U.S. patent application number 09/946034 was filed with the patent office on 2002-10-17 for genetically engineered animals for use as organ donors.
This patent application is currently assigned to Baptist Medical Center of Oklahoma, Inc.. Invention is credited to Cooper, David K. C., Koren, Eugen.
Application Number | 20020152488 09/946034 |
Document ID | / |
Family ID | 21961896 |
Filed Date | 2002-10-17 |
United States Patent
Application |
20020152488 |
Kind Code |
A1 |
Cooper, David K. C. ; et
al. |
October 17, 2002 |
Genetically engineered animals for use as organ donors
Abstract
Methods to manipulate animals such as pigs, and the animals and
tissues thereby derived, to reduce their immunogenicity following
implantation into humans, are described. These methods are based on
the discovery that certain carbohydrate structures on pig tissues,
which require expression of the gene encoding the .alpha.1.fwdarw.3
galactosyl transferase enzyme, are targets for natural preformed
antibodies of humans and elicit further antibody production in
humans, while other carbohydrate structures do not or do so in a
reduced amount. In the preferred embodiment, animals are produced
by homologous recombination of the gene encoding .alpha.1.fwdarw.3
galactosyl transferase in embryonic stem cells or by microinjection
into embryos of sequences eliminating or decreasing expression of
.alpha.1.fwdarw.3 galactosyl transferase. In alternative
embodiments, animals are produced having reduced amounts of
.alpha.1.fwdarw.3 galactosyl epitopes or epitopes which are masked
by sialylation or fucosylation.
Inventors: |
Cooper, David K. C.;
(Oklahoma City, OK) ; Koren, Eugen; (Oklahoma
City, OK) |
Correspondence
Address: |
PATREA L. PABST
HOLLAND & KNIGHT LLP
SUITE 2000, ONE ATLANTIC CENTER
1201 WEST PEACHTREE STREET, N.E.
ATLANTA
GA
30309-3400
US
|
Assignee: |
Baptist Medical Center of Oklahoma,
Inc.
|
Family ID: |
21961896 |
Appl. No.: |
09/946034 |
Filed: |
September 4, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09946034 |
Sep 4, 2001 |
|
|
|
08379040 |
Jan 27, 1995 |
|
|
|
08379040 |
Jan 27, 1995 |
|
|
|
08049817 |
Apr 20, 1993 |
|
|
|
Current U.S.
Class: |
800/14 ;
424/93.21; 435/325 |
Current CPC
Class: |
A01K 2217/00 20130101;
A01K 2267/025 20130101; A01K 2217/075 20130101; A01K 2267/02
20130101; A01K 2227/108 20130101; A01K 2227/10 20130101; C12N
15/8509 20130101; A01K 2207/15 20130101; A01K 2217/05 20130101;
A61K 35/12 20130101 |
Class at
Publication: |
800/14 ;
424/93.21; 435/325 |
International
Class: |
A01K 067/027; A61K
048/00; C12N 005/06 |
Claims
We claim:
1. A method for making an organ for implantation into a human
comprising genetically engineering a non-human animal having
.alpha.1.fwdarw.3 galactosyl epitopes on its cells to decrease or
prevent expression of .alpha.1.fwdarw.3 galactosyl epitopes on the
cells of the animal.
2. The method of claim 1 wherein the animal is engineered to
decrease or prevent expression of an .alpha.1.fwdarw.3 transferase
enzyme.
3. The method of claim 1 wherein the .alpha.1.fwdarw.3 galactosyl
epitopes are masked.
4. The method of claim 1 wherein the animal is genetically
engineered by homologous recombination in embryonic stem cells to
insert or delete a gene selected from the group encoding the
.alpha.1.fwdarw.3 galactosyl transferase enzyme, sialyltransferase
enzyme, and .alpha.1.fwdarw.3 fucosyltransferase.
5. The method of claim 1 wherein the animal is genetically
engineered by manipulation of the embryo to alter expression of an
enzyme selected from the group consisting of the .alpha.1.fwdarw.3
galactosyl transferase enzyme, sialyltransferase enzyme, and
.alpha.1.fwdarw.3 fucosyltransferase.
6. The method of claim 2 wherein the embryo is altered by
introduction of sequences which inhibit expression of the
.alpha.1.fwdarw.3 galactosyl transferase enzyme gene.
7. A non-primate animal, and tissues derived therefrom, which is
deficient in expression of .alpha.1.fwdarw.3 galactosyl epitopes on
its cells.
8. The animal of claim 7 wherein the animal is engineered to
decrease or prevent expression of an .alpha.1.fwdarw.3 transferase
enzyme.
9. The animal of claim 7 wherein the .alpha.1.fwdarw.3 galactosyl
epitopes are masked.
10. The animal of claim 7 wherein the animal is genetically
engineered by homologous recombination in embryonic stem cells of a
gene selected from the group encoding the .alpha.1.fwdarw.3
galactosyl transferase enzyme, sialyltransferase enzyme, and
.alpha.1.fwdarw.3 fucosyltransferase.
11. The animal of claim 7 wherein the animal is genetically
engineered by manipulation of the embryo to alter expression of an
enzyme selected from the group consisting of the .alpha.1.fwdarw.3
galactosyl transferase enzyme, sialyltransferase enzyme, and
.alpha.1.fwdarw.3 fucosyltransferase.
12. The animal of claim 8 wherein the embryo is altered by
introduction of sequences which inhibit expression of the
.alpha.1.fwdarw.3 galactosyl transferase enzyme gene.
13. The animal of claim 8 not expressing carbohydrate structures
selected from the group consisting of .alpha.Gal(1.fwdarw.3)
.beta.Gal(1.fwdarw.4) .beta. GlcNac (linear B type 2), .alpha. Gal
(1.fwdarw.3) .beta. Gal (1.fwdarw.4) .beta. Glc (linear B type 6),
.alpha.Gal(1.fwdarw.3) .beta. Gal (B disaccharide), and .alpha. Gal
(.alpha.-D-galactose).
14. The animal of claim 8 wherein expression of the transferase
gene is decreased by alteration of the regulatory sequences
required for expression of the transferase gene.
15. The animal of claim 7 wherein the animal is a pig.
16. The tissues of claim 7 selected from the group consisting of
skin, heart, liver, kidney, lung, pancreas, small bowel, and
components thereof.
17. The tissues of claim 16 wherein the animal also does not
express, or expresses in reduced amounts, on its cell surfaces,
carbohydrate structures selected from the group consisting of
N-acetyl-.beta.-D-glucos- aminide (.beta. GlcNac) and other
structures containing a terminal .beta. GlcNac, .alpha.-L-Rhamnose
and Rhamnose-containing structures, Forssman disaccharides,
Forssman trisaccharides, and A or A-like carbohydrates.
18. The tissues of claim 7 wherein the tissue is selected from the
group consisting of kidney, heart, liver, skin, lung, pancreas,
small bowel, and components thereof.
19. The animal of claim 9 wherein the .alpha.1.fwdarw.3 galactose
residues are capped with a carbohydrate selected from the group
consisting of sialic acid and fucose.
20. A method for decreasing rejection of a xenotransplant
comprising isolating tissues from non-human animals, which normally
have .alpha.1.fwdarw.3 galactosyl epitopes on their cells, which
have been genetically engineered to decrease or prevent expression
of .alpha.1.fwdarw.3 galactosyl epitopes on the cells of the
animal.
21. The method of claim 20 wherein the animal is engineered to
decrease or prevent expression of an .alpha.1.fwdarw.3 transferase
enzyme.
22. The method of claim 20 wherein the animal is genetically
engineered in embryonic stem cells to alter expression of a gene
selected from the group encoding the .alpha.1.fwdarw.3 galactosyl
transferase enzyme, sialyltransferase enzyme, and .alpha.1.fwdarw.3
fucosyltransferase.
23. The method of claim 20 wherein the animal is genetically
engineered by manipulation of the embryo to alter expression of an
enzyme selected from the group consisting of the .alpha.1.fwdarw.3
galactosyl transferase enzyme, sialyltransferase enzyme, and
.alpha.1.fwdarw.3 fucosyltransferase.
24. The method of claim 20 wherein the .alpha.1.fwdarw.3 galactosyl
epitopes are masked.
25. The method of claim 20 wherein the .alpha.1.fwdarw.3 galactosyl
epitopes are not produced or are decreased by elimination of or
decrease in expression of .alpha.1.fwdarw.3 galactosyl transferase
in the animal.
26. The method of claim 20 further comprising transplanting the
tissues into a human.
27. The method of claim 20 wherein the animal is a pig and the
tissue is selected from the group consisting of liver, heart, skin,
kidney, and components thereof.
Description
BACKGROUND OF THE INVENTION
[0001] The present invention is a genetically-engineered animal
such as a pig that is deficient in the .alpha.1.fwdarw.3 galactosyl
transferase gene, resulting in non-expression of galactosyl
epitopes on its organs and tissues, or in masked expression of
galactosyl epitopes on its organs and tissues, and methods for use
thereof as a organ donor for humans.
[0002] Organ transplantation is now an increasingly successful
option open to patients with end-stage disease of vital organs, but
is limited by the availability of suitable donors. There is now a
worldwide shortage of donor organs, and the number of potential
recipients on waiting lists and the period of time that each waits
for a suitable organ are both increasing annually, as reported in
UNOS Annual Report (1990-1991) and UNOS Update 8, 1, 1992.
[0003] At the end of 1990, almost 22,000 patients awaited a solid
organ transplant in the USA. One year later, the number had
increased to over 25,000, despite the fact that approximately
15,000 organ transplants had been performed during this period. It
is unlikely that the availability of human donors will ever be
sufficient to match the rapidly increasing number of potential
recipients.
[0004] One solution to the problem of organ supply would be the use
of organs taken from a suitable animal donor. Although the higher
non-human primates (apes and monkeys) would provide the closest
immunological match for man, there are several factors that make
the routine use of these species as organ donors unlikely. These
include (i) inadequate numbers, (ii) difficulty and expense of
breeding in large numbers, (iii) inadequate size of some organs
(e.g., heart) for adult humans, (iv) probability of public concern
regarding the use of such species for this purpose, and (v) risk of
transfer of serious viral disease.
[0005] Attention is, therefore, being directed towards more
commonly available mammals that are lower on the phylogenetic
scale, in particular, the pig, which has many advantages in this
respect, as reported by Kirkman, R. L. Of swine and men: organ
physiology in different species. In Hardy, M. D. (ed), Xenograft
25, (Elsevier, Amsterdam, N. Y., Oxford, 1989), pp. 125-132,
Cooper, D. K. C., et al. The pig as potential organ donor for man.
In Xenotransplantation. Cooper, K. D. C., Kemp, E., Reemtsma, K.,
White, D. J. G. (eds.) (Springer, Heidelberg, 1991), pp. 481-500.
These include (i) availability in large numbers, (ii) inexpensive
to breed and maintain, (iii) suitable size for the smallest or
largest of humans, (iv) availability of pathogen-free (gnotobiotic)
animals, and (v) considerable similarities of anatomy and
physiology with man.
[0006] Survival of pig-to-man (or other primate) organ transplants
is currently limited, however, by a severe humoral immune response
that leads to destruction of the graft within minutes or hours, as
reviewed by Cooper, et al. Experience with clinical heart
xenotransplantation. In Xenotransplantation. Cooper, D. K. C.,
Kemp, E., Reemtsma, K., White, D. J. G. (eds.). (Springer,
Heidelberg, 1991), pp. 541-557, and Cooper, et al. Effects of
cyclosporine and antibody adsorption on pig cardiac xenograft
survival in the baboon. J. Heart Transplant 7:238-246, 1988. The
length of the period of survival of organ xenografts decreases with
the increase of phylogenetic distance between donor and recipient
species. Xenotransplants between closelyrelated species can usually
survive the initial period of blood perfusion without damage, as do
allotransplants. Subsequently, the foreign antigens of the
transplanted organ trigger the recipient's immune response and the
acute cellular rejection process begins. These xenografts, which
behave clinically and histologically like allografts, are termed
concordant xenotransplants. Xenografts between phylogenetically
distant species follow a clinical course quite different from
allotransplants and are term discordant xenotransplants.
[0007] In discordant xenografted organs, vascular rejection occurs
within a few minutes of recirculation, with a typical
histopathological pattern of endothelial lesions with severe
interstitial hemorrhage. This hyperacute rejection is usually
irreversible, but can be delayed by removal of the recipient's
natural antibodies against the donor tissue. There is now
considerable evidence to suggest that this hyperacute rejection is
entirely or largely a result of antibody-mediated complement
activation through the classical pathway, as reported by Paul, L.
C. Mechanism of humoral xenograft rejection. In
Xenotransplantation. Cooper, D. K. C., Kemp, E., Reemtsma, K.,
White, D. J. G. (eds.) (Springer, Heidelberg, 1991), pp. 47-67, and
Platt, et al. Mechanism of tissue injury in hyperacute xenograft
rejection. In Xenotransplantation, pp. 69-79, and much attention is
being directed towards inhibiting this humoral response.
[0008] A similar situation exists with regard to organ allografting
across the ABO blood group barrier, from which much of the
available information on antibody-mediated hyperacute rejection has
been derived, as reviewed by Cooper, D. K. C. A clinical survey of
cardiac transplantation between ABO-blood group incompatible
recipients and donors. J. Heart Transplant 9:376-381, 1990, and
Alexandre, et al., Present experiences in a series of 26
ABO-incompatible living donor renal allografts. Transplant Proc.
19:4538, 1987. The utilization of synthetic A and/or B blood group
trisaccharides (Lemieux, R. U. Human blood groups and carbohydrate
chemistry. Chem. Soc. Rev. 7:423-, 1978), covalently attached to a
solid support in the form of an immunoadsorbent for the
extracorporeal depletion of human anti-A and anti-B antibodies, has
been shown to facilitate bone marrow and kidney transplantation
across the ABO blood group barrier, as shown by Bensinger, et al.
ABO-incompatible marrow transplants. Transplantation 33:427-429,
1982, and Bannett, et al., Experiences with known ABO-mismatched
renal transplants. Transplant Proc. 19:4543-4546, 1987,
respectively. Prolonged allograft survival even after the return of
high titers of anti-A or anti-B antibody, and in the presence of
normal levels of complement, has been documented by Alexandre and
Bannett, supra, and has subsequently been termed "accommodation" by
Bach, et al. Accommodation--the role of natural antibody and
complement in discordant xenograft rejection. In
Xenotransplantation, Cooper, D. K. C., Kemp, E., Reemtsma, K.,
White, D. J. G. (eds.), Springer, Heidelberg, 1991, pp. 81-99.
Using similar methods, shorter periods of accommodation have also
been documented following pig-to-baboon heart and kidney
xenografting, as reported by Cooper, et al. Effects of cyclosporine
and antibody adsorption on pig cardiac xenograft survival in the
baboon. J. Heart Transplant 7:238, 1988, and Alexandre, et al.,
Plasmapheresis and splenectomy in experimental renal
xenotransplantation. In:
[0009] Hardy, M. D. (Ed.) Xenograft 25. (New York, Elsevier Science
Publishers, 1989), p. 259.
[0010] An injectable form of the synthetic A and B blood group
trisaccharides for the in situ "neutralization" of anti-A and
anti-B antibodies (as originally investigated by Romano et al.
Preliminary human study of synthetic trisaccharide representing
blood substance A Transplant Proc. 19:4475-4478, 1987), has been
demonstrated to prevent antibody-mediated hyperacute rejection in
the baboon and, when combined with standard pharmacologic
immunosuppressive therapy, extend experimental ABO-incompatible
cardiac allograft survival from a mean of 19 minutes to more than
28 days, with one heart still functioning at almost 2 months, as
reported by Cooper, et al., A novel approach to "neutralization" of
preformed antibodies: cardiac allotransplantation across the ABO
blood group barrier as a paradigm of discordant transplantation.
Transplant Proc. 24:566-571, 1992.
[0011] However, it is clearly impractical to continually infuse the
synthetic trisaccharides, or antibodies to the trisaccharides, into
a patient, along with the immunosuppressive therapy, over an
extended period of time.
[0012] As reported in the New York Times Feb. 3, 1993, The DNX
Corporation is developing a pig with genes that are intended to
mask the immunological markers present in pigs that are used as a
source of donor organs for implantation into humans. These pigs are
created by microinjection of human DNA into pig embryos. However,
the end result is not that the pig genes are eliminated, but that
the cells also express human markers.
[0013] It is therefore an object of the present invention to
provide a long term solution to the problem of alleviating
immunorejection of xenotransplants, specifically pig into human,
where the rejection is mediated by the glycoprotein structures
present on the xenotransplant which are not found in the human.
[0014] It is a further object of the present invention to provide
genetically engineered tissues which do not express sugars which
may elicit an immune, especially a complement-mediated, response
following transplantation of an animal organ into a human.
SUMMARY OF THE INVENTION
[0015] Methods to manipulate animals, and the animals and organs
thereby derived, to reduce their immunogenicity following
implantation into humans, are described. These methods are based on
the discovery that certain carbohydrate structures on the pig
tissues, which require expression of the gene encoding the
.alpha.1.fwdarw.3 galactosyl transferase enzyme, are targets for
natural preformed antibodies of humans and elicit further antibody
production in humans, while other carbohydrate structures do not or
do so in a reduced amount. In particular, animals such as pigs are
produced by homologous recombination of the gene encoding
.alpha.1.fwdarw.3 galactosyl transferase in embryonic stem cells to
eliminate expression of the .alpha.1.fwdarw.3 galactosyl
transferase gene or by microinjection of CDNA constructs into
embryos of sequences inactivating or decreasing expression of
.alpha.1.fwdarw.3 galactosyl transferase.
BRIEF DESCRIPTION OF THE DRAWING
[0016] FIG. 1 is a comparison of DNA and derived protein sequences
of murine .alpha.(1,3)-GT CDNA, bovine .alpha.(1,3)-GT CDNA, and
cloned homologous human genomic sequences, as shown at page 7058 of
Larsen, et al., J. Biol. Chem. 265(12), 7055-7061 (1990). The
nucleotide sequence of an 801-bp segment of pHGT-1 (human genomic
DNA) is shown, with the corresponding amino acid sequence derived
from the relevant reading frame (human protein, reading frames
denoted by a, b and c). The nucleotide sequence is numbered in
register with the sequence of the murine .alpha.(1,3)-GT cDNA,
Sequence ID No. 1, a portion of which is displayed (murine cDNA)
below the human DNA sequence. Vertical lines between the murine and
human DNA sequences denote nucleotide sequence identity. Human
genomic DNA sequences located 5' from bp 492' which exhibit no
homology to the murine .alpha.(1,3)-GT cDNA, are displayed in lower
case letters. A portion of this part of the human sequence which
displays strong similarity to the mammalian consensus splice
acceptor sequence is double underlined. The predicted amino acid
sequences inferred from the nucleotide sequences of the murine
.alpha.(1,3)-GT cDNA (murine protein) and the bovine
.alpha.(1,3)-GT cDNA (bovine protein) are indicated below the
murine nucleotide sequence. Amino acids within these sequences that
are identical to the corresponding human amino acid residue are
indicated by a hyphen. The two segments of the human DNA used to
generate the polymerase chain reaction amplimers are denoted by the
stippled underlining. The AvrII site used to analyze the polymerase
chain reaction products is underlined.
DETAILED DESCRIPTION OF THE INVENTION
[0017] Working on the hypothesis that those portions of the
antigenic targets against which human anti-pig antibodies are
directed are also carbohydrate structures, carbohydrate structures
present in pig but not human which appear to elicit an immune
response against the pig tissues when transplanted into humans have
been identified. A method to create pigs, as well as other animals,
for use as potential organ and tissue donors has been developed
based on this information. This method, and the animals produced
using the method, should be effective in achieving successful organ
transplantation between these animals and man in a manner similar
to that achieved when organ transplantation is performed between
donor and recipient of ABO-incompatible allografts.
[0018] When pig tissues are implanted into humans, they elicit the
production of antibodies against the pig tissues. These antibodies
have been isolated and characterized for immunoreaction against
specific components or fractions of pig tissues to determine which
pig-specific molecules elicit the antibody production, as described
below in Example 1.
[0019] Numerous carbohydrate structures bound human anti-pig
antibodies eluted from one or more pig heart and/or pig kidney
transplants. The populations of anti-carbohydrate antibodies varied
slightly depending on the pig organ and the individual human serum
adsorbed. Four a-galactosyl related molecules (haptens), however,
bound all of the human anti-pig kidney antibodies and most of the
anti-pig heart antibodies. These four haptens were: (i) .alpha.
Gal(1.fwdarw.3) .beta. Gal(1.fwdarw.4) .beta. GlcNac (linear B type
2), (ii) .alpha. Gal (1.fwdarw.3) .beta. Gal (1.fwdarw.4) .beta.
Glc (linear B type 6), (iii) .alpha. Gal(1.fwdarw.3) .beta. Gal (B
disaccharide), and (iv) .alpha. Gal (.alpha.-D-galactose). All
yielded high optical density (O.D.) results for the samples tested.
Significant levels of both IgG and IgM anti-linear B antibodies
were detected, although in some preparations, IgG anti-linear B
antibodies predominated.
[0020] Other carbohydrate haptens were bound by antibodies from
individual eluted antibody preparations, including (i)
N-acetyl-.beta.-D-glucosamini- de (.beta. GlcNac) and other
structures containing a terminal .beta. GlcNac, (ii)
.alpha.-L-Rhamnose and Rhamnose-containing structures, (iii)
Forssman disaccharide and Forssman trisaccharide, (iv) A or A-like
carbohydrates (namely A disaccharide, A trisaccharide, a variety of
A tetrasaccharides and linear A type 6). However, these
carbohydrates were not bound by significant levels of antibody from
all preparations and were demonstrated not to elicit the most
significant immunoreactions, as shown by the data in example 1
below.
[0021] The human anti-pig antibody preparations in this study
contained primarily IgG anti-linear B, but some preparations
contained IgM anti-linear B. Anti-pig antibodies can be adsorbed
from human plasma by passing the plasma through a column of one or
more of the specific linear .alpha.-Galactosyl structures.
Moreover, the addition of the specific carbohydrate to human serum
also appears to inhibit or "neutralize" the destructive effect,
wholly or in part, of the serum on pig kidney and endothelial cell
lines.
[0022] The adsorption or "neutralization" of such anti-pig
antibodies by a specific carbohydrate or combination of
carbohydrates, utilizing one (or a combination) of the above two
techniques, should prevent the hyperacute rejection that occurs
when xenotransplantation is carried out using a discordant donor in
man, based on the survival of ABO-incompatible cardiac allografts
in hyperimmunized baboons from a mean of 19 minutes in untreated
animals to several weeks in recipients receiving a continuous
intravenous infusion of A or B synthetic hapten (for periods less
than 19 days) and long-term pharmacologic immunosuppressive
therapy, as reported by Cooper, et al., 1992.
[0023] Based on these studies, production of pig-specific
carbohydrate structures eliciting an immune response is due to
expression in pigs of the enzyme .alpha.1.fwdarw.3 galactosyl
transferase. A means is described herein of genetically engineering
animals that do not express the .alpha.-galactosyl epitope on their
cells, or in which the epitope is reduced in frequency or masked
from the immune response, making xenotransplantation possible
without the need for prior removal or "neutralization" of the human
anti-galactosyl antibodies.
[0024] To prevent expression of the .alpha.1.fwdarw.3 galactosyl
transferase, the gene is deleted, interrupted, or replaced, either
within the coding region or within the regulatory sequences, so
that enzyme is not produced. This is generally accomplished by
manipulation of animal embryos followed by implantation of the
embryos in a surrogate mother. The embryos can be manipulated
directly, by injection of genetic material into the embryo by
microinjection or by vectors such as retroviral vectors, or
indirectly, by manipulation of embryonic stem cells. The latter
methodology is particularly useful in the case where the end result
that is desired is to completely prevent expression of an active
enzyme. In some cases, however, it may simply be that one wants to
decrease expression, where there is a role of the protein encoded
by the gene that is essential to viability or health of the animal
and the optimum results are achieved by suppression, rather than
eliminating gene expression, or one may want to introduce a gene
for an enzyme which can "cap" or mask the .alpha.1.fwdarw.3
galactosyl epitopes. Suppression can be achieved by introduction of
pig antisense to the .alpha.1.fwdarw. galactosyl transferase
gene.
[0025] Genes encoding a galactosyl transferase from species other
than, but related to, pig, have been identified and can be used
with standard techniques, for example, hybridization under
stringent conditions or polymerase chain reaction, to obtain the
pig .alpha. galactosyl transferase gene. Accordingly, the most
preferred method at this time is to use microinjection methodology
to eliminate the gene from the animals by homologous recombination
of the gene.
[0026] "Isolation of a CDNA encoding a murine
UDP:galactose:.beta.-D-galac- tosyl-1,4-N-acetyl-D-glucosaminide
.alpha.-1,3-galactosyltransferase: Expression cloning by gene
transfer", Larsen, et al., Proc. Natl. Acad. Sci. USA 86, 8227-8231
(1989), the teachings of which are incorporated herein, describes
how to isolate cloned cDNA sequences that determine expression of
cell surface oligosaccharide structures and their cognate
glycosyltransferases. See also Smith, et al., "Transfer and
Expression of a Murine
UDP-Gal:.beta.-D-Gal-.alpha.1,3-Galactosyltransferase Gene in
Transfected Chinese Hamster Ovary Cells" J. Biol. Chem. 265(11),
6225-6234 (1990). They identified a cDNA, Sequence ID No. 1,
containing a single long open reading frame that predicts a 394
amino acid protein, Sequence ID No. 2, having a topology similar to
other mammalian glycosyltransferases and which could be inserted
into COS cells not expressing (.alpha.1.fwdarw.3)GT and result in
formation of Gal(.alpha.1.fwdarw.3) Gal(.beta.1.fwdarw.4)GlcNAc on
the cell surfaces. Subsequent studies by Larsen, et al.,
"Frameshift and Nonsense Mutations in a Human Genomic Sequence
Homologous to a Murine UDP-Gal: .beta.-D-Gal(1,4)-D-GlcNAc
.alpha.(1,3)-Galactosyltransferase cDNA" J. Biol. Chem. 265(12),
7055-7061 (1990), demonstrates that the human gene corresponding to
the murine gene for the galactosyltransferase is defective and
therefore cannot determine expression of Gal.alpha.1.fwdarw.3Gal
epitopes on human cells. The information used in these publications
can be used to obtain a genomic DNA clone to delete or inactivate
the corresponding galactosyltransferase gene in pigs and other
animals using microinjection of the DNA to inactivate or delete the
animal galactosyltransferase responsible for expression of
structures on the cells which elicit the major immunorejection of
the cells when implanted into humans. A comparison of DNA and
derived protein sequences of murine .alpha.(1,3)-GT cDNA, bovine
.alpha.(1,3)-GT cDNA, and cloned homologous human genomic
sequences, as shown at page 7058 of Larsen, et al. (1990), is shown
in FIG. 1.
[0027] The murine cDNA sequence (Sequence ID No. 1) is as
follows:
1 CCTTCCCTTGTAGACTCTTCTTGGAATGAGAAGTACCGATTCTGCTGAAGACCTCGCGCTCTCAG
GCTCTGGGAGTTGGAACCCTGTACCTTCCTTTCCTCTGCTGAGCCCTGCCTCCTTA- GGCAGGCCA
GAGCTCGACAGAACTCGGTTGCTTTGCTGTTTGCTTTGGAGGGAACAC- AGCTGACGATGAGGCTG
ACTTTGAACTCAAGAGATCTGCTTACCCCAGTCTCCTGGA- ATTAAAGGCCTGTACTACATTTGCC
TGGACCTAAGATTTTC (non-coding region)
ATGATCACTATGCTTCAAGATCTCCATGTCAACAAGATCTCCATGTCAA- GATCCAAGTCAGAAAC
AAGTCTTCCATCCTCAAGATCTGGATCACAGGAGAAAATAA- TGAATGTCAAGGGAAAAGTAATCC
TGTTGATGCTGATTGTCTCAACCGTGGTTGTCG- TGTTTTGGGAATATGTCAACAGAATTCCAGAG
GTTGGTGAGAACAGATGGCAGAAGG- ACTGGTGGTTCCCAAGCTGGTTTAAAAATGGGACCCACAG
TTATCAAGAAGACAACGTAGAAGGACGGAGAGAAAAGGGTAGAAATGGAGATCGCATTGAAGAGC
CTCAGCTATGGGACTGGTTCAATCCAAAGAACCGCCCGGATGTTTTGACAGTGACCCCGTGGAAG
GCGCCGATTGTGTGGGAAGGCACTTATGACACAGCTCTGCTGGAAAAGTACTACGCC- ACACAGAA
ACTCACTGTGGGGCTGACAGTGTTTGCTGTGGGAAAGTACATTGAGCAT- TACTTAGAAGACTTTC
TGGAGTCTGCTGACATGTACTTCATGGTTGGCCATCGGGTC- ATATTTTACGTCATGATAGACGAC
ACCTCCCGGATGCCTGTCGTGCACCTGAACCCT- CTACATTCCTTACAAGTCTTTGAGATCAGGTC
TGAGAAGAGGTGGCAGGATATCAGC- ATGATGCGCATGAAGACCATTGGGGAGCACATCCTGGCCC
ACATCCAGCACGAGGTCGACTTCCTCTTCTGCATGGACGTGGATCAAGTCTTTCAAGACAACTTC
GGGGTGGAAACTCTGGGCCAGCTGGTAGCACAGCTCCAGGCCTGGTGGTACAAGGCCAGTCCCGA
GAAGTTCACCTATGAGAGGCGGGAACTGTCGGCCGCGTACATTCCATTCGGAGAGGG- GGATTTTT
ACTACCACGCGGCCATTTTTGGAGGAACGCCTACTCACATTCTCAACCT- CACCAGGGAGTGCTTT
AAGGGGATCCTCCAGGACAAGAAACATGACATAGAAGCCCA- GTGGCATGATGAGAGCCACCTCAA
CAAATACTTCCTTTTCAACAAACCCACTAAAAT- CCTATCTCCAGAGTATTGCTGGGACTATCAGA
TAGGCCTGCCTTCAGATATTAAAAG- TGTCAAGGTAGCTTGGCAGACAAAAGAGTATAATTTGGTT
AGAAATAATGTCT (coding region)
GACTTCAAATTGTGATGGAAACTTGACACTATTTCTAACCA (non-coding region)
[0028]
2 Sequence ID No. 2 is the amino acid sequence: M I T M L Q D L H V
N K I S M S R S K S E T S L P S S R S G S Q E K I M N V K G K V I L
L M L I V S T V V V V F W E Y V N R I P E V G E N R W Q K D W W F P
S W F K N G T H S Y Q E D N V E G R R E K G R N G D R I E E P Q L W
D W F N P K N R P D V L T V T P W K A P I V W E G T Y D T A L L E K
Y Y A T Q K L T V G L T V F A V G K Y I E H Y L E D F L E S A D M Y
F M V G H R V I F Y V M I D D T S R M P V V H L N P L H S L Q V F E
I R S E K R W Q D I S M M R M K T I G E H I L A H I Q H E V D F L F
C M D V D Q V F Q D N F G V E T L G Q L V A Q L Q A W W Y K A S P E
K F T Y E R R E L S A A Y I P F G E G D F Y Y H A A I F G G T P T H
I L N L T R E C F K G I L Q D K K H D I E A Q W H D E S H L N K Y F
L F N K P T K I L S P E Y C W D Y Q I G L P S D I K S V K V A W Q T
K E Y N L V R N N V *
Construction of Transgenic Animals.
Animal Sources
[0029] Animals suitable for transgenic experiments can be obtained
from standard commercial sources. These include animals such as
mice and rats for testing of genetic manipulation procedures, as
well as larger animals such as pigs, cows, sheep, goats, and other
animals that have been genetically engineered using techniques
known to those skilled in the art. These techniques are briefly
summarized below based principally on manipulation of mice and
rats.
Microiniection Procedures
[0030] The procedures for manipulation of the embryo and for
microinjection of DNA are described in detail in Hogan et al.
Manipulating the mouse embryo, Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y. (1986), the teachings of which are incorporated
herein. These techniques are readily applicable to embryos of other
animal species, and, although the success rate is lower, it is
considered to be a routine practice to those skilled in this
art.
Transgenic Animals
[0031] Female animals are induced to superovulate using methodology
adapted from the standard techniques used with mice, that is, with
an injection of pregnant mare serum gonadotrophin (PMSG; Sigma)
followed 48 hours later by an injection of human chorionic
gonadotrophin (hCG; Sigma). Females are placed with males
immediately after hCG injection. Approximately one day after hCG,
the mated females are sacrificed and embryos are recovered from
excised oviducts and placed in Dulbecco's phosphate buffered saline
with 0.5% bovine serum albumin (BSA; Sigma). Surrounding cumulus
cells are removed with hyaluronidase (1 mg/ml). Pronuclear embryos
are then washed and placed in Earle's balanced salt solution
containing 0.5% BSA (EBSS) in a 37.5.degree. C. incubator with a
humidified atmosphere at 5% CO.sub.2, 95% air until the time of
injection.
[0032] Randomly cycling adult females are mated with vasectomized
males to induce a false pregnancy, at the same time as donor
females. At the time of embryo transfer, the recipient females are
anesthetized and the oviducts are exposed by an incision through
the body wall directly over the oviduct. The ovarian bursa is
opened and the embryos to be transferred are inserted into the
infundibulum. After the transfer, the incision is closed by
suturing.
Embryonic Stem (ES) Cell Methods
Introduction of cDNA into ES cells
[0033] Methods for the culturing of ES cells and the subsequent
production of transgenic animals, the introduction of DNA into ES
cells by a variety of methods such as electroporation, calcium
phosphate/DNA precipitation, and direct injection are described in
detail in Teratocarcinomas and embryonic stem cells. a practical
approach, ed. E. J. Robertson, (IRL Press 1987), the teachings of
which are incorporated herein. Selection of the desired clone of
transgene-containing ES cells is accomplished through one of
several means. In cases involving sequence specific gene
integration, a nucleic acid sequence for recombination with the
.alpha.(1.fwdarw.3) galactosyl transferase gene or sequences for
controlling expression thereof is co-precipitated with a gene
encoding a marker such as neomycin resistance. Transfection is
carried out by one of several methods described in detail in
Lovell-Badge, in Teratocarcinomas and embryonic stem cells, a
practical approach, ed. E. J. Robertson, (IRL Press 1987) or in
Potter et al Proc. Natl. Acad. Sci. USA 81,7161 (1984). Calcium
phosphate/DNA precipitation, direct injection, and electroporation
are the preferred methods. In these procedures, a number of ES
cells, for example, 0.5.times.10.sup.6, are plated into tissue
culture dishes and transfected with a mixture of the linearized
nucleic acid sequence and 1 mg of pSV2neo DNA (Southern and Berg,
J. Mol. Appl. Gen. 1:327-341 (1982)) precipitated in the presence
of 50 mg lipofectin in a final volume of 100 .mu.l. The cells are
fed with selection medium containing 10% fetal bovine serum in DMEM
supplemented with an antibiotic such as G418 (between 200 and 500
.mu.g/ml). Colonies of cells resistant to G418 are isolated using
cloning rings and expanded. DNA is extracted from drug resistant
clones and Southern blotting experiments using the nucleic acid
sequence as a probe are used to identify those clones carrying the
desired nucleic acid sequences. In some experiments, PCR methods
are used to identify the clones of interest.
[0034] DNA molecules introduced into ES cells can also be
integrated into the chromosome through the process of homologous
recombination, described by Capecchi, (1989). Direct injection
results in a high efficiency of integration. Desired clones are
identified through PCR of DNA prepared from pools of injected ES
cells. Positive cells within the pools are identified by PCR
subsequent to cell cloning (Zimmer and Gruss, Nature 338,150-153
(1989)). DNA introduction by electroporation is less efficient and
requires a selection step. Methods for positive selection of the
recombination event (i.e., neo resistance) and dual
positive-negative selection (i.e., neo resistance and ganciclovir
resistance) and the subsequent identification of the desired clones
by PCR have been described by Joyner et al., Nature 338, 153-156
(1989) and Capecchi, (1989), the teachings of which are
incorporated herein.
Embryo Recovery and ES Cell Injection
[0035] Naturally cycling or superovulated females mated with males
are used to harvest embryos for the injection of ES cells. Embryos
of the appropriate age are recovered after successful mating.
Embryos are flushed from the uterine horns of mated females and
placed in Dulbecco's modified essential medium plus 10% calf serum
for injection with ES cells. Approximately 10-20 ES cells are
injected into blastocysts using a glass microneedle with an
internal diameter of approximately 20 .mu.m.
Transfer of Embryos to Pseudopregnant Females
[0036] Randomly cycling adult females are paired with vasectomized
males. Recipient females are mated such that they will be at 2.5 to
3.5 days post-mating (for mice, or later for larger animals) when
required for implantation with blastocysts containing ES cells. At
the time of embryo transfer, the recipient females are
anesthetized. The ovaries are exposed by making an incision in the
body wall directly over the oviduct and the ovary and uterus are
externalized. A hole is made in the uterine horn with a needle
through which the blastocysts are transferred. After the transfer,
the ovary and uterus are pushed back into the body and the incision
is closed by suturing. This procedure is repeated on the opposite
side if additional transfers are to be made.
Identification of Transgenic Animals.
[0037] Samples (1-2 cm of mouse tails) are removed from young
animals. For larger animals, blood or other tissue can be used. To
test for chimeras in the homologous recombination experiments,
i.e., to look for contribution of the targeted ES cells to the
animals, coat color has been used in mice, although blood could be
examined in larger animals. DNA is prepared and analyzed by both
Southern blot and PCR to detect transgenic founder (F.sub.0)
animals and their progeny (F.sub.l and F.sub.2).
[0038] Once the transgenic animals are identified, lines are
established by conventional breeding and used as the donors for
tissue removal and implantation using standard techniques for
implantation into humans.
Insertion or Modification of the Genomic DNA Encoding
.alpha.1.fwdarw.3 galactosyltransferase or the 1.fwdarw.3
galactosyl structures
[0039] These manipulations are performed by insertion of cDNA or
genomic DNA into the embryo using microinjection or other
techniques known to those skilled in the art such as
electroporation. The DNA is selected on the basis of the purpose
for which it is intended: to inactivate the gene encoding an enzyme
such as the .alpha.1.fwdarw.3 galactosyltransferase. The enzyme
encoding gene can be modified by homologous recombination with a
DNA for a defective enzyme, such as one containing within the
coding sequence an antibiotic marker, which can then be used for
selection purposes.
[0040] The gene encoding an .alpha.1.fwdarw.3 galactosyltransferase
is described by Larsen, et al., 1990. Frameshift and Nonsense
Mutations in a Human Genomic Sequence Homologous to a Murine
UDP-Gal:.beta.-D-Gal(1,4)-D- -GlcNAc
.alpha.(1,3)-Galactosyltransferase cDNA J. Biol. Chem. 265(12),
7055-7061, the teachings of which are incorporated herein.
Alternative Methodologies to Produce Animals with Altered
Expression of .alpha.1.fwdarw.3 Galactosyl Transferase
[0041] The DNA encoding another enzyme for modification of the
sugar structures, such as a sialylase, can also be inserted into
the embryo where it is incorporated into the animal's chromosomes
and expressed to modify or mask the immunoreactivity of the
.alpha.-galactosyl structures on the cell surfaces.
[0042] Although not preferred, in some cases it may be equally
useful to alter expression of .alpha.1.fwdarw.3 galactosyl
transferase in the pigs using techniques other than genetic
engineering. For example, pigs can be selected for decreased
expression of .alpha.1.fwdarw.3 galactosyl transferase and bred by
standard techniques to produce animals that are deficient in this
enzyme. It is routine to screen animals both for the presence of,
and expression of, enzymes, as well as defined epitopes on the
tissues, although prior to this disclosure one would not have been
motivated to screen for expression of .alpha.1.fwdarw.3 galactosyl
transferase in transgenic animals for use as organ donors.
[0043] The same effect may also be achieved through the use of
retroviral vectors, especially tissue specific vectors, which carry
nucleic acid sequences, such as antisense sequences, resulting in
decreased expression of the gene encoding .alpha.1.fwdarw.3
galactosyl transferase.
Methods for Masking Expression of .alpha.-galactosyl Epitopes
[0044] It is possible not only to decrease or completely inhibit
expression of the .alpha.-galactosyl epitopes on the animal
tissues, but also to mask them by attaching another carbohydrate to
the epitopes to mask them from the immune response following
transplantation. This can be accomplished by introduction into the
animal of a gene encoding an enzyme that "caps" the
.alpha.-galactosyl epitopes or by the use of an introduced enzyme
plus manipulation of substrate feeding to cap the epitopes.
[0045] It has been hypothesized that the lack of .alpha.-galactosyl
epitopes in man and Old World monkeys is the result of diminishing
activity of one enzyme, the .alpha.(1.fwdarw.3)
galactosyltransferase. The membrane glycoproteins of human cells
are usually sialylated by sialyltransferase. The diversity in
carbohydrate structure presumably arises from a multiplicity of
synthetic enzymes in different species or different cells.
Switching galactosyltransferase with fucosyl or sialyltransferase
in animal cells should result in the expression of fucose or sialic
acid in their antigen epitopes.
[0046] A human .alpha.-1,3 fucosyltransferase has been cloned by
Koszdin and Bowen, 1992 The Cloning and Expression of a Human
.alpha.-1,3 Fucosyltransferase Capable of Forming the E-Selectin
Ligand Biochem. Biophys. Res. Comm. 187(1), 152-157; and Lowe, et
al., 1991 Molecular Cloning of a Human Fucosyltransferase Gene That
Determines Expression of the Lewis x and VIM-2 Epitopes but Not
ELAM-1-dependent Cell Adhesion, J. Biol. Chem. 266(26),
17467-17477, the teachings of which are incorporated herein. Human
.alpha.(1-3)fucosyltransferase was transfected into mammalian
cells, which resulted in the expression of Lewis X and sialyl Lewis
carbohydrate structures in the cell membrane.
[0047] Kayser, et al., 1992 Incorporation of
N-acyl-2-amino-2-deoxy-hexose- s into glycosphingolipids of the
pheochromocytoma cell line PC 12, FEBS 301(2), 137-140; and Kayser,
et al., 1992 Biosynthesis of a Nonphysiological Sialic Acid in
Different Rat Organs, using N-Propanoyl-D-hexosamines as
Precursors, J. Biol. Chem. 267(24), 16934-16938, have successfully
modified the N-acetyl neuraminic acid which is normally present in
rat tissues by the in vivo administration of chemically synthesized
N-propanoyl precursors. Rat cells are able to take up N-acetyl
D-mannosamine or N-propanoyl D-glucosamine as precursors, and the
presence of sialyltransferase in rat cells can incorporate these
precursors into glycolipids and glycoproteins, which are expressed
in the cell membrane.
[0048] It therefore should be possible to inject galactosyl
analogues into animals such as the pig where they will compete with
the natural substrate to be transferred to glycoproteins. Even a
slight change of carbohydrate epitope could reduce antibody
binding. It is preferable to modify the epitope to a carbohydrate
that is present in the human subject so that antibodies against
this carbohydrate are not present in the human recipient of the
animal organ. If it is modified to any other carbohydrate, then
antibodies to this carbohydrate might develop if the carbohydrate
is not naturally occurring in the human subject.
[0049] Although not preferred, this same methodology can also be
used to inhibit or decrease expression of other carbohydrate
structures on non-human animal tissues, to further enhance
compatibility, including structures such as (i)
N-acetyl-.beta.-D-glucosaminide (.beta. GlcNac) and other
structures containing a terminal .beta. GlcNac, (ii)
.alpha.-L-Rhamnose and Rhamnose-containing structures, (iii)
Forssman disaccharide and Forssman trisaccharide, and (iv) A or
A-like carbohydrates (A disaccharide, A trisaccharide, a variety of
A tetrasaccharides and linear A type 6).
[0050] Once the animals are produced, tissues, including skin,
heart, livers, kidneys, lung, pancreas, small bowel, and components
thereof are harvested and implanted as known by those skilled in
the art of transplantation.
EXAMPLE 1
Demonstration of Importance of .alpha.-Gal in Eliciting Immune
Mediated Rejection of Xenotransplants from Pigs into Humans
[0051] Pig tissues were screened by immunofluorescence with
lectins, monoclonal antibodies and human natural antibodies for the
presence of carbohydrate antigens which may be potential targets
for hyperacute vascular rejection in pig-to-man
xenotransplantation. The unfucosylated monomorph linear B-anitgen
was found at the surface of all porcine vascular endothelial cells.
This pig linear-B antigen reacts strongly with the anti-.alpha. Gal
isolectin B.sub.4 from Griffonia simplicifolia 1 and with human
natural anti-.alpha. Gal antibodies specifically purified by
affinity chromatography on synthetic oligosaccharides containing
the terminal non-reducing a Gall.fwdarw.3 Gal-R disaccharide. This
antigenic activity is destroyed by treatment of pig tissues with
.alpha.-galactosidase. The localization of this linear-B epitope on
vascular endothelium and its reactivity with natural human
anti-.alpha. Gal antibodies suggest that it may play a major role
in the hyperacute vascular rejection of pig-to-man organ
xenografts. Unlike pigs, humans express the fucosylated polymorphic
ABH histo-blood group antigens on vascular endothelium.
[0052] Epithelial cells of pig renal proximal convoluted tubules,
respiratory epithelium, pancreatic ducts and epidermis also express
the linear-B antigen, but they are less likely to trigger a
hyperacute vascular rejection because they are not directly exposed
to the blood.
[0053] The genetically defined pig A+/A- system controls the
expression of A and H antigens in pig epithelial cells from renal
distal and collecting tubules, biliary ducts, pancreatic ducts,
large bronchi and digestive mucosa. The pig A antigen may trigger
an immune response in human O or B recipients if they are
transplanted with organs from A+ pigs, but the pig A antigen is
probably not involved in the hyperacute vascular rejection of a
xenograft because it is not expressed on vascular endothelium.
Materials and Methods
Pig tissues
[0054] Pigs do not express the ABH blood group antigens as
constitutive glycoproteins of the erythrocyte membrane, as do
humans. However, there are genetically defined A+ and A- pigs,
which can be identified by hemagglutination with some strong anti-A
reagents. The A+ or "A like" pigs have a circulating A
glycosphingolipid which is passively adsorbed at the surface of
erythrocytes and leukocytes, while the A- or "O like" pigs have a
circulating H glycosphingolipid which is passively adsorbed on the
same cells, as reported by Oriol R. Tissular expression of ABH and
Lewis antigens in humans and animals: Expected value of different
animal models in the study of ABO-incompatible organ transplants.
Transplant Proc. 1987 19:4416-4420. The serum of A- pigs can
agglutinate red cells of A+ pigs, but the reaction is weak and can
take a long time to be completed, as discussed by Andresen, "Blood
groups in pigs" Ann. N.Y. Acad. Sci. 97,205-225 (1962).
[0055] Two A+ and two A- healthy Yorkshire pigs from a specific
pathogen-free herd at the Oklahoma State University were selected
serologically. Tissue samples of myocardium, aorta, kidney, liver,
pancreas, lung, intestine and skin were divided into two. One
sample was maintained frozen at -80.degree. C. for cryostat
sections, and the second was fixed in formalin 10% (SIGMA, USA) and
embedded in paraffin wax by routine histological techniques.
Lectins
[0056] Tetramethyl rhodamine isothiocyanate (TRIT)-labelled, Ulex
europaeus agglutinin 1 staining H-type-2
(.alpha.Fuc1.fwdarw.2.beta.Gal1.- fwdarw.4.beta.GlcNAc) and
Le.sup.y (.alpha. Fuc1.fwdarw.2.beta..beta.Gal1.- fwdarw.4
(.alpha.Fuc1.fwdarw.3)BG1cNAc), Griffonia simplicifolia lectin 1
staining terminal .alpha.Gal and .alpha.GalNAc, and fluorescein
isothiocyanate (FITC)-labelled Arachis hypoaea lectin (peanut
agglutinin, PNA) staining terminal .beta.GalNAc > .alpha.GalNAc
disaccharide > .beta. or .beta.Gal were obtained from Vector
Laboratories (Burlingame, Calif., USA). FITC-labelled Helix pomatia
(anti-Forssmann>anti-A> .alpha.Gal), and isolectins A.sub.4
(.alpha.GalNAc>.alpha.Gal) and B.sub.4 (specific for .alpha.Gal)
from Griffonia simplicifolia lectin 1 were obtained from E-Y (San
Mateo, Calif., USA).
Monoclonal Antibodies
[0057] Nineteen anti-A (001, 002, 005, 006, 008, 009, 012, 013,
014, 016, 018, 020, 021, 022, 048, 049, 050, 052, 053), seventeen
anti-B (025, 026, 028, 031, 032, 033, 034, 035, 036, 037, 040, 041,
042, 043, 044, 046, 047), and four anti-II-type-2 (058, 059, 063
and 064) monoclonal reagents were obtained from the Second
International Workshop on Monoclonal Antibodies against Human Red
Blood cells and Related Antigens, Lund, Sweden, 1990 (Oriol, et
al., "ABO antibodies-serological behaviour and immuno-chemical
characterization" J. Immunogenet. 17, 279-299 (1990). Anti-Le.sup.x
(80H5 and 82H5) were obtained from Chembiomed Ltd. (Alberta
Research Council, Edmonton, Canada).
Polyclonal Hyperimmune Animal Antibodies.
[0058] Polyclonal anti-H (SupH) antibodies, described by Mollicone,
et al., "Immunohistologic pattern of type 1 (Le.sup.a,Le.sup.b) and
type 2 (X,Y,H) blood group-related antigens in the human pyloric
and duodenal mucosae" Lab. Invest. 53, 219-227 (1985), were
obtained from the serum of a goat hyperimmunized with human saliva
from a blood group 0 Le(a-b-) individual, salivary secretor of H
antigen. Specific anti-H antibodies were purified from this serum
by affinity chromatography on synthetic H-type-2 immunoadsorbent
(Chembiomed Ltd., Alberta Research Council, Edmonton, Canada). The
purified anti-H reagent recognized H-type-1, H-type-2,
H-type-3,H-type-4, H-type-5 and H-type-6 synthetic
oligosaccharides.
[0059] Polyclonal anti-H-type-1 (gift of S. Henry, Auckland Blood
Transfusion Center, New Zealand) was obtained from the serum of
rabbits immunized with human saliva of blood group 0 Le (a-g-)
salivary secretor individuals. Anti-H-type-2 activity of this serum
was removed by adsorption with H-type-2 immunoadsorbent and the
specific anti-H-type-1 antibodies were then purified by affinity
chromatography on the H-type-1 immunoadsorbent (Chembiomed Ltd.,
Alberta Research Council, Edmonton, Canada). This purified
anti-H-type-1 reagent cross-reacted with the type 1 Leb synthetic
oligosaccharides, but did not cross-react with H-type-2
structures.
Purification of Natural Anti-.alpha. Gal Human Antibodies
[0060] Five different fractions of human anti-.alpha. Gal
antibodies were obtained by affinity chromatography of normal human
serum on solid immunoadsorbents made with five structurally related
synthetic oligosaccharides, described by Lemieux "Human blood
groups and carbohydrate chemistry" Chem. Soc. Rev. 7, 423-452
(1978), covalently coupled through the aliphatic linking arm
R=(CH.sub.2).sub.8COOCH.sub.3 to a silica matrix (Synsorb.TM. from
Chembiomed Ltd.). The structures of the synthetic oligosaccharide
coupled to the immunoadsorbent were (i) the terminal monosaccharide
of the linear-B epitope .alpha.-Gal-R, (ii) the terminal
disaccharide of the linear-B epitope .alpha.Gal1.fwdarw.3.beta.G-
al-R, (iii) the trisaccharide linear-B-type-2 epitope
.alpha.Gal1.fwdarw.3.beta.GlcNAc-R, (iv) the trisaccharide
linear-B-type-6 or deacetylated linear-B-type-2
.alpha.Gal1.fwdarw.3.beta- .Gal1.fwdarw.4.beta.Gle-R and (v) the
terminal disaccharide of the P.sub.1 red cell antigen
.alpha.Gal1.fwdarw.4 .beta.Gal-R, that is also a receptor for a
uropathogenic Escherichia coli, as reported by Bock, et al.,
"Specificity of binding of a strain of uropathogenic Escherichia
coli to Gal.alpha. 1-4Gal-containing glycosphingolipids" J. Biol.
Chem. 260, 8545-8551 (1985), and has the second galactose linked
1.fwdarw.4 instead of the 1.fwdarw.3 linkage of the linear-B. This
last oligosaccharide structure has been found in several pig
glycolipids, as reported by Holgersson, et al., "Structural
characterization of non-acid glycosphingolipids in kidneys of
single blood group O and A pigs" J. Biochem. 108, 766-777
(1990).
[0061] Small columns (0.5 cm diameter.times.10 cm height) were
packed with 1 g of each immunoadsorbent. Aliquots of 3 ml of a pool
of normal human serum were adsorbed onto each column, and the
columns were washed with phosphate buffered saline (PBS) until the
OD at 280 nm of the eluate was <0.005. Then the adsorbed
antibodies were eluted with NH.sub.4OH 1% (pH 11) and dialyzed
against PBS. The final yield of protein was 0.6 mg for the
monosaccharide a-galactose immunoadsorbent and about 1 mg for the
di and trisaccharide immunoadsorbents.
Secondary Antibodies
[0062] Affinity purified, FITC-labelled sheep anti-mouse and
anti-rabbit Ig were obtained from Pasteur Diagnostics (Marnes la
Coquette, France). FITC-labelled Fab fragment of affinity purified
anti-human Ig was obtained from Biosys (Compiegne, France). FITC-
labelled, affinity purified, pig anti-goat Ig was obtained from E-Y
(San Mateo, Calif. USA).
[0063] Glycosidases. .alpha.-galactosidase EC 3.2.1.22 from green
coffee beans, .beta.-galactosidase EC 3.2.1.23 from Escherichia
coli, .alpha.-fucosidase EC 3.2.1.51 from beef kidney and
neuraminidase EC 3.2.1.18 from Vibrio cholera, were obtained from
Boehringer (Mannheim, Germany). Enzymatic digestions of the
histological cuts were performed, at the optimum pH for each
enzyme, by 24 h incubation (.alpha.-fucosidase) or 2 h incubation
(all of the others) in a closed wet chamber at 37.degree. C. After
digestion, tissues were washed and studied by
immunofluorescence.
Immunofluorescence
[0064] Direct, indirect and polychromatic immunofluorescence were
carried out on both cryostat and deparaffinated tissue
sections.
[0065] For direct immunofluorescence, slides were incubated for 30
min in a wet chamber with the optimal dilution of the FITC or
TRITC-labelled lectins.
[0066] Indirect immunofluorescence was performed under similar
conditions. Both incubations with primary antibodies and the
corresponding FITC-labelled anti-Ig secondary antibodies were of 30
min duration.
[0067] Green and red polychromatic fluorescence was performed
either with simultaneous 30 min incubation with two lectins, one
labelled with FITC and the other with TRITC, or with a primary
antibody revealed with a mixture of the corresponding FITC-labelled
secondary anti-Ig antibody and a TRITC-labelled lectin. After
staining, slides were washed, and mounted under coverslides With
Vectashield.TM. (Vector Laboratories, Burlingame, Calif., USA).
[0068] The immunofluorescence results were observed on a Leitz
fluorescence SM-Lux microscope equipped with a lamp source of 200 W
HBO, a Ploemopak illuminator and a dual band filter set allowing
simultaneous visualization of green and red fluorescence (Omega
Optical, Brattleboro, Vt, USA). Pictures were taken with a Leitz
Photoautomat MPS50 on Fujichrome 400 ASA, 24.times.36 mm films.
[0069] Results
Vascular Endothelium and Heart Muscle
[0070] Both cryostat and deparaffinated sections gave the same
fluorescence pattern of reactivity in all pigs. The purified human
anti-linear-B reagents were positive on all vascular endothelial
cells from capillaries to aorta, irrespective of the size of the
blood vessel (Tables 1 and 2).
3TABLE 1 Immunoflourescent staining of tissues from A+ pigs with:
Human anti-.alpha.Gal (.alpha.Gal); Griffonia simplicifolia 1
isolectin B.sub.4 (GSI); anti-B (B); Helix pomatia (HPA); anti-A
(A); anti-H (SupH); Ulex europaeus 1 (UEA); anti-H-type-2 (Ht2);
anti-H- type-1 (Ht1); peanut agglutinin (PNA) and anti-Le.sup.x
(Le.sup.x). Tissue .alpha.Gal GSI B HPA A SupH UEA Ht2 Ht1 PNA
Le.sup.x Vascular endothelium +++ +++ - + - - - - - - - Heart
muscle - - - - - - - - - - - Kidney glomer, basal mem. - - - - - -
- - - +++ - proximal tubules +++ +++ ++ + - - - - - - - thin Henle
limbs + + - - - - - - - - - large henle limbs - - - ++ ++ - - - -
++ - distal tubules - - - +++ +++ .+-. .+-. .+-. - ++ +++*
collecting ducts .+-. + - ++ ++ .+-. - - - ++ - calyces .+-. + - ++
+++ - .+-. - - + - urinary epithelium .+-. + - ++ +++ - .+-. .+-. -
+ - Liver duct epithelium - - - ++ +++ .+-. - - + + - hepatocytes -
+ - - - - - - - - - Pancreas duct epithelium + + - +++ + .+-. + + +
+ - Langerhans islets - - - - - ++ - - + ++ - Lung bronchus
epithelium - - - ++ +++ .+-. .+-. - .+-. + - seromucous glands + +
- ++ +++ - - - - +++ - bronchiole +++ +++ + + + - - - - + - alveoli
++ ++ ++ .+-. - - - - - - - Small intestine brush border - - - ++
+++ ++ - - - - - goblet cells - - - +++ +++ ++ - - + - Skin stratum
granulosum - - - + - ++ + + - ++ - stratum spinosum + + - + - ++ -
- - ++ - hair follicles - - - .+-. - ++ - - .+-. + - apocrine
glands - - - ++ - +++ +++ + .+-. + - *Only the macula densa in
front of the glomerular vascular pole was positive.
[0071]
4TABLE 2 Immunoflourescent staining of tissues from A- pigs with:
Human anti-.alpha.Gal (.alpha.Gal); Griffonia simplicifolia 1
isolectin B.sub.4 (GSI); anti-B (B); Helix pomatia (HPA); anti-A
(A); anti-H (SupH); Ulex europaeus 1 (UEA); anti-H-type-2 (Ht2);
anti-H- type-1 (Ht1); peanut agglutinin (PNA) and anti-Le.sup.x
(Le.sup.x). Tissue .alpha.Gal GSI B HPA A SupH UEA Ht2 Ht1 PNA
Le.sup.x Vascular endothelium +++ +++ - + - - - - - - - Heart
muscle - - - - - - - - - - - Kidney glomer, basal mem. - - - - - -
- - - +++ - proximal tubules +++ +++ ++ + - - - - - - - thin Henle
limbs + + - - - - - - - - - large henle limbs - - - - - ++ ++ ++ ++
++ - distal tubules - - - - - ++ ++ ++ ++ ++ ++* collecting ducts
.+-. + - - - ++ ++ ++ ++ ++ - calyces .+-. + - - - +++ +++ +++ +++
+ - urinary epithelium .+-. + - - - +++ +++ +++ +++ + - Liver duct
epithelium - - - - - +++ .+-. + +++ + - hepatocytes - + - - - - - -
- - - Pancreas duct epithelium + + - - - +++ ++ ++ +++ + -
Langerhans islets - - - - - ++ - - + ++ - Lung bronchus epithelium
- - - - - +++ +++ +++ +++ + - seromucous glands + + - + - +++ +++
++ ++ ++ - bronchiole +++ +++ + .+-. - + + + .+-. .+-. - alveoli ++
++ ++ .+-. - - - - - - - Small intestine brush border - - - - - +++
+++ +++ +++ - - goblet cells - - - + - +++ +++ +++ +++ + - Skin
stratum granulosum - - - - - ++ + + - ++ - stratum spinosum + + - +
- ++ - - - ++ - hair follicles - - - .+-. - ++ - - .+-. + -
apocrine glands - - - .+-. - +++ +++ ++ .+-. + - *Only the macula
densa in front of the glomerular vascular pole was positive.
[0072] The antibodies eluted from the immunoadsorbents containing
the structure .alpha.Gal1-3.beta.Gal (the linear-B disaccharide and
the two linear-B trisaccharides) gave similar immunofluorescence
results. They stained strongly the pig vascular endothelium at 200
.mu.g/ml. Their activity faded with dilution of the antibody and
disappeared at 20 .mu.g/ml.
[0073] The antibodies obtained with the monosaccharide .alpha.Gal
were only weakly positive at 100 .mu.g/ml, and the antibodies
eluted with the Escherichia coli receptor disaccharide
.alpha.Gal1.fwdarw.4.beta.Gal were negative at 100 and 200
.mu.g/ml. The relative intensity of the reaction of the different
fractions of anti-.alpha.Gal antibodies purified on the five
immunoadsorbents were: the two linear-B
trisaccharides.apprxeq.linea- r-B disaccharide >
.alpha.-galactose >disaccharide receptor of Escherichia coli.
This last fraction was weakly positive at higher
concentrations.
[0074] Immunofluorescence of vascular endothelial cells in
myocardium stained with the isolectin B4 from Griffonia
simplicifolia lectin 1 (FITC-GSIB.sub.4). Only the vascular
endothelium is positive (green). Both A+ and A- pigs give the same
staining.
[0075] The same positive reactions on vascular endothelium were
obtained with the affinity purified lectin 1 from Griffonia
simplicifolia at 100 .mu.g/ml. This lectin preparation is a random
mixture of tetramers of two subunits, A and B, in different
proportions (A.sub.4, A.sub.3B, A.sub.2B.sub.2, AB.sub.3 and
B.sub.4). A .sub.4 reacts strongly with .alpha.GalNac and weakly
with .alpha.Gal, while B.sub.4 is specific for .alpha.Gal epitopes,
as described by Murphy and Goldstein, "Five
.alpha.-D-Galactopyranosyl-binding isolectins from Bandeiraea
simplicifolia seeds" J. Biol. Chem. 252, 4739-4742 (1977). A.sub.4
and B.sub.4, the two purified extreme isolectins, reacted also with
vascular endothelium, but isolectin B.sub.4 was positive at 10
.mu.g/ml, while isolectin A.sub.4 required a hundred times higher
concentration to give the same result.
[0076] The Helix pomatia lectin was also positive on vascular
endothelium, but weakly and only at a very high concentration (1
mg/ml).
[0077] All the other lectins, monoclonal and polyclonal antibodies
were negative on pig heart irrespective of the A+ or A-phenotype of
the pig.
[0078] Myocardium section treated with neuraminidase and stained
with peanut agglutinin (FITC-PNA). All connective tissue is
positive (green) and myocytes are negative. Both A+ and A- pigs
give the same staining.
[0079] The positive reactions on vascular endothelium given by
human anti-.alpha.Gal, Griffonia simplicifolia 1 and Helix pomatia
lectins were abolished by pre-digestion of the tissue with
.alpha.-galactosidase and were not modified by
.beta.-galactosidase, .alpha.-fucosidase or neuraminidase. After
treatment with neuraminidase the connective tissue around myocytes
appeared positive with peanut agglutinin (PNA).
[0080] Vascular endothelium had the same positive
immunofluorescence reactions with human anti-.alpha.Gal, Griffonia
simplicifolia 1 isolectin B.sub.4 and Helix pomatia in all the
other organs studied, irrespective of the A+ or A-phenotype of the
pig. However, other organs had in addition positive reactions on
other cells (Tables 1 and 2).
[0081] The lectin MAA (Maackia amurensis), specific for NeuAc
.alpha.2.fwdarw.3 Gal .beta.1-R, stains well the pig vascular
endothelium, showing that both .alpha.NeuAc and .alpha.Gal epitope
are present on pig endothelium.
Kidney
[0082] Cortex of the kidney of an A+ pig double stained with anti-A
(FITC) and anti-.alpha.Gal (TRITC-GSI). Proximal tubules and
vascular endothelium are positive with anti-.alpha.Gal (red).
Distal and collecting tubules are positive with anti-A (green).
Medulla of the kidney of an A+ pig double stained with anti-A
(FITC) and anti-.alpha.Gal (TRITC-GSI). Collecting ducts and large
limbs of Henle's loop are positive with anti-A (green). Vascular
endothelium of the intertubular capillaries and the epithelial
cells of the thin limbs of the loops of Henle are positive with
anti-.alpha.Gal (red).
[0083] In addition to vascular endothelium, human anti-.alpha.Gal,
Griffonia simplicifolia 1 and its isolectin B.sub.4 stained
strongly the brush border and the cytoplasm of epithelial cells of
proximal convoluted tubules and weakly the apical portion of thin
Henle limbs and collecting ducts, calyces and urinary
epithelium.
[0084] The three strongest monoclonal anti-B reagents from the
workshop (026, 028 and 046) also stained the renal proximal
tubules. These antibodies belong to the cluster which cross-reacts
with all linear-B structures containing the terminal disaccharide
.alpha.Gal.fwdarw.3.beta.- Gal. Three other anti-B of the same
cluster (041, 031 and 032), and the remaining 11 anti-B monoclonals
which did not recognize the linear-B antigen, did not stain pig
kidney. These anti-linear-B reactions, as those of the vascular
endothelium, were independent of the A+ or A-phenotype of the pig
and were destroyed by pre-treatment with .alpha.-galactosidase.
[0085] A dual reaction was observed with Helix pomatia in the
kidney. Weak anti-linear-B reactivity at high lectin concentration
(1 mg/ml), similar to the above described positive pattern on
proximal tubules with anti-.alpha.Gal and anti-linear-B, and strong
anti-A reaction at low lectin concentration (10 .mu.g/ml), on
distal tubules, collecting ducts, calyces and urinary epithelium of
A+ pigs were both documented. The anti-A reactions of Helix pomatia
was only present on A+ pigs (Table 1). A- pigs were negative (Table
2).
[0086] Twelve (001, 002, 005, 006, 012, 013, 016, 018, 020, 049,
050, 052) out of the 18 anti-A monoclonal antibodies were positive
on the same cells of the distal convoluted tubules in the cortex,
large Henle and collecting ducts in the medulla, calyces and
urinary epithelium of A+ pigs (Table 1). These positive anti-A
monoclonals corresponded to the strongest antibodies of each of the
6 anti-A clusters defined in the Second International Workshop on
Monoclonal Antibodies Against Human Blood Red Cells.
[0087] Goat SupH, the four anti-H-type-2 monoclonals, anti-H-type-1
and Ulex europeaus lectin 1 were positive on the same cells of A-
pigs (Table 2). This fluorescence of anti-H reagents on kidneys
from A- pigs was also detected, although very weakly, in the
corresponding areas of A+ pigs.
[0088] Cortex of the kidney of an A+ pig double stained with Helix
pomatia (FITC-HPA) and Ulex europaeus lectin 1 (TRTC-UEA). Most
cells of the distal and collecting tubules are stained by the
anti-A activity of Helix pomatia (green), but some cells on the
same tubules are stained by the anti-H activity of Ulex europaeus
(red). This micrograph illustrates that some H structures are not
transformed into A.
[0089] Cortex of the kidney treated with neuraminidase and double
stained with peanut agglutinin (FITC-PNA) and Griffonia
simplicifolia lectin 1 (TRITC-GSI). Glomerular basal membrane and
the apical poles of epithelial cells of distal and collecting
tubules are stained by PNA (green). Proximal convoluted tubules and
vascular endothelium are stained with GSI (red). Both A+ and A-
pigs give the same staining.
[0090] Due to the fact that the A glycosyltransferase uses the H
structure as a substrate to make the A epitope, for each A antigen
made, one H antigen is used up; complete transformation of H into A
resulted in negative reactions with anti-H reagents in some distal
convoluted tubules and collecting ducts of A+ pigs. However, in
some epithelial cells incomplete transformation of H into A could
be detected by dual simultaneous fluorescence of anti-H in red and
anti-A in green.
[0091] Peanut agglutinin was positive on the glomerular basal
membrane and the apical areas of epithelial cells from distal and
collecting tubules. This reaction increased with neuraminidase
treatment and was independent of the A+ or A-phenotype of the
pig.
[0092] Cortex of the kidney stained with anti-Le.sup.x (FITC). Only
a very short portion of the distal tubule at the level of the
macula densa, in front of the vascular pole of glomeruli, is
positive (green). Both A+ and A- pigs give the same staining.
[0093] The Le.sup.x antigen was only present on some epithelial
cells of the distal convoluted tubule at the level of the macula
densa, in a very short segment just in front of the vascular pole
of the glomerulus. In humans this antigen is present on epithelial
cells of proximal tubules in the same areas of the nephron that are
positive with the anti-linear-B in pigs.
Liver
[0094] Liver section of an A+ pig double stained with anti-A (FITC)
and Griffonia simplicifolia lectin 1 (TRITC). Biliary ducts are
positive with anti-A (green). Vascular endothelium is strongly
positive and hepatocytes are faintly positive with GSI (red).
[0095] Liver section of an A- pig double stained with anti-H-type-1
(FITC) and Griffonia simplicifolia lectin 1 (TRITC). Biliary ducts
are stained by anti-H-type-1 (green). As in the case described
above, vascular endothelium is brighter than hepatocytes with GSI
(red).
[0096] In A+ pigs, all epithelial cells of biliary ducts were
stained strongly with anti-A and Helix pomatia, and weakly with
SupH, anti-H-type-1 and peanut agglutinin (Table 1). Inversely, in
A- pigs all anti-A reagents were negative, and all anti-H reagents
were positive on biliary epithelium (Table 2). However,
anti-H-type-1 was always stronger than anti-H-type-2, suggesting
that type 1 structures are predominant in pig biliary ducts. A
similar phenomenon is observed in human liver, where type 1
structures (A, B and H-type-1, Le.sup.a and Le.sup.b) are also
predominant in biliary ducts.
[0097] Hepatocytes did not stain with any of the anti-A or anti-H.
They were only weakly and irregularly stained with Griffonia
simplicifolia lectin 1 in addition to its vascular endothelium
staining. Human hepatocytes are not stained by any of these
reagents, but they express sialyl-Le.sup.x.
Pancreas
[0098] Pancreas section of an A+ pig double stained with anti-A
(FITC) and Griffonia simplicifolia lectin 1 (TRITC). Large and
small ducts are stained with anti-A (green). Vascular endothelium
is stained with GSI (red). The apical portion of epithelial cells
in large ducts and the intraluminal secretion is stained by both
reagents (bright yellow).
[0099] Pancreatic ducts of A+ pigs were-strongly stained with
anti-A and Helix pomatia and they were not (or weakly) stained with
anti-H (Table 1). The same ducts of A- pigs were negative with
anti-A strongly stained with anti-H (Table 2). The vascular
endothelium and the apical border of ductal cells were positive
with human anti-.alpha.Gal and Griffonia simplicifolia lectin 1 in
both A+ and A- pigs.
[0100] Small secretory ducts were weakly positive with anti-A in A+
pigs and with anti-H in A- pigs.
[0101] Pancreas double stained with SupH (FITC) and Griffonia
simplicifolia lectin 1 (TRITC). Some cells in the Islets of
langerhans are stained with anti-H (green). Vascular endothelium is
stained with GSI (red). Both A+ and A- pigs give the same
staining.
[0102] The cytoplasm of some cells of the islets of Langerhans was
positive with SupH, anti-H-type-1 and peanut agglutinin
irrespective of the A phenotype of the pig.
Lung
[0103] Lung of an A+ pig double stained with anti-A (FITC) and
Griffonia simplicifolia lectin 1 (TRITC). The ciliated epithelium
of large bronchi and seromucous glands are stained with anti-A
(green). Part of the mucous secretion in seromucous glands is
stained with GSI (red).
[0104] The ciliated epithelium of large bronchi were strongly
positive with anti-A and Helix pomatia in A+ pigs (Table 1) and
with anti-H reagents in A- pigs (Table 2). Seromucous glands were
positive with anti-A or anti-H in A+ or A- pigs respectively, and
were also positive with the anti-.alpha.gal reagents in both types
of pigs.
[0105] Lung of an A+ pig double stained with anti-A (FITC) and
Griffonia simplicifolia lectin 1 (TRITC). Only a few cells in the
bronchiolar epithelium are stained with anti-A (green). The
respiratory epithelium and the great majority of the bronchiolar
epithelial cells are stained with GSI (red).
[0106] Lung of an A- pig double stained with anti-H (FITC) and
Griffonia simplicifolia lectin 1 (TRITC). Only a few cells in the
bronchiolar epithelium are stained with anti-H (green). The
majority of the bronchiolar epithelium is stained with GSI
(red).
[0107] In both A+ or A- pigs the number of A and H positive
epithelial cells decreased progressively with reduction of the size
of the bronchi; only a few A or H-positive cells were found in
terminal bronchiolar epithelium. The bronchial epithelial cells
that did not stain with anti-A or anti-H, did stain with human
anti-.alpha.gal and Griffonia slimplicifolia lectin 1. The number
of .alpha.gal-positive cells increased with the decrease in size of
bronchi, and all the final bronchiolar branches and the alveolar
respiratory epithelium were stained by anti-.alpha.Gal reagents and
were negative with anti-A or anti-H. The human respiratory
epithelium has the blood group I antigen at the places where the
pig respiratory epithelium expresses the linear-B antigen.
Small Intestine.
[0108] Goblet cells and the brush border were strongly positive
with anti-A and Helix pomatia in A+ pigs (Table 1) and with anti-H
reagents in A- pigs (Table 2). In A- pigs, Helix pomatia was
negative on all cells of surface epithelium and positive on some
deep goblet cells. PNA was positive on goblet cells and negative on
the brush border of both A+ and A- pigs.
[0109] Mucosa of small intestine of an A- pig double stained with
Ulex europaeus lectin 1 (FITC-UEA) and Griffonia simplicifolia
lectin 1 (TRITC). Goblet cells and brush border are stained with
anti-H (green). Vascular endothelium in the stroma of the villi is
stained with GSI (red). Both A+ and A- pigs give the same staining
with GSI.
[0110] As in all the other pig organs, the vascular endothelium in
the stroma of the villi was positive with anti-.alpha.Gal
reagents.
Skin
[0111] All layers of the epidermis and hair follicles were positive
with SupH and peanut agglutinin.
[0112] Skin double stained with the isolectin B.sub.4 from
Griffonia simplicifolia (FITC-GSIB.sub.4) and Ulex europaeus lectin
1 (TRITC-UEA). Vascular endothelium in the dermis and deep layers
of epidermis are stained with GSIB.sub.4 (green). Upper layers of
epidermis are stained with UEA (red).
[0113] Other reagents were only positive on certain areas. The
stratum granulosum was positive with Ulex europaeus. The deep
layers of the epidermis and the vascular endothelium in the dermis
were positive with .alpha.Gal reagents. The intraluminal content
and the epithelial cells of apocrine secretory glands in the dermis
were strongly positive with anti-H reagents.
[0114] All anti-A reagents were negative on the skin and its
appendages and all the epidermal positive staining with other
reagents were independent of the A+ or A- phenotype of the pig.
[0115] These results indicate that the smallest common structure
able to react efficiently with the human natural antibodies is the
linear-B disaccharide .alpha.Gal1.fwdarw.3.beta.Gal. Such a small
structure has the advantage of being relatively easy to synthesize
and provides the possibility of performing exploratory tests in a
pig-to-baboon organ transplant model, which is believed to closely
resemble the pig-to-human transplant situation.
[0116] Modifications and variations of the present invention, a
method to produce organs for transplantation, will be obvious to
those skilled in the art from the foregoing detailed description.
Such modifications and variations are intended to come within the
scope of the following claims.
Sequence CWU 1
1
* * * * *