U.S. patent application number 09/850165 was filed with the patent office on 2002-10-17 for recombinant antibodies for human therapy.
This patent application is currently assigned to IDEC Pharmaceuticals Corporation. Invention is credited to Hanna, Nabil, Newman, Roland A., Raab, Ronald W..
Application Number | 20020150580 09/850165 |
Document ID | / |
Family ID | 27503174 |
Filed Date | 2002-10-17 |
United States Patent
Application |
20020150580 |
Kind Code |
A1 |
Newman, Roland A. ; et
al. |
October 17, 2002 |
Recombinant antibodies for human therapy
Abstract
Chimeric antibodies including an Old World monkey portion and a
human portion, nucleic acid encoding such antibodies, Old World
monkey monoclonal antibodies, and methods for their production and
use.
Inventors: |
Newman, Roland A.; (San
Diego, CA) ; Hanna, Nabil; (Olivenhain, CA) ;
Raab, Ronald W.; (San Diego, CA) |
Correspondence
Address: |
PILLSBURY WINTHROP, LLP
P.O. BOX 10500
MCLEAN
VA
22102
US
|
Assignee: |
IDEC Pharmaceuticals
Corporation
San Diego
CA
|
Family ID: |
27503174 |
Appl. No.: |
09/850165 |
Filed: |
May 8, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09850165 |
May 8, 2001 |
|
|
|
09082472 |
May 21, 1998 |
|
|
|
09082472 |
May 21, 1998 |
|
|
|
08476237 |
Jun 7, 1995 |
|
|
|
5756096 |
|
|
|
|
08476237 |
Jun 7, 1995 |
|
|
|
08397072 |
Apr 17, 1995 |
|
|
|
08397072 |
Apr 17, 1995 |
|
|
|
07912292 |
Jul 10, 1992 |
|
|
|
07912292 |
Jul 10, 1992 |
|
|
|
07856281 |
Mar 23, 1992 |
|
|
|
07856281 |
Mar 23, 1992 |
|
|
|
07735064 |
Jul 25, 1991 |
|
|
|
Current U.S.
Class: |
424/154.1 ;
435/320.1; 435/326; 435/69.1; 530/388.8; 536/23.53 |
Current CPC
Class: |
C07K 2317/21 20130101;
C07K 16/462 20130101; C07K 16/2821 20130101; A61K 2039/505
20130101; C07K 16/00 20130101; C07K 2319/00 20130101; C07K 16/2812
20130101; C07K 2317/24 20130101; C07K 16/461 20130101; A61K 38/00
20130101; C07K 16/28 20130101 |
Class at
Publication: |
424/154.1 ;
530/388.8; 435/69.1; 435/326; 435/320.1; 536/23.53 |
International
Class: |
A61K 039/395; C07H
021/04; C12P 021/02; C12N 005/06; C07K 016/30 |
Claims
What is claimed is:
1. A recombinant antibody comprising a human, a chimpanzee or a
first Old World monkey immunoglobulin constant region and an
antigen-binding portion of a second Old World monkey immunoglobulin
variable region; wherein said first and second Old World monkey can
be the same or different.
2. A recombinant antibody comprising an immunoglobulin heavy or
light chain having specificity for a particular known antigen
having a constant region homologous to a corresponding constant
region of a human, chimpanzee or first Old World monkey antibody, a
framework region homologous to a corresponding human, chimpanzee or
second Old World monkey framework region, and an antigen-binding
portion homologous to a third Old World monkey antigen-binding
portion, wherein said first, second, and third Old World monkey can
be the same or different.
3. A recombinant antibody comprising an immunoglobulin constant
region which is not immunogenic to a human, a framework region
which is essentially not immunogenic to a human, and an
antigen-binding portion of a first Old World monkey immunoglobulin
variable region.
4. The antibody of claim 1, 2 or 3 wherein said antibody binds
specifically to a human antigen.
5. The antibody of claim 3 wherein said constant region is
homologous to a constant region of a human, a chimpanzee or a
second old World monkey immunoglobulin constant region, wherein
said first and second Old World monkey can be the same or
different.
6. The antibody of claim 3 wherein said framework region is
homologous to a human, chimpanzee or Old World monkey framework
region.
7. The antibody of claim 1, 2 or 3 wherein one said Old World
monkey is a Rhesus monkey.
8. The antibody of claim 1, 2 or 3 wherein one said Old World
monkey is a cynomolgus monkey.
9. The antibody of claim 1, 2, or 3 wherein one said Old World
monkey is a baboon.
10. A recombinant antibody comprising a first Old World monkey
immunoglobulin constant region and a second antigen-binding portion
of a different Old World monkey immunoglobulin variable region.
11. The antibody of claim 10, wherein said antibody binds
specifically to a human antigen.
12. The antibody of claim 1, 2, 3, 5, 6, 10 or 11 wherein said
antibody binds specifically to human antigens chosen from CD58,
VCAM, VLA4, CD2, LFA3, ELAM, LAM, CD25, CD4, CD19, CD20, CD23,
CD41, CD44, CD54, TNF.alpha., TNF.beta., Tn antigen, IL-1, IL-8,
human T-cell receptor, CD3, CD28, CD8, CD11a, CD11b, CD18, CD5a,
CD11c, CD45, neu oncogene product, MDR-1, TGF.alpha., TGF.alpha.
receptor, PDGF, and CD71.
13. The antibody of claim 4 wherein said antibody binds
specifically to human antigens chosen from CD58, VCAM, VLA4, CD2,
LFA3, ELAM, LAM, CD25, CD4, CD19, CD20, CD23, CD41, CD44, CD54,
TNF.alpha., TNF.beta., Tn antigen, IL-1, IL-8, human T-cell
receptor, CD3, CD28, CD8, CD11a, CD11b, CD11c, CD18, CD5a, CD45,
neu oncogene product, MDR-1, TGF.alpha., TGF.alpha. receptor, PDGF,
and CD71.
14. The antibody of claim 7 wherein said antibody binds
specifically to human antigens chosen from CD58, VCAM, VLA4, CD2,
LFA3, ELAM, LAM, CD23, CD25, CD4, CD19, CD20, CD41, CD44, CD54,
TNF.alpha., TNF.beta., Tn antigen, IL-1, IL-8, human T-cell
receptor, CD3, CD28, CD8, CD11a, CD11b, CD11c, CD18, CD5a, CD45,
neu oncogene product, MDR-1, TGF.alpha., TGF.alpha. receptor, PDGF,
and CD71.
15. The antibody of claim 8 wherein said antibody binds
specifically to human antigens chosen from CD58, VCAM, VLA4, CD2,
LFA3, ELAM, LAM, CD23, CD25, CD4, CD19, CD20, CD41, CD44, CD54,
TNF.alpha., TNF.beta., Tn antigen, IL-1, IL-8, human T-cell
receptor, CD3, CD28, CD8, CD11a, CD11b, CD11c, CD18, CD5a, CD45,
neu oncogene product, MDR-1, TGF.alpha., TGF.alpha. receptor, PDGF,
and CD71.
16. The antibody of claim 9 wherein said antibody binds
specifically to human antigens chosen from CD58, VCAM, VLA4, CD2,
LFA3, ELAM, LAM, CD25, CD4, CD19, CD20, CD23, CD41, CD44, CD54,
TNF.alpha., TNF.beta., Tn antigen, IL-1, IL-8, human T-cell
receptor, CD3, CD28, CD8, CD11a, CD11b, CD11c, CD18, CDSA, CD45,
neu oncogene product, MDR-1, TGF.alpha., TGF.alpha. receptor, PDGF,
and CD71.
17. The antibody of claim 10 wherein each said Old World monkey is
selected from the group consisting of baboon, Rhesus, and
cynomolgus monkeys.
18. The antibody of claim 1, 2 or 3 wherein said antigen-binding
portion comprises one or more CDR regions of an Old World monkey
variable region.
19. The antibody of claim 1, 2 or 3 wherein said antigen-binding
portion comprises the whole variable region of an Old World
monkey.
20. Nucleic acid encoding a recombinant antibody comprising a first
Old World monkey immunoglobulin antigen-binding portion.
21. The nucleic acid of claim 20 wherein said recombinant antibody
comprises a human, chimpanzee or second Old World monkey constant
region, wherein said first and second Old World monkey may be the
same or different.
22. The nucleic acid of claim 21 wherein said antibody comprises a
framework region of a second Old World monkey, a human or a
chimpanzee antibody, wherein said first and second Old World monkey
may be the same or different.
23. The nucleic acid of claim 20 wherein said antigen-recognizing
portion comprises the whole variable region of said Old World
monkey antibody.
24. The nucleic acid of claim 20 wherein said antigen-recognizing
portion comprises one or more CDR regions of said first Old World
monkey variable region.
25. The nucleic acid of claim 20, 21, or 22 wherein said first and
second Old World monkey are separately selected from the group
consisting of baboon, Rhesus and cynomolgus monkeys.
26. A monoclonal antibody, or a Fab or Fv or (Fab).sub.2 fragment
thereof, formed by an immortalized Old World monkey B-cell.
27. The monoclonal antibody of claim 26 wherein said B-cell is a
cynomolgus B-cell.
28. The monoclonal antibody of claim 26 wherein said B-cell is a
Rhesus B-cell.
29. The monoclonal antibody of claim 26 wherein said B-cell is a
baboon B-cell.
30. The monoclonal antibody of claim 26, 27, 28 or 29 wherein said
antibody is produced to a human antigen.
31. The monoclonal antibody of claim 26, 27, 28 or 29 wherein said
antibody binds specifically to human antigens chosen from CD58,
VCAM, VLA4, CD2, LFA3, ELAM, LAM, CD25, CD4, CD19, CD20, CD 23,
CD41, CD44, CD54, TNF.alpha., TNF.beta., Tn antigen, IL-1, IL-8,
human T-cell receptor, CD3, CD28, CD8, CD11a, CD18, CD11b, CD11c,
C5a, CD45, neu oncogene product, MDR-1, TGF.alpha., TGF.alpha.
receptor, PDGF, and CD71.
32. A method for isolating the variable region of an Old World
monkey antibody gene, comprising the steps of: contacting nucleic
acid from the Old World monkey, and a primer complementary to the
nucleic acid sequence encoding a 5' leader sequence of said
antibody gene, to form a hybrid complex; and amplifying said
nucleic acid in said hybrid complex to produce amplified nucleic
acid.
33. The method of claim 32, wherein said nucleic acid is DNA or
cDNA.
34. The method of claim 32 wherein said primer is complementary to
the non-coding strand of a 5' leader sequence of a human or old
World monkey antibody gene.
35. The method of claim 32 wherein said amplifying step produces
sufficient nucleic acid to place within a vector.
36. A method for isolating the variable region of an Old World
monkey antibody gene, comprising the steps of: contacting RNA from
an Old World monkey with reverse transcriptase to form cDNA,
contacting said cDNA with a primer complementary to the cDNA at a
location encoding a 5' leader sequence of said antibody gene, to
form a hybrid complex, and amplifying said nucleic acid in said
hybrid complex to produce amplified nucleic acid.
37. A method for producing a recombinant antibody to a human
antigen, said antibody being not immunogenic in a human, comprising
the steps of: raising an Old World monkey antibody to said antigen
in an Old World monkey, isolating an Old World monkey nucleic acid
encoding an antigen-binding portion of a variable region of said
Old World monkey antibody, providing a human nucleic acid encoding
a human constant region of a human antibody, ligating said Old
World monkey nucleic acid and said human nucleic acid to form a
recombinant nucleic acid, and expressing said recombinant nucleic
acid to produce said recombinant antibody.
38. The method of claim 37 wherein said antigen-binding portion
comprises one or more CDR regions of an Old World monkey variable
region.
39. The method of claim 37 wherein said antigen-binding portion
comprises the whole variable region of an Old World monkey.
40. The method of claim 37, wherein said method further comprises
the step of immortalizing a cell able to produce said old World
monkey antibody.
41. The method of claim 37, further comprising the step of
identifying the Old World monkey nucleic acid encoding a variable
region of said Old World monkey antibody.
42. The method of claim 40 wherein said immortalizing is by
hybridoma fusion.
43. The method of claim 40 wherein said immortalizing is by viral
transformation.
44. The method of claim 40 wherein said immortalizing is by single
B-cell cloning.
45. The method of claim 40 wherein said immortalizing is by library
construction.
46. The method of claim 37 wherein said human constant region is
selected to have a desired isotype.
47. The method of claim 37 wherein said method further comprises
selecting a B-cell from said Old World monkey.
48. The method of claim 47 wherein said B-cell is obtained from
peripheral blood lymphocytes, lymph node, bone marrow or
spleen.
49. The method of claim 37 wherein said method further comprises
screening cells of said old World monkey for production of said
antibody.
50. The method of claim 37 wherein said expressing is within a
producer cell line.
51. The method of claim 37 wherein said isolating comprises
immunoglobulin gene rescue of said variable region.
52. The method of claim 30, wherein said antigen is selected from
CD58, VCAM, VLA4, CD2, LFA3, ELAM, LAM, CD25, CD4, CD19, CD20,
CD23, CD41, CD44, CD54, TNF.alpha., TNF.beta., Tn antigen, IL-1,
IL-8, human T-cell receptor, CD3, CD28, CD8, CD18, CD11a, CD11b,
CD11c, C5a, CD45, neu oncogene product, MDR-1, TGF.alpha.,
TGF.alpha. receptor, PDGF, and CD71.
53. A method for treating a human having an antigen, wherein said
human is in need of treatment, comprising the step of administering
a therapeutically effective amount of a recombinant antibody
specific for said antigen, wherein said antibody comprises a human
or chimpanzee or first Old World monkey constant region and an
antigen-binding portion of a second Old World monkey variable
region.
54. The method of claim 53 wherein said human suffers from cancer,
and said antigen is a tumor antigen.
55. The method of claim 53 wherein said human suffers from an
auto-immune response, and said antigen is an antigen involved in an
autoimmune response in the human.
56. The method of claim 53 wherein said antigen is a receptor
expressed on a host cell.
57. The method of claim 53 wherein said antibody comprises portions
homologous to human and Old World monkey antibodies.
58. The method of claim 53 or 57 wherein said antigen is selected
from CD58, VCAM, VLA4, CD2, LFA3, ELAM, LAM, CD25, CD4, CD19, CD20,
CD23, CD41, CD44, CD54, TNF.alpha., TNF.beta., Tn antigen, IL-1,
IL-8, human T-cell receptor, CD3, CD28, CD8, CD18, CD11a, CD1b,
CD11c, C5a, CD45, neu oncogene product, MDR-1, TGF.alpha.,
TGF.alpha. receptor, PDGF, and CD71.
59. The method of claim 53 wherein said antigen-binding portion
comprises one or more CDR regions of an Old World monkey variable
region.
60. The method of claim 53 wherein said antigen-binding portion
comprises the whole variable region of an Old World monkey.
61. A recombinant antibody comprising (1) a constant region of a
heavy chain of a human antibody; (2) a constant region of a light
chain of said human antibody; (3) a variable region of a heavy
chain of an Old World monkey antibody against a human antigen; and
(4) a variable region of a light chain of said Old World monkey
antibody.
62. Recombinant nucleic acid comprising at least one CDR region
from the variable region in SEQ.ID NOS. 15 or 16.
63. A pharmaceutical composition comprising a therapeutically or
prophylactically effective amount of an antibody of any of claim 1,
2, 3, 10 or 26 in a pharmaceutically acceptable carrier.
64. The pharmaceutical composition of claim 63 where said antibody
binds specifically to CD58, VCAM, VLA4, CD2, LFA3, ELAM, LAM, CD25,
CD4, CD19, CD20, CD23, CD41, CD44, CD54, TNF.alpha., TNF.beta., Tn
antigen, IL-1, IL-8, human T-cell receptor, CD3, CD28, CD8, CD18,
CD11a, CD11b, CD11c, C5a, CD45, neu oncogene product, MDR-1,
TGF.alpha., TGF.alpha. receptor, PDGF, or CD71.
65. A method for treatment of a disease chosen from rheumatoid
arthritis, eczema and an immunomodulatory disease comprising the
step of providing a pharmaceutical composition of claim 63 to a
human suffering from said disease.
Description
FIELD OF THE INVENTION
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/397,072, filed Jan. 25, 1995, which is a continuation of U.S.
Ser. No. 07/912,292, filed Jul. 10, 1992, which is a
continuation-in-part of Newman et al., U.S. patent application Ser.
No. 07/856,281, filed Mar. 23, 1992, which is a
continuation-in-part of U.S. patent application Ser. No.
07/735,064, filed Jul. 25, 1991, the whole of which, including
drawings, are hereby incorporated by reference. This invention
relates to recombinant antibodies useful for human therapy, and to
methods for production of such antibodies.
BACKGROUND OF THE INVENTION
[0002] Murine monoclonal antibodies are used in diagnosis of human
disease, and in solving basic biological research problems. These
reagents are also used in clinical trials as therapeutics for both
acute and chronic human diseases, including leukemias, lymphomas,
solid tumors (e.g., colon, breast, hepatic), AIDS and autoimmune
diseases.
[0003] Mouse/human chimeric antibodies have been created, and shown
to exhibit the binding characteristics of the parental mouse
antibody, and effector functions associated with the human constant
region. See e.g., Cabilly et al., U.S. Pat. No. 4,816,567;
Shoemaker et al., U.S. Pat. No. 4,978,745; Beavers et al., U.S.
Pat. No. 4,975,369; and Boss et al., U.S. Pat. No. 4,816,397 all of
which are incorporated by reference herein. Generally these
chimeric antibodies are constructed by preparing a genomic gene
library from DNA extracted from pre-existing murine hybridomas.
Nishimura et al., 47 Cancer Research 999, 1987. The library is then
screened for variable region genes from both heavy and light chains
exhibiting the correct antibody fragment rearrangement patterns.
The cloned variable region genes are then ligated into an
expression vector containing cloned cassettes of the appropriate
heavy or light chain human constant region gene. The chimeric genes
are then expressed in a cell line of choice, usually a murine
myeloma line.
[0004] Such chimeric antibodies have been used in human therapy.
Antibodies to these chimeric antibodies, however, have been
produced by the human recipient in a number of cases. Such
anti-chimeric antibody antibodies are detrimental to continued
therapy with the chimeric antibody.
[0005] Erlich et al., 34 Clinical Chemistry 1681, 1988, Erlich et
al., 7 Hybridoma 385, 1988, Erlich et al., 6 Hybridoma 151, 1987,
and Erlich et al., 1 Human Antibody Hybridomas 23, 1990 (not
admitted to be prior art to the present application) state that
human monoclonal antibodies are expected to be an improvement over
mouse monoclonal antibodies for in vivo human therapy. They also
postulate that non-human primate antibodies, e.g., chimpanzee
monoclonal antibodies, to be tolerated in humans because they are
structurally similar to human antibodies. Since human antibodies
are non-immunogenic in Rhesus monkeys (i.e., do not induce an
antibody response), they predict that primate antibodies will be
non-immunogenic in humans. They indicate that the testing of
antibodies in humans is unnecessary if a primate antibody has a
constant region structure identical to that of a human
immunoglobulin or, at least, a structure no more different from a
human immunoglobulin than the different human antibodies differ
from each other. Thus, they suggest that chimpanzee antibodies may
be useful in human therapy.
SUMMARY OF THE INVENTION
[0006] The present invention concerns methods for the amplification
and cloning of Old World monkey (referred to herein as "monkey,"
e.g., baboon or macaque) antigen-binding portions of immunoglobulin
variable region-encoding genes, the fusion of these genes to cloned
human, chimpanzee or other monkey constant region-encoding genes
(and human, chimpanzee or other monkey framework-encoding genes if
required), and their expression as human/monkey recombinant
antibodies, or wholly monkey recombinant antibodies. Furthermore,
the invention concerns use of such recombinant antibodies (which
term includes antibodies produced by fusion of DNA from two
different antibody genes, even from the same species, e.g., two
different monkey antibody genes, for example, Rhesus and cynomolgus
monkeys, to give a monkey-monkey recombinant antibody) as
immunotherapeutic agents for the treatment of human disease. The
invention is based upon the discovery that evolutionary distant
monkeys (e.g., baboon or macaque monkeys (including cynomolgus, and
Rhesus monkeys)), unlike the Chimpanzee, are not only sufficiently
different from humans to allow antibodies against human antigens to
be raised in these monkeys, even to relatively conserved human
antigens, e.g., CD4 and CD54, but are sufficiently similar to
humans to have antibodies similar to human antibodies, so that
there is no host anti-antibody immune response when such monkey
antibodies, or recombinant antibodies derived therefrom, are
introduced into a human.
[0007] Unlike some prior antibodies used for human therapy, the
antibodies of the present invention do not suffer from several
drawbacks, e.g., 1) immunogenicity and induction of human
anti-antibody (HAA) response upon repeated administration necessary
to treat chronic conditions, 2) relatively short half-life compared
to human antibodies, and 3) lack of effector functions with human
cells or complement. The lack of these drawbacks is a significant
advantage for human therapy with antibodies made by the-present
invention. For example, in the case of chronic human diseases,
including auto-immune diseases, or any disease where prolonged
administration of an antibody is necessary, one of the major
obstacles to repetitive antibody therapy is the host response to
the therapeutic antibody. HAA responses are often unpredictable
from one patient to another. Such responses are predominantly,
though not exclusively, directed against the constant region of the
antibody molecule, and once they occur they often preclude, or
reduce the effectiveness of, any further therapy with that
antibody, or another antibody of the same isotype.
[0008] Potentially, the problems of HAA could be circumvented by
the use of human monoclonal antibodies. This approach, however,
suffers from the ethical, clinical, and immunological limitations
on immunization of human subjects with many antigens of choice
(e.g., human antigens, which phrase includes antigenic or
immunogenic portions of any proteins, polypeptides or their
equivalent present in a human) for antibody generation. Applicants'
approach to circumvent this problem includes generation of
antibodies of the appropriate specificity and desired effector
function, and their use in production of recombinant antibodies.
These recombinant antibodies generally include an appropriate
portion of the variable region of an antibody derived from an
immunized monkey, and the constant region of an antibody from a
human or chimpanzee. Thus, the specificities and high affinities of
monoclonal antibodies are retained, and the appropriate human or
chimpanzee constant region displaying the desired effector
functions can be readily chosen.
[0009] The present invention is further based on a method for
amplification of monkey immunoglobulin genes, e.g., by the
polymerase chain reaction (PCR), from RNA extracted from monkey
lymphocytes using synthetic oligonucleotide primers specific for
heavy and light chain variable region gene families. The amplified
genes or appropriate portions (e.g., complementarity determining
region (CDR)-coding regions; see Winter, British Patent Application
No. GB2188638A, hereby incorporated by reference herein) are cloned
into an expression vector containing a human or chimpanzee constant
region gene for the production of a monkey/human recombinant
antibody, or a vector containing a monkey constant region gene for
the production of wholly monkey recombinant antibody of the desired
isotype. These antibodies represent immunotherapeutic agents
capable of localizing and/or killing appropriate target cells
(e.g., tumor cells) after in vivo administration.
[0010] Thus, in a first aspect the invention features a method for
cloning an antigen-recognizing portion of the variable region of a
monkey antibody gene. This method includes providing nucleic acid,
e.g., RNA from the monkey, forming cDNA to the RNA (using reverse
transcriptase), providing a primer complementary to the cDNA
sequence encoding a 5' leader sequence of the antibody gene,
contacting that cDNA and the primer to form a hybrid complex and
amplifying the cDNA to produce nucleic acid encoding the variable
region of the monkey antibody gene.
[0011] By "antigen-recognizing portion" is meant one or more
portions of a variable region of a monkey antibody which are
responsible for binding and/or recognizing the target antigen (or
epitope or idiotype) of the antibody. For example, it includes the
CDR regions (see below) or the whole variable region, or any
combination of these two regions including any changes in coding
regions that may be induced to make the region more human-like
rather than monkey-like, without altering the specific binding
properties of the antibody. If only a portion of the whole variable
region is used then the remaining portions, e.g., the so-called
"framework", are provided from another antibody, preferably a human
or chimpanzee antibody (see below) and in the art cited above and
incorporated herein by reference.
[0012] The phrases "variable region", "leader sequence", "constant
region" and "framework" are used in their common art recognized
manner, examples of which are provided below and in the art cited
above and incorporated herein by reference.
[0013] In preferred embodiments, the leader sequence is a human,
chimpanzee or monkey leader sequence of approximately 60 bases,
examples of which are provided in FIG. 1.
[0014] Applicant has discovered that the monkey, chimpanzee and
human variable region leader sequences are sufficiently similar
that primers constructed to one are suitable for amplification of
the other. In the method, the RNA is amplified sufficiently to
produce enough nucleic acid to place that nucleic acid within a
vector for later cloning.
[0015] In a second aspect, the invention features a method for
producing an antibody to a human antigen, which antibody-is not
immunogenic in humans. The method involves raising in a monkey a
monkey antibody to the human antigen, and isolating monkey nucleic
acid encoding an antigen-recognizing portion of a variable region
of the monkey antibody. Human nucleic acid encoding a human
constant region of an antibody is provided, and ligated to the
monkey nucleic acid to form recombinant nucleic acid. This
recombinant nucleic acid is then expressed to produce the desired
antibody. Alternatively, chimpanzee or monkey constant
region-encoding nucleic acid can be used to form the recombinant
antibody. There are few, if any, differences in the amino acid
sequence of human and chimpanzee constant regions (i.e., they are
homologous), and those differences present between human and monkey
can be readily altered by standard techniques if the nucleic acid
encoding the monkey constant region is used to form a recombinant
antibody. All that is critical in the invention is that an antibody
be produced that is less immunogenic than the monkey constant
region so that no significant immune response ensues when the
recombinant antibody is introduced into a human. (Such antibody
regions are herein referred to as homologous regions.) Thus, the
recombinant antibody is engineered to be functionally the same as a
human antibody in its amino acid sequence, i.e., it has a constant
region homologous to a human or chimpanzee antibody constant
region. In summary, the antibody is as human an antibody as is
necessary to reduce the chance of an undesired immunological
response to the antibody, and contains an antigen-binding portion
of a monkey antibody.
[0016] By "not immunogenic is meant that the antibody does not
raise an antibody response of sufficient magnitude to reduce the
effectiveness of continued administration of the antibody in the
majority of humans for sufficient time to achieve therapeutic
efficacy, e.g., as compared to a murine or murine-human chimeric
antibody. Preferably, no antibody response is observed.
[0017] In preferred embodiments, the method includes immortalizing
a cell of the monkey which is responsible for producing the monkey
antibody, e.g., by hybridoma fusion, viral transformation with
Herpes papio, single B-cell cloning (also termed "transient
immortalization"), and production of a library of recombinant
immunoglobulins. In other preferred embodiments, the method
includes selecting a B-cell from the monkey from either a
peripheral blood leukocyte, the spleen, bone marrow or a lymph
node; selecting a clone which produces the appropriate antibody;
rescuing the immunoglobulin genes encoding that antibody from the
immortalized cell line; and reexpressing the genes in a producer
cell line (i.e., a cell line which causes sufficient production of
the antibody to be useful for human therapy).
[0018] In a third aspect, the invention features a recombinant
antibody formed from either a human or chimpanzee constant region
and an antigen recognizing portion of a monkey variable region, or
a first monkey constant region and a second, different monkey
antigen recognizing portion of a variable region.
[0019] In a related aspect, the invention features a monoclonal
antibody, or an Fab, (Fab).sub.2, a light chain or heavy chain
dimer, or any minimal recombinant fragment thereof, such as an Fv
or a SCA (single chain antibody) or other immunologically active
fragment thereof (e.g., a CDR-region), to a human antigen formed by
an immortalized monkey B-cell. Such fragments are useful as
immunosuppressive agents. Alternatively, the antibody of the
invention may have attached to it an effector or reporter molecule.
For instance, an antibody of the invention may have a macrocycle,
for chelating a heavy metal atom, or a toxin, such as ricin,
attached to it by a covalent bridging structure. In addition, the
Fc fragment or CH3 domain of a complete antibody molecule may be
replaced by an enzyme or toxin molecule, and a part of the
immunoglobulin chain may be bonded with a polypeptide effector or
reporter molecule. Bispecific antibodies can also be constructed by
standard procedure.
[0020] In another aspect, the invention features pharmaceutical
compositions in which antibodies of the present invention are
provided for therapeutic or prophylactic uses. Such antibodies can
also be provided as immunotoxins, i.e., molecules which are
characterized by two components and are particularly useful for
killing selected cells in vitro or in vivo. One component is a
cytotoxic agent which is usually fatal to a cell when attached or
absorbed. The second component, known as the "delivery vehicle"
provides a means for delivering the toxic agent to a particular
cell type, such as carcinoma cells. The two components are commonly
chemically bonded together by any of a variety of well-known
chemical or genetic procedures. For example, when the cytotoxic
agent is a protein and the second component is an intact
immunoglobulin, the linkage may be by way of hetero-bifunctional
crosslinkers, e.g., carbodiimide, glutaraldehyde, and the like.
Production of various immunotoxins is well-known in the art.
[0021] In another related aspect, the invention features nucleic
acid encoding a human/monkey recombinant antibody. In preferred
embodiments, the nucleic acid encodes a human or chimpanzee
constant region and an antigen recognizing portion of monkey
variable region; and the nucleic acid is purified, i.e., separated
from biological components with which it naturally occurs, or more
preferably, is provided as a homogeneous solution.
[0022] In yet another aspect, the invention features a CDR-grafted
antibody formed from at least one of the complementarity
determining regions (CDRs), that is, amino acid residues (using the
standard amino acid labeling system of Kabat) 31-35 (CDR 1), 50-65
(CDR 2) and 95-102 (CDR 3) of the specified heavy chain, and amino
acid residues 24-34 (CDR 1), 50-56 (CDR 2) and 89-97 (CDR 3) of the
specified light chain of an Old World monkey variable region, and
an immunoglobulin variable region framework from a second species.
The CDR-grafted antibody is able to bind to the same antigen as the
original monkey antibody. The antibody constant region is derived
from a human or chimpanzee immunoglobulin. The methodology for
performing this aspect is generally described by Jones et al., 321
Nature 522, 1986. Such CDR grafts can be altered if desired to
ensure that they appear more human-like so that the probability of
instigation of adverse reaction to the antibody is lessened.
[0023] In preferred embodiments, the method includes
immortalization or selection of a cell from a macaque, which is
responsible for producing a macaque antibody, and rescuing the
immunoglobulin genes from the cell; cloning and sequencing the
antibody genes responsible for the production of antibody;
selecting a human variable region framework sequence (preferably
with the closest homology to the macaque variable region
framework); and substituting macaque CDR sequences for human CDR
sequences and minor modifications in the human framework region may
be included to maintain affinity of the antibody for its
antigen.
[0024] By "minor modifications" is meant that less than a total of
about 6 amino acids in the framework may be substituted by other
amino acids. Usually such substitutions or modifications are made
only when those amino acids are involved in conformational
interactions that hold the framework in an appropriate form so that
the desired antigen is recognized by the antibody. Such
modifications will generally reflect those differing amino acids
present in a monkey antibody, compared to a human antibody. For
example, the amino acid sequence of a human antibody just prior to
heavy chain CDR 3, 92-94 is generally cysteine-alamine-argimine
(argimine is known to be replaced in a minority of antibodies with
serine or threonine); in some antibodies in the monkey the sequence
is cysteine-alamine-serine; thus, in this example, it may be
preferred to use serine at amino acid 94 (see FIG. 9D).
[0025] In a further aspect, the invention features a method for
treating a human having a particular antigen, e.g., one associated
with disease. The method includes administering a therapeutically
effective amount of a recombinant antibody specific for the
particular antigen, wherein the recombinant antibody is one having
either a human or chimpanzee constant region and an antigen
recognizing portion of a monkey variable region, or a first monkey
constant region and an antigen-recognizing portion of a second,
different monkey variable region.
[0026] In preferred embodiments of the above aspects, the antigen
is a tumor antigen, an antigen involved in an immune disorder, an
antigen involved in an autoimmune response, a receptor expressed on
a host cell, or an antigen selected from the human antigens CD58,
VLA4 (.alpha.4.beta.1 integrin), CD2, LFA3, ELAM, LAM, CD25, CD4,
CD19, CD20, human T-cell receptor, CD3, CD8, CD23, CD41, CD44,
CD45, CD71, TNF.alpha., TNF.beta., Tn antigen, IL-1, IL-8, C5a,
adhesion molecules, e.g., VCAM, CD54, CD28, CD11a, CD11c, CD18, and
CD11b, the neu oncogene product, MDR-1 (P-glycoprotein), TGF.alpha.
and its receptor, and PDGF; and the recombinant antibody is active
to either deplete (kill or eliminate) undesired cells (e.g.,
anti-CD4) by acting with complement, or killer cells, or is active
as a cytotoxic agent or to cause Fc-receptor binding by a
phagocyte. Alternatively, the antibody blocks or stimulates
receptor functions, or neutralizes active soluble products, such as
one or more of the interleukins, TNF and C5a.
[0027] In other aspects, the invention features pharmaceutical
compositions of the above antibodies or fragments thereof.
Compositions or products according to the invention may
conveniently be provided in the form of solutions suitable for
parenteral or nasal or oral administration. Appropriate
preparations of antibody may be mixed with appropriate preparations
of other agents, resulting in increased clinical utility.
[0028] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0029] The drawings will first briefly be described.
DRAWINGS
[0030] FIG. 1 is a tabular representation of 20 codons in nine
different Ig heavy chain leader sequences and ten monkey Ig heavy
chain leader sequences;
[0031] FIG. 2 is a diagrammatic representation of the structure of
various Ig chains showing the relative position of leader,
variable, and constant regions with the positions of restriction
sites and primers used for amplification;
[0032] FIG. 3 is a diagrammatic representation of a heavy chain
cassette vector for expression of human or chimeric antibodies;
[0033] FIG. 4 is a diagrammatic representation of a light chain
cassette vector designed for expression of human or chimeric
antibodies;
[0034] FIGS. 5 and 6 are diagrammatic representations of vectors
designed for expression of immunoglobulin from kappa or lambda
light chain cDNA, respectively. In these vectors, the
immunoglobulin genes are arranged in a tandem configuration using
neomycin phosphotransferase as the selectable marker;
[0035] FIGS. 7-1, 7-2, and 8 show the nucleic acid sequence of
various leader sequence primers useful in the invention (these
primers in FIG. 8 correspond to those listed as SEQ. ID Nos. 1-12
infra;
[0036] FIGS. 9A through 9H are comparisons of human and monkey
regions in the VH1, VH2, VH3, VH4, and VH5 sequences, and VKI and
VKII, and VlambdaIII sequences, respectively;
[0037] FIG. 10 is a comparison of human and monkey VH3 sequences,
with one comparison to the human VH2 sequence;
[0038] FIG. 11 is a graphical representation of the binding of an
antibody of the invention to a human CD4 antigen;
[0039] FIG. 12 is a graphical representation of the inhibition of
binding of lF3 by the antibody shown in FIG. 10;
[0040] FIGS. 13 and 14 are portions of the nucleotide sequences of
anti-CD4 VH, and VL regions respectively;
[0041] FIG. 15 is a graph showing anti-CD54 activity; and
[0042] FIG. 16 is a histogram comparing plasmid expression
features.
[0043] Monkey Antibodies
[0044] Old World monkeys include those referred to as baboon and
macaque monkeys (including Rhesus monkey and cynomolgus monkey).
This invention provides details of use of the claimed invention
with various monkey genes. These examples are not limiting in the
invention and may be readily applied to other Old World
Monkeys.
[0045] Referring to FIG. 2, there is shown in diagrammatic form the
general structure of genes encoding immunoglobulin heavy, kappa
light, and lambda light chains. Each of these chains is formed with
an ATG start codon followed by a leader sequence of approximately
60 bases, a region encoding a variable region of the
immunoglobulin, and a constant region of that immunoglobulin.
Examples of different leader sequences, or signal peptides, of
heavy chains are shown in FIG. 1. These sequences, and their
equivalent in monkey, can be determined by standard techniques well
known to those of ordinary skill in the art, and as described
below.
[0046] The sequences shown in the lower portion of FIG. 1 are human
leader sequences. Applicants have discovered that construction of
primers complementary to these leader regions allows amplification
of Ig genes from monkeys. Similarly, primers homologous to monkey
leader sequences (see e.g., upper portion of FIG. 1) can be used in
amplification of monkey immunoglobulin genes, and also for
amplification of human immunoglobulin genes.
[0047] By use of such primers in standard amplification procedures,
genes encoding various monkey immunoglobulin genes, can be readily
isolated, and the sequences encoding the variable regions of the
antibodies determined. Examples of such procedures are provided
below. The results of the analysis provided below are presented in
FIGS. 9A through 9H, and in FIG. 10. Surprisingly, applicant found
that, despite the ability to produce antibodies to relatively
conserved human antigens in the monkeys, the variable regional
framework sequences of the antibodies so produced were
indistinguishable from those of human antibodies. That is, the
amount of variability in immunoglobulin sequence observed for the
monkeys was similar to that observed for humans, and it was
impossible to determine which antibody was derived from a human or
monkey without analysis of the source itself.
[0048] Thus, for example, referring to FIG. 10, the amino acid
sequence of the VH3 region of human was compared with monkey. The
human antibodies showed a range of homology among themselves from
83-98%, while those of the monkey were from 90-95% homologous with
the human VH3 region. In contrast, the human VH2 region was
homologous to the human VH3 by 60%. [In this drawing, as in the
other drawings, the presence of the same amino acid at any location
is shown by a dash, while the presence of a different amino acid is
shown by the standard one letter code. Positions to which no
consensus amino acid can be assigned are shown as an X.] Similarly,
homology for VH1, VH2, VH3, VH4, and VH5, and for VKI and VKII and
Vlambda III is shown in FIGS. 9A-9H, respectively. Again,
significant homology between the monkey immunoglobulin region and
that of the human was observed in each variable region including
immunoglobulin J regions sequences. Such high homology is similar
to that observed among human antibodies.
[0049] The methodology by which the sequences were determined is
presented below in the examples. Those of ordinary skill in the art
will recognize that these examples are not limiting in this
invention and equivalent results and monoclonal and chimeric
antibodies can be obtained by similar procedures well known to
those of ordinary skill in the art. See e.g., U.S. Pat. Nos.
4,816,567; 4,978,745; 4,975,369; 4,816,397, supra. For example,
after cloning a gene encoding a monkey variable region, such a gene
is readily ligated to one encoding a monkey or human constant
region, and the fused genes expressed in a producer cell line to
produce the desired antibody. Below are provided examples of such
procedures.
[0050] In the following examples, the first step in the method
involves the isolation of total RNA from monkey peripheral blood or
spleen cells. B cells from immunized monkeys may be obtained from
peripheral blood or lymph nodes and used directly or, they may be
preferentially expanded. Expansion may involve Herpes papio virus
transformation, fusion to a heterologous myeloma cell with
subsequent selection, or cloning of single B cells under limiting
dilution in the presence of stimulated human T cells.
[0051] Total RNA is then converted to single stranded (ss) cDNA by
reverse transcriptase using non-specific (oligo-dt or random
hexamers) or specific (immunoglobulin CH1 or CK or Clambda constant
region) oligonucleotide primers. Single-stranded cDNA produced by
this reaction is amplified using the polymerase chain reaction in
which ss cDNA, together with deoxynucleotide triphosphates, a DNA
polymerase (e.g., a thermostable polymerase) and specific primers,
are used to amplify heavy or light chain variable region
immunoglobulin genes. The primers used are single stranded
synthetic oligonucleotides ranging from 20 to 40 bases, containing
some degenerate bases which bind to the immunoglobulin 5' leader
sequences. Six different 5' leader sequence primers (see, FIG. 7-1
incorporating a restriction enzyme site (e.g., SalI) have been
designed for amplification of monkey heavy chain variable
region-families based on their similarity to human heavy chain
variable region gene families. With each of the six 5' leader
sequence primers, a 3' primer specific for the constant region
domain of the relevant isotype (e.g., IgG, IgM, IgA or IgE) also
incorporating a restriction enzyme site (e.g., NheI) is used.
Similarly, for monkey kappa and lambda light chains, other pairs of
primers are used for amplification of the appropriate light chain
variable region (FIG. 7-2).
[0052] Other sets of primers can be used in order to incorporate
different, unique restriction sites to allow directional cloning of
PCR-amplified DNA into an appropriate expression vector possessing
the same restriction site. A set of primers binding to the 3' end
of the antibody heavy chain leader sequence incorporating a Mlu1
site, or a set of primers binding to the first 23 bases of
framework one incorporating a XhoI site can also be used and are
described in FIG. 7-1. The monkey immunoglobulin heavy and light
chain variable region genes may be cloned into a shuttle vector
directly after PCR amplification to allow further molecular
manipulations if necessary or, cloned directly into an expression
vector that contains human heavy or light chain constant region
genes. The molecular configuration of the immunoglobulin genes in
the expression vector may be genomic, in which immunoglobulin
promoter/enhancer and other regulatory regions are present as well
as splice donor/acceptor sequences at the intron/exon junctions.
Alternatively, chimeric immunoglobulin genes can be inserted in a
cDNA configuration using heterologous viral promoter/enhancer
sequences.
[0053] In a particularly preferred embodiment, the invention
provides a specific recombinant referred to as CE9.1 (see Example
3) primate/human chimeric monoclonal antibody which is directed
against the human CD4 antigen. This recombinant antibody has
particular utility as an immunosuppressant and is especially useful
for the treatment of autoimmune diseases such as rheumatoid
arthritis. As described in greater detail in the Examples, in
particular Example 3, this recombinant antibody is generated by
grafting the antigen binding variable Fv domains from cynomolgus
macaque to human constant IgG.sub.1 and gamma domains. More
particularly, this antibody contains a human gamma 1 domain. The
resultant recombinant antibody sequences are indistinguishable from
human immunoglobulin sequences. As a result, this antibody upon in
vivo administration in humans should exhibit reduced immunogenicity
and longer serum half-life compared to similar murine monoclonal or
mouse-human chimeric antibodies directed to CD4. This antibody
binds to domain 1 of human, but not macaque, CD4, a region which is
involved in the interaction with MHC Class II molecules on antigen
presenting cells. Potent immunomodulatory activity has been
observed with this antibody both in vitro and in vivo. Given these
properties, i.e., reduced immunogenicity, longer half-life and
potent immunosuppression, indicate that this antibody should be
particularly suitable for long term therapy of diseases where
immunosuppression is desirable, e.g., autoimmune disorders and
chronic inflammatory diseases such as rheumatoid arthritis.
However, it is expected that this antibody should be useful for the
treatment of many other disease conditions including, by way of
example, Hashimoto's thyroiditis, primary myxoedema,
thyrotoxicosis/Graves disease, pernicious anaemia, autoimmune
atrophic gastritis, autoimmune carditis, Addison's disease,
premature menopause, type I-diabetes mellitus, Good pasture's
syndrome, myasthenia gravis, multiple sclerosis, male infertility,
pemphigus vulgaris, pemphigoid, sympathetic ophthalmia, phacogenic
uveitis, autoimmune haemolytic anaemia, idiopathic thrombocytopenic
purpura, idiopathic leucopenia, primary biliary cirrhosis, active
chronic hepatitis (HBs Ag negative), cryptogenic cirrhosis,
inflammatory bowel disease syndrome, Sjogren's syndrome, psoriasis,
rheumatoid arthritis, dermatomyositis, scleroderma, mixed tissue
connective disease, discoid lupus erythematosus, systemic
vasculitis, and systemic lupus erythematosus (SLE). In the
preferred embodiment, however, the disease indication will comprise
rheumatoid arthritis.
[0054] Rheumatoid arthritis (RA) is an inflammatory disease of the
synovium which comprises one manifestation of an autoimmune
phenomenon which results in erosion, deformity, and destruction of
joints. As is true with most autoimmune diseases, the ideology of
RA is not well defined but is characterized by elevated levels of
activated CD4.sup.+ T-lymphocytes in the affected joints. Currently
there is no cure for RA and therapy for treatment of this
debilitating disease is designed only to provide relief of symptoms
and improvement in functional abilities over the short term.
Moreover, second and third line immunosuppressants and steroids
such as azathioprine, methotrexate and prednisolone aimed at the
underlying disease are only given in more severe cases and are
usually mildly effective or exhibit unacceptable toxicity when used
for chronic therapy. By contrast, it is expected that the subject
antibody will be suitable over prolonged and chronic administration
given the fact that it exhibits reduced immunogenicity, longer half
life and potent immunosuppression activity.
[0055] Essentially, the subject recombinant anti-CD4 monoclonal
antibody or other antibodies produced according to the invention
should mediate therapeutic activity by arresting or altering the
destructive activity of CD4.sup.+ cells, particularly during acute
phases of autoimmune disorders such as rheumatoid arthritis. Thus,
administration of antibodies according to the invention will result
in a state of immunological unresponsiveness (anergy) or long term
tolerance to the insulting antigens (or specific tissues) that
sustain the underlying disease without compromising normal host
defenses against opportunistic infections. Apart from RA, CD4
monoclonal antibodies should be beneficial in the treatment of the
above-identified diseases and afford particular application for the
treatment of insulin-dependent diabetes mellitus, systemic lupus
erythematosus, cirrhosis, inflammatory bowel disease, multiple
sclerosis, as well as other autoimmune diseases.
[0056] Recombinant anti-CD4 monoclonal antibodies produced
according to the invention in particular CE9.1 disclosed in example
3 should mediate the desired in vivo therapeutic effect through one
or more of the following mechanisms:
[0057] i) blocking the interaction of CD4 with MHC class 2
molecules;
[0058] ii) down modulation of cell surface CD4;
[0059] iii) depletion of CD4 cells; and
[0060] iv) induction of tolerance to autoantigens.
[0061] Although transient depletion of CD4.sup.+ cells results in
immunosuppression and perhaps normalization of an otherwise
hyperactive immune system, the main mechanism by which anti-CD4
antibodies exhibit their in vivo effect is not necessarily
dependent on T cell depletion. Rather, it is believed that antibody
binding to the CD4 molecule prevents helper T cell activation by
antigens bound to CD cell receptor leading to antigen-specific
T-cell anergy or tolerance. In fact, the exemplified recombinant
anti-CD4 antibody which comprises a human gamma 1 domain exhibits
substantial immunosuppression activity. However, it only partially
depletes CD4 cells in chimpanzees. Moreover, results in humans
indicate that this antibody results in substantially less cell
depletion compared to other monoclonal antibodies now in clinical
trials.
[0062] Also, in in vivo experimental models, allograft specific
tolerance has been induced by non-depleting anti-CD4 antibodies
administered at the time of transplantation. The maintenance of the
tolerance state did not require a depleting anti-CD4 antibody but
does appear, however, to be dependent on the continued presence of
antigen. Based on these findings, it is expected that the subject
recombinant antibody or other recombinant anti-CD4 antibodies
produced according to the invention should be suitable for
treatment of autoimmune diseases. Brief treatment schedules with
anti-CD4 antibodies will interfere with helper T-cell responses
against auto antigens leading to long-lasting clinical cal
improvements in the absence of generalized immunosuppression.
[0063] Based on the information contained in the subject
application, and using known methods, one skilled in the art can
readily ascertain a safe, tolerated and effective regimen of the
subject recombinant anti-CD4 antibody disclosed in the Examples as
well as other antibodies produced substantially according to the
invention.
[0064] It has been found that the CE9.1 antibody exhibits
reversible T cell depleting activity in chimpanzees. Also, it is
likely to be improved over current murine and murine/chimeric
anti-CD4 monoclonal antibodies by virtue of its expected longer
half-life in human serum and reduced potential adverse immunogenic
effects. Also, given the presence of human constant domain
sequences, it is expected that the subject antibody upon
administration in humans will maintain the normal effector
functions of human antibodies. In fact, the effector functions of
the preferred embodiment, CE9.1 antibody has been evaluated in
several different assays. This antibody was found to exhibit
inhibitory activity in mixed lymphocyte reaction (MLR), to exhibit
weak C1q binding, but not to exhibit complement mediated cellular
cytotoxicity. Also, it was found to exhibit antibody dependent
complement cellular cytotoxicity activity (ADDC) and to bind FcR.
Moreover, this antibody has been tested in HuCD4.sup.+ a transgenic
mouse which expresses CD4. It was found that the subject antibody
inhibits the humoral response therein, inhibits T cell reduction
(ex vivo) and does not inhibit B cell response (ex vivo). Also, the
subject antibody has been evaluated in vivo in chimpanzees wherein
it was found that administration results in partial depletion of
CD4 cells, and modulation of the CD4 receptor. It is expected,
based on these properties, that the subject antibody and
equivalents thereof will function as potent immunosuppressants
which may be used for the treatment of autoimmune diseases,
including in particular rheumatoid arthritis.
[0065] The preparation of the preferred embodiment is disclosed in
detail in Example 3 infra. As discussed herein, this antibody is an
anti-CD4 monoclonal antibody macaque-human chimeric antibody which
is of the IgG.sub.1 molecule which is expressed in Chinese hamster
ovary (CHO) cells which exhibits 91-92% homology with human
immunoglobulin framework regions. Therefore, this molecule should
exhibit reduced or even no immunogenic response in humans and
should exhibit longer serum half-life compared to murine monoclonal
or mouse-human chimeric antibodies. Also, the antibody exhibits
limited cross reactivity with human tissues. For example, no
evidence of binding of this antibody to non-lymphoid tissues was
observed in testing. As expected, the antibody binds to some but
not all of the lymphoid cells from peripheral blood and other
organs. Also, it has been found that this antibody reacts with
chimpanzee CD4.sup.+ T cells but does not react with CD4.sup.+ T
cells from rhesus, cynomolgus or pigtail macaques, baboons, rats,
mice, or rabbits. Therefore, based on this reactivity, chimpanzees
comprise a relevant species to confirm the in vivo pharmacological
affects of this antibody, i.e., its ability to function as an
effective immunosuppressant.
[0066] The subject CE9.1 antibody has been administered to
chimpanzees at various dosages. More specifically, the effects of
dosages of 0.1, 0.3, 1, 5, and 10 milligrams/per kilogram were
studied in a chimpanzee dosed at 7 to 14 day intervals. No clinical
evidence of toxicity was observed. Dosages of milligram per
kilogram or greater caused an 80-95% reduction in circulating
CD4.sup.+ cells 24 hours after dosing. Significant depression of
CD4.sup.+ cells was not observed seven days after a dose of 1
milligram/kilogram. After a dose of 5 milligrams/kilogram
circulating CD4.sup.+ cell counts recovered to approximately 40% of
base line after seven days and approximately 60% of base line after
fourteen days. After a dose of 10 milligrams/kilogram circulating
CD4.sup.+ cell counts had not recovered seven days after treatment
and recovered to only 40% of base line forty-two days after dosing.
No changes in other clinical pathology parameters were observed.
Thus, based on these results, it would appear that 10
milligrams/kilogram is the maximum tolerated dose in
chimpanzees.
[0067] The subject CE9.1 antibody has also been tested in humans.
For example, the activity of the subject CE9.1 antibody has also
been evaluated in single dose-escalating phase 1 trials in
rheumatoid arthritis patients. These results were very promising.
Specifically, about half of the patients who were administered
exhibited at least a 30% improvement in their tender joint scores,
with the adverse event profile being extremely benign. Moreover, as
discussed supra, while it was initially assumed that CE9.1 would be
depleting, in fact this antibody exhibited only partial and
transient depletion upon single administration. The partial
non-depleting nature of this antibody may be beneficial because in
a number of animal studies it has been reported that CD4.sup.+ T
cell depletion is apparently not necessary for efficacy of CD4
monoclonal antibodies. (See Carteron et al, (1988), Induction of
Immune Tolerance During Administration of Monoclonal Antibody to L3
T4 Does not Depend on L3 T4.sup.+ Cells, Underlying Journal of
Immunology, 140:713-716; Carteron et al, (1990), F(ab')2 Anti-CD4
and Intact Anti-CD4 Monoclonal Antibodies Inhibit the Accumulation
of CD4.sup.+ T Cells, CD8.sup.+ T cells and BT T Cells and B cells
in the Kidneys of Lupus-Prone NZB/NZW Mice, Clinical Immunology
Immunopathology, 56:373-383.) Thus, this antibody may function like
a classical receptor antagonist by: i) block interaction of CD4
with its counter receptor MHC II; ii) or i) causing modulation of
CD4 from the cell surface. Under these conditions, CD4.sup.+ T cell
responses that require the participation of the CD4 receptor would
be attenuated or blocked. The fact that the subject CE9.1 antibody
apparently exhibits little depleting activity in humans is
advantageous because it may improve safety, may obviate the need
for frequent monitoring of CD4.sup.+ cell counts, and may also
improve efficacy.
[0068] In using the subject CE9.1 monoclonal antibody for the
treatment of autoimmune disorders, including for example rheumatoid
arthritis, this antibody may be administered by itself or in
combination with other compounds suitable for treatment of the
particular disease condition. For example, the subject antibody may
be administered in combination with other proteins, for example
monoclonal antibody soluble receptor proteins to TNF-alpha,
monoclonal antibodies to IL2 receptor, monoclonal antibodies and
receptor fusion proteins which antagonize the CD40/gp39 interaction
and CTLA 4-Ig in monoclonal antibodies which antagonize the B7/CD28
interaction. Also, in the case of treatment of rheumatoid
arthritis, the subject antibody may be administered in combination
with other therapeutics, for example Rapamycin, Leflunomide,
Tenidap, RS-61443 (Mycophenolate Mofetil), Surenyl (sodium
Hyaluronate), anti-TCR (V.beta.17) peptide vaccine, Anerva X
(anti-MHC vaccine), and extracorporeal protein A immunoabsorbants
or combinations thereof. Additionally, the subject antibody may be
administered in combination with other antibodies produced
according to the invention or known in the art which are specific
to human CD4. This may result in synergistic effects, for example,
if these antibodies bind to different epitopes of the CD4
protein.
EXAMPLE 1
Sequence of Monkey Antibodies
[0069] FIGS. 7 and 8 show the primers with or without restriction
sites respectively, used in the PCR amplification of immunoglobulin
genes from monkey and/or human cDNAs. Details of the procedures
used are provided below. RNA was isolated from the spleen,
peripheral blood and lymph node cells of monkeys using the standard
guanidinium isothiocyanate method. The total RNA fraction isolated
by this method was then used as a template for subsequent
amplification reactions. An aliquot of the RNA was incubated in the
presence of 200 units of Moloney murine leukemia virus reverse
transcriptase and non-specific (oligo-dt or random hexamers) or
specific (immunoglobulin IgG CH1 region or kappa chain constant
region CK) oligonucleotide primers (50-100 picomoles) to generate a
non-coding sense single cDNA strand. Single stranded cDNA produced
by this reaction was then amplified using the polymerase chain
reaction (PCR). An aliquot of single stranded cDNA was incubated
together with deoxynucleotide tri-phosphates (20 .mu.M), a
thermostable DNA polymerase (2-5 units) and human-derived synthetic
oligonucleotide primers (50 picomoles), to amplify either heavy or
light chain variable region immunoglobulin genes.
[0070] Using pairs of primers shown in FIG. 8, several
representative cynomolgus immunoglobulin heavy and light chain
variable region sequences from a number of gene families were
amplified. These amplified sequences were cloned into the EcoRV
site of the plasmid vector p-Bluescript (pBS, available from
Stratagene, Calif.) and used for DNA sequencing. DNA sequencing was
performed using the plasmid DNA containing the cloned insert as a
double stranded DNA template and the standard chain termination
sequencing method.
[0071] Representative cynomolgus monkey immunoglobulin sequences
are shown in FIGS. 9A-9H. Included in FIGS. 9A-9H are the consensus
amino acid sequence for human variable region genes representing
each of the major variable region gene families. The percentage
homology of each monkey sequence with the human consensus sequence,
excluding the constant domain regions and the CDR regions, is
shown. The level of homology between human and monkey sequences for
a given family is as high as between two human sequences within
that family. It is impossible therefore to distinguish between
variable region immunoglobulin sequences originating from Old World
monkeys, and those originating from humans based on sequence
comparisons alone.
[0072] Isolation of RNA
[0073] Monkey antigen-specific B cells were obtained in several
ways: by fusion of immunized monkey lymph node cells to the
human/mouse heteromyeloma fusion partner cell line K5H6/B5, and
subsequent screening of the hybridoma lines, by virally transformed
B cells, or by in vitro single B cell cloning techniques. In the
latter case growth of a single monkey B cell was supported in vitro
by co-cultivation with human T cells that were stimulated by
antibody. A single B cell was placed in each well of a 96 well
tissue culture plate together with approximately 150,000
anti-CD3-stimulated mytomycin C-treated human T cells. After a two
week incubation period the single B cell expanded to at least 200
differentiated plasma cells. Culture supernatant from these wells
were assayed for the presence of immunoglobulin by ELISA technique
using a capture antibody of goat anti-monkey immunoglobulin.
[0074] Cells either from antigen-specific virally transformed cells
or hybridomas were grown up in sufficient numbers for extraction of
RNA. Wells from the in vitro single B cell cloning technique that
were positive for immunoglobulin were removed, washed twice with
cold phosphate buffered saline pH 7.5 and centrifuged (1000.times.
g 10 min). The washed cells were suspended in 1000 .mu.l of lysis
solution (4 M guanidinium isothiocyanate, 25 mM sodium citrate pH
7.0, 0.5 sodium sarcosine, 0.1M 2-mercaptoethanol). 10 .mu.l of 2M
sodium acetate, pH 4.0, was added and mixed. Protein was removed by
adding 100 .mu.l water saturated phenol, mixing and adding 20 .mu.l
of chloroform/isoamyl alcohol (49:1). After vortexing and
incubation on ice for 15 min, the samples were centrifuged at
10,000.times. g for 20 minutes. The aqueous phase was transferred
to a new tube, mixed with an equal volume of isopropanol and
incubated for 1 hr at -20.degree. C. The precipitate was collected
by centrifugation at 10,000.times. g for 15 minutes, washed with
70% ethanol, recentrifuged and the pellet dried in a Speedivac
(Savant). The dried RNA was redissolved a second time in 100 .mu.l
of lysis buffer. An equal volume is isopropanol was added and
incubated at -20.degree. C. for one hour. The precipitate was
collected by centrifugation at 10,000.times. g for 15 minutes and
washed with 70% ethanol. The pellet was dried in a Speedivac
(Savant) and stored at -20.degree. C. in 70% ethanol until use.
[0075] Synthesis of Single Stranded cDNA
[0076] The total RNA extracted from the cells originating from a
single well was dissolved in 32 .mu.l of double distilled water to
which is added 1 .mu.l (50-100 picomoles) of primer (either random
hexamers, oligo dT or 3'1 immunoglobulin-specific primers) and 10
.mu.l of 5.times. reverse transcriptase buffer (0.25 Tris-HCl pH
8.3, 0.375M KCl, 15 mM MgCl.sub.2, 50 mM dithiothreitol). The
mixture was heated at 65.degree. C. for 5 minutes after which it
was placed in ice for 2 minutes. After heating, 1 .mu.l RNAsin
(Promega), 5 .mu.l of 5 mM deoxynucleotide triphosphates, and 1
.mu.l (200 units) of Moloney murine leukemia virus reverse
transcriptase (BRL) was added, and the mixture incubated at
37.degree. C. for 1.5 hours. After completion of the reverse
transcriptase reaction, the single stranded cDNA/RNA mixture was
extracted with phenol/chloroform and passed through a 1 ml G-25
SEPHADEX spin column. The material passing through this column was
used as template ss cDNA for PCR amplification.
[0077] Amplification of ss cDNA
[0078] 3-10 .mu.l of the ss cDNA was mixed with 10 .mu.l 10.times.
PCR buffer (500 mM KCl, 100 mM Tris-HCl pH 8.3, 15 mM MgCl.sub.2),
1.6 .mu.l of 1.25 mM deoxynucleotide triphosphates, 50 picomoles of
specific immunoglobulin 5' primer, 50 picomoles of specific
immunoglobulin 3' primer, and 2-5 units of thermostable DNA
polymerase (Synthetic Genetics). The reaction volume was brought to
100 .mu.l with water and overlaid with 100 .mu.l of mineral oil.
The reaction mixture was incubated at the following temperatures
for the specified times.
[0079] 94.degree. C. for 1 minute
[0080] 48.degree. C. for 2 minutes
[0081] 72.degree. C. for 2 minutes
[0082] This cycle was repeated 30-35 times. The amplified products
were examined by agarose gel electrophoresis using a 1.2% agarose
gel and molecular weight standards. The amplified immunoglobulin
variable region genes ran approximately between 350-500 bp markers.
The PCR amplified products were then used for cloning into the
appropriate plasmid vector.
EXAMPLE 2
Cloning Monkey Antibody genes
[0083] Since monkey variable region gene sequences, at the cDNA
level, are indistinguishable from human members of the equivalent
gene family, immune responses to monkey/human chimeric antibodies,
if any, are unlikely to be any different than those mounted against
human antibody molecules.
[0084] PCR technology can be used to introduce specific restriction
enzyme sites, including (but not limited to) SalI, BglII, KpnI and
NheI, into the Old World variable region sequences during the PCR
amplification reaction using primers based on those in FIG. 6.
Pre-existing cloned genes were amplified from their specific vector
using these primers to introduce the specific restriction site
which was subsequently used to clone the gene into an expression
vector. Alternatively, these primers were used to amplify directly
from cellular RNA.
[0085] Expression vectors which have been constructed are of two
types. The first (see FIGS. 3 and 4) allows cloned cDNA
immunoglobulin variable regions from monkeys to be inserted into a
cassette vector, using unique restriction sites, in which the
immunoglobulin gene elements are arranged in a genomic
configuration. This type of vector incorporates an immunoglobulin
promoter, the two exons making up the immunoglobulin leader
sequence, two cloning sites SpeI and NheI, downstream splice donor
sequences, an immunoglobulin enhancer region, a human constant
region gene (heavy or light chain) and downstream polyadenylation
signals. In addition, they include a bacterial origin of
replication, a betalactamase gene for bacterial selection, and a
neomycin phosphotransferase gene for G418 selection, or a
xanthine-guamine phosphoribosyl transferase (gpt) gene for
mycophenolic acid selection in mammalian cells. The heavy and light
chain expression vectors use neomycin phosphotransferase (Neo) and
xanthine-guamine phosphoribosyl transferase (Gpt) genes
respectively as the selectable marker.
[0086] The second type of expression system (see FIGS. 5 and 6)
uses immunoglobulin genes in a cDNA configuration. That is, no
introns or splice sites are present between the 5' leader sequence
and the 3' constant region sequences. This type of vector utilizes
heterologous viral promoter/enhancer sequences, driving
immunoglobulin heavy and light chain genes arranged in a tandem
fashion, polyadenylation sequences and a selectable mammalian cell
marker (Neo). The Neo gene can be modified to weaken its
translation, e.g., by changing the codon upstream and adjacent the
start site of the gene from ACC to TCT. In addition, a
dihydrofolate reductase (dhfr) gene is present for subsequent gene
amplification with methotrexate. Monkey immunoglobulin variable
region genes to be cloned into cDNA configured expression vectors
were amplified either from pre-existing cloned sequences in the
shuttle vector (PBS), or directly from RNA with primers containing
either the restriction sites SalI or MluI and NheI, for heavy
chain, or BglII and KpnI or BSIWI for kappa or lambda light chains.
Other potential unique restriction sites however are not
excluded.
[0087] Chimeric heavy and light chain immunoglobulin genes were
introduced separately or sequentially (for genomically configured
constructs), or on the same vector (for cDNA configured
constructs), by electroporation into a producer cell line.
Electroporation was used to introduce linearized DNA constructs
into either Chinese hamster ovary (CHO) cells, or mouse myeloma
cells, followed by single cell cloning of the transfectants into 96
well tissue culture plates. Electroporation conditions using a
BTX-100 (BTX, San Diego) electroporation device and a iml
disposable plastic cuvette gave optimal numbers of transfectants
from a given amount of vector DNA. CHO cells that were adapted to
grow in suspension in serum-free medium (CHO-S SFM II minus
hypoxanthine and thymidine, Gibco) were used in constructs
containing viral regulatory elements.
[0088] Subcloning Ig Variable Region Genes
[0089] The products of the PCR reaction were extracted with
phenol/chloroform and passed through a 1 ml SEPHADEX G-25 spin
column. If the DNA fragment was to be blunt end cloned into a
plasmid 1 .mu.l 1M MgCl.sub.2, 0.5 ml of 1.25 mM deoxynucleotide
triphosphates and 1 .mu.l of Klenow DNA polymerase (5 units) was
added to the total PCR reaction mixture (100 .mu.l) and incubated
at 37.degree. C. for 15 minutes to fill in any 5' overhangs. Before
blunt end cloning into a plasmid, the 5' ends were phosphorylated
as follows; 5 .mu.l of 10 mM ATP, 1 .mu.l of T4 polynucleotide
kinase (10 units) were added to the total reaction mix and
incubated at 37.degree. C. for 30 minutes. Amplified fragments that
contained internal restriction sites were first cut with the
appropriate restriction enzyme and used directly for ligation
without phosphorylation. In both cases the fragment to be cloned
was extracted with phenol/chloroform before ligating into the
appropriate vector.
[0090] For the ligation reaction 10% of the phosphorylated or
restriction enzyme cut-PCR amplified fragment was mixed with
approximately 2 ng of appropriate vector (total volume 8 .mu.l),
previously digested with the restriction enzyme(s). For blunt
end-cloning pbluescript digested with EcoRV was used. For sticky
end cloning the vector TCAE 5.2 or 6.0 or pGenexH or pGenexL, cut
with appropriate restriction enzymes was used. 1 .mu.l of 10.times.
ligation buffer (500 mM Tri-HCl pH 7.6, 100 mM MgCl.sub.2, 10 M
ATP, 10 M dithiothreitol), 1 .mu.l T4 DNA ligase (1 unit) was added
and the reaction allowed to proceed at 14.degree. C. overnight. The
ligated material was used to transform competent E. coli HB101
cells using the standard calcium chloride method of transformation.
The transformed bacteria were selected by growth on LB
ampicillin-containing agar plates. Individual colonies were
selected and grown up overnight in LB medium containing ampicillin
and plasmid DNA extracted using the standard alkaline lysis method.
After restriction analysis to determine which clones contained
immunoglobulin inserts, the DNA was prepared for sequencing.
[0091] Sequencing Cloned Genes
[0092] Cloned immunoglobulin variable region genes were sequenced
using a standard chain termination method. Double stranded plasmid
DNA containing the cloned insert was used as the sequencing
template. Before sequencing, the double stranded DNA was chemically
denatured. DNA was sequenced using T7 DNA polymerase SEQUENASE
(United States Biochemical Corporation, Cleveland, Ohio),
radiolabeled alpha deoxyATP, and the following sequencing primers:
(5' CAGAGCTGGGTACGTCCTCA 3') and (5' GCCCCCAGAGGTGCTCTTGG 3') for
immilnoglobulin G heavy chain variable region in 5' to 3' and 3' to
5' directions respectively. (5' CAGAGCTGGGTACGTGAACC 3') and (5'
GGCTTGAAGCTCCTCAGAGG 3') for immunoglobulin lambda light chain
variable region in 5' to 3' and 3' to 5' directions, respectively.
Reaction products were separated on 6% polyacrylamide gels and
read.
[0093] The results of sequencing a number of Old World monkey
immunoglobulin heavy and light variable region genes are summarized
in FIGS. 9A-9H. Cloning and sequencing cynomolgus immunoglobulin
genes has not been previously described in the literature. Nor,
therefore, has the degree of homology between human and cynomolgus
V region genes been possible to define. The homology between a
single chimpanzee variable lambda gene and its human genomic
counterpart has been described showing only a 2% difference in the
framework regions.
[0094] Transfection and Selection
[0095] After sequencing cloned heavy and light chain variable
region genes, they were sub-cloned into appropriate vectors for
expression. These may be vectors constructed with immunoglobulin
regulatory elements in a genomic configuration (as shown in FIGS. 3
and 4), or with viral regulatory elements using a cDNA
configuration (FIGS. 5 and 6). Appropriate restriction sites (SpeI
and NheI) can be designed into the PCR amplification primers during
the initial amplification step, or conversely amplification primers
containing restriction sites can be used to amplify. mmunoglobulin
genes from the shuttle vectors into which they have been cloned.
Alternatively, immunoglobulin variable region genes may be cloned
directly into expression vectors after PCR amplification from RNA,
so that subcloning is unnecessary.
[0096] Electroporation
[0097] Electroporation was used to either co-transfect heavy and
light chain genomic constructs or sequentially transfect heavy and
light chain genomic constructs into Sp2/0 cells. In sequential
transfections electroporation of the chimeric light chain construct
was followed by selection in mycophenolic acid. Screening culture
supernatants from clones, grown in 96 well plates, for light chain
production with antisera against human light chain constant region
using an ELISA technique, allowed selection of the highest light
chain expressing clones. Subsequent electroporation of light chain
transfectants with a vector containing the monkey/human chimeric
heavy chain immunoglobulin construct allowed the selection of
transfectomas expressing chimeric antibody of the desired
specificity and isotype.
[0098] The light chain construct PGENEX-L (FIGS. 3 and 4) was
transfected into the murine myeloma cell line Sp2/0 by
electroporation as follows. SP2/0 cells at a concentration of
1.times.10.sup.7/ml in transfection buffer (272 mM sucrose, 7 mM
sodium phosphate pH 7.4, 1 MM MgCl.sub.2) were mixed with 50 ug of
PGENEX-L containing the appropriate cloned light chain gene, which
had previously been linearized by digestion with the restriction
enzyme PvuII. The cells were placed into a iml disposable plastic
spectrophotometry cuvette and plate electrodes 3.5 mm apart
inserted into the cuvette. Using a BTX-100 (BTX, Inc.) transfection
apparatus the cells were given a pulse of current for 500
microseconds such that approximately 50% cell death occurred. This
value was determined prior to the transfection by pulsing the
cells, in the absence of DNA, with increasing voltages and
measuring the numbers of cells surviving 24 hours later. The
voltage versus cell viability was plotted graphically and the
voltage corresponding to 50% cell death used for all subsequent
electroporation experiments. Using the BTX-100 apparatus, the
optimal value was found to be a pulse at an amplitude of 200 for
500 microseconds. After pulsing the cells, they were allowed to
recover on ice for 15 minutes before being transferred to 96-well
tissue culture plates in Dulbeccols modified Eagle's medium (DMEM)
containing 5% fetal calf serum and 10% Sp2/0 conditioned medium.
Cells were plated at a concentration at which cell growth was seen
in approximately 1 in 3 of the wells after selection with the
appropriate drug. This parameter was determined for each
electroporation experiment by plating varying numbers of
electroporated cells per well (1000-10,000) and selecting for cells
which have incorporated the plasmid. The number of wells on each
plate which showed cell growth was counted after 2-3 weeks of
selection. Thus, the appropriate number of cells that gave 1 out of
3 positive wells with a given concentration of a particular plasmid
was determined for use in future experiments.
[0099] Directly after electroporation cells were placed in medium
without drug. Fresh medium was added two days after electroporation
containing either G418 or mycophenolic acid for cells exhibiting
neomycin phosphotransferase or guanasyl phosphotransferase activity
respectively. Cells were fed every 2 days for the first week and
then twice a week thereafter. The concentration of drug to use was
determined by incubating cells in the presence of increasing
concentrations of drug and monitoring cell viability. The
concentration of drug used was twice that which gave 100% killing.
For Sp2/0 approximately 1 .mu.g mycophenolic acid/ml was required
and for G418 approximately 800 g/ml.
[0100] Cells were electroporated in several ways, either heavy and
light chain genomic vectors (pGenex-H and pGenex-L) were
co-electroporated, or the light chain was electroporated alone. In
the latter case, clones were screened for high level expression of
chimeric immunoglobulin light chain using an ELISA technique. These
clones were then grown up and electroporated with heavy chain
containing vector. If cDNA tandem gene constructs were used, the
expression vector (TCAE5.2 or TCAE6) was first linearized by
digestion with the restriction enzyme NotI. A single
electroporation was sufficient to achieve integration of both heavy
and light chain genes. After 2-3 weeks supernatants from wells
which continue to grow in the presence of appropriate drug were
assayed for the secretion of chimeric immunoglobulin light chain or
whole immunoglobulin using an ELISA technique. Immunoglobulin genes
in a cDNA configuration were electroporated into either Sp2/0
cells, as described above, or into Chinese Hamster Ovary (CHO)
cells adapted to grow in suspension in serum-free medium. CHO cells
were electroporated using a BTX 600 electroporation apparatus, set
at conditions for achieving maximal numbers of G418 resistant
colonies. These were 210 volts, 400 .mu.F and 13 ohms. After
electroporation, cells were counted, washed in transfection buffer,
resuspended in the same buffer and placed on ice for 15 minutes.
Cells were adjusted to 1.times.10.sup.7 live cells/ml and 400 .mu.l
of cell suspension placed in a 0.4 ml sterile disposable cuvette
(BTX Inc.). 25 .mu.g of Not 1 linearized TCAE 5.2 or TCAE 6 vector
DNA, containing cloned macaque immunoglobulin variable region
genes, were resuspended in TE buffer (10 mM Tris, 1 mM EDTA, pH
8.0) at 1 .mu.g/ml and added to the cell suspension.
Electroporation was carried out by discharging the apparatus using
the automatic charge and pulse button. The cuvette was placed on
ice for 15 minutes, the cells diluted into 120 mls of serum-free
medium and placed into six 96-well plates (200 .mu.l per well
containing approximately 6,667 electroporated or 3,333 live cells
per well). Independent electroporation parameters were established
for this cell line and selection by G418 was at 400 .mu.g/ml.
[0101] Screening for Production of Antibody
[0102] The presence of human, monkey or chimeric antibody secreted
by transfectants was assayed by an ELISA technique as follows:
96-well flat bottom plates (Dynatech) were coated with goat
anti-human IgG or kappa at 200 ng/well in Coating Buffer (sodium
carbonate 0.8 mg/ml, sodium bicarbonate 1.55 mg/ml, pH 9.6) and
incubated for at least 16 hr at 4.degree. C. The coating buffer was
removed and the wells blocked with 120 .mu.l of Blocking Buffer (1%
bovine serum albumin in phosphate buffered saline containing 0.2%
sodium azide) and incubated at 37.degree. C. for 1 hr. Up to 125
.mu.l of cell culture supernatant was added to the wells containing
blocking buffer and incubated 2 hrs at 37.degree. C. The plates
were then washed five times with PBS. 100 .mu.l of horse radish
peroxidase-labeled goat anti-human IgG (or kappa) diluted
1:1000-1:5000 in Dilution Buffer (1% bovine serum albumin, 0.05%
Tween-20, 0.02% sodium azide in PBS) was added. Plates were
incubated at 37.degree. C. for 1 hr then washed five times with
PBS. Chimeric antibody was detected with 100 .mu.l of hydrogen
peroxide and the substrate, 3,3',5,5'-tetramethylbenzid- ine (1:1
v/v) per well. The color reaction was terminated after 2 to 5 min.
with 100 .mu.l of 2M sulfuric acid per well.
[0103] Those of ordinary skill in the art can readily perform
equivalent methodologies to those described above. Examples of such
technology include immortalization of selected B-cells by hybridoma
fusion, as described above, with the cell line K5H6/B5 described by
Carroll et al., 164 J. Experimental Medicine 1566, 1986, or an
equivalent cell line, such as SPAZ4 (available from Sandoz, see,
Ehrlich et al., 34 Clin. Chem. 1681, 1988). Similar cell lines can
be readily constructed by standard techniques using publically
available methodology. Alternatively, immunoglobulin genes may be
cloned from: (a) cells immortalized by viral transformation with
Herpes papio, as described by Markova et al., 30 Vopr Virusol 549,
1985, or with an equivalent virus, (b) by single B-cell cloning to
provide a transient immortalization, as described by Amaroso and
Lipske 145 J. Immunology 3155, 1990, or (c) by use of a recombinant
immunoglobulin bacteriophage libraries, as described by Huse et
al., 246 Science 1275, 1989 and McCafferty et al., 348 Nature 552,
1990. Screening for appropriate antibody containing clones can be
performed by those techniques described above, or equivalent
techniques well known to those of ordinary skill in the art, and
the desired immunoglobulin gene rescued from the immortalized cell
line. In addition, the antibody produced by isolated monkey B cells
can be used in human therapy, without manipulation to form a
chimeric antibody.
[0104] The human constant region may be obtained by standard
techniques, with any desired isotype well known to those of
ordinary skill in the art, and the variable region of a monkey
antibody ligated with that human constant region. Particularly
useful chimeric antibodies against specific cell surface receptors
which can be used in immiinotherapy of humans include CD4, ICAMs,
CD19, CD20, CD8, CD11a, CD11b, CD28, CD18, CD45, CD71, and TCR.
EXAMPLE 3
Cloning and Expressing a Monkey/Human Chimeric Antibody with
Specificity for CD4
[0105] The following is a specific example of the methods and
antibodies of this invention.
[0106] Generation of Monkey Immortalized B-cell Lines
[0107] An adult cynomolgus monkey (White Sands New Mexico Primate
Center) was immunized intramuscularly, at multiple sites, with
150-300 .mu.g of soluble CD4 (sCD4) or cell membranes
(1.times.10.sup.8 cells) from the CD4 positive cell line suptl
using a standard adjuvant. Immunization was repeated every 2-3
weeks a total of six times. The monkey was boosted by injection of
100 .mu.g of sCD4 into the inguinal region of one thigh and one
week later the draining lymph node from the same thigh surgically
removed. Lymphocytes were removed from the lymph node by slicing
the tissue and rinsing with sterile DMEM medium. The cell
suspension was passed through a nylon gauze and collected by
centrifugation at 1000.times. g for 10 minutes.
[0108] Approximately 1.times.10.sup.8 lymphocytes were suspended in
Tris-ammonium chloride buffer (16 mM, pH 7.5) and warmed to
37.degree. C. for 5 minutes to lyse the erythrocytes. Lymphocytes
were collected by centrifugation and resuspended in L-leucine
methyl ester (LME) and incubated at 37.degree. C. for 45 minutes.
The LME treated cells were filtered through a nylon screen and
centrifuged. 1 ml of fetal calf serum was added, the cells
suspended and washed twice in serum-free RPMI. The cells were
counted and mixed into a single 50 ml conical centrifuge tube
together with an equal number of K6H6/B5 heteromyeloma cells,
prewashed twice in serum free medium. Cells were gently suspended
in 1 ml of 50% PEG (polyethylene glycol) added slowly with gentle
stirring over a 1 minute period. The cells were then resuspended by
the addition of 20 ml of serum-free medium over a 5 minute period,
with gentle mixing to dilute out the PEG. After washing twice with
serum-free medium cells were resuspended at a concentration of
5.times.10.sup.5/0.1 ml in RPMI medium, containing 20% fetal calf
serum and gentamycin and placed into 96 well micro tissue culture
plates at 0.1 ml per well. An equal volume of HAT medium (0.1 ml)
was added to each well and the hybrids allowed to grow for 14-17
days before screening.
[0109] Screening of Fused Cell Hybrids for the Production of
Anti-CD4
[0110] The assay to determine anti-CD4 specificity was as follows:
ELISA plates were coated with recombinant sCD4 at a concentration
of loong per well and blocked with 1% bovine serum albumin in PBS.
50 .mu.l aliquots of hybridoma supernatant were removed from each
well and allowed to incubate with the sCD4 coated plates for 60
minutes. Binding was detected by incubation with .sup.125I labeled
goat anti-human or goat anti-monkey Ig for 60 minutes. After
washing four times with distilled water, the wells were counted in
a gamma counter. Positive wells were re-assayed in duplicate and
the hybridoma cells from those wells subcloned three times, first
at 5 cells per well then twice at 1 cell per well. At this stage
anti-sCD4 positives were screened for the ability to bind to cell
surface CD4. This was done by inhibition of binding of an anti-CD4
murine monoclonal, termed lF3, to the CD4 positive cell line supT1.
Briefly this was done by co-incubating different amounts of monkey
anti-CD4 and long of .sup.125I-labeled 1F3 with 3.times.105 supT1
cells/well in a 96 well plate. After incubation for 1 hour at room
temperature (about 20-25.degree. C.) cells were removed by vacuum
onto glass fiber filters. After extensive washing with PBS the
filters were counted in a gamma counter to determine the inhibition
of lF3 binding to supT1 cells by the monkey hybridoma
supernatants.
[0111] A candidate clone was chosen which produced an antibody that
showed strong inhibition against 1F3. The clone we chose was
isotyped using human isotyping reagents and found to be an IgG2
possessing a lambda light chain. This cell line was grown up to
larger numbers for cloning of its immunoglobulin genes.
[0112] Cloning of Heavy and Light Chain Variable Region Genes from
Monkey Immortalized B-cells
[0113] Total RNA was isolated from 1.times.10.sup.7 monkey
immortalized B-cells using the guanidinium isothiocyanate method
described above. One tenth of the total RNA was used to make single
stranded cDNA-using an oligo-dT oligonucleotide primer and reverse
transcriptase, also as described above. One tenth of the amount of
ss cDNA was used to set up PCR reactions. The six PCR reactions
each included one of six 5' V.sub.H family specific oligonucleotide
primers containing a Sal I restriction site together with an IgG 3'
constant region oligonucleotide containing an Nhe I site, both
shown in FIG. 7-1. Similarly, five PCR reactions, utilizing one of
five 5' lambda leader sequence oligonucleotide primers containing a
Bgl II site and a 3' lambda constant region prime containing an Avr
II site, were run. Reaction conditions were as described above.
Each PCR reaction was run in triplicate. The products of each of
the heavy chain and light chain amplification reactions were run on
1.2% agarose gels. The VH4 heavy chain primer (SEQ. ID. NO.: 13: 5'
ACTAAGTCGACATGAAACACCTGTGGTTCTT 3') and lambda primer (SEQ. ID.
NO.: 14: (5' ATCACAGATCTCTCACCATGACCTGCTCCCCTCTCCTCC 3') gave
strong bands on agarose gel electrophoresis. The products of these
reactions were used for cloning into the vector TCAE 6, which
contains human IgG1 and human lambda constant region sequences.
[0114] Cloning of the two variable region genes into the expression
vector TCAE 6 was done sequentially. First, the heavy chain PCR
product and the vector TCAE 6 were digested with the restriction
enzymes Sal I and Nhe I, the products extracted with
phenol/chloroform, and passed through a SEPHADEX G-25 spin column.
The PCR product was ligated to the cut vector overnight at
14.degree. C. in the presence of T4 DNA ligase. Approximately 500
ng total DNA was ligated in a volume of 10 .mu.l with an
insert/vector molar ratio of 10:1. Ligated material was used to
transform XL-1 Blue competent cells (Stratagene) and the
transformed cells plated onto LB agar plates containing 50 g/ml
ampicillin. Colonies of ampicillin resistant bacteria were picked
and grown as 5 ml minicultures. Plasmid DNA was extracted from each
of these cultures by a standard alkaline lysis method cut with the
restriction enzymes Sal I and Nhe I and the products run on a 1.2%
agarose gel. Plasmids with inserts of approximately 450 bp were
used as templates for the subsequent cloning of light chain
variable regions. The products of the light chain PCR reaction as
well the plasmid containing the heavy chain insert were cut with
the restriction enzymes Bgl II and Avr II and ligated together.
Plasmid minicultures were screened by cutting with Bgl II and Avr
II. Digests giving an insert of approximately 400-450 bp were
scored positive. Plasmids containing both Sal I/Nhe I and Bgl
II/Avr II inserts were grown up in larger quantities for DNA
sequencing.
[0115] The tandem chimeric antibody expression vectors TCAE 5.2 and
TCAE 6 were derived from the vector CLDN, which itself is a
derivative of the vector RLDN10b (253 Science 77-79,1991). RLDN10b
in turn is a derivative of the expression vector TND (7 DNA
651-661, 1988)
[0116] RLDN10b differs from the vector TND in the following ways.
The dihydrofolate reductase (DHFR) transcriptional cassette
(promoter, cDNA, and polyadenylation region) was placed inbetween
the tissue plasminogen activator cassette (t-PA expression
cassette) and the neomycin phosphotransferase (NEO) cassette so
that all three cassettes are in tandem and in the same
transcriptional orientation. In addition, the DHFR gene promoter in
CLDN has been replaced by the mouse beta globin major promoter (3
Mol. Cell Biol. 1246-54, 1983) and the t-PA cDNA replaced by a
polylinker. All three eukaryotic transcriptional cassettes
(Expression, DHFR, NEO) can be separated from the bacterial plasmid
DNA (pUC9 derivative) by digestion with the restriction
endonuclease NotI.
[0117] CLDN differs from RLDN10b because the Rous LTR in front of
the polylinker has been replaced by the human cytomegalovirus
immediate early gene promoter enhancer (41 Cell, 521, 1985).
[0118] The expression vectors TCAE 5.2 and TCAE 6 differ from CLDN
in that:
[0119] 1) They contain four transcriptional cassettes (instead of
three), in tandem order:
[0120] (a) A human immunoglobulin light chain constant region
derived via amplification of cDNA by a polymerase chain reaction.
In TCAE 5.2 this is the human immunoglobulin light chain kappa
constant region (Kabat numbering amino acids 108-214, allotype
Km3), and in TCAE 6 the human immunoglobulin light chain lambda
constant region (Kabat numbering amino acids 108-215, genotype Oz
minus, Mcg minus, Ke minus allotype)
[0121] (b) A human immunoglobulin heavy chain constant region; in
both constructs the human immunoglobulin heavy chain was a gamma 1
constant region (Kabat numbering amino acids 114-478 allotype Gm1a,
Gm1z), which was derived via amplification of cDNA by a polymerase
chain reaction.
[0122] (c) DHFR; containing its own eukaryotic promoter and
polyadenylation region.
[0123] (d) NEO; also containing its own eukaryotic promoter and
polyadenylation region.
[0124] 3) The human immunoglobulin light and heavy chain cassettes
contain synthetic signal sequences for secretion of the
immunoglobulin chains
[0125] 4) The human immunoglobulin light and heavy chain cassettes
contain specific DNA linkers which allow for insertion of light and
heavy immunoglobulin variable regions which maintain the
translational reading frame and do not alter the amino acids
normally found in immunoglobulin chains. The incorporation of the
changes described, led to the construction of the vectors TCAE 5.2
and TCAE 6. The cloning of the immunoglobulin light and heavy
variable region genes, from the anti-CD4 heterohybridoma cell line
E9.1, into TCAE 6 led to the construct which is deposited in the
ATCC. The construct, which has been deposited, contains the
cynomolgus monkey immunoglobulin heavy chain variable region and
cynomolgus monkey immunoglobulin light chain variable region, whose
sequences are shown in FIGS. 13 and 14 respectively, cloned from
the anti-CD4 hybridoma cell line E9.1. The heavy chain constant
region is of human origin of the gamma 1 isotype and Gm1a, Gm1z
allotype. The lambda light chain constant region is also of human
origin, of the oz minus, mcg minus genotype and Ke minus allotype.
The immunoglobulin genes are cloned into the mammalian expression
vector TCAE 6, shown in FIG. 6, which, when electroporated into the
mammalian cell line CHO produced a monkey/human anti-CD4 chimeric
antibody. The DNA construct described herein, has been used to
transform the bacterial strain XL-1 Blue, selected in the
antibiotic ampicillin and deposited as a bacterial cell suspension
in sterile LB medium containing 15% glycerol.
[0126] Another useful expression system is one in which the gene
encoding a selective marker is modified to enhance yield of
recombinant systems encoding a desired sequence. For example,
translation initiation impairment of a dominant selectable marker
results in fewer drug resistant colonies compared to a non-impaired
vector, but each individual colony expresses significantly higher
levels of colinked gene product than in the unimpaired vector. For
example, translation initiation is the first step in protein
synthesis. The translation initiation site of the neomycin
phosphotransferase gene (G418 resistance gene) was changed from a
consensus Kozak (sequence--ccAccATGG) to a poor Kozak
(sequence--ccTccATGC). Translational initiation impairment of the
G418 resistance gene resulted in: 1) a significant (5 fold)
reduction in the number of G418 resistant colonies obtained from a
same amount of plasmid DNA transfected per cell, and 2) a
significant increase in the amount of colinked product gene
expressed in each clone. In the clones containing the consensus
Kozak 73% of the colonies screened produced less than 25 ng/ml,
with only 3% producing greater than 100 ng/ml. For clones with the
altered, poorer Kozak, 8% of the colonies screened produced less
than 25 ng/ml, compared with 63% of colonies producing greater than
100 ng/ml. Specifically, referring to FIG. 16 (where TCAE 5.2 has a
consensus Kozak, and TCAE 12 has a poorer Kozak), 258 colonies were
derived from 2 electroporations of 25 .mu.g of DNA which contains a
neomycin phosphotransferase gene with a consensus (unchanged)
translation start site. 201 of these colonies (78%) did not express
any detectable gene product (i.e., <25 ng/ml of chimeric
immunoglobulin), and only 8 colonies (3%) expressed more than 100
ng/ml. 98 colonies were derived from 6 electroporations of 25 .mu.g
of DNA which contains the neomycin phosphotransferase gene with an
altered translation start site. 63% of these colonies were
expressing more than 100 ng/ml, and only 8% of these colonies
expressed less than 25 ng/ml.
[0127] DNA Sequencing
[0128] Plasmid DNA was prepared from 100 ml cultures. It was
further purified by precipitating (1 volume) with a mixture of 2.5M
sodium chloride and 20% polyethylene glycol (6 volumes) on ice for
15 minutes. After centrifugation at 10,000.times. g for 20 minutes,
the pellet was washed with 70% ethanol, recentrifuged and dried in
a Speedivac (Savant). The pellet of DNA was resuspended in
deionized water at a concentration of 150-250 .mu.g/ml. Sequencing
was carried out on 5 .mu.g of double stranded DNA using the
technique of Sanger. Sequencing primers which were homologous to
sequences within the expression vector upstream and downstream of
either the light chain or heavy chain inserts were used. The
inserts were sequenced in both 5' to 3' and 3' to 5' directions.
Two clones of anti-CD4 light chain and two clones of anti-CD4 heavy
chain each generated from separate PCR reactions were sequenced in
parallel in order to determine whether any nucleotide changes had
been introduced during the PCR reaction. Both of the chosen heavy
chain and both light chain clones were found to be identical over
their entire length, confirming that no errors had been introduced
during the amplification process. The sequence of the anti-CD4
heavy and light chains are shown in FIGS. 13 and 14 and Sequence
Listing Nos.: 15 and 16.
[0129] Expression of Monkey/Human Chimeric Anti-CD4
[0130] The expression vector TCAE 5.2 and TCAE 6 are not only able
to be used for stable integrated expression into the cell lines
Sp2/0 and CHO but, because it includes the SV40 origin, is also
able to be expressed transiently in the cell line COS. COS cell
expression was performed as follows: COS cells were seeded one day
before the transfection so that they would be 50-70% confluent the
following day. Culture medium was removed and the cells washed
twice with Transfection Buffer (TB--140 mM NaCl, 25 mM Tris, 5 mM
KCl, 0.5 mM Na.sub.2HPO.sub.4 1 mM MgCl.sub.2, 1 mM CaCl.sub.2). 30
.mu.g of cesium chloride purified TCAE 6 plasmid containing the
anti-CD4 monkey/human chimeric heavy and light immunoglobulin
chains were mixed with 3 ml of DEAE dextran per dish (1 mg/ml in
TB). The DNA was allowed to incubate with the cells for 1 hour at
37.degree. C. DNA solution was removed and replaced with 3 ml of
20% glycerol for 1.5-2.5 minutes, after which the cells were twice
washed with TB. Cells were incubated in 5 ml of fresh medium
containing 100 uM chloroquine for 3-5 hours at 37.degree. C., after
which they were washed twice with medium and incubated with normal
DMEM for 72 hours. Supernatant (100 .mu.l) from the transfected COS
cells was assayed at various dilutions for the presence of antibody
by an ELISA-based technique. Goat anti-human lambda was used to
coat 96 well assay plates and a peroxidase-labeled goat anti-human
IgG as the detection antibody, under standard ELISA conditions. COS
cells were found to produce between 10 and 40 ng/ml of monkey/human
chimeric antibody. Larger volumes of supernatant were concentrated
10 fold and used in a direct binding RIA to CD4 positive supti
cells. The parental whole monkey antibody and an irrelevant human
immilnoglobulin were used as a positive and negative controls
respectively (FIG. 11). Furthermore, the monkey anti-CD4 and the
monkey/human chimeric anti-CD4 were used to inhibit the binding of
a high affinity mouse anti-CD4 (1F3) antibody (FIG. 12). It can be
seen that the monkey/human recombinant antibody (ATCC No. ______)
not only binds to CD4 positive cells but is able to inhibit the
binding of 1F3 to CD4 positive cells in approximately the same
concentrations of wholly monkey antibody or 1F3 itself.
[0131] The following is an example of the methods and antibodies of
this invention.
EXAMPLE 4
Generation of Monkey Antibodies Against Human Lymphocyte
Antigens
[0132] An adult cynomolgus monkey (White Sands New Mexico Primate
Center) was immunized intramuscularly, at multiple sites, with
5.times.10.sup.8 whole CD54 positive human lymphocytes. Cells used
were alternately, SB cells (human B lymphoid line) and activated
peripheral human lymphocytes, activated by pre-incubation with a
mixture of pokeweed mitogen (2.5 mg/ml), phorbol monoacetate (40
rM) and phytohemagglutinin (4 mg/well) with the inclusion of a
standard adjuvant. Immunization was repeated every 2-3 weeks over a
period of 8 months. Sera from the immunized animals were screened
at various times by inhibition of binding of a murine antibody,
84HlO, known to bind to ICAM-1. A saturating amount of 84HlO was
bound to chinese hamster ovary cells (CHO), previously transfected
with an expression vector containing human CD54 c-DNA and selected
for high expression of cell surface CD54, together with increasing
dilutions of monkey serum. The inhibition of 84H10 binding is shown
in FIG. 15.
[0133] Other murine monoclonal antibodies which recognize other
human lymphocyte antigens were tested by inhibition using monkey
sera obtained by the same immunization methods.
[0134] Use
[0135] Antibodies produced in the manner described above, or by
equivalent techniques, can be purified by a combination of affinity
and size exclusion chromatography for characterization in
functional biological assays. These assays include determination of
specificity and binding affinity as well as effector function
associated with the expressed isotype, e.g., ADCC, or complement
fixation. Such antibodies may be used as passive or active
therapeutic agents against a number of human diseases, including B
cell lymphoma, infectious diseases including AIDS, autoimmune and
inflammatory diseases, and transplantation. The antibodies can be
used either in their native form, or as part of an
antibody/chelate, antibody/drug or antibody/toxin complex.
Additionally, whole antibodies or antibody fragments (Fab.sub.2,
Fab, Fv) may be used as imaging reagents or as potential vaccines
or immunogens in active immunotherapy for the generation of
anti-idiotypic responses.
[0136] The amount of antibody useful to produce a therapeutic
effect can be determined by standard techniques well known to those
of ordinary skill in the art. The antibodies will generally be
provided by standard technique within a pharmaceutically acceptable
buffer, and may be administered by any desired route. Because of
the efficacy of the presently claimed antibodies and their
tolerance by humans it is possible to administer these antibodies
repetitively in order to combat various diseases or disease states
within a human.
[0137] The anti-CD4 recombinant antibodies (or fragments thereof)
of this invention are also useful for inducing immunosuppression,
i.e., inducing a suppression of a human's or animal's immune
system. This invention therefore relates to a method of
prophylactically or therapeutically inducing immunosuppression in a
human or other animal in need thereof by administering an
effective, non-toxic amount of such an antibody of this invention
to such human or other animal.
[0138] The ability of the compounds of this invention to induce
immunosuppression may be demonstrated in standard tests used for
this purpose, for example, a mixed lymphocyte reaction test or a
test measuring inhibition of T-cell proliferation measured by
thymidine uptake.
[0139] The fact that the antibodies of this invention have utility
in inducing immunosuppression means that they are useful in the
treatment or prevention of resistance to or rejection of
transplanted organs or tissues (e.g., kidney, heart, lung, bone
marrow, skin, cornea, etc.); the treatment or prevention of
autoimmune, inflammatory, proliferative and hyperproliferative
diseases, and of cutaneous manifestations of immunologically
medicated diseases (e.g., rheumatoid arthritis, lupus
erythematosus, systemic lupus erythematosus, Hashimotos
thyroiditis, multiple sclerosis, myasthenia gravis, type 1
diabetes, uveitis, nephrotic syndrome, psoriasis, atopical
dermatitis, contact dermatitis and further eczematous dermatitides,
seborrheic dermatitis, Lichen planus, Pemplugus, bullous
pemphicjus, Epidermolysis bullosa, urticaria, angioedemas,
vasculitides, erythema, cutaneous eosinophilias, Alopecia areata,
etc.); the treatment of reversible obstructive airways disease,
intestinal inflammations and allergies (e.g., Coeliac disease,
proctitis, eosinophilia gastroenteritis, mastocytosis, Crohn's
disease and ulcerative colitis) and food-related allergies (e.g.,
migraine, rhinitis and eczema).
[0140] One skilled in the art would be able, by routine
experimentation, to determine what an effective, non-toxic amount
of antibody would be for the purpose of inducing immunosuppression.
Generally, however, an effective dosage will be in the range of
about 0.05 to 100 milligrams per kilogram body weight per day.
[0141] The antibodies (or fragments thereof) of this invention
should also be useful for treating tumors in a mammal. More
specifically, they should be useful for reducing tumor size,
inhibiting tumor growth and/or prolonging the survival time of
tumor-bearing animals. Accordingly, this invention also relates to
a method of treating tumors in a human or other animal by
administering to such human or animal an effective, non-toxic
amount of an antibody. One skilled in the art would be able, by
routine experimentation, to determine what an effective, non-toxic
amount of antibody would be for the purpose of treating
carcinogenic tumors. Generally, however, an effective dosage is
expected to be in the range of about 0.05 to 100 milligrams per
kilogram body weight per day.
[0142] The antibodies of the invention may be administered to a
human or other animal in accordance with the aforementioned methods
of treatment in an amount sufficient to produce such effect to a
therapeutic or prophylactic degree. Such antibodies of the
invention can be administered to such human or other animal in a
conventional dosage form prepared by combining the antibody of the
invention with a conventional pharmaceutically acceptable carrier
or diluent according to known techniques. It will be recognized by
one of skill in the art that the form and character of the
pharmaceutically acceptable carrier or diluent is dictated by the
amount of active ingredient with which it is to be combined, the
route of administration and other well-known variables.
[0143] The route of administration of the antibody (or fragment
thereof) of the invention may be oral, parenteral, by inhalation or
topical. The term parenteral as used herein includes intravenous,
intramuscular, subcutaneous, rectal, vaginal or intraperitoneal
administration. The subcutaneous and intramuscular forms of
parenteral administration are generally preferred.
[0144] The daily parenteral and oral dosage regimens for employing
compounds of the invention to prophylactically or therapeutically
induce immunosudpression, or to therapeutically treat carcinogenic
tumors will generally be in the range of about 0.05 to 100, but
preferably about 0.5 to 10, milligrams per kilogram body weight per
day.
[0145] The antibody of the invention may also be administered by
inhalation. By "inhalation" is meant intranasal and oral inhalation
administration. Appropriate dosage forms for such administration,
such as an aerosol formulation or a metered dose inhaler, may be
prepared by conventional techniques. The preferred dosage amount of
a compound of the invention to be employed is generally within the
range of about 10 to 100 milligrams.
[0146] The antibody of the invention may also be administered
topically. By topical administration is meant non-systemic
administration and includes the application of an antibody (or
fragment thereof) compound of the invention externally to the
epidermis, to the buccal cavity and instillation of such an
antibody into the ear, eye and nose, and where it does not
significantly enter the blood stream. By systemic administration is
meant oral, intravenous, intraperitoneal and intramuscular
administration. The amount of an antibody required for therapeutic
or prophylactic effect will, of course, vary with the antibody
chosen, the nature and severity of the condition being treated and
the animal undergoing treatment, and is ultimately at the
discretion of the physician. A suitable topical dose of an antibody
of the invention will generally be within the range of about 1 to
100 milligrams per kilogram body weight daily.
[0147] Formulations
[0148] While it is possible for an antibody or fragment thereof to
be administered alone, it is preferable to present it as a
pharmaceutical formulation. The active ingredient may comprise, for
topical administration, from 0.001% to 10% w/w, e.g., from 1% to 2%
by weight of the formulation, although it may comprise as much as
10% w/w but preferably not in excess of 5% w/w and more preferably
from 0.1% to 1% w/w of the formulation.
[0149] The topical formulations of the present invention, comprise
an active ingredient together with one or more acceptable
carrier(s) therefor and optionally any other therapeutic
ingredients(s). The carrier(s) must be "acceptable" in the sense of
being compatible with the other ingredients of the formulation and
not deleterious to the recipient thereof.
[0150] Formulations suitable for topical administration include
liquid or semi-liquid preparations suitable for penetration through
the skin to the site of where treatment is required, such as
liniments, lotions, creams, ointments or pastes, and drops suitable
for administration to the eye, ear or nose.
[0151] Drops according to the present invention may comprise
sterile aqueous or oily solutions or suspensions and may be
prepared by dissolving the active ingredient in a suitable aqueous
solution of a bactericidal and/or fungicidal agent and/or any other
suitable preservative, and preferably including a surface active
agent. The resulting solution may then be clarified by filtration,
transferred to a suitable container which is then sealed and
sterilized by autoclaving or maintaining at 90.degree.-100.degree.
C. for half an hour. Alternatively, the solution may be sterilized
by filtration and transferred to the container by an aseptic
technique. Examples of bactericidal and fungicidal agents suitable
for inclusion in the drops are phenylmercuric nitrate or acetate
(0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate
(0.01%). Suitable solvents for the preparation of an oily solution
include glycerol, diluted alcohol and propylene glycol.
[0152] Lotions according to the present invention include those
suitable for application to the skin or eye. An eye lotion may
comprise a sterile aqueous solution optionally containing a
bactericide and may be prepared by methods similar to those for the
preparation of drops. Lotions or liniments for application to the
skin may also include an agent to hasten drying and to cool the
skin, such as an alcohol or acetone, and/or a moisturizer such as
glycerol or an oil such as castor oil or arachis oil.
[0153] Creams, ointments or pastes according to the present
invention are semi-solid formulations of the active ingredient for
external application. They may be made by mixing the active
ingredient in finely-divided or powdered form, alone or in solution
or suspension in an aqueous or non-aqueous fluid, with the aid of
suitable machinery, with a greasy or non-greasy basis. The basis
may comprise hydrocarbons such as hard, soft or liquid paraffin,
glycerol, beeswax, a metallic soap; a mucilage; an oil of natural
origin such as almond, corn, arachis, castor or olive oil; wool fat
or its derivatives, or a fatty acid such as stearic or oleic acid
together with an alcohol such as propylene glycol or macrogols. The
formulation may incorporate any suitable surface active agent such
as an anionic, cationic or non-ionic surface active such as
sorbitan esters or polyoxyethylene derivatives thereof. Suspending
agents such as natural gums, cellulose derivatives or inorganic
materials such as silicaceous silicas, and other ingredients such
as lanolin, may also be included.
[0154] It will be recognized by one of skill in the art that the
optimal quantity and spacing of individual dosages of an antibody
or fragment thereof of the invention will be determined by the
nature and extent of the condition being treated, the form, route
and site of administration, and the particular animal being
treated, and that such optimums can be determined by conventional
techniques. It will also be appreciated by one of skill in the art
that the optimal course of treatment, i.e., the number of doses of
an antibody or fragment thereof of the invention given per day for
a defined number of days, can be ascertained by those skilled in
the art using conventional course of treatment determination
tests.
[0155] Without further elaboration, it is believed that one skilled
in the art can, using the preceding description, utilize the
present invention to its fullest extent. The following are,
therefore, to be construed as merely illustrative examples and not
a limitation of the scope of the present invention in any way.
[0156] Capsule Composition
[0157] A pharmaceutical composition of this invention in the form
of a capsule is prepared by filling a standard two-piece hard
gelatin capsule with 50 mg. of an antibody or fragment thereof of
the invention, in powdered form, 100 mg. of lactose, 32 mg. of talc
and 8 mg. of magnesium stearate.
[0158] Injectable Parenteral Composition
[0159] A pharmaceutical composition of this invention in a form
suitable for administration by injection is prepared by stirring
1.5% by weight of an antibody or fragment thereof of the invention
in 10% by volume propylene glycol and water. The solution is
sterilized by filtration.
[0160] Ointment Composition
[0161] Antibody or fragment thereof of the invention 1.0 g.
[0162] White soft paraffin to 100.0 g.
[0163] The antibody or fragment thereof of the invention is
dispersed in a small volume of the vehicle to produce a smooth,
homogeneous product. Collapsible metal tubes are then filled with
the dispersion.
[0164] Topical Cream Composition
[0165] Antibody or fragment thereof of the invention 1.0 g.
[0166] Polawax GP 200 20.0 g.
[0167] Lanolin Anhydrous 2.0 g.
[0168] White Beeswax 2.5 g.
[0169] Methyl hydroxybenzoate 0.1 g.
[0170] Distilled Water to 100.0 g.
[0171] The polawax, beeswax and lanolin are heated together at
60.degree. C. A solution of methyl hydroxybenzoate is added and
homogenization is achieved using high speed stirring. The
temperature is then allowed to fall to 50.degree. C. The antibody
or fragment thereof of the invention is then added and dispersed
throughout, and the composition is allowed to cool with slow speed
stirring.
[0172] Topical Lotion Composition
[0173] Antibody or fragment thereof of the invention 1.0 g.
[0174] Sorbitan Monolaurate 0.6 g. Polysorbate 20 0.6 g.
[0175] Cetostearyl Alcohol 1.2 g. Glycerin 6.0 g.
[0176] Methyl Hydroxybenzoate 0.2 g.
[0177] Purified Water B.P. to 100.00 ml. (B.P.=British
Pharmacopeia)
[0178] The methyl hydroxybenzoate and glycerin are dissolved in 70
ml. of the water at 75.degree. C. The sorbitan monolaurate,
polysorbate 20 and cetostearyl alcohol are melted together at
75.degree. C. and added to the aqueous solution. The resulting
emulsion is homogenized, allowed to cool with continuous stirring
and the antibody or fragment thereof of the invention is added as a
suspension in the remaining water. The whole suspension is stirred
until homogenized.
[0179] Eye Drop Composition
[0180] Antibody or fragment thereof of the invention 0.5 g.
[0181] Methyl Hydroxybenzoate 0.01 g.
[0182] Propyl Hydroxybenzoate 0.04 g.
[0183] Purified Water B.P. to 100.00 ml.
[0184] The methyl and propyl hydroxybenzoates are dissolved in 70
ml. purified water at 75.degree. C. and the resulting solution is
allowed to cool. The antibody or fragment thereof of the invention
is then added, and the solution is sterilized by filtration through
a membrane filter (0.022 .mu.m pore size), and packed aseptically
into suitable sterile containers.
[0185] Composition for Administration by Inhalation
[0186] For an aerosol container with a capacity of 15-20 ml: mix 10
mg. of an antibody or fragment thereof of the invention with
0.2-0.5% of a lubricating agent, such as polysorbate 85 or oleic
acid, and disperse such mixture in a propellant, such as freon,
preferably in a combination of (1,2 dichlorotetrafluoroethane) and
difluorochloromethane and put into an appropriate aerosol container
adapted for either intranasal or oral inhalation administration.
Composition for Adminstration by Inhalation For an aerosol
container with a capacity of 15-20 ml: dissolve 10 mg. of an
antibody or fragment thereof of the invention in ethanol (6-8 ml.),
add 0.1-0.2%; of a lubricating agent, such as polysorbate 85 or
oleic acid; and disperse such in a propellant, such as freon,
preferably in combination of (1.2 dichlorotetrafluoroethane) and
difluorochloromethane, and put into an appropriate aerosol
container adapted for either intranasal or oral inhalation
administration.
[0187] The antibodies and pharmaceutical compositions of the
invention are particularly useful for parenteral administration,
i.e., subcutaneously, intramuscularly or intravenously. The
compositions for parenteral administration will commonly comprise a
solution of an antibody or fragment thereof of the invention or a
cocktail thereof dissolved in an acceptable carrier, preferably an
aqueous carrier. A variety of aqueous carriers may be employed,
e.g., water, buffered water, 0.4% saline, 0.3% glycine, and the
like. These solutions are sterile and generally free of
particulate-matter. These solutions may be sterilized by
conventional, well-known sterilization techniques. The compositions
may contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions such as pH
adjusting and buffering agents, etc. The concentration of the
antibody or fragment thereof of the invention in such
pharmaceutical formulation can vary widely, i.e., from less than
about 0.5%, usually at or at least about 1% to as much as 15 or 20%
by weight, and will be selected primarily based on fluid volumes,
viscosities, etc., according to the particular mode of
administration selected.
[0188] Thus, a pharmaceutical composition of the invention for
intramuscular injection could be prepared to contain 1 mL sterile
buffered water, and 50 mg. of an antibody or fragment thereof of
the invention. Similarly, a pharmaceutical composition of the
invention for intravenous infusion could be made up to contain 250
ml. of sterile Ringer's solution, and 150 mg. of an antibody or
fragment thereof of the invention. Actual methods for preparing
parenterally administrable compositions are well-known or will be
apparent to those skilled in the art, and are described in more
detail in, for example, Remington's Pharmaceutical Science, 15th
ed., Mack Publishing Company, Easton, Pa., hereby incorporated by
reference herein.
[0189] The antibodies (or fragments thereof) of the invention can
be lyophilized for storage and reconstituted in a suitable carrier
prior to use. This technique has been shown to be effective with
conventional immune globulins and art-known lyophilization and
reconstitution techniques can be employed.
[0190] Depending on the intended result, the pharmaceutical
composition of the invention can be administered for prophylactic
and/or therapeutic treatments. In therapeutic application,
compositions are administered to a patient already suffering from a
disease, in an amount sufficient to cure or at least partially
arrest the disease and its complications. In prophylactic
applications, compositions containing the present antibodies or a
cocktail thereof are administered to a patient not already in a
disease state to enhance the patient's resistance.
[0191] Single or multiple administrations of the pharmaceutical
compositions can be carried out with dose levels and pattern being
selected by the treating physician. In any event, the
pharmaceutical composition of the invention should provide a
quantity of the altered antibodies (or fragments thereof) of the
invention sufficient to effectively treat the patient.
[0192] It should also be noted that the antibodies of this
invention may be used for the design and synthesis of either
peptide or non-peptide compounds (mimetics) which would be useful
in the same therapy as the antibody. See, e.g., Saragovi et al.,
Science, 253, 792-795 (1991).
[0193] Deposit
[0194] Strain ______ has been deposited with the ATCC and assigned
number ______. This deposit was made on Jul. 9, 1992.
[0195] Applicants' and their assignees acknowledge their
responsibility to replace these cultures should they die before the
end of the term of a patent issued hereon, 5 years after the last
request for a culture, or 30 years, whichever is the longer, and
its responsibility to notify the depository of the issuance of such
a patent, at which time the deposit will be made irrevocably
available to the public. Until that time the deposit will be made
available to the Commissioner of Patents under the terms of 37
C.F.R. Section 1-14 and 35 U.S.C. Section 112.
[0196] Other embodiments are within the following claims.
Sequence CWU 1
1
114 1 17 DNA Artificial Sequence Description of Artificial Sequence
Primer 1 ccatggactg gacctgg 17 2 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 2 atggacatac tttgttccac
20 3 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 3 ccatggagtt tgggctgagc 20 4 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 4 atgaaacacc tgtggttctt
20 5 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 5 atggggtcaa ccgccatcct 20 6 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 6 atgtctgtct ccttcctcat
20 7 16 DNA Artificial Sequence Description of Artificial Sequence
Primer 7 ttggggcgga tgcact 16 8 17 DNA Artificial Sequence
Description of Artificial Sequence Primer 8 gatgggccct tggtgga 17 9
21 DNA Artificial Sequence Description of Artificial Sequence
Primer 9 gatgacccag tctccakcct c 21 10 21 DNA Artificial Sequence
Description of Artificial Sequence Primer 10 ctcaytyrct gcmcagggtc
c 21 11 19 DNA Artificial Sequence Description of Artificial
Sequence Primer 11 aagacagatg gtgcagcca 19 12 20 DNA Artificial
Sequence Description of Artificial Sequence Primer 12 ggaacagagt
gaccgagggg 20 13 31 DNA Artificial Sequence Description of
Artificial Sequence Primer 13 actaagtcga catgaaacac ctgtggttct t 31
14 39 DNA Artificial Sequence Description of Artificial Sequence
Primer 14 atcacagatc tctcaccatg acctgctccc ctctcctcc 39 15 423 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
anti-CD4 VH nucleic acid 15 gac atg aaa cac ctg tgg ttc ttc ctc ctc
ctg gtg gca gcc ccc aga 48 Met Lys His Leu Trp Phe Phe Leu Leu Leu
Val Ala Ala Pro Arg 1 5 10 15 tgg gtc ttg tcc cag gtg cag ctg cag
gag gcg ggc cca gga ctg gtg 96 Trp Val Leu Ser Gln Val Gln Leu Gln
Glu Ala Gly Pro Gly Leu Val 20 25 30 aag cct tcg gag acc ctg tcc
ctc acc tgc agt gtc tct ggt ggc tcc 144 Lys Pro Ser Glu Thr Leu Ser
Leu Thr Cys Ser Val Ser Gly Gly Ser 35 40 45 atc agc ggt gac tat
tat tgg ttc tgg atc cgc cag tcc cca ggg aag 192 Ile Ser Gly Asp Tyr
Tyr Trp Phe Trp Ile Arg Gln Ser Pro Gly Lys 50 55 60 gga ctg gag
tgg atc ggc tac atc tat ggc agt ggt ggg ggc acc aat 240 Gly Leu Glu
Trp Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn 65 70 75 tac
aat ccc tcc ctc aac aat cga gtc tcc att tca ata gac acg tcc 288 Tyr
Asn Pro Ser Leu Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser 80 85
90 95 aag aac ctc ttc tcc ctg aaa ctg agg tct gtg acc gcc gcg gac
acg 336 Lys Asn Leu Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp
Thr 100 105 110 gcc gtc tat tac tgt gcg agt aat ata ttg aaa tat ctt
cac tgg tta 384 Ala Val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Leu
His Trp Leu 115 120 125 tta tac tgg ggc cag gga gtc ctg gtc acc gtc
tcc tca 423 Leu Tyr Trp Gly Gln Gly Val Leu Val Thr Val Ser 130 135
16 387 DNA Artificial Sequence Description of Artificial Sequence
Synthetic anti-CD4 VL nucleic acid 16 acc atg gcc tgg gct ctg ctg
ctc ctc ggc ctc ctt gct cac ttt aca 48 Met Ala Trp Ala Leu Leu Leu
Leu Gly Leu Leu Ala His Phe Thr 1 5 10 15 gac tct gcg gcc tcc tat
gag ttg agt cag cct cgc tca gtg tcc gtg 96 Asp Ser Ala Ala Ser Tyr
Glu Leu Ser Gln Pro Arg Ser Val Ser Val 20 25 30 tcc cca gga cag
acg gcc ggg ttc acc tgt ggg gga gac aac gtt gga 144 Ser Pro Gly Gln
Thr Ala Gly Phe Thr Cys Gly Gly Asp Asn Val Gly 35 40 45 agg aaa
agt gta cag tgg tac cag cag aag cca ccg cag gcc cct gtg 192 Arg Lys
Ser Val Gln Trp Tyr Gln Gln Lys Pro Pro Gln Ala Pro Val 50 55 60
ctg gtc atc tat gct gac agc gaa cgg ccc tca ggg atc cct gcg cga 240
Leu Val Ile Tyr Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg 65
70 75 ttc tct ggc tcc aac tca ggg aac acc gcc acc ctg acc atc agc
ggg 288 Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser
Gly 80 85 90 95 gtc gag gcc ggg gat gag gct gac tat tac tgt cag gtg
tgg gac agt 336 Val Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Gln Val
Trp Asp Ser 100 105 110 act gct gat cat tgg gtc ttc ggc gga ggg acc
cgg ctg acc gtc cta 384 Thr Ala Asp His Trp Val Phe Gly Gly Gly Thr
Arg Leu Thr Val Leu 115 120 125 ggt 387 Gly 17 139 PRT Artificial
Sequence Description of Artificial Sequence Synthetic anti-CD4 VH
peptide 17 Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro
Arg Trp 1 5 10 15 Val Leu Ser Gln Val Gln Leu Gln Glu Ala Gly Pro
Gly Leu Val Lys 20 25 30 Pro Ser Glu Thr Leu Ser Leu Thr Cys Ser
Val Ser Gly Gly Ser Ile 35 40 45 Ser Gly Asp Tyr Tyr Trp Phe Trp
Ile Arg Gln Ser Pro Gly Lys Gly 50 55 60 Leu Glu Trp Ile Gly Tyr
Ile Tyr Gly Ser Gly Gly Gly Thr Asn Tyr 65 70 75 80 Asn Pro Ser Leu
Asn Asn Arg Val Ser Ile Ser Ile Asp Thr Ser Lys 85 90 95 Asn Leu
Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala 100 105 110
Val Tyr Tyr Cys Ala Ser Asn Ile Leu Lys Tyr Leu His Trp Leu Leu 115
120 125 Tyr Trp Gly Gln Gly Val Leu Val Thr Val Ser 130 135 18 128
PRT Artificial Sequence Description of Artificial Sequence
Synthetic anti-CD4 VL peptide 18 Met Ala Trp Ala Leu Leu Leu Leu
Gly Leu Leu Ala His Phe Thr Asp 1 5 10 15 Ser Ala Ala Ser Tyr Glu
Leu Ser Gln Pro Arg Ser Val Ser Val Ser 20 25 30 Pro Gly Gln Thr
Ala Gly Phe Thr Cys Gly Gly Asp Asn Val Gly Arg 35 40 45 Lys Ser
Val Gln Trp Tyr Gln Gln Lys Pro Pro Gln Ala Pro Val Leu 50 55 60
Val Ile Tyr Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg Phe 65
70 75 80 Ser Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser
Gly Val 85 90 95 Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys Gln Val
Trp Asp Ser Thr 100 105 110 Ala Asp His Trp Val Phe Gly Gly Gly Thr
Arg Leu Thr Val Leu Gly 115 120 125 19 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 19 cagagctggg tacgtcctca
20 20 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 20 gcccccagag gtgctcttgg 20 21 20 DNA Artificial Sequence
Description of Artificial Sequence Primer 21 cagagctggg tacgtgaacc
20 22 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 22 ggcttgaagc tcctcagagg 20 23 57 DNA Unknown Organism
Description of Unknown Organism Monkey 23 atggactgga cctggaggct
cctctttgtg gtggcagcag ctacaggtgc caagtcc 57 24 45 DNA Unknown
Organism Description of Unknown Organism Monkey 24 tgttccacgc
tcctgctgct gaccgtcccg tcctgggttt tgtcc 45 25 33 DNA Unknown
Organism Description of Unknown Organism Monkey 25 ttgctactga
ccgtcccgtc ctgggtcttg tcc 33 26 45 DNA Unknown Organism Description
of Unknown Organism Monkey 26 tgttccacac tcttgctact gaccgtcccg
tcctgggtct tgtcc 45 27 57 DNA Unknown Organism Description of
Unknown Organism Monkey 27 atggagtttg ggctgagctg ggttttcctt
gttgctattt tcaaaggtgt ccagtgt 57 28 57 DNA Unknown Organism
Description of Unknown Organism Monkey 28 atggagtttg ggctgagctg
ggttttcctt gttgctcttt taaagggcgt ccagtgt 57 29 57 DNA Unknown
Organism Description of Unknown Organism Monkey 29 atggagtttg
ggctgagctg ggttttcctt gttgctattt taagaggcgt ccagtgt 57 30 57 DNA
Unknown Organism Description of Unknown Organism Monkey 30
atgaaacacc tgtggttctt cctcctcctg gtggcggctc ccagatgggt cctgtcc 57
31 57 DNA Unknown Organism Description of Unknown Organism Monkey
31 atgaaacacc tgtggttctt cctcctcctg ctggcagctc ccagatgggt ctgttcc
57 32 26 DNA Unknown Organism Description of Unknown Organism
Monkey 32 tggctgttct ccaaggagtc tgttcc 26 33 57 DNA Homo sapiens 33
atggactgga cctggagggt cttctgcttg ctggctgtag caccaggtgc ccactcc 57
34 54 DNA Homo sapiens 34 atggactgga cctggatcct cttcttggtg
gcagcagcca cgcgagtcca ctcc 54 35 57 DNA Homo sapiens 35 atggacatac
tttgttccac gctcctgcta ctgactgtcc cgtcctgggt cttatcc 57 36 57 DNA
Homo sapiens 36 atggagtttg ggctgagctg gctttttctt gtggctattt
taaaaggtgt ccagtgt 57 37 57 DNA Homo sapiens 37 atggagtttg
ggctgagctg ggttttcctt gttgctattt taaaaggtgt ccagtgt 57 38 57 DNA
Homo sapiens 38 atggagcttg ggctgacctg ggttttcctt gttgctcttt
taaaaggtgt ccagtgt 57 39 57 DNA Homo sapiens 39 atggagcttg
ggctgacctg ggttttcctt gttgctcttt taaaaggtgt ccagtgt 57 40 60 DNA
Homo sapiens 40 atgaaacacc tgtggttcct cctcctctgg tgtcagctcc
cagatgtgag ggtcctgtcc 60 41 56 DNA Homo sapiens 41 atgaaacact
gtggttcttc cttctcctgg tggcagctcc cagatgggtc ctgtcc 56 42 26 DNA
Artificial Sequence Description of Artificial Sequence Primer 42
actaagtcga catggactgg acctgg 26 43 31 DNA Artificial Sequence
Description of Artificial Sequence Primer 43 actaagtcga catggacata
ctttgttcca c 31 44 29 DNA Artificial Sequence Description of
Artificial Sequence Primer 44 actaagtcga catggagttt gggctgagc 29 45
31 DNA Artificial Sequence Description of Artificial Sequence
Primer 45 actaagtcga catggggtca accgccatcc t 31 46 31 DNA
Artificial Sequence Description of Artificial Sequence Primer 46
actaagtcga catgtctgtc tccttcctca t 31 47 30 DNA Artificial Sequence
Description of Artificial Sequence Primer 47 ggcagcagcy acgcgtgccc
actccgaggt 30 48 30 DNA Artificial Sequence Description of
Artificial Sequence Primer 48 gaccgtcccg acgcgtgtyt tgtcccaggt 30
49 27 DNA Artificial Sequence Description of Artificial Sequence
Primer 49 gctattttca cgcgtgtcca gtgtgag 27 50 27 DNA Artificial
Sequence Description of Artificial Sequence Primer 50 gcggctccca
cgcgtgtcct gtcccag 27 51 30 DNA Artificial Sequence Description of
Artificial Sequence Primer 51 ggctgttctc acgcgtgtct gtgccgaggt 30
52 128 PRT Homo sapiens MOD_RES (1) Any amino acid; preferably Gln
52 Xaa Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Xaa
1 5 10 15 Ser Val Xaa Xaa Ser Cys Lys Xaa Ser Gly Tyr Thr Phe Ser
Asp Tyr 20 25 30 Xaa Ile His Trp Val Arg Gln Ala Pro Gly Xaa Xaa
Leu Glu Trp Xaa 35 40 45 Gly Xaa Ile Asn Pro Ser Xaa Gly Xaa Thr
Asn Tyr Ala Pro Xaa Phe 50 55 60 Gln Gly Arg Val Thr Xaa Thr Xaa
Asp Xaa Xaa Xaa Asn Xaa Xaa Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu
Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Xaa Tyr
Gly Phe Tyr Ser Asn Asp Tyr Xaa Xaa Xaa Xaa Xaa 100 105 110 Tyr Thr
Xaa Asp Tyr Trp Gly Gln Gly Xaa Leu Val Thr Val Ser Ser 115 120 125
53 121 PRT Artificial Sequence Description of Artificial Sequence
Synthetic monkey clone 53 Xaa Val Gln Leu Val Gln Ser Gly Ala Glu
Val Lys Lys Pro Gly Xaa 1 5 10 15 Ser Val Xaa Xaa Ser Cys Lys Xaa
Ser Gly Phe Asn Phe Gly Asn Tyr 20 25 30 Ala Ile Ser Trp Val Arg
Gln Ala Pro Gly Xaa Xaa Leu Glu Trp Xaa 35 40 45 Gly Trp Ile Asn
Thr Asp Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe 50 55 60 Lys Glu
Arg Val Thr Phe Thr Met Asp Xaa Xaa Xaa Asn Xaa Xaa Tyr 65 70 75 80
Met Lys Ile Ser Leu Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Arg Val Val Gly Thr Thr Tyr Ala Glu Tyr Phe Glu Phe Trp
Gly 100 105 110 Gln Gly Ala Leu Val Thr Val Ser Ser 115 120 54 119
PRT Artificial Sequence Description of Artificial Sequence
Synthetic monkey clone 54 Xaa Val Gln Gln Val Gln Ser Gly Ala Glu
Val Lys Lys Pro Gly Thr 1 5 10 15 Ser Val Xaa Xaa Ser Cys Lys Xaa
Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Tyr Ile Asn Trp Val Arg
Gln Ala Pro Gly Xaa Val Leu Glu Trp Ser 35 40 45 Gly Trp Ile Asn
Pro Ser Asn Gly Asn Thr Gly Tyr Ala Gln Lys Phe 50 55 60 Gln Gly
Arg Val Thr Xaa Thr Xaa Asp Xaa Xaa Xaa Asn Xaa Xaa Tyr 65 70 75 80
Met Glu Leu Asn Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Arg Met Tyr Ser Trp Lys Gly Thr Phe Asp Tyr Trp Gly Gln
Gly 100 105 110 Xaa Leu Val Thr Val Ser Ser 115 55 22 DNA
Artificial Sequence Description of Artificial Sequence Primer 55
cagtgcagct gctcgagtct gg 22 56 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 56 caggtcaact tactcgagtc
tgg 23 57 23 DNA Artificial Sequence Description of Artificial
Sequence Primer 57 gaggtgcagc tgctcgagtc tgg 23 58 23 DNA
Artificial Sequence Description of Artificial Sequence Primer 58
caggtgcagc tgctcgagtc ggg 23 59 23 DNA Artificial Sequence
Description of Artificial Sequence Primer 59 caggtacagc tgctcgagtc
agg 23 60 26 DNA Artificial Sequence Description of Artificial
Sequence Primer 60 ggcggatgcg ctagctgagg agacgg 26 61 38 DNA
Artificial Sequence Description of Artificial Sequence Primer 61
atcacagatc tctcaccatg gtgttgcaga cccaggtc 38 62 37 DNA Artificial
Sequence Description of Artificial Sequence Primer 62 atcacagatc
tctcaccatg grgwccccwg ckcagct 37 63 41 DNA Artificial Sequence
Description of Artificial Sequence Primer 63 atcacagatc tctcaccatg
gacatgaggg tccccgctca g 41 64 41 DNA Artificial Sequence
Description of Artificial Sequence Primer 64 atcacagatc tctcaccatg
gacacvaggg cccccactca g 41 65 39 DNA Artificial Sequence
Description of Artificial Sequence Primer 65 atcacagatc tctcaccatg
gcctgggctc tgctgctcc 39 66 39 DNA Artificial Sequence Description
of Artificial Sequence Primer 66 atcacagatc tctcaccatg gcctgggctc
cactacttc 39 67 39 DNA Artificial Sequence Description of
Artificial Sequence Primer 67 atcacagatc tctcaccatg gcctggactc
ctctctttc 39 68 38 DNA Artificial Sequence Description of
Artificial Sequence Primer 68 atcacagatc tctcaccatg acttggaccc
cactcctc 38 69 36 DNA Artificial Sequence Description of Artificial
Sequence Primer 69 ccgtttgatt tccagcttgg tacctccacc gaacgt 36 70 30
DNA Artificial Sequence Description of Artificial Sequence Primer
70 tgcagcatcc gtacgtttga tttccagctt 30 71 30 DNA Artificial
Sequence Description of Artificial Sequence Primer 71 acctaggacg
gtaagcttgg tacctccgcc 30 72 36 DNA Artificial Sequence Description
of Artificial Sequence Primer 72 acctaggacg gtcassttgg tacctccgcc
gaacac 36 73 27 DNA Artificial Sequence Description of Artificial
Sequence Primer 73 cttgggctga
cctaggacgg tcagccg 27 74 130 PRT Homo sapiens MOD_RES (1) Any amino
acid; preferably Gln 74 Xaa Val Thr Leu Xaa Glu Ser Gly Pro Xaa Leu
Val Lys Pro Thr Xaa 1 5 10 15 Thr Leu Thr Leu Thr Cys Thr Xaa Ser
Gly Phe Ser Xaa Ser Thr Xaa 20 25 30 Gly Met Xaa Val Gly Trp Ile
Arg Gln Pro Pro Gly Lys Xaa Leu Glu 35 40 45 Trp Leu Ala Arg Ile
Asn Xaa Trp Asp Asp Asp Lys Tyr Tyr Ser Thr 50 55 60 Ser Leu Arg
Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln 65 70 75 80 Val
Val Leu Xaa Xaa Xaa Xaa Xaa Asp Pro Xaa Asp Thr Ala Thr Tyr 85 90
95 Tyr Cys Ala Arg Arg Xaa Pro Arg Xaa Xaa Xaa Gly Asp Xaa Gly Xaa
100 105 110 Tyr Xaa Xaa Ala Phe Asp Val Trp Gly Gln Gly Thr Xaa Val
Thr Val 115 120 125 Ser Ser 130 75 116 PRT Artificial Sequence
Description of Artificial Sequence Synthetic monkey clone 75 Xaa
Val Thr Leu Xaa Glu Ser Gly Pro Xaa Leu Val Lys Pro Thr Xaa 1 5 10
15 Thr Leu Thr Leu Thr Cys Thr Xaa Ser Gly Phe Ser Xaa Ser Thr Ser
20 25 30 Gly Thr Gly Tyr Ser Trp Ile Arg Gln Pro Pro Gly Lys Xaa
Leu Glu 35 40 45 Trp Leu Ala Arg Ile Asp Trp Asp Asn Asp Arg Tyr
Tyr Ser Thr Ser 50 55 60 Leu Lys Asn Arg Leu Thr Ile Ser Lys Asp
Thr Ser Lys Asn Gln Val 65 70 75 80 Val Leu Xaa Xaa Xaa Xaa Xaa Asp
Pro Leu Asp Thr Ala Thr Tyr Tyr 85 90 95 Cys Ala Arg Gly Gly Ser
Ile Asp Tyr Trp Gly Gln Gly Val Xaa Val 100 105 110 Thr Val Ser Ser
115 76 121 PRT Artificial Sequence Description of Artificial
Sequence Synthetic monkey clone 76 Xaa Val Thr Leu Xaa Glu Ser Gly
Pro Xaa Leu Val Lys Pro Thr Xaa 1 5 10 15 Thr Leu Thr Leu Thr Cys
Thr Xaa Ser Gly Phe Ser Xaa Ser Ala Ser 20 25 30 Gly Thr Gly Val
Ala Trp Ile Arg Gln Ser Pro Gly Lys Xaa Leu Glu 35 40 45 Trp Leu
Thr Ser Ile Phe Trp Thr Gly Val Lys Tyr Tyr Asn Thr Ser 50 55 60
Leu Lys Asn Arg Leu Thr Ile Ser Ser Asp Thr Ser Lys Asp Gln Val 65
70 75 80 Val Leu Ala Xaa Xaa Xaa Xaa Asp Pro Ile Asp Thr Ala Thr
Tyr Tyr 85 90 95 Cys Gly Arg Gly Val Tyr Trp Ser Gly Tyr Ser Phe
Asp Tyr Trp Gly 100 105 110 Gln Gly Ala Xaa Val Thr Val Ser Ser 115
120 77 125 PRT Artificial Sequence Description of Artificial
Sequence Synthetic monkey clone 77 Xaa Val Thr Leu Xaa Glu Ser Gly
Pro Xaa Leu Val Lys Pro Thr Xaa 1 5 10 15 Thr Leu Thr Leu Thr Cys
Thr Xaa Ser Gly Phe Ser Xaa Ser Thr Ser 20 25 30 Glu Thr Gly Val
Gly Trp Ile Arg Gln Pro Pro Gly Lys Xaa Leu Glu 35 40 45 Trp Leu
Ala Ser Ile Tyr Trp Asn Asp Val Lys Tyr Tyr Ile Thr Phe 50 55 60
Leu Lys Ser Arg Leu Thr Ile Ser Arg Asp Thr Ser Lys Asn Gln Val 65
70 75 80 Val Leu Xaa Xaa Xaa Xaa Xaa Asp Pro Xaa Asp Thr Ala Thr
Tyr Tyr 85 90 95 Cys Ala Arg Ile Pro Gly Thr Ala Gly Thr Val Pro
Tyr Tyr Thr Leu 100 105 110 Asp Ser Trp Gly Gln Gly Ala Val Val Thr
Val Ser Ser 115 120 125 78 130 PRT Homo sapiens MOD_RES (12) Ile,
Ala or Val 78 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Xaa Gln
Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Xaa Ala Ser Gly Phe
Xaa Phe Ser Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Xaa His Ile Glu Glu Lys Xaa
Asn Gly Ser Ala Thr Tyr Tyr Ala Asp 50 55 60 Ser Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Xaa Xaa Lys Asn Xaa 65 70 75 80 Xaa Xaa Leu
Gln Met Xaa Ser Leu Xaa Xaa Glu Asp Thr Ala Xaa Tyr 85 90 95 Xaa
Cys Ala Xaa Asp Pro Glu Val Glu Ser Leu Xaa Xaa Xaa Phe Xaa 100 105
110 Tyr Xaa Xaa Phe Phe Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val
115 120 125 Ser Ser 130 79 123 PRT Artificial Sequence Description
of Artificial Sequence Synthetic monkey clone 79 Glu Val Gln Leu
Glu Glu Ser Gly Gly Gly Leu Xaa Gln Phe Gly Gly 1 5 10 15 Ser Leu
Arg Leu Ser Cys Xaa Ala Ser Gly Phe Xaa Phe Ser Thr Tyr 20 25 30
Asp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35
40 45 Xaa Arg Ile Ser Trp Asn Ser Gly Thr Ile Tyr Tyr Ala Ser Ser
Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Xaa Xaa Lys Asn
Xaa Xaa Xaa 65 70 75 80 Leu Gln Met Xaa Ser Arg Xaa Xaa Glu Asp Thr
Ala Xaa Tyr Xaa Cys 85 90 95 Ala Xaa Gly Thr Ala Leu Cys Ser Asp
Ser Gly Cys Ser Ser Asp Val 100 105 110 Trp Gly Gln Gly Thr Leu Val
Thr Val Ser Ser 115 120 80 122 PRT Artificial Sequence Description
of Artificial Sequence Synthetic monkey clone 80 Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu Xaa Gln Pro Gly Gly 1 5 10 15 Ser Leu
Arg Leu Ser Cys Xaa Ala Ser Gly Phe Xaa Phe Ser Glu Tyr 20 25 30
Ser Ile His Trp Val Arg Gln Ala Gln Gly Lys Gly Leu Arg Trp Val 35
40 45 Xaa Leu Ala Gly Lys Lys Ala Asp Arg Tyr Lys Thr Glu Tyr Ala
Thr 50 55 60 Ala Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Xaa Xaa
Lys Ser Xaa 65 70 75 80 Xaa Xaa Leu Gln Met Thr Ser Leu Xaa Xaa Glu
Asp Thr Ala Xaa Tyr 85 90 95 Xaa Cys Ala Xaa Pro Val Leu Gly Asp
Arg Trp Phe Phe Asp Leu Trp 100 105 110 Gly Gln Gly Thr Pro Ile Thr
Val Ser Ser 115 120 81 128 PRT Artificial Sequence Description of
Artificial Sequence Synthetic monkey clone 81 Glu Val Gln Leu Val
Glu Ser Gly Gly Gly Leu Xaa Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg
Leu Ser Cys Xaa Ala Ser Gly Phe Xaa Phe Ser Ser Tyr 20 25 30 Asp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45 Xaa Tyr Ile Ser Ser Ala Ser Gly Tyr Ile Tyr Tyr Ala Asp Ser Val
50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Phe Xaa Lys Asn Xaa
Xaa Ser 65 70 75 80 Leu Gln Met Xaa Ser Leu Xaa Xaa Glu Asp Thr Ala
Xaa Tyr Xaa Cys 85 90 95 Ala Xaa Gly Gln Pro Val Leu Gln Phe Leu
Glu Trp Leu Leu Pro Thr 100 105 110 Thr Gly Ser Asp Val Trp Gly Pro
Gly Val Leu Val Thr Val Ser Ser 115 120 125 82 116 PRT Artificial
Sequence Description of Artificial Sequence Synthetic monkey clone
82 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Xaa Gln Pro Gly Gly
1 5 10 15 Ser Leu Ser Leu Ser Cys Xaa Ala Ser Gly Phe Xaa Phe Ser
Asn Tyr 20 25 30 Asn Met Asp Trp Val Arg Gln Ser Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45 Xaa Arg Val Ile Arg Lys Gly Ala Arg Thr
Lys Tyr Ala Ala Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg
Asp Xaa Xaa Lys Asn Xaa Xaa Xaa 65 70 75 80 Leu Gln Met Xaa Ser Leu
Xaa Xaa Glu Asp Thr Ala Xaa Tyr Xaa Cys 85 90 95 Ala Xaa Asp Val
Ala Ala Ala Gly Thr Gly Gly Gln Gly Val Leu Val 100 105 110 Thr Val
Ser Ser 115 83 98 PRT Homo sapiens MOD_RES (23) Thr or Ala 83 Gln
Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10
15 Thr Leu Ser Leu Thr Cys Xaa Val Ser Gly Xaa Ser Xaa Ser Ser Ser
20 25 30 Tyr Tyr Trp Ser Trp Ile Arg Gln Xaa Pro Gly Xaa Gly Leu
Glu Trp 35 40 45 Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr
Asn Pro Ser Leu 50 55 60 Lys Ser Arg Val Thr Xaa Ser Xaa Asp Xaa
Xaa Lys Asn Xaa Phe Xaa 65 70 75 80 Leu Lys Leu Xaa Ser Val Thr Ala
Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg 84 125 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
monkey clone 84 Gln Met Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys
Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Xaa Val Ser Gly Xaa
Ser Xaa Ser Ser Ser 20 25 30 Tyr Asp Trp Thr Trp Ile Arg Gln Xaa
Pro Gly Met Gly Leu Glu Trp 35 40 45 Ile Ala Val Ile Ser Gly Asn
Ser Gly Ser Ala Asp Tyr Asn Pro Ser 50 55 60 Leu Lys Asn Arg Val
Thr Xaa Ser Xaa Asp Xaa Xaa Asn Asn Xaa Phe 65 70 75 80 Xaa Leu Lys
Met Thr Ser Val Thr Ala Ala Asp Thr Ala Ile Tyr Tyr 85 90 95 Cys
Ala Arg Gly Asp Val Thr Ser Gly Trp Tyr Arg Gly Tyr Phe Asp 100 105
110 Ser Trp Gly Gln Gly Cys Leu Val Thr Val Ser Ser Gly 115 120 125
85 119 PRT Artificial Sequence Description of Artificial Sequence
Synthetic monkey clone 85 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly
Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Xaa Val
Ser Gly Xaa Ser Xaa Ser Ser Gly 20 25 30 Tyr Tyr Trp Gly Trp Ile
Arg Gln Thr Pro Gly Xaa Gly Leu Glu Trp 35 40 45 Ile Gly Ser Leu
Gln Gly Arg Gly Gly Asn Lys Tyr Leu Asn Leu Cys 50 55 60 Leu Lys
Ser Arg Val Thr Leu Ser Ala Asp Xaa Xaa Lys Asn Xaa Phe 65 70 75 80
Xaa Leu Lys Leu Xaa Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85
90 95 Cys Ala Arg Val Gly Asp Asn Arg Phe Asp Val Trp Gly Pro Gly
Val 100 105 110 Leu Val Thr Val Ser Ser Gly 115 86 124 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
monkey clone 86 Gln Val His Leu Gln Glu Ser Gly Pro Gly Leu Val Lys
Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Xaa
Ser Xaa Ser Ser Ser 20 25 30 Gly Tyr Tyr Trp Gly Trp Ile Arg Gln
Xaa Pro Gly Xaa Gly Leu Glu 35 40 45 Trp Ile Gly Ser Ile His Gly
Ser Gly Gly Ser Asn Ser Leu Asn Pro 50 55 60 Ser Leu Lys Ser Arg
Val Thr Leu Ser Xaa Asp Xaa Xaa Gly Asn Lys 65 70 75 80 Phe Xaa Leu
Lys Leu Xaa Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 85 90 95 Phe
Cys Ala Arg Glu Leu Tyr Ser Ser Ser Pro Tyr Tyr Phe Asp Phe 100 105
110 Trp Gly Gln Gly Val Arg Val Thr Val Ser Ser Gly 115 120 87 116
PRT Artificial Sequence Description of Artificial Sequence
Synthetic monkey clone 87 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly
Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Xaa Val
Ser Gly Xaa Ser Xaa Ser Gly Tyr 20 25 30 Tyr Trp Gly Trp Ile Arg
Gln Thr Pro Gly Xaa Gly Leu Glu Trp Ile 35 40 45 Gly Ser Leu Gln
Gly Arg Gly Gly Asn Lys Tyr Leu Asn Leu Ser Leu 50 55 60 Lys Ser
Arg Val Thr Leu Ser Ala Asp Xaa Xaa Lys Asn Xaa Phe Xaa 65 70 75 80
Leu Lys Leu Xaa Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Arg Gly Asp Asn Arg Phe Asp Val Trp Gly Pro Gly Val Leu
Val 100 105 110 Thr Val Ser Ser 115 88 121 PRT Artificial Sequence
Description of Artificial Sequence Synthetic monkey anti-CD4 88 Gln
Val Gln Leu Gln Ala Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10
15 Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Xaa Ser Xaa Ser Gly Asp
20 25 30 Tyr Tyr Trp Phe Trp Ile Arg Gln Xaa Pro Gly Xaa Gly Leu
Glu Trp 35 40 45 Ile Gly Tyr Ile Tyr Gly Ser Gly Gly Gly Thr Asn
Tyr Asn Pro Ser 50 55 60 Leu Asn Asn Arg Val Ser Xaa Ser Ile Asp
Xaa Xaa Lys Asn Leu Phe 65 70 75 80 Xaa Leu Lys Leu Arg Ser Val Thr
Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Ser Asn Ile Leu
Lys Tyr Leu His Trp Leu Leu Tyr Trp Gly 100 105 110 Gln Gly Val Leu
Val Thr Val Ser Ser 115 120 89 98 PRT Homo sapiens MOD_RES (19) Arg
or Lys 89 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro
Gly Glu 1 5 10 15 Ser Leu Xaa Ile Ser Cys Lys Gly Ser Gly Tyr Ser
Phe Thr Ser Tyr 20 25 30 Trp Ile Gly Trp Val Arg Gln Met Pro Gly
Lys Gly Leu Glu Trp Met 35 40 45 Gly Ile Ile Tyr Pro Gly Asp Ser
Asp Thr Arg Tyr Ser Pro Ser Phe 50 55 60 Gln Gly His Val Thr Ile
Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr 65 70 75 80 Leu Gln Trp Ser
Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Arg 90
123 PRT Artificial Sequence Description of Artificial Sequence
Synthetic monkey clone 90 Glu Val Gln Leu Val Gln Ser Gly Gly Glu
Val Lys Arg Pro Gly Glu 1 5 10 15 Ser Leu Arg Ile Ser Cys Lys Thr
Cys Gly Phe Ser Phe Thr Gly Phe 20 25 30 Trp Ile Ser Trp Val Arg
Gln Val Pro Gly Gln Gly Leu Glu Trp Val 35 40 45 Gly Arg Val Ser
Pro Gly Asp Ser Ile Thr Arg Tyr Asn Pro Ser Phe 50 55 60 Gln Gly
His Val Thr Ile Ser Ala Asp Lys Ser Ile Thr Thr Thr Phe 65 70 75 80
Leu Gln Trp Asn Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85
90 95 Ala Gln Arg Ala Gly Asn Gly Asn Tyr Tyr Gln Asp Phe Tyr Tyr
Trp 100 105 110 Gly His Gly Val Leu Val Thr Val Ser Ser Gly 115 120
91 116 PRT Homo sapiens MOD_RES (13) Val or Ala 91 Asp Ile Gln Met
Thr Gln Ser Pro Ser Ser Leu Ser Xaa Ser Val Gly 1 5 10 15 Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Xaa Xaa Ser 20 25 30
Asp Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala 35
40 45 Pro Lys Leu Leu Ile Tyr Xaa Ala Ser Ser Leu Glu Ser Gly Val
Pro 50 55 60 Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
Leu Thr Ile 65 70 75 80 Ser Xaa Leu Gln Pro Glu Asp Xaa Ala Thr Tyr
Tyr Cys Gln Gln Tyr 85 90 95 Asn Ser Leu Pro Xaa Xaa Tyr Asp Tyr
Thr Phe Gly Gln Gly Thr Lys 100 105 110 Val Glu Ile Lys 115 92 108
PRT Artificial Sequence Description of Artificial Sequence
Synthetic monkey clone 92 Asp Ile Gln Met Thr Gln Ser Pro Ala Ser
Leu Ser Xaa Ser Val Gly 1 5 10 15 Asp Lys Val Thr Ile Thr Cys Arg
Ala Ser Gln Ser Phe Ser Ser Ser 20 25 30 Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Asp Ser Ala Ser
Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50
55 60 Ser Lys Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Xaa Leu Gln
Pro 65 70 75 80 Glu Asp Xaa Ala Ser Tyr Tyr Cys Gln Gln Tyr Tyr Ser
Tyr Pro Arg 85 90 95 Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile
Lys 100 105 93 107 PRT Artificial Sequence Description of
Artificial Sequence Synthetic monkey clone 93 Asp Ile Gln Met Thr
Gln Ser Pro Ala Ser Leu Ser Xaa Ser Val Gly 1 5 10 15 Asp Arg Val
Thr Ile Thr Cys Gln Ala Ser Gln Ser Val Ser Asn Leu 20 25 30 Leu
Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro Leu Ile 35 40
45 Tyr Lys Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Thr Arg
50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn Xaa Leu
Glu Pro 65 70 75 80 Glu Asp Xaa Ala Thr Tyr Phe Cys Gln Gln Gly Asn
Ser Tyr Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile
Lys 100 105 94 107 PRT Artificial Sequence Description of
Artificial Sequence Synthetic monkey clone 94 Asp Ile Gln Met Thr
Gln Ser Pro Ala Ser Leu Ser Xaa Ser Val Gly 1 5 10 15 Asp Arg Val
Thr Val Thr Cys Arg Ala Ser Gln Gly Ile Asn Gln Glu 20 25 30 Leu
Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Thr Leu Leu Ile 35 40
45 Tyr Ala Ala Ser Ser Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ser Ser Xaa Pro
Glu Pro 65 70 75 80 Glu Asp Val Ala Thr Glu Asp Cys Leu Gln Asp Tyr
Met Ser Pro Trp 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile
Lys 100 105 95 49 PRT Artificial Sequence Description of Artificial
Sequence Synthetic monkey clone 95 Asp Ile Gln Met Thr Gln Ser Pro
Ala Ser Leu Ser Xaa Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30 Leu Asn Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Leu 96 112
PRT Homo sapiens MOD_RES (44) Arg or Lys 96 Asp Ile Val Met Thr Gln
Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10 15 Glu Pro Ala Ser
Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser 20 25 30 Asn Gly
Asn Thr Tyr Leu Asn Trp Tyr Leu Gln Xaa Pro Gly Gln Ser 35 40 45
Pro Gln Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 50
55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys
Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys
Met Gln Ala 85 90 95 Leu Gln Ser Pro Tyr Thr Phe Gly Gln Gly Thr
Lys Xaa Glu Ile Xaa 100 105 110 97 112 PRT Artificial Sequence
Description of Artificial Sequence Synthetic monkey clone 97 Asp
Ile Val Met Thr Gln Ser Pro Ala Ser Leu Pro Val Thr Leu Gly 1 5 10
15 Gly Pro Ala Ser Ile Ser Cys Thr Ser Thr Gln Ser Leu Leu Ser Gly
20 25 30 Asn Gly Tyr Ser Tyr Leu Asn Trp Tyr Leu Gln Xaa Pro Gly
Gln Ser 35 40 45 Pro His Leu Leu Ile Tyr Tyr Asp Ser Tyr Arg Ala
Ser Gly Val Pro 50 55 60 Thr Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val
Gly Val Tyr Tyr Cys Met Gln Thr 85 90 95 Leu Gln Ser Pro Phe Thr
Phe Gly Pro Gly Thr Lys Xaa Asp Ile Xaa 100 105 110 98 109 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
monkey clone 98 Asp Leu Ala Met Pro Gln Ser Pro Ala Ser Leu Ala Val
Thr Pro Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Arg Ala Ser Glu
Ser Val Ser Phe Phe 20 25 30 Gly Val Asn Leu Ile His Trp Tyr Leu
Gln Xaa Pro Gly Gln Pro Pro 35 40 45 Gln Leu Leu Ile Tyr Gln Ala
Ser Asn Lys Asp Thr Gly Val Pro Ala 50 55 60 Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Lys Phe Asn 65 70 75 80 Pro Val Glu
Ala Asp Asp Ala Gly Asp Tyr Tyr Cys Leu Gln Ser Lys 85 90 95 Asn
Ser Pro Arg Thr Phe Gly Gly Gly Thr Lys Xaa Glu 100 105 99 109 PRT
Homo sapiens MOD_RES (20) Ser or Ile 99 Ser Tyr Glu Leu Thr Gln Pro
Pro Ser Val Ser Val Ser Pro Gly Gln 1 5 10 15 Thr Ala Arg Xaa Thr
Cys Ser Gly Asp Ala Leu Gly Gln Lys Tyr Val 20 25 30 Tyr Trp Tyr
Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr 35 40 45 Glu
Asp Ser Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55
60 Asn Ser Gly Xaa Thr Ala Thr Leu Thr Ile Ser Gly Xaa Xaa Ala Xaa
65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gln Ala Trp Asp Ser Xaa Thr
Xaa Xaa 85 90 95 Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu
Gly 100 105 100 109 PRT Artificial Sequence Description of
Artificial Sequence Synthetic monkey anti-CD4 100 Ser Tyr Glu Leu
Ser Gln Pro Arg Ser Val Ser Val Ser Pro Gly Gln 1 5 10 15 Thr Ala
Gly Phe Thr Cys Gly Gly Asp Asn Val Gly Arg Lys Ser Val 20 25 30
Gln Trp Tyr Gln Gln Lys Pro Pro Gln Ala Pro Val Leu Val Ile Tyr 35
40 45 Ala Asp Ser Glu Arg Pro Ser Gly Ile Pro Ala Arg Phe Ser Gly
Ser 50 55 60 Asn Ser Gly Xaa Thr Ala Thr Leu Thr Ile Ser Gly Xaa
Xaa Ala Xaa 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp
Ser Thr Ala Asp His 85 90 95 Trp Val Phe Gly Gly Gly Thr Arg Leu
Thr Val Leu Gly 100 105 101 130 PRT Homo sapiens MOD_RES (12) Ile
or Val 101 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Xaa Gln Pro
Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Xaa Ala Ser Gly Phe Thr
Phe Ser Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val 35 40 45 Xaa His Ile Glu Glu Lys Xaa Asn
Gly Ser Ala Thr Tyr Tyr Ala Asp 50 55 60 Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Xaa Xaa Lys Asn Xaa 65 70 75 80 Xaa Xaa Leu Gln
Met Xaa Ser Leu Xaa Xaa Glu Asp Thr Ala Xaa Tyr 85 90 95 Xaa Cys
Xaa Arg Asp Pro Glu Val Glu Ser Leu Xaa Xaa Xaa Phe Xaa 100 105 110
Tyr Xaa Xaa Phe Phe Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val 115
120 125 Ser Ser 130 102 123 PRT Homo sapiens MOD_RES (12) Ile or
Val 102 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Xaa Gln Pro Gly
Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Xaa Ala Ser Gly Phe Thr Phe
Ser Ser Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu Glu Trp Val 35 40 45 Xaa Val Ile Ser Tyr Asp Gly Ser Asn
Glu Tyr Phe Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser
Arg Asp Xaa Xaa Asn Asn Xaa Xaa Xaa 65 70 75 80 Met Gly Met Xaa Ser
Leu Xaa Xaa Glu Asp Thr Ala Xaa Tyr Xaa Cys 85 90 95 Xaa Arg Asp
Arg Val Ala Val Tyr Ala Ser Val Phe Phe Ile Asp Ser 100 105 110 Phe
Asp Ile Trp Gly Gln Gly Thr Gly Val Thr 115 120 103 126 PRT Homo
sapiens MOD_RES (12) Ile or Val 103 Gln Val Gln Leu Val Glu Ser Gly
Gly Gly Val Xaa Gly Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys
Xaa Ala Ser Gly Phe Ser Phe Ser Ser Tyr 20 25 30 Gly Met His Trp
Val Arg Gln Cys Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Xaa Val
Ile Ser Asp Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Xaa Xaa Lys Lys Xaa Xaa Xaa 65
70 75 80 Leu Gln Met Xaa Ser Leu Xaa Asp Glu Asp Thr Ala Xaa Tyr
Xaa Cys 85 90 95 Xaa Lys Gly Val Tyr Cys Ser Ser Ser Ser Cys Tyr
Ser Tyr Tyr Tyr 100 105 110 Tyr His Tyr Met Asp Val Trp Gly Lys Gly
Thr Thr Val Thr 115 120 125 104 128 PRT Homo sapiens MOD_RES (12)
Ile or Val 104 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Xaa Gln
Pro Ser Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Xaa Ala Ser Gly Phe
Thr Phe Ser Ser Tyr 20 25 30 Ala Met His Trp Val Arg Gly Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Xaa Val Ile Ser Tyr Asp Gly
Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr
Ile Ser Arg Asp Xaa Xaa Lys Asn Xaa Xaa Ser 65 70 75 80 Leu Gln Met
Xaa Ser Leu Xaa Xaa Glu Asp Thr Ala Xaa Tyr Xaa Cys 85 90 95 Xaa
Arg Gly Arg Phe Cys Ser Gly Gln Ser Cys Tyr Ser Tyr Tyr Tyr 100 105
110 Tyr Tyr Tyr Met Asp Val Gly Lys Gly Thr Thr Val Thr Val Ser Ser
115 120 125 105 117 PRT Homo sapiens MOD_RES (12) Ile or Val 105
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Xaa Gln Pro Gly Gly 1 5
10 15 Ser Leu Arg Leu Ser Cys Xaa Val Ser Gly Phe Asn Phe Ser Ser
Cys 20 25 30 Thr Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 35 40 45 Xaa Thr Ile Ser Ala Ser Gly Tyr Ala Thr Tyr
Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Ile Thr Ile Ser Arg Asp
Xaa Xaa Lys Asn Xaa Xaa Xaa 65 70 75 80 Leu Gln Met Xaa Ser Leu Xaa
Xaa Glu Asp Ala Ala Xaa Tyr Xaa Cys 85 90 95 Xaa Asn Asn Ile Ser
Glu Thr Leu Asp Ser Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val
Ser Ser 115 106 120 PRT Homo sapiens MOD_RES (12) Ile or Val 106
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Xaa Gln Pro Gly Arg 1 5
10 15 Ser Leu Arg Leu Ser Cys Xaa Ala Ser Gly Phe Asn Phe Gly Asp
Tyr 20 25 30 Ser Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 35 40 45 Xaa Ser Ile Arg Ser Lys Asp Tyr Gly Gly Thr
Thr Glu Tyr Ala Ala 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser
Arg Asp Xaa Xaa Lys Ser Ile 65 70 75 80 Xaa Xaa Leu Gln Met Xaa Ser
Leu Xaa Xaa Glu Asp Thr Ala Xaa Tyr 85 90 95 Xaa Cys Ser Arg Asn
Asn Thr Ser Pro Tyr Phe Asp Tyr Trp Gly Glu 100 105 110 Gly Thr Leu
Val Thr Val Ser Ser 115 120 107 125 PRT Homo sapiens MOD_RES (12)
Ile or Val 107 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Xaa Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Xaa Ala Ser Gly Phe
Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Xaa Ala Ile Ser Gly Ser Gly
Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr
Ile Ser Arg Asp Xaa Xaa Lys Asn Xaa Xaa Xaa 65 70 75 80 Leu Gln Met
Xaa Ser Leu Xaa Xaa Glu Asp Thr Ala Xaa Tyr Xaa Cys 85 90 95 Xaa
Lys Gly Gln Val Leu Tyr Tyr Gly Ser Gly Ser Tyr His Trp Phe 100 105
110 Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125
108 119 PRT Homo sapiens MOD_RES (12) Ile or Val 108 Glu Val Arg
Leu Val Glu Ser Gly Gly Asp Leu Xaa Glu Pro Gly Gly 1 5 10 15 Ser
Leu Arg Val Ser Cys Glu Val Ser Gly Phe Ile Phe Ser Lys Ala 20 25
30 Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Gln Trp Val
35 40 45 Xaa Gln Ile Lys Asn Lys Val Asp Gly Gly Thr Ile Asp Tyr
Ala Ala 50 55 60 Pro Val Lys Gly Arg Phe Ile Ile Ser Arg Asp Xaa
Xaa Lys Ser Xaa 65 70 75 80 Xaa Xaa Leu Gln Met Xaa Ser Leu Lys Ile
Glu Asp Thr Ala Xaa Tyr 85 90 95 Xaa Cys Val Gly Asn Tyr Thr Gly
Thr Val Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser
Ser 115 109 120 PRT Homo sapiens MOD_RES (12) Ile or Val 109 Glu
Met Gln Leu Val Glu Ser Gly Gly Ala Phe Xaa Gln Pro Gly Gly 1 5 10
15 Ser Leu Lys Leu Ser Cys Xaa Ala Ser Gly Phe Asn Phe Ser Asp Ser
20 25 30 Thr Ile His Trp Val Arg Gln Ala Ser Gly Lys Ser Leu Glu
Trp Val 35 40 45 Xaa His Ile Glu Asn Lys Thr Lys Asn Tyr Ala Thr
Ile Tyr Arg Ala 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
Asp Xaa Xaa Lys Asn Xaa 65 70 75 80 Ala Phe Leu Gln Met Asp Ser Leu
Xaa Pro Asp Asp Thr Ala Leu Tyr 85 90 95 Xaa Cys Xaa Pro Pro Pro
Glu Val Glu Ser Leu Arg Ser Trp Gly Arg 100 105 110 Gly Thr Leu Val
Thr Val Ser Ser 115 120 110 128 PRT Unknown Organism Description of
Unknown Organism Monkey 110 Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Xaa Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Xaa Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Asp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Xaa Tyr Ile Ser
Ser Ala Ser Gly Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly
Arg Phe Thr Ile Ser Arg Asp Phe Ala Lys Asn Ser Xaa Ser 65 70 75 80
Leu Gln Met Ser Ser Leu Xaa Xaa Glu Asp Thr Ala Xaa Tyr Xaa Cys 85
90 95 Xaa Arg Gly Gln Pro Val Leu Gln Phe Leu Glu Trp Leu Leu Pro
Thr 100 105 110 Thr Gly Ser Asp Val Trp Gly Pro Gly Val Leu Val Thr
Val Ser Ser 115 120 125 111 116 PRT Unknown Organism Description of
Unknown Organism Monkey 111 Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Ala Gln Pro Gly Gly 1 5 10 15 Ser Leu Ser Leu Ser Cys Val Ala
Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Asn Met Asp Trp Val Arg
Gln Ser Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Xaa Arg Val Ile
Arg Lys Gly Ala Arg Thr Lys Tyr Ala Ala Ser Val 50 55 60 Lys Gly
Arg Phe Thr Ile Ser Arg Asp Xaa Xaa Lys Asn Xaa Xaa Xaa 65 70 75 80
Leu Gln Met Ser Ser Leu Lys Thr Glu Asp Thr Ala Xaa Tyr Xaa Cys 85
90 95 Xaa Arg Asp Val Ala Ala Ala Gly Thr Gly Gly Gln Gly Val Leu
Val 100 105 110 Thr Val Ser Ser 115 112 123 PRT Unknown Organism
Description of Unknown Organism Monkey 112 Glu Val Gln Leu Glu Glu
Ser Gly Gly Gly Leu Xaa Gln Phe Gly Gly 1 5 10 15 Ser Leu Arg Leu
Ser Cys Xaa Ala Ser Gly Phe Thr Phe Ser Thr Tyr 20 25 30 Asp Met
Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Xaa Arg Ile Ser Trp Asn Ser Gly Thr Ile Tyr Tyr Ala Ser
Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Xaa Xaa Lys
Asn Xaa Xaa Xaa 65 70 75 80 Leu Gln Met Xaa Arg Leu Xaa Xaa Glu Asp
Thr Ala Xaa Tyr Xaa Cys 85 90 95 Xaa Arg Gly Thr Ala Leu Cys Ser
Asp Ser Gly Cys Ser Ser Asp Val 100 105 110 Trp Gly Gln Gly Thr Leu
Val Thr Val Ser Ser 115 120 113 122 PRT Unknown Organism
Description of Unknown Organism Monkey 113 Glu Val Gln Leu Val Glu
Ser Gly Gly Gly Leu Xaa Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu
Ser Cys Xaa Ala Ser Gly Phe Ser Phe Ser Glu Tyr 20 25 30 Ser Ile
His Trp Val Arg Gln Ala Gln Gly Lys Gly Leu Arg Trp Val 35 40 45
Xaa Leu Ala Gly Lys Lys Ala Asp Arg Tyr Lys Thr Glu Tyr Ala Thr 50
55 60 Ala Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Xaa Xaa Lys Ser
Xaa 65 70 75 80 Xaa Xaa Leu Gln Met Xaa Thr Leu Xaa Xaa Glu Asp Thr
Ala Xaa Tyr 85 90 95 Xaa Cys Xaa Arg Pro Val Leu Gly Asp Arg Trp
Phe Phe Asp Leu Trp 100 105 110 Gly Gln Gly Thr Pro Ile Thr Ile Ser
Ser 115 120 114 130 PRT Homo sapiens MOD_RES (1) Any amino acid 114
Xaa Val Thr Leu Arg Glu Ser Gly Pro Xaa Leu Xaa Lys Pro Thr Glu 1 5
10 15 Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Thr
Xaa 20 25 30 Gly Met Xaa Val Gly Trp Ile Arg Gln Pro Pro Gly Lys
Xaa Leu Glu 35 40 45 Trp Leu Xaa Arg Ile Asn Xaa Trp Asp Asp Asp
Lys Tyr Tyr Ser Thr 50 55 60 Ser Leu Arg Ser Arg Leu Thr Ile Ser
Lys Asp Thr Xaa Lys Asn Gln 65 70 75 80 Val Val Leu Xaa Xaa Xaa Xaa
Xaa Asp Pro Xaa Asp Thr Ala Thr Tyr 85 90 95 Xaa Cys Xaa Arg Arg
Xaa Pro Arg Xaa Xaa Xaa Gly Asp Xaa Gly Xaa 100 105 110 Tyr Xaa Xaa
Ala Phe Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val 115 120 125 Ser
Ser 130
* * * * *