U.S. patent application number 09/855186 was filed with the patent office on 2002-10-10 for cytokine immunoconjugates.
Invention is credited to Gillies, Stephen D..
Application Number | 20020146388 09/855186 |
Document ID | / |
Family ID | 27086679 |
Filed Date | 2002-10-10 |
United States Patent
Application |
20020146388 |
Kind Code |
A1 |
Gillies, Stephen D. |
October 10, 2002 |
Cytokine immunoconjugates
Abstract
Immunoconjugates for the selective delivery of a cytokine to a
target cell are disclosed. The immunoconjugates are comprised of an
immunoglobulin heavy chain having a specificity for the target
cell, such as a cancer or virus-infected cell, and a cytokine, such
as lymphotoxin, tumor necrosis factor alpha, interleukin-2, or
granulocyte-macrophage colony stimulating factor, joined via Aits
amino terminal amino acid to the carboxy-Aterminus of the
immunoglobulin. Nucleic acid sequences encoding these
immunoconjugates and methods of their preparation by genetic
engineering techniques are also disclosed.
Inventors: |
Gillies, Stephen D.;
(Carlisle, MA) |
Correspondence
Address: |
TESTA, HURWITZ & THIBEAULT, LLP
HIGH STREET TOWER
125 HIGH STREET
BOSTON
MA
02110
US
|
Family ID: |
27086679 |
Appl. No.: |
09/855186 |
Filed: |
May 14, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09855186 |
May 14, 2001 |
|
|
|
08937222 |
Sep 11, 1997 |
|
|
|
08937222 |
Sep 11, 1997 |
|
|
|
08652847 |
May 23, 1996 |
|
|
|
08652847 |
May 23, 1996 |
|
|
|
08281238 |
Jul 27, 1994 |
|
|
|
08281238 |
Jul 27, 1994 |
|
|
|
07788765 |
Nov 7, 1991 |
|
|
|
07788765 |
Nov 7, 1991 |
|
|
|
07612099 |
Nov 9, 1990 |
|
|
|
Current U.S.
Class: |
424/85.1 ;
424/133.1; 424/85.2; 530/351; 530/391.1 |
Current CPC
Class: |
C07K 16/06 20130101;
A61K 47/6877 20170801; C07K 14/525 20130101; C07K 16/18 20130101;
C07K 2319/00 20130101; C07K 2317/24 20130101; A61K 38/00 20130101;
C07K 14/535 20130101; A61K 47/6845 20170801; C07K 14/5255 20130101;
A61K 47/6813 20170801; C07K 16/30 20130101 |
Class at
Publication: |
424/85.1 ;
424/133.1; 424/85.2; 530/351; 530/391.1 |
International
Class: |
A61K 039/395; C07K
016/46; C07K 014/19; C07K 014/20 |
Claims
What is claimed is:
1. A chimeric immunoglobulin (Ig) chain comprising an Ig heavy
chain and a cytokine.
2. The chimeric Ig chain of claim 1, wherein the Ig heavy chain is
joined at its carboxy-terminus by a peptide bond to the amino
terminal amino acid of the cytokine.
3. The chimeric Ig chain of claim 1, wherein the Ig heavy chain
comprises CH1, CH2, and CH3 domains.
4. The chimeric Ig chain of claim 1, wherein a proteolytic cleavage
site is located between the Ig heavy chain and the cytokine.
5. The chimeric Ig chain of claim 1, wherein the variable region is
derived from a mouse and the constant region is derived from a
human antibody.
6. The chimeric Ig chain of claim 1, wherein the variable region of
the Ig heavy chain is derived from an Ig specific for a cancer cell
or a virus-infected cell.
7. The conjugate of claim 6, wherein the variable region is derived
from an Ig specific for a tumor-associated antigen or a viral
antigen.
8. The chimeric Ig chain of claim 1, wherein the cytokine is tumor
necrosis factor alpha.
9. The chimeric Ig chain of claim 1, wherein the cytokine is
interleukin-2.
10. The chimeric Ig chain of claim 1, wherein the cytokine is a
lymphokine.
11. The chimeric Ig chain of claim 10, wherein the lymphokine is a
lymphotoxin.
12. The chimeric Ig chain of claim 10, wherein the lymphokine is
granulocyte-macrophage colony stimulating factor.
13. The chimeric Ig chain of claim 10, wherein the lymphokine is a
protein which forms a dimeric or multimeric structure.
14. A chimeric immunoglobulin (Ig) chain comprising an Ig heavy
chain having a variable region specific for a target cell antigen
and a heavy chain including CH1, CH2, and CH3 domains, joined,
through a peptide bond, to the amino terminus amino acid of a
cytokine.
15. The chimeric Ig chain of claim 14, wherein the cytokine is
selected from the group consisting of lymphotoxin, interleukin-2,
tumor necrosis factor, and granulocyte-macrophage colony
stimulating factor.
16. A cytokine immunoconjugate comprising: (a) a chimeric
immunoglobulin (Ig) chain including an Ig heavy chain having a
variable region specific for a cancer cell or virus-infected cell,
joined at the carboxy-terminus of its constant region by a peptide
bond to a cytokine; and (b) an Ig light chain having a variable
region specific for the cancer or virus-infected cell, said heavy
and light chains forming a functional antigen-binding site.
17. The immunoconjugate of claim 16, wherein the chimeric heavy
chain has a constant region comprising CH1, CH2, and CH3
domains.
18. The immunoconjugate of claim 16, wherein the cytokine is
interleukin-2.
19. The immunoconjugate of claim 16, wherein the cytokine is tumor
necrosis factor alpha.
20. The immunoconjugate of claim 16, wherein the cytokine is a
lymphokine.
21. The immunoconjugate of claim 20, wherein the lymphokine is
lymphotoxin.
22. The immunoconjugate of claim 20, wherein the lymphokine is
granulocyte-macrophage stimulating factor.
23. A nucleic acid encoding a chimeric immunoglobulin (Ig) chain
comprising an Ig heavy chain and a cytokine.
24. The nucleic acid of claim 23 which is DNA.
25. The nucleic acid of claim 23, wherein the Ig heavy chain
comprises CH1, CH2, and CH3 domains.
26. The nucleic acid of claim 23, wherein the variable region is
derived from an Ig specific for a cancer cell or a virus-infected
cell.
27. The nucleic acid of claim 26, wherein the variable region is
derived from an Ig specific for a tumor-associated antigen or a
viral antigen.
28. The nucleic acid of claim 23, wherein a proteolytic cleavage
site is located between the Ig heavy chain and the cytokine.
29. The nucleic acid of claim 23, wherein the variable region is
derived from a mouse antibody and the constant region is derived
from a human antibody.
30. The nucleic acid of claim 23, wherein the cytokine is
interleukin-2.
31. The nucleic acid of claim 23, wherein the cytokine is tumor
necrosis factor alpha.
32. The nucleic acid of claim 23, wherein the cytokine is a
lymphokine.
33. The nucleic acid of claim 32, wherein the lymphokine is a
protein which forms a dimeric or multimeric structure.
34. The nucleic acid of claim 32, wherein the lymphokine is a
lymphotoxin.
35. The nucleic acid of chain 32, wherein the lymphokine is
granulocyte-macrophage colony stimulating factor.
36. A recombinant DNA encoding a chimeric immunoglobulin (Ig)
chain, comprising an Ig heavy chain having a variable region
specific for a target cell antigen and heavy chain having CH1, CH2
and CH3 domain, joined, through a peptide bond, to the amino
terminal amino acid of a cytokine.
37. The DNA construct of claim 35, wherein the cytokine is selected
from the group consisting of tumor necrosis factor alpha,
interleukin-2, lymphotoxin, and granulocyte-macrophage colony
stimulating factor.
38. A cell line transfected with the nucleic acid of claim 23.
39. A cell line transfected with the nucleic acid of claim 36.
40. A cell line of claim 23 which is a myeloma cell line.
41. A cell line of claim 36 which is a myeloma cell line.
42. A method of selectively delivering a cytokine to a target cell,
comprising: (a) providing a cytokine immunoconjugate including: a
chimeric immunoglobulin (Ig) chain comprising an Ig heavy chain
having a variable region specific for the target cell joined at the
carboxy terminus of its constant region by a peptide bond to a
cytokine, and an Ig light chain combined with the chimeric Ig heavy
chain, forming a functional antigen-binding site; and (b)
administering to a subject harboring the target cell an amount of
the immunoconjugate sufficient to reach the target cell.
43. The method of claim 42 wherein said target cell is a cancer
cell or a virus-infected cell.
44. The method of claim 42, wherein the chimeric heavy chain has a
constant region comprising CH1, CH2, and CH3 domains.
45. The method of claim 42, wherein the cytokine is selected from
the group consisting of lymphotoxin, interleukin-2, tumor necrosis
factor alpha, and granulocyte-macrophage colony stimulating factor.
Description
[0001] This application is a continuation-in-part of copending
application Ser. No. 612,099, filed Nov. 9, 1990, the disclosure of
which is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] The present invention relates generally to therapies
involving the selective destruction of cells in vivo and to
compositions of matter useful in the treatment of various cancers
and viral infections. In particular, this invention relates to
genetically engineered antibody fusion constructs capable of
targeting an infected cell, and eliciting a localized inflammatory
response such that the cell is killed or neutralized.
[0003] Tumor necrosis factor (TNF.varies.) and lymphotoxin (LT or
TNF.beta.) were first identified on the basis of their ability to
directly kill certain tumors. However, many other biological
activities are now attributed to these closely related cytokines.
These include effects on a variety of cell types, such as the
induction of histocompatibility antigens and adhesion receptors, as
well as those resulting in inflammation, vascular permeability
changes and mononuclear cell infiltration (Goeddel, D. V. et al.
(1986) Symp. Quant. Biol. 51:597, Cold Spring Harbor; Beutler, B.
and Cerami, A. (1988) Ann. Rev. Biochem. 57:505; Paul N. L. and
Ruddle, N. H. (1988) Ann. Rev. Immunol. 6:407). The very short
half-life of both TNF.varies. and LT ensures that these
inflammatory reactions do not occur systematically, but only at the
sites of release from TNF-producing cells.
[0004] This ability to elicit a localized inflammatory response
could be used in the treatment of solid tumors or other diseased
tissue. For example, if it were possible to specifically deliver
either TNF.varies. or LT to a tumor site, a local inflammatory
response could lead to an influx of effector cells such as natural
killer cells, large granular lymphocytes, and eosinophils, i.e.,
the cells that are needed for antibody-dependent cellular
cytotoxicity (ADCC) activity.
[0005] A way to deliver the lymphokine to a specific site in vivo
is to conjugate it to an immunoglobulin specific for the site.
However, the fusion of protein domains to the carboxy-termini of
immunoglobulin chains or fragments can have unexpected consequences
for the activities of both the protein to be fused and the
immunoglobulin, particularly as far as antigen binding, assembly
and effector functions are concerned. For example, the desired
biological functions of the individual proteins may not be
maintained in the final product.
[0006] Another potential problem with expressing proteins, such as
the lymphokine LT, as a fusion protein to an immunoglobulin chain
is that the native molecule exists in solution as a trimer and
binds more efficiently to its receptor in this form. Thus, it seems
unlikely that trimerization could still occur when LT is attached
to an immunoglobulin heavy (H) chain via amino terminus and is
assembled into an intact Ig molecule containing two paired H chain
fusion polypeptides. Secondly, the ability of the fused LT to bind
its receptor may be severely compromised if a free amino terminus
is required for receptor binding activity. In fact, it has been
postulated that the amino and carboxy-termini of TNF.varies., and,
by analogy, LT, together form a structure that is required for
receptor interaction.
[0007] It is an object of the invention to provide compositions of
matter capable of selectively destroying cells in vivo, and
therapeutic methods for accomplishing this. It is also an object of
the invention to provide compositions of matter and therapeutic
methods for selectively delivering a cytokine to a target cell for
the purpose of destroying the target cell either directly or by
creating an environment lethal to the target cell.
SUMMARY OF THE INVENTION
[0008] This invention relates to immunoconjugates which include an
immunoglobulin (Ig), typically a heavy chain, and a cytokine, and
to the use of the immunoconjugates to treat disease. The
immunoconjugates retain the antigen-binding activity of the Ig and
the biological activity of the cytokine and can be used to
specifically deliver the cytokine to the target cell.
[0009] The term "cytokinel" is used herein to describe proteins,
analogs thereof, and fragments thereof which are produced and
excreted by a cell, and which elicit a specific response in a cell
which has a receptor for that cytokine. Preferable cytokines
include the interleukins such as interleukin-2 (IL-2),
hematopoietic factors such as granulocyte-macrophage colony
stimulating factor (GM-CSF), and tumor necrosis factor alpha
(TNF.varies.).
[0010] The term "lymphokine" as used herein describes proteins,
analogs thereof, and fragments thereon produced by activated
lymphocytes, and having the ability to elicit a specific response
in a cell which has a receptor for that lymphokine, e.g.,
lymphotoxins. Lymphokines are a particular type of cytokine.
[0011] In preferred embodiments, the immunoconjugate comprises a
chimeric Ig chain having a variable region specific for a target
antigen and a constant region linked through a peptide bond at the
carboxy terminus of the heavy chain to the cytokine.
[0012] Immunoconjugates of the invention may be considered chimeric
by virtue of two aspects of their structure. First, the
immunoconjugate is chimeric in that it includes an immunoglobulin
chain (typically but not exclusively a heavy chain) of appropriate
antigen binding specificity fused to a given cytokine. Second, an
immunoconjugate of the invention may be chimeric in the sense that
it includes a variable region and a constant region which may be
the constant region normally associated with the variable region,
or a different one and thus a V/C chimera; e.g., variable and
constant regions from different naturally occurring antibody
molecules or from different species. Also embraced within the term
"immunoconjugate" are constructs having a binding domain comprising
framework regions and variable regions (i.e., complementarity
determining regions) from different species, such as are disclosed
by Greg Winter et al., GB2, 188, 638. Preferably, the cytokine of
the immunoconjugate can be a protein which naturally forms a
dimeric or multimeric structure when unfused, such as LT or
TNF.varies..
[0013] In a preferred embodiment, the chimeric Ig chain comprises a
heavy (H) chain which includes the CH1, CH2 and CH3 domains. A
proteolytic cleavage site may be located between the Ig heavy chain
and the cytokine so that, when the conjugate reaches the target
cell, the cytokine is cleaved from the heavy chain. A "proteolytic
cleavage site" is an amino acid sequence recognizable by a protease
with cleaves either within or proximal to the sequence. Preferably,
the variable region is derived from a mouse (i.e. its DNA sequence
or its amino acid sequence is based on a DNA or amino acid sequence
of mouse origin) and the constant region (preferably including the
framework region amino acids of the variable region) is derived
from a human; and the variable region of the heavy chain is derived
from an Ig specific for a virus-infected cell, or for a
tumor-associated or viral antigen. Preferably, the chimeric Ig
chain can be assembled into the immunoconjugate by combining it
with an appropriate counterpart (light or heavy) chain to form a
monovalent antigen-binding region, which can then be associated to
produce a divalent immunoconjugate specific for the target
antigen.
[0014] The invention also features DNA constructs encoding the
above-described immunoconjugates, and cell lines, e.g., myelomas,
transfected with these constructs.
[0015] The invention also includes a method of selectively
delivering a cytokine to a target cell, which method includes
providing a cytokine immunoconjugate including a chimeric Ig chain
including an Ig heavy chain having a variable region specific for
the target cell and a constant region joined at its carboxy
terminus by a peptide bond to a cytokine, and an Ig light chain
combined with the chimeric Ig heavy chain, forming a functional
antigen-binding site, and administering the immunoconjugate in an
amount sufficient to reach the target cell to a subject harboring
the target cell.
[0016] The invention thus provides an immunoconjugate in which the
antigen binding specificity and activity of an antibody are
combined in one molecule with the potent biological activity of a
cytokine. An immunoconjugate of the invention can be used to
deliver selectively a cytokine to a target cell in vivo so that the
cytokine can exert a localized biological effect, such as a local
inflammatory response, stimulation of T cell growth and activation,
and ADCC activity. Such conjugates, depending on their specificity
and biological activity can be used to treat diseases involving
viral infections, or cancer, by targeted cell lysis, according to
methods of the invention.
DESCRIPTION OF THE DRAWINGS
[0017] The foregoing and other objects of the present invention,
and the various features thereof, may be more fully understood from
the following description, when read together with the accompanying
drawings, in which:
[0018] FIG. 1 is a schematic representation of one embodiment of
the immunoconjugate of the present invention;
[0019] FIG. 2 is a diagram of the construction of fusion proteins
between LT and the human Ig H chain; wherein FIG. 2A is a map of a
human C.gamma.l gene fragment cloned in plasmid pBR322; FIG. 2B
shows the C.gamma.l gene fused to LT at the end of the CH2 domain;
FIG. 2C shows the C.gamma.l gene fused to LT at the end of the CH3
domain; FIG. 2D shows the cDNA encoding LT cloned in expression
vector pDEM including promoter (arrow), the natural leader peptide
of LT (open box), the first residue of the mature protein (+1) and
mouse .kappa. L-chain poly A and 3'untranslated sequence. Open
boxes represent protein coding regions of C.gamma.l in A-C; black
boxes represent synthetic linkers used to join the protein coding
sequences; and striped boxes represent LT coding sequences;
[0020] FIG. 3 is a photograph of an SDS-polyacrylamide gel showing
an analysis of fusion protein chain assembly, wherein chimeric
ch14.18 antibody is shown in lanes 1 and 4; CH2-LT is shown in
lanes 2 and 5; and CH3-LT is shown in lanes 3 and 6. The position
of stained marker proteins and their apparent molecular weights are
indicated. The dried gel was exposed to film for either 4 hr (lanes
1 and 4) or 18 hr. Cells were labeled with .sup.35S-methionine and
secreted proteins were precipitated with an anti-human .kappa.
antiserum and protein A and analyzed on an SDS gel either reduced
(lanes 1-3) or unreduced (lanes 4-6);
[0021] FIG. 4 is a graph showing the comparison of LT cytolytic
activities for native LT (.DELTA.--.DELTA.) CH2-LT
(.largecircle.--.largecircle.) or CH3-LT
(.largecircle.--.largecircle., filled in) immunoconjugates. A
sensitive clone of the mouse fibroblast line 929 was used in the
1-day assay with mitomycin C. Relative cell survival was
quantitated by staining with crystal violet and measuring the
absorbance at 630 nm. FIG. 4A shows culture supernatants from
transfected cells assayed after first quantitating the conjugates
by ELISA. FIG. 4B shows purified proteins assayed following protein
A Sepharose or immunoaffinity chromatography;
[0022] FIG. 5 is a graph of the effect of pH during purification on
the cytostatic activity of CH3-LT. The activities of native LT
(.largecircle.--.largecircle.), CH3-LT in culture supernatant
(.DELTA.--.DELTA.), CH3-LT purified by protein A Sepharose
chromatography (.sunburst.--.sunburst.) and CH3-LT purified at pH
6.5 (.DELTA.--.DELTA.) were compared in the cytostatic assay (in
the absence of mitomycin C) using a mouse 929 subclone;
[0023] FIG. 6 is a graph of the cytolytic and cytostatic activities
of LT and CH3-LT GD2-positive M21 human melanoma cells. M21 cells
were seeded in 96-well plates in the [Bpresence (FIG. 6A) or
absence (FIG. 6B) of mitomycin C and dilutions of LT
(.largecircle.--.largecircle.) or CH3-LT
(.largecircle.--.largecircle., filled in) were added. Relative cell
growth was measured by staining wells with crystal violet after 48
hr and measuring the absorbance at 630 nm;
[0024] FIG. 7 is a graph of the antigen binding activity of Ig/LT
immunoconjugates. Relative binding was determined in a competitive
antigen binding assay using ch14.18 antibody conjugated to HRP as
tracer and either unlabeled ch14.18 (.largecircle.--.largecircle.),
CH2-LT (.largecircle.--.largecircle., filled in) or labeled ch14.18
(.sunburst.--.sunburst.) as competitor.
[0025] FIG. 8 is a photograph of an SDS-polyacrylamide gel showing
an analysis, under reducing (R) or nonreducing (NR) conditions, of
the fusion protein ch14.18-CH3-GM-CSF (lane 1) and the unfused
protein ch14.18 (lane 2), where M is molecular weight markers of
indicated sizes.
[0026] FIG. 9 is a graph of GM-CSF activity of the Ig/GM-CSF
immunoconjugate ch14.18-GM-CSF (.largecircle.--.largecircle.,
filled in) compared to a GM-CSF standard
(.largecircle.--.largecircle.) and conditioned medium
(.DELTA.--.DELTA.).
[0027] FIG. 10 is a graph of TNF.varies. activity of the Ig/TNF
immunoconjugatees ch14.18-TNF.varies. (early)
(.largecircle.--.largecircl- e., filled in), ch14.18-TNF-.varies.
(late) (.DELTA.--.DELTA., filled in), compared to TNF-.varies.
(early) (.largecircle.--.largecircle.) and TNF-.varies. (late)
(.DELTA.--.DELTA.).
DETAILED DESCRIPTION OF THE INVENTION
[0028] The invention relates to immunoconjugates useful for killing
a malignant or virus-infected target cell. The immunoconjugate
includes a conjugate of an antibody portion having a specificity
for a surface antigen on a virus-infected or malignant cell, and a
cytokine.
[0029] FIG. 1 shows a schematic view of a representative
immunoconjugate 10. In this embodiment, cytokine molecules 2 and 4
are peptide bonded to the carboxy termini 6 and 8 of CH3 regions 10
and 12 of antibody heavy chains 14 and 16. V.sub.L regions 26 and
28 are shown paired with V.sub.H regions 18 and 20 in a typical IgG
configuration, thereby providing two antigen binding sites 30 and
32 at the amino ends of immunoconjugate 10 and two cytokine
receptor-binding sites 40 and 42 at the carboxy ends of
immunoconjugate 10. Of course, in their broader aspects, the
immunoconjugates need not be paired as illustrated.
[0030] The immunoconjugates of this invention can be produced by
genetic engineering techniques; i.e., by forming a nucleic acid
construct encoding the chimeric immunoconjugate. Preferably, the
gene construct encoding the immunoconjugate of the invention
includes, in 5' to 3' orientation, a DNA segment which encodes a
heavy chain variable region, a DNA segment encoding the heavy chain
constant region, and DNA coding for the cytokine. The fused gene is
assembled in or inserted into an expression vector for transfection
of the appropriate recipient cells where it is expressed. The
hybrid chain can be combined with a light (or heavy) chain
counterpart to form monovalent and divalent immunoconjugates.
[0031] The cytokine can be any cytokine or analog or fragment
thereof which has a therapeutically valuable biological function.
Useful cytokines include the interleukins and hematopoietic factors
such as interleukin-2 (IL-2) and granulocyte-macrophage colony
stimulating factor (GMCSF). Lymphokines such as LT and TNF.varies.,
which require the formation of multimeric structures to
function,-can also be used. The gene encoding the lymphokine or
cytokine can be cloned de novo, obtained from an available source,
or synthesized by standard DNA synthesis from a known nucleotide
sequence. For example, the DNA sequence of LT is known (see, e.g.
Nedwin et al. (1985) Nucleic Acids Res. 13:6361), as are the
sequences for interleukin-2 (see, e.g., Taniguchi et al. (1983)
Nature 302:305-318), granulocyte-macrophage colony stimulating
factor (see, e.g., Gasson et al. (1984) Science 266:1339-1342), and
tumor necrosis factor alpha (see, e.g., Nedwin et al. 1. Ibid.)
[0032] The heavy chain constant region for the conjugates can be
selected from any of the five isotypes: alpha, delta, epsilon,
gamma or mu. Heavy chains or various subclasses (such as the IgG
subclasses 1-4) can be used. The light chains can-have either a
kappa or lambda constant chain. DNA sequences for these
immunoglobulin regions are well known in the art. (See, e.g.,
Gillies et al. (1989) J. Immunol. Meth. 125:191).
[0033] In preferred embodiments, the variable region is derived
from an antibody specific for the target antigen (an antigen
associated with a diseased cell such as a cancer cell or
virus-infected cell), and the constant region includes the CH1, CH2
and CH3 domains. The gene encoding the cytokine is joined, (e.g.,
by appropriate linkers, e.g., by DNA encoding (Gly.sub.4-Ser).sub.3
in frame to the 3' end of the gene encoding the constant region
(e.g., CH3 exon), either directly or through an intergenic region.
In certain embodiments, the intergenic region can comprise a
nucleotide sequence coding for a proteolytic cleavage site. This
site, interposed between the immunoglobulin and the cytokine, can
be designed to provide for proteolytic release of the cytokine at
the target site. For example, it is well known that plasmin and
trypsin cleave after lysine and arginine residues at sites that are
accessible to the proteases. Many other site-specific endoproteases
and the amino acid sequences they attack are well-known.
[0034] The nucleic acid construct can include the endogenous
promoter and enhancer for the variable region-encoding gene to
regulate expression of the chimeric immunoglobulin chain. For
example, the variable region encoding genes can be obtained as DNA
fragments comprising the leader peptide, the VJ gene (functionally
rearranged variable (V) regions with joining (J) segment) for the
light chain or VDJ gene for heavy chain, and the endogenous
promoter and enhancer for these genes. Alternatively, the gene
coding for the variable region can be obtained apart from
endogenous regulatory elements and used in an expression vector
which provides these elements.
[0035] Variable region genes can be obtained by standard DNA
cloning procedures from cells that produce the desired antibody.
Screening of the genomic library for a specific functionally
rearranged variable region can be accomplished with the use of
appropriate DNA probes such as DNA segments containing the J region
DNA sequence and sequences downstream. Identification and
confirmation of correct clones are then achieved by DNA sequencing
of the cloned genes and comparison of the sequence to the
corresponding sequence of the full length, properly spliced
mRNA.
[0036] The target antigen can be a cell surface antigen of a tumor
cell, a virus-infected cell or another diseased cell. Genes
encoding appropriate variable regions can be obtained generally
from Ig-producing lymphoid cells. For example, hybridoma cell lines
producing Ig specific for tumor associated antigens or viral
antigens can be produced by standard somatic cell hybridization
techniques. (See, e.g., U.S. Pat. No. 4,96,265.) These Ig-producing
cell lines provide the source of variable region genes in
functionally rearranged form. The variable region genes will
typically be of murine origin because this murine system lends
itself to the production of a wide variety of Igs of desired
specificity.
[0037] The DNA fragment containing the functionally rearranged
variable region gene is linked to a DNA fragment containing the
gene encoding the desired constant region (or a portion thereof).
Ig constant regions (heavy and light chain) can be obtained from
antibody-producing cells by standard gene cloning techniques. Genes
for the two classes of human light chains and the five classes of
human heavy chains have been cloned, and thus, constant regions of
human origin are readily available from these clones.
[0038] The fused gene encoding the hybrid IgH chain is assembled or
inserted into expression vectors for incorporation into a recipient
cell. The introduction of gene construct into plasmid vectors can
be accomplished by standard gene splicing procedures.
[0039] The chimeric IgH chain can be co-expressed in the same cell
with a corresponding L chain so that a complete immunoglobulin can
be expressed and assembled simultaneously. For this purpose, the
heavy and light chain constructs can be placed in the same or
separate vectors.
[0040] Recipient cell lines are generally lymphoid cells. The
preferred recipient cell is a myeloma (or hybridoma). Myelomas can
synthesize, assemble, and secrete immunoglobulins encoded by
transfected genes and they can glycosylate protein. A particularly
preferred recipient cell is the Sp2/0 myeloma which normally does
not produce endogenous immunoglobulin. When transfected, the cell
will produce only Ig encoded by the transfected gene constructs.
Transfected myelomas can be grown in culture or in the peritoneum
of mice where secreted immunoconjugate can be recovered from
ascites fluid. Other lymphoid cells such as B lymphocytes can be
used as recipient cells.
[0041] There are several methods for transfecting lymphoid cells
with vectors containing the nucleic acid constructs encoding the
chimeric Ig chain. A preferred way of introducing a vector into
lymphoid cells is by spheroblast fusion. (see, Gillies et al.
(1989) Biotechnol. 7:798-804). Alternative methods include
electroporation or calcium phosphate precipitation.
[0042] Other useful methods of producing the immunoconjugates
include the preparation of an RNA sequence encoding the construct
and its translation in an appropriate in vivo or in vitro
system.
[0043] The immunoconjugate of this invention can be used to deliver
selectively a cytokine to a target cell in vivo so that the
cytokine can exert a localized biological effect such as a local
inflammatory response, stimulation of T cell growth and activation,
and ADCC activity. A therapeutically effective amount of the
immunoconjugate is administered into the circulatory system of a
subject harboring the target cell.
[0044] The invention is illustrated further by the following
non-limiting Examples.
[0045] 1. Plasmid Construction
[0046] Described below is the construction of PdHL2, a plasmid
which contains the human C.gamma.l heavy and kappa light chain gene
sequences as well as insertion sites for V region cDNA cassettes
(Gillies et al. (1989) J. Immunol. Meth. 125:191). This plasmid may
be used as a starter plasmid for constructing any IgH chain
cytokine fusion. For example, PdHL2 was used for the expression of
Ig/LT fusion proteins. A LT cDNA was isolated from a human
peripheral blood leukocyte library cloned in .lambda.gt10. The
sequence was identical to that reported in the literature by Nedwin
et al. (Nucleic Acids Res (1985) 13:6361). The cDNA was inserted
into vector pDEM (Gillies et al., ibid) as an XhoI fragment after
first removing most of the 3' untranslated region with Bal31
nuclease. The resulting plasmid, pDEM-LT (FIG. 2), expresses (in
transfected cells) a fusion mRNA with a 5' untranslated sequence
derived from the metallothionein (MT) promoter, the LT coding
sequence and a 3' untranslated sequence and a poly A addition
signal from the mouse C.kappa. gene. Fusion protein-encoding
vectors-were constructed by ligating HindIII to TaqI (CH2-LT) or
HindIII to NsiI (CH3-LT) fragments of the human C.gamma.l gene to
HindIII and PvuII digested PDEM-LT using synthetic DNA linkers
(FIG. 2). These linkers:
1 (5'-CGAAGAAAACCATCTCCAAA/CTCCCTGGTGTTGGCCTCAC ACCTTCAG-3' (for
CH2-LT); and 5'-TGAGGCTCTGCACAACCACT- ACACGCAGAAGAGCCTCTCCCT
GTCCCCGGGTAAA/CTCCCTGGTGTTGGCCTCACACCTTCAG-3- ')
[0047] provide the protein coding sequence from the unique site
(NsiI or TaqI) to the end of the heavy-chain domain (indicated by
the slash), and join them to the amino terminus of the mature form
of LT (up to the unique PvuII site). The linker for the CH3 fusion
protein also includes a silent mutation that creates a SmaI site
close to the end of the domain for future use in constructing
fusion proteins. The DNA sequences at the junction of each
construct were confirmed and each HindIII to EcoRI fragment was
inserted into plasmid pdHL2-VC.gamma.l.kappa. (14.18). This plasmid
contains the V cassettes for the ch14.18 anti-ganglioside GD2
antibody (Gillies et al., ibid.).
[0048] 2. Cell Culture and Transfection
[0049] Sp2/0 Ag14 mouse hybridoma cells were maintained and
transfected as described by Gillies et al. (BioTechnology (1989)
7:8799). Drug selection in methotrexate (MTX) was initiated 24
hours after transfection by adding an equal volume of medium
containing MTX at 0.1 .mu.M. Two additional feedings with selection
medium were done at 3 day intervals. Transfectants secreting human
Ig determinants were identified by ELISA (Gillies et al., 1989.
ibid), grown in medium containing increasing concentrations of MTX,
and subcloned by limiting dilution in medium containing MTX at 5
.mu.M.
[0050] 3. Purification and Characterization of Fusion Proteins
[0051] Proteins were biosynthetically labeled by incubating
transfected cells (1.times.10.sup.6/mL) for 16 hr in growth medium
containing .sup.35S-methionine (50 .mu.Ci/mL-Amersham). Culture
supernatants were then clarified by centrifugation in a
microcentrifuge and the labeled proteins were immmunoprecipitated
with polyclonal anti-human .kappa. chain antisera (Jackson
Immunoresearch, Bar Harbor, Me.) and protein A Sepharose (Repligen,
Corp., Cambridge, Mass.). Protein samples were boiled for 5 min. in
gel sample buffer in the presence or absence of 2-mercaptoethanol
and analyzed on a 7% polyacrylamide gel. Proteins were detected by
fluorography (diphenyloxazole in DMSO) and autoradiography.
[0052] Unlabeled proteins were purified from spent suspension
culture medium by either immunoaffinity chromatography with a
monoclonal anti-human .kappa. antibody for the CH2-LT protein or by
protein A Sepharose chromatography for the CH3-LT protein. All
materials were concentrated by membrane dialysis into PBS. An
alternative procedure for purification of the CH3-LT protein was
developed to prevent the loss of LT activity during elution from
the protein A column. Spent culture media was diluted with three
volumes of 10 mM sodium phosphate buffer (pH 6.5) and loaded onto a
Bakerbond AbX (J. T. Baker) column at room temperature. The column
was washed with 10 mM sodium phosphate buffer until the absorbance
returned to baseline and then with PBS, pH 6.5 (150 mM NaCl, 10 mM
sodium phosphate, pH 6.5). The CH3-LT protein was eluted with 150
mM NaCl, 50 mM sodium phosphate, pH 6.5.
[0053] 4. Activity Assay
[0054] The antigen binding activity of the Ig-LT proteins was
measured as described in Gillies et al. (J. Immunol. Meth. (1989)
125:191), and LT activity was determined in the cytolytic or
cytostatic assay (Kahn et al. (1982)) utilizing the 159124T2.5
subclone of the mouse L929 cell line (provided by Dr. H. Schreiber,
University of Chicago). Cells were seeded into 96-well plates at
4.times.10.sup.4 cells per well, with (cytolytic) or without
(cytostatic) mitomycin C (2 .mu.g/mL), and 10 .mu.L of the test
sample was added after 24 hr. Cells were stained either 24 or 48 hr
later (see FIG. descriptions) with crystal violet and the amounts
of dye retained in the wells were compared to those of untreated
wells and those receiving the LT standard (R&D Systems). The
same assay was also carried out with the GD2-bearing human melanoma
line M21, originally provided by D. L. Morton, University of
California, Los Angeles. The latter cell line was also used for
measuring CDC and ADCC activity as described earlier (Gillies et
al. (1990) Human Antibody. Hybridomas 1:47)
[0055] 5. Expression of Ig/LT Immunoconjugates
[0056] The Ig/LT immunoconjugates were made by directly fusing the
cDNA sequence encoding the mature form of LT to the end of either
the CH2 or CH3 exon of the human C.gamma.l gene (FIG. 2) with the
appropriate synthetic linkers. This gene fusion was then combined
in a vector together with the V regions of murine antibody 14.18
and the human C.kappa. gene, and expressed in transfected Sp2/0
cells. These immunoconjugates were then expressed and tested for
antigen binding activity and Ig chain assembly. The
immunoconjugates retained antigen binding when measured in a
competitive antigen binding ELISA (see below), and were assembled.
Cells expressing these immunoconjugates were labeled with
.sup.35S-methionine, and the secreted proteins were analyzed by
SDS-PAGE in the presence or absence of reducing agent.
[0057] As seen in FIG. 3, the CH2-LT immunoconjugate was expressed
as a mixture of whole (approximately 180 Kd) and half (90 Kd)
molecules. The CH3-LT fusion protein, on the other hand, consisted
entirely of fully assembled molecules. This result is not
surprising since the CH3 domain is most responsible for Ig chain
assembly. The reason why a portion of the CH2-LT did assemble, i.e.
formed disulfide bonds in the hinge-domain of the antibody, is
likely due to the dimerization of the carboxy-terminal LT
domains.
[0058] 6. Biological Activity of Ig/LT Conjugates
[0059] The LT activities of the CH2-LT and CH3-LT conjugates were
compared in the standard cytolytic assay (Kahn, A. et al. (1982) "A
standardized automated computer assisted micro-assay for
lymphotoxin." In: Human Lymphokines, Biological response modified;
(Kahn and Hill, eds.) Academic Press, New York, p. 23), using a
mouse L929 subclone. This assay measures the ability of the
immunoconjugate to bind to the TNF/LT receptor and trigger the
active cell killing process in this cell line. When crude
preparations (culture supernatants) were compared (FIG. 4A), CH3-LT
was found to be much more active (nearly 100 fold by this assay)
than CH2-LT and exhibited approximately the same specific activity
per mole as the LT standard. This higher activity of CH3-LT is
likely due to the increased proportion of fully assembled H-chain
fusion proteins. Thus, the presence of the CH3 exon in the
immunoconjugate may allow the H-chains to associate more
efficiently, perhaps positioning the LT domains in a manner that
allows for dimerization and, as a consequence, more LT receptor
binding.
[0060] When purified preparations were compared, the difference in
activities between CH2-LT and CH3-LT was still evident, but the
activity of the conjugates, especially CH3-LT, was greatly reduced
compared to the LT control (FIG. 4B). Since both proteins had been
purified by using elution steps at acidic pH (i.e., less than pH4),
the pH sensitivity of the culture supernatants was examined, and
the LT activity was found to be very acid labile.
[0061] An alternative purification scheme was developed in which
the pH was not reduced to below 6.5. The material from this
preparation was compared to that purified by protein A, the
original starting material, and the LT standard. The results of the
LT cytostatic assay, in the absence of mitomycin C, shown in FIG.
5, demonstrate that full LT activity can be maintained during
purification provided low pH is avoided. This assay was used to
give a better dose response for the LT control and to demonstrate
that the relationship between CH2-LT and CH3-LT is consistent for
both assay systems. The same results were obtained in the cytolytic
assay.
[0062] The results show that full activity (as measured by this
assay) can be maintained when LT is fused to an Ig H chain. The
fact that the LT amino terminus is covalently bound to the
carboxy-terminus of the antibody apparently does not prevent LT
receptor binding or the steps subsequent to binding that are
required for activating the cell killing process.
[0063] 7. Antigen Binding and Effector Functions of Ig/LT
Immunoconjugates
[0064] The antigen binding activity of the immunoconjugates was
measured on antigen-coated plates in either a direct binding or
competition assay format. In the direct binding assay antigen
binding activity was found to be much higher than that of the
control ch14.18 antibody. Since the source of the GD2 antigen was a
crude membrane extract from neuroblastoma cells, it is possible
that the TNF/LT receptor is present in the preparation and that
binding of the conjugate through the LT domain is responsible for
this increased activity. When antigen binding was measured in a
competition assay, the conjugate was found to compete with the
labeled ch14.18 antibody for antigen only slightly more efficiently
than the unlabeled ch14.18 antibody (FIG. 7).
[0065] The results show that it is possible to-combine the antigen
binding activity of an anti-tumor cell antibody with the potent
biological activity of a cytokine. The presence of the CH3 exon in
the immunoconjugate results in complete H-chain assembly and, as a
consequence, higher LT and effector activities. The assembly of H
chains may likely result in LT dimerization.
[0066] In addition, a free amino terminus is not necessary for LT
binding to its receptor since in the highly active CH3-LT
immunoconjugate, the amino terminus of the LT domain is peptide
bonded to the Ig H chain.
[0067] 8. Construction and Expression of Ig/GM-CSF
Immunoconjugates
[0068] Ig/GM-CSF conjugates were made by joining a nucleotide
sequence encoding GM-CSF to a nucleotide sequence encoding an Ig
heavy chain, such that the encoded protein includes a heavy chain
fused via the carboxy terminus to GM-CSF. The construct was made as
follows. The mature protein coding sequence of GM-CSF was linked to
the end of the CH3 exon of the human C.gamma..sub.1 gene using
PdHDL2 and appropriate oligonucleotide linkers, as described above
for the LT conjugate and according to procedures well-known in the
art. Also as described above for LT conjugates, the Ig heavy chain
GM-CSF fused gene was combined with the heavy chain V region gene
of the 14.18 anti-GD2 heavy chain, and carried on the same vector
as the human C.kappa. gene and the light chain V region gene of the
14.18 antibody. After transfection of the DNA into hybridoma cells
and consequent expression of the H and L genes, a complete ch14.18
antibody with GM-CSF attached to the end of each H chain was
produced. The fusion protein was purified from conditioned medium
using adsorbtion to and elution from protein A Sepharose. The peak
material was diafiltered using an Amicon stirred cell into PBS and
concentrated to approximately 1mg/mL.
[0069] The fusion protein was analyzed by electrophoresis on a 10%
SDS-polyacrylamide gel (FIG. 8) under reducing (R) or non-reducing
(NR) conditions and the proteins were visualized by staining with
Coomassie Blue. Lane 1, ch14.18-CH3-GMCSF; Lane 2, ch14.18; M,
molecular weight markers of the indicated sizes in kD. The relative
molecular weight of the fused H chain of 75 kD in lane 1 (R) is
consistent with a glycosylated GM-CSF (.about.25 kD) being fused to
the H chain (50 kD). Note in the non-reduced lane 1 that the fusion
protein is assembled into a single high molecular weight species of
.about.200 kD.
[0070] 9. Biological Activity of Iq/GM-CSF Conjugates
[0071] The GM-CSF activity of the ch14.18-GM-CSF fusion protein was
examined in a proliferation assay using the GM-CSF-dependent cell
line AML-193 (human acute myelogenous leukemia) (obtained from
Daniel Santoli, Wistar Institute, Philadelphia, Pa.). Cells are
cultured for 2 days in serum-free medium containing insulin and
transferrin (but no GM-CSF), at which time GM-CSF or fusion protein
sample dilutions are added. After five more days, 5 .mu.Ci of
.sup.3H-thymidine is added to each well and after 16 hr, the cells
are harvested in 10% trichloroacetic acid. After 30 min. on ice the
precipitated material is collected on GF/C filters, dried and
counted by liquid scintillation.
[0072] In FIG. 9, the proliferation obtained with varying amounts
of GM-CSF, conditioned medium containing the secreted fusion
protein, or ch14.18-GM-CSF purified by protein A Sepharose are
compared. The results show that significant GM-CSF activity is
maintained once the molecule is fused to the H-chain but that the
activity is-either 20% (conditioned medium) or 10% that of
(purified fusion protein) GM-CSF standard. Maximum incorporation
was obtained with less than 10 ng/mL of the purified fusion protein
(GM-CSF equivalents or 50 ng of total protein). This slight loss of
activity is not likely to affect the utility of-this fusion
protein, especially if large amounts of ch14.18-GM-CSF accumulate
at the site of solid tumors expressing the GD2 antigen.
[0073] The in vivo half-life of the immunoconjugate was determined
by injecting mice (20 .mu.g injected in the tail vein) with
ch14.18-GM-CSF. Samples of blood were collected at the indicated
times and the amount of fusion protein in the serum was determined
by ELISA. The capture antibody was a polyclonal goat anti-human IgG
(Fc-specific) and the detecting antibody was a horseradish
peroxidase-conjugated goat anti-human K. As seen in Table 1, the
half-life (calculated between the 24 hr and 4 day time points) was
nearly 3 days. This compares to the published value of 85 min. in
humans (Herrmann et al. (1989) J. Clin Oncol. 7:159-167). This
increased half-life may compensate for the reduced activity of the
fusion protein, especially since the local concentration of the
immunoconjugate at the tumor site is likely to be increased by
antibody targeting.
2TABLE 1 Serum Concentration of ch14.18-CH3-GM-CSF* Time after
injection Ab Concentration (ng/mL) 4 hr 9210 16 hr 9660 24 hr 5950
4 days 2530 *Mice were injected with 20 .mu.g of the
ch14.18-CH3-GM-CSF fusion protein in the tail vein. Small samples
(.about.50 .mu.L) were taken from the tail vein and assayed for
human antibody determinants.
[0074] 10. Construction, Expression, and Activity of Ig/TNF
Immunoconjugates
[0075] Ig/TNF immunoconjugates were made by fusing nucleotide
sequences encoding TNF.alpha. and immunoglobulin heavy chain such
that TNF.alpha. is fused to the carboxy terminus of the heavy
chain. Briefly, the mature TNF.alpha. coding sequence was fused to
the end of the human C.gamma.l CH3 exon using oligonucleotides. The
recombined fragment was joined downstream of the heavy chain V
region encoding gene from the anti-GD2 mouse antibody 14.18; also
contained in this vector was the human .kappa. gene, including both
the V region gene encoding the light chain V region from the
anti-GD2 mouse antibody 14.18 and the C region encoding gene.
Hybridoma cells were transfected and selected as described above.
Clones secreting human antibody determinants were expanded and used
for the production and purification of the ch14.18-CH3-TNF.alpha.
fusion protein by protein A Sepharose chromatography. The activity
of the fusion protein was tested as described above for the CH3-LT
fusion proteins.
[0076] As seen in FIG. 10, the amount of cytotoxicity obtained with
the fusion protein met or exceeded that of native TNF( at either
early (20 hr) or late (24 hr) points in the assay. This fusion
protein appears to be fully functional with respect to TNF.alpha.
activity, even though it was purified using protein A Sepharose.
The CH3-LT construct was partially inactivated by the elution at
acidic pH using the same protocol.
[0077] The results described above for the Ig/LT, Ig/GM-CSF,
andIg/TNF.alpha. immunoconjugates demonstrate that an antibody can
be genetically fused to a cytokine without the loss of antigen
binding activity and effector functions of the antibody, or the
receptor binding and biological activity of a cytokine.
[0078] 11. Dosage
[0079] Immunoconjugates of the invention may be administered at a
therapeutically effective dosage within the range of lug-100mg/kg
body weight per day. The immunoconjugate may be administered in
physiologic saline or any other biologically compatible buffered
solution. This solution may be administered systemically (e.g., by
injection intravenously or intramuscularly).
[0080] Other Embodiments
[0081] The invention may be embodied in other specific forms
without departing from the spirit or essential characteristics
thereof. The present embodiments are therefore considered to be in
all respects as illustrative and not restrictive, the scope of the
invention being indicated by the appended claims rather than by the
foregoing description, and all changes which come within the
meaning and range of equivalency of the claims are therefore
intended to be embraced therein.
* * * * *