U.S. patent application number 09/319264 was filed with the patent office on 2002-10-24 for fusion protein comprising the whole or part of the pp65 protein of human cmv, useable in particular for preparing a vaccine.
Invention is credited to DAVIGNON, JEAN-LUC, LULE, JACQUELINE, PRIEUR, ERIC.
Application Number | 20020156251 09/319264 |
Document ID | / |
Family ID | 9498647 |
Filed Date | 2002-10-24 |
United States Patent
Application |
20020156251 |
Kind Code |
A1 |
PRIEUR, ERIC ; et
al. |
October 24, 2002 |
FUSION PROTEIN COMPRISING THE WHOLE OR PART OF THE PP65 PROTEIN OF
HUMAN CMV, USEABLE IN PARTICULAR FOR PREPARING A VACCINE
Abstract
The invention concerns a fusion protein characterised in that it
comprises at least part of the pp65 protein of the cytomegalovirus
(or CMV), or a protein having at least 80% homology with the pp65
protein, in combination with at least a second peptide fragment
derived from CMV. The invention also concerns a nucleotide sequence
coding for such a protein, or a pharmaceutical composition
containing them. It further concerns its use as medicine and a
method for preparing the protein.
Inventors: |
PRIEUR, ERIC; (OXFORD,
FR) ; LULE, JACQUELINE; (PLAISANCE DU TOUCH, FR)
; DAVIGNON, JEAN-LUC; (TOURNEFEUILLE, FR) |
Correspondence
Address: |
FOLEY & LARDNER
3000 K STREET NW
SUITE 500 PO BOX 25696
WASHINGTON
DC
20007-8696
US
|
Family ID: |
9498647 |
Appl. No.: |
09/319264 |
Filed: |
July 6, 1999 |
PCT Filed: |
December 12, 1997 |
PCT NO: |
PCT/FR97/02285 |
Current U.S.
Class: |
536/23.1 ;
424/192.1; 424/230.1; 536/23.72 |
Current CPC
Class: |
C12N 2710/16122
20130101; C07K 2319/00 20130101; A61K 39/00 20130101; A61P 31/22
20180101; A61K 38/00 20130101; C07K 14/005 20130101 |
Class at
Publication: |
536/23.1 ;
536/23.72; 424/230.1; 424/192.1 |
International
Class: |
C07H 021/02; C07H
021/04; A61K 039/00; A61K 039/245; A61K 039/25 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 13, 1996 |
FR |
96-15344 |
Claims
1. Fusion protein, characterized in that it comprises at least part
of the cytomegalovirus (or CMV) protein pp65, or of a protein
having at least 80% homology with protein pp65, in combination with
at least one second peptide fragment derived from CMV, with the
exception of protein pp150.
2. Fusion protein according to claim 1, characterized in that the
second peptide fragment is composed of protein IE1 or one of its
epitopes, or of a protein having at least 80% homology.
3. Fusion protein according to one of claims 1 and 2, characterized
in that the second peptide fragment is fragment e4 of CMV protein
IE1, or a peptide fragment having at least 80% homology with said
fragment e4.
4. Fusion protein according to one of claims 1 and 2, characterized
in that the second peptide fragment is: a) the fragment delimited
by the amino acid residues 162 and 175 of the sequence of protein
IE1, or b) a peptide fragment having at least 90% homology with
said fragment mentioned under a).
5. Fusion protein according to one of claims 1 to 4, characterized
in that it additionally comprises a peptide fragment derived from a
microorganism other than CMV.
6. Fusion protein according to claim 5, characterized in that it
comprises a peptide fragment derived from an enzyme with
glutathion-S transferase (or GST) activity or any other "Tag"
sequence.
7. Nucleotide sequence coding for a fusion protein according to one
of claims 1 to 6.
Description
[0001] The present invention relates to novel combinations of
proteins and to their use as medicament. More particularly, it
relates to the preparation of vaccines against CMV.
[0002] Human cytomegalovirus (CMV), an enveloped virus with a 230
kbp DNA double strand, is the largest virus of the herpesvirus
family. Like the other members of this virus family, it exists in
latent form and can undergo repeated reactivation steps which lead
to a viremia several years after the initial infection. CMV is
widely distributed throughout the world and, while being well
tolerated by healthy individuals, it is associated with pathologies
which frequently have drastic consequences for the fetus and for
immuno-depressed patients (transplant, AIDS and cancer patients)
(see Review (1)).
[0003] Following a primary infection during pregnancy, the vertical
transmission of the virus to the fetus via the placenta leads to
complications in the newborn. These are, in particular, sensorial
disorders (vision, hearing) and significant mental backwardness
which arise during the first few years of the child's life.
Infection with CMV is associated with graft rejection in transplant
patients (foreign transplants of marrow, kidneys, heart, liver). It
constitutes one of the most drastic opportunistic infections in
HIV+ patients which, despite antiviral chemotherapy, fall victim
to--frequently lethal--pathologies. All these reasons mean that CMV
infection raises a substantial public health problem.
[0004] The use of unspecific antivirals, such as Ganciclovir* and
Foscarnet* during transplantation causes cytotoxicity problems. The
secondary effects frequently require a reduced dosage or
termination of the treatment, thus posing the risk of the disorder
associated with the viral infection recurring. In certain cases,
the intravenous injection of high doses of immunoglobulins has
reduced the frequency of pneumopathies and rejections. Attempts at
adoptive immunotherapy have been developed by injecting, into
recipients, marrow of clones of cytotoxic T-cells which are
specific for CMV (2).
[0005] The development of a subunit vaccine would be of enormous
importance to future mothers. In fact, it has been demonstrated
that maternal immunity which has been acquired prior to conception
could protect the newborn babies from the damage of congenital
infection (3). The development of an anti-CMV immunity in
transplant patients would be an important factor against the
development of infection-associated diseases. Vaccination trials
with the attenuated virus of the Towne strain were carried out and
are being performed on seronegative volunteers and seronegative
transplant patients who have received a transplant from
seropositive donors (4). In the majority of the cases, the
vaccination has reduced the severity of the diseases associated
with viral replication. As the pathogenic activity of such vaccines
has not definitively been excluded and where the use of live
vaccines might cause severe side effects in immunodeficient
individuals, novel approaches using recombinant viral proteins in
the presence of adjuvants are being developed.
[0006] The importance for public health of developing a vaccine
against CMV no longer has to be demonstrated as a result of the
problem presented by the congenital infection, which has hitherto
been underestimated by the medical community.
[0007] The savings made by developing a strategy of preventing
diseases linked to CMV infection in risk patients would be
substantial. In fact, estimates of the costs associated with the
vaccination of an individual and its taking (serological analyses,
vaccine, treatment of minor side effects) show that it would be
approximately 50 times less than that of the care with which a
newborn is provided which is the victim of congenital infection.
CMV infection can be observed in 2/3 kidney transplant patients and
more often in other transplant patients. Taking into consideration
that the infection is associated with complications in
approximately 1/3 of these, the annual costs in addition to the
transplantation costs are considerable. Despite the impact of drugs
such as Ganciclovir*, the injection of gammaglobulins or the
transfer of anti-CMV T-clones on the disease, prevention of the
primary infection and reactivation in these patients should be a
priority. The benefits of an immunization are obvious at the
clinical and at the economic level.
[0008] The applicant has now found that the combination of CMV
protein pp65 or a fragment thereof with another hapten or antigen
of CMV allows the immune reaction towards this virus to be
potentiated, in particular by stimulating the compartments T CD4+
and CD8+ against the virus.
[0009] This is why the present invention relates to a fusion
protein, characterized in that it comprises at least part of the
cytomegalovirus (or CMV) protein pp65, or of a protein having at
least 80% homology with protein pp65, in combination with at least
one second peptide fragment derived from CMV.
[0010] Protein pp65 is a CMV matrix protein which is internalized
in the cells and delivered into the cytosol at the same time as the
virion, very shortly after infection.
[0011] It can be used whole or in the form of one or more
fragments; the peptide fragments which make up the chimeric protein
preferably have a length of greater than, or equal to, 9 amino
acids and cover different HLA class I restrictions. The applicant
has shown that a peptide of protein pp65 of a length greater than 9
amino acids can be internalized by a presenting cell and presented
to a CD8+ specific T-line by a class I MHC molecule. The importance
of constructions which include these peptides and the protein IE1
for vaccination would be linked to the use of antigens which are
capable of entering the presenting cell by a unique endocytosis
pathway, simultaneously inducing it to a TCD4+ and TCD8+
response.
[0012] The second peptide fragment which is present in the fusion
protein is preferably composed of protein IE1 or one of its
epitopes, or of a protein having at least 80% homology.
[0013] In fact, the polypeptide sequence of IE1, which is a major
regulatory protein of the viral cycle, is highly conserved between
the different viral strains. Introduction of this protein into a
subunit vaccine would allow the induction of memory CD4+ helper
T-cells, which are capable of cooperating with the induction of
cytotoxic CD8+ T-cells against pp65 and with the production of
antibody against the envelope protein gB, subjected to greater
variability (cross help). In fact, it has been shown that most of
the neutralizing antibodies which are present in the serum of
infected individuals were directed against the viral envelope
glycoprotein gB (UL55). This is why protein gB was considered to be
one of the most important viral antigens for vaccination. A large
number of protocols in which recombinant viruses are used
(adenovirus, vaccinia, canarypox) have been developed (5, 6,
7).
[0014] The problems presented by these vaccines are linked either
to the pathogenic character of the live viruses or to the fact that
they induce too low antibody titers. An alternative is the use of
recombinant antigens which are combined with adjuvants. The
combination of glycoprotein gB with the chimeric protein IE1-pp65
into one structure allows its conformation to be maintained, which
is indispensable for its immunogenicity, would offer a means for
stimulating the T and B compartments of the antiviral response.
Moreover, activation of the CD4+ T-cells against IE1, which is
mediated by the IE1 peptides in combination with class II MHC
molecules being recognized, would allow viral replication in the
adjacent cells, which are subjected to the effect of TNF.gamma. and
TNF.alpha. (8) to be controlled. Naturally, these hypotheses are
not intended to limit the scope of the invention.
[0015] In particular, use can be made of fragment e4 of CMV protein
IE1, or a peptide fragment having at least 80% homology with said
fragment e4. e4, or exon 4, which comprises 406 amino acids, is a
fragment of protein IE1, which is composed of 491 amino acids.
[0016] According to another advantageous aspect of the invention,
the fusion protein comprises a) the fragment delimited by the amino
acid residues 162 and 175 of the sequence of protein IE1, or
[0017] b) a peptide fragment having at least 90% homology with said
fragment mentioned under a).
[0018] Other epitopes are also suitable for carrying out the
invention, such as those mentioned by Davignon et al. (8).
[0019] The fusion protein according to the invention can
additionally contain a peptide fragment derived from a
microorganism other than CMV and/or any polypeptide fragment which
allows it to be purified later from Tag-type sequences; these
sequences, which are placed upstream or downstream of the protein
of interest allow it to be purified or labeled; the use of
.beta.-galactosidase, histidine hexamers (His6) or GST may be
mentioned as examples. According to a preferred embodiment, the
fusion protein comprises a peptide fragment derived from an enzyme
with glutathion-S transferase (or GST) activity.
[0020] The GST protein will make it easier, in particular, to
purify the fusion protein from a complex culture medium.
[0021] The invention therefore relates to a chimeric protein
GST-IE1-pp65 of 145 kd, which can be prepared in E. coli. Its
immunogenicity was demonstrated in vitro by the proliferation of
IE1-specific CD4+ T-cell-clones and by the lysis of target cells
incubated in the presence of a pp65-specific CD8+ T-line. The
applicant has shown that the protein in soluble form and its
fragments allow the CD4+ and CD8+ T-compartments of the specific
cell response to be stimulated in vitro. These results make this
protein the reactant of choice for designing a subunit vaccine.
[0022] The nucleotide sequences which code for a fusion protein as
defined hereinabove are also within the scope of the invention.
[0023] The fusion proteins and the corresponding nucleotide
sequences can be used as medicament and in particular for the
preparation of a vaccine for preventing infections caused by CMV.
Such a vaccine will be suitable for inducing an efficient response
against a primary infection before the virus has replicated
actively.
[0024] In accordance with another aspect, the invention relates to
a pharmaceutical composition, characterized in that it contains
[0025] a) at least part of the CMV protein pp65 or of a protein
having at least 80% homology with protein pp65, in combination with
at least one second peptide fragment derived from CMV, or
[0026] b) nucleotide sequences coding for the peptides mentioned
under a).
[0027] In addition to formulation excipients known to the skilled
worker, such as stabilizers, preservatives, antioxidants, adapted
to suit the route of administration, in particular an injection,
the compositions can contain immunity adjuvants. They can also
contain other CMV epitopes. Finally, they can be formulated with
systems which improve transport and presentation of the molecules
to the target cells.
[0028] The proteins can be in the form of various different
proteins in the composition; they can also be in the form of a
fusion protein as described above; the same applies to the
corresponding nucleotide sequences.
[0029] In addition, the composition can contain other epitopes, in
particular CMV envelope antigens, such as protein gB.
[0030] In accordance with yet another aspect, the invention relates
to a process for the preparation of a fusion protein, characterized
in that the following steps are carried out:
[0031] a) a first DNA sequence which codes for at least a part of
the CMV protein pp65 is linked with a second DNA sequence which
codes for another polypeptide or protein derived from CMV so as to
obtain a recombinant DNA sequence which codes for a fusion
protein,
[0032] b) the recombinant DNA sequence is introduced into a
construction containing the elements required for its expression,
and, if appropriate, sequences which code for other
polypeptides,
[0033] c) the construction obtained in b) is introduced into host
cells which are subsequently cultured under conditions in which the
expression system of the fused DNA is functional, so that the
fusion protein is produced in the host cell,
[0034] d) the fusion protein produced in the host cell is recovered
and purified.
[0035] The host cell which contains a nucleotide sequence coding
for a fusion protein, which can be obtained in the process
described hereinabove, also comes within the scope of the
invention. This host cell can be selected in particular from the
group consisting of the bacteria, the viruses, the yeasts and
eukaryotic cells, in particular higher eukaryotes.
[0036] Other characteristics and advantages of the invention will
become obvious from the examples which follow.
[0037] Reference will be made in these examples to the following
figures:
[0038] FIG. 1: Western blot analysis of the expression of protein
GST-IE1-pp65.
[0039] Lysates of bacteria which have been transformed with
plasmids pGEX 2TK (1) and PGEX 2TK/IE1-pp65 (2, 2') were subjected
to SDS-PAGE and then to a western blot which is visualized by
antibodies against GST (A), against IE1 (B) and against pp65 (C).
Pre-stained molecular weight markers (Gibco) have been used.
[0040] FIG. 2: Protein GST-IE1-pp65 induces a specific
proliferation of the CD4+ T-clone BeA3G9 in the presence of
PBMC.
[0041] The cells of clone BeA3G9 were incubated in the presence of
irradiated PBMC of the phenotype HLA-DRA8 and GST or
GST-IE1-pp65-antigen. Cell proliferation of the clone was
determined by the incorporation of [.sup.3H]-thymidine, measured in
cpm.
[0042] FIG. 3: The anti-pp65 CD8+ T-line "Val" lysis of U373MG
astrocytoma cells infected with CMV Towne.
[0043] The CD8+ T-line "Val" which has been generated with the pp65
peptide N9V was used in a .sup.51Cr enlargement test in the
presence of U373MG cells, either incubated with peptide N9V or with
peptide 19Y or infected with CMV Towne (5 moi) for 4 hours and
followed by incubation with peptide 19Y. The percentage of specific
lysis was calculated as shown in Materials and Methods.
[0044] FIG. 4: Schematic representation of recombinant proteins
produced in E. coli.
[0045] The peptide sequences which correspond to the epitopes
presented by HLA-DR8, HLA-A2 and HLA-B35 and their locations are
shown.
[0046] FIG. 5: The anti-pp65 CD8+ T-line "Val" lysis of B/EBV cells
incubated in the presence of the trypsin-pretreated protein
GST-IE1-pp65.
[0047] Cells of the line "Val" were used in a .sup.51Cr enlargement
test in the presence of autologous B/EBV lymphocytes which were
untreated or pretreated with chloroquine (Materials and Methods)
and the peptides and proteins as shown.
[0048] FIG. 6: Analysis of the production of the protein
His6-IE1-pp65 by insect cells infected with a recombinant
baculovirus.
[0049] Sf9 insect cells were infected for 48 hours with recombinant
IE1-pp65 baculoviruses. The cell lysates (1) were centrifuged, and
the supernatant (2) was passed through an Ni-agarose column and the
eluates were recovered (3, 4). The different fractions were
subjected to SDS-PAGE and stained with Coomassie blue.
[0050] FIG. 7: Induction of anti-IE1 CD4+ T-effectors in a CMV+
donor using formulation SMBV/IE1-pp65.
[0051] PBMCs of a CMV+ donor were stimulated with the protein
IE1-pp65 (AG) either in soluble form or formulated with SMBV (AG
form) or in the absence of antigen (mock). On day 35, the cells are
incubated in the presence of protein solutions with or without the
protein IE1 (col). The proliferation of the specific anti-IE1
T-cells was determined by measuring the incorporation of tritiated
thymidine.
EXAMPLE 1
[0052] Production of the fusion protein in DH5.alpha. bacteria
[0053] Materials and Methods
[0054] I-Cloning of IE1 and pp65 cDNAs in PGEX 2TK
[0055] I-1 Preparation of the IE1 and pp65 cDNAs
[0056] I-1-1 IE1-cDNA
[0057] The region of the viral genome containing the sequence which
codes for protein IE1 which is located in the Hind III C fragment
of the CMV strain Towne was cloned into a plasmid called pRL103.
This plasmid was used for transfecting cells of the astrocyte line
U373 MG (termed A2 (provided by R. Lafemina, Merck Sharp and Dohme,
WestPoint, Pa., USA). These cells were cultured to confluence in
RPMI-FCS (RPMI 1640 Glutamax, 1 mM sodium pyruvate, 200 u/ml
penicillin, 100 .mu.g/ml streptomycin, 10% decomplemented calf
serum). The total RNA of a 3-day culture was prepared following the
method of Chomzynski and Sacchi (14). The IEI cDNA was generated by
RT-PCR (Kit Super Script, GIBCO BRL) using an aliquot of 5 .mu.g of
total RNA, in accordance with the manufacturer's instructions using
the primers C1: GATCCGGATCCATGGAGTCCTCTGCCAAGAGA and C2:
CCCGGGGAATTCCTGGTCAGCCTTGCTTCTAGT. BamH1 and EcoR1 sites were
introduced into the primers C1 (5'-end of IE1) and C2 (3'-end of
IE1), respectively. The PCR product thus obtained (1480 bp) was
purified on an S400-HR column (PHARMACIA).
[0058] I-1-2 pp65-cDNA
[0059] The cells of a human fibroblast line (MRC5, Mrieux) grown in
BME supplemented with 10% fetal calf serum (BME/FCS) were infected
with CMV (Towne-strain). After a cytopathic effect was observed,
the supernatant containing the virus was recovered and
heat-inactivated (60.degree. C., 30 minutes) . The virus particles
were harvested by centrifugation (31,000 g, 4.degree. C., 90
minutes) and the capsids were degraded by treatment with proteinase
K (BOEHRINGER) (150 .mu.g) in 250 .mu.l lysis buffer (10 mM TrisCl
pH 7.5, 1 mM EDTA, 2% sarcosyl) for 30 minutes at ambient
temperature. The viral DNA was extracted with phenol/chloroform and
then precipitated with absolute ethanol. The DNA pellet was dried
and solubilized in 20 .mu.l of water. A fragment corresponding to
the pp65 cDNA was obtained by PCR with an aliquot of 2 .mu.l of
viral DNA using the primers C3: CCCGGGGAATTCATGGCATCCGTACTGGGTCCC
and C4: GAATTCGGATCCTCAACCTCGGTGCTrmGG which were complementary to
the 5' and 3' ends of the pp65 gene and contained the EcoRI and
BamHI sites, respectively. The PCR product (1670 bp) was purified
on an S400-HR column (PHARMACIA).
[0060] I-2 Construction of the plasmid pGEX 2TK-IE1-pp65
[0061] I-2-1 Purification of the Bam H1- and Eco R1-digested
fragments IE1 and pp65
[0062] The IEI and pp65 cDNA fragments were previously cloned into
the BamH1 and EcoRI sites of a pUC18 plasmid. Competent DH5.alpha.
bacteria (GIBCO) were transformed with 5 to 10 ng of a ligation
IEI/pUC18 or pp65/pUC18. The recombinant plasmids were digested
with BamH1 and EcoR1. The digestion products were separated by
agarose gel electrophoresis and extracted from the gel using the
"JetSorb/150" kit (GENOMED).
[0063] I-2-2 Purification of the IE1-pp65 fragment
[0064] An identical quantity of fragments IE1 and pp65 which have
been digested with BamH1 and EcoR1 was incubated in the presence of
T4 DNA ligase. The reaction mixture was digested with BamH1. The
fragments obtained pp65-pp65 (3340 bp), IE1-pp65 (3150 bp) IE1-IE1
(2960 bp) were separated by agarose gel electrophoresis. The
fragment IE1-pp65 was extracted from the gel using the
"JetSorb/150" kit (GENOMED).
[0065] 1-2-3 Cloning of IE1-pp65 into pGEX 2TK
[0066] Fragment IE1-pp65 was inserted into the BamH1 site of
plasmid PGEX 2TK (PHARMACIA). Clones of the recombinant bacteria
were stored at -80.degree. C. in PBS, 3.5% DMSO, until used for
protein purification.
[0067] II-Production of the fusion protein GST-IE1-pp65
[0068] An aliquot of bacteria which had been frozen at -80.degree.
C. was resuspended in 5 ml of LB medium containing ampicillin (Ap,
50 .mu.g/ml) and cultured for 8 hours at 37.degree. C. The culture,
which was diluted with 45 ml of the same medium, was continued for
15 hours and taken up in 500 ml of LB+Ap to an optical density
(.lambda.=600 nm) of 1. The production of GST-IE1-pp65 was induced
by adding IPTG (100 .mu.M) to the culture medium. The bacteria were
harvested by centrifugation after 3 hours of culture at ambient
temperature and stored at -80.degree. C.
[0069] The bacteria were lysed and the recombinant protein purified
by affinity chromatography on a "Sepharose 4-B" column grafted with
glutathion (PHARMACIA) according to the manufacturer's
instructions.
[0070] The degree of purity of the protein was checked by SDS-PAGE
followed by staining with Coomassie blue. The antigenicity of
GST-IE1-pp65 was analyzed by western blot using goat antibodies
directed against GST (PHARMACIA, dilution 1/400), and mouse
antibodies directed against IE1 (supernatant E13 diluted to 1/10,
provided by Dr Mazeron, Hal Lariboisire, Paris) and pp65 (NEA 20
diluted to 1/250, DUPONT). Secondary antibodies coupled to RAG/PO,
RAM/PO peroxidase (Nordic) were used at 1/500. The proteins were
assayed by the method of Bradford using the "Bio-Rad Protein Assay"
kit (BIORAD). The recombinant GST protein was produced and
purified.
[0071] Results and Discussion
[0072] Purification of G3ST-IE1-pp65
[0073] On average, we have obtained 1 mg of GST-IE1-pp65 protein
purified by glutathion chromatography from a culture of 500 ml of
DH5a/pGEX 2TK-IE1-pp65. Analysis by electrophoresis under
denaturing conditions followed by a western blot with the
antibodies anti-GST, anti-IE1 and anti-pp65 using lysates of
recombinant bacteria is shown in FIG. 1. A product corresponding to
a theoretical mass of 145 kd was revealed by the three antibodies
in the samples prepared from recombinant bacteria. The
lower-molecular-weight bands recognized by the antibodies are
protein degradation products. These results agree with the
production of a protein resulting from the fusion GST-IE1-pp65 in
these bacteria (FIG. 4). Trypsin proteolysis of the protein was
analyzed by SDS-PAGE and shows that the disappearance of the
migration band which corresponds to the whole protein correlated
with the appearance of a band of a low molecular weight which
corresponds to the generation of peptides. Amongst these fragments,
and after analysis of the sequence of the protein, a peptide of 15
aa appears which contains the peptide N9V (see "Materials and
Methods" and FIG. 4).
EXAMPLE 2
[0074] Materials and Methods
[0075] I-Lymphoproliferation test
[0076] Cells (2.times.10.sup.4) of a CD4+ T-clone (BeA3G9)
restricted by HLA DR8 and specific for an epitope at position
162-175 of the protein IE1 were incubated in 100 .mu.l of RPMI-SH
medium with irradiated (2500 rads) antigen-presenting cells
(1.times.10.sup.5 PBMC) of the same HLA-DR phenotype. These cells
were incubated with a dilution series of the recombinant protein.
On day 3, 1 .mu.Ci of [.sup.3H]-thymidine (AMERSHAM) was added to
each well of the culture. Fifteen hours later, the cell DNA was
collected on fiberglass filters (PACKARD), and the incorporation of
[.sup.3H]-thymidine was measured in a Matrix 9600 gas .beta.
counter (PACKARD). Each measurement was carried out in
triplicate.
[0077] II-Generation of a CD8+ T-line which is specific for a
peptide of protein pp65
[0078] Peripheral blood leukocytes of CMV-seropositive donors of
the haplotype HLA-A2 (2.times.10.sup.6/ml) were cultured in
24-well-plates in RPMI-SH (2 ml). On day 3, 100 U/ml of
"Lymphocult-T-LF" (BIOTEST, France) were added. On day 7, the live
cells were recovered in the ring of a ficoll gradient. These cells
(5.times.10.sup.5/well) were incubated in the presence of
autologous stimulator cells (1.5.times.10.sup.6/well) in RPMI-SH (2
ml) supplemented with 10% of "Lymphocult". The stimulator cells
(10.times.10.sup.6 cells/ml) were incubated in RPMI in the presence
of 30 ug of a peptide presented by HLA-A2 (peptide N9V, FIG. 5,
Neosystem, France) for 1 hour at 37.degree. C. and irradiated (2500
rads). The effector cells were restimulated under the same
conditions every 7 days. The cytotoxicity of the resulting line
"Val" was tested on day 14. The CD8+ phenotype of the line was
determined cytofluorimetrically with the monoclonal mouse antibody
OKT8.
[0079] III-Cytotoxicity test
[0080] III-1 In the context of CMV infection
[0081] U373MG astrocytoma cells of the haplotype HLA-A2
(2.times.10.sup.5) at 80% confluence in RPMI/FCS were infected with
Towne-CMV virus at 5 pfu/cell in 6-well-plates (10 cm2). After
infection for 4 hours, the cells were labeled with 100 .mu.ci of
Na.sub.2.sup.51CrO.sub.4 (ICN, France) and washed with RPMI. The
autologous effector cells of the CD8+ T-line were incubated with
10.sup.4 target cells in RPMI/10% FCS (500 .mu.l) for 4 hours at
37.degree. C. Various quantities of effector cells were added to
the targets to obtain different effector/target ratios. An
alternative treatment was the preincubation overnight at 37.degree.
C. of the cells, either with peptide N9V or with a peptide
recognized by HLA-B35 (peptide I9Y, FIG. 4, Nosystem, France) at a
final concentration of 100 nM.
[0082] The rate of spontaneous enlargement was determined by
measuring the radioactivity liberated by target cells which were
cultured for 4 hours. The percentage of specific lysis was
calculated by using the following formula ([measured
radioactivity-spontaneous enlargement/total
radioactivity-spontaneous enlargement].times.100). The
radioactivity is measured on a Cobra-.gamma.-counter (PACKARD).
Each measurement is carried out in duplicate.
[0083] III-2 In the presence of the native or trypsin--digested
protein GST-IEI-pp65, with or without chloroquine
[0084] The purified protein GST-IE1-pp65 was demineralized in an
ultrafiltration centrifuge with "Centricon 10" filter units
(FILTRON), lyophilized and taken up in water and then used in this
form or digested with trypsin (TCPK, SIGMA, 200 ng per 900 .mu.g of
protein) in a volume of 100 .mu.l of Tris-buffer [100 mM tris-HCl
pH 8.0] for 2 hours at 370.degree. C. Aliquots taken before and
after digestion were analyzed by SDS-PAGE.
[0085] Autologous B-EBV lymphocytes (1.times.10.sup.6) which have
previously been washed and irradiated (104 rads) were preincubated
either with the antigens (1 .mu.M) for 15 hours at 37.degree. C. in
RPMI-FCS medium (0.5 ml) in a 48-well plate or in RPMI-FCS
5%/chloroquine 80 .mu.M (SIGMA) for 30 minutes, before adding the
antigens. As an alternative treatment, the cells were preincubated
overnight at 37.degree. C. either with peptide N9V or with peptide
I9Y at a final concentration of 10 nM. After this incubation had
ended, the cells (50,000/ml) were labeled with 100 .mu.Ci of
Na.sub.2.sup.51CrO.sub.4 and washed with RPMI. The effector cells
of the CD8+ T-line were added under the same conditions as
described for the astrocytoma cells.
[0086] Results and Discussion
[0087] I-Lymphoproliferation of the CD4+ T-clone BeA3G9 in the
presence of GSTIE1-pp65
[0088] FIG. 2 shows the results of the proliferation of the
anti-IE1 clone BeA3G9 in the presence of PBMC incubated with the
purified recombinant antigen GST-IE1-pp65. The clone proliferated
specifically since no incorporation of thymidine was observed in
the presence of protein GST. This proliferation was of the same
extent as the proliferation obtained with the fusion protein GST-e4
(C-terminal 80% of IE1) or GST-IE1. These results demonstrate that
the protein GST-IE1-pp65 was prepared correctly by the HLA-DR8
antigen presenting cells so as to present an IE1 epitope which is
recognized by cells of clone BeA3G9.
[0089] II-The anti-pp65 CD8+ T-cells of the line "Val" lyse targets
incubated in the presence of the trypsin-directed protein
GST-IE1-pp65
[0090] II-1 Line "Val" recognizes a natural peptide generated after
infection with CMV
[0091] FIG. 3 shows the result of a cytotoxicity test carried out
in the context of the infection of U373MG astrocytoma cells of the
phenotype HLA-A2. A specific lysis of the targets was observed in
the presence of peptide N9V (HLA-A2), while this is virtually zero
with peptide I9Y (HLA-B35), which demonstrates that the class I MHC
molecules of the phenotype A2 at the surface of the U373MG cells
are charged specifically with peptide N9V. When these cells are
infected with CMV, a specific lysis of a level equivalent to that
obtained with peptide N9V was observed. This suggests that protein
pp65, which has been provided by the inoculum, has been delivered
into the cytosol and prepared in such a way that a peptide
identical to, or of a similar structure to, N9V was generated and
presented specifically to the cells of the line "Val".
[0092] II-2 B/EBV lymphocytes incubated in the presence of the
trypsin-digested protein GST-IE1-pp65 are lysed by the anti-pp65
line "Val" as an effect of the chloroquine-treatment of the
cells
[0093] The results of an experiment in which the protein
GST-IE1-pp65 did not sensitize targets to lysis by line "Val", in
contrast to a sample of this same fraction which had been
predigested with trypsin, are shown in FIG. 5. When the cells were
pretreated with chloroquine and incubated in the presence of the
trypsin-digested protein, the targets were not lysed. Trypsin
digestion of the protein generates a peptide of 15 aa, N15K, which
contains peptide N9V (FIG. 4). The lysis shown by the targets in
the presence of this hydrolysate suggests that peptide N15K is
presented to the line "Val". Moreover, chloroquine-pretreatment of
the cells shows that this peptide has been internalized by the
cells and prepared in an endo-lysosome-type compartment which is
sensitive to a pH increase.
EXAMPLE 3
[0094] Materials and Methods
[0095] Cloning of IE1-pp65 into the expression vector "baculovirus"
pAcHLT-B. Cotransfection of Sf9 insect cells with the recombinant
plasmid and baculovirus DNA:
[0096] The purified fragment IE1-pp65 (Example 1, para. 1-2-2) was
inserted into the BglII site of plasmid pAcHLT-B (Pharmingen) which
contains a sequence coding for a peptide of 6 histidine residues
(His.sub.6). The recombinant plasmids were characterized and
purified. Sf9 insect cells (ATCC CRL1711) were incubated for 4
hours at 37.degree. C. in the presence of a mixture containing 3
.mu.g of plasmid and 0.5 .mu.g of viral DNA according to the
protocol provided by Pharmingen. After 5 days of culture, the
protein production was analyzed by a "western blot" using
monoclonal antibodies against IE1 (E13, Argene) and against pp65
(NEA20, Biosoft).
[0097] Production and purification of the protein His6IE1-pp65
[0098] The production kinetics of the protein in the infected Sf9
cells were established from days 0 to 5 and analyzed by a "western
blot". Lysates of infected cells (lysis buffer: Tris 10 mM, NaCl
130 mM, Triton X-100, NaF 10 mM, NaPi 10 mM, NaPPi 10 mM, pH 7.5,
Pharmingen) were applied to an Ni-NTA affinity column (Qiagen) and
the protein was eluted with the buffer (NaPO4 50 mM, NaCl 300 mM,
glycerol 10%, imidazole 0.5 M, Pharmingen). The degree of purity of
the protein was checked by SDS-PAGE and staining with Coomassie
blue.
[0099] Results
[0100] Purification of the Protein His6IE1-pp65
[0101] FIG. 6 shows the SDS-PAGE analysis of the protein
His.sub.6IE1-pp65 which had been produced by cells infected with
recombinant baculoviruses and purified by Ni chromatography. These
results demonstrate that the protein constitutes a substantial part
of the total cell proteins and is obtained at a higher degree of
purity after chromatography.
EXAMPLE 4
[0102] Materials and Methods
[0103] Induction of the CD4+ T-lines in vitro from PBMC of a CMV+
donor and incubated in the presence of the chimeric protein
IE1-pp65 either in soluble form or formulated in SMBV
(supramolecular biovectors)
[0104] The IE1-pp65 formulations were obtained by coincubating for
1 hour at ambient temperature the protein solution (200 nM in PBS
with 2.5 mM Na.sub.2HP0.sub.4/NaH.sub.2PO.sub.4, 62 mM NaCl, 0.65
mM KC1+10% glycerol) and type L SMBV (1 mg/ml in distilled water)
at a protein/biovector weight ratio of 7.7 and a protein/nucleus
weight ratio of 10. The L-type SMBV, which is described in WO
94/20078, comprises an external double layer composed of
DPPC/cholesterol. Peripheral blood mononuclear cells (PBMC) of a
CMV+donor of the haplotype DR3,13 ("Val") were incubated in
24-well-plates (Falcon) at a density of 4.times.10.sup.6 cells in 2
ml of RPMI medium/10% human serum (HS). The soluble or formulated
antigen IE1-pp65 was added, and the mixture was incubated for 3
days at 37.degree. C. On day 3, 1 ml of culture medium is replaced
by 1 ml of fresh medium supplemented with 10% Lymphocult (100 U/ml,
Biotest, France). On day 7, the effector cells are stimulated by
incubation with autologous PBMC (at 1.5.times.10.sup.6 PBMC per
0.5.times.10.sup.6 cells) which had previously been incubated (15
hours) in the presence of either the soluble antigen or the
formulated antigen or in the absence of the protein. On day 35, a
proliferation test is carried out under the conditions described in
Example 2, section Materials and Methods, "Lymphoproliferation
test", with the following modifications:
[0105] 2.times.10.sup.4 effector cells are incubated in the
presence of 1.times.10.sup.5 allogenic PBMC and of a solution of
proteins originating from the lysate of astrocytoma cells U373MG
which have been transfected with the IE genes (termed A2) and
contain the antigen IE1. A lysate of non-transfected cells (termed
AO) was used as negative control.
[0106] Results
[0107] Induction of the anti-IE1 CD4+ T-Effectors in a CMV+ Donor
from IE1-pp65 Formulations.
[0108] FIG. 7 shows the proliferation of anti-IE1 effectors
generated from PBMC of the "Val" donor in the single case where the
effectors were induced in the presence of the formulated antigen.
This result emphasizes the potentiating effect of the formulation,
as has been demonstrated before by Prieur et al (9). These results
suggest that under conditions where the frequency of the anti-IE1
CD4+ T-precursors is low as is probably the case with the donor
"Val" at the time of removing, the formulation allows those cells
which are not stimulated and enlarged when the soluble antigen is
used to be stimulated and enlarged. The importance of the use of
these formulations for inducing T-effectors in vitro is obvious for
the development of transfer protocols, for example for marrow
transplantations.
LEGENDS TO THE FIGURES
[0109] FIG. 2
[0110] -.box-solid.- GST
[0111] -o- GST-IE1-pp65
[0112] FIG. 3
[0113] .quadrature. N9V
[0114] .quadrature. CMV 4h
[0115] .quadrature. I9Y
[0116] FIG. 5
[0117] -.box-solid.- I9Y
[0118] -.quadrature.- N9V
[0119] -.circle-solid.- N9V chloroquine
[0120] -o- GST-IE1-pp65
[0121] -.diamond-solid.- GST-IE1-pp65, digested
[0122] -"- GST-IE1-pp65, digested, chloroquine
[0123] FIG. 7 1
REFRENCES
[0124] 1. Alford C. A., and Britt W. J.(1990) Cytomegalovirus. In:
Virology, Second Edition, (ed. B. N. Fields, and D. M. Knipe et
al.), Raven Press Ltd., New York.
[0125] 2. Riddell, S. R., Watanabe, K. S., Goodrich, J. M., Li, R.
C., Agha, M. E., Greenberg, P. D. (1992) Restoration of viral
immunity in immunodeficient humans by the adoptive transfer of T
cell clones. Sciences 257: 238-241.
[0126] 3. Fowler, K. B., Stagno, S., Pass, R. F., Britt, W. J.,
Boll, T. J., Alford, C. A. (1992) The outcome of congenital
cytomegalovirus infection in relation to maternal antibody status.
N Engl J Med 326: 663-66.
[0127] 4. Plotkin, S., Higgins, R., Kurtz, J. B., Morris, P. J.,
Campbell, D. A., Shope, T. C., Spector, S. A., and Dankner, W. M.
(1994) Multicenter trial of Towne strain attenuated virus vaccine
in seronegative renal transplant recipients. Transplantation 58:
1176-1178.
[0128] 5. Cranage, M. P., Kouzarides, T., Bankier, A., Satchxell,
S.; Weston, K., Tomlinson, P and Barrell, B. Identification of the
hyman Cytomegalovirus glycoprotein B gene and induction of
neutralizing antibodies via its expression in recombinant vaccinia
virus. EMBO J. 1986, 5: 3057-3063.
[0129] 6. Marshall, G. S., Ricciardi, R. P., Rando, R. F., Puck,
J., Ge, R., Plotkin, S. A., and Gonezol, E. An adenovirus
recombinant that express the human cytomegalovirus major envelope
glycoprotein and induces neutralizing antibodies. J. Infect. Dis.
1990, 162: 1177-1181.
[0130] 7. Gonczol, E; Berencsi, K., Pincus, S., Endresz; V., Mric,
C., Paoletti E., and Plotkin, S. Preclinical evaluation of an ALVAC
(canarypox)-human cytomegalovirus glycoprotein B vaccine candidate.
Vaccine. 1995, 13: 1080-1085.
[0131] 8. Davignon J-L, Castani P., Allan-Yorke J., Gautier N.,
Clment D., Davrinche C. (1995) Anti-human cytomegalovirus activity
of cytokines produced by CD4+ T cell clones specifically activated
by IE1 peptides in vitro. J. Virol 70, 2162-2169 (1996).
[0132] 9. Prieur E, Betbeder D, Niedergang F, Major M, Alcover A,
Davignon J-L, Davrinche C. Combination of human cytomegalovirus
recombinant immediate-early protein (IE1) with 80nm cationic
biovectors: protection from proteolysis and potentiation of
presentation to CD4+ T cell clones in vitro. Vaccine, 1996, 14:
511-520.
* * * * *