function
optimally in yeast. The fundamental question thus raised is whether
plants have homologs of ADA2, ADA3 and GCN5 and whether these
adaptors are required for CBF1 function (and function of other
transcription factors with acidic activator regions) in
Arabidopsis.
[0302] A final point regards regulation of CBF1 activity. The
results of the northern analysis indicate that CBF1 transcript
levels increase only slightly in response to low temperature, while
those for COR15a increase dramatically (FIG. 7). Thus, unlike in
yeast, it would appear that transcription of CBF1 in Arabidopsis at
warm temperatures is not sufficient to cause appreciable activation
of promoters containing the C-repeat/DRE. The molecular basis for
this apparent low temperature activation of CBF1 in Arabidopsis is
not known. One intriguing possibility, however is that CBF1 might
be modified at low temperature in Arabidopsis resulting in either
stabilization of the protein, translocation of the protein from the
cytoplasm to the nucleus, or activation of either the DNA binding
domain or activation domain of the protein. Such modification could
involve a signal transduction pathway that is activated by low
temperature. Indeed, as already discussed, cold-regulated
expression of COR genes in Arabidopsis and alfalfa appears to
involve a signal transduction pathway that is activated by low
temperature-induced calcium flux (Knight, H., et al., The Plant
Cell 8:489-503 (1996); Knight, M. R., et al., Nature 352:524-526
(1991); Monroy, A. F., et al, Plant Physiol. 102:1227-1235 (1993);
Monroy, A. F., and R. S., The Plant Cell, 7:321-331 (1995)). It
will, therefore, be of interest to determine whether CBF1 is
modified at low temperature, perhaps by phosphorylation, and if so,
whether this is dependent on calcium-activated signal
transduction.
[0303] 2. Use of CBF1 to Induce Cold Regulated Gene Expression in
Nonacclimated Arabidopsis Plants.
[0304] The following example demonstrates that increased expression
of CBF1 induces COR gene expression in nonacclimated Arabidopsis
plants. Transgenic Arabidopsis plants that overexpress CBF1 were
created by placing a cDNA encoding CBF1 under the control of the
strong cauliflower mosaic virus (CaMV) 35S promoter and
transforming the chimeric gene into Arabidopsis ecotype RLD plants
(Standard procedures were used for plasmid manipulations (J.
Sambrook, et al., Molecular Cloning, A Laboratory Manual (Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, ed. 2, (1989)).
The CBF1-containing AseI-BglII fragment from pACT-Bgl+(Stockinger,
E. J., et al., Proc. Natl. Acad. Sci. U.S.A. 94:1035 (1997)) was
gel-purified, BamHI linkers were ligated to both ends and the
fragment was inserted into the BamHI site in pCIB710 (S. Rothstein,
et al., Gene 53:153-161 (1987)) which contains the CaMV 35S
promoter and terminator. The chimeric plasmid was linearized at the
KpnI site and inserted into the KpnI site of the binary vector
pCIB10g (Ciba-Geigy, Research Triangle Park, N.C.). The plasmid was
transformed into Agrobacterium tumefaciens strain C58C1 (pMP90) by
electroporation. Arabidopsis plants were transformed by the vacuum
infiltration procedure (N. Bechtold, J. Ellis, and G. Pelletier, C.
R. Acad. Sci. Paris, Life Sci. 316:1194-1199 (1993)) as modified
(A. van Hoof, P. J. Green, Plant Journal 10:415-424 (1996)).
Initial screening gave rise to two transgenic lines, A6 and B16,
that accumulated CBF1 transcripts at elevated levels.
[0305] FIG. 8 is a Northern blot showing CBF1 and COR transcript
levels in RLD and transgenic Arabidopsis plants. Leaves from
nonacclimated and three-day cold-acclimated plants (Arabidopsis
thaliana ecotype RLD plants were grown in pots under continuous
light (100 .mu.E/m.sup.2/sec) at 22 C for 18-25 days as described
(Gilmour, S. J., et al., Plant Physiol. 87:735 (1988)). In some
cases, plants were then cold-acclimated by placing them at
2.5.degree. C. under continuous light (50 .mu.E/m.sup.2/sec) for
varying amounts of time. Leaves were harvested and total RNA
prepared and analyzed for CBF1 and COR transcripts by RNA blot
analysis using .sup.32P-radiolabeled probes (Total RNA was isolated
from plant leaves and subjected to RNA blot analysis using high
stringency hybridization and wash conditions as described (E. J.
Stockinger, et al., Proc. Natl. Acad. Sci. USA 94:1035 (1997); and
S. J. Gilmour, et al., Plant Physiol. 87:735 (1988)).
[0306] FIG. 9 is an immunoblot showing COR15am protein levels in
RLD and transgenic Arabidopsis plants. Total soluble protein (100
.mu.g) was prepared from leaves of the nonacclimated RLD (RLDw),
4-day cold-acclimated RLD (RLDc4), 7-day cold-acclimated RLD
(RLDc7) and nonacclimated A6 and B16 plants and the levels of
COR15am determined by immunoblot analysis using antiserum raised
against the COR15am polypeptide (Total soluble protein was isolated
from plant leaves, fractionated by tricine SDS-PAGE and transferred
to 0.2 micron nitrocellulose as previously described (N. N. Artus
et al., Proc. Natl. Acad. Sci. U.S.A. 93:13404 (1996)). COR15am
protein was detected using antiserum raised to purified COR15am and
protein A conjugated alkaline phosphatase (Sigma, St. Louis, Mo.)
(N. N. Artus et al., Proc. Natl. Acad. Sci. U.S.A. 93:13404
(1996)). No reacting bands were observed with preimmune serum (not
shown).
[0307] Southern analysis indicated that the A6 line had a single
DNA insert while the B16 line had multiple inserts (not shown).
Examination of fourth generation homozygous A6 and B16 plants
indicated that CBF1 transcript levels were higher in nonacclimated
A6 and B16 plants than they were in nonacclimated RLD plants, the
levels in A6 being about three fold higher than in B16 (FIG.
8).
[0308] CBF1 overexpression resulted in strong induction of COR gene
expression (FIG. 8). Specifically, the transcript levels of COR6.6,
COR15a, COR47 and COR78 were dramatically elevated in nonacclimated
A6 and B16 plants as compared to nonacclimated RLD plants. The
effect was greater in the A6 line, where COR transcript levels in
nonacclimated plants approximated those found in cold-acclimated
RLD plants. The finding that COR gene expression was greater in A6
plants than in B16 plants was consistent with CBF1 transcript
levels being higher in the A6 plants (FIG. 7A). Immunoblot analysis
indicated that the levels of the COR15am (FIG. 9) and COR6.6 (not
shown) polypeptides were also elevated in the A6 and B16 lines, the
level of expression again being higher in the A6 line. Attempts to
identify the CBF1 protein in either RLD or transgenic plants were
unsuccessful. Overexpression of CBF1 had no effect on the
transcript levels for elF4A (eukaryotic initiation factor 4A)
(Metz, A. M., et al., Gene 120:313 (1992)), a constitutively
expressed gene that is not responsive to low temperature (FIG. 8)
and had no obvious effects on plant growth and development.
[0309] The results from this example demonstrate that
overexpression of the Arabidopsis transcriptional activator CBF1
induces expression of an Arabidopsis COR "regulon" composed of
genes carrying the CRT/DRE DNA regulatory element. It appears that
CBF1 binds to the CRT/DRE DNA regulatory elements present in the
promoters of these genes and activates transcription which is
consistent with the notion of CBF1 having a role in COR gene
regulation. Significantly, there was a strong correlation between
CBF1 transcript levels and the magnitude of COR gene induction in
nonacclimated A6, B16, and RLD plants (FIG. 8). However, upon low
temperature treatment the level of CBF1 transcripts remained
relatively low in RLD plants, while COR gene expression was induced
to about the same level as that in nonacclimated A6 plants (FIG.
8). Thus, it appears that CBF1 or an associated protein becomes
"activated" in response to low temperature.
[0310] 3. CBF1 Overexpression Resulted in a Marked Increase in
Plant Freezing Tolerance
[0311] The following example describes a comparison of the freezing
tolerance of nonacclimated Arabidopsis plants which overexpress
CBF1 to that of cold-acclimated wild-type plants. As described
below, the freezing tolerance of nonacclimated Arabidopsis plants
overexpressing CBF1 significantly exceeded that of non-acclimated
wild-type Arabidopsis plants and approached that of cold-acclimated
wild-type plants.
[0312] Freezing tolerance was determined using the electrolyte
leakage test (Sukumaran, N. P., et al., HortScience 7:467 (1972)).
Detached leaves were frozen to various subzero temperatures and,
after thawing, cellular damage (due to freeze-induced membrane
lesions) was estimated by measuring ion leakage from the
tissues.
[0313] FIGS. 10A and 10B are graphs showing freezing tolerance of
leaves from RLD and transgenic Arabidopsis plants. Leaves from
nonacclimated RLD (RLDw) plants, cold-acclimated RLD (RLDc) plants
and nonacclimated A6, B16 and T8 plants were frozen at the
indicated temperatures and the extent of cellular damage was
estimated by measuring electrolyte leakage (Electrolyte leakage
tests were conducted as described (N. P. Sukumaran, et al.,
HortScience 7, 467 (1972); and S. J. Gilmour, et al., Plant
Physiol. 87:735 (1988)) with the following modifications. Detached
leaves (2-4) from nonacclimated or cold-acclimated plants were
placed in a test tube and submerged for 1 hour in a -2.degree. C.
water-ethylene glycol bath in a completely randomized design, after
which ice crystals were added to nucleate freezing. After an
additional hour of incubation at -2.degree. C., the samples were
cooled in decrements of 1.degree. C. each hour until -8.degree. C.
was reached. Samples (five replicates for each data point) were
thawed overnight on ice and incubated in 3 ml distilled water with
shaking at room temperature for 3 hours. Electrolyte leakage from
leaves was measured with a conductivity meter. The solution was
then removed, the leaves frozen at -80.degree. C. (for at least one
hour), and the solution returned to each tube and incubated for 3
hours to obtain a value for 100% electrolyte leakage. In FIGS. 10A
and 10B, the RLDc plants were cold-acclimated for 10 and 11 days,
respectively. Error bars indicate standard deviations.
[0314] As can be seen from FIGS. 10A and 10B, CBF1 overexpression
resulted in a marked increase in plant freezing tolerance. The
experiment presented in FIG. 10A indicates that the leaves from
both nonacclimated A6 and B16 plants were more freezing tolerant
than those from nonacclimated RLD plants. Indeed, the freezing
tolerance of leaves from nonacclimated A6 plants approached that of
leaves from cold-acclimated RLD plants. The results also indicate
that the leaves from nonacclimated A6 plants were more freezing
tolerant than those from nonacclimated B16 plants, a result that is
consistent with the greater level of CBF1 and COR gene expression
in the A6 line.
[0315] The results presented in FIG. 10B further demonstrate that
the freezing tolerance of leaves from nonacclimated A6 plants was
greater than that of leaves from nonacclimated RLD plants and that
it approached the freezing tolerance of leaves from cold-acclimated
RLD plants. In addition, the results indicate that overexpression
of CBF1 increases freezing tolerance to a much greater extent than
overexpressing COR15a alone. This conclusion comes from comparing
the freezing tolerance of leaves from nonacclimated A6 and T8
plants (FIG. 10B). T8 plants (Artus, N. N., et al., Proc. Natl.
Acad. Sci. U.S.A. 93:13404 (1996)) are from a transgenic line that
constitutively expresses COR15a (under control of the CaMV 35S
promoter) at about the same level as in A6 plants (FIG. 1).
However, unlike in A6 plants, other CRT/DRE-regulated COR genes are
not constitutively expressed in T8 plants (FIG. 8).
[0316] A comparison of EL.sub.50 values (the freezing temperature
that results in release of 50% of M tissue electrolytes) of leaves
from RLD, A6, B16 and T8 plants is presented in Table 2.
[0317] EL.sub.50 values were calculated and compared by analysis of
variance curves fitting up to third order linear polynomial trends
were determined for each electrolyte leakage experiment. To insure
unbiased predictions of electrolyte leakage, trends significantly
improving the model fit at the 0.2 probability level were retained.
EL.sub.50 values were calculated from the fitted models. In Table
2, an unbalanced one-way analysis of variance, adjusted for the
different numbers of EL.sub.50 values for each plant type, was
determined using SAS PROC GLM [SAS Institute, Inc. (1989), SASISTAT
User's Guide, Version 6, Cory, NC)]. EL.sub.50 values.+-.SE (n) are
presented on the diagonal line for leaves from nonacclimated RLD
(RLDw), cold-acclimated (7 to 10 days) RLD (RLDc) and nonacclimated
A6, B16 and T8 plants. P values for comparisons of EL.sub.50 values
are indicated in the intersecting cells.
2TABLE 2 EL.sub.50 values RLDw RLDc A6 B16 T8 RLDw -3.9 .+-. P <
P < 0.0001 P = 0.0014 P = 0.7406 0.21 (8) 0.0001 RLDc -7.6 .+-.
P = 0.3261 P < 0.0001 P < 0.0001 0.30 (4) A6 -7.2 .+-. 0.25 P
< 0.0001 P < 0.0001 (6) B16 -5.2 .+-. 0.27 P = 0.0044 (5) T8
-3.8 .+-. 0.35 (3)
[0318] The data confirm that: 1) the freezing tolerance of leaves
from both nonacclimated A6 and B16 plants is greater than that of
leaves from both nonacclimated RLD and T8 plants; and 2) that
leaves from nonacclimated A6 plants are more freezing tolerant than
leaves from nonacclimated B16 plants. No significant difference was
detected in EL.sub.50 values for leaves from nonacclimated A6 and
cold-acclimated RLD plants or from nonacclimated RLD and T8
plants.
[0319] The enhancement of freezing tolerance in the A6 line was
also apparent at the whole plant level. FIG. 11 is a photograph
showing freezing survival of RLD and A6 Arabidopsis plants.
Nonacclimated (WARM) RLD and A6 plants and 5-day cold-acclimated
(COLD) RLD plants were frozen at -5.degree. C. for 2 days and then
returned to a growth chamber at 22.degree. C. (Pots (3.5 inch)
containing about 40 nonacclimated Arabidopsis plants (20 day old)
and 4 day cold-acclimated plants (25 days old) (Arabidopsis
thaliana ecotype RLD plants were grown in pots under continuous
light (100 .mu.E/m.sup.2/sec) at 22.degree. C. for 18-25 days as
described (S. J. Gilmour, et al., Plant Physiol. 87:735 (1988)). In
some cases, plants were then cold-acclimated by placing them at
2.5.degree. C. under continuous light (50 .mu.E/m.sup.2/sec) for
varying amounts of time) were placed in a completely randomized
design in a -5.degree. C. cold chamber in the dark. After 1 hour,
ice chips were added to each pot to nucleate freezing. Plants were
removed after 2 days and returned to a growth chamber at 22.degree.
C.). A photograph of the plants after 7 days of regrowth is
shown.
[0320] Although the magnitude of the difference varied from
experiment to experiment, nonacclimated A6 plants consistently
displayed greater freezing tolerance in whole plant freeze tests
than did nonacclimated RLD plants (FIG. 11). No difference in whole
plant freeze survival was detected between nonacclimated B16 and
RLD plants or nonacclimated T8 and RLD plants (not shown).
[0321] The results of this experiment show that CBF1-induced
expression of CRT/DRE-regulated COR genes result in a dramatic
increase in freezing tolerance and confirms the belief that COR
genes play a major role in plant cold acclimation. The increase in
freezing tolerance brought about by expressing the battery of
CRT/DRE-regulated COR genes was much greater than that brought
about by overexpressing COR15a alone indicating that COR genes in
addition to COR15a have roles in freezing tolerance.
[0322] Traditional plant breeding approaches have met with limited
success in improving the freezing tolerance of agronomic plants
(Thomashow, M. F., Adv. Genet 28:99 (1990)). For instance, the
freezing tolerance of the best wheat varieties today is essentially
the same as the most freezing-tolerance varieties developed in the
early part of this century. Thus, in recent years there has been
considerable interest that biotechnology might offer new strategies
to improve the freezing tolerance of agronomic plants. By the
results of the present invention, Applicants demonstrate the
ability to enhance the freezing tolerance of nonacclimated
Arabidopsis plants by increasing the expressing of the Arabidopsis
regulatory gene CBF1. As described throughout this application, the
ability of the present invention to modify the expression of
environmental stress tolerance genes such as core genes has wide
ranging implications since the CRT/DRE DNA regulatory element is
not limited to Arabidopsis (Jiang C., et al., Plant Mol. Biol.
30:679 (1996)). Rather, CBF1 and homologous genes can be used to
manipulate expression of CRT/DRE-regulated COR genes in important
crop species and thereby improve their freezing tolerance. By
transforming modified versions of CBF1 (or homologs) into such
plants, it will extend their safe growing season, increase yield
and expand areas of production.
[0323] 4. Selection of Promoters to Control Expression of CBF1 in
Plants
[0324] The following examples describe the isolation of different
promoters from plant genomic DNA, construction of the plasmid
vectors carrying the CBF1 gene and the inducible promoters,
transformation of Arabidoposis cells/plants with these constructs,
and regeneration of transgenic plants with increased tolerance to
environmental stresses.
[0325] A. Isolation of Inducible Promoters from Plant Genomic
DNAs
[0326] Inducible promoters from different plant genomic DNAs were
identified and isolated by PCR amplification using primers designed
to flank the promoter region and contain suitable restriction sites
for cloning into the expression vector. The following genes were
used to BLAST search Genbank to find the inducible promoters:
Dreb2a; P5CS; Rd22; Rd29a; Rd29b; Rab18; Cor47. Table 3 lists the
accession numbers and positions of these promoters. Table 4 lists
the forward and reverse primers that were used to isolate the
promoters.
3 TABLE 3 Gene Name Accession No. Position Length (bps) Dreb2a
AB010692 51901-53955 2054 P5CS AC003000 45472-47460 1988 Rd22
D10703 17-1046 1029 Rd29a D13044 3870-5511 1641 Rd29b D13044
90-1785 1695 Rab18 AB013389 8070-9757 1687 Cor47 AB004872 1-1370
1370
[0327]
4TABLE 4 Promoter name Primer name Cloning sites SEQ. ID. No.
Dreb2a Dreb2a-reverse HindIII (AAGCTT) 19 Dreb2a-forward BgIII
(AGATCT) 20 P5CS P5CS-reverse HindIII (AAGCTT) 21 P5CS-forward
BgIII (AGATCT) 22 Rd22 Rd22-reverse HindIII (AAGCTT) 23
Rd22-forward KpnI (GGTACC) 24 Rd29a Rd29a-reverse HindIII (AAGCTT)
25 Rd29a-forward KpnI (GGTACC) 26 Rd29b Rd29b-reverse HindIII
(AAGCTT) 27 Rd29b-forward KpnI (GGTACC) 28 Rab18 Rab18-reverse
HindIII (AAGCTT) 29 Rab18-forward BgIII (AGATCT) 30 Cor47
Cor47-reverse HindIII (AAGCTT) 31 Cor47-forward BgIII (AGATCT)
32
[0328] (1) Dreb2a Promoter
[0329] A cDNA encoding DRE (C-repeat) binding protein (DREB2A) has
been recently identified (Liu, et al. 1998 Plant Cell
10:1391-1406). The transcription of the DREB2A gene is activated by
dehydration and high-salt stress, but not by cold stress. The
upstream untranslated region (166 bps) of dreb2a was used to
BLAST-search the public database. A region containing the DREB2A
promoter was identified in chromosome 5 of Arabidopsis (Accession
No. AB010692) between nucleotide positions 51901-53955 (Table
3).
[0330] Two PCR primers designed to amplify the promoter region from
Arabidopsis thaliana genomic DNA are as follows: dreb2a-reverse:
5'-GCCCAAGCTTCAAGTTTAGTGAGCACTATGTGCTCG-3' [SEQ ID No. 19]; and
dreb2a-forward: 5'-GGAAGATCTCCTTCCCAGAAACAACACMTCTAC-3' [SEQ. ID.
No. 20]. The dre2ba-reverse primer includes a Hind III (AAGCTT)
restriction site near the 5'-end of the primer and dreb2a-forward
primer has a Bgl II (AGATCT) restriction site at near 5'-end of the
primer. These restriction sites may be used to facilitate cloning
of the fragment into an expression vector.
[0331] Total genomic DNA may be isolated from Arabidopsis thaliana
(ecotype colombia) by using the CTAB method (Ausubel et al. (1992)
Current Protocols in Molecular Biology (Greene & Wiley, New
York)). Ten nanograms of the genomic DNA can be used as a template
in a PCR reaction under conditions suggested by the manufacturer
(Boehringer Mannheim). The reaction conditions that may be used in
this PCR experiment are as follows: Segment 1: 94.degree. C., 2
minutes; Segment 2: 94.degree. C., 30 seconds; 60.degree. C., 1
minute; 72.degree. C., 3 minutes, for a total of 35 cycles; Segment
3: 72.degree. C. for 10 minutes. A PCR product of 2054 bp is
expected.
[0332] The PCR products can be subject to electrophoresis in a 0.8%
agarose gel and visualized by ethidium bromide staining. The DNA
fragments containing the inducible promoter will be excised and
purified using a Qiaquick gel extraction kit (Qiagen, Calif.).
[0333] (2) P5CS Promoter
[0334] A cDNA for delta 1-pyrroline-5-carboxylate synthetase (P5CS)
has been isolated and characterized (Yoshiba, et al., 1995, Plant
J. 7:751-760). The cDNA encodes an enzyme involved in the
biosynthesis of proline under osmotic stress (drought/high
salinity). The transcription of the P5CS gene was found to be
induced by dehydration, high salt and treatment with plant hormone
ABA, while it did not respond to heat or cold treatment.
[0335] A genomic DNA containing a promoter region of P5CS was
identified by a BLAST search of Genbank using the upstream
untranslated region (106 bps) of the P5CS sequence (Accession No.
D32138). The sequence for the P5CS promoter is located in the
region between from nucleotide positions 45472 to 47460 (Accession
No. AC003000; Table 3).
[0336] Reverse and forward PCR primers designed to amplify this
promoter region from Arabidopsis thaliana genomic DNA are
P5CS-reverse primer 5'-GCCCAAGCTTGTTTCATTTTCTCCATGAAGGAGAT-3' [SEQ.
ID. No. 21]; and P5CS-forward primer
5'-GGAAGATCTTATCGTCGTCGTCGTCTACCAAAACCACAC-3' [SEQ. ID. No.
22].
[0337] Total genomic DNA may be isolated from Arabidopsis thaliana
(ecotype colombia) by using the CTAB method (Ausubel et al. (1992)
Current Protocols in Molecular Biology (Greene & Wiley, New
York)). Ten nanograms of the genomic DNA can be used as a template
in a PCR reaction under conditions suggested by the manufacturer
(Boehringer Mannheim). The PCR product is expected to be 1988 bps
and may be PCR amplified and gel purified following the same
protocol described for the dreb2a promoter.
[0338] (3) rd22Promoter
[0339] A cDNA clone of rd22 was isolated from Arabidopsis under
dehydration conditions (Yamaguchi-Shinozaki and Shinozaki, Mol.
Gen. Genet. 238:17-25 (1993)). Transcripts of rd22 were found to be
induced by salt stress, water deficit and endogenous abscisic acid
(ABA) but not by cold or heat stress. A promoter region was
identified from Genebank by using Nucleotide Search WWW Entrez at
the NCBI with the rd22 as a search word. The sequence for the rd22
promoter is located in the region between nucleotide positions 17
to 1046 (Accession No. D10703; Table 3).
[0340] Reverse and forward PCR primers designed to amplify this
promoter region from Arabidopsis thaliana genomic DNA are
rd22-reverse primer 5'-GCTCTAAGCTTCACAAGGGGTTCGTTTGGTGC-3' [SEQ.
ID. No. 23]; and rd22-forward T primer
5'-GGGGTACCTTTTGGGAGTTGGMTAGAAATGGGTTTGATG-3' [SEQ. ID. No.
24].
[0341] The rd22-reverse primer includes a Hind III (AAGCTT )
restriction site near the 5'-end of primer and rd22-forward primer
has a Kpnl (GGTACC) restriction site at near 5'-end of primer.
[0342] Total genomic DNA may be isolated from Arabidopsis thaliana
(ecotype colombia) by using the CTAB method (Ausubel et al. (1992)
Current Protocols in Molecular Biology (Greene & Wiley, New
York)). Ten nanograms of the genomic DNA can be used as a template
in a PCR reaction under conditions suggested by the manufacturer
(Boehringer Mannheim). The PCR product is expected to be 1029 bps
and may be PCR amplified and gel purified following the same
protocol described for the dreb2a promoter.
[0343] (4) rd29a Promoter
[0344] The rd29a and rb29b genes were isolated and characterized by
Shinozaki's group in Japan (Yamaguchi-Shinizaki and Shinozaki,
Plant Physiol. 101: 1119-1120 (1993)). Both rd29a and rb29b gene
expressions were found to be induced by desiccation, salt stress
and exogenous ABA treatment (Yamaguchi-Shinizaki and Shinozaki,
Plant Physiol. 101: 1119-1120 (1993); Ishitani et al., Plant Cell
10: 1151-1161 (1998)). The rd29a gene expression was induced within
20 min after desiccation, but rd29b mRNA did not accumulate to a
detectable level until 3 hours after desiccation. Expression of
rd29a could also be induced by cold stress, whereas expression of
rd29b could not be induced by low temperature.
[0345] A genomic clone carrying the rd29a promoter was identified
by using Nucleotide Search WWW Entrez at the NCBI with the rd29a as
a search word. The sequence for the rd29a promoter is located in
the region between nucleotide positions 3870 to 5511 (Accession No.
D13044, Table 3).
[0346] Reverse and forward primers designed to amplify this
promoter region from Arabidopsis genomic DNA are: rd29a-reverse
primer 5'-GCCCAAGCTTAATTTTACTCAAAATGTTTTGGTTGC-3' [SEQ. ID. No.
25]; and rd29a-forward primer
5'-CCGGTACCTTTCCAAAGATTTTTTTCTTTCCAATAGMGTAATC-3' [SEQ. ID. No.26].
The rd29a-reverse primer includes a Hind Ill (AAGCTT) restriction
site near the 5'-end of primer and rd29a-forward primer has a Kpnl
(GGTACC) restriction site near 5'-end of primer.
[0347] Total genomic DNA may be isolated from Arabidopsis thaliana
(ecotype colombia) by using the CTAB method (Ausubel et al. (1992)
Current Protocols in Molecular Biology (Greene & Wiley, New
York)). Ten nanograms of the genomic DNA can be used as a template
in a PCR reaction under conditions suggested by the manufacturer
(Boehringer Mannheim). The PCR product is expected to be 1641 bps
and may be PCR amplified and gel purified following the same
protocol described for the dreb2a promoter.
[0348] (5) rd29b Promoter
[0349] A genomic clone carrying the rd29b promoter was identified
by using Nucleotide Search WWW Entrez at the NCBI with the rd29b as
a search word. The sequence for the rd29a promoter was located in
the region between nucleotide positions 90 to 1785 for rd29b
(Accession No. D13044; Table 3).
[0350] Reverse and forward PCR primers designed to amplify this
promoter region from Arabidopsis thaliana genomic DNA are:
rd29b-reverse primer 5'-GCGGAAGCTTCATTTTCTGCTACAGAAGTG-3' [SEQ. ID.
No. 27]; and rd29b-forward primer
5'-CCGGTACCTTTCCAAAGCTGTGTTTTCTCTTTTTCAAGTG-3' [SEQ. ID. No.
28].
[0351] Total genomic DNA may be isolated from Arabidopsis thaliana
(ecotype colombia) by using the CTAB method (Ausubel et al. (1992)
Current Protocols in Molecular Biology (Greene & Wiley, New
York)). Ten nanograms of the genomic DNA can be used as a template
in a PCR reaction under conditions suggested by the manufacturer
(Boehringer Mannheim). The PCR product is expected to be 1695 bps
and may be PCR amplified and gel purified following the same
protocol described for the dreb2a promoter.
[0352] (6) rab18 Promoter
[0353] A rab-related (responsive to ABA) gene, rab18 from
arabidopsis has been isolated. The gene encodes a hydrophilic,
glycine-rich protein with the conserved serine- and lysine-rich
domains. The rab18 transcripts accumulate in plants exposed to
water deficit or exogenous abscisic acid (ABA) treatment. A weak
induction of rab18 mRNA by low temperature was also observed
(Ishitani et al., Plant Cell 10: 1151-1161 (1998)).
[0354] A genomic DNA containing a promoter region of rab18 was
identified by a BLAST search of Genbank using the upstream
untranslated region (757 bps) of the rab18 sequence (Accession No.
L04173). The sequence of the rab18 promoter is located in the
region between nucleotide positions 8070 to 9757 (Accession No.
AB013389).
[0355] Reverse and forward PCR primers designed and used to amplify
this promoter region from Arabidopsis thaliana genomic DNA are:
rab18-reverse primer 5'-GCCCAAGCTTCAAATTCTGMTATTCACATATCAAAAAGTG-3'
[SEQ. ID. No. 29]; and rab18-forward primer
5'-GGAAGATCTGTTCTTCTTGTCTTAAGCAAACACTTTGAGC-3' [SEQ. ID. No. 30].
The rab18-reverse primer includes a Hind III (AAGCTT) restriction
site near the 5'-end of the primer and rab18-forward primer has a
Bgl II (AGATCT) restriction site near the 5'-end of the primer.
[0356] Total genomic DNA may be isolated from Arabidopsis thaliana
(ecotype colombia) by using the CTAB method (Ausubel et al. (1992)
Current Protocols in Molecular Biology (Greene & Wiley, New
York)). Ten nanograms of the genomic DNA can be used as a template
in a PCR reaction under conditions suggested by the manufacturer
(Boehringer Mannheim). The PCR product is expected to be 1687 bps
and may be PCR amplified and gel purified following the same
protocol described for the dreb2a promoter.
[0357] (7) Cor47 Promoter
[0358] The DNA sequence of cDNA for cold-regulated (cor47) gene of
Arabidopsis thaliana was determined. Gilmour et al., Plant
Molecular Biology 18: 13-21 (1992)). Expression of cor47 gene was
induced by cold stress, dehydration and high NaCl treatment
(Ishitani et al., Plant Cell, 10: 1151-1161 (1998)). The promoter
region of cor47 gene was identified in Genbank by using Nucleotide
Search WWW Entrez at the NCBI with the cor47 as a search word. The
sequence of the cor47 promoter is located in the region between
nucleotide positions 1-1370 (Accession No. AB004872; Table 3).
[0359] Reverse and forward PCR primers designed to amplify this
promoter region from Arabidopsis thaliana genomic DNA are:
cor47-reverse primer 5'-GCCCAAGCTTTCGTCTGTTATCATACMGGCACAAAACGAC-3'
[SEQ. ID. No. 31]; and cor47-forward primer
5'-GGAAGATCTAGTTMTCTTGATTTGATTAAAAGTTTATATAG-3' [SEQ. ID. No. 32].
The cor47-reverse primer includes a Hind III (AAGCTT) restriction
site near the 5'-end of the primer and cor47-forward primer has a
Bgl II (AGATCT) restriction site near the 5'-end of the primer.
[0360] Total genomic DNA may be isolated from Arabidopsis thaliana
(ecotype Colombia) by using the CTAB method (Ausubel et al. (1992)
Current Protocols in Molecular Biology (Greene & Wiley, New
York)). Ten nanograms of the genomic DNA can be used as a template
in a PCR reaction under conditions suggested by the manufacturer
(Boehringer Mannheim). The PCR product is expected to be 1370 bps
and may be PCR amplified and gel purified following the same
protocol described for the dreb2a promoter.
[0361] B. Construction of the Plamids Containing CBF1 and Inducible
Promoter
[0362] The expression binary vector pMEN020 contains a kanamycin
resistance gene (neomycin phosphotransferase) for antibiotic
selection of the transgenic plants and a Spc/Str gene used for
bacterial or agrobacterial selections. The pMEN020 plasmid is
digested with restriction enzymes such as HindIII and BgIII to
remove the 35S promoter. The 35S promoter is then replaced with an
inducible promoter.
[0363] (1) Cloning of the Inducible Promoter into pMEN020
[0364] The sequences of the inducible promoters that are PCR
amplified and gel purified, as well as the plasmid pMEN020, are
subject to restriction digestion with their respective restriction
enzymes as listed in Table 4. Both DNA samples are purified by
using the Qiaquick purification kit (Qiagen, Calif.) and ligated at
a ratio of 3:1 (vector to insert). Ligation reactions using T4 DNA
ligase (New England Biolabs, MA) are carried out at 16.degree. C.
for 16 hours. The ligated DNAs are transformed into competent cells
of the E. coli strain DH5a by using the heat shock method. The
transformed cells are plated on LB plates containing 100 .mu.g/ml
spectinomycin (Sigma). Individual colonies are grown overnight in
five milliliters of LB broth containing 100 .mu.g/ml spectinomycin
at 37.degree. C.
[0365] Plasmid DNAs from transformants are purified by using
Qiaquick Mini Prep kits (Qiagen, Calif.) according to the
manufacturer's instruction. The presence of the promoter insert is
verified by restriction mapping with the respective restriction
enzymes as listed in Table 4 to cut out the cloned insert. The
plasmid DNA is also subject to double-strand DNA sequencing
analysis using a vector primer (E9.1 primer
5'-CAAACTCAGTAGGATTCTGGTGTGT-3' [SEQ. ID. No. 33].
[0366] (2) Cloning of the cbf1gene into the Plasmids Containing the
Inducible Promoters
[0367] To clone the CBF1 gene into the plasmids, different PCR
primers with suitable restriction sites for each plasmid are used
to isolate cbf1 gene from Arabidopsis thaliana genomic DNA.
[0368] The primers that may be used are listed in Table 5.
5 TABLE 5 Promoter name Primer name Cloning sites Dreb2a
Cbf1-reverse1 BgIII (AGATCT) Cbf1-forward1 BamHI (GGATCC) P5CS
Cbf1-reverse1 BgIII (AGATCT) Cbf1-forward1 BamHI (GGATCC) Rd22
Cbf1-reverse2 KpnI (GGTACC Cbf1-forward1 BamHI (GGATCC) Rd29a Cbf1
-reverse2 KpnI (GGTACC Cbf1-forward1 BamHI (GGATCC) Rd29b
Cbf1-reverse2 KpnI (GGTACC Cbf1-forward1 BamHI (GGATCC) Rab18
Cbf1-reverse1 BgIII (AGATCT) Cbf1-forward2 XbaI (TCTAGA Cor47
Cbf1-reverse1 BgIII (AGATCT) Cbf1-forward1 BamHI (GGATCC)
[0369] Two of the four available PCR primers (Table 5) are used for
cloning the at-cbf1 gene into the expression vectors containing
each inducible promoter described above. The four primers have
these sequences: cbf1-reverse 1
5'-GGAAGATCTTGAAACAGAGTACTCTGATCAATGAACTC-3' [SEQ. ID. No. 34],
cbf1-forward 1 5'-CGCGGATCCCTCGTTTCTACAACAATAAAATAAAAT- AAAATG-3'
[SEQ. ID. No. 35], cbf1-reverse 2 5'-GGGGTACCTGAAACAGAGTACTCTGAT-
CAATGAACTC-3' [SEQ. ID. No. 36], and cbf1-forward 2
5'-GCTCTAGACTCGTTTCTACAACAATAAAATAAAATAAAATG-3' [SEQ. ID. No. 37].
For example, for the Dreb2a, P5CS, and COR47 promoters that are
ligated to a BamHI and BgIII flanked insert, the cbf1-reverse 1 and
cbf1-forward 1 primers [SEQ. ID. No. 34 and 35, respectively] are
used to isolate cbf1 gene from Arabidopsis thaliana genomic DNA.
The cbf1-reverse primer includes a BgIII (AGATCT) restriction site
near the 5'-end of the primer and cbf1-forward primer has a BamHI
(GGATCC) restriction site near the 5'-end of the primer. A PCR
product of 764 bp is expected. The genomic DNA (10 ng) is used as a
template in a PCR reaction under conditions suggested by the
manufacturer (Boehringer Mannheim). The reaction conditions to be
used in this PCR experiment are as follows: Segment 1: 94.degree.
C., 2 minutes; Segment 2: 94.degree. C., 30 seconds; 55.degree. C.,
1 minute; 72.degree. C., 1 minute, for a total of 35 cycles;
Segment 3: 72.degree. C. for 10 minutes.
[0370] The PCR products are subject to electrophoresis in a 0.8%
agarose gel and visualized by ethidium bromide staining. The DNA
fragment containing cbf1 is excised and purified by using a
Qiaquick gel extraction kit (Qiagen, a; Calif.). The purified
fragment and the vector pMBI2001 containing the inducible promoter
(Table 5) are each digested with BgIII and BamHI restriction
enzymes at 37.degree. C. for 2 hours. Both DNA samples are purified
by using the Qiaquick purification kit (Qiagen, Calif.) and ligated
at a ratio of 3:1 (vector to insert). Ligation reactions using T4
DNA ligase (New England Biolabs, MA) are carried out at 16.degree.
C. for 16 hours. The ligated DNAs are transformed into competent
cells of the E. coli strain DH5.alpha. by using the heat shock
method. The transformation are plated on LB plates containing 100
(g/ml spectinomycin (Sigma).
[0371] Individual colonies are grown overnight in five milliliters
of LB broth containing 100 g/ml spectinomycin at 37.degree. C.
Plasmid DNA are purified by using Qiaquick Mini Prep kits (Qiagen,
Calif.). The presence of the cbf1 insert is verified by restriction
mapping with BgIII and BamHI. The plasmid DNA is also subject to
double-strand DNA sequencing analysis by using vector primer E9.1
(5'-CAAACTCAGTAGGATTCTGGTGTGT-3') [SEQ. ID. No. 33]. The other
primers shown in Table 5 and appropriate restriction enzymes are
used in a similar way to clone the Cbf1 gene into plasmids
containing the other inducible promoters. The resulting plasmids
are listed in Table 6 and shown in FIGS. 17A-17G.
[0372] A similar cloning strategy may be used to clone other genes,
such as cbf2, cbf3, and the other full length CBF genes listed in
Table 9 and shown in FIG. 18 (new CBF gene table) into plasmids
containing inducible promoters.
6TABLE 6 Construct name Promoter name Figure name PMBI2008 Dreb2a
PMBI2009 P5CS PMBI2010 Rd22 PMBI2011 Rd29a PMBI2012 Rd29b PMBI2013
Rab18 PMBI2014 Cor47 FIG. 17G
[0373] C. Transformation of Agrobacterium with Plasmids Containing
CBF1 Gene and Inducible Promoters
[0374] After the plasmid vectors containing cbf1 gene and inducible
promoters are constructed, these vectors are used to transform
Agrobacterium tumefaciens cells expressing the gene products. The
stock of Agrobacterium tumefaciens cells for transformation are
made as described by Nagel et al. FEMS Microbiol Letts 67: 325-328
(1990). Agrobacterium strain ABI is grown in 250 ml LB medium
(Sigma) overnight at 28.degree. C. with shaking until an absorbance
(A.sub.600) of 0.5-1.0 is reached. Cells are harvested by
centrifugation at 4,000.times. g for 15 min at 4 C. Cells are then
resuspended in 250 .mu.l chilled buffer (1 mM HEPES, pH adjusted to
7.0 with KOH). Cells are centrifuged again as described above and
resuspended in 125 .mu.l chilled buffer. Cells are then centrifuged
and resuspended two more times in the same HEPES buffer as
described above at a volume of 100 .mu.l and 750 .mu.l,
respectively. Resuspended cells are then distributed into 40 pi
aliquots, quickly frozen in liquid nitrogen, and stored at -80
C.
[0375] Agrobacterium cells are transformed with plasmids formed as
described above in Section 4B(2) following the protocol described
by Nagel et al. FEMS Microbiol Letts 67: 325-328 (1990). For each
DNA construct to be transformed, 50-100 ng DNA (generally
resuspended in 10 mM Tris-HCl, 1 mM EDTA, pH 8.0) is mixed with 40
.mu.l of Agrobacterium cells. The DNA/cell mixture is then
transferred to a chilled cuvette with a 2 mm electrode gap and
subject to a 2.5 kV charge dissipated at 25 .mu.F and 200 .mu.F
using a Gene Pulser II apparatus (Bio-Rad). After electroporation,
cells are immediately resuspended in 1.0 ml LB and allowed to
recover without antibiotic selection for 2-4 hours at 28.degree. C.
in a shaking incubator. After recovery, cells are plated onto
selective medium of LB broth containing 100 .mu.g/ml spectinomycin
(Sigma) and incubated for 24-48 h at 28.degree. C. Single colonies
are then picked and inoculated in fresh medium. The presence of the
plasmid construct are verified by PCR amplification and sequence
analysis.
[0376] D. Transformation of Arabidopsis Plants With Agrobacterium
tumefaciens Carrying Expression Vector for CBF1 Protein
[0377] After transformation of Agrobacterium tumefaciens with
plasmid vectors containing cbf1 gene and inducible promoters,
single Agrobacterium colonies containing each of pMBI2008-pMBI2014
are identified, propagated, and used to transform Arabidopsis
Plants. Briefly, 500 ml cultures of LB medium containing 100 ug/ml
spectinomycin are inoculated with the colonies and grown at 28 C
with shaking for 2 days until an absorbance (A.sub.600) of >2.0
is reached. Cells are then harvested by centrifugation at
4,000.times. g for 10 min, and resuspended in infiltration medium
(1/2.times. Murashige and Skoog salts (Sigma), 1.times. Gamborg's
B-5 vitamins (Sigma), 5.0% (w/v) sucrose (Sigma), 0.044 .mu.M
benzylamino purine (Sigma), 200 .mu.l/L Silwet L-77 (Lehle Seeds)
until an absorbance (A.sub.600) of 0.8 is reached.
[0378] Prior to transformation, Arabidopsis thaliana seeds (ecotype
Columbia) are sown at a density of .about.10 plants per 4" pot onto
Pro-Mix BX potting medium (Hummert International) covered with
fiberglass mesh (18 mm.times.16 mm). Plants are grown under
continuous illumination (50-75 .mu.E/m.sup.2/sec) at 22-23 C with
65-70% relative humidity. After about 4 weeks, primary
inflorescence stems (bolts) are cut off to encourage growth of
multiple secondary bolts. After flowering of the mature secondary
bolts, plants are prepared for transformation by removal of all
siliques and opened flowers.
[0379] The pots are then immersed upside down in the mixture of
Agrobacterium/infiltration medium as described above for 30 sec,
and placed on their sides to allow draining into a 1'.times.2' flat
surface covered with plastic wrap. After 24 h, the plastic wrap is
removed and pots are turned upright. The immersion procedure is
repeated one week later, for a total of two immersions per pot.
Seeds are then collected from each transformation pot and analyzed
following the protocol described below.
[0380] E. Identification of Arabidopsis Primary Transformants
[0381] Seeds collected from the transformation pots are sterilized
essentially as follows. Seeds are dispersed into in a solution
containing 0.1% (v/v) Triton X-100 (Sigma) and sterile H.sub.2O and
washed by shaking the suspension for 20 min. The wash solution is
then drained and replaced with fresh wash solution to wash the
seeds for 20 min with shaking. After removal of the second wash
solution, a solution containing 0.1% (v/v) Triton X-100 and 70%
EtOH (Equistar) is added to the seeds and the suspension is shaken
for 5 min. After removal of the ethanol/detergent solution, a
solution containing 0.1% (v/v) Triton X-100 and 30% (v/v) bleach
(Chlorox) is added to the seeds, and the suspension is shaken for
10 min. After removal of the bleach/detergent solution, seeds are
then washed five times in sterile distilled H.sub.2O. The seeds are
stored in the last wash water at 4.degree. C. for 2 days in the
dark before being plated onto antibiotic selection medium (1.times.
Murashige and Skoog salts (pH adjusted to 5.7 with 1 M KOH),
1.times. Gamborg's B-5 vitamins, 0.9% phytagar (Life Technologies),
and 50 .mu.g/L kanamycin). Seeds are germinated under continuous
illumination (50-75 .mu.E/m.sup.2/sec) at 22-23.degree. C. After
7-10 days of growth under these conditions, kanamycin resistant
primary transformants (T.sub.1 generation) are visible and are
obtained for each of constructs pMBI2008-pMBI2014. These seedlings
are transferred first to fresh selection plates where the seedlings
continued to grow for 3-5 more days, and then to soil (Pro-Mix BX
potting medium). Progeny seeds (T.sub.2) are collected; kanamycin
resistant seedlings selected and analyzed as described above.
[0382] F. Transformation of Cereal Plants with Plasmid Vectors
Containing cbf1 Gene and Inducible Promoters
[0383] Cereal plants, such as corn, wheat, rice, sorghum and
barley, can also be transformed with the plasmid vectors containing
the cbf genes and inducible promoters to increase their tolerance
to environmental stresses. In these cases, the cloning vector,
pMEN020, is modified to replace the Nptl I coding region with the
BAR gene of Streptomyces hygroscopicus that confers resistance to
phosphinothricin. The KpnI and BgIII sites of the Bar gene are
removed by site-directed mutagenesis with silent codon changes.
After cloning of the inducible promoters into the modified plasmid
by the same procedures described above, the at-cbf coding region of
cbf1gene is inserted into the plasmid following the same procedures
as described above. The resulted plasmids are listed in Table
7.
7 TABLE 7 Promoter name Construct name Dreb2a PMBI2015 P5CS
PMBI2016 Rd22 PMBI2017 Rd29a PMBI2018 Rd29b PMBI2019 Rab18 PMBI2020
Cor47 PMBI2021
[0384] It is now routine to produce transgenic plants of most
cereal crops (Vasil, I., Plant Molec. Biol. 25: 925-937 (1994))
such as corn, wheat, rice, sorghum (Cassas, A. et al., Proc. Natl.
Acad Sci USA 90: 11212-11216 (1993) and barley (Wan, Y. and
Lemeaux, P. Plant Physiol. 104:37-48 (1994) Other direct DNA
transfer methods such as the microprojectile gun or Agrobacterium
tumefaciens-mediated transformation can be used for corn (Fromm. et
al. Bio/Technology 8: 833-839 (1990); Gordon-Kamm et al. Plant Cell
2: 603-618 (1990); Ishida, Y., Nature Biotechnology 14:745-750
(1990)), wheat (Vasil, et al. Bio/Technology 10:667-674 (1992);
Vasil et al., Bio/Technology 11:1553-1558 (1993); Weeks et al.,
Plant Physiol. 102:1077-1084 (1993)), rice (Christou Bio/Technology
9:957-962 (1991); Hiei et al. Plant J. 6:271-282 (1994); Aldemita
and Hodges, Planta 199:612-617; Hiei et al., Plant Mol Biol.
35:205-18 (1997)). For most cereal plants, embryogenic cells
derived from immature scutellum tissues are the preferred cellular
targets for transformation (Hiei et al., Plant Mol Biol. 35:205-18
(1997); Vasil, Plant Molec. Biol. 25: 925-937 (1994)).
[0385] Plasmids according to the present invention may be
transformed into corn embryogenic cells derived from immature
scutellar tissue by using microprojectile bombardment, with the
A188XB73 genotype as the preferred genotype (Fromm, et al.,
Bio/Technology 8: 833-839 (1990); Gordon-Kamm et al., Plant Cell 2:
603-618 (1990)). After microprojectile bombardment the tissues are
selected on phosphinothricin to identify the transgenic embryogenic
cells (Gordon-Kamm et al., Plant Cell 2: 603-618 (1990)).
Transgenic plants are regenerated by standard corn regeneration
techniques (Fromm, et al., Bio/Technology 8: 833-839 (1990);
Gordon-Kamm et al., Plant Cell 2: 603-618 (1990)).
[0386] The plasmids prepared as described above can also be used to
produce transgenic wheat and rice plants (Christou, Bio/Technology
9:957-962 (1991); Hiei et al., Plant J. 6:271-282 (1994); Aldemita
and Hodges, Planta 199:612-617 (1996); Hiei et al., Plant Mol Biol.
35:205-18 (1997)) by following standard transformation protocols
known to those skilled in the art for rice and wheat Vasil, et al.
Bio/Technology 10:667-674 (1992); Vasil et al., Bio/Technology
11:1553-1558 (1993); Weeks et al., Plant Physiol. 102:1077-1084
(1993)), where the BAR gene is used as the selectable marker.
[0387] 5. Identification of CBF1 Homologs CBF2 and CBF3 Using
CBF1
[0388] This example describes two homologs of CBF1 from Arabidopsis
thaliana and named them CBF2 and CBF3.
[0389] CBF2 and CBF3 have been cloned and sequenced as described
below. The sequences of the DNA and encoded proteins are set forth
in SEQ ID NOS: 12, 13, 14 and 15. FIG. 12 shows the DNA sequence
for CBF2 encoding CBF2. FIG. 13 shows the DNA sequence for CBF3
encoding CBF3.
[0390] A lambda cDNA library prepared from RNA isolated from
Arabidopsis thaliana ecotype Columbia (Lin and Thomashow, Plant
Physiol. 99: 519-525 (1992)) was screened for recombinant clones
that carried inserts related to the CBF1 gene (Stockinger, E. J.,
et al., Proc Natl Acad Sci USA 94:1035-1040 (1997)). CBF1 was
.sup.32P-radiolabeled by random priming (Sambrook et al., Molecular
Cloning. A Laboratory Manual, Ed. 2, Cold Spring Harbor Laboratory
Press, New York (1989)) and used to screen the library by the
plaque-lift technique using standard stringent hybridization and
wash conditions (Hajela, R. K., et al., Plant Physiol 93:1246-1252
(1990); Sambrook et al., Molecular Cloning. A Laboratory Manual, Ed
2. Cold Spring Harbor laboratory Press, New York (1989) 6.times.
SSPE buffer, 60.degree. C. for hybridization and 0.1.times. SSPE
buffer and 60.degree. C. for washes). Twelve positively hybridizing
clones were obtained and the DNA sequences of the cDNA inserts were
determined at the MSU-DOE Plant Research Laboratory sequencing
facility. The results indicated that the clones fell into three
classes. One class carried inserts corresponding to CBF1. The two
other classes carried sequences corresponding to two different
homologs of CBF1, designated CBF2 and CBF3. The nucleic acid
sequences and predicted protein coding sequences for CBF1, CBF2 and
CBF3 appear at FIG. 14.
[0391] A comparison of the nucleic acid sequences of CBF1, CBF2 and
CBF3 indicate that they are 83 to 85% identical as shown in Table
8. FIG. 14 shows the amino acid alignment of proteins CBF1, CBF2
and CBF3.
8 TABLE 8 Percent identity.sup.a DNA.sup.b Polypeptide cbf1/cbf2 85
86 cbf1/cbf3 83 84 cbf2/cbf3 84 85 .sup.aPercent identity was
determined using the Clustal algorithm from the Megalign program
(DNASTAR, Inc.). .sup.bComparisons of the nucleic acid sequences of
the open reading frames are shown.
[0392] Similarly, the amino acid sequences of the three CBF
polypeptides range from 84 to 86% identity. An alignment of the
three amino acidic sequences reveals that most of the differences
in amino acid sequence occur in the acidic C-terminal half of the
polypeptide. This region of CBF1 serves as an activation domain in
both yeast and Arabidopsis (not shown).
[0393] Residues 47 to 106 of CBF1 correspond to the AP2 domain of
the protein, a DNA binding motif that to date, has only been found
in plant proteins. A comparison of the AP2 domains of CBF1, CBF2
and CBF3 indicates that there are a few differences in amino acid
sequence. These differences in amino acid sequence might have an
effect on DNA binding specificity.
[0394] 6. Activation of Transcription in Yeast Containing
C-repeat/DRE Using CBF1, CBF2 and CBF3
[0395] This example shows that CBF1, CBF2 and CBF3 activate
transcription in yeast containing CRT/DREs upstream of a reporter
gene. The CBFs were expressed in yeast under control of the ADC1
promoter on a 2.mu. plasmid (pDB20.1; Berger, S. L., et al., Cell
70:251-265 (1992)). Constructs expressing the different CBFs were
transformed into yeast reporter strains which had the indicated
CRT/DRE upstream of the lacZ reporter gene. Copy number of the
CRT/DREs and its orientation relative to the direction of
transcription from each promoter is indicated by the direction of
the arrow.
[0396] FIG. 15 is a graph showing transcription regulation of
CRT/DRE containing reporter genes by CBF1, CBF2 and CBF3 genes in
yeast. In FIG. 15, the vertical lines across the arrows of the
COR15a construct represent the m3cor15a mutant CRT/DRE construct.
Each CRT/DRE-lacZ construct was integrated into the URA3 locus of
yeast. Error bars represent the standard deviation derived from
three replicate transformation events with the same CBF activator
construct into the respective reporter strain. Quantitative B-gal
assays were performed as described by Rose and Botstein (Rose, M.,
et al., Methods Enzymol. 101:167-180 (1983)).
[0397] 7. Homologous CBF Encoding Genes in Other Plants.
[0398] This example shows that homologous sequences to CBF1 are
present in other plants. The presence of these homologous sequences
suggest that the same or similar cold regulated environmental
stress response regulatory elements such as the C-repeat/DRE of
Arabidopsis (CCGAC) exist in other plants. This example serves to
indicate that genes with significant homology to CBF1, CBF2 and
CBF3 exist in a wide range of plant species.
[0399] Total plant DNAs from Arabadopsis thaliana, Nicotiana
tabacum, Lycopersicon pimpinellifolium, Prunis avium, Prunus
cerasus, Cucumis sativus, and Oryza saliva were isolated according
to Stockinger al (Stockinger, E. J., et al., J. Heredity,
87:214-218 (1996)). Approximately 2 to 10 .mu.g of each DNA sample
was restriction digested, transferred to nylon membrane (Micron
Separations, Westboro, Mass.) and hybridized according to Walling
et al. (Walling, L. L., et al., Nucleic Acids Res. 16:10477-10492
(1988)). Hybridization conditions were: 42.degree. C. in 50%
formamide, 5.times. SSC, 20 mM phosphate buffer 1.times.
Denhardt's, 10% dextran sulfate, and 100 .mu.g/ml herring sperm
DNA. Four low stringency washes at RT in 2.times. SSC, 0.05% Na
sarcosyl and 0.02% Na.sub.4 pyrophosphate were performed prior to
high stringency washes at 55.degree. C. in 0.2.times. SSC, 0.05% Na
sarcosyl and 0.01% Na.sub.4 pyrophosphate. High stringency washes
were performed until no counts were detected in the washout. The
BclI-BglII fragment of CBF1 (Stockinger et al., Proc Natl Acad Sci
USA 94:1035-1040 (1997)) was gel isolated (Sambrook et al.,
Molecular Cloning. A Laboratory Manual, Ed 2. Cold Spring Harbor
Laboratory Press, New York (1989)) and direct prime labelled
(Feinberg and Vogelstein, Anal. Biochem 132: 6-13 (1982)) using the
primer MT117 (TTGGCGGCTACGAATCCC; SEQ ID NO:16). Specific activity
of the radiolabelled fragment was approximately 4.times.108
cpm/.mu.g. Autoradiography was performed using HYPERFILM-MP
(Amersham) at -80.degree. C. with one intensifying screen for 15
hours.
[0400] Autoradiography of the gel showed that DNA sequences from
Arabadopsis thaliana, Nicotiana tabacum, Lycopersicon
pimpinellifolium, Prunis avium, Prunus cerasus, Cucumis sativus,
and Oryza sativa hybridized to the labeled BclI, BglII fragment of
CBF1. These results suggest that homologous CBF encoding genes are
present in a variety of other plants.
[0401] 8. Identification of Homologous Sequence to CBF1 in
Canola
[0402] This example describes the identification of homologous
sequences to CBF1 in canola using PCR. Degenerate primers were
designed for regions of AP2 binding domain and outside of the AP2
(carboxyl terminal domain). More specifically, the following
degenerate PCR primers were used:
9 Mol 368 (reverse) 5'- CAY CCN ATH TAY MGN GGN GT -3' Mol 378
(forward) 5'- GGN ARN ARC ATN CCY TCN GCC -3'
[0403] (Y: C/T, N: A/C/G/T, H: A/C/T, M: A/C, R: A/G)
[0404] Primer Mol 368 is in the AP2 binding domain of CBF1 (amino
acid seq: H P I Y R G V) while primer Mol 378 is outside the AP2
domain (carboxyl terminal domain)(amino acid seq: M A E G M L L
P).
[0405] The genomic DNA isolated from Brassica Napus was PCR
amplified by using these primers following these conditions: an
initial denaturation step of 2 min at 93.degree. C.; 35 cycles of
93.degree. C. for 1 min, 55.degree. C. for 1 min, and 72.degree. C.
for 1 min; and a final incubation of 7 min at 72.degree. C. at the
end of cycling.
[0406] The PCR products were separated by electrophoresis on a 1.2%
agarose gel and, transferred to nylon membrane and hybridized with
the AT CBF1 probe prepared from Arabidopsis genomic DNA by PCR
amplification. The hybridized products were visualized by
colormetric detection system (Boehringer Mannheim) and the
corresponding bands from a similar agarose gel were isolated (By
Qiagen Extraction Kit). The DNA fragments were ligated into the TA
clone vector from TOPO TA Cloning Kit (Invitrogen) and transformed
into E. coli strain TOP10 (Invitrogen).
[0407] Seven colonies were picked and the inserts were sequenced on
an ABI 377 machine from both strands of sense and antisense after
plasmid DNA isolation. The DNA sequence was edited by sequencer and
aligned with the AtCBF1 by GCG software and NCBI blast
searching.
[0408] FIG. 16 shows an amino acid sequence of a homolog [CAN1;
SEQ. ID. No. 17] identified by this process and its alignment to
the amino acid sequence of CBF1. The nucleic acid sequence for CAN1
is listed herein as SEQ. ID. No. 18.
[0409] As illustrated in FIG. 16, the DNA sequence alignment in
four regions of BN-CBF1 shows 82% identity in the AP2 binding
domain region and range from 75% to 83% with some alignment gaps
due to regions of lesser homology or introns in the genomic
sequence. The aligned amino acid sequences show that the BNCBF1
gene has 88% identity in the AP2 domain region and 85% identity
outside the AP2 domain when aligned for two insertion sequences
that are outside the AP2 domain. The extra amino acids in the 2
insertion regions are either due to the presence of introns in this
region of the BNCBF1 gene, as it was derived from genomic DNA, or
could be due to extra amino acids in these regions of the BNCBF1
gene. Isolation and sequencing of a cDNA of the BNCBF1 gene using
the genomic DNA as a probe will resolve this.
[0410] 9. Identification of Homologous Sequence to CBF1 in Canola
and Other Species
[0411] A PCR strategy similar to that described in Example 8 was
used to isolate additional CBF homologues from Brassica juncea,
Brassica napus, Brassica oleracea, Brassica rapa, Glycine max,
Raphanus sativus and Zea Maize. The nucleotide (e.g. bjCBF1) and
peptide sequences (e.g. BJCBF1-PEP) of these isolated CBF
homologues are shown in FIGS. 18A and 18B, respectively. Table 9
lists the sequence names and sequence ID Nos. of these isolated CBF
homologues. The PCR primers are internal to the gene so partial
gene sequences are initially obtained. The full length sequences of
some of these genes were further isolated by inverse PCR or ligated
linker PCR. One skilled in the art can use the conserved regions in
these genes to design PCR primers to isolate additional CBF
genes.
10TABLE 9 DNA Seq. Name Seq. ID No. Peptide Seq. Name Seq. ID No.
bjCBF1 38 BJCBF1-PEP 39 bJCBF2 40 BJCBF2-PEP 41 bjCBF3 42
BJCBF3-PEP 43 bjCBF4 44 BJCBF4-PEP 45 bnCBF1 46 BNCBF1-PEP 47
bnCBF2 48 BNCBF2-PEP 49 bnCBF3 50 BNCBF3-PEP 51 bnCBF4 52
BNCBF4-PEP 53 bnCBF5 54 BNCBF5-PEP 55 bnCBF6 56 BNCBF6-PEP 57
bnCBF7 58 BNCBF7-PEP 59 bnCBF8 60 BNCBF8-PEP 61 bnCBF9 62
BNCBF9-PEP 63 boCBF1 64 BOCBF1-PEP 65 boCBF2 66 BOCBF2-PEP 67
boCBF3 68 BOCBF3-PEP 69 boCBF4 70 BOCBF4-PEP 71 boCBF5 72
BOCBF5-PEP 73 brCBF1 74 BRCBF1-PEP 75 brCBF2 76 BRCBF2-PEP 77
brCBF3 78 BRCBF3-PEP 79 brCBF4 80 BRCBF4-PEP 81 brCBF5 82
BRCBF5-PEP 83 brCBF6 84 BRCBF6-PEP 85 brCBF7 86 BRCBF7-PEP 87
gmCBF1 88 GMCBF1-PEP 89 rsCBF1 90 RSCBF1-PEP 91 rsCBF2 92
RSCBF2-PEP 93 zmCBF1 94 ZMCBF1-PEP 95
[0412] FIG. 19A shows an amino acid alignment of the AP2 domains of
the CBF proteins listed in Table 9 with their consensus sequences
highlighted. FIG. 19A also provides a comparison of the consensus
sequence with that of the tobacco DNA binding protein EREBP2
(Okme-Takagi, M., et al., The Plant Cell 7:173-182 (1995). The
sequences of these CBF proteins are BRCBF3-PEP [SEQ. ID. No. 79],
BRCBF6-PEP [SEQ. ID. No.85], BNCBF5-PEP [SEQ. ID. No. 55],
ATCBF2-PEP [SEQ. ID. No. 13], ATCBF3-PEP [SEQ. ID. No. 15],
ATCBF1-PEP [SEQ. ID. No. 2], BNCBF2-PEP [SEQ. ID. No. 49],
BNCBF6-PEP [SEQ. ID. No. 57], BOCBF3-PEP [SEQ. ID. No. 69],
BNCBF3-PEP [SEQ. ID. No. 51], BNCBF8-PEP [SEQ. ID. No. 61],
BNCBF9-PEP [SEQ. ID. No. 63], BRCBF2-PEP [SEQ. ID. No. 77],
BOCBF5-PEP [SEQ. ID. No. 73], BOCBF2-PEP [SEQ. ID. No. 67],
RSCBF2-PEP [SEQ. ID. No. 93], BNCBF4-PEP [SEQ. ID. No. 53],
BNCBF7-PEP [SEQ. ID. No. 59], BOCBF4-PEP [SEQ. ID. No. 71],
BRCBF7-PEP [SEQ. ID. No. 87], BRCBF4-PEP [SEQ. ID. No. 81],
BRCBF5-PEP [SEQ. ID. No. 83], RSCBF1-PEP [SEQ. ID. No. 91],
BJCBF2-PEP [SEQ. ID. No. 41], BJCBF3-PEP [SEQ. ID. No. 43],
BNCBF1-PEP [SEQ. ID. No.47], BOCBF1-PEP [SEQ. ID. No. 65],
BRCBF1-PEP [SEQ. ID. No. 75], BJCBF4-PEP [SEQ. ID. No. 45],
ZMCBF1-PEP [SEQ. ID. No. 95], and GMCBF1-PEP [SEQ. ID. No. 89].
[0413] As can be seen from the consensus sequence shown in FIG.
19A, a significant portion of the AP2 domain is conserved among the
different CBF proteins. In view of this data, Applicants use the
conserved sequence in the AP2 domain to define a class of AP2
domain proteins comprising this conserved sequence.
[0414] FIG. 19B shows an amino acid alignment of the AP2 domains
shown in FIG. 19A and dreb2a and dreb2b and a consensus sequence
between the proteins highlighted. As can be seen, a very high
degree of homology exists between AP2 domains shown in FIG. 19A and
dreb2a and dreb2b. Applicants employ the conserved sequence in the
AP2 domain shown in FIG. 19B to define a broader class of AP2
domain proteins which are capable of binding to CCG regulatory
region.
[0415] FIG. 19C shows an amino acid alignment of the AP2 domains
shown in FIG. 19B and tiny and a consensus sequence between the
proteins highlighted. As can be seen, a very high degree of
homology exists between AP2 domains shown in FIG. 19A, dreb2a,
dreb2b and tiny. Applicants employ the conserved sequence in the
AP2 domain shown in FIG. 19C to define a yet broader class of AP2
domain proteins which are capable of binding to CCG regulatory
region.
[0416] FIG. 19D shows a consensus sequence corresponding to the
difference between the consensus sequence shown in FIGS. 19A and
tiny. Applicants employ the highlighted portion of the conserved
sequence shown in FIG. 19D to define a group of amino acid residues
which may be critical to binding to a CCG regulatory region.
[0417] FIG. 19E shows a consensus sequence corresponding to the
difference between the consensus sequence shown in FIGS. 19B and
tiny. Applicants employ the highlighted portion of the conserved
sequence shown in FIG. 19E to define another group of amino acid
residues which may be critical to binding to a CCG regulatory
region.
[0418] FIG. 20 shows the amino acid alignment of the amino terminus
of the CBF proteins with their consensus sequence highlighted. The
sequences of these CBF proteins are: BRCBF3-PEP [SEQ. ID. No. 79],
BRCBF6-PEP [SEQ. ID. No.85], BNCBF5-PEP [SEQ. ID. No. 55],
ATCBF2-PEP [SEQ. ID. No. 13], ATCBF3-PEP [SEQ. ID. No. 15],
ATCBF1-PEP [SEQ. ID. No. 2], BNCBF2-PEP [SEQ. ID. No. 49],
BNCBF6-PEP [SEQ. ID. No. 57], BOCBF3-PEP [SEQ. ID. No. 69],
BNCBF3-PEP [SEQ. ID. No. 51], BNCBF8-PEP [SEQ. ID. No. 61],
BNCBF9-PEP [SEQ. ID. No. 63], BRCBF2-PEP [SEQ. ID. No. 77],
BOCBF5-PEP [SEQ. ID. No. 73], BOCBF2-PEP [SEQ. ID. No. 67],
RSCBF2-PEP [SEQ. ID. No. 93], BNCBF4-PEP [SEQ. ID. No. 53 ],
BNCBF7-PEP [SEQ. ID. No. 59], BOCBF4-PEP [SEQ. ID. No. 71],
BRCBF7-PEP [SEQ. ID. No. 87], BRCBF4-PEP [SEQ. ID. No. 81],
BRCBF5-PEP [SEQ. ID. No. 83], and RSCBF1-PEP [SEQ. ID. No. 91].
[0419] As can be seen from the consensus sequence shown in FIG. 20,
a significant portion of the amino terminus of CBF proteins is
conserved among the different CBF proteins. In view of this data,
Applicants employ the conserved sequence in the amino terminus
domain to define a class of proteins comprising this conserved
sequence.
[0420] FIG. 21A shows the amino acid alignment of the carboxy
terminus of 24 CBF proteins with their consensus sequences
highlighted. The sequences of these CBF proteins are: BRCBF6-PEP
[SEQ. ID. No.85], BNCBF5-PEP [SEQ. ID. No. 55], ATCBF2-PEP [SEQ.
ID. No. 13], ATCBF3-PEP [SEQ. ID. No. 15], ATCBF1-PEP [SEQ. ID. No.
2], BNCBF2-PEP [SEQ. ID. No. 49], BNCBF6-PEP [SEQ. ID. No. 57],
BOCBF3-PEP [SEQ. ID. No. 69], BNCBF3-PEP [SEQ. ID. No. 51],
BNCBF8-PEP [SEQ. ID. No. 61], BNCBF9-PEP [SEQ. ID. No. 63],
BRCBF2-PEP [SEQ. ID. No. 77], BOCBF5-PEP [SEQ. ID. No. 73],
RSCBF2-PEP [SEQ. ID. No. 93], BNCBF4-PEP [SEQ. ID. No. 53],
BNCBF7-PEP [SEQ. ID. No. 59], BOCBF4-PEP [SEQ. ID. No. 71],
BRCBF7-PEP [SEQ. ID. No. 87], BRCBF5-PEP [SEQ. ID. No. 83],
RSCBF1-PEP [SEQ. ID. No. 91], BJCBF2-PEP [SEQ. ID. No. 41],
BJCBF3-PEP [SEQ. ID. No. 43], BNCBF1-PEP [SEQ. ID. No. 47], and
BOCBF1-PEP [SEQ. ID. No. 65].
[0421] As can be seen from the consensus sequence shown in FIG.
21A, a significant portion of the carboxy terminus of CBF proteins
is conserved among the different CBF proteins. In view of this
data, Applicants employ the conserved sequence in the carboxy
terminus domain to define a class of proteins comprising this
conserved sequence.
[0422] FIG. 21B shows the amino acid alignment of the carboxy
terminus of 9 CBF proteins with their consensus sequences
highlighted. The sequences of these CBF proteins are: BNCBF2-PEP
[SEQ. ID. No. 49], BOCBF3-PEP [SEQ. ID. No. 69], BNCBF3-PEP [SEQ.
ID. No. 51], BNCBF8-PEP [SEQ. ID. No. 61], BNCBF9-PEP [SEQ. ID. No.
63], BRCBF2-PEP [SEQ. ID. No. 77], BOCBF5-PEP [SEQ. ID. No. 73],
BNCBF1-PEP [SEQ. ID. No. 47], and BNCBF6-PEP [SEQ. ID. No. 57].
[0423] As can be seen from the consensus sequence shown in FIG.
21B, a greater portion of the carboxy terminus is conserved when
these 9 CBF proteins are used. In view of this data, Applicants
employ the conserved sequence in the carboxy terminus domain to
define another class of proteins comprising this conserved
sequence.
[0424] While the present invention is disclosed by reference to the
preferred embodiments and examples detailed above, it is to be
understood that these examples are intended in an illustrative
rather than limiting sense, as it is contemplated that
modifications will readily occur to those skilled in the art, which
modifications will be within the spirit of the invention and the
scope of the appended claims.
Sequence CWU 1
1
259 1 905 DNA Arabidopsis thaliana 1 aaaaagaatc tacctgaaaa
gaaaaaaaag agagagagat ataaatagct taccaagaca 60 gatatactat
cttttattaa tccaaaaaga ctgagaactc tagtaactac gtactactta 120
aaccttatcc agtttcttga aacagagtac tctgatcaat gaactcattt tcagcttttt
180 ctgaaatgtt tggctccgat tacgagcctc aaggcggaga ttattgtccg
acgttggcca 240 cgagttgtcc gaagaaaccg gcgggccgta agaagtttcg
tgagactcgt cacccaattt 300 acagaggagt tcgtcaaaga aactccggta
agtgggtttc tgaagtgaga gagccaaaca 360 agaaaaccag gatttggctc
gggactttcc aaaccgctga gatggcagct cgtgctcacg 420 acgtcgctgc
attagccctc cgtggccgat cagcatgtct caacttcgct gactcggctt 480
ggcggctacg aatcccggag tcaacatgcg ccaaggatat ccaaaaagcg gctgctgaag
540 cggcgttggc ttttcaagat gagacgtgtg atacgacgac cacggatcat
ggcctggaca 600 tggaggagac gatggtggaa gctatttata caccggaaca
gagcgaaggt gcgttttata 660 tggatgagga gacaatgttt gggatgccga
ctttgttgga taatatggct gaaggcatgc 720 ttttaccgcc gccgtctgtt
caatggaatc ataattatga cggcgaagga gatggtgacg 780 tgtcgctttg
gagttactaa tattcgatag tcgtttccat ttttgtacta tagtttgaaa 840
atattctagt tcctttttta gaatggttcc ttcattttat tttattttat tgttgtagaa
900 acgag 905 2 213 PRT Arabidopsis thaliana 2 Met Asn Ser Phe Ser
Ala Phe Ser Glu Met Phe Gly Ser Asp Tyr Glu 1 5 10 15 Pro Gln Gly
Gly Asp Tyr Cys Pro Thr Leu Ala Thr Ser Cys Pro Lys 20 25 30 Lys
Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg His Pro Ile Tyr 35 40
45 Arg Gly Val Arg Gln Arg Asn Ser Gly Lys Trp Val Ser Glu Val Arg
50 55 60 Glu Pro Asn Lys Lys Thr Arg Ile Trp Leu Gly Thr Phe Gln
Thr Ala 65 70 75 80 Glu Met Ala Ala Arg Ala His Asp Val Ala Ala Leu
Ala Leu Arg Gly 85 90 95 Arg Ser Ala Cys Leu Asn Phe Ala Asp Ser
Ala Trp Arg Leu Arg Ile 100 105 110 Pro Glu Ser Thr Cys Ala Lys Asp
Ile Gln Lys Ala Ala Ala Glu Ala 115 120 125 Ala Leu Ala Phe Gln Asp
Glu Thr Cys Asp Thr Thr Thr Thr Asp His 130 135 140 Gly Leu Asp Met
Glu Glu Thr Met Val Glu Ala Ile Tyr Thr Pro Glu 145 150 155 160 Gln
Ser Glu Gly Ala Phe Tyr Met Asp Glu Glu Thr Met Phe Gly Met 165 170
175 Pro Thr Leu Leu Asp Asn Met Ala Glu Gly Met Leu Leu Pro Pro Pro
180 185 190 Ser Val Gln Trp Asn His Asn Tyr Asp Gly Glu Gly Asp Gly
Asp Val 195 200 205 Ser Leu Trp Ser Tyr 210 3 27 DNA Artificial
Sequence Synthetic Construct 3 gatcatttca tggccgacct gcttttt 27 4
28 DNA Artificial Sequence Synthetic Construct 4 cacaatttca
agaattcact gctttttt 28 5 27 DNA Artificial Sequence Synthetic
Construct 5 gatcatttca tggtatgtct gcttttt 27 6 27 DNA Artificial
Sequence Synthetic Construct 6 gatcatttca tggaatcact gcttttt 27 7
27 DNA Artificial Sequence Synthetic Construct 7 gatcacttga
tggccgacct ctttttt 27 8 27 DNA Artificial Sequence Synthetic
Construct 8 gatcaatata ctaccgacat gagttct 27 9 25 DNA Artificial
Sequence Synthetic Construct 9 actaccgaca tgagttccaa aaagc 25 10 60
PRT Arabidopsis thaliana 10 Ile Tyr Arg Gly Val Arg Gln Arg Asn Ser
Gly Lys Trp Val Ser Glu 1 5 10 15 Val Arg Glu Pro Asn Lys Lys Thr
Arg Ile Trp Leu Gly Thr Phe Gln 20 25 30 Thr Ala Glu Met Ala Ala
Arg Ala His Asp Val Ala Ala Leu Ala Leu 35 40 45 Arg Gly Arg Ser
Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 11 61 PRT Tobacco 11 His
Tyr Arg Gly Val Arg Gln Arg Pro Trp Gly Lys Phe Ala Ala Glu 1 5 10
15 Ile Arg Asp Pro Ala Lys Asn Gly Ala Arg Val Trp Leu Gly Thr Tyr
20 25 30 Glu Thr Ala Glu Glu Ala Ala Leu Ala Tyr Asp Lys Ala Ala
Tyr Arg 35 40 45 Met Arg Gly Ser Lys Ala Leu Leu Asn Phe Pro His
Arg 50 55 60 12 651 DNA Arabidopsis thaliana 12 atgaactcat
tttctgcctt ttctgaaatg tttggctccg attacgagtc tccggtttcc 60
tcaggcggtg attacagtcc gaagcttgcc acgagctgcc ccaagaaacc agcgggaagg
120 aagaagtttc gtgagactcg tcacccaatt tacagaggag ttcgtcaaag
aaactccggt 180 aagtgggtgt gtgagttgag agagccaaac aagaaaacga
ggatttggct cgggactttc 240 caaaccgctg agatggcagc tcgtgctcac
gacgtcgccg ccatagctct ccgtggcaga 300 tctgcctgtc tcaatttcgc
tgactcggct tggcggctac gaatcccgga atcaacctgt 360 gccaaggaaa
tccaaaaggc ggcggctgaa gccgcgttga attttcaaga tgagatgtgt 420
catatgacga cggatgctca tggtcttgac atggaggaga ccttggtgga ggctatttat
480 acgccggaac agagccaaga tgcgttttat atggatgaag aggcgatgtt
ggggatgtct 540 agtttgttgg ataacatggc cgaagggatg cttttaccgt
cgccgtcggt tcaatggaac 600 tataattttg atgtcgaggg agatgatgac
gtgtccttat ggagctatta a 651 13 216 PRT Arabidopsis thaliana 13 Met
Asn Ser Phe Ser Ala Phe Ser Glu Met Phe Gly Ser Asp Tyr Glu 1 5 10
15 Ser Pro Val Ser Ser Gly Gly Asp Tyr Ser Pro Lys Leu Ala Thr Ser
20 25 30 Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr
Arg His 35 40 45 Pro Ile Tyr Arg Gly Val Arg Gln Arg Asn Ser Gly
Lys Trp Val Cys 50 55 60 Glu Leu Arg Glu Pro Asn Lys Lys Thr Arg
Ile Trp Leu Gly Thr Phe 65 70 75 80 Gln Thr Ala Glu Met Ala Ala Arg
Ala His Asp Val Ala Ala Ile Ala 85 90 95 Leu Arg Gly Arg Ser Ala
Cys Leu Asn Phe Ala Asp Ser Ala Trp Arg 100 105 110 Leu Arg Ile Pro
Glu Ser Thr Cys Ala Lys Glu Ile Gln Lys Ala Ala 115 120 125 Ala Glu
Ala Ala Leu Asn Phe Gln Asp Glu Met Cys His Met Thr Thr 130 135 140
Asp Ala His Gly Leu Asp Met Glu Glu Thr Leu Val Glu Ala Ile Tyr 145
150 155 160 Thr Pro Glu Gln Ser Gln Asp Ala Phe Tyr Met Asp Glu Glu
Ala Met 165 170 175 Leu Gly Met Ser Ser Leu Leu Asp Asn Met Ala Glu
Gly Met Leu Leu 180 185 190 Pro Ser Pro Ser Val Gln Trp Asn Tyr Asn
Phe Asp Val Glu Gly Asp 195 200 205 Asp Asp Val Ser Leu Trp Ser Tyr
210 215 14 651 DNA Arabidopsis thaliana 14 atgaactcat tttctgcttt
ttctgaaatg tttggctccg attacgagtc ttcggtttcc 60 tcaggcggtg
attatattcc gacgcttgcg agcagctgcc ccaagaaacc ggcgggtcgt 120
aagaagtttc gtgagactcg tcacccaata tacagaggag ttcgtcggag aaactccggt
180 aagtgggttt gtgaggttag agaaccaaac aagaaaacaa ggatttggct
cggaacattt 240 caaaccgctg agatggcagc tcgagctcac gacgttgccg
ctttagccct tcgtggccga 300 tcagcctgtc tcaatttcgc tgactcggct
tggagactcc gaatcccgga atcaacttgc 360 gctaaggaca tccaaaaggc
ggcggctgaa gctgcgttgg cgtttcagga tgagatgtgt 420 gatgcgacga
cggatcatgg cttcgacatg gaggagacgt tggtggaggc tatttacacg 480
gcggaacaga gcgaaaatgc gttttatatg cacgatgagg cgatgtttga gatgccgagt
540 ttgttggcta atatggcaga agggatgctt ttgccgcttc cgtccgtaca
gtggaatcat 600 aatcatgaag tcgacggcga tgatgacgac gtatcgttat
ggagttatta a 651 15 216 PRT Arabidopsis thaliana 15 Met Asn Ser Phe
Ser Ala Phe Ser Glu Met Phe Gly Ser Asp Tyr Glu 1 5 10 15 Ser Ser
Val Ser Ser Gly Gly Asp Tyr Ile Pro Thr Leu Ala Ser Ser 20 25 30
Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg His 35
40 45 Pro Ile Tyr Arg Gly Val Arg Arg Arg Asn Ser Gly Lys Trp Val
Cys 50 55 60 Glu Val Arg Glu Pro Asn Lys Lys Thr Arg Ile Trp Leu
Gly Thr Phe 65 70 75 80 Gln Thr Ala Glu Met Ala Ala Arg Ala His Asp
Val Ala Ala Leu Ala 85 90 95 Leu Arg Gly Arg Ser Ala Cys Leu Asn
Phe Ala Asp Ser Ala Trp Arg 100 105 110 Leu Arg Ile Pro Glu Ser Thr
Cys Ala Lys Asp Ile Gln Lys Ala Ala 115 120 125 Ala Glu Ala Ala Leu
Ala Phe Gln Asp Glu Met Cys Asp Ala Thr Thr 130 135 140 Asp His Gly
Phe Asp Met Glu Glu Thr Leu Val Glu Ala Ile Tyr Thr 145 150 155 160
Ala Glu Gln Ser Glu Asn Ala Phe Tyr Met His Asp Glu Ala Met Phe 165
170 175 Glu Met Pro Ser Leu Leu Ala Asn Met Ala Glu Gly Met Leu Leu
Pro 180 185 190 Leu Pro Ser Val Gln Trp Asn His Asn His Glu Val Asp
Gly Asp Asp 195 200 205 Asp Asp Val Ser Leu Trp Ser Tyr 210 215 16
18 DNA Tobacco 16 ttggcggcta cgaatccc 18 17 210 PRT Brassica napus
17 His Pro Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp Val
1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu
Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met Ala Ala Arg Ala His Asp
Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly Arg Gly Ala Cys Leu Asn
Tyr Ala Asp Ser Ala Trp 50 55 60 Arg Leu Arg Ile Pro Glu Thr Thr
Cys His Lys Asp Ile Gln Lys Ala 65 70 75 80 Ala Ala Glu Ala Ala Leu
Ala Phe Glu Ala Glu Lys Ser Asp Val Thr 85 90 95 Met Gln Asn Gly
Gln Asn Met Glu Glu Thr Thr Ala Val Ala Ser Gln 100 105 110 Ala Glu
Val Asn Asp Thr Thr Thr Glu His Gly Met Asn Met Glu Glu 115 120 125
Ala Thr Ala Val Ala Ser Gln Ala Glu Val Asn Asp Thr Thr Thr Asp 130
135 140 His Gly Val Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr
Gly 145 150 155 160 Glu Gln Ser Glu Gly Phe Asn Met Ala Lys Glu Ser
Thr Val Glu Ala 165 170 175 Ala Val Val Thr Glu Glu Pro Ser Lys Gly
Ser Tyr Met Asp Glu Glu 180 185 190 Trp Met Leu Glu Met Pro Thr Leu
Leu Ala Asp Met Ala Glu Gly Met 195 200 205 Leu Leu 210 18 632 DNA
Canola 18 cacccgatat accggggagt tcgtctgaga aagtcaggta agtgggtgtg
tgaagtgagg 60 gaaccaaaca agaaatctag aatttggctt ggaactttca
aaacagctga gatggcagct 120 cgtgctcacg acgtcgctgc cctagccctc
cgtggaagag gcgcctgcct caattatgcg 180 gactcggctt ggcggctccg
catcccggag acaacctgcc acaaggatat ccagaaggct 240 gctgctgaag
ccgcattggc ttttgaggct gagaaaagtg atgtgacgat gcaaaatggc 300
cagaacatgg aggagacgac ggcggtggct tctcaggctg aagtgaatga cacgacgaca
360 gaacatggca tgaacatgga ggaggcaacg gcagtggctt ctcaggctga
ggtgaatgac 420 acgacgacgg atcatggcgt agacatggag gagacaatgg
tggaggctgt ttttactggg 480 gaacaaagtg aagggtttaa catggcgaag
gagtcgacgg tggaggctgc tgttgttacg 540 gaggaaccga gcaaaggatc
ttacatggac gaggagtgga tgctcgagat gccgaccttg 600 ttggctgata
tggcagaagg gatgctcctg cc 632 19 36 DNA Artificial Sequence
Synthetic Construct 19 gcccaagctt caagtttagt gagcactatg tgctcg 36
20 34 DNA Artificial Sequence Synthetic Construct 20 ggaagatctc
cttcccagaa acaacacaat ctac 34 21 35 DNA Artificial Sequence
Synthetic Construct 21 gcccaagctt gtttcatttt ctccatgaag gagat 35 22
39 DNA Artificial Sequence Synthetic Construct 22 ggaagatctt
atcgtcgtcg tcgtctacca aaaccacac 39 23 32 DNA Artificial Sequence
Synthetic Construct 23 gctctaagct tcacaagggg ttcgtttggt gc 32 24 40
DNA Artificial Sequence Synthetic Construct 24 ggggtacctt
ttgggagttg gaatagaaat gggtttgatg 40 25 36 DNA Artificial Sequence
Synthetic Construct 25 gcccaagctt aattttactc aaaatgtttt ggttgc 36
26 44 DNA Artificial Sequence Synthetic Construct 26 ccggtacctt
tccaaagatt tttttctttc caatagaagt aatc 44 27 30 DNA Artificial
Sequence Synthetic Construct 27 gcggaagctt cattttctgc tacagaagtg 30
28 40 DNA Artificial Sequence Synthetic Construct 28 ccggtacctt
tccaaagctg tgttttctct ttttcaagtg 40 29 42 DNA Artificial Sequence
Synthetic Construct 29 gcccaagctt caaattctga atattcacat atcaaaaaag
tg 42 30 40 DNA Artificial Sequence Synthetic Construct 30
ggaagatctg ttcttcttgt cttaagcaaa cactttgagc 40 31 41 DNA Artificial
Sequence Synthetic Construct 31 gcccaagctt tcgtctgtta tcatacaagg
cacaaaacga c 41 32 42 DNA Artificial Sequence Synthetic Construct
32 ggaagatcta gttaatcttg atttgattaa aagtttatat ag 42 33 25 DNA
Artificial Sequence Synthetic Construct 33 caaactcagt aggattctgg
tgtgt 25 34 38 DNA Artificial Sequence Synthetic Construct 34
ggaagatctt gaaacagagt actctgatca atgaactc 38 35 42 DNA Artificial
Sequence Synthetic Construct 35 cgcggatccc tcgtttctac aacaataaaa
taaaataaaa tg 42 36 37 DNA Artificial Sequence Synthetic Construct
36 ggggtacctg aaacagagta ctctgatcaa tgaactc 37 37 41 DNA Artificial
Sequence Synthetic Construct 37 gctctagact cgtttctaca acaataaaat
aaaataaaat g 41 38 577 DNA Brassica juncea 38 tttcacccta tctaccgggg
agttcgcctg agaaagtcag gtaagtgggt gtgtgaagtg 60 agggagccaa
acaagaaatc taggatttgg cttggaactt tcaaaaccgc agagatcgct 120
gctcgtgctc acgacgttgc cgccttagcc ctccgtggaa gagcggcctg tctcaacttc
180 gccgactcgg cttggcggct ccgtatcccg gagacaactt gcgccaagga
tatccagaag 240 gctgctgctg aagctgcgtt ggcttttggg gccgaaaaga
gtgataccac gacgaatgat 300 caaggcatga acatggagga gatgacggtg
gtggcttctc aggctgaggt gagcgacacg 360 acgacatatc atggcctgga
catggaggag actatggtgg aggctgtttt tgctgaggaa 420 cagagagaag
ggttttactt ggcggaggag acgacggtgg agggtgttgt tacggaggaa 480
cagagcaaag ggttttatat gtacgaggag tggacgttcg ggatgcagtc ctttttggcc
540 gatatggctg aaggcatgct cttttcaaag ggcgaat 577 39 130 PRT
Brassica juncea 39 Leu Pro Gly Val Arg Leu Arg Lys Ser Gly Lys Trp
Val Cys Glu Val 1 5 10 15 Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp
Leu Gly Thr Phe Lys Thr 20 25 30 Ala Glu Ile Ala Ala Arg Ala His
Asp Val Ala Ala Leu Ala Leu Arg 35 40 45 Gly Arg Ala Ala Cys Leu
Asn Phe Ala Asp Ser Ala Trp Arg Leu Arg 50 55 60 Ile Pro Glu Thr
Thr Cys Ala Lys Asp Ile Gln Lys Ala Ala Ala Glu 65 70 75 80 Ala Ala
Leu Ala Phe Gly Ala Glu Lys Ser Asp Thr Thr Thr Asn Asp 85 90 95
Gln Gly Met Asn Met Glu Glu Met Thr Ala Val Ala Ser Gln Ala Glu 100
105 110 Val Ser Asp Thr Thr Thr Tyr His Gly Leu Asp Met Glu Glu Thr
Met 115 120 125 Val Asp 130 40 431 DNA Brassica juncea 40
catccgatct acaggggagt tcgtctgaga aaatcaggta agtgggtgtg tgaagtgagg
60 gaaccaaaca agagatctag gatctggctc ggtactttcc taaccgccga
gatcgcagct 120 cgcgctcacg acgtcgccgc catagccctc cgtggcaaat
ccgcatgtct caatttcgct 180 gactcggctt ggcggctccg tatctcggag
acaacatgcc ctaaggagat tcagaaggct 240 gctgctgaag ccgcggtggc
ttttcaggct gagctaaatg atacgacggc cgatcatggc 300 cttgacgtgg
aggagacgat cgtggaggct attttcacgg aggaaagcag cgaagggttt 360
tatatggacg aggagttcat gttcgggatg ccgaccttgt gggctagtat ggcagaaggg
420 atgcttcttc c 431 41 143 PRT Brassica juncea 41 His Pro Ile Tyr
Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu
Val Arg Glu Pro Asn Lys Arg Ser Arg Ile Trp Leu Gly Thr 20 25 30
Phe Leu Thr Ala Glu Ile Ala Ala Arg Ala His Asp Val Ala Ala Ile 35
40 45 Ala Leu Arg Gly Lys Ser Ala Cys Leu Asn Phe Ala Asp Ser Ala
Trp 50 55 60 Arg Leu Arg Ile Ser Glu Thr Thr Cys Pro Lys Glu Ile
Gln Lys Ala 65 70 75 80 Ala Ala Glu Ala Ala Val Ala Phe Gln Ala Glu
Leu Asn Asp Thr Thr 85 90 95 Ala Asp His Gly Leu Asp Val Glu Glu
Thr Ile Val Glu Ala Ile Phe 100 105 110 Thr Glu Glu Ser Ser Glu Gly
Phe Tyr Met Asp Glu Glu Phe Met Phe 115 120 125 Gly Met Pro Thr Leu
Trp Ala Ser Met Ala Glu Gly Met Leu Leu 130 135 140 42 431 DNA
Brassica juncea 42 catccaattt accgtggagt tcgtctgaga aaatcaggta
agtgggtgtg tgaagtgagg 60 gagccaaaca
agaaatctag gatctggccc ggtactttcc taaccgccga gatcgcagct 120
cgcgctcacg acgtcgccgc catagccctc cgtggcaaat ccgcatgtct caatttcgct
180 gactcggctt ggcggctccg tatcccggag acaacatgcc ctaaggagat
tcagaaggct 240 gctgctgaag ccgcggtggc ttttcaggct gagctaaatg
atacgacggc cgatcatggc 300 cttgacgtgg aggagacgat cgtggaggct
attttcacgg aggaaagcag cgaagggttt 360 tatatggacg aggagttcat
gttcgggatg ccgaccttgt gggctagtat ggcggagggc 420 atgctccttc c 431 43
143 PRT Brassica juncea 43 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Pro Gly Thr 20 25 30 Phe Leu Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Ile 35 40 45 Ala Leu Arg Gly
Lys Ser Ala Cys Leu Asn Phe Ala Asp Ser Ala Trp 50 55 60 Arg Leu
Arg Ile Pro Glu Thr Thr Cys Pro Lys Glu Ile Gln Lys Ala 65 70 75 80
Ala Ala Glu Ala Ala Val Ala Phe Gln Ala Glu Leu Asn Asp Thr Thr 85
90 95 Ala Asp His Gly Leu Asp Val Glu Glu Thr Ile Val Glu Ala Ile
Phe 100 105 110 Thr Glu Glu Ser Ser Glu Gly Phe Tyr Met Ala Glu Glu
Phe Met Phe 115 120 125 Gly Met Pro Thr Leu Trp Ala Ser Val Ala Glu
Gly Met Leu Leu 130 135 140 44 425 DNA Brassica juncea 44
catccaatct accggggtgt tcgacagaga aactcaggga aatgggtttg tgaagttagg
60 gagcctaata agaaatctag gatctggtta gggacttttc cgaccgtcga
aatggccgct 120 cgtgctcacg acgtcgccgc tttagccctt cgtggccgct
ccgcttgtct taatttcgcc 180 gactcggcgt ggtgtctacg gattcccgag
tctacttgtc ctaaagagat tcagaaagct 240 gcggccgaag ctgcaatggc
gtttcagaac gagacggcta cgactgagac gactatggtt 300 gagggagtca
taccggcgga ggagacggtg gggcagacgc gtgtggagac agcagaggag 360
aacggtgtgt tttatatgga cgatccaagg tttcttgaga atatggcaga gggcatgttc
420 ctacc 425 45 142 PRT Brassica juncea 45 His Pro Ile Tyr Arg Gly
Val Arg Gln Arg Asn Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg
Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Pro
Thr Val Glu Met Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45
Ala Leu Arg Gly Arg Ser Ala Cys Leu Asn Phe Ala Asp Ser Ala Trp 50
55 60 Cys Leu Arg Ile Pro Glu Ser Thr Cys Pro Lys Glu Ile Gln Lys
Ala 65 70 75 80 Ala Ala Glu Ala Ala Met Ala Phe Gln Asn Glu Glu Thr
Ala Thr Thr 85 90 95 Glu Thr Thr Met Val Glu Gly Val Ile Pro Ala
Glu Glu Thr Val Gly 100 105 110 Gln Thr Arg Val Glu Thr Ala Glu Glu
Asn Gly Val Glu Tyr Met Asp 115 120 125 Asp Pro Arg Phe Leu Glu Asn
Met Ala Glu Gly Met Leu Phe 130 135 140 46 632 DNA Brassica napus
46 cacccgatat accggggagt tcgtctgaga aagtcaggta agtgggtgtg
tgaagtgagg 60 gaaccaaaca agaaatctag aatttggctt ggaactttca
aaacagctga gatggcagct 120 cgtgctcacg acgtcgctgc cctagccctc
cgtggaagag gcgcctgcct caattatgcg 180 gactcggctt ggcggctccg
catcccggag acaacctgcc acaaggatat ccagaaggct 240 gctgctgaag
ccgcattggc ttttgaggct gagaaaagtg atgtgacgat gcaaaatggc 300
cagaacatgg aggagacgac ggcggtggct tctcaggctg aagtgaatga cacgacgaca
360 gaacatggca tgaacatgga ggaggcaacg gcagtggctt ctcaggctga
ggtgaatgac 420 acgacgacgg atcatggcgt agacatggag gagacaatgg
tggaggctgt ttttactggg 480 gaacaaagtg aagggtttaa catggcgaag
gagtcgacgg tggaggctgc tgttgttacg 540 gaggaaccga gcaaaggatc
ttacatggac gaggagtgga tgctcgagat gccgaccttg 600 ttggctgata
tggcagaagg gatgctcctg cc 632 47 210 PRT Brassica napus 47 His Pro
Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp Val 1 5 10 15
Cys Glu Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly Thr 20
25 30 Phe Lys Thr Ala Glu Met Ala Ala Arg Ala His Asp Val Ala Ala
Leu 35 40 45 Ala Leu Arg Gly Arg Gly Ala Cys Leu Asn Tyr Ala Asp
Ser Ala Trp 50 55 60 Arg Leu Arg Ile Pro Glu Thr Thr Cys His Lys
Asp Ile Gln Lys Ala 65 70 75 80 Ala Ala Glu Ala Ala Leu Ala Phe Glu
Ala Glu Lys Ser Asp Val Thr 85 90 95 Met Gln Asn Gly Gln Asn Met
Glu Glu Thr Thr Ala Val Ala Ser Gln 100 105 110 Ala Glu Val Asn Asp
Thr Thr Thr Glu His Gly Met Asn Met Glu Glu 115 120 125 Ala Thr Ala
Val Ala Ser Gln Ala Glu Val Asn Asp Thr Thr Thr Asp 130 135 140 His
Gly Val Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr Gly 145 150
155 160 Glu Gln Ser Glu Gly Phe Asn Met Ala Lys Glu Ser Thr Val Glu
Ala 165 170 175 Ala Val Val Thr Glu Glu Pro Ser Lys Gly Ser Tyr Met
Asp Glu Glu 180 185 190 Trp Met Leu Glu Met Pro Thr Leu Leu Ala Asp
Met Ala Glu Gly Met 195 200 205 Leu Leu 210 48 876 DNA Brassica
napus 48 accgctcgag caacaatgaa cacattccct gcttccactg aaatggttgg
ctccgagaac 60 gagtctccgg ttactacggt agtaggaggt gattattatc
ccatgttggc ggcaagctgt 120 ccgaagaagc cagcgggtag gaagaagttt
caggagacac gtcaccccat ttaccgagga 180 gttcgtctga gaaagtcagg
taagtgggtg tgtgaagtga gggaaccaaa caagaaatct 240 agaatttggc
ccggaacttt caaaacagct gagatggcag ctcgtgctca cgacgtcgct 300
gccctagccc tccgtggaag aggcgcctgc ctcaattatg cggactcggc ttggcggctc
360 cgcatcccgg aaacaacctg ccacaaggat atccagaagg ctgctgctga
agccgcattg 420 gcttttgagg ctgagaaaag tgatgtgacg atgcaaaatg
gcctgaacat ggaggagacg 480 acggcggtgg cttctcaggc tgaagtgaat
gacacgacga cagaacatgg catgaacatg 540 gaggaggcaa cagcggtggc
ttctcaggct gaggtgaatg acacgacgac agatcatggc 600 gtagacatgg
aggagacgat ggtggaggct gtttttacgg aggaacaaag tgaagggttc 660
aacatggcgg aggagtcgac ggtggaggct gctgttgtta cggatgaact gagcaaagga
720 ttttacatgg acgaggagtg gacgtacgag atgccgacct tgttggctga
tatggcggca 780 gggatgcttt tgccgccacc atctgtacaa tggggacata
atgatgactt ggaaggagat 840 gcggacatga acctctggag ttattaagga tccgcg
876 49 283 PRT Brassica napus 49 Met Asn Thr Phe Pro Ala Ser Thr
Glu Met Val Gly Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val
Val Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20 25 30 Ala Ser Cys Pro
Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr 35 40 45 Arg His
Pro Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp 50 55 60
Val Cys Glu Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Pro Gly 65
70 75 80 Thr Phe Lys Thr Ala Glu Met Ala Ala Arg Ala His Asp Val
Ala Ala 85 90 95 Leu Ala Leu Arg Gly Arg Gly Ala Cys Leu Asn Tyr
Ala Asp Ser Ala 100 105 110 Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys
His Lys Asp Ile Gln Lys 115 120 125 Ala Ala Ala Glu Ala Ala Leu Ala
Phe Glu Ala Glu Lys Ser Asp Val 130 135 140 Thr Met Gln Asn Gly Leu
Asn Met Glu Glu Thr Thr Ala Val Ala Ser 145 150 155 160 Gln Ala Glu
Val Asn Asp Thr Thr Thr Glu His Gly Met Asn Met Glu 165 170 175 Glu
Ala Thr Ala Val Ala Ser Gln Ala Glu Val Asn Asp Thr Thr Thr 180 185
190 Asp His Gly Val Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr
195 200 205 Glu Glu Gln Ser Glu Gly Phe Asn Met Ala Glu Glu Ser Thr
Val Glu 210 215 220 Ala Ala Val Val Thr Asp Glu Leu Ser Lys Gly Phe
Tyr Met Asp Glu 225 230 235 240 Glu Trp Thr Tyr Glu Met Pro Thr Leu
Leu Ala Asp Met Ala Ala Gly 245 250 255 Met Leu Leu Pro Pro Pro Ser
Val Gln Trp Gly His Asn Asp Asp Leu 260 265 270 Glu Gly Asp Ala Asp
Met Asn Leu Trp Ser Tyr 275 280 50 884 DNA Brassica napus 50
actacactca gccttatcca gtttttttca aaagattttt caacaatgaa cacattccct
60 gcgtccactg aaatggttgg ctccgagaac gagtctccgg ttactacggt
agcaggaggt 120 gattattatc ccatgttggc ggcaagctgt ccgaagaagc
cagcaggtag gaagaagttt 180 caggagacac gtcaccccat ttaccgagga
gttcgtctga gaaagtcagg taagtgggtg 240 tgtgaagtga gggaaccaaa
caagaaatct agaatttggc ccggaacttt caaaacagct 300 gagatggcag
ctcgtgctca cgacgtcgct gccctagccc tccgtggaag aggcgcctgc 360
ctcaattatg cggactcggc ttggcggctc cgcatcccgg agacaacctg ccacaaggat
420 atccagaagg ctgctgctga agccgcattg gcttttgagg ctgagaaaag
tgatgtgacg 480 atgcaaaatg gcctgaacat ggaggagacg acggcggtgg
cttctcaggc tgaagtgaat 540 gacacgacga cagaacatgg catgaacatg
gaggaggcaa cggcagtggc ttctcaggct 600 gaggtgaatg acacgacgac
ggatcatggc gtagacatgg aggagacaat ggtggaggct 660 gtttttactg
gggaacaaag tgaagggttt aacatggcga aggagtcgac ggtggaggct 720
gctgttgtta cggaggaacc gagcaaagga tcttacatgg acgaggagtg gatgctcgag
780 atgccgacct tgttggctga tatggcggaa gggatgcttt tgccgccgcc
gtccgtacaa 840 tggggacaga atgatgactt cgaaggagat gctgacatga acct 884
51 279 PRT Brassica napus 51 Met Asn Thr Phe Pro Ala Ser Thr Glu
Met Val Gly Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Ala
Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20 25 30 Ala Ser Cys Pro Lys
Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr 35 40 45 Arg His Pro
Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp 50 55 60 Val
Cys Glu Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Pro Gly 65 70
75 80 Thr Phe Lys Thr Ala Glu Met Ala Ala Arg Ala His Asp Val Ala
Ala 85 90 95 Leu Ala Leu Arg Gly Arg Gly Ala Cys Leu Asn Tyr Ala
Asp Ser Ala 100 105 110 Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys His
Lys Asp Ile Gln Lys 115 120 125 Ala Ala Ala Glu Ala Ala Leu Ala Phe
Glu Ala Glu Lys Ser Asp Val 130 135 140 Thr Met Gln Asn Gly Leu Asn
Met Glu Glu Thr Thr Ala Val Ala Ser 145 150 155 160 Gln Ala Glu Val
Asn Asp Thr Thr Thr Glu His Gly Met Asn Met Glu 165 170 175 Glu Ala
Thr Ala Val Ala Ser Gln Ala Glu Val Asn Asp Thr Thr Thr 180 185 190
Asp His Gly Val Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr 195
200 205 Gly Glu Gln Ser Glu Gly Phe Asn Met Ala Lys Glu Ser Thr Val
Glu 210 215 220 Ala Ala Val Val Thr Glu Glu Pro Ser Lys Gly Ser Tyr
Met Asp Glu 225 230 235 240 Glu Trp Met Leu Glu Met Pro Thr Leu Leu
Ala Asp Met Ala Glu Gly 245 250 255 Met Leu Leu Pro Pro Pro Ser Val
Gln Trp Gly Gln Asn Asp Asp Phe 260 265 270 Glu Gly Asp Ala Asp Met
Asn 275 52 874 DNA Brassica napus 52 gtaattcgat taccgctcga
gtacttacta tactacactc agccttatcc agtttttcaa 60 aagaagtttt
caactatgaa ctcagtctct actttttctg aacttcttgg ctctgagaac 120
gagtctccgg taggtggtga ttactgtccc atgttggcgg cgagctgtcc gaagaagccg
180 gcgggtagga agaagtttcg ggagacacgt caccccattt accgaggagt
tcgccttaga 240 aaatcaggta agtgggtgtg tgaagtgagg gaaccaaaca
aaaaatctag gatttggctc 300 ggaactttca aaacagctga gatcgcagct
cgtgctcacg acgtcgccgc cttagctctc 360 cgtggaagag gcgcctgcct
caacttcgcc gactcggctt ggcggctccg tatcccggag 420 acaacctgcg
ccaaggatat ccagaaggct gctgctgaag ccgcattggc ttttgaggcc 480
gagaagagtg ataccacgac gaatgatcat ggcatgaaca tggcttctca ggccgaggtt
540 aatgacacaa cggatcatgg cctggacatg gaggagacga tggtggaggc
tgtttttact 600 gaggagcaga gagacgggtt ttacatggcg gaggagacga
cggtggaggg tgttgttccg 660 gaggaacaga tgagcaaagg gttttacatg
gacgaggagt ggatgttcgg gatgccgacc 720 ttgttggctg atatggcggc
agggatgctc ttaccgccgc cgtccgtaca atggggacat 780 aatgatgact
tcgaaggaga tgttgacatg aacctctgga attattagta ctcatatttt 840
tttaaattat tttttgaacg aataatattt tatt 874 53 250 PRT Brassica napus
53 Met Asn Ser Val Ser Thr Phe Ser Glu Leu Leu Gly Ser Glu Asn Glu
1 5 10 15 Ser Pro Val Gly Gly Asp Tyr Cys Pro Met Leu Ala Ala Ser
Cys Pro 20 25 30 Lys Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr
Arg His Pro Ile 35 40 45 Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly
Lys Trp Val Cys Glu Val 50 55 60 Arg Glu Pro Asn Lys Lys Ser Arg
Ile Trp Leu Gly Thr Phe Lys Thr 65 70 75 80 Ala Glu Ile Ala Ala Arg
Ala His Asp Val Ala Ala Leu Ala Leu Arg 85 90 95 Gly Arg Gly Ala
Cys Leu Asn Phe Ala Asp Ser Ala Trp Arg Leu Arg 100 105 110 Ile Pro
Glu Thr Thr Cys Ala Lys Asp Ile Gln Lys Ala Ala Ala Glu 115 120 125
Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp Thr Thr Thr Asn Asp 130
135 140 His Gly Met Asn Met Ala Ser Gln Ala Glu Val Asn Asp Thr Thr
Asp 145 150 155 160 His Gly Leu Asp Met Glu Glu Thr Met Val Glu Ala
Val Phe Thr Glu 165 170 175 Glu Gln Arg Asp Gly Phe Tyr Met Ala Glu
Glu Thr Thr Val Glu Gly 180 185 190 Val Val Pro Glu Glu Gln Met Ser
Lys Gly Phe Tyr Met Asp Glu Glu 195 200 205 Trp Met Phe Gly Met Pro
Thr Leu Leu Ala Asp Met Ala Ala Gly Met 210 215 220 Leu Leu Pro Pro
Pro Ser Val Gln Trp Gly His Asn Asp Asp Phe Glu 225 230 235 240 Gly
Asp Val Asp Met Asn Leu Trp Asn Tyr 245 250 54 898 DNA Brassica
napus 54 aataaatatc ttatcaaacc agtcagaaca gagatcttgt tacttactat
actacactca 60 gccttatcca gttttcaaaa aaagtattca acgatgaact
cagtctctac tttttctgaa 120 ctgctccgct ccgagaacga gtctccggtt
aatacggaag gtggtgatta cattttggcg 180 gcgagctgtc ccaagaaacc
tgctggtagg aagaagtttc aggagacacg ccaccccatt 240 tacagaggag
ttcgtctgag gaagtcaggt aagtgggtgt gtgaagtgag ggaaccaaac 300
aagaaatcta gaatttggct cggaactttc aaaacagctg agatcgcagc tcgtgctcac
360 gacgttgccg ccttagctct ccgtggaaga ggcgcctgcc tcaacttcgc
cgactcggct 420 tggcggctcc gtatcccgga gacgacctgc gccaaggata
tccagaaggc tgctgctgaa 480 gccgcattgg cttttgaggc cgagaagagt
gataccacga cgaatgatca tggcatgaac 540 atggcttctc aggttgaggt
taatgacacg acggatcatg acctggacat ggaggagacg 600 atagtggagg
ctgtttttag ggaggaacag agagaagggt tttacatggc ggaggagacg 660
acggttgtgg gtgttgttcc ggaggaacag atgagcaaag ggttttacat ggacgaggag
720 tggatgttcg ggatgccgac cttgttggct gatatggcgg cagggatgct
cttaccgctg 780 ccgtccgtac aatggggaca taatgatgac ttcgaaggag
atgctgacat gaacctctgg 840 aattattagt actcatattt ttttaaatta
ttttttgaac gaataatatt ttattgaa 898 55 251 PRT Brassica napus 55 Met
Asn Ser Val Ser Thr Phe Ser Glu Leu Leu Arg Ser Glu Asn Glu 1 5 10
15 Ser Pro Val Asn Thr Glu Gly Gly Asp Tyr Ile Leu Ala Ala Ser Cys
20 25 30 Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr Arg
His Pro 35 40 45 Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly Lys
Trp Val Cys Glu 50 55 60 Val Arg Glu Pro Asn Lys Lys Ser Arg Ile
Trp Leu Gly Thr Phe Lys 65 70 75 80 Thr Ala Glu Ile Ala Ala Arg Ala
His Asp Val Ala Ala Leu Ala Leu 85 90 95 Arg Gly Arg Gly Ala Cys
Leu Asn Phe Ala Asp Ser Ala Trp Arg Leu 100 105 110 Arg Ile Pro Glu
Thr Thr Cys Ala Lys Asp Ile Gln Lys Ala Ala Ala 115 120 125 Glu Ala
Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp Thr Thr Thr Asn 130 135 140
Asp His Gly Met Asn Met Ala Ser Gln Val Glu Val Asn Asp Thr Thr 145
150 155 160 Asp His Asp Leu Asp Met Glu Glu Thr Ile Val Glu Ala Val
Phe Arg 165 170 175 Glu Glu Gln Arg Glu Gly Phe Tyr Met Ala Glu Glu
Thr Thr Val Val 180 185 190 Gly Val Val Pro Glu Glu Gln Met Ser Lys
Gly Phe Tyr Met Asp Glu 195 200 205 Glu Trp Met Phe Gly Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly 210 215 220 Met Leu Leu Pro Leu Pro
Ser Val Gln Trp Gly His Asn Asp Asp Phe 225 230 235 240 Glu Gly Asp
Ala Asp Met Asn Leu Trp Asn Tyr 245
250 56 1132 DNA Brassica napus 56 gattaccgct cgagtactta ctatactaca
ctcagcctta tccagttttt ctcaaaagat 60 ttttcaacaa tgaacacatt
ccctgcttcc actgaaatgg ttggctccga gaacgagtct 120 ccggttacta
cggtagtagg aggtgattat tatcccatgt tggcggcaag ctgtccgaag 180
aagccagcgg gtaggaagaa gtttcaggag acacgtcacc ccatttaccg aggagttcgt
240 ctgagaaagt caggtaagtg ggtgtgtgaa gtgagggaac caaacaagaa
atctagaatt 300 tggcttggaa ctttcaaaac agctgagatg gcagctcgtg
ctcacgacgt ggctgcccta 360 gccctccgtg gaagaggcgc ctgcctcaat
tatgcggact cggcttcgcg gctccgcatc 420 ccggagacaa cctgccacaa
ggatatccag aaggctgctg ctgaagccgc attggctttt 480 gaggctgaga
aaagtgatgt gacgatggag gagacgatgg cggtggcttc tcaggctgaa 540
gtgaatgaca cgacgacaga tcatggcatg aacatggagg aggcaacagc ggtggcttct
600 caggctgagg tgaatgacac gacgacagat catggcgtag acatggagga
gacgatggtg 660 gaggctgttt ttacggagga acaaagtgaa gggttcaaca
tggcggagga gtcgacggtg 720 gaggctgctg ttgttacgga tgaactgagc
aaaggatttt acatggacga ggagtggacg 780 tacgagatgc cgaccttgtt
ggctgatatg gcggcaggga tgcttttgcc gccaccatct 840 gtacaatggg
gacataatga tgacttggaa ggagatgctg acatgaacct ctggaattat 900
taatactcgt gttttaaaaa ttatacattg tgcaataata ttttatcgaa tttctaattc
960 tgcctttaac ttttaatggg gatctttatt agtgtaggaa acgagtgtaa
atgttccgcc 1020 gtggtgttgt caaaatgctg attatttttt gtgtgcagca
taatcacgtt tggtttcctt 1080 tacactccaa atttagttga aatacaaata
gaatagaaaa gtgaaaaaat gt 1132 57 277 PRT Brassica napus 57 Met Asn
Thr Phe Pro Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu 1 5 10 15
Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20
25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu
Thr 35 40 45 Arg His Pro Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser
Gly Lys Trp 50 55 60 Val Cys Glu Val Arg Glu Pro Asn Lys Lys Ser
Arg Ile Trp Leu Gly 65 70 75 80 Thr Phe Lys Thr Ala Glu Met Ala Ala
Arg Ala His Asp Val Ala Ala 85 90 95 Leu Ala Leu Arg Gly Arg Gly
Ala Cys Leu Asn Tyr Ala Asp Ser Ala 100 105 110 Ser Arg Leu Arg Ile
Pro Glu Thr Thr Cys His Lys Asp Ile Gln Lys 115 120 125 Ala Ala Ala
Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp Val 130 135 140 Thr
Met Glu Glu Thr Met Ala Val Ala Ser Gln Ala Glu Val Asn Asp 145 150
155 160 Thr Thr Thr Asp His Gly Met Asn Met Glu Glu Ala Thr Ala Val
Ala 165 170 175 Ser Gln Ala Glu Val Asn Asp Thr Thr Thr Asp His Gly
Val Asp Met 180 185 190 Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu
Glu Gln Ser Glu Gly 195 200 205 Phe Asn Met Ala Glu Glu Ser Thr Val
Glu Ala Ala Val Val Thr Asp 210 215 220 Glu Leu Ser Lys Gly Phe Tyr
Met Asp Glu Glu Trp Thr Tyr Glu Met 225 230 235 240 Pro Thr Leu Leu
Ala Asp Met Ala Ala Gly Met Leu Leu Pro Pro Pro 245 250 255 Ser Val
Gln Trp Gly His Asn Asp Asp Leu Glu Gly Asp Ala Asp Met 260 265 270
Asn Leu Trp Asn Tyr 275 58 768 DNA Brassica napus 58 agtgatgttt
ttcaaaagaa gttttcaact atgaactcag tctctacttt ttctgaactt 60
cttggctctg agaacgagtc tccggtaggt ggtgattact gtcccatgtt ggcggcgagc
120 tgtccgaaga agccggcggg taggaagaag tttcgggaga cacgtcaccc
catttaccga 180 ggagttcgcc ttagaaaatc aggtaagtgg gtgtgtgaag
tgagggagcc aaacaagaaa 240 tctaggattt ggctcggtac tttcctaaca
gccgagatcg cagcccgtgc tcacgacgtc 300 gccgccatag ccctccgcgg
caaatcagct tgtctcaatt ttgccgactc cgcttggcgg 360 ctccgtatcc
cggagacaac atgccccaag gagattcaga aggcggctgc tgaagccgcg 420
gtggctttta aggctgagat aaataatacg acggcggatc atggcattga cgtggaggag
480 acgatcgttg aggctatttt cacggaggaa aacaacgatg gtttttatat
ggacgaggag 540 gagtccatgt tcgggatgcc ggccttgttg gctagtatgg
ctgaaggaat gcttttgccg 600 cctccgtccg tacaattcgg acatacctat
gactttgacg gagatgctga cgtgtccctt 660 tggagttatt agtacaaaga
ttttttattt ccatttttgg tataatactt ctttttgatt 720 ttcggattct
acctttttat gggtatcatt ttttttttag gaaacggg 768 59 213 PRT Brassica
napus 59 Met Asn Ser Val Ser Thr Phe Ser Glu Leu Leu Gly Ser Glu
Asn Glu 1 5 10 15 Ser Pro Val Gly Gly Asp Tyr Cys Pro Met Leu Ala
Ala Ser Cys Pro 20 25 30 Lys Lys Pro Ala Gly Arg Lys Lys Phe Arg
Glu Thr Arg His Pro Ile 35 40 45 Tyr Arg Gly Val Arg Leu Arg Lys
Ser Gly Lys Trp Val Cys Glu Val 50 55 60 Arg Glu Pro Asn Lys Lys
Ser Arg Ile Trp Leu Gly Thr Phe Leu Thr 65 70 75 80 Ala Glu Ile Ala
Ala Arg Ala His Asp Val Ala Ala Ile Ala Leu Arg 85 90 95 Gly Lys
Ser Ala Cys Leu Asn Phe Ala Asp Ser Ala Trp Arg Leu Arg 100 105 110
Ile Pro Glu Thr Thr Cys Pro Lys Glu Ile Gln Lys Ala Ala Ala Glu 115
120 125 Ala Ala Val Ala Phe Lys Ala Glu Ile Asn Asn Thr Thr Ala Asp
His 130 135 140 Gly Ile Asp Val Glu Glu Thr Ile Val Glu Ala Ile Phe
Thr Glu Glu 145 150 155 160 Asn Asn Asp Gly Phe Tyr Met Asp Glu Glu
Glu Ser Met Phe Gly Met 165 170 175 Pro Ala Leu Leu Ala Ser Met Ala
Glu Gly Met Leu Leu Pro Pro Pro 180 185 190 Ser Val Gln Phe Gly His
Thr Tyr Asp Phe Asp Gly Asp Ala Asp Val 195 200 205 Ser Leu Trp Ser
Tyr 210 60 953 DNA Brassica napus 60 accgctcgag caacaatgaa
cacattccct gcttccactg aaatggttgg ctccgagaac 60 gagtctccgg
ttactacggt agcaggaggt gattattatc ccatgttggc ggcaagctgt 120
ccgaagaagc cagcgggtag gaagaagttt caggagacac gtcaccccat ttaccgagga
180 gttcgtctga gaaagtcagg taagtgggtg tgtgaagtga gggaaccaaa
caagaaatct 240 agaatttggc ttggaacttt caaaacagct gagatggcag
ctcgtgctca cgacgtggct 300 gccctagccc tccgtggaag aggcgcctgc
ctcaattatg cggactcggc ttcgcggctc 360 cgcatcccgg agacaacctg
ccacaaggat atccagaagg ctgctgctga agccgcattg 420 gcttttgagg
ctgagaaaag tgatgtgacg atggaggaga cgatggcggt ggcttctcag 480
gctgaagtga atgacacgac gacagatcat ggcatgaaca tggaggaggc aacggcagtg
540 gcttctcagg ctgaggtgaa tgacacgacg acggatcatg gcgtagacat
ggaggagaca 600 atggtggagg ctgtttttac tggggaacaa agtgaagggt
ttaacatggc gaaggagtcg 660 acggtggagg ctgctgttgt tacggaggaa
ccgagcaaag gatcttacat ggacgaggag 720 tggatgctcg agatgccgac
cttgttggct gatatggcgg aagggatgct tttgccgccg 780 ccgtccgtac
aatggggaca gaatgatgac ttcgaaggag atgcggacat gaacctctgg 840
agttattaat actcgtattt ttaaaattat ttattgtgca ataatttttt atcgaatttc
900 gaattctgcc tttaattttt aatggggatc tttatttgcc aaaaaaaaaa aaa 953
61 277 PRT Brassica napus 61 Met Asn Thr Phe Pro Ala Ser Thr Glu
Met Val Gly Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Ala
Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20 25 30 Ala Ser Cys Pro Lys
Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr 35 40 45 Arg His Pro
Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp 50 55 60 Val
Cys Glu Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly 65 70
75 80 Thr Phe Lys Thr Ala Glu Met Ala Ala Arg Ala His Asp Val Ala
Ala 85 90 95 Leu Ala Leu Arg Gly Arg Gly Ala Cys Leu Asn Tyr Ala
Asp Ser Ala 100 105 110 Ser Arg Leu Arg Ile Pro Glu Thr Thr Cys His
Lys Asp Ile Gln Lys 115 120 125 Ala Ala Ala Glu Ala Ala Leu Ala Phe
Glu Ala Glu Lys Ser Asp Val 130 135 140 Thr Met Glu Glu Thr Met Ala
Val Ala Ser Gln Ala Glu Val Asn Asp 145 150 155 160 Thr Thr Thr Asp
His Gly Met Asn Met Glu Glu Ala Thr Ala Val Ala 165 170 175 Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp His Gly Val Asp Met 180 185 190
Glu Glu Thr Met Val Glu Ala Val Phe Thr Gly Glu Gln Ser Glu Gly 195
200 205 Phe Asn Met Ala Lys Glu Ser Thr Val Glu Ala Ala Val Val Thr
Glu 210 215 220 Glu Pro Ser Lys Gly Ser Tyr Met Asp Glu Glu Trp Met
Leu Glu Met 225 230 235 240 Pro Thr Leu Leu Ala Asp Met Ala Glu Gly
Met Leu Leu Pro Pro Pro 245 250 255 Ser Val Gln Trp Gly Gln Asn Asp
Asp Phe Glu Gly Asp Ala Asp Met 260 265 270 Asn Leu Trp Ser Tyr 275
62 889 DNA Brassica napus 62 ctagtgatta ccgctcgagc aacaatgaac
acattccctg cttccactga aatggttggc 60 tccgagaacg agtctccggt
tactacggta gcaggaggtg attattatcc catgttggcg 120 gcaagctgtc
cgaagaagcc agcgggtagg aagaagtttc aggagacacg tcaccccatt 180
taccgaggag ttcgtctgag aaagtcaggt aagtgggtgt gtgaagtgag ggaaccaaac
240 aagaaatcta gaatttggcc cggaactttc aaaacagctg agatggcagc
tcgtgctcac 300 gacgtcgctg ccctagccct ccgtggaaga ggcgcccgcc
tcaattatgc ggactcagct 360 tggcggctcc gcatcccgga gacaacctgc
cacaaggata tccagaaggc tgctgctgaa 420 gccgcattgg cttttgaggc
tgagaaaagt gatgtgacga tgcaaaatgg cctgaacatg 480 gaggagacga
cggcggtggc ttctcaggct gaagtgaatg acacgacgac agaacatggc 540
atgaacatgg aggaggcaac ggcagtggct tctcaggctg aggtgaatga cacgacgacg
600 gatcatggcg tagacatgga ggagacaatg gtggaggctg tttttactgg
ggaacaaagt 660 gaagggttta acatggcgaa ggagtcgacg gtggaggctg
ctgttgttac ggaggaaccg 720 agcaaaggat cttacatgga cgaggagtgg
atgctcgaga tgccgacctt gttggctgat 780 atggcggaag ggatgctttt
gccgccgccg tccgtacaat ggggacagaa tgatgacttc 840 gaaggagatg
cgcacatgaa cctctggagt tattaaggat ccgcgaatc 889 63 283 PRT Brassica
napus 63 Met Asn Thr Phe Pro Ala Ser Thr Glu Met Val Gly Ser Glu
Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Ala Gly Gly Asp Tyr Tyr
Pro Met Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg
Lys Lys Phe Gln Glu Thr 35 40 45 Arg His Pro Ile Tyr Arg Gly Val
Arg Leu Arg Lys Ser Gly Lys Trp 50 55 60 Val Cys Glu Val Arg Glu
Pro Asn Lys Lys Ser Arg Ile Trp Pro Gly 65 70 75 80 Thr Phe Lys Thr
Ala Glu Met Ala Ala Arg Ala His Asp Val Ala Ala 85 90 95 Leu Ala
Leu Arg Gly Arg Gly Ala Arg Leu Asn Tyr Ala Asp Ser Ala 100 105 110
Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys His Lys Asp Ile Gln Lys 115
120 125 Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp
Val 130 135 140 Thr Met Gln Asn Gly Leu Asn Met Glu Glu Thr Thr Ala
Val Ala Ser 145 150 155 160 Gln Ala Glu Val Asn Asp Thr Thr Thr Glu
His Gly Met Asn Met Glu 165 170 175 Glu Ala Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr 180 185 190 Asp His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr 195 200 205 Gly Glu Gln Ser
Glu Gly Phe Asn Met Ala Lys Glu Ser Thr Val Glu 210 215 220 Ala Ala
Val Val Thr Glu Glu Pro Ser Lys Gly Ser Tyr Met Asp Glu 225 230 235
240 Glu Trp Met Leu Glu Met Pro Thr Leu Leu Ala Asp Met Ala Glu Gly
245 250 255 Met Leu Leu Pro Pro Pro Ser Val Gln Trp Gly Gln Asn Asp
Asp Phe 260 265 270 Glu Gly Asp Ala His Met Asn Leu Trp Ser Tyr 275
280 64 563 DNA Brassica oleracea 64 caccctatct accggggagt
tcgcctgaga aagtcaggta agtgggtgtg tgaagtgagg 60 gagccaaaca
agaaatctag gatttggctt ggaactttca aaaccgcaga gatcgctgct 120
cgtgctcacg acgttgccgc cttagccctc cgtggaagag cggcctgtct caacttcgcc
180 gactcggctt ggcggctccg tatcccggag acaacttgcg ccaaggatat
ccagaaggct 240 gctgctgaag ctgcgttggc ttttggggcc gaaaagagtg
ataccacgac gaatgatcaa 300 ggcatgaaca tggaggagat gacggtggtg
gcttctcagg ctgaggtgag cgacacgacg 360 acatatcatg gcctggacat
ggaggagact atggtggagg ctgtttttgc tgaggaacag 420 agagaagggt
tttacttggc ggaggagacg acggtggagg gtgttgttac ggaggaacag 480
agcaaagggt tttatatgga cgaggagtgg acgttcggga tgcagtcctt tttggccgat
540 atggctgaag gcatgctctt tcc 563 65 188 PRT Brassica oleracea 65
His Pro Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp Val 1 5
10 15 Cys Glu Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly
Thr 20 25 30 Phe Lys Thr Ala Glu Ile Ala Ala Arg Ala His Asp Val
Ala Ala Leu 35 40 45 Ala Leu Arg Gly Arg Ala Ala Cys Leu Asn Phe
Ala Asp Ser Ala Trp 50 55 60 Arg Leu Arg Ile Pro Glu Thr Thr Cys
Ala Lys Asp Ile Gln Lys Ala 65 70 75 80 Ala Ala Glu Ala Ala Leu Ala
Phe Gly Ala Glu Lys Ser Asp Thr Thr 85 90 95 Thr Asn Asp Gln Gly
Met Asn Met Glu Glu Met Thr Val Val Ala Ser 100 105 110 Gln Ala Glu
Val Ser Asp Thr Thr Thr Tyr His Gly Leu Asp Met Glu 115 120 125 Glu
Thr Met Val Glu Ala Val Phe Ala Glu Glu Gln Arg Glu Gly Phe 130 135
140 Tyr Leu Ala Glu Glu Thr Thr Val Glu Gly Val Val Thr Glu Glu Gln
145 150 155 160 Ser Lys Gly Phe Tyr Met Asp Glu Glu Trp Thr Phe Gly
Met Gln Ser 165 170 175 Phe Leu Ala Asp Met Ala Glu Gly Met Leu Phe
Pro 180 185 66 533 DNA Brassica oleracea 66 gaaacataga tctttgtact
tactatactt caccttatcc agttttattt ttttatttat 60 aaagagtttt
caacaatgac ctcattttct accttttctg aactgttggg ctccgagcat 120
gagtctccgg ttacattagg cgaagagtat tgtccgaagc tggccgcaag ctgtccgaag
180 aaaccagccg gccggaagaa gtttcgagag acgcgtcacc cagtttacag
aggagttcgt 240 ctgagaaact caggtaagtg ggtgtgtgaa gtgagggagc
caaacaagaa atctaggatt 300 tggctcggta ctttcctaac agccgagatc
gcagcccgtg ctcacgacgt cgccgccata 360 gccctccgcg gcaaatcagc
ttgtctcaat tttgccgact ccgcttggcg gctccgtatc 420 ccggagacaa
catgccccaa ggagattcag aaggcggctg ctgaagccgc ggtggctttt 480
aaggctgaga taaataatac gacggcggat cacggcctcg acatggaaga gac 533 67
152 PRT Brassica oleracea 67 Met Thr Ser Phe Ser Thr Phe Ser Glu
Leu Leu Gly Ser Glu His Glu 1 5 10 15 Ser Pro Val Thr Leu Gly Glu
Glu Tyr Cys Pro Lys Leu Ala Ala Ser 20 25 30 Cys Pro Lys Lys Pro
Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg His 35 40 45 Pro Val Tyr
Arg Gly Val Arg Leu Arg Asn Ser Gly Lys Trp Val Cys 50 55 60 Glu
Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly Thr Phe 65 70
75 80 Leu Thr Ala Glu Ile Ala Ala Arg Ala His Asp Val Ala Ala Ile
Ala 85 90 95 Leu Arg Gly Lys Ser Ala Cys Leu Asn Phe Ala Asp Ser
Ala Trp Arg 100 105 110 Leu Arg Ile Pro Glu Thr Thr Cys Pro Lys Glu
Ile Gln Lys Ala Ala 115 120 125 Ala Glu Ala Ala Val Ala Phe Lys Ala
Glu Ile Asn Asn Thr Thr Ala 130 135 140 Asp His Gly Leu Asp Met Glu
Glu 145 150 68 887 DNA Brassica oleracea 68 actcagcctt atccagtttt
tctcaaaaga tttttcaaca atgaacacat tccctgcttc 60 cactgaaatg
gttggctccg agaacgagtc tccggttact acggtagtag gaggtgatta 120
ttatcccatg ttggcggcaa gctgtccgaa gaagccagcg ggtaggaaga agtttcagga
180 gacacgtcac cccatttacc gaggagttcg tctgagaaag tcaggtaagt
gggtgtgtga 240 agtgagggaa ccaaacaaga aatctagaat ttggcttgga
actttcaaaa cagctgagat 300 ggcagctcgt gctcacgacg tggctgccct
agccctccgt ggaagaggcg cctgcctcaa 360 ttatgcggac tcggcttggc
ggctccgcat cccggagaca acctgccaca aggatatcca 420 gaaggctgct
gctgaagccg cattggcttt tgaggctgag aaaagtgatg tgacgatgga 480
ggagacgatg gcggtggctt ctcaggctga agtgaatgac acgacgacag atcatggcat
540 gaacatggag gaggcaacag cggtggcttc tcaggctgag gtgaatgaca
cgacgacaga 600 tcatggcgta gacatggagg agacgatggt ggaggctgtt
tttacggagg aacaaagtga 660 agggttcaac atggcggagg agtcgacggt
ggaggctgct gttgttacgg atgaactgag 720 caaaggattt tacatggacg
aggagtggac gtacgagatg ccgaccttgt tggctgatat 780 ggcggcaggg
atgcttttgc cgccaccatc tgtacaatgg ggacataatg atgacttgga 840
aggagatgcg gacatgaacc tctggagtta ttaatactcg tattttt 887 69 277 PRT
Brassica oleracea 69 Met Asn Thr Phe Pro Ala Ser Thr Glu Met Val
Gly Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Val Gly Gly
Asp Tyr Tyr Pro Met Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro
Ala Gly Arg Lys Lys Phe Gln Glu Thr 35 40 45 Arg His Pro Ile Tyr
Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp 50
55 60 Val Cys Glu Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu
Gly 65 70 75 80 Thr Phe Lys Thr Ala Glu Met Ala Ala Arg Ala His Asp
Val Ala Ala 85 90 95 Leu Ala Leu Arg Gly Arg Gly Ala Cys Leu Asn
Tyr Ala Asp Ser Ala 100 105 110 Trp Arg Leu Arg Ile Pro Glu Thr Thr
Cys His Lys Asp Ile Gln Lys 115 120 125 Ala Ala Ala Glu Ala Ala Leu
Ala Phe Glu Ala Glu Lys Ser Asp Val 130 135 140 Thr Met Glu Glu Thr
Met Ala Val Ala Ser Gln Ala Glu Val Asn Asp 145 150 155 160 Thr Thr
Thr Asp His Gly Met Asn Met Glu Glu Ala Thr Ala Val Ala 165 170 175
Ser Gln Ala Glu Val Asn Asp Thr Thr Thr Asp His Gly Val Asp Met 180
185 190 Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu Glu Gln Ser Glu
Gly 195 200 205 Phe Asn Met Ala Glu Glu Ser Thr Val Glu Ala Ala Val
Val Thr Asp 210 215 220 Glu Leu Ser Lys Gly Phe Tyr Met Asp Glu Glu
Trp Thr Tyr Glu Met 225 230 235 240 Pro Thr Leu Leu Ala Asp Met Ala
Ala Gly Met Leu Leu Pro Pro Pro 245 250 255 Ser Val Gln Trp Gly His
Asn Asp Asp Leu Glu Gly Asp Ala Asp Met 260 265 270 Asn Leu Trp Ser
Tyr 275 70 950 DNA Brassica oleracea 70 ctgaaaagaa gataaaagag
agagaaataa atatcttatc aaaccagaca gaacagagat 60 cttgttactt
actatactac actcagcctt atccagtttt tcaaaagaag ttttcaacta 120
tgaactcagt ctctactttt tctgaacttc ttggctctga gaacgagtct ccggtaggtg
180 gtgattactg tcccatgttg gcggcgagct gtccgaagaa gccggcgggt
aggaagaagt 240 ttcgggagac acgtcacccc atttaccgag gagttcgcct
tagaaaatca ggtaagtggg 300 tgtgtgaagt gagggaacca aacaaaaaat
ctaggatttg gctcggaact ttcaaaacag 360 ctgagatcgc agctcgtgct
cacgacgtcg ccgccttagc tctccgtgga agaggcgcct 420 gcctcaactt
cgccgactcg gcttggcggc tccgtatccc ggagacaacc tgcgccaagg 480
atatccagaa ggctgctgct gaagccgcat tggcttttga ggccgagaag agtgatacca
540 cgacgaatga tcatggcatg aacatggctt ctcaggctga ggttaatgac
acgacggatc 600 atggcctgga catggaggag acgatggtgg aggctgtttt
tactgaggag cagagagacg 660 ggttttacat ggcggaggag acgacggtgg
agggtgttgt tccggaggaa cagatgagca 720 aagggtttta catggacgag
gagtggatgt tcgggatgcc gaccttgttg gctgatatgg 780 cggcagggat
gctcttaccg ccgccgtccg tacaatgggg acataatgat gacttcgaag 840
gagatgctga catgaacctc tggaattatt agtactcgta tttttttaaa ttattttttg
900 aacgaataat attttattga attcggattc tacctgtttt tttaatggat 950 71
250 PRT Brassica oleracea 71 Met Asn Ser Val Ser Thr Phe Ser Glu
Leu Leu Gly Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Gly Gly Asp Tyr
Cys Pro Met Leu Ala Ala Ser Cys Pro 20 25 30 Lys Lys Pro Ala Gly
Arg Lys Lys Phe Arg Glu Thr Arg His Pro Ile 35 40 45 Tyr Arg Gly
Val Arg Leu Arg Lys Ser Gly Lys Trp Val Cys Glu Val 50 55 60 Arg
Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly Thr Phe Lys Thr 65 70
75 80 Ala Glu Ile Ala Ala Arg Ala His Asp Val Ala Ala Leu Ala Leu
Arg 85 90 95 Gly Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser Ala Trp
Arg Leu Arg 100 105 110 Ile Pro Glu Thr Thr Cys Ala Lys Asp Ile Gln
Lys Ala Ala Ala Glu 115 120 125 Ala Ala Leu Ala Phe Glu Ala Glu Lys
Ser Asp Thr Thr Thr Asn Asp 130 135 140 His Gly Met Asn Met Ala Ser
Gln Ala Glu Val Asn Asp Thr Thr Asp 145 150 155 160 His Gly Leu Asp
Met Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu 165 170 175 Glu Gln
Arg Asp Gly Phe Tyr Met Ala Glu Glu Thr Thr Val Glu Gly 180 185 190
Val Val Pro Glu Glu Gln Met Ser Lys Gly Phe Tyr Met Asp Glu Glu 195
200 205 Trp Met Phe Gly Met Pro Thr Leu Leu Ala Asp Met Ala Ala Gly
Met 210 215 220 Leu Leu Pro Pro Pro Ser Val Gln Trp Gly His Asn Asp
Asp Phe Glu 225 230 235 240 Gly Asp Ala Asp Met Asn Leu Trp Asn Tyr
245 250 72 877 DNA Brassica oleracea 72 accgctcgag caacaatgaa
cacattccct gcttccactg aaatggttag ctccgagaac 60 gagtctccgg
ttactacggt agtaggaggt gattattatc ccatgttggc ggcaagctgt 120
ccgaagaagc cagcgggtag gaagaagttt caggagacac gtcaccccat ttaccgagga
180 gttcgtctga gaaagtcagg taagtgggtg tgtgaagtga gggaactaaa
caagaaatct 240 agaatttggc ttggaacttt caaaacagct gagatggcag
ctcgtgctca cgacgtggct 300 gccctagccc tccgtggaag aggcgcctgc
ctcaattatg cggactcggc ttggcggctc 360 cgcatcccgg agacaacctg
ccacaaggat atccagaagg ctgctgctga agccgcattg 420 gcttttgagg
ctgagaagag tgatgcgacg atgcaaaatg gcctgaacat ggaggagacg 480
acggcggcgg cttctcagac tgaagtgagt gacacgacga cagatcatgg catgaacatg
540 gaggagacaa cggcggtggc ttctcaggct gaggtgaatg acacgacgac
agatcatggc 600 gtagacatgg aggagacgat ggtggaggct gtttttactg
aggaacaaag tgaagggttc 660 aacatggcga aggagtcgac ggcggaggct
gctgttgtta cggaggaact gagcaaagga 720 gtttacatgg acgaggagtg
gacgtacgag atgccgacct tgttggctga tatggcggca 780 gggatgcttt
tgccgccacc atctgtacaa tggggacata atgatgactt ggaaggagat 840
gcggacatga acctactgga gttattaagg atccgcg 877 73 287 PRT Brassica
oleracea 73 Met Asn Thr Phe Pro Ala Ser Thr Glu Met Val Ser Ser Glu
Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr Tyr
Pro Met Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg
Lys Lys Phe Gln Glu Thr 35 40 45 Arg His Pro Ile Tyr Arg Gly Val
Arg Leu Arg Lys Ser Gly Lys Trp 50 55 60 Val Cys Glu Val Arg Glu
Leu Asn Lys Lys Ser Arg Ile Trp Leu Gly 65 70 75 80 Thr Phe Lys Thr
Ala Glu Met Ala Ala Arg Ala His Asp Val Ala Ala 85 90 95 Leu Ala
Leu Arg Gly Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser Ala 100 105 110
Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys His Lys Asp Ile Gln Lys 115
120 125 Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp
Ala 130 135 140 Thr Met Gln Asn Gly Leu Asn Met Glu Glu Thr Thr Ala
Ala Ala Ser 145 150 155 160 Gln Thr Glu Val Ser Asp Thr Thr Thr Asp
His Gly Met Asn Met Glu 165 170 175 Glu Thr Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr 180 185 190 Asp His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr 195 200 205 Glu Glu Gln Ser
Glu Gly Phe Asn Met Ala Lys Glu Ser Thr Ala Glu 210 215 220 Ala Ala
Val Val Thr Glu Glu Leu Ser Lys Gly Val Tyr Met Asp Glu 225 230 235
240 Glu Trp Thr Tyr Glu Met Pro Thr Leu Leu Ala Asp Met Ala Ala Gly
245 250 255 Met Leu Leu Pro Pro Pro Ser Val Gln Trp Gly His Asn Asp
Asp Leu 260 265 270 Glu Gly Asp Ala Asp Met Asn Leu Leu Glu Leu Leu
Arg Ile Arg 275 280 285 74 374 DNA Brassica rapa 74 catcccattt
acaggggggt tcgtttaaga aagtcaggta agtgggtgtg tgaagtgagg 60
gaaccaaaca agaaatctag gatttggctc ggaactttca aaaccgctga gatcgctgct
120 cgtgctcacg acgttgctgc cttagccctc cgcgggagag gcgcctgcct
caacttcgcc 180 gactcggctt ggcggctccg tatcccggag acaacctgcg
ccaaggacat ccagaaggcg 240 gctgctgaag ctgcattggc ttttgaggcc
gagaagagtg atcatggcat gaacatcaag 300 aatactacgg cggtggtttc
tcaggttgag gtgaatgaca cgacgacgga ccacggcttg 360 gacatggagg agac 374
75 124 PRT Brassica rapa 75 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser Ala Trp 50 55 60 Arg Leu
Arg Ile Pro Glu Thr Thr Cys Ala Lys Asp Ile Gln Lys Ala 65 70 75 80
Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp His Gly 85
90 95 Met Asn Ile Lys Asn Thr Thr Ala Val Val Ser Gln Val Glu Val
Asn 100 105 110 Asp Thr Thr Thr Asp His Gly Leu Asp Met Glu Glu 115
120 76 884 DNA Brassica rapa 76 tacactcagc cttatccagt ttttttcaaa
agacttttca acaatgaaca cattccctgc 60 gtccactgaa atggttggct
ccgagaacga gtctccggtt actacggtag caggaggtga 120 ttattatccc
atgttggcgg caagctgtcc gaagaagcca gcgggtagga agaagtttca 180
ggagacacgt caccccattt accgaggagt tcgtctgaga aagtcaggta agtgggtgtg
240 tgaagtgagg gaaccaaaca agaaatctag aatttggctt ggaactttca
aaacagctga 300 gatggcagct cgtgctcacg acgtcgctgc cctagccctc
cgtggaagag gcgcctgcct 360 caattatgcg gactcggctt ggcggctccg
catcccggag acaacctgcc acaaggatat 420 ccagaaggct gctgctgaag
ccgcattggc ttttgaggct gagaaaagtg atgtgacgat 480 gcaaaatggc
ctgaacatgg aggagatgac ggcggtggct tctcaggctg aagtgaatga 540
cacgacgaca gaacatggca tgaacatgga ggaggcaacg gcagtggctt ctcaggctga
600 ggtgaatgac acgacgacgg atcatggcgt agacatggag gagacaatgg
tggaggctgt 660 ttttactgag gaacaaagtg aagggtttaa catggcgaag
gagtcgacgg tggaggctgc 720 tgttgttacg gaggaaccga gcaaaggatc
ttacatggac gaggagtgga tgctcgagat 780 gccgaccttg ttggctgata
tggcggaagg gatgcttttg ccgccgccgt ccgtacaatg 840 gggacagaat
gatgacttcg aaggagatgc tgacatgaac ctct 884 77 280 PRT Brassica rapa
77 Met Asn Thr Phe Pro Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu
1 5 10 15 Ser Pro Val Thr Thr Val Ala Gly Gly Asp Tyr Tyr Pro Met
Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys
Phe Gln Glu Thr 35 40 45 Arg His Pro Ile Tyr Arg Gly Val Arg Leu
Arg Lys Ser Gly Lys Trp 50 55 60 Val Cys Glu Val Arg Glu Pro Asn
Lys Lys Ser Arg Ile Trp Leu Gly 65 70 75 80 Thr Phe Lys Thr Ala Glu
Met Ala Ala Arg Ala His Asp Val Ala Ala 85 90 95 Leu Ala Leu Arg
Gly Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser Ala 100 105 110 Trp Arg
Leu Arg Ile Pro Glu Thr Thr Cys His Lys Asp Ile Gln Lys 115 120 125
Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp Val 130
135 140 Thr Met Gln Asn Gly Leu Asn Met Glu Glu Met Thr Ala Val Ala
Ser 145 150 155 160 Gln Ala Glu Val Asn Asp Thr Thr Thr Glu His Gly
Met Asn Met Glu 165 170 175 Glu Ala Thr Ala Val Ala Ser Gln Ala Glu
Val Asn Asp Thr Thr Thr 180 185 190 Asp His Gly Val Asp Met Glu Glu
Thr Met Val Glu Ala Val Phe Thr 195 200 205 Glu Glu Gln Ser Glu Gly
Phe Asn Met Ala Lys Glu Ser Thr Val Glu 210 215 220 Ala Ala Val Val
Thr Glu Glu Pro Ser Lys Gly Ser Tyr Met Asp Glu 225 230 235 240 Glu
Trp Met Leu Glu Met Pro Thr Leu Leu Ala Asp Met Ala Glu Gly 245 250
255 Met Leu Leu Pro Pro Pro Ser Val Gln Trp Gly Gln Asn Asp Asp Phe
260 265 270 Glu Gly Asp Ala Asp Met Asn Leu 275 280 78 806 DNA
Brassica rapa 78 acactcagcc ttatccagtt ttcaaaaaaa gtattcaacg
atgaactcag tctctacttt 60 ttctgaactg ctctgctccg agaacgagtc
tccggttaat acggaaggtg gtgattacat 120 tttggcggcg agctgtccca
agaaacctgc tggtaggaag aagtttcagg agacacgcca 180 ccccatttac
agaggagttc gtctgaggaa gtcaggtaag tgggtgtgtg aagtgaggga 240
accaaacaag aaatctagaa tttggctcgg aactttcaaa acagctgaga tcgcagctcg
300 tgctcacgac gttgccgcct tagctctccg tggaagaggc gcctgcctca
acttcgccga 360 ctcggcttgg cggctccgta tcccggagac gacctgcgcc
aaggatatcc agaaggctgc 420 tgctgaagcc gcattggctt ttgaggccga
gaagagtgat accacgacga atgatcgtgg 480 catgaacatg gaggagacgt
cggcggtggc ttctccggct gagttgaatg atacgacggc 540 ggatcatggc
ctggacatgg aggagacgat ggtggaggct gtttttaggg aggaacagag 600
agaagggttt tacatggcgg aggagacgac ggtggagggt gttgttccgg agtaacagat
660 gagcaaaggg ttttacatgg acgaggagtg gacgttcgag atgccgaggt
tgttggctga 720 tatggcggaa gggatgcttt tgccgccccc gtccgtacaa
tggggacata acgatgactt 780 cgaaggagat gctgacatga acctct 806 79 204
PRT Brassica rapa 79 Met Asn Ser Val Ser Thr Phe Ser Glu Leu Leu
Cys Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Asn Thr Glu Gly Gly Asp
Tyr Ile Leu Ala Ala Ser Cys 20 25 30 Pro Lys Lys Pro Ala Gly Arg
Lys Lys Phe Gln Glu Thr Arg His Pro 35 40 45 Ile Tyr Arg Gly Val
Arg Leu Arg Lys Ser Gly Lys Trp Val Cys Glu 50 55 60 Val Arg Glu
Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly Thr Phe Lys 65 70 75 80 Thr
Ala Glu Ile Ala Ala Arg Ala His Asp Val Ala Ala Leu Ala Leu 85 90
95 Arg Gly Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser Ala Trp Arg Leu
100 105 110 Arg Ile Pro Glu Thr Thr Cys Ala Lys Asp Ile Gln Lys Ala
Ala Ala 115 120 125 Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp
Thr Thr Thr Asn 130 135 140 Asp Arg Gly Met Asn Met Glu Glu Thr Ser
Ala Val Ala Ser Pro Ala 145 150 155 160 Glu Leu Asn Asp Thr Thr Ala
Asp His Gly Leu Asp Met Glu Glu Thr 165 170 175 Met Val Glu Ala Val
Phe Arg Glu Glu Gln Arg Glu Gly Phe Tyr Met 180 185 190 Ala Glu Glu
Thr Thr Val Glu Gly Val Val Pro Glu 195 200 80 755 DNA Brassica
rapa 80 accgctcgag tacttactat actacactca gccttatcca gtttttcttc
caacgatgga 60 ctcaatctct acttttcctg aactgcttgg ctcagagaac
gagtctccgg ttactacggt 120 agtaggaggt gattattgtc ccaggttggc
ggcaagctgt ccgaagaagc cagcgggtag 180 gaagaagttt caggagacac
gtcaccccat ttaccgtgga gttcgtttaa gaaagtccgg 240 taagtgggtg
tgtgaagtga gggaaccaaa caagaaatct aggatttggc tcggaacttt 300
caaaaccgct gagatcgctg ctcgtgctca cgacgttgct gccttagccc tccgcggaag
360 aggcgcctgc ctcaacttcg ccgactcggc ttgacggctc cgtatcccgg
agacaacctg 420 cgccaaggat atccagaagg ctgctgctga agctgcattg
gcttttgagg ccgagaagag 480 tgatcatggc atgaacatga agaatactac
ggcggtggct tctcaggttg aggtgaatga 540 tacgacgacg gaccatggcg
tggacatgga ggagacgagg gtggagggtg ttgttacgga 600 ggaacagaac
aattggtttt acatggacga ggagtggatg tttgggatgc cgacgttgtt 660
ggttgatatg gcggaaggga tgcttatacc gcggcagtcc gtacaatcgg gacactacga
720 tgacttcgaa ggagatgctg acatgaacct ctgga 755 81 112 PRT Brassica
rapa 81 Met Asp Ser Ile Ser Thr Phe Pro Glu Leu Leu Gly Ser Glu Asn
Glu 1 5 10 15 Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr Cys Pro
Arg Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys
Lys Phe Gln Glu Thr 35 40 45 Arg His Pro Ile Tyr Arg Gly Val Arg
Leu Arg Lys Ser Gly Lys Trp 50 55 60 Val Cys Glu Val Arg Glu Pro
Asn Lys Lys Ser Arg Ile Trp Leu Gly 65 70 75 80 Thr Phe Lys Thr Ala
Glu Ile Ala Ala Arg Ala His Asp Val Ala Ala 85 90 95 Leu Ala Leu
Arg Gly Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser Ala 100 105 110 82
832 DNA Brassica rapa 82 accgctcgag tacttactat actacactca
gccttatcca gtttttcttc caacgatgga 60 ctcaatctct acttttcctg
aactgcttgg ctcagagaac gagtctccgg ttactacggt 120 agtaggaggt
gattattgtc ccaggttggc ggcaagctgt ccgaagaagc cagcgggtag 180
gaagaagttt caggagacac gtcaccccat ttaccgtgga gttcgtttaa gaaagtccgg
240 taagtgggtg tgtgaagtga gggaaccaaa caagaaatct aggatttggc
tcggaacttt 300 caaaaccgct gagatcgctg ctcgtgctca cgacgttgct
gccttagccc tccgcggaag 360 aggcgcctgc ctcaacttcg ccgactcggc
ttggcggctc cgtatcccgg agacaacctg 420 cgccaaggat atccagaagg
ctgctgctga agctgctttg gcttttgagg ccgagaagag 480 tgatcatggc
atgaacatga agaatactac ggcggtggct tctcaggttg aggtgaatga 540
tacgacgacg gaccatggcg tggacatgga ggagacgttg gtggaggctg tttttacgga
600 ggaacagaga gaagggtttt acatgacgga ggagacgagg gtggagggtg
ttgttacgga 660 ggaacagaac aattggtttt acatggacga ggagtggatg
tttgggatgc cgacgttgtt 720 ggttgatatg gcggaaggga tgcttatacc
gcggcagtcc gtacaatcgg gacactacga 780 tgacttcgaa ggagatgctg
acatgaacct ctggaattat tagggatccg cg 832 83 255 PRT
Brassica rapa 83 Met Asp Ser Ile Ser Thr Phe Pro Glu Leu Leu Gly
Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Val Gly Gly Asp
Tyr Cys Pro Arg Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala
Gly Arg Lys Lys Phe Gln Glu Thr 35 40 45 Arg His Pro Ile Tyr Arg
Gly Val Arg Leu Arg Lys Ser Gly Lys Trp 50 55 60 Val Cys Glu Val
Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly 65 70 75 80 Thr Phe
Lys Thr Ala Glu Ile Ala Ala Arg Ala His Asp Val Ala Ala 85 90 95
Leu Ala Leu Arg Gly Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser Ala 100
105 110 Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys Ala Lys Asp Ile Gln
Lys 115 120 125 Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys
Ser Asp His 130 135 140 Gly Met Asn Met Lys Asn Thr Thr Ala Val Ala
Ser Gln Val Glu Val 145 150 155 160 Asn Asp Thr Thr Thr Asp His Gly
Val Asp Met Glu Glu Thr Leu Val 165 170 175 Glu Ala Val Phe Thr Glu
Glu Gln Arg Glu Gly Phe Tyr Met Thr Glu 180 185 190 Glu Thr Arg Val
Glu Gly Val Val Thr Glu Glu Gln Asn Asn Trp Phe 195 200 205 Tyr Met
Asp Glu Glu Trp Met Phe Gly Met Pro Thr Leu Leu Val Asp 210 215 220
Met Ala Glu Gly Met Leu Ile Pro Arg Gln Ser Val Gln Ser Gly His 225
230 235 240 Tyr Asp Asp Phe Glu Gly Asp Ala Asp Met Asn Leu Trp Asn
Tyr 245 250 255 84 830 DNA Brassica rapa 84 tactacactc agccttatcc
agttttcaaa aaaagtattc aactatgaac tcagtctcta 60 ctttttctga
actgctctgc tccgagaaca agtctccggt taatacggaa ggtggtgatt 120
acattttggc ggcgagctgt cccaagaaac ctgctggtag gaagaagttt caggagacac
180 gccaccccat ttacagagga gttcgcctaa gaaagtcagg taagtgggtg
tgtgaagtga 240 gggaaccaaa caagaaatct agaatttggc tcggaacttt
caaaacagct gagatagcag 300 ctcgtgctca cgacgtcgcc gccttagctc
tccgtggaag aggcgcctgc ctcaacttcg 360 ccgactcggc ttggcggctc
cgtatcccag agacaacctg cgccaaggat atccagaagg 420 ctgctgctga
agccgcattg gcttttgagg ccgagaagag tgataccacg acgaatgatc 480
gtggcatgaa catggaggag acgtccgcgg tggcttctcc ggctgagttg aatgatacga
540 cggcggatca tggcctggac atggaggaga cgatggtgga ggctgttttt
agggacgaac 600 agagagaagg gttttacatg gcggaggaga cgacggtgga
gggtgttgtt ccggaggaac 660 agatgagcaa agggttttac atggacgagg
agtggacgtt cgagatgccg aggttgttgg 720 ctgatatggc ggaagggatg
cttctgcctc ccccgtccgt acaatgggga cataacgatg 780 acttcgaagg
agatgctgac atgaacctct ggaattatta gggatccgcg 830 85 258 PRT Brassica
rapa 85 Met Asn Ser Val Ser Thr Phe Ser Glu Leu Leu Cys Ser Glu Asn
Lys 1 5 10 15 Ser Pro Val Asn Thr Glu Gly Gly Asp Tyr Ile Leu Ala
Ala Ser Cys 20 25 30 Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln
Glu Thr Arg His Pro 35 40 45 Ile Tyr Arg Gly Val Arg Leu Arg Lys
Ser Gly Lys Trp Val Cys Glu 50 55 60 Val Arg Glu Pro Asn Lys Lys
Ser Arg Ile Trp Leu Gly Thr Phe Lys 65 70 75 80 Thr Ala Glu Ile Ala
Ala Arg Ala His Asp Val Ala Ala Leu Ala Leu 85 90 95 Arg Gly Arg
Gly Ala Cys Leu Asn Phe Ala Asp Ser Ala Trp Arg Leu 100 105 110 Arg
Ile Pro Glu Thr Thr Cys Ala Lys Asp Ile Gln Lys Ala Ala Ala 115 120
125 Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp Thr Thr Thr Asn
130 135 140 Asp Arg Gly Met Asn Met Glu Glu Thr Ser Ala Val Ala Ser
Pro Ala 145 150 155 160 Glu Leu Asn Asp Thr Thr Ala Asp His Gly Leu
Asp Met Glu Glu Thr 165 170 175 Met Val Glu Ala Val Phe Arg Asp Glu
Gln Arg Glu Gly Phe Tyr Met 180 185 190 Ala Glu Glu Thr Thr Val Glu
Gly Val Val Pro Glu Glu Gln Met Ser 195 200 205 Lys Gly Phe Tyr Met
Asp Glu Glu Trp Thr Phe Glu Met Pro Arg Leu 210 215 220 Leu Ala Asp
Met Ala Glu Gly Met Leu Leu Pro Pro Pro Ser Val Gln 225 230 235 240
Trp Gly His Asn Asp Asp Phe Glu Gly Asp Ala Asp Met Asn Leu Trp 245
250 255 Asn Tyr 86 854 DNA Brassica rapa 86 ctatactaca cacagcctta
tccagccgct cgagtactta ctatactaca ctcagccttt 60 tccagttttt
caaaagaagt tttcaacgat gaactcagtc tctactcttt ctgaagttct 120
tggctcccag aacgagtctc ccgtaggtgg tgattactgt cccatgttgg cggcgagctg
180 tccgaagaag ccggcgggta ggaagaagtt tcgggagaca cgtcacccca
tttacagagg 240 agttcgtctt agaaagtcag gtaagtgggt gtgtgaagtg
agggaaccaa acaagaaatc 300 taggatttgg ctcggaactt tcaaaacagc
tgagatcgca gctcgtgctc acgacgttgc 360 cgccttagct ctccgtggaa
gaggcgcctg cctcaacttc gccgactcgg cttggcggct 420 ccgtatcccg
gagacaacct gcgccaagga tatccagaag gctgctgctg aagccgcatt 480
ggcttttgag gcggagaaga gtgataccac gacgacgaat gatcatggca tgaacatggc
540 ttctcaggtt gaggttaatg acacgacgga tcatgacctg gacatggagg
agacgatggt 600 ggaggctgtt tttagggagg aacagagaga agggttttac
atggcggagg agacgacggt 660 ggagggtatt gttccggagg aacagatgag
caaagggttt tacatggacg aggagtggat 720 gttcgggatg ccgaccttgt
tggctgatat ggcggcaggg atgctcttac cgccgccgtc 780 cgtacaatgg
ggacataatg atgacttcga aggagatgct gacatgaacc tctggaatta 840
ttaagggatc cgcg 854 87 251 PRT Brassica rapa 87 Met Asn Ser Val Ser
Thr Leu Ser Glu Val Leu Gly Ser Gln Asn Glu 1 5 10 15 Ser Pro Val
Gly Gly Asp Tyr Cys Pro Met Leu Ala Ala Ser Cys Pro 20 25 30 Lys
Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg His Pro Ile 35 40
45 Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly Lys Trp Val Cys Glu Val
50 55 60 Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu Gly Thr Phe
Lys Thr 65 70 75 80 Ala Glu Ile Ala Ala Arg Ala His Asp Val Ala Ala
Leu Ala Leu Arg 85 90 95 Gly Arg Gly Ala Cys Leu Asn Phe Ala Asp
Ser Ala Trp Arg Leu Arg 100 105 110 Ile Pro Glu Thr Thr Cys Ala Lys
Asp Ile Gln Lys Ala Ala Ala Glu 115 120 125 Ala Ala Leu Ala Phe Glu
Ala Glu Lys Ser Asp Thr Thr Thr Thr Asn 130 135 140 Asp His Gly Met
Asn Met Ala Ser Gln Val Glu Val Asn Asp Thr Thr 145 150 155 160 Asp
His Asp Leu Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Arg 165 170
175 Glu Glu Gln Arg Glu Gly Phe Tyr Met Ala Glu Glu Thr Thr Val Glu
180 185 190 Gly Ile Val Pro Glu Glu Gln Met Ser Lys Gly Phe Tyr Met
Asp Glu 195 200 205 Glu Trp Met Phe Gly Met Pro Thr Leu Leu Ala Asp
Met Ala Ala Gly 210 215 220 Met Leu Leu Pro Pro Pro Ser Val Gln Trp
Gly His Asn Asp Asp Phe 225 230 235 240 Glu Gly Asp Ala Asp Met Asn
Leu Trp Asn Tyr 245 250 88 738 DNA Glycine max 88 catccgattt
atagtggcgt gaggaggagg aacacggata agtgggtaag tgaggtgagg 60
gagcccaaca aaaagaccag gatttggctg gggacttttc ccacgccgga gatggcggca
120 cgggcccacg acgtggcggc aatggccctg aggggccggt atgcctgtct
caacttcgct 180 gactcgacgt ggcggttacc aattcccgcc actgctaacg
caaaggatat acagaaagca 240 gcagcagagg ctgccgaggc tttcagacca
agtcagacct tagaaaatac gaatacaaag 300 caagagtgtg taaaagtggt
gacgacaaca acgatcacag aacaaaaacg aggaatgttt 360 tatacggagg
aagaagagca agtgttagat atgcctgagt tgcttaggaa tatggtgctt 420
atgtccccaa cacattgcat agggtatgag tatgaagatg ctgacttgga tgctcaagat
480 gctgaggtgt ccctatggag tttctcaatt taataacgtg cttttggttt
ggttttttat 540 gttagttttg gagtgtgact gtctgtactg gttttttatt
agtagtacgg atactagcta 600 taggtggcag attgaaaggg accaaaagga
attttctttt gaaacccttt ttgtcaaagt 660 aatcaatcgc gtatcatcaa
gtgaatccct tgatcaagtt tatgtatgaa ttaaataaaa 720 gaagaatcta gttttggt
738 89 170 PRT Glycine max 89 His Pro Ile Tyr Ser Gly Val Arg Arg
Arg Asn Thr Asp Lys Trp Val 1 5 10 15 Ser Glu Val Arg Glu Pro Asn
Lys Lys Thr Arg Ile Trp Leu Gly Thr 20 25 30 Phe Pro Thr Pro Glu
Met Ala Ala Arg Ala His Asp Val Ala Ala Met 35 40 45 Ala Leu Arg
Gly Arg Tyr Ala Cys Leu Asn Phe Ala Asp Ser Thr Trp 50 55 60 Arg
Leu Pro Ile Pro Ala Thr Ala Asn Ala Lys Asp Ile Gln Lys Ala 65 70
75 80 Ala Ala Glu Ala Ala Glu Ala Phe Arg Pro Ser Gln Thr Leu Glu
Asn 85 90 95 Thr Asn Thr Lys Gln Glu Cys Val Lys Val Val Thr Thr
Thr Thr Ile 100 105 110 Thr Glu Gln Lys Arg Gly Met Phe Tyr Thr Glu
Glu Glu Glu Gln Val 115 120 125 Leu Asp Met Pro Glu Leu Leu Arg Asn
Met Val Leu Met Ser Pro Thr 130 135 140 His Cys Ile Gly Tyr Glu Tyr
Glu Asp Ala Asp Leu Asp Ala Gln Asp 145 150 155 160 Ala Glu Val Ser
Leu Trp Ser Phe Ser Ile 165 170 90 793 DNA Raphanus sativus 90
actacactca gccttatcca gtttttcttc caacgatgga ctcaatctct actttttctg
60 aactgcttgg ctccgagaac gagtctccgg ttactacggt agtaggaggt
gattattttc 120 ccaggttggc ggcaagctgt ccgaagaagc cagcgggtag
gaagaagttt caggagacac 180 gtcaccccat ttaccgcgga gttcgtttaa
gaaagtcagg taagtgggtg tgtgaagtga 240 gggaaccaaa caagaaatct
aggatttggc tcggaacttt caaaaccgct gagatcgctg 300 ctcgtgctca
cgacgttgct gccttagccc tccgcggaag aggcgcctgc ctcaacttcg 360
ccgactcggc ttggcggctc cgtatcccgg agacaacctg cgccaaggat atccagaagg
420 ctgctgctga agctgcattg gcttttgagg ccgagaagag tgatcatggc
atgaacatga 480 agaatactac ggcggtggct tctcaggttg aggtgaatga
cacgacgacg gaccatggcg 540 tggacatgga ggagacgttg gtggaggctg
tttttacgga ggaacagaga gaagggtttt 600 acatgacgga ggagacgagg
gtggagggtg ttgttacgga ggaacagaac aattggtttt 660 acatggacga
ggagtggatg tttgggatgc cgacgttgtt ggttgatatg gcggaaggga 720
tgcttttacc gcggccgtcc gtacaatcgg gacactacga tgacttcgaa ggagatgctg
780 acatgaacct ctg 793 91 252 PRT Raphanus sativus 91 Met Asp Ser
Ile Ser Thr Phe Ser Glu Leu Leu Gly Ser Glu Asn Glu 1 5 10 15 Ser
Pro Val Thr Thr Val Val Gly Gly Asp Tyr Phe Pro Arg Leu Ala 20 25
30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr
35 40 45 Arg His Pro Ile Tyr Arg Gly Val Arg Leu Arg Lys Ser Gly
Lys Trp 50 55 60 Val Cys Glu Val Arg Glu Pro Asn Lys Lys Ser Arg
Ile Trp Leu Gly 65 70 75 80 Thr Phe Lys Thr Ala Glu Ile Ala Ala Arg
Ala His Asp Val Ala Ala 85 90 95 Leu Ala Leu Arg Gly Arg Gly Ala
Cys Leu Asn Phe Ala Asp Ser Ala 100 105 110 Trp Arg Leu Arg Ile Pro
Glu Thr Thr Cys Ala Lys Asp Ile Gln Lys 115 120 125 Ala Ala Ala Glu
Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp His 130 135 140 Gly Met
Asn Met Lys Asn Thr Thr Ala Val Ala Ser Gln Val Glu Val 145 150 155
160 Asn Asp Thr Thr Thr Asp His Gly Val Asp Met Glu Glu Thr Leu Val
165 170 175 Glu Ala Val Phe Thr Glu Glu Gln Arg Glu Gly Phe Tyr Met
Thr Glu 180 185 190 Glu Thr Arg Val Glu Gly Val Val Thr Glu Glu Gln
Asn Asn Trp Phe 195 200 205 Tyr Met Asp Glu Glu Trp Met Phe Gly Met
Pro Thr Leu Leu Val Asp 210 215 220 Met Ala Glu Gly Met Leu Leu Pro
Arg Pro Ser Val Gln Ser Gly His 225 230 235 240 Tyr Asp Asp Phe Glu
Gly Asp Ala Asp Met Asn Leu 245 250 92 682 DNA Raphanus sativus 92
acacctaaac cttatccagg tttaactttt tttttcataa agagttttca acaatgacca
60 cattttctac cttttccgaa atgttgggct ccgagtacga gtctccggtt
acattaggcg 120 gagagtattg tccgaagctg gccgcgagct gtccgaagaa
accagctggt cgtaagaagt 180 ttcgagagac gcgccaccca atatacagag
gagttcgtct gagaaactca ggtaagtggg 240 tgtgtgaagt gagggagcca
aacaagaaat ctaggatttg gctcggtact ttcctaaccg 300 ccgagatcgc
agcgcgtgcc cacgacgtcg ccgccatagc cctccgcggc aaatccgcat 360
gtctcaattt cgctgactcg gcttggcggc tccgtatccc ggagacaaca tgccccaagg
420 atatacagaa ggcggctgct gaagccgcgg tggcttttca ggctgagata
aatgatacga 480 cgacggatca tggcctggac ttggaggaga cgatcgtgga
ggctattttt acggaggtaa 540 acaacgatga gttttatatg gacgaggagt
ccatgttcgg gatgccgtct ttgttggcta 600 gtatggcgga agggatgctt
ttgccgctgc cgtccgtaca atctgaacat aactgtgact 660 tcgacggaga
tgctgacatg aa 682 93 209 PRT Raphanus sativus 93 Met Thr Thr Phe
Ser Thr Phe Ser Glu Met Leu Gly Ser Glu Tyr Glu 1 5 10 15 Ser Pro
Val Thr Leu Gly Gly Glu Tyr Cys Pro Lys Leu Ala Ala Ser 20 25 30
Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg His 35
40 45 Pro Ile Tyr Arg Gly Val Arg Leu Arg Asn Ser Gly Lys Trp Val
Cys 50 55 60 Glu Val Arg Glu Pro Asn Lys Lys Ser Arg Ile Trp Leu
Gly Thr Phe 65 70 75 80 Leu Thr Ala Glu Ile Ala Ala Arg Ala His Asp
Val Ala Ala Ile Ala 85 90 95 Leu Arg Gly Lys Ser Ala Cys Leu Asn
Phe Ala Asp Ser Ala Trp Arg 100 105 110 Leu Arg Ile Pro Glu Thr Thr
Cys Pro Lys Asp Ile Gln Lys Ala Ala 115 120 125 Ala Glu Ala Ala Val
Ala Phe Gln Ala Glu Ile Asn Asp Thr Thr Thr 130 135 140 Asp His Gly
Leu Asp Leu Glu Glu Thr Ile Val Glu Ala Ile Phe Thr 145 150 155 160
Glu Val Asn Asn Asp Glu Phe Tyr Met Asp Glu Glu Ser Met Phe Gly 165
170 175 Met Pro Ser Leu Leu Ala Ser Met Ala Glu Gly Met Leu Leu Pro
Leu 180 185 190 Pro Ser Val Gln Ser Glu His Asn Cys Asp Phe Asp Gly
Asp Ala Asp 195 200 205 Met 94 349 DNA Zea maize 94 cggagtccgc
ggacggcggc ggcggcggcg acgacgagta cgcgacggtg ctgtcggcgc 60
cacccaagcg gccggcgggg cggaccaagt tccgggagac gcggcacccc gtgtaccgcg
120 gcgtgcggcg gcgcgggccc gcggggcgct gggtgtgcga ggtccgcgag
cccaacaaga 180 agtcgcgcat ctggctcggc accttcgcca cccccgaggc
cgccgcgcgc gcgcacgacg 240 tggccgcgct ggccctgcgg ggccgcgccg
cgtgcctcaa cttcgccgac tcggcgcgcc 300 tgctccaagt cgaccccgcc
acgctcgcca cccccgacga catccgccg 349 95 115 PRT Zea maize 95 Glu Ser
Ala Asp Gly Gly Gly Gly Gly Asp Asp Glu Tyr Ala Thr Val 1 5 10 15
Leu Ser Ala Pro Pro Lys Arg Pro Ala Gly Arg Thr Lys Phe Arg Glu 20
25 30 Thr Arg His Pro Val Tyr Arg Gly Val Arg Arg Arg Gly Pro Ala
Gly 35 40 45 Arg Trp Val Cys Glu Val Arg Glu Pro Asn Lys Lys Ser
Arg Ile Trp 50 55 60 Leu Gly Thr Phe Ala Thr Pro Glu Ala Ala Ala
Arg Ala His Asp Val 65 70 75 80 Ala Ala Leu Ala Leu Arg Gly Arg Ala
Ala Cys Leu Asn Phe Ala Asp 85 90 95 Ser Ala Arg Leu Leu Gln Val
Asp Pro Ala Thr Leu Ala Thr Pro Asp 100 105 110 Asp Ile Arg 115 96
39 DNA Artificial Sequence Synthetic Construct 96 ggaagatcta
tgaaacagag tactctgatc aatgaactc 39 97 37 DNA Artificial Sequence
Synthetic Construct 97 ggaagatctg aaacagagta ctctgatcaa tgaactc 37
98 38 DNA Artificial Sequence Synthetic Construct 98 ggaagatcta
tgaacagagt actctgatca atgaactc 38 99 39 DNA Artificial Sequence
Synthetic Construct 99 ggaagatcta tgaacagagt actctgatgc aatgaactc
39 100 49 DNA Artificial Sequence Synthetic Construct 100
ggaggatcct cgtttctaca acaataaaat aaaataaaat gaaggaacc 49 101 20 DNA
Artificial Sequence Degenerate PCR primer 101 cayccnatht aymgnggngt
20 102 21 DNA Artificial Sequence Degenerate PCR primer 102
ggnarnarca tnccytcngc c 21 103 62 PRT Arabidopsis thaliana 103 His
Pro Ile Tyr Arg Gly Val Arg Gln Arg Asn Ser Gly Lys Trp Val 1 5 10
15 Cys Glu Leu Arg Glu Pro Asn Lys Lys Thr Arg Ile Trp Leu Gly Thr
20 25 30
Phe Gln Thr Ala Glu Met Ala Ala Arg Ala His Asp Val Ala Ala Ile 35
40 45 Ala Leu Arg Gly Arg Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55
60 104 62 PRT Arabidopsis thaliana 104 His Pro Ile Tyr Arg Gly Val
Arg Arg Arg Asn Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu
Pro Asn Lys Lys Thr Arg Ile Trp Leu Gly Thr 20 25 30 Phe Gln Thr
Ala Glu Met Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala
Leu Arg Gly Arg Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 105 62
PRT Arabidopsis thaliana 105 His Pro Ile Tyr Arg Gly Val Arg Gln
Arg Asn Ser Gly Lys Trp Val 1 5 10 15 Ser Glu Val Arg Glu Pro Asn
Lys Lys Thr Arg Ile Trp Leu Gly Thr 20 25 30 Phe Gln Thr Ala Glu
Met Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg
Gly Arg Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 106 62 PRT
Arabidopsis thaliana 106 His Pro Ile Tyr Arg Gly Val Arg Gln Arg
Asn Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Pro Thr Val Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 107 62 PRT
Arabidopsis thaliana 107 His Pro Val Tyr Arg Gly Val Arg Leu Arg
Asn Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Leu Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Ile 35 40 45 Ala Leu Arg Gly
Lys Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 108 62 PRT
Arabidopsis thaliana 108 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Asn Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Leu Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Ile 35 40 45 Ala Leu Arg Gly
Lys Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 109 62 PRT
Arabidopsis thaliana 109 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Arg Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Leu Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Ile 35 40 45 Ala Leu Arg Gly
Lys Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 110 62 PRT
Arabidopsis thaliana 110 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Leu Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Ile 35 40 45 Ala Leu Arg Gly
Lys Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 111 62 PRT
Arabidopsis thaliana 111 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Pro Gly Thr 20 25 30 Phe Leu Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Ile 35 40 45 Ala Leu Arg Gly
Lys Ser Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 112 62 PRT
Arabidopsis thaliana 112 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Pro Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser 50 55 60 113 62 PRT
Arabidopsis thaliana 113 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Pro Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser 50 55 60 114 62 PRT
Arabidopsis thaliana 114 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser 50 55 60 115 62 PRT
Arabidopsis thaliana 115 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser 50 55 60 116 62 PRT
Arabidopsis thaliana 116 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser 50 55 60 117 62 PRT
Arabidopsis thaliana 117 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser 50 55 60 118 62 PRT
Arabidopsis thaliana 118 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser 50 55 60 119 62 PRT
Arabidopsis thaliana 119 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 120 62 PRT
Arabidopsis thaliana 120 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 121 62 PRT
Arabidopsis thaliana 121 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 122 62 PRT
Arabidopsis thaliana 122 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 123 62 PRT
Arabidopsis thaliana 123 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 124 62 PRT
Arabidopsis thaliana 124 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 125 62 PRT
Arabidopsis thaliana 125 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 126 62 PRT
Arabidopsis thaliana 126 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 127 62 PRT
Arabidopsis thaliana 127 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 128 62 PRT
Arabidopsis thaliana 128 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 129 62 PRT
Arabidopsis thaliana 129 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Ile
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Ala Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 130 62 PRT
Arabidopsis thaliana 130 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Leu Asn Lys
Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Cys Leu Asn Tyr Ala Asp Ser 50 55 60 131 62 PRT
Arabidopsis thaliana 131 His Pro Ile Tyr Arg Gly Val Arg Leu Arg
Lys Ser Gly Lys Trp Val 1 5 10 15 Cys Glu Val Arg Glu Pro Asn Lys
Lys Ser Arg Ile Trp Pro Gly Thr 20 25 30 Phe Lys Thr Ala Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Leu 35 40 45 Ala Leu Arg Gly
Arg Gly Ala Arg Leu Asn Tyr Ala Asp Ser 50 55 60 132 63 PRT
Arabidopsis thaliana 132 His Pro Val Tyr Arg Gly Val Arg Arg Arg
Gly Pro Ala Gly Arg Trp 1 5 10 15 Val Cys Glu Val Arg Glu Pro Asn
Lys Lys Ser Arg Ile Trp Leu Gly 20 25 30 Thr Phe Ala Thr Pro Glu
Ala Ala Ala Arg Ala His Asp Val Ala Ala 35 40 45 Leu Ala Leu Arg
Gly Arg Ala Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 133 62 PRT
Arabidopsis thaliana 133 His Pro Ile Tyr Ser Gly Val Arg Arg Arg
Asn Thr Asp Lys Trp Val 1 5 10 15 Ser Glu Val Arg Glu Pro Asn Lys
Lys Thr Arg Ile Trp Leu Gly Thr 20 25 30 Phe Pro Thr Pro Glu Met
Ala Ala Arg Ala His Asp Val Ala Ala Met 35 40 45 Ala Leu Arg Gly
Arg Tyr Ala Cys Leu Asn Phe Ala Asp Ser 50 55 60 134 63 PRT Tobacco
134 Gly Arg His Tyr Arg Gly Val Arg Gln Arg Pro Trp Gly Lys Phe Ala
1 5 10 15 Ala Glu Ile Arg Asp Pro Ala Lys Asn Gly Ala Arg Val Trp
Leu Gly 20 25 30 Thr Tyr Glu Thr Ala Glu Glu Ala Ala Leu Ala Tyr
Asp Lys Ala Ala 35 40 45 Tyr Arg Met Arg Gly Ser Lys Ala Leu Leu
Asn Phe Pro His Arg 50 55 60 135 62 PRT Arabidopsis thaliana 135
Arg Cys Ser Phe Arg Gly Val Arg Gln Arg Ile Trp Gly Lys Trp Val 1 5
10 15 Ala Glu Ile Arg Glu Pro Asn Arg Gly Ser Arg Leu Trp Leu Gly
Thr 20 25 30 Phe Pro Thr Ala Gln Glu Ala Ala Ser Ala Tyr Asp Glu
Ala Ala Lys 35 40 45 Ala Met Tyr Gly Pro Leu Ala Arg Leu Asn Phe
Pro Arg Ser 50 55 60 136 62 PRT Arabidopsis thaliana 136 His Cys
Ser Phe Arg Gly Val Arg Gln Arg Ile Trp Gly Lys Trp Val 1 5 10 15
Ala Glu Ile Arg Glu Pro Lys Ile Gly Thr Arg Leu Trp Leu Gly Thr 20
25 30 Phe Pro Thr Ala Glu Lys Ala Ala Ser Ala Tyr Asp Glu Ala Ala
Thr 35 40 45 Ala Met Tyr Gly Ser Leu Ala Arg Leu Asn Phe Pro Gln
Ser 50 55 60 137 62 PRT Arabidopsis thaliana 137 His Pro Val Tyr
Arg Gly Val Arg Lys Arg Asn Trp Gly Lys Trp Val 1 5 10 15 Ser Glu
Ile Arg Glu Pro Arg Lys Lys Ser Arg Ile Trp Leu Gly Thr 20 25 30
Phe Pro Ser Pro Glu Met Ala Ala Arg Ala His Asp Val Ala Ala Leu 35
40 45 Ser Ile Lys Gly Ala Ser Ala Ile Leu Asn Phe Pro Asp Leu 50 55
60 138 46 PRT Arabidopsis thaliana 138 Met Asn Ser Val Ser Thr Phe
Ser Glu Leu Leu Cys Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Asn Thr
Glu Gly Gly Asp Tyr Ile Leu Ala Ala Ser Cys 20 25 30 Pro Lys Lys
Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr Arg 35 40 45 139 46 PRT
Arabidopsis thaliana 139 Met Asn Ser Val Ser Thr Phe Ser Glu Leu
Leu Cys Ser Glu Asn Lys 1 5 10 15 Ser Pro Val Asn Thr Glu Gly Gly
Asp Tyr Ile Leu Ala Ala Ser Cys 20 25 30 Pro Lys Lys Pro Ala Gly
Arg Lys Lys Phe Gln Glu Thr Arg 35 40 45 140 46 PRT Arabidopsis
thaliana 140 Met Asn Ser Val Ser Thr Phe Ser Glu Leu Leu Arg Ser
Glu Asn Glu 1 5 10 15 Ser Pro Val Asn Thr Glu Gly Gly Asp Tyr Ile
Leu Ala Ala Ser Cys 20 25 30 Pro Lys Lys Pro Ala Gly Arg Lys Lys
Phe Gln Glu Thr Arg 35 40 45 141 47 PRT Arabidopsis thaliana 141
Met Asn Ser
Phe Ser Ala Phe Ser Glu Met Phe Gly Ser Asp Tyr Glu 1 5 10 15 Ser
Pro Val Ser Ser Gly Gly Asp Tyr Ser Pro Lys Leu Ala Thr Ser 20 25
30 Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg 35
40 45 142 47 PRT Arabidopsis thaliana 142 Met Asn Ser Phe Ser Ala
Phe Ser Glu Met Phe Gly Ser Asp Tyr Glu 1 5 10 15 Ser Ser Val Ser
Ser Gly Gly Asp Tyr Ile Pro Thr Leu Ala Ser Ser 20 25 30 Cys Pro
Lys Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg 35 40 45 143 44
PRT Arabidopsis thaliana 143 Met Asn Ser Phe Ser Ala Phe Ser Glu
Met Phe Gly Ser Asp Tyr Glu 1 5 10 15 Pro Gln Gly Gly Asp Tyr Cys
Pro Thr Leu Ala Thr Ser Cys Pro Lys 20 25 30 Lys Pro Ala Gly Arg
Lys Lys Phe Arg Glu Thr Arg 35 40 144 49 PRT Arabidopsis thaliana
144 Met Asn Thr Phe Pro Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu
1 5 10 15 Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr Tyr Pro Met
Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys
Phe Gln Glu Thr 35 40 45 Arg 145 49 PRT Arabidopsis thaliana 145
Met Asn Thr Phe Pro Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu 1 5
10 15 Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr Tyr Pro Met Leu
Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe
Gln Glu Thr 35 40 45 Arg 146 49 PRT Arabidopsis thaliana 146 Met
Asn Thr Phe Pro Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu 1 5 10
15 Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr Tyr Pro Met Leu Ala
20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln
Glu Thr 35 40 45 Arg 147 49 PRT Arabidopsis thaliana 147 Met Asn
Thr Phe Pro Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu 1 5 10 15
Ser Pro Val Thr Thr Val Ala Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20
25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu
Thr 35 40 45 Arg 148 49 PRT Arabidopsis thaliana 148 Met Asn Thr
Phe Pro Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu 1 5 10 15 Ser
Pro Val Thr Thr Val Ala Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20 25
30 Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr
35 40 45 Arg 149 49 PRT Arabidopsis thaliana 149 Met Asn Thr Phe
Pro Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu 1 5 10 15 Ser Pro
Val Thr Thr Val Ala Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20 25 30
Ala Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr 35
40 45 Arg 150 49 PRT Arabidopsis thaliana 150 Met Asn Thr Phe Pro
Ala Ser Thr Glu Met Val Gly Ser Glu Asn Glu 1 5 10 15 Ser Pro Val
Thr Thr Val Ala Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20 25 30 Ala
Ser Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr 35 40
45 Arg 151 49 PRT Arabidopsis thaliana 151 Met Asn Thr Phe Pro Ala
Ser Thr Glu Met Val Ser Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Thr
Thr Val Val Gly Gly Asp Tyr Tyr Pro Met Leu Ala 20 25 30 Ala Ser
Cys Pro Lys Lys Pro Ala Gly Arg Lys Lys Phe Gln Glu Thr 35 40 45
Arg 152 47 PRT Arabidopsis thaliana 152 Met Thr Ser Phe Ser Thr Phe
Ser Glu Leu Leu Gly Ser Glu His Glu 1 5 10 15 Ser Pro Val Thr Leu
Gly Glu Glu Tyr Cys Pro Lys Leu Ala Ala Ser 20 25 30 Cys Pro Lys
Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg 35 40 45 153 47 PRT
Arabidopsis thaliana 153 Met Thr Thr Phe Ser Thr Phe Ser Glu Met
Leu Gly Ser Glu Tyr Glu 1 5 10 15 Ser Pro Val Thr Leu Gly Gly Glu
Tyr Cys Pro Lys Leu Ala Ala Ser 20 25 30 Cys Pro Lys Lys Pro Ala
Gly Arg Lys Lys Phe Arg Glu Thr Arg 35 40 45 154 45 PRT Arabidopsis
thaliana 154 Met Asn Ser Val Ser Thr Phe Ser Glu Leu Leu Gly Ser
Glu Asn Glu 1 5 10 15 Ser Pro Val Gly Gly Asp Tyr Cys Pro Met Leu
Ala Ala Ser Cys Pro 20 25 30 Lys Lys Pro Ala Gly Arg Lys Lys Phe
Arg Glu Thr Arg 35 40 45 155 45 PRT Arabidopsis thaliana 155 Met
Asn Ser Val Ser Thr Phe Ser Glu Leu Leu Gly Ser Glu Asn Glu 1 5 10
15 Ser Pro Val Gly Gly Asp Tyr Cys Pro Met Leu Ala Ala Ser Cys Pro
20 25 30 Lys Lys Pro Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg 35 40
45 156 45 PRT Arabidopsis thaliana 156 Met Asn Ser Val Ser Thr Phe
Ser Glu Leu Leu Gly Ser Glu Asn Glu 1 5 10 15 Ser Pro Val Gly Gly
Asp Tyr Cys Pro Met Leu Ala Ala Ser Cys Pro 20 25 30 Lys Lys Pro
Ala Gly Arg Lys Lys Phe Arg Glu Thr Arg 35 40 45 157 45 PRT
Arabidopsis thaliana 157 Met Asn Ser Val Ser Thr Leu Ser Glu Val
Leu Gly Ser Gln Asn Glu 1 5 10 15 Ser Pro Val Gly Gly Asp Tyr Cys
Pro Met Leu Ala Ala Ser Cys Pro 20 25 30 Lys Lys Pro Ala Gly Arg
Lys Lys Phe Arg Glu Thr Arg 35 40 45 158 49 PRT Arabidopsis
thaliana 158 Met Asp Ser Ile Ser Thr Phe Pro Glu Leu Leu Gly Ser
Glu Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr
Cys Pro Arg Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly
Arg Lys Lys Phe Gln Glu Thr 35 40 45 Arg 159 49 PRT Arabidopsis
thaliana 159 Met Asp Ser Ile Ser Thr Phe Pro Glu Leu Leu Gly Ser
Glu Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr
Cys Pro Arg Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly
Arg Lys Lys Phe Gln Glu Thr 35 40 45 Arg 160 49 PRT Arabidopsis
thaliana 160 Met Asp Ser Ile Ser Thr Phe Ser Glu Leu Leu Gly Ser
Glu Asn Glu 1 5 10 15 Ser Pro Val Thr Thr Val Val Gly Gly Asp Tyr
Phe Pro Arg Leu Ala 20 25 30 Ala Ser Cys Pro Lys Lys Pro Ala Gly
Arg Lys Lys Phe Gln Glu Thr 35 40 45 Arg 161 50 PRT Arabidopsis
thaliana 161 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys His Lys
Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu
Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn Gly Leu Asn Met
Glu Glu Thr Thr Ala Val Ala 35 40 45 Ser Gln 50 162 50 PRT
Arabidopsis thaliana 162 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr
Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu
Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn Gly
Leu Asn Met Glu Glu Thr Thr Ala Val Ala 35 40 45 Ser Gln 50 163 50
PRT Arabidopsis thaliana 163 Ala Trp Arg Leu Arg Ile Pro Glu Thr
Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn
Gly Leu Asn Met Glu Glu Met Thr Ala Val Ala 35 40 45 Ser Gln 50 164
50 PRT Arabidopsis thaliana 164 Ala Trp Arg Leu Arg Ile Pro Glu Thr
Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn
Gly Gln Asn Met Glu Glu Thr Thr Ala Val Ala 35 40 45 Ser Gln 50 165
44 PRT Arabidopsis thaliana 165 Ala Ser Arg Leu Arg Ile Pro Glu Thr
Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Glu Glu
Thr Met Ala Val Ala Ser Gln 35 40 166 44 PRT Arabidopsis thaliana
166 Ala Ser Arg Leu Arg Ile Pro Glu Thr Thr Cys His Lys Asp Ile Gln
1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys
Ser Asp 20 25 30 Val Thr Met Glu Glu Thr Met Ala Val Ala Ser Gln 35
40 167 44 PRT Arabidopsis thaliana 167 Ala Trp Arg Leu Arg Ile Pro
Glu Thr Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu
Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met
Glu Glu Thr Met Ala Val Ala Ser Gln 35 40 168 50 PRT Arabidopsis
thaliana 168 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys His Lys
Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu
Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn Gly Leu Asn Met
Glu Glu Thr Thr Ala Val Ala 35 40 45 Ser Gln 50 169 50 PRT
Arabidopsis thaliana 169 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr
Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu
Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Ala Thr Met Gln Asn Gly
Leu Asn Met Glu Glu Thr Thr Ala Ala Ala 35 40 45 Ser Gln 50 170 31
PRT Arabidopsis thaliana 170 Ala Trp Arg Leu Arg Ile Pro Glu Thr
Thr Cys Ala Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser 20 25 30 171 31 PRT Arabidopsis
thaliana 171 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys Ala Lys
Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu
Ala Glu Lys Ser 20 25 30 172 33 PRT Arabidopsis thaliana 172 Ala
Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys Ala Lys Asp Ile Gln 1 5 10
15 Lys Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp
20 25 30 Thr 173 33 PRT Arabidopsis thaliana 173 Ala Trp Arg Leu
Arg Ile Pro Glu Thr Thr Cys Ala Lys Asp Ile Gln 1 5 10 15 Lys Ala
Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30
Thr 174 33 PRT Arabidopsis thaliana 174 Ala Trp Arg Leu Arg Ile Pro
Glu Thr Thr Cys Ala Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu
Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Thr 175 34 PRT
Arabidopsis thaliana 175 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr
Cys Ala Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu
Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Thr Thr 176 33 PRT
Arabidopsis thaliana 176 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr
Cys Ala Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu
Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Thr 177 33 PRT Arabidopsis
thaliana 177 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys Ala Lys
Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu Ala Phe Gly
Ala Glu Lys Ser Asp 20 25 30 Thr 178 26 PRT Arabidopsis thaliana
178 Ala Trp Arg Leu Arg Ile Ser Glu Thr Thr Cys Pro Lys Glu Ile Gln
1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Val Ala Phe 20 25 179 26 PRT
Arabidopsis thaliana 179 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr
Cys Pro Lys Glu Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Val
Ala Phe 20 25 180 26 PRT Arabidopsis thaliana 180 Ala Trp Arg Leu
Arg Ile Pro Glu Thr Thr Cys Pro Lys Glu Ile Gln 1 5 10 15 Lys Ala
Ala Ala Glu Ala Ala Val Ala Phe 20 25 181 26 PRT Arabidopsis
thaliana 181 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys Pro Lys
Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Val Ala Phe 20 25
182 26 PRT Arabidopsis thaliana 182 Ala Trp Arg Leu Arg Ile Pro Glu
Ser Thr Cys Ala Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala
Ala Leu Ala Phe 20 25 183 26 PRT Arabidopsis thaliana 183 Ala Trp
Arg Leu Arg Ile Pro Glu Ser Thr Cys Ala Lys Glu Ile Gln 1 5 10 15
Lys Ala Ala Ala Glu Ala Ala Leu Asn Phe 20 25 184 26 PRT
Arabidopsis thaliana 184 Ala Trp Arg Leu Arg Ile Pro Glu Ser Thr
Cys Ala Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu
Ala Phe 20 25 185 49 PRT Arabidopsis thaliana 185 Ala Glu Val Asn
Asp Thr Thr Thr Glu His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr
Ala Val Ala Ser Gln Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30
His Gly Val Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr Gly 35
40 45 Glu 186 49 PRT Arabidopsis thaliana 186 Ala Glu Val Asn Asp
Thr Thr Thr Glu His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala
Val Ala Ser Gln Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His
Gly Val Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr Gly 35 40
45 Glu 187 49 PRT Arabidopsis thaliana 187 Ala Glu Val Asn Asp Thr
Thr Thr Glu His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val
Ala Ser Gln Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly
Val Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu 35 40 45
Glu 188 49 PRT Arabidopsis thaliana 188 Ala Glu Val Asn Asp Thr Thr
Thr Glu His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala
Ser Gln Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val
Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr Gly 35 40 45 Glu
189 49 PRT Arabidopsis thaliana 189 Ala Glu Val Asn Asp Thr Thr Thr
Asp His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser
Gln Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp
Met Glu Glu Thr Met Val Glu Ala Val Phe Thr Gly 35 40 45 Glu 190 49
PRT Arabidopsis thaliana 190 Ala Glu Val Asn Asp Thr Thr Thr Asp
His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu 35 40 45 Glu 191 49 PRT
Arabidopsis thaliana 191 Ala Glu Val Asn Asp Thr Thr Thr Asp His
Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln Ala
Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met Glu
Glu Thr Met Val Glu Ala Val Phe Thr Glu 35 40 45 Glu 192 49 PRT
Arabidopsis thaliana 192 Ala Glu Val Asn Asp Thr Thr Thr Glu His
Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln Ala
Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met Glu
Glu Thr Met
Val Glu Ala Val Phe Thr Glu 35 40 45 Glu 193 49 PRT Arabidopsis
thaliana VARIANT (1)...(49) Xaa = Any Amino Acid 193 Thr Glu Val
Ser Asp Thr Thr Thr Asp His Gly Met Asn Met Glu Glu 1 5 10 15 Thr
Thr Ala Val Ala Ser Gln Ala Glu Val Asn Asp Xaa Xaa Thr Asp 20 25
30 His Gly Val Asp Met Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu
35 40 45 Glu 194 41 PRT Arabidopsis thaliana 194 Asp His Gly Met
Asn Met Lys Asn Thr Thr Ala Val Ala Ser Gln Val 1 5 10 15 Glu Val
Asn Asp Thr Thr Thr Asp His Gly Val Asp Met Glu Glu Thr 20 25 30
Leu Val Glu Ala Val Phe Thr Glu Glu 35 40 195 41 PRT Arabidopsis
thaliana 195 Asp His Gly Met Asn Met Lys Asn Thr Thr Ala Val Ala
Ser Gln Val 1 5 10 15 Glu Val Asn Asp Thr Thr Thr Asp His Gly Val
Asp Met Glu Glu Thr 20 25 30 Leu Val Glu Ala Val Phe Thr Glu Glu 35
40 196 37 PRT Arabidopsis thaliana 196 Thr Thr Asn Asp His Gly Met
Asn Met Ala Ser Gln Ala Glu Val Asn 1 5 10 15 Asp Thr Thr Asp His
Gly Leu Asp Met Glu Glu Thr Met Val Glu Ala 20 25 30 Val Phe Thr
Glu Glu 35 197 37 PRT Arabidopsis thaliana 197 Thr Thr Asn Asp His
Gly Met Asn Met Ala Ser Gln Ala Glu Val Asn 1 5 10 15 Asp Thr Thr
Asp His Gly Leu Asp Met Glu Glu Thr Met Val Glu Ala 20 25 30 Val
Phe Thr Glu Glu 35 198 37 PRT Arabidopsis thaliana 198 Thr Thr Asn
Asp His Gly Met Asn Met Ala Ser Gln Val Glu Val Asn 1 5 10 15 Asp
Thr Thr Asp His Asp Leu Asp Met Glu Glu Thr Ile Val Glu Ala 20 25
30 Val Phe Arg Glu Glu 35 199 37 PRT Arabidopsis thaliana 199 Thr
Thr Asn Asp His Gly Met Asn Met Ala Ser Gln Val Glu Val Asn 1 5 10
15 Asp Thr Thr Asp His Asp Leu Asp Met Glu Glu Thr Met Val Glu Ala
20 25 30 Val Phe Arg Glu Glu 35 200 44 PRT Arabidopsis thaliana 200
Thr Thr Asn Asp Arg Gly Met Asn Met Glu Glu Thr Ser Ala Val Ala 1 5
10 15 Ser Pro Ala Glu Leu Asn Asp Thr Thr Ala Asp His Gly Leu Asp
Met 20 25 30 Glu Glu Thr Met Val Glu Ala Val Phe Arg Asp Glu 35 40
201 44 PRT Arabidopsis thaliana 201 Thr Thr Asn Asp Gln Gly Met Asn
Met Glu Glu Met Thr Val Val Ala 1 5 10 15 Ser Gln Ala Glu Val Ser
Asp Thr Thr Thr Tyr His Gly Leu Asp Met 20 25 30 Glu Glu Thr Met
Val Glu Ala Val Phe Ala Glu Glu 35 40 202 26 PRT Arabidopsis
thaliana 202 Gln Ala Glu Leu Asn Asp Thr Thr Ala Asp His Gly Leu
Asp Val Glu 1 5 10 15 Glu Thr Ile Val Glu Ala Ile Phe Thr Glu 20 25
203 26 PRT Arabidopsis thaliana 203 Gln Ala Glu Leu Asn Asp Thr Thr
Ala Asp His Gly Leu Asp Val Glu 1 5 10 15 Glu Thr Ile Val Glu Ala
Ile Phe Thr Glu 20 25 204 26 PRT Arabidopsis thaliana 204 Lys Ala
Glu Ile Asn Asn Thr Thr Ala Asp His Gly Ile Asp Val Glu 1 5 10 15
Glu Thr Ile Val Glu Ala Ile Phe Thr Glu 20 25 205 26 PRT
Arabidopsis thaliana 205 Gln Ala Glu Ile Asn Asp Thr Thr Thr Asp
His Gly Leu Asp Ile Glu 1 5 10 15 Glu Thr Ile Val Glu Ala Ile Phe
Thr Glu 20 25 206 28 PRT Arabidopsis thaliana 206 Gln Asp Glu Thr
Cys Asp Thr Thr Thr Thr Asp His Gly Leu Asp Met 1 5 10 15 Glu Glu
Thr Met Val Glu Ala Ile Tyr Thr Pro Glu 20 25 207 28 PRT
Arabidopsis thaliana 207 Gln Asp Glu Met Cys His Met Thr Thr Asp
Ala His Gly Leu Asp Met 1 5 10 15 Glu Glu Thr Leu Val Glu Ala Ile
Tyr Thr Pro Glu 20 25 208 27 PRT Arabidopsis thaliana 208 Gln Asp
Glu Met Cys Asp Ala Thr Thr Asp His Gly Phe Asp Met Glu 1 5 10 15
Glu Thr Leu Val Glu Ala Ile Tyr Thr Ala Glu 20 25 209 49 PRT
Arabidopsis thaliana 209 Gln Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala 1 5 10 15 Val Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp 20 25 30 Met Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu 35 40 45 Leu 210 49 PRT
Arabidopsis thaliana 210 Gln Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala 1 5 10 15 Val Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp 20 25 30 Met Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu 35 40 45 Leu 211 49 PRT
Arabidopsis thaliana 211 Gln Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala 1 5 10 15 Val Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp 20 25 30 Met Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu 35 40 45 Leu 212 49 PRT
Arabidopsis thaliana 212 Gln Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala 1 5 10 15 Val Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp 20 25 30 Met Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu 35 40 45 Leu 213 49 PRT
Arabidopsis thaliana 213 Gln Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala 1 5 10 15 Val Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp 20 25 30 Met Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu 35 40 45 Leu 214 49 PRT
Arabidopsis thaliana 214 Gln Ser Glu Gly Phe Asn Met Ala Glu Glu
Ser Thr Val Glu Ala Ala 1 5 10 15 Val Val Thr Asp Glu Leu Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp 20 25 30 Thr Tyr Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu 35 40 45 Leu 215 49 PRT
Arabidopsis thaliana 215 Gln Ser Glu Gly Phe Asn Met Ala Glu Glu
Ser Thr Val Glu Ala Ala 1 5 10 15 Val Val Thr Asp Glu Leu Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp 20 25 30 Thr Tyr Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu 35 40 45 Leu 216 49 PRT
Arabidopsis thaliana 216 Gln Ser Glu Gly Phe Asn Met Ala Glu Glu
Ser Thr Val Glu Ala Ala 1 5 10 15 Val Val Thr Asp Glu Leu Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp 20 25 30 Thr Tyr Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu 35 40 45 Leu 217 49 PRT
Arabidopsis thaliana 217 Gln Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Ala Glu Ala Ala 1 5 10 15 Val Val Thr Glu Glu Leu Ser Lys
Gly Val Tyr Met Asp Glu Glu Trp 20 25 30 Thr Tyr Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu 35 40 45 Leu 218 48 PRT
Arabidopsis thaliana 218 Gln Arg Glu Gly Phe Tyr Met Thr Glu Glu
Thr Arg Val Glu Gly Val 1 5 10 15 Val Thr Glu Glu Gln Asn Asn Trp
Phe Tyr Met Asp Glu Glu Trp Met 20 25 30 Phe Gly Met Pro Thr Leu
Leu Val Asp Met Ala Glu Gly Met Leu Ile 35 40 45 219 48 PRT
Arabidopsis thaliana 219 Gln Arg Glu Gly Phe Tyr Met Thr Glu Glu
Thr Arg Val Glu Gly Val 1 5 10 15 Val Thr Glu Glu Gln Asn Asn Trp
Phe Tyr Met Asp Glu Glu Trp Met 20 25 30 Phe Gly Met Pro Thr Leu
Leu Val Asp Met Ala Glu Gly Met Leu Leu 35 40 45 220 49 PRT
Arabidopsis thaliana 220 Gln Arg Asp Gly Phe Tyr Met Ala Glu Glu
Thr Thr Val Glu Gly Val 1 5 10 15 Val Pro Glu Glu Gln Met Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp 20 25 30 Met Phe Gly Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu 35 40 45 Leu 221 49 PRT
Arabidopsis thaliana 221 Gln Arg Asp Gly Phe Tyr Met Ala Glu Glu
Thr Thr Val Glu Gly Val 1 5 10 15 Val Pro Glu Glu Gln Met Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp 20 25 30 Met Phe Gly Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu 35 40 45 Leu 222 49 PRT
Arabidopsis thaliana 222 Gln Arg Glu Gly Phe Tyr Met Ala Glu Glu
Thr Thr Val Val Gly Val 1 5 10 15 Val Pro Glu Glu Gln Met Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp 20 25 30 Met Phe Gly Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu 35 40 45 Leu 223 49 PRT
Arabidopsis thaliana 223 Gln Arg Glu Gly Phe Tyr Met Ala Glu Glu
Thr Thr Val Glu Gly Ile 1 5 10 15 Val Pro Glu Glu Gln Met Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp 20 25 30 Met Phe Gly Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu 35 40 45 Leu 224 49 PRT
Arabidopsis thaliana 224 Gln Arg Glu Gly Phe Tyr Met Ala Glu Glu
Thr Thr Val Glu Gly Val 1 5 10 15 Val Pro Glu Glu Gln Met Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp 20 25 30 Thr Phe Glu Met Pro Arg
Leu Leu Ala Asp Met Ala Glu Gly Met Leu 35 40 45 Leu 225 48 PRT
Arabidopsis thaliana 225 Gln Arg Glu Gly Phe Tyr Leu Ala Glu Glu
Thr Thr Val Glu Gly Val 1 5 10 15 Val Thr Glu Glu Gln Ser Lys Gly
Phe Tyr Met Asp Glu Glu Trp Thr 20 25 30 Phe Gly Met Gln Ser Phe
Leu Ala Asp Met Ala Glu Gly Met Leu Phe 35 40 45 226 29 PRT
Arabidopsis thaliana 226 Glu Ser Ser Glu Gly Phe Tyr Met Asp Glu
Glu Phe Met Phe Gly Met 1 5 10 15 Pro Thr Leu Trp Ala Ser Met Ala
Glu Gly Met Leu Leu 20 25 227 29 PRT Arabidopsis thaliana 227 Glu
Ser Ser Glu Gly Phe Tyr Met Ala Glu Glu Phe Met Phe Gly Met 1 5 10
15 Pro Thr Leu Trp Ala Ser Val Ala Glu Gly Met Leu Leu 20 25 228 30
PRT Arabidopsis thaliana 228 Glu Asn Asn Asp Gly Phe Tyr Met Asp
Glu Glu Glu Ser Met Phe Gly 1 5 10 15 Met Pro Ala Leu Leu Ala Ser
Met Ala Glu Gly Met Leu Leu 20 25 30 229 29 PRT Arabidopsis
thaliana 229 Val Asn Asn Asp Glu Phe Tyr Met Asp Glu Glu Ser Met
Phe Gly Met 1 5 10 15 Pro Ser Leu Leu Ala Ser Met Ala Glu Gly Met
Leu Leu 20 25 230 29 PRT Arabidopsis thaliana 230 Gln Ser Glu Gly
Ala Phe Tyr Met Asp Glu Glu Thr Met Phe Gly Met 1 5 10 15 Pro Thr
Leu Leu Asp Asn Met Ala Glu Gly Met Leu Leu 20 25 231 29 PRT
Arabidopsis thaliana 231 Gln Ser Gln Asp Ala Phe Tyr Met Asp Glu
Glu Ala Met Leu Gly Met 1 5 10 15 Ser Ser Leu Leu Asp Asn Met Ala
Glu Gly Met Leu Leu 20 25 232 29 PRT Arabidopsis thaliana 232 Gln
Ser Glu Asn Ala Phe Tyr Met His Asp Glu Ala Met Phe Glu Met 1 5 10
15 Pro Ser Leu Leu Ala Asn Met Ala Glu Gly Met Leu Leu 20 25 233 50
PRT Arabidopsis thaliana 233 Ala Trp Arg Leu Arg Ile Pro Glu Thr
Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn
Gly Leu Asn Met Glu Glu Thr Thr Ala Val Ala 35 40 45 Ser Gln 50 234
50 PRT Arabidopsis thaliana 234 Ala Trp Arg Leu Arg Ile Pro Glu Thr
Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn
Gly Leu Asn Met Glu Glu Thr Thr Ala Val Ala 35 40 45 Ser Gln 50 235
50 PRT Arabidopsis thaliana 235 Ala Trp Arg Leu Arg Ile Pro Glu Thr
Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn
Gly Leu Asn Met Glu Glu Met Thr Ala Val Ala 35 40 45 Ser Gln 50 236
50 PRT Arabidopsis thaliana 236 Ala Trp Arg Leu Arg Ile Pro Glu Thr
Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn
Gly Gln Asn Met Glu Glu Thr Thr Ala Val Ala 35 40 45 Ser Gln 50 237
44 PRT Arabidopsis thaliana 237 Ala Ser Arg Leu Arg Ile Pro Glu Thr
Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala
Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Glu Glu
Thr Met Ala Val Ala Ser Gln 35 40 238 44 PRT Arabidopsis thaliana
238 Ala Ser Arg Leu Arg Ile Pro Glu Thr Thr Cys His Lys Asp Ile Gln
1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu Ala Glu Lys
Ser Asp 20 25 30 Val Thr Met Glu Glu Thr Met Ala Val Ala Ser Gln 35
40 239 44 PRT Arabidopsis thaliana 239 Ala Trp Arg Leu Arg Ile Pro
Glu Thr Thr Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu
Ala Ala Leu Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Val Thr Met
Glu Glu Thr Met Ala Val Ala Ser Gln 35 40 240 50 PRT Arabidopsis
thaliana 240 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr Cys His Lys
Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu Ala Phe Glu
Ala Glu Lys Ser Asp 20 25 30 Val Thr Met Gln Asn Gly Leu Asn Met
Glu Glu Thr Thr Ala Val Ala 35 40 45 Ser Gln 50 241 50 PRT
Arabidopsis thaliana 241 Ala Trp Arg Leu Arg Ile Pro Glu Thr Thr
Cys His Lys Asp Ile Gln 1 5 10 15 Lys Ala Ala Ala Glu Ala Ala Leu
Ala Phe Glu Ala Glu Lys Ser Asp 20 25 30 Ala Thr Met Gln Asn Gly
Leu Asn Met Glu Glu Thr Thr Ala Ala Ala 35 40 45 Ser Gln 50 242 50
PRT Arabidopsis thaliana 242 Ala Glu Val Asn Asp Thr Thr Thr Glu
His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr Gly 35 40 45 Glu Gln 50 243
50 PRT Arabidopsis thaliana 243 Ala Glu Val Asn Asp Thr Thr Thr Glu
His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr Gly 35 40 45 Glu Gln 50 244
50 PRT Arabidopsis thaliana 244 Ala Glu Val Asn Asp Thr Thr Thr Glu
His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu 35 40 45 Glu Gln 50 245
50 PRT Arabidopsis thaliana 245 Ala Glu Val Asn Asp Thr Thr Thr Glu
His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln
Ala Glu Val
Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met Glu Glu Thr
Met Val Glu Ala Val Phe Thr Gly 35 40 45 Glu Gln 50 246 50 PRT
Arabidopsis thaliana 246 Ala Glu Val Asn Asp Thr Thr Thr Asp His
Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln Ala
Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met Glu
Glu Thr Met Val Glu Ala Val Phe Thr Gly 35 40 45 Glu Gln 50 247 50
PRT Arabidopsis thaliana 247 Ala Glu Val Asn Asp Thr Thr Thr Asp
His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu 35 40 45 Glu Gln 50 248
50 PRT Arabidopsis thaliana 248 Ala Glu Val Asn Asp Thr Thr Thr Asp
His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu 35 40 45 Glu Gln 50 249
50 PRT Arabidopsis thaliana 249 Ala Glu Val Asn Asp Thr Thr Thr Glu
His Gly Met Asn Met Glu Glu 1 5 10 15 Ala Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu 35 40 45 Glu Gln 50 250
50 PRT Arabidopsis thaliana 250 Thr Glu Val Ser Asp Thr Thr Thr Asp
His Gly Met Asn Met Glu Glu 1 5 10 15 Thr Thr Ala Val Ala Ser Gln
Ala Glu Val Asn Asp Thr Thr Thr Asp 20 25 30 His Gly Val Asp Met
Glu Glu Thr Met Val Glu Ala Val Phe Thr Glu 35 40 45 Glu Gln 50 251
50 PRT Arabidopsis thaliana 251 Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala Val 1 5 10 15 Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp Met 20 25 30 Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu Leu 35 40 45 Pro Pro 50 252
50 PRT Arabidopsis thaliana 252 Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala Val 1 5 10 15 Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp Met 20 25 30 Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu Leu 35 40 45 Pro Pro 50 253
50 PRT Arabidopsis thaliana 253 Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala Val 1 5 10 15 Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp Met 20 25 30 Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu Leu 35 40 45 Pro Pro 50 254
48 PRT Arabidopsis thaliana 254 Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Val Glu Ala Ala Val 1 5 10 15 Val Thr Glu Glu Pro Ser Lys
Gly Ser Tyr Met Asp Glu Glu Trp Met 20 25 30 Leu Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Glu Gly Met Leu Leu 35 40 45 255 50 PRT
Arabidopsis thaliana 255 Ser Glu Gly Phe Asn Met Ala Lys Glu Ser
Thr Val Glu Ala Ala Val 1 5 10 15 Val Thr Glu Glu Pro Ser Lys Gly
Ser Tyr Met Asp Glu Glu Trp Met 20 25 30 Leu Glu Met Pro Thr Leu
Leu Ala Asp Met Ala Glu Gly Met Leu Leu 35 40 45 Pro Pro 50 256 50
PRT Arabidopsis thaliana 256 Ser Glu Gly Phe Asn Met Ala Glu Glu
Ser Thr Val Glu Ala Ala Val 1 5 10 15 Val Thr Asp Glu Leu Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp Thr 20 25 30 Tyr Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu Leu 35 40 45 Pro Pro 50 257
50 PRT Arabidopsis thaliana 257 Ser Glu Gly Phe Asn Met Ala Glu Glu
Ser Thr Val Glu Ala Ala Val 1 5 10 15 Val Thr Asp Glu Leu Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp Thr 20 25 30 Tyr Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu Leu 35 40 45 Pro Pro 50 258
50 PRT Arabidopsis thaliana 258 Ser Glu Gly Phe Asn Met Ala Glu Glu
Ser Thr Val Glu Ala Ala Val 1 5 10 15 Val Thr Asp Glu Leu Ser Lys
Gly Phe Tyr Met Asp Glu Glu Trp Thr 20 25 30 Tyr Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu Leu 35 40 45 Pro Pro 50 259
50 PRT Arabidopsis thaliana 259 Ser Glu Gly Phe Asn Met Ala Lys Glu
Ser Thr Ala Glu Ala Ala Val 1 5 10 15 Val Thr Glu Glu Leu Ser Lys
Gly Val Tyr Met Asp Glu Glu Trp Thr 20 25 30 Tyr Glu Met Pro Thr
Leu Leu Ala Asp Met Ala Ala Gly Met Leu Leu 35 40 45 Pro Pro 50
* * * * *