U.S. patent application number 09/502558 was filed with the patent office on 2002-10-17 for detection of polymorphisms by denaturing high-performance liquid chromatography.
Invention is credited to Oefner, Peter J..
Application Number | 20020150892 09/502558 |
Document ID | / |
Family ID | 23998349 |
Filed Date | 2002-10-17 |
United States Patent
Application |
20020150892 |
Kind Code |
A1 |
Oefner, Peter J. |
October 17, 2002 |
DETECTION OF POLYMORPHISMS BY DENATURING HIGH-PERFORMANCE LIQUID
CHROMATOGRAPHY
Abstract
The present invention provides a method for detecting
polymorphisms in a nucleic acid by preconditioning a sample of
nucleic acids to completely denature the nucleic acids, e.g., via
heating and/or chemical treatment, and performing high-performance
liquid chromatography (HPLC) on the nucleic acid under denaturing
conditions to identify any polymorphisms. The nucleic acids to be
analyzed are completely denatured prior to application of the
sample to a stationary reverse-phase support and throughout the
HPLC process. Sample elution is also carried out under completely
denaturing conditions, and the sample mixture is eluted with a
mobile phase containing an ion-pairing reagent and an organic
solvent.
Inventors: |
Oefner, Peter J.; (Redwood
City, CA) |
Correspondence
Address: |
Dianna L DeVore
BOZICEVIC, FIELD & FRANCIS LLP
200 MIDDLEFIELD ROAD
Suite 200
MENLO PARK
CA
94025
US
|
Family ID: |
23998349 |
Appl. No.: |
09/502558 |
Filed: |
February 10, 2000 |
Current U.S.
Class: |
435/6.16 ;
435/91.2; 702/19 |
Current CPC
Class: |
C12Q 2527/125 20130101;
C12Q 2527/101 20130101; C12Q 1/6827 20130101; C12Q 2565/537
20130101; C12Q 1/6827 20130101 |
Class at
Publication: |
435/6 ; 435/91.2;
702/19 |
International
Class: |
C12Q 001/68; C12P
019/34; G01N 033/48 |
Goverment Interests
[0001] The United States Government may have certain rights in this
application pursuant to NIH grant HG01707.
Claims
That which is claimed is:
1. A method for analyzing the nucleotide sequence of a nucleic acid
in a sample, said method comprising: preconditioning a sample
comprising a nucleic acid to provide complete denaturation of the
nucleic acid; applying the preconditioned sample to a stationary
reverse phase support; and eluting the sample under completely
denaturing conditions using a mobile phase comprising an
ion-pairing reagent and a solvent; wherein said eluting results in
the resolution of single or multiple nucleotide differences in the
nucleic acid in said sample.
2. The method of claim 1, wherein the sample is preconditioned by
heating the sample to a temperature effective to provide
denaturation of the nucleic acid.
3. The method of claim 2, wherein the temperature effective to
provide denaturation is above about 65.degree. C.
4. The method of claim 2, where said eluting is carried out at a
temperature between about 65.degree. C. and 95.degree. C.
5. The method of claim 1, wherein the sample is preconditioned by
the addition of a compound that increases the pH of the sample.
6. The method of claim 4, wherein the pH of the sample is increased
to between about 9.0 and 12.0.
7. The method of claim 4, where said eluting is carried out at a
temperature between about 50.degree. C. and 65.degree. C.
8. The method of claim 1, where the stationary support is composed
of an alkylated solid support.
9. The method of claim 8, wherein the solid support is selected
from the group consisting of silica, alumina, zirconia,
polystyrene, polyacrylamide, and styrene-divinyl copolymers.
10. The method of claim 8, where the surface of said base material
is alkylated with hydrocarbon chains containing from 4-18 carbon
atoms.
11. The method of claim 1, further comprising the steps of:
isolating a nucleic acid; and preparing said nucleic acid in a
sample for analysis of the nucleotide sequence.
12. The method of claim 11, wherein the nucleic acid is isolated
using a technique selected from the group consisting of polymerase
chain reaction, reverse transcription, reverse-transcribed
polymerase chain reaction, restriction endonuclease digestion, and
cloning and hybridization selection.
13. The method of claim 1, where the mobile phase contains an
ion-pairing agent selected from the group consisting of lower alkyl
primary, secondary, and tertiary amines, lower trialkylammonium
salts, lower quaternary ammonium salts, triethylamine,
tetrahydrofuran, and triethylammonium acetate.
14. The method of claim 1, where the mobile phase is comprised of
an organic solvent selected from the group consisting of methanol,
ethanol, acetonitrile, ethyl acetate, and 2-propanol.
15. A method for determining polymorphisms in an allele, the method
comprising the steps of: isolating a nucleic acid spanning the
genetic region of said polymorphism; preconditioning the nucleic
acid to provide for complete denaturation of the nucleic acid;
applying the preconditioned nucleic acid to a stationary reverse
phase support; and eluting the sample under completely denaturing
conditions using a mobile phase comprising an ion-pairing reagent
and a solvent; wherein said eluting results in the resolution of
the order of single nucleotides in the nucleic acid in said
sample.
16. The method of claim 15, wherein the nucleic acid is isolated
from nuclear DNA, and wherein the method is used to identify a
mutation associated with the presence of disease.
17. The method of claim 15, wherein the nucleic acid is isolated
from a mammal, and wherein the polymorphism is associated with a
physical characteristic selected from the group consisting of
predisposition to a disease, prognosis of a disease state, and
response of therapeutic effectiveness.
18. A method for preparing a database comprising information of
polymorphisms, said method comprising the steps of: isolating a
nucleic acid spanning the genetic region of a polymorphism from a
plurality of subjects; preconditioning each nucleic acid to provide
for complete denaturation; applying each preconditioned nucleic
acid to separate stationary reverse phase support; and eluting each
sample under completely denaturing conditions using a mobile phase
comprising an ion-pairing reagent and a solvent; determining the
polymorphism present in each nucleic acid; and entering information
of the determined polymorphism into a computer system.
19. A database produced using the method of claim 18.
20. The database of claim 19, wherein the database further
comprises information on the subjects.
Description
FIELD OF THE INVENTION
[0002] The present invention relates to a chromatographic method
for the detection or analysis of polymorphisms in nucleic acids,
and particularly to denaturing high performance liquid
chromatography for such uses.
BACKGROUND OF THE INVENTION
[0003] Approximately 4,000 human disorders are attributed to
heritable genetic causes. Hundreds of genes responsible for various
disorders have been mapped, and sequence information is being
accumulated rapidly. A principal goal of the Human Genome Project
is to find all genes associated with each disorder.
[0004] The most reliable diagnostic test for any specific genetic
disease (or predisposition to a particular disease) is the
identification of polymorphic variations in DNA sequence in
affected cells that result in altered gene function and/or
expression levels. In addition, certain polymorphic variations that
are associated with predispositions for disorders, e.g., alleles
that are associated with disease such as certain forms of cancer or
Alzheimer's disease, may allow prophylactic measure to be taken to
help reduce or reverse the risk imposed by the polymorphic allele.
Furthermore, responses to specific medications may depend on the
presence of polymorphisms, making people with a particular
polymorphism a better candidate for a medication than those not
possessing the polymorphism. These and other reasons provide a
great impetus for developing DNA or RNA screening as a practical
tool for medical diagnostics.
[0005] Genetic polymorphisms and mutations can manifest themselves
in several forms, such as point polymorphisms or point mutations
where a single base is changed to one of the three other bases,
deletions where one or more bases are removed from a nucleic acid
sequence and the bases flanking the deleted sequence are directly
linked to each other, insertions where new bases are inserted at a
particular point in a nucleic acid sequence adding additional
length to the overall sequence, and expansions and reductions of
repeating sequence motifs. Large insertions and deletions, often
the result of chromosomal recombination and rearrangement events,
can lead to partial or complete loss of a gene. Of these forms of
polymorphism, in general point polymorphisms are the most difficult
to detect because they represent the smallest degree of molecular
change.
[0006] The most definitive screening method to identify and
determine polymorphisms such as SNPs in a nucleic acid requires
determining the actual base sequence (Maxam and Gilbert, 1977;
Sanger et al., 1977). Although such a method is the most accurate,
it is also the most expensive and time consuming method.
Restriction mapping analysis has some limited use in analyzing DNA
for polymorphisms. If one is looking for a known polymorphism at a
site which will change the recognition site for a restriction
enzyme, it is possible simply to digest DNA with this restriction
enzyme and analyze the relative sizes and numbers of fragments to
determine the presence or absence of the polymorphism. (R. K. Saiki
et al., Science 230 (1985), 1350-1354). This type of analysis is
also useful for determining the presence or absence of gross
insertions or deletions, but may not be useful in detecting smaller
changes that do not result in a readily distinguishable change in
restriction fragment size and/or number. Restriction mapping
methods also generally require the use of hybridization techniques
which are time consuming and costly.
[0007] The large-scale identification of single-nucleotide
polymorphisms (SNPs) in the human as well as other model genomes
such as yeast and Arabidopsis thaliana has been accomplished by
methods such as fluorescence-based sequencing (P. -Y. Kwok, Q. et
al., Genomics 31 (1996) 123-126), hybridization high-density
variation-detection DNA chips (D. G. Wang et al., Science 280
(1998) 1077-1082; E. A. Winzeler et al., Science 281 (1998)
1194-1197), and high performance liquid chromatography (P. A.
Underhill et al., Genome Res. 7 (1997) 996-1005; M. Giordano et
al., Genomics, 56 (1999) 247-253; R. J. Cho et al., Nature Genet.
23 (1999) 203-207; and M. Cargill et al, Nature Genet. 22 (1999)
231-238). These and other methods have been used to identify
thousands of SNPs. For this reason, the development of simple and
inexpensive technology for the genotyping of SNPs of individuals
(e.g., in a clinical setting) has become of great interest as the
ability to discriminate between allelic forms of SNPs is
increasingly seen as fundamental to future molecular genetic
analysis of disease (N. Risch and K. Merikangas, Science 273 (1996)
1516-1517; F. S. Collins et al., Science 278 (1997) 1580-1581; L.
Kruglyak, Nature Genet. 17 (1997) 21-24).
[0008] A number of additional methods are available for SNP
genotyping such as allele-specific hybridization (R. K. Saiki et
al., N. Engl. J. Med. 319 (1988) 537-541; M. Chee et al., Science
274 (1996) 610-614), nick translation PCR (L. G. Lee et al., Nucl.
Acids Res. 21 (1993) 3761-3766; K. J. Livaket al., PCR Methods
Appl. 4 (1995) 357-362), ligase chain reaction (D. Y. Wu and R. B.
Wallace, Genomics 4 (1989) 560-560; D. A. Nickerson et al., Proc.
Natl. Acad. Sci. USA 87 (1990) 8923-8927), allele-specific
polymerase chain reaction (C. R. Newton et al, Nucl. Acids Res. 17
(1989) 2503-2516; D. Y. Wu et al. Proc. Natl. Acad. Sci. USA 86
(1989) 2757-2760); T.sub.m-shift genotyping (S. Germer and R.
Higuchi, Genome Res. 9 (1999) 72-78), and minisequencing (A.
Jalanko et al., Clin. Chem. 38 (1992) 39-43; P. Nyren et al., Anal.
Biochem. 208 (1993) 171-175; T. T. Nikiforov et al., Nucl. Acids
Res. 22 (1994) 4167-4175; T. Pastinen et al., Clin. Chem. 42 (1996)
1391-1397; G. S. Higgins et al., BioTechniques 23 (1997) 710-714;
L. A. Haff and I. P Smirnov, Genome Res. 7 (1997) 378-388; C. A.
Piggee et al., J. Chromatogr. A 781 (1997) 367-75; X. Chen et al.,
Genome Res. 9 (1999) 492-498; and B. Hoogendoorn et al., Hum.
Genet. 104 (1999) 89-93). The latter method, which is based on the
annealing of a primer immediately upstream or downstream from the
polymorphic site and its extension by one or more bases in the
presence of the appropriate dNTPs and ddNTPs, has become very
popular. It has been combined with a variety of techniques for
detecting the extension products, including radiolabeling (A.
Jalanko et al., Clin. Chem. 38 (1992) 39-43), luminous detection
(P. Nyren et al, Anal. Biochem. 208 (1993) 171-175), colorimetric
ELISA (T. T. Nikiforov et al., Nucl. Acids Res. 22 (1994)
4167-4175), gel-based fluorescent detection (T. Pastinen et al.,
Clin. Chem. 42 (1996) 1391-1397), mass spectrometry (G. S. Higgins
et al., BioTechniques 23 (1997) 710-714; 25 L. A. Haff and I. P
Smirnov, Genome Res. 7 (1997) 378-388), capillary electrophoresis
(C. A. Piggee et al., J. Chromatogr. A 781 (1997) 367-75),
fluorescence polarization (X. Chen et al., Genome Res. 9 (1999)
492-498), and most recently high-performance liquid chromatography
(B. Hoogendoorn et al., Hum. Genet. 104 (1999) 89-93).
[0009] All of the aforementioned genotyping techniques use the
polymerase chain reaction as the initial sample pretreatment step.
Many of these techniques thus require at least a two-step process
to determine the presence of an SNP. Although some of the methods
can be done in a single step in a single tube, these techniques
require expensive fluorescent dye-labeled oligonucleotide probes
(L. G. Lee et al., Nucl. Acids Res. 21 (1993) 3761-3766.; K. J.
Livak et al., PCR Methods Appl. 4 (1995) 357-362). Others require
additional steps such as hybridization or primer extension. Primer
extension also requires prior purification of the PCR product from
unincorporated dNTPs and oligonucleotides by either solid-phase
extraction or enzymatic treatment with Shrimp Alkaline Phosphatase
and Exonuclease I. For these reasons, genotyping is still a far
more costly undertaking than identifying the presence of an SNP in
the genome. This constitutes a severe limitation in the application
of SNPs to genetic studies in the clinic and laboratories.
[0010] High-performance liquid chromatography (HPLC) has been used
to identify and analyze polymorphisms in DNA, for example by
detecting the presence of heteroduplices in DNA samples from an
individual. The importance of preconditioning DNA prior to its
contact with the column matrix had been recognized for the
successful resolution of homo- and heteroduplex species under
partially denaturing conditions, as it proved impossible to detect
heteroduplices when the DNA sample was injected directly into the
column without such preconditioning. (A. Hayward-Lester et al., in:
F. Ferr (Ed.), Gene Quantification, Birkhuser Verlag, 1997, pp.
44-77; U.S. Pat. No. 5,795,976). Although techniques such as HPLC
under partially denaturing conditions are powerful for identifying
poymorphisms and detecting polymorphisms in the presence of a
reference nucleic acid (i.e., by the formation of a homo- or
heteroduplex with the reference nucleic acid), single nucleotide
changes in an allele could not be directly determined using these
techniques, even under optimum conditions. (See e.g., C. G. Huber
et al., Anal. Biochem. 212 (1993) 351-358).
[0011] All of the methods in use today capable of screening broadly
for genetic polymorphisms suffer from technical complications and
are labor and time intensive. There is a need for new methods that
can provide cost effective and expeditious means for screening
genetic material.
SUMMARY OF THE INVENTION
[0012] The present invention provides a method for detecting
polymorphisms in a nucleic acid, e.g., DNA or RNA, by 1)
preconditioning a sample of nucleic acids to completely denature
the nucleic acids, e.g., via heating and/or chemical treatment; and
2) performing high-performance liquid chromatography (HPLC) on the
sample under denaturing conditions to identify the polymorphism of
the nucleic acid. The nucleic acids to be analyzed are completely
denatured prior to application of the sample to a stationary
reverse-phase support and throughout the HPLC process. The sample
mixture is eluted with a mobile phase containing an ion-pairing
reagent and an organic solvent. Sample elution is also carried out
under completely denaturing conditions.
[0013] The nucleic acid sample to be analyzed is generally injected
and pre-mixed with the mobile phase prior to elution on the solid
support. The sample is preferably injected into a pre-conditioned
mobile phase, though it can also be passed through a
"preconditioning" tubing or pre-column placed between injector and
column. This allows the sample to equilibrate before contact with
the solid support, and provides a means for denaturation of the
sample, e.g., by heating of the mobile phase-sample mixture or by
contact of the sample with the alkaline environment of the mobile
phase.
[0014] The stationary phase used in the present methods may be any
reverse phase solid support, including monolith stationary phases
and stationary phases based on particles. Reverse phase columns or
column packing materials for use in the invention are typically
composed of alkylated polymeric solid support materials such as
silica, cellulose and cellulose derivatives such as
carboxymethylcellulose, alumina, zirconia, polystyrene,
polyacrylamide, polymethylmethacrylate, and styrene copolymers. In
a preferred embodiment, the polymeric base material is a
styrene-divinyl copolymer. Typically, the stationary support is
composed of beads from about 1-100 microns in size.
[0015] The mobile phase contains an ion-pairing agent and an
organic solvent. Ion-pairing agents for use in the method include
lower primary, secondary and tertiary amines, lower
trialkylammonium salts such as triethylammonium acetate and lower
quaternary ammonium salts. A preferred tertiary amine is triethyl
amine. Typically, the ion-pairing reagent is present at a
concentration between about 0.05 and 1.0 molar. Organic solvents
for use in the method include solvents such as methanol, ethanol,
2-propanol, acetonitrile, and ethyl acetate.
[0016] In one embodiment, the method of the invention utilizes
thermal means to provide and maintain completely denaturing
conditions of the mobile phase and the stationary phase during
HPLC. When denaturation of the sample is provided by heating,
preferably the apparatus used in performing the HPLC, e.g., the
sample loop, preconditioning coil, and the column, are all
maintained at a sufficient temperature to maintain denaturation of
the nucleic acid in the sample.
[0017] In another embodiment of the invention, completely
denaturing conditions are achieved and maintained by the presence
of a compound that increases the pH of the mobile phase, e.g. NaOH.
Sample elution is then carried out under pH conditions effective to
maintain complete denaturation of the nucleic acids. In such cases,
a lower column temperature (less than about 65.degree. C.) may be
sufficient for determining polymorphisms in the sample.
[0018] In one particularly preferred embodiment of the present
method, analysis of the nucleotide sequence of an oligomer is
determined by applying a sample containing an oligomer to a C-18
alkylated polystyrene-divinylbenzene copolymer stationary support
and eluting the mixture with a mobile phase containing
triethylammonium acetate as the ion-pairing reagent and
acetonitrile as the organic solvent at a temperature between about
70.degree.-80.degree. C.
[0019] An advantage of the present invention is that the majority
of possible transitions and transversions can be typed
accurately.
[0020] Another advantage of the invention is that the method of the
present invention can be used in conjunction with other methods of
detecting and analyzing polymorphisms, e.g., detection by means of
HPLC based heteroduplex detection under partially denaturing
conditions and analysis using methods such as mass
spectrometry.
[0021] The invention also provides a method for direct
discrimination of alleles using completely denaturing HPLC. A DNA
oligomer (e.g., an amplicon produced from a genetic region
containing a known SNP) is amplified from the individual to be
analyzed and the selected polymorphic site contained therein is
identified using the separation method of the present invention.
The polymorphism is detected by the sequence of the oligomer, and
thus does not require the use of a reference oligomer to determine
the presence of the polymorphism.
[0022] Isolation may be accomplished through any number of methods,
including but not limited to amplification (e.g., PCR) or reverse
transcription, and restriction digestion and purification. HPLC is
performed using a reverse phase column. Such methods provide a
fast, efficient and inexpensive method of direct allelic
discrimination which does not require a positive control to
identify single base polymorphisms.
[0023] It is an object of the present invention to provide methods
for allelic discrimination using direct detection of nucleotide
differences by HPLC analysis of PCR-generated amplicons.
[0024] It is an advantage of the present method that the oligomers
may be rapidly genotyped without the need of a reference
chromosome.
[0025] It is an advantage of the present method that the oligomers
to be analyzed may be isolated using any number of different
methods, including reverse transcription and PCR.
[0026] The invention also provides methods to diagnose and/or
determine prognosis and appropriate treatment methods for a subject
using the methods of the invention. The present methods of
identifying polymorphisms can be used to identity nucleotide
changes associated with a disease state, with a predisposition for
a disease, with a particular prognosis, or with response to a
particular therapeutic treatment.
[0027] It is yet another object of the present invention to detect
polymorphisms to be used as genetic markers and/or diagnostic
tools. This includes polymorphisms in regions of either high or low
mutation, including polymorphisms in regions known to have great
genetic variability across a population, mutations that are
causative of a disorder. The present methods can also be used to
detect very rare somatic mutations.
[0028] In another embodiment, a selected set of one or more single
nucleotide polymorphisms is determined for a given group or
population, and the information stored in a data storage computer
system, e.g., a relational database system.
[0029] The invention also provides the production of polymorphism
databases produced using the present methods. Such databases may be
produced for any number of purposes such as forensic identification
of an individual, linkage analysis, population studies,
epidemiological surveys, and the like.
[0030] These and other objects, advantages, and features of the
invention will become apparent to those persons skilled in the art
upon reading the details of the protocols as more fully described
below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 is a line graph illustrating the impact of heating
and instrument configuration on the resolution of
oligodeoxythymidylic acids: (.diamond-solid.) sample loop and 80-cm
preconditioning coil outside the oven, (.box-solid.) only 80-cm
preconditioning coil in the oven, and (.circle-solid.) both sample
loop and 80-cm preconditioning loop placed inside the oven.
[0032] FIG. 2 is a graph illustrating separation of phosphorylated
homo-oligonucleotides under thermally denaturing conditions.
[0033] FIG. 3 is a graph illustrating the impact of temperature on
the separation efficiency of 16- and 22-mer heterooligonucleotides
that differ in a single base at either the 3'-end or in the center
of the molecule.
[0034] FIG. 4 is a graph showing the effect of temperature on the
resolution of dephosphorylated oligodeoxyadenylic acids and
phosphorylated oligodeoxythymidylic acids. The samples are as
follows: .box-solid., d(A).sub.15/16; .diamond-solid.,
d(A).sub.14/15; .tangle-solidup. pd(T).sub.15/16; and
.circle-solid., d(T).sub.14/15.
[0035] FIG. 5 is a series of Van't Hoff plots illustrating the
dependence of the logarithmic retention factors of
homooligonucleotides. The samples are as follows: .circle-solid.,
pd(T).sub.16; .tangle-solidup., d(T).sub.16; .box-solid.,
pd(A).sub.16; and .diamond-solid., d(A).sub.16.
[0036] FIGS. 6-11 are a series of graphs illustrating the allelic
discrimination of transitions and transversions by high-performance
liquid chromatography under completely denaturing conditions.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0037] Before the present methods are described, it is to be
understood that this invention is not limited to particular methods
described, as such may, of course, vary. It is also to be
understood that the terminology used herein is for the purpose of
describing particular embodiments only, and is not intended to be
limiting, since the scope of the present invention will be limited
only by the appended claims.
[0038] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limits of that range is also specifically disclosed. Each
smaller range between any stated value or intervening value in a
stated range and any other stated or intervening value in that
stated range is encompassed within the invention. The upper and
lower limits of these smaller ranges may independently be included
or excluded in the range, and each range where either, neither or
both limits are included in the smaller ranges is also encompassed
within the invention, subject to any specifically excluded limit in
the stated range. Where the stated range includes one or both of
the limits, ranges excluding either or both of those included
limits are also included in the invention.
[0039] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited.
[0040] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "an amplicon" includes a plurality of such
amplicons and reference to an "SNP" includes reference to one or
more SNPs in a nucleic acid and equivalents thereof known to those
skilled in the art, and so forth.
[0041] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
Definitions
[0042] The terms "reverse phase" and "reverse phase support" as
used herein refer to any stationary support, including the base
material and any chemically bonded phase, for use in high
performance liquid chromatography (HPLC) which is less polar (e.g.,
more hydrophobic) than the starting mobile phase. The term is
intended to encompass a porous and/or a non-porous support
[0043] "Alkylated", "alkylation" and the like as used herein in
reference to the solid support refers to attachment of hydrocarbon
chains to the surface of particles of the solid support, typically
ranging about 3 to 22 carbon atoms in length. The hydrocarbon
chains may be saturated or unsaturated and may optionally contain
additional functional groups attached thereto. The hydrocarbon
chains may be branched or straight chain and may contain cyclic
groups such as cyclopropyl, cyclopropyl-methyl, cyclobutyl,
cyclopentyl, cyclopentylethyl, and cyclohexyl. Typically, an
alkylated solid support refers to an extent of alkylation of the
base material of greater than about 50 percent.
[0044] "Lower alkyl" refers to an alkyl radical of one to six
carbon atoms, as exemplified by methyl, ethyl, n-butyl, i-butyl,
t-butyl, isoamyl, n-pentyl, and isopentyl.
[0045] "Organic solvent" as used herein, refers to a component of
the mobile phase utilized in reverse phase ion pairing HPLC. The
organic solvent, occasionally referred to as an organic modifier,
is any organic (e.g., non-aqueous) liquid suitable for use in the
chromatographic separation methods of the present invention.
Generally, the organic solvent is a polar solvent (e.g., more polar
than the stationary support) such as acetonitrile or methanol.
[0046] "Ion-pair (IP) chromatography" as used herein refers to any
chromatographic method for separating samples in which some or all
of the sample components contain functional groups which are
ionized or are ionizable. Ion-pair chromatography is typically
carried out with a reverse phase column in the presence of an
ion-pairing reagent.
[0047] "Ion-pairing reagent" is a reagent which interacts with
ionized or ionizable groups in a sample to improve resolution in a
chromatographic separation. As used herein, ion-pairing agent
refers to both the reagent and aqueous solutions thereof. An
ion-pairing agent is typically added to the mobile phase in reverse
phase HPLC for optimal separation. The concentration and
hydrophobicity of an ion-pairing agent of choice will depend upon
the number and types (e.g., cationic or anionic) of charged sites
in the sample to be separated.
[0048] The term "polymorphism" as used herein refers to any
detectable polymorpohism in DNA or RNA that is detectable using the
present methods. The term as used herein encompasses, for example,
polymorphisms associated with a disease state (i.e. mutations),
"silent" polymorphisms (i.e. associated with a wild-type phenotype
or in a non-coding region), and polymorphisms associated with a
predisposition and/or response to treatment (i.e. a polymorphism in
an allele of a gene, e.g., apoE). Polymorphisms can be small
deletions, insertions, single nucleotide changes, and the like.
[0049] The terms "single nucleotide polymorphism" and "SNP" refer
to polymorphisms of a single base change.
[0050] The term "genetic region" as used herein refers to a
specific region on a chromosome which may be isolated for detection
of a polymorphism.
[0051] The term "oligomer" as used herein refers to any nucleic
acid, including DNA and RNA, having a plurality of nucleotides. In
the present methods, oligomers for determining nucleotides by HPLC
are preferably less than 1000 nucleotides long, more preferably
less than 500 nucleotides long, and even more preferably are less
than 100 nucleotides long.
[0052] The term "amplicon" as used herein refers to an oligomer
prepared using PCR amplification of a selected genetic region in an
individual.
[0053] The phrase "completely denaturing conditions" as used herein
refer to the conditions under which nucleic acids are analyzed in
the present invention. The term as used encompasses complete to
substantially complete denaturation conditions, i.e. a sufficient
number of nucleic acids are denatured to allow resolution using
HPLC protocols. Preferably, completely denaturing conditions will
provide denaturation of at least 90%, more preferably at least 95%,
and even more preferably at least 99.5% of the nucleic acid
molecules in the sample.
General Aspects Of The Invention
[0054] The present invention is based on the scientific observation
that high-performance liquid chromatography can be used to resolve
single nucleotide changes in single-stranded nucleic acids by
subjecting the nucleic acids to reverse phase HPLC under completely
denaturing conditions. The methods of the invention provide
successful resolution of hetero-oligonucleotides differing only in
a single base, irrespective of the location of the substitution.
The method of the present invention requires only small amounts
(typically less than about 100 nanograms) of sample, yields results
in minutes, utilizes on-line detection, and is adaptable to
complete automation. In addition, the reagents used in the present
techniques are less costly than reagents required for other
techniques such as fluorescent detection of polymorphic
markers.
[0055] The methods of the present invention improve resolution of
oligonucleotides significantly, by maintaining continuous, complete
denaturation of the nucleic acids at temperatures higher than
65.degree. C. throughout the process, e.g., by heating both the
sample loop and the mobile phase of the column to a temperature
sufficient to provide denaturing conditions. For example, both the
sample loop and an 80-cm coil of polyether ether ketone (PEEK)
tubing, through which the mobile phase is run prior to injection,
may be placed in the column oven. Positioning only the coil in the
oven, but not the injection loop, resulted in neither an
improvement nor a decrease in resolution of the oligonucleotides.
See FIG. 1. Resolution of the nucleic acid sequences improved
increasingly with increasing length of the tubing placed between
the injector and the column. The same effect can be obtained by
placing the coil in front of the injector with the sample loop
being mounted inside the oven.
[0056] The observed improvement in the resolution of
oligonucleotides is also reflected in a significant increase in the
number of theoretical plates. The number of theoretical plates
increased from 4.58.times.10.sup.5 to 8.50.times.10.sup.5 and
3.75.times.10.sup.5 to 6.33.times.10.sup.5 plates/m, respectively,
for a phosphorylated and dephosphorylated hexadecamer of
oligodeoxy-thymidylic acid upon increase of the column oven
temperature from 40 to 80.degree. C.
[0057] Using the completely denaturing conditions, it is possible
to resolve oligomers (e.g., oligodeoxy-guanylic acids) that could
not separated previously by means of ion-pair reversed-phase HPLC.
FIG. 2 shows the simultaneous separation of homooligonucleotides in
the size range of 12-18 bases. In agreement with a previous study
of homotetramers (C. G. Huber et al., LC-GC 14 (1996) 114-127), the
homooligomers eluted in the order G<C<A<T. The originally
observed elution order is corroborated by the present study for a
set of four 16-mer heterooligonucleotides differing again in a
single base at the 3'-end. Without being bound to any specific
theory, it can be speculated that retention of isomeric
oligo-nucleotides that exhibit roughly the same degree of
electrostatic interaction with the ion-pairing reagent is
controlled by differences in the hydrophobicity of the bases
located at the 3'-end and by their hydrophobic interaction with the
stationary phase.
[0058] HPLC under completely denaturing conditions can be used for
direct allelic discrimination without prior addition of a known
homozygous reference as is required for high-performance liquid
chromatography under partially denaturing conditions (P. A.
Underhill, et al., Genome Res. 7 (1997) 996-1005; A. Hayward-Lester
et al., in: F. Ferr (Ed.), Gene Quantification, Birkhuser Verlag,
1997, pp. 44-77). A recent study evaluating the use of high-density
oligonucleotide arrays for the purpose of genotyping biallelic
markers observed that only approximately 60% of a total of 487
biallelic markers proved amenable to allelic discrimination by this
approach (R. J. Cho et al., Nature Genet. 23 (1999) 203-207.).
Therefore, the demonstrated ability of HPLC to discriminate
nucleotide level changes constitutes a significant improvement over
other conventional methods in the art. The ability of the ion-pair
reversed-phase HPLC protocols of the present invention to resolve
at elevated column temperatures the single-stranded components of
short PCR products, e.g., even when they differ only in a single
base expands the utility of high-performance liquid chromatography
in genetic studies. Importantly, it also complements the proven
ability of partially denaturing HPLC to detect single-base
mismatches in amplicons as long as 1 kb and constitutes an
inexpensive and readily automated approach to the scoring of
biallelic markers in disease association studies and gene mapping
by means of linkage disequilibrium.
[0059] Preconditioning of Nucleic Acid in a Sample
[0060] The sample to be analyzed is preconditioned prior to
application to the stationary phase to effect complete denaturation
of the nucleic acid molecules within the sample. Denaturation of
the nucleic acids may be provided using methods known to those
skilled in the art, as will be apparent to one skilled in the art
upon reading the present disclosure, and all such methods
compatible with the technique of reverse phase HPLC are intended to
be encompassed by the present application. Two exemplary techniques
for effecting denaturation of nucleic acids, thermal denaturation
and alkaline denaturation, are described herein in more detail.
[0061] Thermal Denaturation
[0062] Preconditioning of the sample using thermal denaturation
generally requires mixture of the sample with an adequately
preheated and/or chemically treated mobile phase that results in
the instantaneous complete denaturation of the nucleic acid in the
sample. The temperature of the sample is preferably at least
65.degree. C. The mobile phase components can be introduced into a
mixer inside the column oven and mixed prior to contact with the
sample. Preferably, the sample is injected into the mobile phase
and pre-equilibrated to the temperature of the column, i.e., a
temperature sufficient to provide complete denaturation of the
nucleic acids in the sample. This allows for a fairly direct
connection between the column and the injector to minimize
diffusion and enhance sample resolution.
[0063] Where a low-pressure HPLC system is used, sample mixing
typically occurs at ambient temperature. In instances in which the
autosampler does not provide for heating, the injection port to
column temperature, standard HPLC tubing (e.g., 0.005-0.01 '
diameter) may be positioned between the injector and the column, to
heat the mobile phase and induce denaturation of the nucleic acid
ion the sample. The tubing is preferably fitted with hardware such
as that made of PEEK or titanium. The length of the tubing is
typically determined based upon the efficiency of heat transfer.
Preferably, the entire length of the pre-column is maintained at
oven temperature. The sample is passed through the pre-column and
then contacted with the stationary phase for subsequent elution.
Detection was achieved using an 80 cm length of heated tubing
between the injector and the column, with the total length
maintained at a column temperature of 70.degree. C. Longer tubing
may also be used to enhance the denaturation by providing a longer
expanse over which the sample is heated.
[0064] The pH of the mobile phase used in thermal denaturation can
vary depending upon the concentrations of various components. For
separation of nucleic acid samples such as RNA or DNA oligomers,
using temperature to denature the nucleic acid, the pH of the
mobile phase is typically maintained between about 7 and 9. For
example, the mobile phase is maintained at a pH around 7.5.
Alternatively, the pH may be increased to ensure the denaturation
of the nucleic acid in the sample.
[0065] The optimal column temperature will in part depend upon the
sequence (base composition) of the sample to be separated, the
choice of stationary phase, the choice of mobile phase, pH, flow
rate, and the like, and in many cases, will be determined
empirically. Ideally, in cases with known sequence, a suitable
column temperature may be calculated that will provide denaturation
of at least 90%, more preferably at least 95%, and even more
preferably at least 99.5% of the nucleic acid molecules in the
sample.
[0066] The composition of the sample sequence to be analyzed also
affects the parameters to be selected for carrying out the
separation method of the invention. For samples containing a
polymorphic site flanked by a GC-rich region, higher temperatures
may be required to detect the polymorphism.
[0067] Thermal denaturation obviates the need to add denaturing
chemicals such as formamide to the sample (M. B. Arghavani et al.,
231 (1995) 201-209) or to work under highly alkaline pH conditions
as shown for the separation of oligonucleotides on a strong
anion-exchanger (W. A. Ausserer and M. L. Biros, BioTechniques 19
(1995) 136-139). In addition, the use of thermal denaturation does
not result in added chemicals to the mobile phase, which is
especially useful if the eluted sample is to be subjected to
additional analysis, e.g., mass spectrometry, since chemical
components used for denaturation or produced during denaturation
(e.g., salt precipitates) may interfere with the procedure of the
subsequent analysis or be detrimental to equipment.
[0068] Denaturation via Alkaline Environment
[0069] Alternatively or in conjunction with thermal denaturation,
the nucleic acid in the sample may be denatured by adjusting the pH
of the sample and/or mobile phase prior to application to the
column. The pH may be adjusted by the addition of a base (e.g.,
sodium hydroxide or urea to a pH of greater than about 9) under
conditions effective to completely denature nucleic acid molecules.
Conditions are chosen that do not degrade the nucleic acids present
in the sample nor adversely affect the integrity of the stationary
phase. When chemical preconditioning of the sample is used, sample
elution may be carried out at lower temperatures, e.g., at or less
than about 50.degree. C., and preferably from about 50.degree. C.
to about 65.degree. C. Alternatively, the altered pH of the mobile
phase may be used in conjunction with heat to ensure complete
denaturation of the product.
[0070] Denaturing High Performance Liquid Chromatography
[0071] High performance liquid chromatography (HPLC) generally
refers to a technique for partitioning a sample or more
specifically the components of a sample between a liquid moving or
mobile phase and a solid stationary phase. In the present
invention, the applicants have discovered a chromatographic method
which utilizes completely denaturing conditions to enable the
identification of single nucleotide differences in a short nucleic
acid irrespective of the position of the nucleotide difference.
[0072] Stationary Phase
[0073] In the method of the present invention, a sample containing
denatured nucleic acid molecules are applied to a stationary phase.
Generally, the stationary phase is a reverse phase material in
which the chemically bonded phase is hydrophobic and is less polar
than the starting mobile phase. Any of a number of commercially
available reverse phase solid supports may be utilized in the
present nucleic acid separation method, although the resolution may
vary depending upon the nature of the sample and other relevant
experimental parameters, as will be apparent to one skilled in the
art upon reading the present disclosure. Reverse phase columns or
column packing materials for use in the invention are typically
composed of alkylated polymeric base materials such as silica
(Eriksson, et al.), cellulose and cellulose derivatives such as
carboxymethylcellulose, alumina, zirconia, polystyrene,
polyacrylamide, polymethylmethacrylate, and styrene copolymers. In
a preferred embodiment, the polymeric base material is a
styrene-divinyl copolymer. Typically, the stationary support is
composed of beads from about 1-100 microns in size.
[0074] The base materials composing the solid support are typically
alkylated. Alkylation of the base material prevents secondary
interactions and can improve the loading of the stationary phase
with the ion-pairing reagent to promote conversion of the solid
support into a dynamic anion-exchanger. Typically, the solid
support is alkylated to possess alkyl groups containing at least 3
carbon atoms, generally between about 3 and 22 carbon atoms, and
preferably contains between about 4 and 18 carbon atoms. The base
material is alkylated to contain at least 50% surface alkyl groups,
and preferably, at least 90% of the surface base material is
covered. The alkylated solid support phase may optionally contain
functional groups for surface modification. The presence or absence
of such functional groups will be dictated by the nature of the
sample to be separated and other relevant operational
parameters.
[0075] Various types of alkylating reagents may be used to alkylate
the polymeric solid support. Alkylation may take place either after
formation of the polymeric beads as described in Example 1 or
before (e.g., by utilizing alkylated monomers to produce alkylated
co-polymer beads). Alkylation may be carried out by any of a number
of synthetic approaches depending upon the base support material to
be alkylated. In an exemplary method for alkylating polymeric base
materials containing aryl groups such as
polystyrene-divinylbenzene, alkylation is carried out using the
Friedel-Crafts reaction, utilizing either tin tetrachloride or
aluminum chloride as the Lewis acid catalyst. Alternatively, one
may utilize commercially available reverse phase supports
containing surface alkyl groups, such as those available from
Hamilton (Reno, Nev.) or Hewlett Packard (Wilmington, Del.).
[0076] A stationary phase for use in the present method may be
either porous or non-porous. A porous stationary phase may contain
more than one type of pore or pore system, e.g., containing
micropores (less than about 50 .ANG.) and/or macropores (greater
than about 1000 .ANG.). The stationary phase will typically have a
surface area of about 2-400 m.sup.2/g, and preferably about 8-20
m.sup.2/g as determined by nitrogen adsorption.
[0077] The separation method of the present invention utilizes
denaturing HPLC, and more specifically, ion-pairing reverse phase
HPLC (IP-RP-HPLC). In carrying out the separation according to the
present method, the aqueous mobile phase contains an ion-pairing
agent and an organic solvent. The selection of aqueous mobile phase
components will vary depending upon the nature of the sample and
the degree of separation desired. Any of a number of mobile phase
components typically utilized in ion-pairing reverse phase HPLC are
suitable for use in the present invention. Several mobile phase
parameters (e.g., pH, organic solvent, ion-pairing reagent and
counterion, elution gradient) may be varied to achieve optimal
separation, as will be apparent to one skilled in the art based on
the present disclosure.
[0078] Ion-pairing reagents for use in the invention are those
which interact with ionized or ionizable groups in a sample to
improve resolution including both cationic and anionic ion-pairing
reagents. Cationic ion-pairing agents for use in the invention
include lower alkyl primary, secondary and tertiary amines, such as
triethylamine (TEA), lower trialkylammonium salts of organic or
inorganic acids such as triethylammonium acetate, and lower
quaternary ammonium salts such as tetrabutylammonium phosphate.
Anionic ion-pairing agents include perfluorinated carboxylic
acids.
[0079] The hydrophobicity of the ion-pairing agent will vary
depending upon the nature of the desired separation. For example,
tetrabutylammonium phosphate is considered a strongly hydrophobic
cation while triethylamine is a weak hydrophobic cationic
ion-pairing reagent. Generally, preferred ion-pairing agents are
cationic in nature. One such preferred ion-pairing agent for use in
the invention is triethylammonium acetate (TEAA).
[0080] The concentration of the ion-pairing agent in the mobile
phase is typically between about 0.05 and 1.0 molar, with a
preferred concentration of about 0.1 molar. Generally, sample
resolution is improved with increasing concentrations of
ion-pairing agent. Trialkylammonium salts appear to be useful for
obtaining good size-based separation for AT-rich sequences.
[0081] Organic solvents for use in the mobile phase are generally
polar solvents such as acetonitrile, methanol, ethanol, ethyl
acetate, and 2-propanol. A preferred solvent is acetonitrile.
[0082] The concentration of the mobile phase components will vary
depending upon the nature of the separation to be carried out. The
mobile phase composition may vary from sample and during the course
of the sample elution. Gradient systems containing two or more
components may be used.
[0083] Samples are typically eluted by starting with an aqueous or
mostly aqueous mobile phase containing an ion-pairing agent and
progressing to a mobile phase containing increasing amounts of an
organic solvent. Any of a number of gradient profiles and system
components may be used to achieve the denaturing conditions of the
present invention. One such exemplary gradient system in accordance
with the invention is a linear binary gradient system composed of
(i) 0.1 molar triethylammonium acetate and (ii) 25% acetonitrile in
a solution of 0.1 molar triethylammonium acetate
[0084] Allelic Discrimination using Denaturing HPLC
[0085] The present methods are especially useful in discriminating
between two or more alleles having distinct polymorphisms without
the need for a reference allele. This is especially useful in the
case where a number of different alleles exist for a particular
locus, as the present invention can distinguish the particular
allele based on the actual sequence of the polymorphism or
polymorphisms.
[0086] Isolation of Nucleic Acid Oligomers
[0087] The nucleic acid oligomers to be evaluated using the methods
of the invention may be isolated using any number of various
techniques available to one skilled in the art. For example, where
it is desirable to detect a polymorphism (e.g., an SNP) in a
specific genetic region, a DNA sample from an individual may be
used as a template for amplification of the genetic region using
the polymerase chain reaction (PCR). This methods will produce an
amplicon that can be tested for the presence of a selected
polymorphism. In another example, a sample may be obtained from
amplification of a selected region of mRNA, e.g., a region of mRNA
that may contain a mutation associated with a disease state.
Suitable templates for a PCR reaction to prepare such an amplicon
include, but are not limited to, DNA isolated from a subject, RNA
isolated from a subject, either total or mRNA, or a cDNA library
prepared from cells or tissue of a subject. The reactions
themselves can be optimized by those skilled in the art based on
variables such as the length of the oligomer to be amplified, the
G-C content of the oligomer to be amplified, the template used, and
the like. See e.g., PCR Strategies, eds. by M. A. Innis, D. H.
Gelfand, J. J. Sninsky and J. I. Sninksy both of which are
incorporated herein by reference.
[0088] In another example, a nucleic acid region of interest can
also be isolated using a technique such as reverse transcription of
RNA. The RNA used as template for the reverse transcriptase may be
preselected (e.g., through oligo-dT selection) or total RNA.
Enzymes that may be used in the reverse transcriptase reaction
include, but are not limited to, commercially available enzymes
such as Avian Myeloblastosis Virus (AMV) Reverse Transcriptase and
MoMLV Reverse Transcriptase.
[0089] In yet another example, a nucleic acid region of interest
may be isolated using a combination and/or modification of reverse
transcription and PCR techniques, such as reverse-transcribed PCR
(RT-PCR). These and other methods are described in detail in The
PCR Technique: RT-PCR (The BioTechniques Update Series)--ed. P. D.
Siebert (1998), which is incorporated herein by reference.
[0090] In yet another example, a nucleic acid region of interest
may be isolated by restriction endonuclease digest and purification
of a selected oligomer containing a polymorphism, e.g., an SNP. The
DNA is optionally enriched prior to the restriction digest (e.g.,
purification of a particular region of a chromosome using a
technique such as pulse-filed gel electrophoresis). DNA is digested
and purified using techniques known in the art (Sambrook et al.,
Molecular Cloning: A Laboratory Manual Cold Spring Harbor
Laboratory Press, Vol. 2 (1989).
[0091] The nucleic acid oligomers to be analyzed using the methods
of the invention are preferably shorter oligomers, e.g.,
oligonucleotides ranging from 2 to 200 nucleotides in length, and
more preferably oligomers from about 40-90. Thus, although the
methods of the invention described herein are described with
respect to and optimized for shorter oligonucleotides, the methods
can be optimized to distinguish single base polymorphisms in longer
oligomers as will be apparent to one skilled in the art upon
reading the present specification.
[0092] The method of the present invention may be enhanced by other
factors that affect resolution of the nucleic acids using HPLC. For
example, the use of nucleotide analogs, such as deoxyinosine or
7-deazaguanine, in the isolation of oligomers may be used to aid in
the elucidation of particular polymorphisms
[0093] Production of Databases Using Methods of the Present
Invention
[0094] The methods of the present invention may be used to generate
a database having data on selected polymorphisms of individuals,
such as subjects affected with a disorder or individuals convicted
of particular crimes. Such databases may be produced using a
variety of different data configurations and processing
capabilities. Examples include, but are not limited to, logical
databases, physical databases, relational databases, central
configuration databases, and the like. For example, the data
generated using the present methods may be used to create a general
database such as that described in U.S. Pat. No. 4,970,672 or a
relational database such as that described in U.S. Pat. No.
5,884,311. Databases containing data generated using the methods of
the invention may also be a central configuration database for data
that is shared among multiprocessor computer systems. See U.S. Pat.
No. 6,014,669. Other database systems and design methodologies can
be found in I. Fogg and M. Orlowska, Computers Math. Applic. (UK),
(1993) 25:97-106; S. Ceri, et al., Proceedings of the IEEE (1987)
75:533-545.
[0095] Utility of the Present Invention
[0096] The methods of the invention have utility in a wide variety
of fields where it is desirable to identify known polymorphisms of
a particular individual and/or to determine allelic distribution in
a group or population. Such methods include, but are not limited
to, linkage analysis for the identification of disease loci,
evolutionary studies to determine rates of evolution in a
population, identification of polymorphisms useful in forensic
identification, identification of mutations associated with a
disease or predisposition, genetic marker development, and the
like.
[0097] The present method facilitates the identification of the
frequency of known genetic markers that are both physically and
genetically mapped. SNPs can be determined for an individual,
without using a comparative control sample, to identify the
individual, e.g. to forensically identify an individual based on
DNA evidence at a crime scene. Specific polymorphic sites may be
quantified in a selected group (e.g., individuals in families with
a history of a genetic disorder) or population (e.g., individuals
of a certain race or ethnicity) to determine the presence of an SNP
in that group or population.
[0098] Using the present denaturing HPLC method, large numbers of
DNA samples can be rapidly and efficiently screened for the
presence or absence of polymorphisms, and only those samples
identified in the pre-screening as possessing polymorphic sites
need be further characterized, typically by conventional sequencing
techniques. Such genomic analysis can be performed using any
genomic nucleic acid material, for example, from mammals, birds,
fish, reptiles, plants, microorganisms, or other organisms of
interest.
[0099] The present method can also be used for forensic
applications such as DNA fingerprinting. DNA fingerprinting
requires the identification of a set of polymorphic loci, selected
so that the probability that two individual DNA samples with
identical haplotypes could by chance come from different
individuals is very low. The method provides an efficient approach
for identifying low mutating polymorphic sites along lengths of
contiguous sequence such that the probability of recombination is
quite low, increasing the likelihood of the preservation of
haplotype information desirable for forensic utilization.
[0100] In addition to analysis of genome diversity, the method of
the present invention can be applied to the analysis of any number
of microorganisms including bacteria, parasites, and other
infectious agents. This may be especially useful in the
determination of a particular strain of an infectious organism,
e.g., the strain of Human Immunodeficiency Virus (HIV) or bacteria
from an infected individual. Determination of the particular
infectious microorganism can aid in prognosis of the disease as
well as in the treatment of the individual, e.g., a particular
strain can determine the aggressiveness of treatment of an infected
individual as well as providing a rational basis for the selection
of a therapeutic regime.
[0101] The method of the present invention can also be applied to
the analysis of any nucleic acid containing entity, including
subcellular organelles such as chloroplasts and mitochondria. Such
methods may be useful for determining disorders associated with
mitochondrial mutations (e.g., ornithine trans-carbamylase
deficiency) or for evolutionary studies involving mutation rates in
organelles, such as mapping of mitochondrial DNA.
[0102] Further, the method of the present invention can also be
used in screening methods for the evaluation of predispositions for
disorders and the use and/or efficacy of therapeutic treatments for
the treatment or prevention of such disorders, e.g. Alzheimer's
disease, Huntington's disease, cancer predisopsitions such as
Li-Fraumeni syndrome, and the like. For example, a specific allele
of the apolipoprotein gene, apoE4, is associated with an increased
risk for development of Alzheimer's disease (M. Kanai et al.,
Neurosci Lett. (1999) 267:65-8; Mirra SS. Hum Pathol. (1999)
30:1125-7). The present method provides an efficient and
inexpensive method for determining the presence or absence of this
allele in an individual, and thus can be predictive of the disease
in an individual. Moreover, certain therapeutic agents may be
particularly effective for an individual having a particular
allele, such as the apoE4 allele, and so identification of the
allele also identifies an individual who is a good candidate for
treatment with a particular therapy.
[0103] Additionally, phylogenetic relationships can be established
by the method of the present invention. Phylogenetic analysis can
be carried out with almost any selected genomic sequence, such as,
glycolytic enzymes (like phosphoglycerate kinase (Vohra, et al.))
or rRNA sequences. Phylogenetic relationships between plants can be
established, using, for example, sequences derived from plastid
ribosomal RNA operons (Wolfe, et al.).
[0104] Use of the Present Method in Concert with Other
Techniques
[0105] The methods of the present invention can also be used in
concert with other protocols for detecting, isolating and/or
analyzing polymorphisms or other attributes of nucleic acids.
Exemplary protocols for use with the present invention include
isolation of heteroduplex molecules using HPLC and analysis of
nucleic acid fragments using mass spectrometry, both of which are
described briefly below.
[0106] Use of the Invention in Concert with Heteroduplex
Identification by HPLC
[0107] The present methods complement other protocols to allow low
cost analysis of biallelic markers in hundreds of samples. For
example, the present methods can be used in conjunction with the
detection of SNPs by DHPLC (see U.S. Pat. No. 5,795,976) to isolate
and analyze a large number of new SNPs in a fast, efficient and
inexpensive manner. This methods involves separating heteroduplex
and homoduplex nucleic acid molecules (e.g., DNA or RNA) in a
mixture using high performance liquid chromatography under
partially denaturing conditions. This method provides a fast and
effective method for identifying new polymorphisms, including SNPs.
Once these polymorphisms are identified, the methods of the present
invention can be used to detect the newly identified polymorphism
in large numbers of samples.
[0108] Use of the Invention in Concert with Mass Spectrometry
[0109] Mass spectrometry can be used in conjunction with the
methods of the present invention to verify a polymorphism and/or to
identify additional polymorphisms. The mass spectrum of an oligomer
can be obtained is compared to the mass spectrum of fragments
obtained from known samples of either wild-type genes or genes
containing the known mutation. These known spectra are referred to
as "signature" spectra. A simple comparison of the sample spectrum
vs. signature spectra will reveal whether the patient's DNA
contains a mutation. Although sequencing of fragments of nucleic
acids is possible using mass spectrometry, actual sequencing of the
nucleic acid is not required for this mutational analysis. Less
preparation and analysis is needed to prepare and analyze a
complete, intact fragment as compared to treating a sample for
actual sequencing.
[0110] Certain mass spectrometry techniques can be used to analyze
for polymorphisms. Short oligomers, e.g., from one nucleotide up to
approximately 50 nucleotides, can be analyzed and the resulting
spectra compared with signature spectra of samples known to be
wild-type or to contain a known polymorphism. A comparison of the
locations (mass) and heights (relative amounts) of peaks in the
sample with the known signature spectra indicate what type of
polymorphism, if any, is present. Exemplary protocols are described
in U.S. Pat Nos. 5,872,003, 5,869,242, 5,851,765 5,622,824, and
5,605, 798, which are incorporated herein by reference for teaching
such techniques.
[0111] Use of the Present Method to Produce a Database for SNPs
[0112] A need remains for a general catalog of genome variation to
address the large-scale sampling designs required by association
studies, gene mapping, and evolutionary biology. There is
widespread interest in documenting the amount and geographic
distribution of genetic variation in the human species. This
information is desired by the biomedical community, who want a
densely packed map of SNP (single nucleotide polymorphism) sites to
be used to identify genes associated with disease by linkage
disequilibrium between sets of adjacent markers and the occurrence
of disease in populations, and to characterize disease-related
variation among populations.
[0113] Anthropologists and archeologists use genetic variation to
reconstruct our species' history, and to understand the role of
culture and geography in the global distribution of human
variation. The requirements for these two perspectives seem to be
converging on a need for an accessible, representative DNA bank and
statistical database of human variation.
[0114] In addition, these systems have potential in both routine
forensic and intelligence database applications, either in place of
or in conjunction with more traditional "DNA fingerprinting"
databases produced using methods such as restriction fragment
length polymorphism mapping.
EXAMPLES
[0115] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Centigrade, and
pressure is at or near atmospheric.
Example 1
Initial Detection of SNPs Using Thermal Denaturation
[0116] Initial experiments to evaluate the effect of temperature on
the separation of oligonucleotides were performed using HPLC on a
chromatograph consisting of an on-line vacuum degassing system
(Alltech, Deerfield, Ill.), an automatic sampling system equipped
with a biocompatible injection valve and a 20-.mu.L Titanium sample
loop (Model AS-100 T HRLC.RTM., Bio-Rad, Hercules, Calif.), a high
precision low pressure gradient pump (Model 480, Gynkotek,
Germering, Germany), a column oven (Model CH-150, Eldex), a UV-VIS
detector (Model Spectra 100, Thermo Separation Products, Riviera
Beach, Fla.), a multichannel interface (Dual Channel Interface HP
35900E, Hewlett Packard, Mountain View, Calif.), and a PC-based
data system (G1304A, Version A.02.05, Hewlett Packard). For the
preheating of the mobile phase, an 80-cm PEEK tubing, 0.01-inch
I.D., which had been encased in a tin-alloy block (Part No. 330-HX,
Timberline, Inc., Boulder, Colo.), was used.
[0117] The column and conditions used for identifying SNPs was as
follows: DNASep.TM., 50.times.4.6 mm I.D.; mobile phase: 0.1 M
TEAA, pH 7.0; linear gradient: 3.75-6.25% acetonitrile in 15 min;
flow-rate: 1 ml/min; temperature: 50 to 80.degree. C.; detection:
UV, 254 nm; sample: 16 and 22 mer oligonucleotides, 0.15 .mu.g
each. Peak identification was determined for the nuclewotides
underlined below as follows:
1TABLE 1 Sequences Used For Initial Detection of SNPs Under
Thermally Denaturing Conditions c, TCCATGAATCACTCCC; (SEQ ID NO:1)
g, TCCATGAATCACTCCG; (SEQ ID NO:2) a, TCCATGAATCACTCCA; (SEQ ID
NO:3) t, TCCATGAATCACTCCT; (SEQ ID NO:4) G, GTGCTCAGTGTGGCCCAGGATC;
(SEQ ID NO:5) C, GTGCTCAGTGTCGCCCAGGATC; (SEQ ID NO:6) A,
GTGCTCAGTGTAGCCCAGGATC; (SEQ ID NO:7) T, GTGCTCAGTGTTGCCCAGGATC;
(SEQ ID NO:8)
[0118] Notably, resolution of the latter two oligonucleotides (SEQ
ID NOS: 7 and 8) improves significantly with an increase in column
temperature from 50 to 80.degree. C., while that of the former two
(SEQ ID NOS: 5 and 6) decreases slightly. More importantly, an
increase in column temperature allowed the almost complete baseline
resolution of four isomeric heterooligonucleotides identical in
sequence except for a single base substitution at the 12th
nucleotide from the 5'-end (FIG. 3). At present, it remains unclear
why the elution order of the latter set of heterooligonucleotides
(SEQ ID NOS: 5 through 8) corresponded to that of
homooligonucleotides (see FIG. 2), while substitution of the base
at the 3'-end results in a reversal of the elution order of
cytosine and guanine.
Example 2
Determination of Effect of Thermal Denaturation on HPLC
Resolution
[0119] In order to determine the impact of heating on the
resolution of oligonucleotides using HPLC, a number of different
oligonucleotides having varying sequences were analyzed. The
sequences investigated are listed as follows in Table 1.
2TABLE 1 List of sequences amplified to genotype the
single-nucleotide polymorphisms given in brackets. Priming sites
are written in lower case. SNP No. 5'-3' Amplicon size SNP1
aaaccacattctgagcatacccCC[C/A]AAAAATTtcatgccgaagctgtggtc 51 bp (SEQ
ID NOS: 9 AND 10) SNP2
caacttaatcagatttaggacacaaaagc[A/T]actacataatgaaaaagagagctggtga 58
bp (SEQ ID NOS: 11 AND 12) SNP3
gaaacggcctaagatggttgaaT[G/C]ctctttatttttctttaatttagacatgttcaaa 58
bp (SEQ ID NOS: 13 AND 14) SNP4
gactttttgtacccaccatttgtGGAACTAAATT[A/G]Tatcagtacaaaaagggctacattc 60
bp (SEQ ID NDS: 15 AND 16) SNP5
agacagttcttcaggaaaacaccT[C/T]CTTTGGACTCACAccatgtgttttccattcaaatta
61 bp (SEQ ID NOS: 17 AND 18) SNP6
cccaaacccattttgatgctT[G/T]ACTTAAaaggtcttcaattattattttcttaaatattttg
62 bp (SEQ ID NOS: 19 AND 20) SNP7
ccattgaggaacaacatacagcTTCTGTTCG[G/A]cctcggctgtgggctc 48 bp (SEQ ID
NO: 21 AND 22) SNP8 aataaacctttacggggctaagcCT[C/T-
]agacctgcaagctgcttgttatag 50 bp (SEQ ID NO: 23 AND 24) SNP9
agacatctgactcccagcatgaa[C/T]GGTCccaactcctctctaacaaaaggtaa 53 bp
(SEQ ID NO: 25 AND 26) SNP10
tttgttcatacggtcaatattcgat[A/T]CTCTCAGtcctcactgctggtccttacg 54 bp
(SEQ ID NOS: 27 AND 28) SNP11 cgaaaaagaagatggtgagttcacTT-
TT[T/C]acctcaataaaaccctttacataaa 54 bp (SEQ ID NOS: 29 AND 30)
SNP12 gctccatttgaaggttctataactgAAACTAGAATAC[C/A]TAAgctatggg-
gaactaaa 65 bp ctctgaat (SEQ ID NOS: 31 AND 32) SNP13
gataagccatatgatccagcaggATTATTCCTTTTAC[C/T]GTTTAATTAgtcgtagat 73 bp
actcaagacagaccgt (SEQ ID NOS: 33 AND 34) SNP14
tgtcctttagtttctatttggttttATATATTATCATATGAACTATAAAGAAG[G/A]Tt 79 bp
gaagcaaagaacagccaaataat (SEQ ID NOS: 35 AND 36) SNP15
tggagtatttctctagcttgctgAAATAATG[C/G]CAAATTTTATAATATGATA- CTAGCAA 94
bp CACAAATATTTAgctaaaattacgttgcattaaaaa (SEQ ID NOS: 37 AND 38)
[0120] The position and chemical nature of the SNP are given in
brackets and the priming sites are written in lower case. All
oligonucleotide primers were obtained from Life Technologies
(Rockville, Md., USA). Phosphorylated and dephosphorylated
oligodeoxyadenylic acids, oligodeoxycytidylic acids,
oligodeoxyguanylic acids and oligodeoxythymidylic acids, 12-18
bases in length, were purchased from Amersham Pharmacia Biotech,
Inc. (Piscataway, N.J., USA). All PCR reagents and 2M triethylamine
acetate buffer were obtained from PE Biosystems, Foster City,
Calif., USA. HPLC grade acetonitrile was purchased from J. T. Baker
(Phillipsburg, N.J., USA), tetrasodium ethylenediamine-tetraacetic
acid from Sigma (St. Louis, Mo., USA).
[0121] Polymerase chain reactions for isolation of each of the
oligonucleotides were performed in a 50 .mu.l volume containing 10
mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl.sub.2, 50 .mu.M dNTPs,
0.2 .mu.M of each primer, 50 ng of genomic human DNA, and 1 unit of
AmpliTaq Gold. The PCR cycling regime carried out in a Perkin-Elmer
9600 thermal cycler comprised an initial denaturation step at
95.degree. C. for 10 min to activate AmpliTaq Gold. Subsequent
denaturing steps were 94.degree. C. for 20 s and extension steps of
72.degree. C. for 60 s; annealing temperatures were lowered over
the first 14 cycles in 0.5.degree. C. decrements from 63-56.degree.
C., followed by 20 cycles at 56.degree. C. for 45 s each. Following
a final extension step at 72.degree. C. for 10 min, samples were
chilled to 6.degree. C. and stored in a refrigerator until HPLC
analysis.
[0122] Each oligonucleotide pair was anaylzed using denaturing
HPLC. The stationary phase consisted of 2-.mu.m nonporous alkylated
poly(styrene-divinylbenzene) particles packed into 50.times.4.6-mm
ID columns, which are commercially available (DNASep.TM.,
Transgenomic, San Jose, Calif., USA). The mobile phase was 0.1 M
triethylammonium acetate buffer (TEAA) at pH 7.0, containing in
addition 0.1 mM Na.sub.4EDTA. Crude PCR products were eluted with a
linear acetonitrile gradient at a flow-rate of 0.8-1.0 ml/min. The
start- and end-points of the gradient were adjusted according to
the size of the single-stranded DNA sequences.
[0123] Intra- and intermolecular interactions were also observed in
the case of oligodeoxyadenylic acids, although they have been
reported to be significantly less than those of guanine-rich
sequences (F. Aboul-ela et al., Nucl. Acids Res. 13 (1985)
4811-4824). This explains why in contrast to oligothymidylic acids,
which have not been observed to interact with each other, no linear
increase in resolution is observed with increasing temperature for
oligodeoxyadenylic acids (FIG. 4). Only at temperatures above
70.degree. C. a resolution similar to that of oligodeoxythymidylic
is obtained. This applies to both phosphorylated and
dephosphorylated oligonucleotides.
[0124] Intra- and intermolecular interactions also explain the
non-linear reaction isochores observed in Van't Hoff plots for
oligodeoxyadenylic acids (FIG. 5) (Due to intra- and intermolecular
interactions oligodeoxyadenylic acids do not yield linear reaction
isochores. The respective adsorption enthalpies for d(T).sub.16 and
pd(T).sub.16 in 7.25 acetonitrile were -81.44 kJ mol.sup.-1 and
-59.36 kJ mol.sup.-1). In contrast, linear isochores were obtained
for phosphorylated and dephosphorylated oligodeoxythymidylic acids
the geometry of which does not allow the formation of atypical
Watson-Crick base pairs (F. Aboul-ela et al., Nucl. Acids Res. 13
(1985) 4811-4824). The plots clearly demonstrate the dependence of
the logarithmic retention factors of d(T).sub.16 and pd(T).sub.16
on the reciprocal absolute temperature. In a mobile phase of 100 mM
TEAA, pH 7, and 7.25% acetonitrile the adsorption enthalpies of the
two oligodeoxythymidylic acids were determined to be -81.44 kJ
mol.sup.-1 and -59.36 kJ mol.sup.-1, respectively. Similar
adsorption enthalpies were determined for the two phosphorylated
18-mer heterooligonucleotides 5'TGTAAAACGACGGCCAGT (SEQ ID NO:39)
and 5'CAGGAAACAGCTATGACC (SEQ ID NO:40), that were also found to
yield linear reaction isochores. The respective values in 100 mM
TEAA and 5.25% acetonitrile were -65.23 kJ mol.sup.-1 and 63.80 kJ
mol.sup.-1. This indicates that phosporylation at the 5'-base has
the greatest effect on the enthalpies due to the hindered
hydrophobic interaction between the former and the column matrix.
The difference in adsorption enthalpies between d(T).sub.16 and
pd(T).sub.16 amounts to>25%.
Example III
Allelic Discrimination by Denaturing HPLC
[0125] In order to evaluate the feasibility of using denaturing
HPLC for genotyping short amplicons, the primers of which flank the
polymorphic site of interest and the bases in its immediate
vicinity, a number of amplicons 51-62 bp in size (SNP 1-6) were
generated (FIGS. 6-11). They contained biallelic sites of different
chemical nature, specifically the two transitions C.fwdarw.T and
A.fwdarw.G, as well as the four transversions C.fwdarw.A,
C.fwdarw.G, T.fwdarw.A, and T.fwdarw.G. The protocols used for PCR
and HPLC analysis were the same as for Example II, except that the
temperatures used for denaturation were 75.degree. C. for SNPI,
70.degree. C. for SNP2, and 80.degree. C. for SNP3-6.
[0126] The void peak comprises unincorporated nucleotides and
excess primers. The peak eluting at approximately 4 minutes is a
system peak. It is apparent that all but the C.fwdarw.G
transversion could be discriminated successfully. Particularly
striking is the case of the T.fwdarw.A transversion, which cannot
be discriminated by assays such as T.sub.m-shift genotyping (D. Y.
Wu et al., Proc. Natl. Acad. Sci. USA 86 (1989) 2757-2760) because
the substitution only results in the replacement of a T.fwdarw.A in
one chromosome to A.fwdarw.T in the other chromosome. This
surprising observation may be attributed to the fact that retention
in HPLC is governed not only by the substituted base but also by
the immediate sequence context. Further, as expected, the
complementary strands of an amplicon are usually resolved well,
resulting in the observation of usually two peaks in case of a
homozygous sample, and four peaks in case of a heterozygous
sample.
[0127] As evident from FIGS. 6-11, temperature can be used to
optimize resolution. For instance, two isomeric single-stranded DNA
molecules that differ in a single adenine or thymine are resolved
somewhat better at a lower temperature, e.g., 70.degree. C. (SNP2).
Other mismatches are discriminated more clearly at 80.degree. C.
Generally, even an amplicon very rich in GC base pairs will be
denatured completely at 70.degree. C. due to the presence of
acetonitrile in the mobile phase. Only the C.fwdarw.G transversions
investigated, namely SNP3, were not as successfully genotyped,
although partial resolution was observed at a concentration of 50
mM triethylammonium acetate in the mobile phase. Use of a different
ion-pairing reagent and other modifications to the protocol may be
used to provide the successful allelic discrimination of C.fwdarw.G
transversions by HPLC.
[0128] In order to assess the reproducibility of elution profiles,
we repeated the genotyping of SNP2 and SNP614 and 17 times,
respectively. The coefficients of variation for the absolute
retention times of the four major product peaks ranged from
0.4-0.6% for SNP2 and 0.3-0.4% for SNP6, respectively. An even more
reliable measure is the ratio of the retention times of the two
complementary strands.
[0129] In case of SNP2, the ratios for allele A and allele T were
0.794.+-.0.003 (mean.+-.LSD, CV=0.39%) and 0.814.+-.0.003
(CV=0.41%), respectively, with the values ranging from 0.787-0.797
and 0.806-8.818, respectively. Comparing the two means of the
ratios of retention times using a t-test, they were found to differ
significantly from each other (t.sub.s=17.638,
t.sub.0001[26]=3.707). The same was true for SNP6: the arithmetic
means and standard deviations for the T allele and G allele were
0.845.+-.10.002 (0.842-0.850, CV=0.27%) and 0.857.+-.0.002
(0.853-0.860, CV=0.22%), respectively. Again, the t-test was highly
significant (t.sub.s=17.493, t.sub.001[32].apprxeq.3.6). The high
reproducibility of retention times also corroborates the excellent
chemical and physical stability of poly(styrene-divinylbenzene)
particles at high temperature with more than 600 analyses having
been performed over a period of 10 days without any noticeable
deterioration in separation efficiency.
[0130] Ultimately, it would be advantageous to couple HPLC to mass
spectrometry to confirm the identity of the peaks. Past problems
with the use of triethylammonium acetate that was found to reduce
drastically ion formation during electrospray ionization have been
overcome recently by replacing it with triethylammonium bicarbonate
without affecting the proven separation efficiency of ion-pair
reversed-phase HPLC. Further, in combination with acetonitrile
added as a sheath liquid to the column effluent, analyte
detectability in the femtomol range has been accomplished for even
large oligonucleotides (C. G. Huber and A. Krajete, Anal. Chem. 71
(1999) 3730-3739).
[0131] In addition to the 6 SNPs depicted in FIGS. 6-11, we tested
nine SNPs (SNP 7-15) for which genotyping information had been
obtained recently by dye terminator sequencing. The HPLC based
genotyping results were found to be in complete accordance with
those determined by sequencing (except SNP 15 that could not be
genotyped at all because of the nature of the substitution).
[0132] While the present invention has been described with
reference to the specific embodiments thereof, it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adapt a particular situation,
material, composition of matter, process, process step or steps, to
the objective, spirit and scope of the present invention. All such
modifications are intended to be within the scope of the claims
appended hereto.
Sequence CWU 1
1
40 1 16 DNA Artificial Sequence synthetic oligonucleotide 1
tccatgaatc actccc 16 2 16 DNA Artificial Sequence synthetic
oligonucleotide 2 tccatgaatc actccg 16 3 16 DNA Artificial Sequence
synthetic oligonucleotide 3 tccatgaatc actcca 16 4 16 DNA
Artificial Sequence synthetic oligonucleotide 4 tccatgaatc actcct
16 5 22 DNA Artificial Sequence synthetic oligonucleotide 5
gtgctcagtg tggcccagga tc 22 6 22 DNA Artificial Sequence synthetic
oligonucleotide 6 gtgctcagtg tcgcccagga tc 22 7 22 DNA Artificial
Sequence synthetic oligonucleotide 7 gtgctcagtg tagcccagga tc 22 8
22 DNA Artificial Sequence synthetic oligonucleotide 8 gtgctcagtg
ttgcccagga tc 22 9 51 DNA Artificial Sequence synthetic
oligonucleotide 9 aaaccacatt ctgagcatac cccccaaaaa tttcatgccg
aagctgtggt c 51 10 51 DNA Artificial Sequence synthetic
oligonucleotide 10 aaaccacatt ctgagcatac ccccaaaaaa tttcatgccg
aagctgtggt c 51 11 58 DNA Artificial Sequence synthetic
oligonucleotide 11 caacttaatc agatttagga cacaaaagca actacataat
gaaaaagaga gctggtga 58 12 58 DNA Artificial Sequence synthetic
oligonucleotide 12 caacttaatc agatttagga cacaaaagct actacataat
gaaaaagaga gctggtga 58 13 58 DNA Artificial Sequence synthetic
oligonucleotide 13 gaaacggcct aagatggttg aatgctcttt atttttcttt
aatttagaca tgttcaaa 58 14 58 DNA Artificial Sequence synthetic
oligonucleotide 14 gaaacggcct aagatggttg aatcctcttt atttttcttt
aatttagaca tgttcaaa 58 15 60 DNA Artificial Sequence synthetic
oligonucleotide 15 gactttttgt acccaccatt tgtggaacta aattatatca
gtacaaaaag ggctacattc 60 16 60 DNA Artificial Sequence synthetic
oligonucleotide 16 gactttttgt acccaccatt tgtggaacta aattgtatca
gtacaaaaag ggctacattc 60 17 61 DNA Artificial Sequence synthetic
oligonucleotide 17 agacagttct tcaggaaaac acctcctttg gactcacacc
atgtgttttc cattcaaatt 60 a 61 18 61 DNA Artificial Sequence
synthetic oligonucleotide 18 agacagttct tcaggaaaac accttctttg
gactcacacc atgtgttttc cattcaaatt 60 a 61 19 62 DNA Artificial
Sequence synthetic oligonucleotide 19 cccaaaccca ttttgatgct
tgacttaaaa ggtcttcaat tattattttc ttaaatattt 60 tg 62 20 62 DNA
Artificial Sequence synthetic oligonucleotide 20 cccaaaccca
ttttgatgct ttacttaaaa ggtcttcaat tattattttc ttaaatattt 60 tg 62 21
48 DNA Artificial Sequence synthetic oligonucleotide 21 ccattgagga
acaacataca gcttctgttc ggcctcggct gtgggctc 48 22 48 DNA Artificial
Sequence synthetic oligonucleotide 22 ccattgagga acaacataca
gcttctgttc gacctcggct gtgggctc 48 23 50 DNA Artificial Sequence
synthetic oligonucleotide 23 aataaacctt tacggggcta agcctcagac
ctgcaagctg cttgttatag 50 24 50 DNA Artificial Sequence synthetic
oligonucleotide 24 aataaacctt tacggggcta agccttagac ctgcaagctg
cttgttatag 50 25 53 DNA Artificial Sequence synthetic
oligonucleotide 25 agacatctga ctcccagcat gaacggtccc aactcctctc
taacaaaagg taa 53 26 53 DNA Artificial Sequence synthetic
oligonucleotide 26 agacatctga ctcccagcat gaatggtccc aactcctctc
taacaaaagg taa 53 27 54 DNA Artificial Sequence synthetic
oligonucleotide 27 tttgttcata cggtcaatat tcgatactct cagtcctcac
tgctggtcct tacg 54 28 54 DNA Artificial Sequence synthetic
oligonucleotide 28 tttgttcata cggtcaatat tcgattctct cagtcctcac
tgctggtcct tacg 54 29 54 DNA Artificial Sequence synthetic
oligonucleotide 29 cgaaaaagaa gatggtgagt tcacttttta cctcaataaa
accctttaca taaa 54 30 54 DNA Artificial Sequence synthetic
oligonucleotide 30 cgaaaaagaa gatggtgagt tcacttttca cctcaataaa
accctttaca taaa 54 31 65 DNA Artificial Sequence synthetic
oligonucleotide 31 gctccatttg aaggttctat aactgaaact agaataccta
agctatgggg aactaaactc 60 tgaat 65 32 65 DNA Artificial Sequence
synthetic oligonucleotide 32 gctccatttg aaggttctat aactgaaact
agaatacata agctatgggg aactaaactc 60 tgaat 65 33 73 DNA Artificial
Sequence synthetic oligonucleotide 33 gataagccat atgatccagc
aggattaatt ccttttaccg tttaattagt cgtagatact 60 caagacagac cgt 73 34
73 DNA Artificial Sequence synthetic oligonucleotide 34 gataagccat
atgatccagc aggattaatt ccttttactg tttaattagt cgtagatact 60
caagacagac cgt 73 35 79 DNA Artificial Sequence synthetic
oligonucleotide 35 tgtcctttag tttctatttg gttttatata ttatcatatg
aactataaag aaggttgaag 60 caaagaacag ccaaataat 79 36 79 DNA
Artificial Sequence synthetic oligonucleotide 36 tgtcctttag
tttctatttg gttttatata ttatcatatg aactataaag aagattgaag 60
caaagaacag ccaaataat 79 37 94 DNA Artificial Sequence synthetic
oligonucleotide 37 tggagtattt ctctagcttg ctgaaataat gccaaatttt
ataatatgat actagcaaca 60 caaatattta gctaaaatta cgttgcatta aaaa 94
38 94 DNA Artificial Sequence synthetic oligonucleotide 38
tggagtattt ctctagcttg ctgaaataat ggcaaatttt ataatatgat actagcaaca
60 caaatattta gctaaaatta cgttgcatta aaaa 94 39 18 DNA Artificial
Sequence synthetic oligonucleotide 39 tgtaaaacga cggccagt 18 40 18
DNA Artificial Sequence synthetic oligonucleotide 40 caggaaacag
ctatgacc 18
* * * * *