U.S. patent application number 09/851771 was filed with the patent office on 2002-10-17 for antisense oligonucleotide modulation of human mdm2 expression.
Invention is credited to Graham, Mark J., Miraglia, Loren J., Monia, Brett P., Nero, Pamela.
Application Number | 20020151511 09/851771 |
Document ID | / |
Family ID | 21956576 |
Filed Date | 2002-10-17 |
United States Patent
Application |
20020151511 |
Kind Code |
A1 |
Miraglia, Loren J. ; et
al. |
October 17, 2002 |
Antisense oligonucleotide modulation of human MDM2 expression
Abstract
Compounds, compositions and methods are provided for inhibiting
the expression of human mdm2. The compositions comprise antisense
oligonucleotides targeted to nucleic acids encoding mdm2. Methods
of using these oligonucleotides for inhibition of mdm2 expression
and for treatment of diseases such as cancers associated with
overexpression of mdm2 are provided.
Inventors: |
Miraglia, Loren J.;
(Encinitas, CA) ; Nero, Pamela; (Oceanside,
CA) ; Graham, Mark J.; (San Clemente, CA) ;
Monia, Brett P.; (La Costa, CA) |
Correspondence
Address: |
Licata & Tyrrell P.C.
66 E. Main Street
Marlton
NJ
08053
US
|
Family ID: |
21956576 |
Appl. No.: |
09/851771 |
Filed: |
May 9, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09851771 |
May 9, 2001 |
|
|
|
09048810 |
Mar 26, 1998 |
|
|
|
6238921 |
|
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.2 |
Current CPC
Class: |
C12N 2310/321 20130101;
A61K 38/00 20130101; C12N 2310/3521 20130101; C12N 2310/3525
20130101; C12N 2310/341 20130101; Y02P 20/582 20151101; A61P 17/06
20180101; C12N 2310/322 20130101; A61P 35/00 20180101; C12N
2310/346 20130101; C12N 2310/315 20130101; C12N 2310/335 20130101;
A61P 9/10 20180101; C12N 2310/321 20130101; C07H 21/00 20130101;
C12N 15/113 20130101; C12N 2310/321 20130101 |
Class at
Publication: |
514/44 ;
536/23.2 |
International
Class: |
A61K 048/00; C07H
021/04 |
Claims
What is claimed is:
1. An oligonucleotide up to 50 nucleotides in length comprising a
nucleotide sequence targeted to the 5' untranslated region,
translation termination codon region, or 3' untranslated region of
a nucleic acid molecule encoding human mdm2, wherein said
oligonucleotide inhibits the expression of said human mdm2.
2. The oligonucleotide of claim 1 comprising SEQ ID NO: 3, SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18,
SEQ ID NO: 19 or SEQ ID NO: 21.
3. The oligonucleotide of claim 1 which is targeted to the 5'
untranslated region of the S-mdm2 transcript.
4. The oligonucleotide of claim 3 comprising SEQ ID NO: 3, SEQ ID
NO: 4, SEQ ID NO: 5 OR SEQ ID NO: 7.
5. The oligonucleotide of claim 1 comprising SEQ ID NO: 4.
6. The oligonucleotide of claim 1 which contains at least one
phosphorothioate intersugar linkage.
7. The oligonucleotide of claim 1 which has at least one
2'-O-methoxyethyl modification.
8. The oligonucleotide of claim 1 which contains at least one
5-methyl cytidine.
9. The oligonucleotide of claim 8 in which every 2'-O-methoxyethyl
modified cytidine residue is a 5-methyl cytidine.
10. A pharmaceutical composition comprising the oligonucleotide of
claim 1 and a pharmaceutically acceptable carrier or diluent.
11. The pharmaceutical composition of claim 10 where said
pharmaceutically acceptable carrier or diluent comprises a lipid or
liposome.
12. A method of modulating the expression of human mdm2 in cells or
tissues comprising contacting said cells or tissues with the
oligonucleotide of claim 1.
13. A method of reducing hyperproliferation of human cells
comprising contacting proliferating human cells with the
composition of claim 1.
14. A method of reducing hyperproliferation of human cells
comprising contacting proliferating human cells with the
pharmaceutical composition of claim 10.
15. A method of treating an animal having a disease or condition
associated with mdm2 comprising administering to said animal a
therapeutically or prophylactically effective amount of an
oligonucleotide of claim 1.
16. The method of claim 15 wherein the disease or condition is
associated with overexpression of mdm2.
17. The method of claim 15 wherein the disease or condition is
associated with amplification of the mdm2 gene.
18. The method of claim 15 wherein the disease or condition is a
hyperproliferative condition.
19. The method of claim 18 wherein the hyperproliferative condition
is cancer.
20. The method of claim 19 wherein the cancer is a blood, brain,
breast, lung or a soft tissue cancer.
21. The method of claim 18 wherein the hyperproliferative condition
is psoriasis, fibrosis, atherosclerosis or restenosis.
22. The method of claim 15 wherein said oligonucleotide is
administered in combination with a chemotherapeutic agent to
overcome drug resistance.
23. An oligonucleotide up to 50 nucleotides targeted to the coding
region of a nucleic acid molecule encoding human mdm2, wherein said
oligonucleotide inhibits the expression of said human mdm2 and
comprises SEQ ID NO: 15.
24. The oligonucleotide of claim 23 which contains at least one
phosphorothioate intersugar linkage.
25. The oligonucleotide of claim 23 which has at least one
2'-O-methoxyethyl modification.
26. The oligonucleotide of claim 23 which contains at least one
5-methyl cytidine.
27. The oligonucleotide of claim 26 in which every
2'-O-methoxyethyl modified cytidine residue is a 5-methyl
cytidine.
28. A pharmaceutical composition comprising the oligonucleotide of
claim 23 and a pharmaceutically acceptable carrier or diluent.
29. The pharmaceutical composition of claim 28 where said
pharmaceutically acceptable carrier or diluent comprises a lipid or
liposome.
30. A method of modulating the expression of human mdm2 in cells or
tissues comprising contacting said cells or tissues with the
oligonucleotide of claim 23.
31. A method of reducing hyperproliferation of human cells
comprising contacting proliferating human cells with the
composition of claim 23.
32. A method of reducing hyperproliferation of human cells
comprising contacting proliferating human cells with the
pharmaceutical composition of claim 28.
33. A method of treating an animal having a disease or condition
associated with mdm2 comprising administering to said animal a
therapeutically or prophylactically effective amount of an
oligonucleotide of claim 23.
34. The method of claim 33 wherein the disease or condition is
associated with overexpression of mdm2.
35. The method of claim 33 wherein the disease or condition is
associated with amplification of the mdm2 gene.
36. The method of claim 33 wherein the disease or condition is a
hyperproliferative condition.
37. The method of claim 36 wherein the hyperproliferative condition
is cancer.
38. The method of claim 37 wherein the cancer is a blood, brain,
breast, lung or a soft tissue cancer.
39. The method of claim 36 wherein the hyperproliferative condition
is psoriasis, fibrosis, atherosclerosis or restenosis.
40. The method of claim 33 wherein said oligonucleotide is
administered in combination with a chemotherapeutic agent to
overcome drug resistance.
Description
[0001] This application is a continuation of U.S. Ser. No.
09/048,810 filed Mar. 26, 1998.
FIELD OF THE INVENTION
[0002] This invention relates to compositions and methods for
modulating expression of the human mdm2 gene, a naturally present
cellular gene implicated in abnormal cell proliferation and tumor
formation. This invention is also directed to methods for
inhibiting hyperproliferation of cells; these methods can be used
diagnostically or therapeutically. Furthermore, this invention is
directed to treatment of conditions associated with expression of
the human mdm2 gene.
BACKGROUND OF THE INVENTION
[0003] Inactivation of tumor suppressor genes leads to unregulated
cell proliferation and is a cause of tumorigenesis. In many tumors,
p53 or the retinoblastoma (Rb) protein are inactivated. This can
occur either by mutations within these genes, or by overexpression
of the mdm2 gene. The mdm2 protein physically associates with both
p53 and Rb, inhibiting their function. The levels of mdm2 are
maintained through a feedback loop mechanism with p53.
Overexpression of mdm2 effectively inactivates p53 and promotes
cell proliferation. Amplification of the mdm2 gene is found in many
human cancers, including soft tissue sarcomas, astrocytomas,
glioblastomas, breast cancers and non-small cell lung carcinomas.
In many blood cancers, overexpression of mdm2 can occur with a
normal copy number. This has been attributed to enhanced
translation of mdm2 mRNA, which is thought to be related to a
distinct 5'-untranslated region (5'-UTR) which causes the
transcript to be translated more efficiently than the normal mdm2
transcript. Landers et al., Cancer Res. 57, 3562, (1997).
[0004] Several approaches have been used to disrupt the interaction
between p53 and mdm2. Small peptide inhibitors, screened from a
phage display library, have been shown in ELISA assays to disrupt
this interaction [Bottger et al., J. Mol. Biol., 269, 744 (1997)].
Microinjection of an anti-mdm2 antibody targeted to the p53-binding
domain of mdm2 increased p53-dependent transcription [Blaydes et
al., Oncogene, 14, 1859 (1997)].
[0005] A vector-based antisense approach has been used to study the
function of mdm2. Using a rhabdomyosarcoma model, Fiddler et al.
[Mol. Cell Biol., 16, 5048 (1996)] demonstrated that amplified mdm2
inhibits the ability of MyoD to function as a transcription factor.
Furthermore, expression of full-length antisense mdm2 from a
cytomegalovirus promoter-containing vector restores muscle-specific
gene expression.
[0006] Antisense oligonucleotides have also been useful in
understanding the role of mdm2 in regulation of p53. An antisense
oligonucleotide directed to the mdm2 start codon allowed
cisplatin-induced p53-mediated apoptosis to occur in a cell line
overexpressing mdm2 [Kondo et al., Oncogene, 10, 2001 (1995). The
same oligonucleotide was found to inhibit the expression of
P-glycoprotein [Kondo et al., Br. J. Cancer, 74, 1263 (1996)].
P-glycoprotein was shown to be induced by mdm2. Teoh et al [Blood,
90, 1982 (1997)] demonstrated that treatment with an identical mdm2
antisense oligonucleotide or a shorter version within the same
region in a tumor cell line decreased DNA synthesis and cell
viability and triggered apoptosis.
[0007] Chen et al. [Proc. Natl. Acad. Sci. USA, 95, 195 (1998)]
disclose antisense oligonucleotides targeted to the coding region
of mdm2. A reduction in mdm2 RNA and protein levels was seen, and
transcriptional activity from a p53-responsive promoter was
increased after oligonucleotide treatment of JAR (choriocarcinoma)
or SJSA (osteosarcoma) cells.
[0008] WO 93/20238 and WO 97/09343 disclose, in general, the use of
antisense constructs, antisense oligonucleotides, ribozymes and
triplex-forming oligonucleotides to detect or to inhibit expression
of mdm2.
[0009] There remains a long-felt need for improved compositions and
methods for inhibiting mdm2 gene expression.
SUMMARY OF THE INVENTION
[0010] The present invention provides oligonucleotides which are
targeted to nucleic acids encoding human mdm2 and are capable of
inhibiting mdm2 expression. The present invention also provides
chimeric oligonucleotides targeted to nucleic acids encoding human
mdm2. The oligonucleotides of the invention are believed to be
useful both diagnostically and therapeutically, and are believed to
be particularly useful in the methods of the present invention.
[0011] The present invention also comprises methods of inhibiting
the expression of human mdm2, particularly the increased expression
resulting from amplification of mdm2. These methods are believed to
be useful both therapeutically and diagnostically as a consequence
of the association between mdm2 expression and hyperproliferation.
These methods are also useful as tools, for example, for detecting
and determining the role of mdm2 expression in various cell
functions and physiological processes and conditions and for
diagnosing conditions associated with mdm2 expression.
[0012] The present invention also comprises methods of inhibiting
hyperproliferation of cells using oligonucleotides of the
invention. These methods are believed to be useful, for example, in
diagnosing mdm2-associated cell hyperproliferation. Methods of
treating abnormal proliferative conditions associated with mdm2 are
also provided. These methods employ the oligonucleotides of the
invention. These methods are believed to be useful both
therapeutically and as clinical research and diagnostic tools.
DETAILED DESCRIPTION OF THE INVENTION
[0013] Tumors often result from genetic changes in cellular
regulatory genes. Among the most important of these are the tumor
suppressor genes, of which p53 is the most widely studied.
Approximately half of all human tumors have a mutation in the p53
gene. This mutation disrupts the ability of the p53 protein to bind
to DNA and act as a transcription factor. Hyperproliferation of
cells occurs as a result. Another mechanism by which p53 can be
inactivated is through overexpression of mdm2, which regulates p53
activity in a feedback loop. The mdm2 protein binds to p53 in its
DNA binding region, preventing its activity. Mdm2 is amplified in
some human tumors, and this amplification is diagnostic of
neoplasia or the potential therefor. Over one third of human
sarcomas have elevated mdm2 sequences. Elevated expression may also
be involved in other tumors including but not limited to those in
which p53 inactivation has been implicated. These include
colorectal carcinoma, lung cancer and chronic myelogenous
leukemia.
[0014] Many abnormal proliferative conditions, particularly
hyperproliferative conditions, are believed to be associated with
mdm2 expression and are, therefore believed to be responsive to
inhibition of mdm2 expression. Examples of hyperproliferative
conditions are cancers, psoriasis, blood vessel stenosis (e.g.,
restenosis or atherosclerosis), and fibrosis, e.g., of the lung or
kidney.
[0015] The present invention employs antisense compounds,
particularly oligonucleotides, for use in inhibiting the function
of nucleic acid molecules encoding mdm2, ultimately modulating the
amount of mdm2 produced. This is accomplished by providing
oligonucleotides which specifically hybridize with nucleic acids,
preferably mRNA, encoding mdm2.
[0016] This relationship between an antisense compound such as an
oligonucleotide and its complementary nucleic acid target, to which
it hybridizes, is commonly referred to as "antisense". "Targeting"
an oligonucleotide to a chosen nucleic acid target, in the context
of this invention, is a multistep process. The process usually
begins with identifying a nucleic acid sequence whose function is
to be modulated. This may be, as examples, a cellular gene (or mRNA
made from the gene) whose expression is associated with a
particular disease state, or a foreign nucleic acid from an
infectious agent. In the present invention, the target is a nucleic
acid encoding mdm2; in other words, a mdm2 gene or RNA expressed
from a mdm2 gene. mdm2 mRNA is presently the preferred target. The
targeting process also includes determination of a site or sites
within the nucleic acid sequence for the antisense interaction to
occur such that modulation of gene expression will result.
[0017] In accordance with this invention, persons of ordinary skill
in the art will understand that messenger RNA includes not only the
information to encode a protein using the three letter genetic
code, but also associated ribonucleotides which form a region known
to such persons as the 5'-untranslated region, the 3'-untranslated
region, the 5' cap region and intron/exon junction ribonucleotides.
Thus, oligonucleotides may be formulated in accordance with this
invention which are targeted wholly or in part to these associated
ribonucleotides as well as to the informational ribonucleotides.
The oligonucleotide may therefore be specifically hybridizable with
a transcription initiation site region, a translation initiation
codon region, a 5' cap region, an intron/exon junction, coding
sequences, a translation termination codon region or sequences in
the 5'- or 3'-untranslated region. Since, as is known in the art,
the translation initiation codon is typically 5'-AUG (in
transcribed mRNA molecules; 5'-ATG in the corresponding DNA
molecule), the translation initiation codon is also referred to as
the "AUG codon," the "start codon" or the "AUG start codon." A
minority of genes have a translation initiation codon having the
RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5.sup.1-ACG and
5'-CUG have been shown to function in vivo. Thus, the terms
"translation initiation codon" and "start codon" can encompass many
codon sequences, even though the initiator amino acid in each
instance is typically methionine (in eukaryotes) or
formylmethionine (prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed from a gene encoding
mdm2, regardless of the sequence(s) of such codons. It is also
known in the art that a translation termination codon (or "stop
codon") of a gene may have one of three sequences, i.e., 5'-UAA,
5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA,
5'-TAG and 5'-TGA, respectively). The terms "start codon region"
and "translation initiation codon region" refer to a portion of
such an mRNA or gene that encompasses from about 25 to about 50
contiguous nucleotides in either direction (i.e., 5' or 3') from a
translation initiation codon. This region is a preferred target
region. Similarly, the terms "stop codon region" and "translation
termination codon region" refer to a portion of such an mRNA or
gene that encompasses from about 25 to about 50 contiguous
nucleotides in either direction (i.e., 5' or 3') from a translation
termination codon. This region is a preferred target region. The
open reading frame (ORF) or "coding region," which is known in the
art to refer to the region between the translation initiation codon
and the translation termination codon, is also a region which may
be targeted effectively. Other preferred target regions include the
5' untranslated region (5'UTR), known in the art to refer to the
portion of an mRNA in the 5' direction from the translation
initiation codon, and thus including nucleotides between the 5' cap
site and the translation initiation codon of an mRNA or
corresponding nucleotides on the gene) and the 3' untranslated
region (3'UTR), known in the art to refer to the portion of an mRNA
in the 3' direction from the translation termination codon, and
thus including nucleotides between the translation termination
codon and 3' end of an mRNA or corresponding nucleotides on the
gene). mdm2 is believed to have alternative transcripts which
differ in their 5'-UTR regions. The @-mdm2 transcript class is
translated approximately 8-fold more efficiently than the L-mdm2
transcripts produced by the constitutive promoter. Landers et al.,
Cancer Res., 57, 3562 (1997). Accordingly, both the 5--UTR of the
S-mdm transcript and the 5'-UTR of the L-mdm2 transcript are
preferred target regions, with the S-mdm2 5'-UTR being more
preferred. mRNA splice sites may also be preferred target regions,
and are particularly useful in situations where aberrant splicing
is implicated in disease, or where an overproduction of a
particular mRNA splice product is implicated in disease. Aberrant
fusion junctions due to rearrangements or deletions may also be
preferred targets.
[0018] Once the target site or sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired modulation.
[0019] "Hybridization", in the context of this invention, means
hydrogen bonding, also known as Watson-Crick base pairing, between
complementary bases, usually on opposite nucleic acid strands or
two regions of a nucleic acid strand. Guanine and cytosine are
examples of complementary bases which are known to form three
hydrogen bonds between them. Adenine and thymine are examples of
complementary bases which form two hydrogen bonds between them.
[0020] "Specifically hybridizable" and "complementary" are terms
which are used to indicate a sufficient degree of complementarity
such that stable and specific binding occurs between the DNA or RNA
target and the oligonucleotide.
[0021] It is understood that an oligonucleotide need not be 100%
complementary to its target nucleic acid sequence to be
specifically hybridizable. An oligonucleotide is specifically
hybridizable when binding of the oligonucleotide to the target
interferes with the normal function of the target molecule to cause
a loss of utility, and there is a sufficient degree of
complementarity to avoid non-specific binding of the
oligonucleotide to non-target sequences under conditions in which
specific binding is desired, i.e., under physiological conditions
in the case of in vivo assays or therapeutic treatment or, in the
case of in vitro assays, under conditions in which the assays are
conducted.
[0022] Hybridization of antisense oligonucleotides with mRNA
interferes with one or more of the normal functions of mRNA. The
functions of mRNA to be interfered with include all vital functions
such as, for example, translocation of the RNA to the site of
protein translation, translation of protein from the RNA, splicing
of the RNA to yield one or more mRNA species, and catalytic
activity which may be engaged in by the RNA.
[0023] The overall effect of interference with mRNA function is
modulation of mdm2 expression. In the context of this invention
"modulation" means either inhibition or stimulation; i.e., either a
decrease or increase in expression. Inhibition of mdm2 gene
expression is presently the preferred form of modulation. This
modulation can be measured in ways which are routine in the art,
for example by Northern blot assay of mRNA expression as taught in
the examples of the instant application or by Western blot or ELISA
assay of protein expression, or by an immunoprecipitation assay of
protein expression, as taught in the examples of the instant
application. Effects on cell proliferation or tumor cell growth can
also be measured, as taught in the examples of the instant
application.
[0024] The oligonucleotides of this invention can be used in
diagnostics, therapeutics, prophylaxis, and as research reagents
and in kits. Since the oligonucleotides of this invention hybridize
to nucleic acids encoding mdm2, sandwich, calorimetric and other
assays can easily be constructed to exploit this fact. Furthermore,
since the oligonucleotides of this invention hybridize specifically
to nucleic acids encoding particular isozymes of mdm2, such assays
can be devised for screening of cells and tissues for particular
mdm2 isozymes. Such assays can be utilized for diagnosis of
diseases associated with various mdm2 forms. Provision of means for
detecting hybridization of oligonucleotide with a mdm2 gene or mRNA
can routinely be accomplished. Such provision may include enzyme
conjugation, radiolabelling or any other suitable detection
systems. Kits for detecting the presence or absence of mdm2 may
also be prepared.
[0025] The present invention is also suitable for diagnosing
abnormal proliferative states in tissue or other samples from
patients suspected of having a hyperproliferative disease such as
cancer or psoriasis. The ability of the oligonucleotides of the
present invention to inhibit cell proliferation may be employed to
diagnose such states. A number of assays may be formulated
employing the present invention, which assays will commonly
comprise contacting a tissue sample with an oligonucleotide of the
invention under conditions selected to permit detection and,
usually, quantitation of such inhibition. In the context of this
invention, to "contact" tissues or cells with an oligonucleotide or
oligonucleotides means to add the oligonucleotide(s), usually in a
liquid carrier, to a cell suspension or tissue sample, either in
vitro or ex vivo, or to administer the oligonucleotide(s) to cells
or tissues within an animal. Similarly, the present invention can
be used to distinguish mdm2-associated tumors, particularly tumors
associated with mdm2.alpha., from tumors having other etiologies,
in order that an efficacious treatment regime can be designed.
[0026] The oligonucleotides of this invention may also be used for
research purposes. Thus, the specific hybridization exhibited by
the oligonucleotides may be used for assays, purifications,
cellular product preparations and in other methodologies which may
be appreciated by persons of ordinary skill in the art.
[0027] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid or
deoxyribonucleic acid. This term includes oligonucleotides composed
of naturally-occurring nucleobases, sugars and covalent intersugar
(backbone) linkages as well as oligonucleotides having
non-naturally-occurring portions which function similarly. Such
modified or substituted oligonucleotides are often preferred over
native forms because of desirable properties such as, for example,
enhanced cellular uptake, enhanced binding to target and increased
stability in the presence of nucleases.
[0028] Specific examples of some preferred modified
oligonucleotides envisioned for this invention include those
containing phosphorothioates, phosphotriesters, methyl
phosphonates, short chain alkyl or cycloalkyl intersugar linkages
or short chain heteroatomic or heterocyclic intersugar linkages.
Most preferred are oligonucleotides with phosphorothioates (usually
abbreviated in the art as P.dbd.S) and those with
CH.sub.2--NH--O--CH.sub.2, CH.sub.2--N(CH.sub.3)--O--CH.sub.2
[known as a methylene (methylimino) or MMI backbone],
CH.sub.2--O--N (CH.sub.3)--CH.sub.2,
CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2 and
O--N(CH.sub.3)--CH.sub.2--CH.sub.2 backbones, wherein the native
phosphodiester (usually abbreviated in the art as P.dbd.O) backbone
is represented as O--P--O--CH.sub.2). Also preferred are
oligonucleotides having morpholino backbone structures (Summerton
and Weller, U.S. Pat. No. 5,034,506). Further preferred are
oligonucleotides with NR--C(*)--CH.sub.2--CH.sub.2,
CH.sub.2--NR--C(*)--CH.sub.2, CH.sub.2--CH.sub.2--NR--C(*),
C(*)--NR--CH.sub.2--CH.sub.2 and CH.sub.2--C(*)--NR--CH.sub.2
backbones, wherein "*" represents O or S (known as amide backbones;
DeMesmaeker et al., WO 92/20823, published Nov. 26, 1992). In other
preferred embodiments, such as the peptide nucleic acid (PNA)
backbone, the phosphodiester backbone of the oligonucleotide is
replaced with a polyamide backbone, the nucleobases being bound
directly or indirectly to the aza nitrogen atoms of the polyamide
backbone (Nielsen et al., Science, 254, 1497 (1991); U.S. Pat. No.
5,539,082). Other preferred modified oligonucleotides may contain
one or more substituted sugar moieties comprising one of the
following at the 2' position: OH, SH, SCH.sub.3, F, OCN,
OCH.sub.3OCH.sub.3, OCH.sub.3O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2 or O(CH.sub.2).sub.nCH.sub.3 where n is
from 1 to about 10; C.sub.1 to C10 lower alkyl, alkoxyalkoxy,
substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF.sub.3;
OCF.sub.3; O--, S--, or N-alkyl; O--, S--, or N-alkenyl;
SOCH.sub.3; SO.sub.2CH.sub.3; ONO.sub.2; NO.sub.2; N.sub.3;
NH.sub.2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino;
polyalkylamino; substituted silyl; an RNA cleaving group; a
reporter group; an intercalator; a group for improving the
pharmacokinetic properties of an oligonucleotide; or a group for
improving the pharmacodynamic properties of an oligonucleotide and
other substituents having similar properties. A preferred
modification includes 2'-O-methoxyethyl [which can be written as
2'--O--CH.sub.2CH.sub.2OCH.sub- .3, and is also known in the art as
2'--O--(2-methoxyethyl) or 2'-methoxyethoxy] [Martin et al., Helv.
Chim. Acta, 78, 486 (1995)]. Other preferred modifications include
2'-methoxy (2'--O--CH.sub.3), 2'-propoxy
(2'--OCH.sub.2CH.sub.2CH.sub.3) and 2'-fluoro (2'--F). Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide and the 5' position of the 5' terminal
nucleotide. Oligonucleotides may also have sugar mimetics such as
cyclobutyls in place of the pentofuranosyl group.
[0029] The oligonucleotides of the invention may additionally or
alternatively include nucleobase modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include adenine
(A), guanine (G), thymine (T), cytosine (C) and uracil (U).
Modified nucleobases include nucleobases found only infrequently or
transiently in natural nucleic acids, e.g., hypoxanthine,
6-methyladenine and 5-methylcytosine, as well as synthetic
nucleobases, e.g., 5-bromouracil, 5-hydroxymethyluracil,
8-azaguanine, 7-deazaguanine, N.sup.6(6-aminohexyl)adenine and
2,6-diaminopurine [Kornberg, A., DNA Replication, 1974, W.H.
Freeman & Co., San Francisco, 1974, pp. 75-77; Gebeyehu, G., et
al., Nucleic Acids Res., 15, 4513 (1987)]. 5-methylcytosine
(5-me-C) is presently a preferred nucleobase, particularly in
combination with 2'-O-methoxyethyl modifications.
[0030] Another preferred additional or alternative modification of
the oligonucleotides of the invention involves chemically linking
to the oligonucleotide one or more lipophilic moieties which
enhance the cellular uptake of the oligonucleotide. Such lipophilic
moieties may be linked to an oligonucleotide at several different
positions on the oligonucleotide. Some preferred positions include
the 3' position of the sugar of the 3' terminal nucleotide, the 5'
position of the sugar of the 5' terminal nucleotide, and the 2'
position of the sugar of any nucleotide. The N.sup.6 position of a
purine nucleobase may also be utilized to link a lipophilic moiety
to an oligonucleotide of the invention (Gebeyehu, G., et al.,
Nucleic Acids Res., 1987, 15, 4513). Such lipophilic moieties
include but are not limited to a cholesteryl moiety [Letsinger et
al., Proc. Natl. Acad. Sci. USA, 86, 6553 (1989)], cholic acid
[Manoharan et al., Bioorg. Med. Chem. Let., 4, 1053 (1994)], a
thioether, e.g., hexyl-S-tritylthiol [Manoharan et al., Ann. N.Y.
Acad. Sci., 660, 306 (1992); Manoharan et al., Bioorg. Med. Chem.
Let., 3, 2765 (1993)], a thiocholesterol [Oberhauser et al., Nucl.
Acids Res., 20, 533 (1992)], an aliphatic chain, e.g., dodecandiol
or undecyl residues [Saison-Behmoaras et al., EMBO J., 10, 111
(1991); Kabanov et al., FEBS Lett., 259, 327 (1990); Svinarchuk et
al., Biochimie., 75, 49(1993)], a phospholipid, e.g.,
di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate [Manoharan et al.,
Tetrahedron Lett., 36, 3651 (1995); Shea et al., Nucl. Acids Res.,
18, 3777 (1990)], a polyamine or a polyethylene glycol chain
[Manoharan et al., Nucleosides & Nucleotides, 14, 969 (1995)],
or adamantane acetic acid [Manoharan et al., Tetrahedron Lett., 36,
3651 (1995)], a palmityl moiety [Mishra et al., Biochim. Biophys.
Acta, 1264, 229 (1995)], or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety [Crooke et al., J.
Pharmacol. Exp. Ther., 277, 923 (1996)]. Oligonucleotides
comprising lipophilic moieties, and methods for preparing such
oligonucleotides, as disclosed in U.S. Pat. No. 5,138,045, No.
5,218,105 and No. 5,459,255, the contents of which are hereby
incorporated by reference.
[0031] The present invention also includes oligonucleotides which
are chimeric oligonucleotides. "Chimeric" oligonucleotides or
"chimeras," in the context of this invention, are oligonucleotides
which contain two or more chemically distinct regions, each made up
of at least one nucleotide. These oligonucleotides typically
contain at least one region wherein the oligonucleotide is modified
so as to confer upon the oligonucleotide increased resistance to
nuclease degradation, increased cellular uptake, and/or increased
binding affinity for the target nucleic acid. An additional region
of the oligonucleotide may serve as a substrate for enzymes capable
of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H
is a cellular endonuclease which cleaves the RNA strand of an
RNA:DNA duplex. Activation of RNase H, therefore, results in
cleavage of the RNA target, thereby greatly enhancing the
efficiency of antisense inhibition of gene expression. Cleavage of
the RNA target can be routinely detected by gel electrophoresis
and, if necessary, associated nucleic acid hybridization techniques
known in the art. This RNAse H-mediated cleavage of the RNA target
is distinct from the use of ribozymes to cleave nucleic acids.
Ribozymes are not comprehended by the present invention.
[0032] Examples of chimeric oligonucleotides include but are not
limited to "gapmers," in which three distinct regions are present,
normally with a central region flanked by two regions which are
chemically equivalent to each other but distinct from the gap. A
preferred example of a gapmer is an oligonucleotide in which a
central portion (the "gap") of the oligonucleotide serves as a
substrate for RNase H and is preferably composed of
2'-deoxynucleotides, while the flanking portions (the 5' and 3'
"wings") are modified to have greater affinity for the target RNA
molecule but are unable to support nuclease activity (e.g.,
2'-fluoro- or 2'-O-methoxyethyl-substituted). Other chimeras
include "wingmers," also known in the art as "hemimers," that is,
oligonucleotides with two distinct regions. In a preferred example
of a wingmer, the 5' portion of the oligonucleotide serves as a
substrate for RNase H and is preferably composed of
2'-deoxynucleotides, whereas the 3' portion is modified in such a
fashion so as to have greater affinity for the target RNA molecule
but is unable to support nuclease activity (e.g., 2'-fluoro- or
2'-O-methoxyethyl-substituted), or vice-versa. In one embodiment,
the oligonucleotides of the present invention contain a
2'-O-methoxyethyl (2'-O-CH.sub.2CH.sub.2OCH.sub.3) modification on
the sugar moiety of at least one nucleotide. This modification has
been shown to increase both affinity of the oligonucleotide for its
target and nuclease resistance of the oligonucleotide. According to
the invention, one, a plurality, or all of the nucleotide subunits
of the oligonucleotides of the invention may bear a
2'-O-methoxyethyl (--O--CH.sub.2CH.sub.2OCH.sub.3) modification.
Oligonucleotides comprising a plurality of nucleotide subunits
having a 2'-O-methoxyethyl modification can have such a
modification on any of the nucleotide subunits within the
oligonucleotide, and may be chimeric oligonucleotides. Aside from
or in addition to 2'-O-methoxyethyl modifications, oligonucleotides
containing other modifications which enhance antisense efficacy,
potency or target affinity are also preferred. Chimeric
oligonucleotides comprising one or more such modifications are
presently preferred. Through use of such modifications, active
oligonucleotides have been identified which are shorter than
conventional "first generation" oligonucleotides active against
mdm2. Oligonucleotides in accordance with this invention are from 5
to 50 nucleotides in length. In the context of this invention it is
understood that this encompasses non-naturally occurring oligomers
as hereinbefore described, having from 5 to 50 monomers.
[0033] The oligonucleotides used in accordance with this invention
may be conveniently and routinely made through the well-known
technique of solid phase synthesis. Equipment for such synthesis is
sold by several vendors including Applied Biosystems. Any other
means for such synthesis may also be employed; the actual synthesis
of the oligonucleotides is well within the talents of the
routineer. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and 2'-alkoxy or
2'-alkoxyalkoxy derivatives, including 2'-O-methoxyethyl
oligonucleotides [Martin, P., Helv. Chim. Acta, 78, 486 (1995)]. It
is also well known to use similar techniques and commercially
available modified amidites and controlled-pore glass (CPG)
products such as biotin, fluorescein, acridine or psoralen-modified
amidites and/or CPG (available from Glen Research, Sterling Va.) to
synthesize fluorescently labeled, biotinylated or other conjugated
oligonucleotides.
[0034] The antisense compounds of the present invention include
bioequivalent compounds, including pharmaceutically acceptable
salts and prodrugs. This is intended to encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to pharmaceutically
acceptable salts of the nucleic acids of the invention and prodrugs
of such nucleic acids.
[0035] Pharmaceutically acceptable "salts" are physiologically and
pharmaceutically acceptable salts of the nucleic acids of the
invention: i.e., salts that retain the desired biological activity
of the parent compound and do not impart undesired toxicological
effects thereto [see, for example, Berge et al., "Pharmaceutical
Salts," J. of Pharma Sci., 66:1 (1977)].
[0036] For oligonucleotides, examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0037] The oligonucleotides of the invention may additionally or
alternatively be prepared to be delivered in a "prodrug" form. The
term "prodrug" indicates a therapeutic agent that is prepared in an
inactive form that is converted to an active form (i.e., drug)
within the body or cells thereof by the action of endogenous
enzymes or other chemicals and/or conditions. In particular,
prodrug versions of the oligonucleotides of the invention are
prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives
according to the methods disclosed in WO 93/24510 to Gosselin et
al., published Dec. 9, 1993.
[0038] For therapeutic or prophylactic treatment, oligonucleotides
are administered in accordance with this invention. Oligonucleotide
compounds of the invention may be formulated in a pharmaceutical
composition, which may include pharmaceutically acceptable
carriers, thickeners, diluents, buffers, preservatives, surface
active agents, neutral or cationic lipids, lipid complexes,
liposomes, penetration enhancers, carrier compounds and other
pharmaceutically acceptable carriers or excipients and the like in
addition to the oligonucleotide. Such compositions and formulations
are comprehended by the present invention.
[0039] Pharmaceutical compositions comprising the oligonucleotides
of the present invention may include penetration enhancers in order
to enhance the alimentary delivery of the oligonucleotides.
Penetration enhancers may be classified as belonging to one of five
broad categories, i.e., fatty acids, bile salts, chelating agents,
surfactants and non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, 8:91-192; Muranishi,
Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7:1).
One or more penetration enhancers from one or more of these broad
categories may be included. Compositions comprising
oligonucleotides and penetration enhancers are disclosed in
co-pending U.S. patent application Ser. No. 08/886,829 to Teng et
al., filed Jul. 1, 1997, which is herein incorporated by reference
in its entirety.
[0040] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional
compatible pharmaceutically-active materials such as, e.g.,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the composition of present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the invention.
[0041] Regardless of the method by which the oligonucleotides of
the invention are introduced into a patient, colloidal dispersion
systems may be used as delivery vehicles to enhance the in vivo
stability of the oligonucleotides and/or to target the
oligonucleotides to a particular organ, tissue or cell type.
Colloidal dispersion systems include, but are not limited to,
macromolecule complexes, nanocapsules, microspheres, beads and
lipid-based systems including oil-in-water emulsions, micelles,
mixed micelles, liposomes and lipid:oligonucleotide complexes of
uncharacterized structure. A preferred colloidal dispersion system
is a plurality of liposomes. Liposomes are microscopic spheres
having an aqueous core surrounded by one or more outer layers made
up of lipids arranged in a bilayer configuration [see, generally,
Chonn et al., Current Op. Biotech., 6, 698 (1995)]. Liposomal
antisense compositions are prepared according to the disclosure of
co-pending U.S. patent application Ser. No. 08/961,469 to Hardee et
al., filed Oct. 31, 1997, herein incorporated by reference in its
entirety.
[0042] The pharmaceutical compositions of the present invention may
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, vaginal,
rectal, intranasal, epidermal and transdermal), oral or parenteral.
Parenteral administration includes intravenous drip, subcutaneous,
intraperitoneal or intramuscular injection, pulmonary
administration, e.g., by inhalation or insufflation, or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration. Modes of administering
oligonucleotides are disclosed in co-pending U.S. patent
application Ser. No. 08/961,469 to Hardee et al., filed Oct. 31,
1997, herein incorporated by reference in its entirety.
[0043] Formulations for topical administration may include
transdermal patches, ointments, lotions, creams, gels, drops,
suppositories, sprays, liquids and powders. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable. Coated condoms, gloves
and the like may also be useful.
[0044] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets or tablets. Thickeners, flavoring agents,
diluents, emulsifiers, dispersing aids or binders may be
desirable.
[0045] Compositions for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives. In some cases it may be more
effective to treat a patient with an oligonucleotide of the
invention in conjunction with other traditional therapeutic
modalities in order to increase the efficacy of a treatment
regimen. In the context of the invention, the term "treatment
regimen" is meant to encompass therapeutic, palliative and
prophylactic modalities. For example, a patient may be treated with
conventional chemotherapeutic agents, particularly those used for
tumor and cancer treatment. Examples of such chemotherapeutic
agents include but are not limited to daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin,
bleomycin, mafosfamide, ifosfamide, cytosine arabinoside,
bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine,
pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil,
methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA),
5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclophosphor- amide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,
taxol, vincristine, vinblastine, etoposide, trimetrexate,
teniposide, cisplatin and diethylstilbestrol (DES). See, generally,
The Merck Manual of Diagnosis and Therapy, 15th Ed., pp. 1206-1228,
Berkow et al., eds., Rahay, N. J., 1987). When used with the
compounds of the invention, such chemotherapeutic agents may be
used individually (e.g., 5-FU and oligonucleotide), sequentially
(e.g., 5-FU and oligonucleotide for a period of time followed by
MTX and oligonucleotide), or in combination with one or more other
such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide,
or 5-FU, radiotherapy and oligonucleotide).
[0046] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 .mu.g to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 .mu.g to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0047] Thus, in the context of this invention, by "therapeutically
effective amount" is meant the amount of the compound which is
required to have a therapeutic effect on the treated mammal. This
amount, which will be apparent to the skilled artisan, will depend
upon the type of mammal, the age and weight of the mammal, the type
of disease to be treated, perhaps even the gender of the mammal,
and other factors which are routinely taken into consideration when
treating a mammal with a disease. A therapeutic effect is assessed
in the mammal by measuring the effect of the compound on the
disease state in the animal. For example, if the disease to be
treated is cancer, therapeutic effects are assessed by measuring
the rate of growth or the size of the tumor, or by measuring the
production of compounds such as cytokines, production of which is
an indication of the progress or regression of the tumor.
[0048] The following examples illustrate the present invention and
are not intended to limit the same.
EXAMPLES
Example 1
Synthesis of Oligonucleotides
[0049] Unmodified oligodeoxynucleotides are synthesized on an
automated DNA synthesizer (Applied Biosystems model 380B) using
standard phosphoramidite chemistry with oxidation by iodine.
.beta.-cyanoethyldiisopropyl-phosphoramidites are purchased from
Applied Biosystems (Foster City, Calif.). For phosphorothioate
oligonucleotides, the standard oxidation bottle was replaced by a
0.2 M solution of .sup.3H-1,2-benzodithiole-3-one 1,1-dioxide in
acetonitrile for the stepwise thiation of the phosphite linkages.
The thiation cycle wait step was increased to 68 seconds and was
followed by the capping step.
[0050] 2'-methoxy oligonucleotides were synthesized using
2'-methoxy .beta.-cyanoethyldiisopropyl-phosphoramidites
(Chemgenes, Needham, Mass.) and the standard cycle for unmodified
oligonucleotides, except the wait step after pulse delivery of
tetrazole and base was increased to 360 seconds. Other 2'-alkoxy
oligonucleotides were synthesized by a modification of this method,
using appropriate 2'-modified amidites such as those available from
Glen Research, Inc., Sterling, Va.
[0051] 2'-fluoro oligonucleotides were synthesized as described in
Kawasaki et al., J. Med. Chem., 36, 831 (1993). Briefly, the
protected nucleoside N.sup.6-benzoyl-2'-deoxy-2'-fluoroadenosine
was synthesized utilizing commercially available
9-.beta.-D-arabinofuranosyladenine as starting material and by
modifying literature procedures whereby the 2'-.alpha.-fluoro atom
is introduced by a S.sub.N2-displacement of a 2'-.beta.-O-trifyl
group. Thus N.sup.6-benzoyl-9-.beta.-D-arabinofuranosy- ladenine
was selectively protected in moderate yield as the
3',5'-ditetrahydropyranyl (THP) intermediate. Deprotection of the
THP and N.sup.6-benzoyl groups was accomplished using standard
methodologies and standard methods were used to obtain the
5'-dimethoxytrityl-(DMT) and 5'-DMT-3'-phosphoramidite
intermediates.
[0052] The synthesis of 2'-deoxy-2'-fluoroguanosine was
accomplished using tetraisopropyldisiloxanyl (TPDS) protected
9-.beta.-D-arabinofuranosylgua- nine as starting material, and
conversion to the intermediate
diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS
group was followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation was followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies were used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidi- tes.
[0053] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by
the modification of a known procedure in which
2,2'-anhydro-1-.beta.-D-arabin- ofuranosyluracil was treated with
70% hydrogen fluoride-pyridine. Standard procedures were used to
obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0054] 2'-deoxy-2'-fluorocytidine was synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N.sup.4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures
were used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0055] 2'-(2-methoxyethyl)-modified amidites are synthesized
according to Martin, P., Helv. Chim. Acta, 78,486 (1995). For ease
of synthesis, the last nucleotide was a deoxynucleotide.
2'--O--CH.sub.2CH.sub.2OCH.sub.3-- cytosines may be 5-methyl
cytosines.
[0056] Synthesis of 5-methyl Cytosine Monomers:
[0057] 2,2'-Anhydro
[1-(.beta.-D-arabinofuranosyl)-5-methyluridine]:
[0058] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M),
diphenyl-carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g,
0.024 M) were added to DMF (300 mL). The mixture was heated to
reflux, with stirring, allowing the evolved carbon dioxide gas to
be released in a controlled manner. After 1 hour, the slightly
darkened solution was concentrated under reduced pressure. The
resulting syrup was poured into diethylether (2.5 L), with
stirring. The product formed a gum. The ether was decanted and the
residue was dissolved in a minimum amount of methanol (ca. 400 mL).
The solution was poured into fresh ether (2.5 L) to yield a stiff
gum. The ether was decanted and the gum was dried in a vacuum oven
(60.degree. C. at 1 mm Hg for 24 hours) to give a solid which was
crushed to a light tan powder (57 g, 85% crude yield). The material
was used as is for further reactions.
[0059] 2'-O-Methoxyethyl-5-methyluridine:
[0060] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with MeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% EtNH. The
residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of
product.
[0061] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine:
[0062] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.41 filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
[0063]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-uridine-
:
[0064] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by tlc by first quenching the tlc
sample with the addition of MeOH. Upon completion of the reaction,
as judged by tlc, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/Hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%).
[0065]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triaz-
oleuridine:
[0066] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M)
was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1
L), cooled to -5.degree. C. and stirred for 0.5 h using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10.degree. C., and the
resulting mixture stirred for an additional 2 hours. The first
solution was added dropwise, over a 45 minute period, to the later
solution. The resulting reaction mixture was stored overnight in a
cold room. Salts were filtered from the reaction mixture and the
solution was evaporated. The residue was dissolved in EtOAc (1 L)
and the insoluble solids were removed by filtration. The filtrate
was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
[0067] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine:
[0068] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5--
methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100.degree. C. for 2 hours (tlc showed complete
conversion). The vessel contents were evaporated to dryness and the
residue was dissolved in EtOAc (500 mL) and washed once with
saturated NaCl (200 mL). The organics were dried over sodium
sulfate and the solvent was evaporated to give 85 g (95%) of the
title compound.
[0069]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine:
[0070] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85
g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, tic showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/Hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
[0071]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine-3'-amidite:
[0072]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine (74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L).
Tetrazole diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (tlc showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using
EtOAc.backslash.Hexane (3:1) as the eluting solvent. The pure
fractions were combined to give 90.6 g (87%) of the title
compound.
[0073] 5-methyl-2'-deoxycytidine (5-me-C) containing
oligonucleotides were synthesized according to published methods
[Sanghvi et al., Nucl. Acids Res., 21, 3197 (1993)] using
commercially available phosphoramidites (Glen Research, Sterling
Va. or ChemGenes, Needham Mass.).
[0074] Oligonucleotides having methylene(methylimino) (MMI)
backbones are synthesized according to U.S. Pat. No. 5,378,825,
which is coassigned to the assignee of the present invention and is
incorporated herein in its entirety. For ease of synthesis, various
nucleoside dimers containing MMI linkages were synthesized and
incorporated into oligonucleotides. Other nitrogen-containing
backbones are synthesized according to WO 92/20823 which is also
coassigned to the assignee of the present invention and
incorporated herein in its entirety.
[0075] Oligonucleotides having amide backbones are synthesized
according to De Mesmaeker et al., Acc. Chem. Res., 28, 366 (1995).
The amide moiety is readily accessible by simple and well-known
synthetic methods and is compatible with the conditions required
for solid phase synthesis of oligonucleotides.
[0076] Oligonucleotides with morpholino backbones are synthesized
according to U.S. Pat. No. 5,034,506 (Summerton and Weller).
[0077] Peptide-nucleic acid (PNA) oligomers are synthesized
according to P. E. Nielsen et al., Science, 254, 1497 (1991).
[0078] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides are
purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes
ethanol. Synthesized oligonucleotides were analyzed by
polyacrylamide gel electrophoresis on denaturing gels and judged to
be at least 85% full length material. The relative amounts of
phosphorothioate and phosphodiester linkages obtained in synthesis
were periodically checked by .sup.31P nuclear magnetic resonance
spectroscopy, and for some studies oligonucleotides were purified
by HPLC, as described by Chiang et al., J. Biol. Chem., 266, 18162
(1991). Results obtained with HPLC-purified material were similar
to those obtained with non-HPLC purified material.
EXAMPLE 2
Human mdm2 Oligonucleotide Sequences
[0079] The oligonucleotides tested are presented in Table 1.
Sequence data are from the cDNA sequence published by Oliner, J.
D., et al., Nature, 358, 80 (1992); Genbank accession number
Z12020, provided herein as SEQ ID NO: 1. Oligonucleotides were
synthesized primarily as chimeric oligonucleotides having a
centered deoxy gap of eight nucleotides flanked by
2'-O-methoxyethyl regions.
[0080] A549 human lung carcinoma cells (obtained from the American
Type Culture Collection) were routinely passaged at 80-90%
confluency in Dulbecco's modified Eagle's medium (DMEM) and 10%
fetal bovine serum (Hyclone, Logan, Utah).
[0081] A549 cells were treated with phosphorothioate
oligonucleotides at 200 nM for four hours in the presence of 6
.mu.g/ml LIPOFECTIN.TM., washed and allowed to recover for an
additional 20 hours. Total RNA was extracted and 15-20 mg of each
was resolved on 1% gels and transferred to nylon membranes. The
blots were probed with a .sup.32P radiolabeled mdm2 cDNA probe and
then stripped and reprobed with a radiolabeled G3PDH probe to
confirm equal RNA loading. mdm2 transcripts were examined and
quantified with a PhosphorImager (Molecular Dynamics, Sunnyvale,
Calif.). Results are shown in Table 2. Oligonucleotides 16506 (SEQ
ID NO: 3), 16507 (SEQ ID NO: 4), 16508 (SEQ ID NO: 5), 16510 (SEQ
ID NO: 7), 16518 (SEQ ID NO: 15), 16520 (SEQ ID NO: 17), 16521 (SEQ
ID NO: 18), 16522 (SEQ ID NO: 19) and 16524 (SEQ ID NO: 21) gave at
least approximately 50% reduction of mdm2 mRNA levels.
Oligonucleotides 16507 and 16518 gave better than 85% reduction of
mdm2.
1TABLE 1 Nucleotide Sequences of Human mdm-2 Phosphorothioate
Oligonucleotides SEQ TARGET GENE GENE ISIS NUCLEOTIDE
SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5' -> 3') NO:
CO-ORDINATES.sup.2 REGION 16506 CAGCCAAGCTCGCGCGGTGC 3 0001-0020
5'-UTR 16507 TCTTTCCGACACACAGGGCC 4 0037-0056 5'-UTR 16508
CAGCAGGATCTCGGTCAGAG 5 0095-0114 5'-UTR 16509 GGGCGCTCGTACGCACTAAT
6 0147-0166 5'-UTR 16510 TCGGGGATCATTCCACTCTC 7 0181-0200 5'-UTR
16511 CGGGGTTTTCGCGCTTGGAG 8 0273-0292 5'-UTR 16512
CATTTGCCTGCTCCTCACCA 9 0295-0314 AUG 16513 GTATTGCACATTTGCCTGCT 10
0303-0322 AUG 16514 AGCACCATCAGTAGGTACAG 11 0331-0350 ORF 16515
CTACCAAGTTCCTGTAGATC 12 0617-0636 ORF 16516 TCAACTTCAAATTCTACACT 13
1047-1066 ORF 16517 TTTACAATCAGGAACATCAA 14 1381-1400 ORF 16518
AGCTTCTTTGCACATGTAAA 15 1695-1714 ORF 16519 CAGGTCAACTAGGGGAAATA 16
1776-1795 stop 16520 TCTTATAGACAGGTCAACTA 17 1785-1804 stop 16521
TCCTAGGGTTATATAGTTAG 18 1818-1837 3'-UTR 16522 AAGTATTCACTATTCCACTA
19 1934-1953 3'-UTR 16523 CCAAGATCACCCACTGCACT 20 2132-2151 3'-UTR
16524 AGGTGTGGTGGCAGATGACT 21 2224-2243 3'-UTR 16525
CCTGTCTCTACTAAAAGTAC 22 2256-2275 3'-UTR 17604 ACAAGCCTTCGCTCTACCGG
23 scrambled 16507 control 17605 TTCAGCGCATTTGTACATAA 24 scrambled
16518 control 17615 TCTTTCCGACACACAGGGCC 25 0037-0056 5'-UTR 17616
AGCTTCTTTGCACATGTAAA 15 1695-1714 ORF 17755 AGCTTCTTTGCACATGTAAA 15
1695-1714 ORF 17756 AGCTTCTTTATACATGTAAA 26 2-base 17616 mismatch
17757 AGCTTCTTTACACATGTAAA 27 1-base 17616 mismatch
.sup.1Emboldened residues, 2'-methoxyethoxy- residues (others are
2'-deoxy-) including "C" residues, 5-methyl-cytosines; all linkages
are phosphorothioate linkages. .sup.2Co-ordinates from Genbank
Accession No. Z12020, locus name "HSP53ASSG", SEQ ID NO: 1.
Oligonucleotides 16505-16511 are targeted to the 5' UTR of the
L-mdm2 transcript as described hereinabove [Landers et al., Cancer
Res., 57, 3562 (1997)] Nucleotide coordinates on the Landers
sequence [Landers et al., Cancer Res., 57, 3562 (1997) and Genbank
accession no. U39736] are identical to those shown in Table 1
except for ISIS 16511, which maps to nucleotides 267-286 on # the
Landers sequence.
[0082]
2TABLE 2 Activities of Phosphorothioate Oligonucleotides Targeted
to Human mdm2 SEQ GENE % mRNA ISIS ID TARGET EX- % mRNA No: NO:
REGION PRESSION INHIBITION LIPOFECTIN .TM. -- -- 100% 0% only 16506
3 5'-UTR 45 55 16507 4 5'-UTR 13 87 16508 5 5'-UTR 38 62 16509 6
5'-UTR 161 -- 16510 7 5'-UTR 46 54 16511 8 5'-UTR 91 9 16512 9 AUG
89 11 16513 10 AUG 174 -- 16514 11 Coding 92 8 16515 12 Coding 155
-- 16516 13 Coding 144 -- 16517 14 Coding 94 6 16518 15 Coding 8 92
16519 16 stop 73 27 16520 17 stop 51 49 16521 18 3'-UTR 38 62 16522
19 3'-UTR 49 51 16523 20 3'-UTR 109 -- 16524 21 3'-UTR 47 53 16525
22 3'-UTR 100 --
EXAMPLE 3
Dose Response of Antisense Oligonucleotide Effects on Human mdm2
mRNA Levels in A549 Cells
[0083] Oligonucleotides 16507 and 16518 were tested at different
concentrations. A549 cells were grown, treated and processed as
described in Example 2. LIPOFECTIN.TM. was added at a ratio of 3
.mu.g/ml per 100 nM of oligonucleotide. The control included
LIPOFECTIN.TM. at a concentration of 12 .mu.g/ml. Oligonucleotide
17605, an oligonucleotide with different sequence but identical
base composition to oligonucleotide 16518, was used as a negative
control. Results are shown in Table 3. Oligonucleotides 16507 and
16518 gave approximately 90% inhibition at concentrations greater
than 200 nM. No inhibition was seen with oligonucleotide 17605.
3TABLE 3 Dose Response of A549 Cells to mdm2 Antisense
Oligonucleotides (ASOs) SEQ ID ASO Gene % mRNA % mRNA ISIS # NO:
Target Dose Expression Inhibition control -- LIPOFECTIN .TM. --
100% 0% only 16507 4 5'-UTR 25 nM 55 45 16507 4 " 50 nM 52 48 16507
4 " 100 nM 24 76 16507 4 " 200 nM 12 88 16518 15 Coding 50 nM 18 82
16518 15 " 100 nM 14 86 16518 15 " 200 nM 9 91 16518 15 " 400 nM 8
92 17605 24 scrambled 400 nM 129 --
EXAMPLE 4
Time Course of Antisense Oligonucleotide Effects on Human mdm2 mRNA
Levels in A549 Cells
[0084] Oligonucleotides 16507 and 17605 were tested by treating for
varying times. A549 cells were grown, treated for times indicated
in Table 4 and processed as described in Example 2. Results are
shown in Table 4. Oligonucleotide 16507 gave greater than 90%
inhibition throughout the time course. No inhibition was seen with
oligonucleotide 17605.
4TABLE 4 Time Course of Response of Cells to Human mdm2 Antisense
Oligonucleotides (ASOs) SEQ ID ASO Gene % RNA % RNA ISIS # NO:
Target Region Time Expression Inhibition basal -- LIPOFECTIN .TM.
24 h 100% 0% only basal -- LIPOFECTIN .TM. 48 h 100% 0% only basal
-- LIPOFECTIN .TM. 72 h 100% 0% only 16518 15 Coding 24 h 3% 97%
16518 15 " 48 h 6% 94% 16518 15 " 72 h 5% 95% 17605 24 scrambled 24
h 195% -- 17605 24 " 48 h 100% -- 17605 24 " 72 h 102% --
EXAMPLE 5
Effect of Antisense Oligonucleotides on Cell Proliferation in A549
Cells
[0085] A549 cells were treated on day 0 for four hours with 400 nM
oligonucleotide and 12 mg/ml LIPOFECTIN. After four hours, the
media was replaced. Twenty-four, forty-eight or seventy-two hours
after initiation of oligonucleotide treatment, live cells were
counted on a hemacytometer. Results are shown in Table 5.
5TABLE 5 Antisense Inhibition of Cell Proliferation in A549 cells
SEQ ID ASO Gene % Cell % Growth ISIS # NO: Target Region Time
Growth Inhibition basal -- LIPOFECTIN .TM. 24 h 100% 0% only basal
-- LIPOFECTIN .TM. 48 h 100% 0% only basal -- LIPOFECTIN .TM. 72 h
100% 0% only 16518 15 Coding 24 h 53% 47% 16518 15 " 48 h 27% 73%
16518 15 " 72 h 17% 83% 17605 24 scrambled 24 h 93% 7% 17605 24 "
48 h 76% 24% 17605 24 " 72 h 95% 5%
EXAMPLE 6
Additional Human mdm2 Antisense Oligonucleotides
[0086] Additional oligonucleotides targeted to the 5'-untranslated
region of human mdm2 mRNA were designed and synthesized. Sequence
data are from the cDNA sequence published by Zauberman, A., et al.,
Nucleic Acids Res., 23, 2584 (1995); Genbank accession number
HSU28935. Oligonucleotides were synthesized primarily as chimeric
oligonucleotides having a centered deoxy gap of eight nucleotides
flanked by 2'-O-methoxyethyl regions. These oligonucleotides are
shown in Table 6.
6TABLE 6 Nucleotide Sequences of additional Human mdm-2
Phosphorothioate Oligonucleotides SEQ TARGET GENE GENE ISIS
NUCLEOTIDE SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5' -> 3')
NO: CO-ORDINATES.sup.2 REGION 21926 CTACCCTCCAATCGCCACTG 28
0238-0257 5'-UTR 21927 GGTCTACCCTCCAATCGCCA 29 0241-0260 5'-UTR
21928 CGTGCCCACAGGTCTACCCT 30 0251-0270 5'-UTR 21929
AAGTGGCGTGCGTCCGTGCC 31 0265-0284 5'-UTR 21930 AAAGTGGCGTGCGTCCGTGC
32 0266-0285 5'-UTR .sup.1Emboldened residues, 2'-methoxyethoxy-
residues (others are 2'-deoxy-); all "C" residues,
5-methyl-cytosines; all linkages are phosphorothioate linkages.
.sup.2Co-ordinates from Genbank Accession No. U28935, locus name
"HSU28935", SEQ ID NO: 2. These oligonucleotides also hybridize to
nucleotides 829-876 of the Landers sequence [Landers et al., Cancer
Res., 57, 3562 (1997) and Genbank accession no. U39736].
[0087]
Sequence CWU 1
1
* * * * *