U.S. patent application number 09/772134 was filed with the patent office on 2002-10-03 for isolated polynucleotides and polypeptides relating to loci underlying resistance to soybean cyst nematode and soybean sudden death syndrome and methods employing same.
Invention is credited to Lightfoot, David A., Meksem, Khalid.
Application Number | 20020144310 09/772134 |
Document ID | / |
Family ID | 22654034 |
Filed Date | 2002-10-03 |
United States Patent
Application |
20020144310 |
Kind Code |
A1 |
Lightfoot, David A. ; et
al. |
October 3, 2002 |
Isolated polynucleotides and polypeptides relating to loci
underlying resistance to soybean cyst nematode and soybean sudden
death syndrome and methods employing same
Abstract
Soybean cyst nematode and soybean sudden death syndrome
resistance genes, soybean cyst nematode and soybean sudden death
syndrome resistant plant lines, and methods of breeding and
engineering same.
Inventors: |
Lightfoot, David A.;
(Carbondale, IL) ; Meksem, Khalid; (Carbondale,
IL) |
Correspondence
Address: |
JENKINS & WILSON, PA
3100 TOWER BLVD
SUITE 1400
DURHAM
NC
27707
US
|
Family ID: |
22654034 |
Appl. No.: |
09/772134 |
Filed: |
January 29, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60178811 |
Jan 28, 2000 |
|
|
|
Current U.S.
Class: |
800/312 |
Current CPC
Class: |
C07K 14/415 20130101;
C12N 15/8285 20130101; Y02A 40/164 20180101 |
Class at
Publication: |
800/312 |
International
Class: |
A01H 005/00 |
Claims
What is claimed is:
1. An isolated and purified genetic marker associated with SCN/SDS
resistance in soybeans, said marker mapping to linkage group G in
the soybean genome, said marker having a sequence selected from
among any of SEQ ID NOs:1, 3, and 5.
2. An isolated and purified genetic marker associated with SCN/SDS
resistance in soybeans, said marker mapping to linkage group A2 in
the soybean genome, said marker having a sequence selected from
among any of SEQ ID NOs:7, 9, and 11.
3. A plant, or parts thereof, which evidences an SCN/SDS resistance
response comprising a genome, homozygous with respect to genetic
alleles which are native to a first parent and nonnative to a
second parent of the plant, wherein said second parent evidences
significantly less resistant response to SCN/SDS than said first
parent and said plant comprises alleles from said first parent that
evidences resistance to SCN/SDS in hybrid combination in at least
one locus selected from: a locus mapping to linkage group G and
mapped by one or more of the markers set forth as SEQ ID NOs:1, 3,
and 5, a locus mapping to linkage group A2 and mapped by one or
more of the markers set forth as SEQ ID NOs:7, 9, and 11; or
combinations thereof, said resistance not significantly less than
that of the first parent in the same hybrid combination, and yield
characteristics which are not significantly different than those of
the second parent in the same hybrid combination.
4. A plant, or parts thereof, as claimed in claim 3 comprising the
progeny of a cross between first and second inbred lines, alleles
conferring SCN/SDS resistance being present in the homozygous state
in the genome of one or the other or both of said first and second
inbred lines such that the genome of said first and second inbreds
together donate to the hybrid a complement of alleles necessary to
confer the SCN/SDS resistance.
5. An SCN/SDS resistant hybrid plant, or parts thereof, formed with
the plant of claim 4.
6. A plant, or parts thereof, formed by selfing the SCN/SDS
resistant hybrid of claim 5.
7. An isolated and purified biologically active SCN/SDS resistance
polypeptide.
8. The isolated and purified biologically active SCN/SDS resistance
polypeptide of claim 7, wherein the encoded polypeptide comprises a
soybean SCN/SDS resistance polypeptide.
9. The isolated and purified biologically active SCN/SDS resistance
polypeptide of claim 7, or functional portion thereof, wherein the
polypeptide comprises: (a) a polypeptide encoded by a nucleic acid
sequence of SEQ ID NO:13; (b) a polypeptide encoded by a nucleic
acid molecule that is substantially identical to SEQ ID NO:13; (c)
a polypeptide having the amino acid sequence of SEQ ID NO:14. (d) a
polypeptide that is a biological equivalent of a peptide having the
amino acid sequence of SEQ ID NO:14; or (e) a polypeptide that is
immunologically cross-reactive with an antibody that shows specific
binding with a polypeptide of SEQ ID NO:14.
10. The isolated and purified biologically active SCN/SDS
resistance polypeptide of claim 7, modified to be in detectably
labeled form.
11. An isolated and purified nucleic acid molecule encoding a
biologically active SCN/SDS resistance polypeptide.
12. The nucleic acid molecule of claim 11, wherein the encoded
polypeptide comprises a soybean SCN/SDS resistance polypeptide.
13. The nucleic acid molecule of claim 11, further comprising an
isolated soybean rhg1 and SDS resistance gene, said gene capable of
conveying Heterodera glycines-infestation resistance, Fusarium
solani-infection resistance, or both Heterodera
glycines-infestation resistance and Fusarium solani-infection
resistance to a non-resistant soybean germplasm, said gene located
within a quantitative trait locus mapping to linkage group G and
mapped by genetic markers of SEQ ID NOs:1-6, said gene located
along said quantitative trait locus between said markers.
14. The nucleic acid molecule of claim 11, further defined as
comprising: (a) the nucleotide sequence of any of SEQ ID NO:13 or
(b) a nucleotide sequence that is substantially identical to any of
SEQ ID NO:13.
15. The nucleic acid molecule of claim 13, further defined as
comprising a 20 base pair nucleotide sequence that is identical to
a contiguous 20 base pair nucleotide sequence of SEQ ID NO:13.
16. The nucleic acid molecule of claim 14, wherein the nucleic acid
sequence comprises a DNA sequence that hybridizes to a nucleic acid
sequence as set forth as SEQ ID NO:13 under wash stringency
conditions represented by a wash solution having about 200 mM salt
concentration and a wash temperature of at least about 45.degree.
C., and that encodes an SCN/SDS resistance polypeptide.
17. The nucleic acid molecule of claim 11, further defined as a DNA
segment.
18. The nucleic acid molecule of claim 11, further defined as
positioned under the control of a promoter.
19. The nucleic acid molecule of claim 18, wherein said DNA segment
and promoter are operationally inserted into a recombinant
vector.
20. A recombinant host cell comprising the nucleic acid molecule of
claim 11.
21. A transgenic plant having incorporated into its genome a
nucleic acid molecule of claim 11, the nucleic acid molecule being
present in said genome in a copy number effective to confer
expression in the plant of an SCN/SDS resistance polypeptide.
22. Plant seeds, parts, or progeny of a plant as claimed in claim
20.
23. The nucleic acid molecule of claim 11, further comprising an
isolated soybean Rhg4 gene, said gene capable of conveying
Heterodera glycines-infestation resistance to a non-resistant
soybean germplasm, said gene located within a quantitative trait
locus mapping to linkage group A2 and mapped by the AFLP markers of
SEQ ID NOs:7-12, said gene located along said quantitative trait
locus between said markers.
24. The isolated gene of claim 23, further comprising: (a) the
nucleotide sequence of any one of SEQ ID NOs:16-19; or (b) a
nucleotide sequence substantially similar to any one of SEQ ID NOs:
16-19.
25. A transgenic plant comprising the isolated soybean Rhg4 gene of
claim 23.
26. Seeds, parts or progeny of a plant as claimed in claim 25.
27. An isolated SCN/SDS resistance gene promoter region, or
functional portion thereof, comprising a 4.5 kb fragment of soybean
genomic clone 21d9A2 8F8 between EcoRI restriction sites.
28. An isolated promoter region of claim 27, comprising: (a) the
nucleotide sequence of SEQ ID NO:15; or (b) a nucleotide sequence
substantially identical to SEQ ID NO:15.
29. The isolated promoter region of claim 28 comprising a 20 base
pair nucleotide sequence identical to a contiguous 20 base pair
nucleotide portion of SEQ ID NO:15.
30. A chimeric gene comprising the isolated promoter region of
claim 27 operably linked to a heterologous nucleotide sequence.
31. A vector comprising the chimeric gene of claim 30.
32. A host cell comprising the chimeric gene of claim 31.
33. The host cell of claim 32, wherein the cell is a bacterial cell
or a plant cell.
34. A transgenic plant comprising a plant cell of claim 33.
35. An assay kit for detecting the presence, in biological samples,
of a nucleic acid molecule encoding an SCN/SDS resistance
polypeptide, the kit comprising a first container that contains a
nucleic acid probe identical or complementary to a segment of at
least ten contiguous nucleotide bases of the nucleic acid molecule
of the odd-numbered SEQ ID NOs:1-13.
36. The kit of claim 35, further comprising a detectable
moiety.
37. The kit of claim 35, wherein the biological sample further
comprises chromosomes, and wherein the nucleic acid probe
hybridizes to a chromosome.
38. A method for determining the presence or absence of SCN/SDS
resistance in a soybean plant, or part thereof, comprising: (a)
detecting a molecular marker linked to a quantitative trait locus
associated with SCN/SDS resistance, wherein the molecular marker
comprises a sequence set forth as any one of SEQ ID NOs:1, 3, 5, 7,
9, and 11; and (b) determining the presence of SCN/SDS resistance
as detection of the molecular marker of step (a) and determining
the absence of SCN/SDS resistance as failure to detect the
molecular marker of step (a).
39. The method of claim 38, further comprising: (a) preparing
genomic DNA from the soybean plant, or part thereof; and (b)
detecting a molecular marker linked to a quantitative trait locus
associated with SCN/SDS resistance, wherein the molecular marker
comprises a sequence set forth as any one of SEQ ID NOs:, 3, 5, 7,
9, and 11; and (c) determining the presence of SCN/SDS resistance
as detection of the molecular marker of step (b) and determining
the absence of SCN/SDS resistance as failure to detect the
molecular marker of step (b).
40. The method of claim 38, wherein the detecting comprises a
PCR-based assay.
41. A method of reliably and predictably introgressing SCN/SDS
resistance into non-resistant soybean germplasm, the method
comprising: (a) identifying one or more nucleic acid markers for
marker assisted selection among soybean lines to be used in a
soybean breeding program, wherein the nucleic acid markers map to
linkage groups G or A2 and wherein the nucleic acid markers are
selected from among any of SEQ ID NOs:1, 3, 5, 7, 9, and 11; and
(b) introgressing said resistance into said non-resistant soybean
germplasm by performing marker-assisted selection.
42. The method of claim 41, wherein the soybean germplasm is
derived from the "Forrest" line, or descendant thereof.
43. A plant, seed, or tissue culture produced by the method of
claim 41 wherein the plant, seed, or tissue culture is resistant to
SCN/SDS infection.
44. A method of positional cloning of a nucleic acid, the method
comprising: (a) identifying a first nucleic acid genetically linked
to a SCN/SDS resistance locus, wherein the first nucleic acid maps
between two markers selected from among any of SEQ ID NOs:1, 3, 5,
7, 9, and 11; and (b) cloning the first nucleic acid.
45. The method of claim 44, wherein the first nucleic acid
comprises the rhg1 and SDS locus.
46. The method of claim 44, wherein the first nucleic acid
comprises the Rhg4 locus.
47. The method of claim 44, further comprising hybridizing a second
nucleic acid comprising the locus to a genomic library and
selecting a clone that hybridizes to the second nucleic acid and
comprises a second locus that confers SCN/SDS resistance in a
plant.
48. The method of claim 44, further comprising hybridizing a second
nucleic acid comprising the locus to a genomic library and
selecting a clone that hybridizes to the second nucleic acid,
wherein the genomic library is selected from the group consisting
of a BAC soybean genomic library, a YAC soybean genomic library,
and a P1 bacteriophage soybean genomic library.
49. The method of claim 44, further comprising identifying
overlapping clones.
50. The method of claim 44, wherein the first nucleic acid is
amplified by PCR prior to cloning of the first nucleic acid.
51. The method of claim 44, wherein the first nucleic acid is
proximal to the selected locus.
52. The method of claim 44, further comprising identifying a coding
region encoded by the first nucleic acid.
53. The method of claim 44, wherein the SCN/SDS resistance locus
corresponds to a nucleic acid selected from among any of SEQ ID
NOs: 13 and 16-19.
54. A method for producing an antibody that specifically recognizes
a SCN/SDS resistance polypeptide, the method comprising: (a)
recombinantly or synthetically producing a SCN/SDS resistance
polypeptide, or portion thereof; (b) formulating the polypeptide of
(a) whereby it is an effective immunogen; (c) administering to an
animal the formulation of (b) to generate an immune response in the
animal comprising production of antibodies, wherein antibodies are
present in the blood serum of the animal; and (d) collecting the
blood serum from the animal of (c) comprising antibodies that
specifically recognize a SCN/SDS resistance polypeptide.
55. An antibody produced by the method of claim 54.
56. A method for detecting a level of a SCN/SDS resistance
polypeptide, the method comprising (a) obtaining a biological
sample having peptidic material; (b) detecting a SCN/SDS resistance
polypeptide in the biological sample of (a) by immunochemical
reaction with the antibody of claim 55, whereby an amount of a
SCN/SDS resistance polypeptide in a sample is determined.
57. A method for identifying a substance that modulates a SCN/SDS
resistance polypeptide function, the method comprising: (a)
isolating a SCN/SDS resistance polypeptide encoded by the
nucleotide sequence of SEQ ID NO:13; a polypeptide encoded by a
nucleic acid molecule that is substantially identical to SEQ ID
NO:13; a polypeptide having the amino acid sequence of SEQ ID
NO:14; a polypeptide that is a biological equivalent of the
polypeptide of SEQ ID NO:14; or a polypeptide which is
immunologically cross-reactive with an antibody that shows specific
binding with a polypeptide of SEQ ID NO:14; (b) exposing the
isolated SCN/SDS resistance polypeptide to one or more candidate
substances; (c) assaying binding of a candidate substance to the
isolated SCN/SDS resistance polypeptide; and (d) selecting a
substance that demonstrates selective binding to the isolated
SCN/SDS resistance polypeptide.
58. A method of detecting a nucleic acid molecule that encodes an
SCN/SDS resistance polypeptide in a biological sample containing
nucleic acid material, the method comprising: (a) hybridizing the
nucleic acid molecule of claim 13 under stringent hybridization
conditions to the nucleic acid material of the biological sample,
thereby forming a hybridization duplex; and (b) detecting the
hybridization duplex, whereby a nucleic acid molecule encoding a
SCN/SDS resistance polypeptide is detected in the biological
sample.
59. The method of claim 58, wherein the nucleic acid molecule that
encodes an SCN/SDS resistance polypeptide further comprises a
chromosome.
60. A method for identifying soybean sudden death syndrome (SDS)
resistance or soybean cyst nematode (SCN) resistance in a plant
using a SDS resistance gene, a SCN resistance gene, or DNA segments
having homology to a SDS resistance gene or to an SCN resistance
gene, the method comprising: (a) probing nucleic acids obtained
from the plant with a probe derived from said SDS resistance gene
or from said SCN resistance gene or from said DNA segment having
homology to said SDS resistance gene or to said SCN resistance
gene; and (b) observing hybridization of said probe to said nucleic
acids, the presence of said hybridization indicating SDS or SCN
resistance in said plant.
61. The method of claim 60, wherein the probe comprises an isolated
and purified nucleic acid molecule encoding a biologically active
SCN/SDS resistance polypeptide.
62. The method of claim 60, wherein the probe comprises a
nucleotide sequence as set forth in of any of SEQ ID NOs:13 and
16-19, or any complementary strand thereof, or any combination
thereof.
63. A method for identifying a candidate compound as a modulator of
SCN/SDS resistance activity, the method comprising: (a) exposing a
cell sample with a candidate compound to be tested, the cell sample
containing at least one cell containing a DNA construct comprising
a modulatable transcriptional regulatory sequence of an SCN/SDS
resistance-encoding nucleic acid and a reporter gene which is
capable of producing a detectable signal; (b) evaluating an amount
of signal produced in relation to a control sample; and (c)
identifying a candidate compound as a modulator of SCN/SDS
resistance activity based on the amount of signal produced in
relation to a control sample.
64. The method of 63, wherein the reporter gene comprises a nucleic
acid molecule encoding an SCN/SDS resistance polypeptide.
65. The method of claim 63, wherein the modulatable transcriptional
regulatory sequence comprises SEQ ID NO:15.
66. A method of modulating SCN/SDS resistance in a plant, the
method comprising administering to the plant an effective amount of
a substance that modulates expression of an SCN/SDS resistance
activity-encoding nucleic acid molecule in the plant to thereby
modulate SCN/SDS resistance in the plant.
67. The method of claim 66, wherein the substance that modulates
expression of an SCN/SDS resistance activity-encoding nucleic acid
molecule comprises a ligand for a regulatory protein that binds a
SCN/SDS resistance gene promoter.
68. The method of claim 67, wherein the SCN/SDS resistance gene
promoter comprises the nucleotide sequence of SEQ ID NO:15, or
functional portion thereof.
69. A method for modulating SCN/SDS resistance in a plant, the
method comprising administering to the plant an effective amount of
a substance that modulates SCN/SDS resistance polypeptide activity
to thereby modulate SCN/SDS resistance in the plant.
70. The method of claim 69, wherein the plant is a soybean
plant.
71. A method for providing a resistance trait to a plant, the
method comprising introducing to said plant a construct comprising
a nucleic acid sequence encoding an SCN/SDS resistance gene product
operatively linked to a promoter, wherein production of the SCN/SDS
resistance gene product in the plant provides SCN or SDS resistance
trait to the plant.
72. The method of claim 71, wherein the construct further comprises
a vector selected from the group consisting of a plasmid vector or
a viral vector.
73. The method of claim 71, wherein the SCN/SDS resistance gene
product comprises a protein having an amino acid sequence of SEQ ID
NO:14.
74. The method of claim 71, wherein the nucleic acid sequence is
selected from the group consisting of: (a) a nucleotide sequence
set forth as SEQ ID NO:13; (b) a nucleotide sequence substantially
similar to SEQ ID NO:13.
75. The method of claim 71, wherein the resistance characteristic
is nematode resistance, fungal resistance or combinations
thereof.
76. The method of claim 75, wherein the nematode resistance is H.
glycines resistance.
77. The method of claim 76, wherein the H. glycines resistance is
race 3 H. glycines resistance.
78. The method of claim 71, wherein the construct further comprises
another nucleic acid molecule encoding a polypeptide that provides
an additional desired characteristic to the plant.
79. The method of either of claims 71 or 78, wherein the method
further comprises monitoring an insertion point for the construct
in the plant genome; and providing for insertion of the construct
into the plant genome at a location not associated with the
resistance characteristic, the desired characteristic, or both the
resistance or the desired characteristic.
80. The method of claim 71, wherein the plant is a soybean plant.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is based on and claims priority to U.S.
Provisional Application Serial Number 60/178,811, filed Jan. 28,
2000, herein incorporated by reference in its entirety.
TECHNICAL FIELD
[0002] The present invention relates to plant breeding and plant
genetics. More particularly, the invention relates to soybean cyst
nematode and soybean sudden death syndrome resistance genes,
soybean cyst nematode and soybean sudden death syndrome resistant
soybean lines, and methods of breeding and engineering the
same.
Table of Abbreviations
[0003] AFLP--amplified fragment length polymorphism
[0004] BAC--bacterial artificial chromosome
[0005] bp--base pair
[0006] Cf--tomato genes for resistance to Cladosporium fulvus
[0007] FAM--6-carboxyfluorescein
[0008] Fl--female index of parasitism
[0009] indel--a nucleotide insertion or deletion
[0010] MMAS--molecular marker-assisted selection
[0011] QTL--quantitative trait loci
[0012] RAPD--random amplified polymorphic DNA
[0013] RFLP--restriction fragment length polymorphism
[0014] rhg1 and Rhg4--genetic loci conferring resistance to
Heterodera glycines
[0015] RIL--recombinant inbred line
[0016] SCN--soybean cyst nematode
[0017] SDS--sudden death syndrome
[0018] SSR--microsatellite
[0019] TAMRA--6-carboxy- N, N, N'5N' tetrachlorofluorescein
[0020] TET--6-carboxy-4, 7, 2', 7', tetrachlorofluorescein
BACKGROUND OF THE INVENTION
[0021] Soybeans are a major cash crop and investment commodity in
North America and elsewhere. Soybean oil is one of the most widely
used edible oils, and soybeans are used worldwide both in animal
feed and in human food production.
[0022] The soybean cyst nematode (SCN), Heterodera glycines, is a
widespread pest of soybeans in the American continent. Reported
first in Japan more than 75 years ago, since the first reports in
North Carolina in 1954, SCN continues its spread toward almost all
soybean-cultivated soils. Known as a small plant-parasitic
roundworm that attacks the roots of soybeans, it reproduces very
quickly, survives in the soil for many years in the absence of a
soybean crop, and can cause substantial soybean crop yield
losses.
[0023] Resistant soybean varieties are an effective tool available
for SCN management. There are multiple sources for soybean cyst
nematode resistance genes in commercial soybean varieties (PI88788,
Peking and PI209332), and several have been used to develop
cultivars (Myers & Anand (1991), Euphytica 55:197-201;
Rao-Arrelli et al. (1988) Crop Sci 28:650-652). All the described
loci involved in the resistance to SCN are reported to be
quantitative. (Concibido et al. (1997) Crop Sci 37:258-264;
Concibido (1996) Theor Appl Genet 93:234-241; Webb et al. (1995)
Theor Appl Genet 91:574-581; Rao-Arrelli et al. (1992) Crop Sci
32:862-864; Matthews et al. (1991) Soybean Genetics Newsletter,
Rao-Arrelli et al.,1988). They differ by their chromosomal position
(LG A2, G, B, I, F, J and E) and race of the pathogen against which
they confer the resistance (e.g. Race 1, 3, 5 or 14). SCN
resistance is simply inherited, but field resistance is oligogenic
due to the existence of variation among SCN populations that are
described as "races" (Riggs and Schmidt (1988) J Nematol
20:392-395).
[0024] One gene, rhg1, provides the major portion of resistance to
SCN race 3 across many genotypes derived from Peking (Chang et al.
(1997) Crop Sci 372:965-971; Mathews et al. (1998) Theor Appl Genet
97:1047-1052; Mahalingam et al. (1995) Breed Sci 45:435-445);
PI437654 (Prabhu et al. (1999) Crop Sci 39:982-987; Webb et
al.,1995), >PI88788=(Bell-Johnson et al. (1998) Soybean Genet
Newslett 25:115-118; Concibido et al., 1997; Cregan et al. (1999a)
Crop Sci 39:1464-1490; Cregan et al. (1999b) Theor Appl Genet
99:811-818; Cregan et al. (1999c) Theor Appl Genet 99:918-928),
>PI209332=(Concibido et al.,1996),or>PI90763=(Concibido et
al.,1997). A second gene for SCN resistance, Rhg4, provides an
equal portion of resistance to SCN race 3 across genotypes derived
from Peking (Chang et al., 1997; Mathews et al., 1998; Mahalingam
et al., 1995); and P1437654 (Prabhu et al., 1999; Webb et al.,
1995) but not PI188788, PI209332 or PI90763 (Concibido et al.,
1996; Concibido et al., 1997). Cytological studies suggest PI437654
and Peking derived resistances share mechanisms (pronounced
necrosis and cell wall appositions) not seen in PI88788 in response
to race 3 (Mahalingham et al. (1996) Genome 39:986-998). These
differences in mechanism may derive from distinct alleles at Rhg4,
rhg1 and/or other defense associated loci.
[0025] DNA molecular markers linked to SCN/SDS resistance loci can
be used to develop effective plant breeding strategies. In general,
molecular markers are abundant, often co-dominant, and suitable for
rapid screening at the seedling stage. Genetic linkage maps of
soybean based on RFLP, RAPD, AFLP, and microsatellite markers have
been described. See Brown et al. (1987) Principles and Practice of
Nematode Control in Crops, pp179-232, Academic Press, Orlando Fla.;
Concibido et al., 1996; Concibido et al., 1997; Mahalingham et al.,
1995; Meksem et al. (1999) Theor Appl Genet 99:1131-1142; Meksem et
al. (2000) Theor Appl Genet 101: 747-755; Webb et al., 1995;
Weiseman et al. (1992) Theor Appl Genet 85:136-138; Lark et al.
(1993) Theor Appl Genet 86:901-906; Shoemaker and Specht (1995)
Crop Sci 35:436-446; Chang et al., 1997; Keim et al. (1997) Crop
Sci 37:537-543).
[0026] All such markers have a limit of resistance trait
predictability based principally on proximity of the marker to the
resistance locus. In some cases, the interpretative value of
genetic linkage experiments can be augmented through the
simultaneous or serial detection of more than one genetic marker,
although this also incurs additional time and resources. Thus,
there is a need for a reliable cost-effective method for detecting
SCN or SDS resistance using genetic markers. Optimally, a genetic
marker comprises a resistance gene.
[0027] Therefore, it is of particular importance, both to the
soybean breeders and to farmers, to identify, genetic loci for
resistance to SCN and SDS. Having knowledge of the loci for
resistance to SCN and SDS, those of ordinary skill in the art can
breed or engineer SCN and SDS resistant soybeans. Soybean
resistance can be further provided to a non-resistant cultivar in
combination with other genotypic and phenotypic characteristics
required for commercial soybean lines.
SUMMARY OF THE INVENTION
[0028] The present invention discloses an isolated and purified
genetic marker associated with SCN/SDS resistance in soybeans, said
marker mapping to linkage group G in the soybean genome.
Preferably, the marker has a sequence identical to any one of SEQ
ID NOs:1, 3, and 5. Representative corresponding markers associated
with SCN/SDS susceptibility are set forth as SEQ ID NOs:2, 4, and
6.
[0029] Also disclosed is an isolated and purified genetic marker
associated with SCN/SDS resistance in soybeans, said marker mapping
to linkage group A2 in the soybean genome. Preferably, the marker
has a sequence identical to any one of SEQ ID NOs:7, 9, and 11.
Representative corresponding markers associated with SCN/SDS
susceptibility are set forth as SEQ ID NOs:8, 10, and 12.
[0030] The present invention further provides a plant, or parts
thereof, which evidences an SCN/SDS resistance response comprising
a genome, homozygous with respect to genetic alleles which are
native to a first parent and nonnative to a second parent of the
plant, wherein said second parent evidences significantly less
resistant response to SCN/SDS than said first parent and said
improved plant comprises alleles from said first parent that
evidences resistance to SCN/SDS in hybrid combination in at least
one locus selected from: a locus mapping to linkage group G and
mapped by one or more of the markers set forth as SEQ ID NOs:1, 3,
and 5, a locus mapping to linkage group A2 and mapped by one or
more of the markers set forth as SEQ ID NOs:7, 9, and 11; or
combinations thereof, said resistance not significantly less than
that of the first parent in the same hybrid combination, and yield
characteristics which are not significantly different than those of
the second parent in the same hybrid combination.
[0031] In another embodiment, a plant of the present invention, or
parts thereof, comprises the progeny of a cross between first and
second inbred lines, alleles conferring SCN/SDS resistance being
present in the homozygous state in the genome of one or the other
or both of said first and second inbred lines such that the genome
of said first and second inbreds together donate to the hybrid a
complement of alleles necessary to confer the SCN/SDS resistance.
Further disclosed are hybrid plants derived therefrom.
[0032] Also disclosed herein are isolated and purified biologically
active SCN/SDS resistance polypeptide and an isolated and purified
nucleic acid molecule encoding the same are disclosed. Preferably,
the polypeptide comprises a soybean SCN/SDS resistance polypeptide.
Chimeric genes comprising the isolated and purified nucleic acid
molecules encoding a SCN/SDS resistance polypeptide are also
provided.
[0033] In one embodiment, the nucleic acid molecule encoding a
SCN/SDS resistance gene comprises an isolated soybean rhg1 gene
that confers SCN/SDS resistance to a non-resistant host organism.
The gene is capable of conveying Heterodera glycines-infestation
resistance, Fusarium solani-infection resistance, or both
Heterodera glycines-infestation resistance or Fusarium
solani-infection resistance to a non-resistant plant germplasm, the
gene located within a quantitative trait locus mapping to linkage
group G and mapped by genetic markers of SEQ ID NOs:1, 3, and 5,
said gene located along said quantitative trait locus between said
markers. Preferably, the polypeptide comprises (a) a polypeptide
encoded by a nucleic acid sequence set forth as SEQ ID NO:13; (b) a
polypeptide encoded by a nucleic acid having homology to a DNA
sequence set forth as SEQ ID NO:1 3; (c) a polypeptide encoded by a
nucleic acid capable of hybridizing under stringent conditions to a
nucleic acid comprising a sequence or the complement of a sequence
set forth as SEQ ID NO:13; (d) a polypeptide which is a
biologically functional equivalent of a peptide set forth as SEQ ID
NO: 14; or (e) a polypeptide comprising a fragment of a polypeptide
of (a), (b), (c) or (d).
[0034] In another embodiment, the nucleic acid molecule encoding a
SCN resistance polypeptide comprises an isolated soybean Rhg4 gene
that is capable of conveying Heterodera glycines-infestation
resistance to a non-resistant plant germplasm, said gene located
within a quantitative trait locus mapping to linkage group A2 and
mapped by the AFLP markers of SEQ ID NOs:7, 9, and 11, said gene
located along said quantitative trait locus between said markers.
Preferably, the nucleic acid molecule comprises any one of SEQ ID
NOs:16-19.
[0035] The present invention further provides an isolated SCN/SDS
resistance gene promoter region, or functional portion thereof,
comprising an about 90 kb fragment of soybean genomic clone 73P6
between BamHI restriction sites and 21d9 between HinDIII
restriction site. The genomic clone is available from the Forrest
BAC library described in Meksem et al (2000) Theor Appl Genet 101
5/6:747-755, available through Southern Illinois
University-Carbondale (Carbondale, Ill.), Texas A&M University
BAC center (College Station, Tex.), and Research Genetics
(Huntsville, Ala.). Preferably, the isolated promoter region
comprises the nucleotide sequence of SEQ ID NO:15 or a sequence
substantially similar to SEQ ID NO:15. The SCN/SDS resistance gene
promoter region can be operably linked to heterologous
sequence.
[0036] A recombinant host cell comprising an isolated and purified
nucleic acid molecule of the present invention is also disclosed,
as is a transgenic plant having incorporated into its genome an
isolated and purified nucleic acid molecule. In one embodiment, the
nucleic acid molecule comprises encodes a SCN/SDS resistance
polypeptide and is present in said genome in a copy number
effective to confer expression in the plant of the SCN/SDS
resistance polypeptide. Seeds, parts or progeny of the transgenic
plant are also disclosed.
[0037] Further provided is a method for detecting a nucleic acid
molecule that encodes an SCN/SDS resistance polypeptide in a
biological sample comprising nucleic acid material is also
disclosed. The method comprises: (a) hybridizing an isolated and
purified nucleic acid molecule of the present invention under
stringent hybridization conditions to the nucleic acid material of
the biological sample, thereby forming a hybridization duplex; and
(b) detecting the hybridization duplex. Preferably, the isolated
and purified nucleic acid molecule comprises any of SEQ ID NOs:13
and 16-19.
[0038] An assay kit for detecting the presence, in biological
samples, of an SCN/SDS resistance polypeptide is also disclosed. In
one embodiment, the kit comprises a first container that contains a
nucleic acid probe identical or complementary to a segment of at
least ten contiguous nucleotide bases of a nucleic acid molecule of
the present invention, preferably a nucleotide sequence of any one
of SEQ ID NOs:13 and 16-19. In another embodiment, the kit
comprises a nucleic acid probe or primer identical to any one of
SEQ ID NOs:1, 3, 5, 7, 9, and 11, or portion thereof.
[0039] A method for identifying soybean sudden death syndrome (SDS)
resistance or soybean cyst nematode (SCN) resistance in a soybean
plant using a SDS resistance gene, a SCN resistance gene, or DNA
segments having homology to a SDS resistance gene or to an SCN
resistance gene is also disclosed. In one embodiment, the method
comprises: (a) probing nucleic acids obtained from the soybean
plant with a probe derived from said SDS resistance gene or from
said SCN resistance gene or from said DNA segment having homology
to said SDS resistance gene or to said SCN resistance gene; and
observing hybridization of said probe to said nucleic acids, the
presence of said hybridization indicating SDS or SCN resistance in
said soybean plant. In another embodiment, the method comprises (a)
detecting a molecular marker linked to a quantitative trait locus
associated with SCN/SDS resistance, wherein the molecular marker is
the sequence set forth as any one of SEQ ID NOs:1, 3, 5, 7, 9, and
11; and (b) determining the presence of SCN/SDS resistance as
detection of the molecular marker and determining the absence of
SCN/SDS resistance as failure to detect the molecular marker of
(b).
[0040] A method of reliably and predictably introgressing SCN/SDS
resistance genes into non-resistant soybean germplasm is also
disclosed. The method comprises: using one or more nucleic acid
markers for marker assisted selection among soybean lines to be
used in a soybean breeding program, wherein the nucleic acid
markers map to linkage groups G or A2 and wherein the nucleic acid
markers are selected from among any of SEQ ID NOs: 1, 3, 5, 7, 9,
and 11; and introgressing said resistance gene into said
non-resistant soybean germplasm.
[0041] A soybean plant, or parts thereof, which evidences a SCN/SDS
resistance response is also disclosed. The plant comprises a
genome, homozygous with respect to genetic alleles which are native
to a first parent and non-native to a second parent of the soybean
plant, wherein said second parent evidences significantly less
resistant response to SCN/SDS than said first parent, and said
improved plant comprises alleles from said first parent that
evidences resistance to SCN/SDS in hybrid combination of at least
one locus selected from: a locus mapping to linkage group G and
mapped by one or more of the markers set forth as SEQ ID NOs:1, 3,
and 5, a locus mapping to linkage group A2 and mapped by one or
more of the markers set forth in SEQ ID NOs:7, 9, and 11; or
combinations thereof, said resistance not significantly less than
that of the first parent in the same hybrid combination, and yield
characteristics which are not significantly different than those of
the second parent in the same hybrid combination.
[0042] The soybean plant, or parts thereof, can further comprise
the progeny of a cross between first and second inbred lines,
alleles conferring SCN/SDS resistance being present in a homozygous
state in the genome of one or the other or both of said first and
second inbred lines such that the genome of said first and second
inbreds together donate to the hybrid a complement of alleles
necessary to confer the SCN/SDS resistance. Thus, an SCN/SDS
resistant hybrid, or parts thereof, formed with the soybean plant
is also disclosed, as is a soybean plant, or parts thereof, formed
by selfing the SCN/SDS resistant hybrid.
[0043] A method of positional cloning of a nucleic acid is also
disclosed. The the method comprises: (a) identifying a first
nucleic acid genetically linked to a SCN/SDS resistance locus,
wherein the first nucleic acid maps between two markers selected
from SEQ ID NOs: 1 -12; and (b) cloning the first nucleic acid.
Optionally, the first nucleic acid can comprise the rhg1 locus or
the Rhg4 locus.
[0044] A method for producing an antibody that specifically
recognizes a SCN/SDS resistance polypeptide is also disclosed. The
method comprises (a) recombinantly or synthetically producing a
SCN/SDS resistance polypeptide, or portion thereof; (b) formulating
the polypeptide of (a) whereby it is an effective immunogen; (c)
administering to an animal the formulation of (b) to generate an
immune response in the animal comprising production of antibodies,
wherein antibodies are present in the blood serum of the animal;
and (d) collecting the blood serum from the animal of (c)
comprising antibodies that specifically recognize a SCN/SDS
resistance polypeptide. Also provided is an antibody produced by
the disclosed method.
[0045] Methods for identifying a candidate compound as a modulator
of SCN/SDS resistance activity is also disclosed. Such methods
include but are not limited to cell-based assays of SCN/SDS
resistance gene expression, assays of specific binding to SCN/SDS
regulatory elements, and assays of specific binding to SCN/SDS
polypeptides. Optionally, the screening methods are adapted to a
high-throughput format.
[0046] In one embodiment, the method comprises: (a) exposing a cell
sample with a candidate compound to be tested, the cell sample
containing at least one cell containing a DNA construct comprising
a modulatable transcriptional regulatory sequence of an SCN/SDS
resistance-encoding nucleic acid and a reporter gene which is
capable of producing a detectable signal; (b) evaluating an amount
of signal produced in relation to a control sample; and (c)
identifying a candidate compound as a modulator of SCN/SDS
resistance activity based on the amount of signal produced in
relation to a control sample.
[0047] The present invention also provides a method for identifying
a substance that regulates SCN/SDS resistance gene expression using
a chimeric gene that includes an isolated SCN/SDS resistance gene
promoter region operably linked to a reporter gene. According to
this method, a gene expression system is established that includes
the chimeric gene and components required for gene transcription
and translation so that reporter gene expression is assayable. To
select a substance that regulates SCN/SDS resistance gene
expression, the method further provides the steps of using the gene
expression system to determine a baseline level of reporter gene
expression in the absence of a candidate regulator; providing a
plurality of candidate regulators to the gene expression system;
and assaying a level of reporter gene expression in the presence of
a candidate regulator. A candidate regulator is selected whose
presence results in an altered level of reporter gene expression
when compared to the baseline level. Preferably, the isolated
SCN/SDS resistance gene promoter region used in this method
comprises the sequence of SEQ ID NO:15, or functional portion
thereof.
[0048] In another embodiment, the method comprises using an SCN/SDS
regulatory sequence to identify a candidate substance that
specifically binds to the regulatory sequence. According to the
method, a SCN/SDS regulatory gene sequence is exposed to a
candidate substance under conditions suitable for binding to a
nucleic acid sequence, and a candidate regulator is selected that
specifically binds to the SCN/SDS resistance gene promoter region.
Preferably, the isolated SCN/SDS resistance gene promoter region
used in this method comprises the sequence of SEQ ID NO:15, or
functional portion thereof.
[0049] In another embodiment, a cell-free assay system is used and
comprises: (a) exposing a SCN/SDS polypeptide of the present
invention to a candidate compound; (b) assaying binding of the
candidate compound to the SCN/SDS polypeptide; and (c) identifying
a candidate compound as a putative modulator of SCN/SDS resistance
activity based on specific binding of the candidate compound to the
SCN/SDS polypeptide. Preferably, the SCN/SDS polypeptide comprises
some or all of the amino acids of SEQ ID NO:14.
[0050] A method of modulating SCN/SDS resistance in a plant is also
disclosed. The method comprises administering to the plant an
effective amount of a substance that modulates expression of an
SCN/SDS resistance activity-encoding nucleic acid molecule in the
plant to thereby modulate SCN/SDS resistance in the plant.
Preferably, the substance that modulates expression of an SCN/SDS
resistance activity is discovered by a disclosed method of the
present invention.
[0051] A method for providing a resistance characteristic to a
plant is also disclosed. The method comprises introducing to said
plant a construct comprising a nucleic acid sequence encoding an
SCN/SDS resistance gene product operatively linked to a promoter,
wherein production of the SCN/SDS resistance gene product in the
plant provides a resistance characteristic to the plant. The
construct can further comprises a vector selected from the group
consisting of a plasmid vector or a viral vector. The SCN/SDS
resistance gene product comprises a protein having an amino acid
sequence of SEQ ID NO:14. The nucleic acid sequence comprises the
nucleotide sequence of SEQ ID NO: 1 3 or a nucleic acid that is
substantially similar to SEQ ID NO: 1 3, and which encodes an
SCN/SDS resistance polypeptide.
[0052] The resistance characteristic is preferably nematode
resistance, fungal resistance or combinations thereof. More
preferably, the nematode resistance is H. glycines resistance, even
more preferably race 3 H. glycines resistance.
[0053] In an alternative embodiment the construct further comprises
another nucleic acid molecule encoding a polypeptide that provides
an additional desired characteristic to the plant. Optionally, the
method further comprises monitoring an insertion point for the
construct in the plant genome; and providing for insertion of the
construct into the plant genome at a location not associated with
the resistance characteristic, the desired characteristic, or both
the resistance and the desired characteristic. Preferably, the
plant is a soybean plant.
[0054] The present invention also provides methods for providing a
resistance characteristic to a plant is also disclosed, wherein a
combination of genetic and non-genetic techniques is employed. The
method comprises introducing to said plant a construct comprising a
nucleic acid sequence encoding an SCN/SDS resistance gene product
operatively linked to a promoter and provision of a substance that
modulates SCS/SDS resistance gene activity, wherein production of
the SCN/SDS resistance gene product in the plant, in combination
with provision of the SCN/SDS resistance gene modulator, provides a
resistance characteristic to the plant.
[0055] Accordingly, it is an object of the present invention to
provide novel isolated polynucleotides and polypeptides relating to
loci underlying resistance to soybean cyst nematode and soybean
sudden death syndrome and methods employing same. The object is
achieved in whole or in part by the present invention.
[0056] An object of the invention having been stated hereinabove,
other objects and advantages will become evident as the description
proceeds, when taken in connection with the accompanying Drawings
and Examples as best described hereinbelow.
BRIEF DESCRIPTION OF THE DRAWINGS
[0057] FIG. 1 depicts new AFLP genetic markers for SCN/SDS
resistance.
[0058] FIG. 1A presents genomic sequences of the both alleles
(resistant Forrest and susceptible Essex) of the converted AFLP
markers E.sub.ATGM.sub.CGA87 (SEQ ID NOs:1-2);
E.sub.CTAM.sub.AGG113 (SEQ ID NOs:3-4); E.sub.CGGM.sub.AGA116 (SEQ
ID NOs:5-6); E.sub.CCGM.sub.AAC405 (SEQ ID NOs:7-8),
E.sub.CCCM.sub.ATG161 (SEQ ID NOs:9-10), E.sub.CCAM.sub.AGC114 (SEQ
ID NOs:1 1-12. The italicized and underlined sequences represent
the forward and reverse sequence specific primers used. The bold
capital sequences represent the original AFLP restriction site. The
bold letters indicate the difference in sequences between the two
alleles.
[0059] FIG. 1B presents genomic sequences of the two alleles
(resistant and susceptible) of the converted E.sub.ATGM.sub.CGA87
markers. The italic sequences represent the resistance specific
TaqMan.TM. probes TMA5-RE and the susceptible allele specific probe
TMA5-S. The standard font underlined sequence represent the
TaqMan.TM. forward and reverse primers assay, the underlined italic
sequence is the ATG4BACF primer used for sequence extension of the
E.sub.ATGM.sub.CGA87 marker, the BAC derived extended sequences are
in small font capitals.
[0060] FIG. 2 depicts AFLPs for selecting SCN/SDS resistance.
[0061] FIG. 2A shows PCR amplification products using
E.sub.ATGM.sub.CGA87 sequence specific primers TMA5 forward and
reverse: Lane 1-40 represent 40 RIL DNA, 41 and 42 are the two
parents. F: Forrest; E: Essex; 1: resistant allele; 2: susceptible
allele; H: heterozygote lines. The PCR products were separated by
electrophoresis on a 4% (w/v) Metaphor gel.
[0062] FIG. 2B shows a partial AFLP autoradiograph profile of the
E.sub.CGGM.sub.AGA116 marker. The six selective nucleotides step
was replaced by MseI primer M.sub.AGAGACT and EcoRI primer E. Lane
7: Essex; Lane 8: Forrest; Lane 1 to 6 and 9 to 20 represent RIL
DNA; 1: resistant allele; 2: susceptible allele
[0063] FIG. 2C shows PCR amplification products using
E.sub.CTAM.sub.AGG113 sequence specific primers CTA forward and
reverse: Lane 1-40 represent 40 RIL DNA, 41 and 42 are the two
parent. F: Forrest; E: Essex; 1: resistant allele; 2: susceptible
allele; H: heterozygote lines. The PCR products were separated by
electrophoresis on a 4% (w/v) Metaphor gel.
[0064] FIG. 2D shows PCR amplification products using
E.sub.CCGM.sub.AAC405 sequence specific primers A2D8 forward and
reverse: Lane 1-40 represent 40 RIL DNA, 41 and 42 are the two
parents F: Forrest; E: Essex; 1: resistant allele; 2: susceptible
allele; H: heterozygote lines. The PCR products were separated by
electrophoresis on a 4% (w/v) Metaphor gel.
[0065] FIG. 3 depicts a genetic and physical map showing the
location of an Rhg4 gene relative to DNA markers. The location of
the aspartokinase serine dehydrogenase (AK-HSDH) and the A2D8
marker are indicated as determined by restriction mapping of BAC
DNA. The A2D8 sequences for Essex and Forrest alleles are deposited
in GenBank as Accession Nos. AF286701 and AF286700, respectively.
The / locus (I) position was estimated by relation to
BARC-SAT.sub.--162 (Cregan et al., 1999c). Genetic mapping shows
Rhg4 and A2D8 are both within the interval shown by the horizontal
line and within a large insert clone, 100B10, that contains a 140
kbp insert (Zobrist et al. (2000) Soybean Genet Newslett
27:10-15).
[0066] FIG. 4 depicts the gene structure of the rhg1 gene and
clones derived from Forrest genomic DNA.
[0067] FIG. 5 depicts detection of the A2D8 marker polymorphism
using the TaqMan.TM. assay and manual selection of genotypes.
Eighty-six individuals from an F5 derived population of recombinant
inbred lines from the cross of Essex.times.Forrest that segregate
for resistance to SCN are shown.
[0068] FIG. 5A is an image of fluorescent signals viewed under the
"dye component" field of the sequence detection software and the
A2D8 genotypes were manually selected based on the ratio of FAM and
TET signals. Allele 1 homozygous, Forrest type; FAM<<TET.
Allele 2 homozygous, Essex type; TET<<FAM. Alleles 1 and 2
heterogeneous, Essex and Forrest type; TET less than 2 fold greater
or lesser than FAM. Two selections were used, in the first
(TaqMan.TM. assay1) group of genotypes FAM 6-8 and TET 8-9 were
considered susceptible. In the second (TaqMan.TM. assay 2) group,
they were considered heterogeneous.
[0069] FIG. 5B is a spreadsheet that contains scores (allele
designations) for the samples as they were arranged in the 96 well
plate. There was no DNA in wells E12, F12 and G12 (negative
controls). There was Essex DNA in wells A1, C12 and D12. There was
Forrest DNA in wells B2, A12 and B12. The RIL DNA was in well A3 to
H11 in order by row from RIL1 -RIL86 except samples E1 (RIL3) and
E6 (RIL 43) that did not amplify. The RILs resistant to SCN had an
index of parasitism FI<10% of the susceptible check resistant
lines.
[0070] FIG. 6 depicts detection of the A2D8 marker polymorphism by
PCR amplification and gel electrophoresis of soybean genotypes.
Seventy-eight individuals from an F5 derived population of
recombinant inbred lines from the cross of Essex.times.Forrest that
segregate for resistance to SCN are shown.
[0071] FIG. 6A is an image of fluorescent signals viewed under the
"dye component" field of the sequence detection software and the
A2D8 genotypes were manually selected based on the ratio of FAM and
TET signals. Lane 1, 42 Essex; Lane 2 and 41 Forrest; Lanes 3-40
RILS 1-38.
[0072] FIG. 6B is a picture of an ehtidium-stained gel, showing
resolution of gel electrophoresis markers. Lane 42 Essex; Lane 41
Forrest; Lanes 1-40 RILS 39-78. Asterisks indicate disagreements
with the TaqMan.TM. assay 1.
[0073] FIG. 7A-B presents the rhg1 gene seqeunce (SEQ ID
NO:13).
[0074] FIG. 7C presents the rhg1 polypeptide (SEQ ID NO:14).
[0075] FIG. 7D shows sequences producing significant alignments
using BLAST analysis.
[0076] FIG. 7E-F is an alignment between rhg1 protein (SEQ ID
NO:14) and Arabidopsis thaliana hypothetical protein T18N14.120
(GenBank Accession T46070).
DETAILED DESCRIPTION OF THE INVENTION
[0077] Disclosed herein is the identification of AFLP markers that
are genetically linked to the SCN/SDS resistance loci of Forrest.
Further disclosed are purified and isolated SCN or SDS resistance
genes, proximal sequences to SCN/SDS resistance genes, and SCN/SDS
resistance-related genes.
[0078] The isolated and purified polynucleotide sequences disclosed
herein can thus be used in a variety of applications pertaining to
breeding and engineering soybeans having SCN and SDS resistance.
For example, the isolated polynucleotides disclosed herein can be
used in position-based or homology-based cloning of additional
SCN/SDS resistance genes, including regulatory elements; in gene
structure determination; in studies of genome organization and gene
expression; in gene complementation experiments; in the isolation
of additional DNA markers for gene manipulation and molecular
marker assisted breeding; and in plant transformation and the
production of transgenic plants.
[0079] The present invention also pertains to a soybean plant and
methods of producing the same, which is resistant to soybean cyst
nematodes (SCN). In one embodiment, the method comprises stable
transformation of a plant with an rhg1 gene, disclosed herein. In
another embodiment, the method comprises introgression in soybean
of a trait enabling the plant to resist soybean cyst nematode (SCN)
infestation. Additionally, the present invention relates to method
of precise and accurate introgression of the genetic material
conferring SCN resistance from one or more parent plants into the
progeny.
[0080] The present invention also pertains to a soybean plant and
methods of producing the same, which is resistant to soybean sudden
death syndrome (SDS). In one embodiment, the method comprises
stable transformation of a plant with an rhg1 gene, disclosed
herein. In another embodiment, the method comprises introgression
of the genetic material conferring SDS resistance from one or more
parent plants into the progeny with precision and accuracy.
[0081] The invention differs from present technology in several
regards. In one aspect, the present invention provides the first
disclosure of the rhg1 gene sequence, thereby enabling transgenic
approaches for providing SCN/SDS resistance. Further, the present
invention provides a non-electorphoretic selection assay using
nucleotide sequences of SCN/SDS resistance gene alleles. The
disclosed nucleotide sequences of SCN/SDS resistance genes and
associated genetic markers provide means for easily selecting
resistant cultivars, for assembling many resistance genes in a
single cultivar, for combining resistance genes in novel
combinations, for identifying genes that confer resistance in new
cultivars, and for predicting resistance in cultivars. The
invention is used to improve selection for SDS and SCN resistance
in soybean in breeding programs.
I. Traits
[0082] The term "phenotype" or "trait" each refer to any observable
property of an organism, produced by the interaction of the
genotype of the organism and the environment. A phenotype can
encompass variable expressivity and penetrance of the phenotype.
Exemplary phenotypes include but are not limited to a visible
phenotype, a physiological phenotype, a susceptibility phenotype, a
cellular phenotype, a molecular phenotype, and combinations
thereof. Preferably, the phenotype is related to SCN/SDS
resistance. The term "susceptibility phenotype" refers to an
increased capacity or risk for displaying a phenotype, i.e. a
susceptibility to SCN/SDS infection.
[0083] The term "complex trait" as used herein refers to a trait
that is not inherited as predicted by classical Mendelian genetics.
A complex trait results from the interaction of multiple genes,
each gene contributing to the phenotype. Complex traits can be
continuous or show threshold penetrance. In the field, SCN/SDS
resistance is inherited as a complex trait.
[0084] The term "quantitative trait" is a complex trait that can be
assessed quantitatively. Quantitation entails measurement of a
trait across a continuous distribution of values. SCN/SDS
resistance is a quantitative trait.
[0085] The term "SCN/SDS resistance" or "SCN/SDS resistance trait"
as used herein refers to a cellular or organismal capacity for
resistance to nematode or fungal infection, or both. Preferably,
the nematode resistance is Heterodera glycines (the organism that
causes SCN in soybeans) resistance, even more preferably race 3
Heterodera glycines resistance. The fungal resistance is preferably
Fusarium solani (the organism that causes SDS in
soybeans)-infection resistance. SCN resistance can be assayed in
the field or in the greenhouse by methods known in the art,
including but not limited to determination of an SCN index of
parasitism as disclosed in Example 2, Meksem et al. (1999), and
U.S. Pat. No.6,096,944. SDS resistance can be scored by
determination of disease incidence, disease severity, and disease
index values as disclosed in Hnetkovsky et al. (1996) Crop Sci
36(2):393-400, Njiti et al. (1996) Crop Sci 36:1 165-1170; and
Matthews et al. (1991).
[0086] The term "SCN/SDS resistance" is used herein for convenience
to describe traits, transgenic plants, polynucleotides, and
polypeptides of the present invention. Therefore, the resistance
characteristic conveyed by the polynucleotides and polypeptides of
the present invention refers to any resistance characteristic as
set forth herein and as would be apparent to one of ordinary skill
in the art after reviewing the disclosure of the present
invention.
[0087] The term "molecular phenotype" refers to a detectable
feature of molecules in a cell or organism. Exemplary molecular
phenotypes include but are not limited to a presence of a genetic
marker nucleotide sequence, a presence of a SCN/SDS resistance gene
sequence, a level of gene expression, a splice selection, a level
of protein, a protein type, a protein modification, a level of
lipid, a lipid type, a lipid modification, a level of carbohydrate,
a carbohydrate type, a carbohydrate modification, and combinations
thereof. Methods for observing, detecting, and quantitating
molecular phenotypes are well known to one skilled in the art. See
Sambrook et al., eds. (1989) Molecular Cloning, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, N.Y.; by Silhavy et
al. (1984) Experiments with Gene Fusions, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, N.Y.; by Ausubel et
al. (1992) Current Protocols in Molecular Bioloqy, John Wylie and
Sons, Inc. New York, N.Y.; Landgren et. al. (1988) Science
242:229-237; Bodanszky, et al. (1976) Peptide Synthesis, John Wiley
and Sons, Second Edition, New York, N.Y.; Harlow and Lane (1988)
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.; Ochman et al. (1990) in PCR
protocols: a Guide to Methods and Applications, Innis et al.
(eds.), pp. 219-227, Academic Press, San Diego, Calif.; Koduri and
Poola (2001) Steroids 66(1):17-23; Regan et al. (2000) Anal Biochem
286(2):265-276; U.S. Pat. Nos. 6,096,555; 5,958,624; and
5,629,158.
II. Genetic Mapping
[0088] For genetic mapping, a representative population was
generated as in Example 1. To detect genomic regions associated
with resistance to SCN and resistance to SDS, the RILs were
classified as Essex type or Forrest type for each marker. In some
cases, SCN susceptibility and resistance was quantitatively
determined according to a SCN female index (F1) of parasitism
(Meksem, 1999) as described in Example 2. Markers were compared
with SCN or SDS response scores by the F-test in analysis of
variance (ANOVA) done with SAS (SAS Institute Inc., Cary, N.C.,
1988). The probability of association of each marker with each
trait was determined and a significant association was declared if
P.ltoreq.0.05 (unless noted otherwise in the text) since the
detection of false associations is reduced in isogenic lines
(Landers & Botstein (1989) Genetics 121:185-199; Paterson et
al. (1990) Genetics 124:735-742).
[0089] Selected pairs of markers were analyzed by the two-way ANOVA
using the general linear model (PROC GLM) procedure to detect
non-additive interactions between the unlinked QTL (Chang et al.
(1996) Crop Sci 36:965-971) or Epistat (Chase et al. (1997) Theor
Appl Genet 94:724-730). Non-additive interactions between markers
which were significantly associated with SCN/SDS response were
excluded when P.gtoreq.0.05. Selected groups of markers were
analyzed by multi-way ANOVA to estimate joint heritabilities for
traits associated with multiple QTL. Joint heritability was
determined from the R.sup.2 term for the joint model in multi-way
ANOVA.
[0090] Mapmaker-EXP 3.0 (Lander et al. 1987) was used to calculate
map distances (cM, Haldane units) between linked markers and to
construct a linkage map including traits as genes. The RIL
(recombinant inbred line) and F.sub.3 self genetic models were
used. The log.sub.10 of the odds ratio (LOD) for grouping markers
was set minimally at 2.0, and maximum distance was set at 30 cM.
Conflicts were resolved in favor of the highest LOD score after
checking the raw data for errors. Marker order within groups was
determined by comparing the likelihood of many map orders. A
maximum likelihood map was computed with error detection. Trait
data were used for QTL analysis (Webb et al. 1995; Chang et al.
1997). The data were subjected to ANOVA (SAS Institute Inc., Cary,
N.C.) with mean separation by LSD (Gomez and Gomez (1984). Graphs
were constructed by Quattro Pro version 5.0 (Novell Inc., Orem,
Utah).
III. Nucleotide Sequences of SCN/SDS Resistance Genes and
Associated Genetic Markers
[0091] The nucleic acid molecules provided by the present invention
include the isolated nucleic acid molecules of SEQ ID NOs:1-13 and
15-114, sequences substantially similar to sequences of SEQ ID
NOs:1-13 and 15-114, conservative variants thereof,
plant-expressible variants thereof, subsequences and elongated
sequences thereof, complementary DNA molecules, and corresponding
RNA molecules. The present invention also encompasses genes, cDNAs,
promoters, chimeric genes, and vectors comprising disclosed SCN/SDS
resistance gene and SCN/SDS resistance gene marker nucleic acid
sequences.
III.A. General Considerations
[0092] The term "nucleic acid molecule" refers to
deoxyribonucleotides or ribonucleotides and polymers thereof in
either single- or double-stranded form. Unless specifically
limited, the term encompasses nucleic acids containing known
analogues of natural nucleotides that have similar properties as
the reference natural nucleic acid. Unless otherwise indicated, a
particular nucleotide sequence also implicitly encompasses
conservatively modified variants thereof (e.g. degenerate codon
substitutions), complementary sequences, subsequences, elongated
sequences, as well as the sequence explicitly indicated. The terms
"nucleic acid molecule" or "nucleotide sequence" can also be used
in place of "gene", "cDNA", or "mRNA". Nucleic acids can be derived
from any source, including any organism.
[0093] The term "isolated", as used in the context of a nucleic
acid molecule, indicates that the nucleic acid molecule exists
apart from its native environment and is not a product of nature.
An isolated DNA molecule can exist in a purified form or can exist
in a non-native environment such as a transgenic host cell.
[0094] The term "purified", when applied to a nucleic acid, denotes
that the nucleic acid is essentially free of other cellular
components with which it is associated in the natural state.
Preferably, a purified nucleic acid molecule is a homogeneous dry
or aqueous solution. The term "purified" denotes that a nucleic
acid or protein gives rise to essentially one band in an
electrophoretic gel. Particularly, it means that the nucleic acid
is at least about 50% pure, more preferably at least about 85%
pure, and most preferably at least about 99% pure.
[0095] The term "substantially identical", in the context of two
nucleotide or amino acid sequences, can also be defined as two or
more sequences or subsequences that have at least 60%, preferably
80%, more preferably 90-95%, and most preferably at least 99%
nucleotide or amino acid sequence identity, when compared and
aligned for maximum correspondence, as measured using one of the
following sequence comparison algorithms (described herein below
under the heading Nucleotide and Amino Acid Sequence Comparisons)
or by visual inspection. Preferably, the substantial identity
exists in nucleotide sequences of at least 50 residues, more
preferably in nucleotide sequence of at least about 100 residues,
more preferably in nucleotide sequences of at least about 150
residues, and most preferably in nucleotide sequences comprising
complete coding sequences.
[0096] In one aspect, polymorphic sequences can be substantially
identical sequences. The term "polymorphic" refers to the
occurrence of two or more genetically determined alternative
sequences or alleles in a population. An allelic difference can be
as small as one base pair.
[0097] Another indication that two nucleotide sequences are
substantially identical is that the two molecules specifically or
substantially hybridize to each other under stringent conditions.
In the context of nucleic acid hybridization, two nucleic acid
sequences being compared can be designated a "probe" and a
"target". A "probe" is a reference nucleic acid molecule, and a
"target" is a test nucleic acid molecule, often found within a
heterogenous population of nucleic acid molecules. "Target
sequence" is synonymous with "test sequence".
[0098] A preferred nucleotide sequence employed for hybridization
studies or assays includes probe sequences that are complementary
to or mimic at least an about 14 to 40 nucleotide sequence of a
nucleic acid molecule of the present invention. Preferably, a probe
comprises 14 to 20 nucleotides, or even longer where desired, such
as 30, 40, 50, 60, 100, 200, 300, or 500 nucleotides or up to the
full length of any of SEQ ID NOs:1-13, 15-114. Such fragments can
be readily prepared by, for example, directly synthesizing the
fragment by chemical synthesis, by application of nucleic acid
amplification technology, or by introducing selected sequences into
recombinant vectors for recombinant production. The phrase
"hybridizing specifically to" refers to the binding, duplexing, or
hybridizing of a molecule only to a particular nucleotide sequence
under stringent conditions when that sequence is present in a
complex nucleic acid mixture (e.g., total cellular DNA or RNA). The
phrase "binds substantially to" refers to complementary
hybridization between a probe nucleic acid molecule and a target
nucleic acid molecule and embraces minor mismatches that can be
accommodated by reducing the stringency of the hybridization media
to achieve the desired hybridization. Probe sequences can also
hybridize specifically to duplex DNA under certain conditions to
form triplex or other higher order DNA complexes. The preparation
of such probes and suitable hybridization conditions are well known
in the art.
[0099] "Stringent hybridization conditions" and "stringent
hybridization wash conditions" in the context of nucleic acid
hybridization experiments such as Southern and Northern blot
analysis are both sequence- and environment-dependent. Longer
sequences hybridize specifically at higher temperatures. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular
Biology-Hybridization with Nucleic Acid Probes part I chapter 2,
Elsevier, N.Y., N.Y. Generally, highly stringent hybridization and
wash conditions are selected to be about 5.degree. C. lower than
the thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength and pH. Typically, under "stringent
conditions" a probe will hybridize specifically to its target
subsequence, but to no other sequences.
[0100] The T.sub.m is the temperature (under defined ionic strength
and pH) at which 50% of the target sequence hybridizes to a
perfectly matched probe. Very stringent conditions are selected to
be equal to the T.sub.m for a particular probe. An example of
stringent hybridization conditions for Southern or Northern Blot
analysis of complementary nucleic acids having more than about 100
complementary residues is overnight hybridization in 50% formamide
with 1 mg of heparin at 42.degree. C. An example of highly
stringent wash conditions is 15 minutes in 0.15 M NaCl at
65.degree. C. An example of stringent wash conditions is 15 minutes
in 0.2X SSC buffer at 65.degree. C. (See Sambrook et al., 1989) for
a description of SSC buffer). Often, a high stringency wash is
preceded by a low stringency wash to remove background probe
signal. An example of medium stringency wash conditions for a
duplex of more than about 100 nucleotides, is 15 minutes in 1X SSC
at 45.degree. C. An example of low stringency wash for a duplex of
more than about 100 nucleotides, is 15 minutes in 4-6X SSC
at40.degree. C. For short probes (e.g., about 10 to 50
nucleotides), stringent conditions typically involve salt
concentrations of less than about 1.0 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0-8.3,
and the temperature is typically at least about 30.degree. C.
Stringent conditions can also be achieved with the addition of
destabilizing agents such as formamide. In general, a signal to
noise ratio of 2-fold (or higher) than that observed for an
unrelated probe in the particular hybridization assay indicates
detection of a specific hybridization.
[0101] The following are examples of hybridization and wash
conditions that can be used to clone homologous nucleotide
sequences that are substantially identical to reference nucleotide
sequences of the present invention: a probe nucleotide sequence
preferably hybridizes to a target nucleotide sequence in 7% sodium
dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50.degree. C.
followed by washing in 2X SSC, 0.1% SDS at 50.degree. C.; more
preferably, a probe and target sequence hybridize in 7% sodium
dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50.degree. C.
followed by washing in 1X SSC, 0.1% SDS at 50.degree. C.; more
preferably, a probe and target sequence hybridize in 7% sodium
dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50.degree. C.
followed by washing in 0.5X SSC, 0.1% SDS at 50.degree. C.; more
preferably, a probe and target sequence hybridize in 7% sodium
dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50.degree. C.
followed by washing in 0.1X SSC, 0.1% SDS at 50.degree. C.; more
preferably, a probe and target sequence hybridize in 7% sodium
dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50.degree. C.
followed by washing in 0.1X SSC, 0.1% SDS at 65.degree. C.
[0102] A further indication that two nucleic acid sequences are
substantially identical is that proteins encoded by the nucleic
acids are substantially identical, share an overall
three-dimensional structure, are biologically functional
equivalents; or are immunologically cross-reactive. These terms are
defined further under the heading SCN/SDS Resistance Polypeptides
herein below. Nucleic acid molecules that do not hybridize to each
other under stringent conditions are still substantially identical
if the corresponding proteins are substantially identical. This can
occur, for example, when two nucleotide sequences are significantly
degenerate as permitted by the genetic code.
[0103] The term "conservatively substituted variants" refers to
nucleic acid sequences having degenerate codon substitutions
wherein the third position of one or more selected (or all) codons
is substituted with mixed-base and/or deoxyinosine residues (Batzer
et al. (1991) Nucleic Acid Res. 19:5081; Ohtsuka et al. (1985) J
Biol Chem 260:2605-2608; Rossolini et al. (1994) Mol Cell Probes
8:91-98).
[0104] The term "plant-expressible variant" means a substantially
similar sequence that has been modified to comprise a coding
sequence (nucleotide sequence) can be efficiently expressed by
plant cells, tissue and whole plants. The art understands that a
plant-expressible coding sequence has a GC composition consistent
with good gene expression in plant cells, a sufficiently low CpG
content so that expression of that coding sequence is not
restricted by plant cells, and codon usage which is consistent with
that of plant genes. Where it is desired that the properties of the
plant-expressible SCN/SDS resistance gene are identical to those of
the naturally occurring SCN/SDS resistance gene, the
plant-expressible homolog will have an identical coding sequence or
a substantially identical coding sequence.
[0105] The term "subsequence" refers to a sequence of nucleic acids
that comprises a part of a longer nucleic acid sequence. An
exemplary subsequence is a probe, described herein above, or a
primer. The term "primer" as used herein refers to a contiguous
sequence comprising about 8 or more deoxyribonucleotides or
ribonucleotides, preferably 10-20 nucleotides, and more preferably
20-30 nucleotides of a selected nucleic acid molecule. The primers
of the present invention encompass oligonucleotides of sufficient
length and appropriate sequence so as to provide initiation of
polymerization on a nucleic acid molecule of the present
invention.
[0106] The term "elongated sequence" refers to an addition of
nucleotides (or other analogous molecules) incorporated into the
nucleic acid. For example, a polymerase (e.g., a DNA polymerase),
e.g., a polymerase that adds sequences at the 3' terminus of the
nucleic acid molecule can be employed to prepare an elongated
sequence. In addition, the nucleotide sequence can be combined with
other DNA sequences, such as promoters, promoter regions,
enhancers, polyadenylation signals, intronic sequences, additional
restriction enzyme sites, multiple cloning sites, and other coding
segments.
[0107] The term "complementary sequence", as used herein, indicates
two nucleotide sequences that comprise anti-parallel nucleotide
sequences capable of pairing with one another upon formation of
hydrogen bonds between base pairs. As used herein, the term
"complementary sequences" means nucleotide sequences which are
substantially complementary, as can be assessed by the same
nucleotide comparison set forth above, or is defined as being
capable of hybridizing to the nucleic acid segment in question
under relatively stringent conditions such as those described
herein. A particular example of a complementary nucleic acid
segment is an antisense oligonucleotide.
[0108] The present invention further includes vectors comprising
the disclosed SCN/SDS resistance gene sequences, including
plasmids, cosmids, and viral vectors. The term "vector", as used
herein refers to a DNA molecule having sequences that enable its
replication in a compatible host cell. A vector also includes
nucleotide sequences to permit ligation of nucleotide sequences
within the vector, wherein such nucleotide sequences are also
replicated in a compatible host cell. A vector can also mediate
recombinant production of an SCN/SDS resistance gene polypeptide,
as described further herein below.
[0109] Nucleic acids of the present invention can be cloned,
synthesized, recombinantly altered, mutagenized, or combinations
thereof. Standard recombinant DNA and molecular cloning techniques
used to isolate nucleic acids are well known in the art. Exemplary,
non-limiting methods are described by Sambrook et al., eds.,1 989;
by Silhavy et al., 1984; by Ausubel et al., 1992; and by Glover,
ed. (1985) DNA Cloning: A Practical Approach, MRL Press, Ltd.,
Oxford, United Kingdom. Site-specific mutagenesis to create base
pair changes, deletions, or small insertions are also well known in
the art as exemplified by publications, see e.g., Adelman et al.,
(1983) DNA 2:183; Sambrook et al. (1989).
[0110] Nucleotide sequences of the present invention can detected,
subcloned, sequenced, and further evaluated by any measure well
known in the art using any method usually applied to the detection
of a specific DNA sequence including but not limited to dideoxy
sequencing, PCR, oligomer restriction (Saiki et al.,
Bio/Technology3:1008-1012 (1985), allele-specific oligonucleotide
(ASO) probe analysis (Conner et al. (1983) Proc Natl Acad Sci USA
80:278), and oligonucleotide ligation assays (OLAs) (Landgren et.
al. (1988) Science 241:1007). Molecular techniques for DNA analysis
have been reviewed (Landgren et. al. (1988) Science
242:229-237).
1!Table of Functionally Equivalent Codons? !Amino Acids? Codons
Alanine Ala A GCA GCC GCG GCU Cysteine Cys C UGC UGU Aspartic Acid
Asp D GAC GAU Glumatic acid Glu E GAA GAG Phenylalanine Phe F UUC
UUU Glycine Gly G GGA GGC GGG GGU Histidine His H CAC CAU
Isoleucine Ile I AUA AUC AUU Lysine Lys K AAA AAG Leucine Leu L UUA
UUG CUA CUC CUG CUU Methionine Met M AUG Asparagine Asn N AAC AAU
Proline Pro P CCA CCC CCG CCU Glutamine Gln Q CAA CAG Arginine Arg
R AGA AGG CGA CGC CGG CGU Serine Ser S ACG AGU UCA UCC UCG UCU
Threonine Thr T ACA ACO ACG ACU Valine Val V GUA GUC GUG GUU
Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU
III.B. Genetic Markers
[0111] The term "genetic marker", as used herein generally refers
to a genetic locus, a phenotype conferred by locus, or a nucleotide
sequence residing at a locus, wherein the locus is genetically
linked to a trait of interest. The term "genetically linked" as
used herein refers to two or more loci that are predictably
inherited together during random crossing or intercrossing.
Quantitative linkage analysis is further described in the section
Genetic Mapping herein above. Preferably, genetically linked loci
are less than about 10 cM apart, more preferably less than about 5
cM apart, and even more preferably less than about 1 cM apart.
Optimally, the genetic marker and the gene conferring a trait of
interest comprise the same or overlapping nucleotide sequence.
[0112] An embodiment of the present invention comprises genetic
markers associated with SCN resistance and SDS resistance that are
isolatable from soybeans, and which are free from total genomic
DNA. Disclosed herein are sequences of AFLP markers mapped in
soybean to the chromosomal segments carrying rhg1 and SDS loci on
molecular linkage group G and the Rhg4 locus on molecular linkage
group A2. Representative markers for SCN/SDS resistance are set
forth as SEQ ID NOs:1, 3, 5, 7, 9, and 11. Respresentative
corresponding markers for SCN/SDS susceptibility are set forth as
SEQ ID NOs:2, 4, 6, 8, 10, and 12.
[0113] AFLP bands were obtained as described in Example 3. From
each AFLP band, 4-30 clones were sequenced (mean 15.6) depending on
the sequence complexity of the originating band. The sequence
analysis showed that each AFLP band can be composed of a number of
different DNA sequences from fragments of identical size. A mean of
6 sequences per band with a range of 1-15 sequences per band was
detected. From a single AFLP band only one sequence corresponded
with the original AFLP marker. The other sequences were bands that
shared not only the same size within 1-2 bp but also the same
selective bases at the EcoRI and MseI sites (100%). Further, some
of the cloned sequences from within a band shared between 6 to 15
bp in common to each side (EcoRI and MseI) of the original AFLP
polymorphism (about 30% of bands).
[0114] To identify polymorphisms within the AFLP, the AFLP sequence
was used to design primers to screen the Forrest BamHI BAC library
by PCR. For example, E.sub.ATGM.sub.CGA87 was a dominant AFLP band
in coupling phase with the rhg1 locus, and screening with a
E.sub.ATGM.sub.CGA87 AFLP band primer yielded a single clone. Two
internal primers were designed from the E.sub.ATGM.sub.CGA87
resistant allele and DNA from the corresponding BAC was used as
template to extend the sequence from the AFLP marker both up and
down stream by sequencing. The sequence showed a single 5 bp indel
underlay the polymorphic band and no SNPs were present. As used
herein, an "indel" refers to a nucleotide insertion or a deletion
(FIG. 1B). No additional polymorphisms were detected in about 1,250
bp of flanking sequence.
[0115] Sequence comparison of both, resistant and the susceptible
alleles of the co-dominant AFLP marker E.sub.CTAM.sub.AGG113 found
polymorphisms including both indels and SNPs. There were 4 SNPs
within 113 bp and 1 indel (21 bp) (FIG. 1A). Primer sets were
designed around the indel site and used to map the genetic
position. The genetic position of the identified indel mapped to
the region of the original AFLP.
[0116] Sequence comparison of resistant and the susceptible alleles
of the dominant AFLP marker E.sub.CCCM.sub.ATG161 found SNP
polymorphism. There were 2 SNPs within 116 bp (FIG. 1A). Primer
sets were designed around the SNP site and used to map the genetic
position. The genetic position of the identified indel mapped to
the region of the original AFLP.
[0117] Sequence comparison of both resistant and susceptible
alleles of the dominant AFLP marker E.sub.CCAM.sub.AGC114 found SNP
polymorphism adjacent to the EcoRI site. There was 1 SNP within 114
bp (FIG. 1A).
[0118] Sequence comparison of resistant and susceptible alleles of
the co-dominant AFLP marker E.sub.CCGM.sub.AAC405 found
polymorphisms including both indels and SNPs. There were 2 indels
(12 bp and 4 bp) and 4 SNPs within 405 bp (FIG. 1A). The 4 bp indel
was two AG repeats in an [AG].sub.5 complex micro-satellite
sequence. Primer sets were designed around both indel sites and
used to map the genetic position. In both cases, the genetic
position of the identified indel mapped to the region of the
original AFLP.
[0119] For the AFLP marker E.sub.CGGM.sub.AGA116, the polymorphisms
were found adjacent to both the EcoRI and MseI restriction sites
(FIG. 1A). The six selective nucleotide step was replaced by
M.sub.AGAGACT and E.sub.C. Using this primer set the detection of
the polymorphism on sequencing gels as well as the mapping of this
sequence to the same location as the original AFLP was successful
(FIG. 2B). There was 1 indel (2 bp) and 1 SNPs within 116 bp (FIG.
1A). The 2 bp indel was the [A].sub.2 extension of an [A].sub.8
repeat. Primer sets were designed around the indel and SNP sites
and used to map their genetic positions. In both cases, the genetic
position of the identified polymorphism was identical to the region
of the original AFLP.
[0120] Comparison of both alleles of the AFLP marker
E.sub.CCGM.sub.AAC405 provided four SNPs, two indels and one SSR.
The insertion of [AG].sub.2 in the [AG].sub.8 repeat of the
resistance allele created a microsatellite polymorphism that was
designated SIUC-SAG405 by the present co-inventors. The difference
of 4 bp between the two alleles at position 224 bp to 228 bp was
enough to discriminate between the resistant and susceptible allele
after electrophoresis through a 4% (v/w) Metaphor7 agarose gel. The
12 bp indel at 42 bp to 54 bp was used to design a sequence
specific PCR marker (FIG. 2D), and to develop a TaqMan.TM. assay
for the Rhg4 locus. SNPs were found within the
E.sub.CCGM.sub.AAC405. The transversions of T at position 327 in
the resistant allele to C at position 337 in the susceptible
allele; and A at position 358 bp in the resistance allele to C at
position 366 bp in the susceptible allele can also be used for
high-throughput screening SNPs based assay.
[0121] An indel of 21 bp was responsible for the polymorphism at
the E.sub.CTAM.sub.AGG113 AFLP locus between Essex and Forrest. PCR
based markers were designed to flank the 21 bp indel and shown to
be polymorphic, the new marker was named CTA (FIG. 2C).
[0122] In the E.sub.ATGM.sub.CGA87 marker the insertion of CTTAT to
form a tandem repeat in the Forrest allele at position 20 bp to 25
bp created a 5 bp polymorphism that was suitable for marker
development. PCR primers were designed to develop a sequence
specific PCR assay (FIG. 2A), the new marker was named ATG4. The
same indel was used to develop a TaqMan.TM. probe named TMA5 to
discriminate between the two alleles.
[0123] The genetic markers of the present invention can be used to
reliably select SCN/SDS resistance, as described herein.
III.C. SCN/SDS Resistance Genes
[0124] The term "gene" refers broadly to any segment of DNA
associated with a biological function. A gene encompasses sequences
including but not limited to a coding sequence, a promoter region,
a cis-regulatory sequence, a non-expressed DNA segment, a
non-expressed DNA segment that contributes to gene expression, a
DNA segment designed to have desired parameters, or combinations
thereof. A gene can be obtained by a variety of methods, including
cloning from a biological sample, synthesis based on known or
predicted sequence information, and recombinant derivation of an
existing sequence.
[0125] The term "gene" thus includes an isolated soybean rhg1 and
SDS resistance gene as disclosed herein (FIG. 3). The gene is
capable of conveying Heterodera glycines-infestation resistance or
Fusarium solani-infection resistance to a non-resistant soybean
germplasm, the gene located within a quantitative trait locus
mapping to linkage group G and mapped by genetic markers of SEQ ID
NOs:1 -6, said gene located along said quantitative trait locus
between said markers. Positional cloning methods were used to
isolate genomic sequences in the chromosomal regions of Forrest
that confers SCN/SDS resistance, as further described in Example 4.
Specifically, rhg1 sequences were derived from BAC clones 21D9 and
73P6 of the Forrest BamHI or HindIII BAC libraries (Meksem et al.,
2000). Preferably, the gene comprises the nucleotide sequence set
forth as SEQ ID:13 (FIG. 7A-B). BLASTP analysis of the conceptual
translation of the rhg1 gene (FIG. 7C), set forth as SEQ ID:14
shows high homology to the T46070 GenBank entry described as
hypothetical protein T18N14.120 from Arabidopsis thaliana (FIG.
7E-F), high homology to the rice Xa2l disease resistance gene
encoding a leucine-rich repeat protein, and high homology to the
tomato CF-2 gene for resistance to Cladosporium fulvus (FIG.
7D).
[0126] The rhg1 seqeunces disclosed herein can also be used to
isolate rhg1 cDNAs according to methods well-known in the art. A
representative rhg1 partial cDNA is set forth as SEQ ID NO:122.
This segment of the rhg1 gene shows homology to the leucine-rich
regions of the Arabidopsis hypothetical protein T18N14.120 (Gen
Bank T46070) and tomato CF-2 resistance genes.
[0127] For example, the term "gene" also includes an isolated
soybean Rhg4 gene. The gene is capable of conveying Heterodera
glycines-infestation resistance to a non-resistant soybean
germplasm, said gene located within a quantitative trait locus
mapping to linkage group A2 and mapped by the AFLP markers of SEQ
ID NOs:6-12, said gene located along said quantitative trait locus
between said markers. Preferably, the gene comprises a nucleotide
sequence set forth as any one of SEQ ID NOs:16-19.
[0128] Genes underlying quantitative traits, or genes with related
function, such as disease resistance, are often organized in
clusters within the genome (e.g., Staskawicz (1995) Science
268:661-667). In the case of SCN/SDS resistance, previous studies
by the co-inventors of the present invention have suggested that
the resistance trait in Forrest may be caused by four genes in a
cluster with two pairs in close linkage or by a two-gene cluster
with each gene displaying pleitropy (Meksem et al., 1999). Thus,
genomic DNA isolated and disclosed herein comprise multiple
resistance gene sequences. Additional sequences derived from the
SCN/SDS resistance locus are set forth as SEQ ID NOs:20-66. BLASTX
analysis of these sequences reveals further homology to known
proteins in other organisms, supporting that they comprise new
partial gene sequences (Table 1). Of particular interest, BLASTX
analysis of the sequences set forth as SEQ ID NOs:67-114 reveals
that several of the disclosed sequences have high homology to the
T46070 GenBank entry described as hypothetical protein T18N 14.120
from Arabidopsis thaliana, high homology to the tomato CF-2 disease
resistance genes encoding leucine-rich repeat proteins, and to the
tomato CF-9 gene for resistance to Cladosporium fulvus (Table
1).
[0129] The present invention also pertains to resistance genes
related to rhg1 and Rhg4. Partial cDNAs of additional putative
SCN/SDS resistance genes, set forth as SEQ ID NOs:67-114, were
identified based on hybridization to rhg1 and Rhg4 sequences, as
further described in Example 5. BLASTX analysis of these sequences
reveals further homology to known proteins in other organisms,
supporting that they comprise new partial gene sequences (Table 2).
Of particular interest, BLASTX analysis of the sequences set forth
as SEQ ID NOs:67-114 reveals that several of the disclosed
sequences have high homology to the T46070 GenBank entry described
as hypothetical protein T18N14.120 from Arabidopsis thaliana, high
homology to the tomato CF-2 disease resistance genes encoding
leucine-rich repeat proteins, and to the tomato CF-9 gene for
resistance to Cladosporium fulvus (Table 2). Based on their
hybridization to rhg1 and Rhg4 sequences, genes comprising any of
SEQ ID NOs:67-114 may also confer resistance to race 3 Heterodera
glycines. It will be apparent to one having ordinary skill in the
art that the disclosed sequences, or portion thereof, can be used
to identify, confirm and/or screen for SDS, SCN and/or other
resistance or for loci that confer SDS, SCN and/or other
resistance.
2TABLE 1 best BLAST hit Score SEQ ID NO. inventor's reference
(ACCESSION) (bits) E value identities Positives 20
III-00_F2-3RCF1900-2450 T47727 230 9 e -60 {fraction (114/170
)}(67%) {fraction (134/170 )}(78%) 21 III-01_21d9A1,1A1 no
significant similarity 22 III-01_21d9A2,11F11Rlaccase AC007063 97 1
e -19 {fraction (62/166 )}(37%) {fraction (92/166 )}(55%) 23
III-01_21d9A2,4A4Mic no significant similarity 24
III-01_CMGsmalF1-1F T46070 67 4 e - 13 {fraction (49/147 )}(33%)
{fraction (62/147 )}(41%) 25 III-02_21d9A2,12A12FNaH + hypoth
T00576 67 2 e - 10 {fraction (57/188 )}(30%) {fraction (87/188
)}(45%) 26 III-02_F3-1RCF2000-2500 T46070 170 7 e - 42 {fraction
(79/105 )}(75%) {fraction (93/105 )}(88%) 27
III-03_21d9A1,1E1Flaccase AC007020 61 1 e - 08 {fraction (37/65
)}(56%) {fraction (43/65 )}(65%) 28 III-03_21d9A2,12A12RNaH +
hypothet AC007063 116 2 e - 25 {fraction (61/165 )}(36%) {fraction
(95/165 )}(56%) 29 III-03_21d9A2,4B4ESTM no significant similarity
30 III-03_21d9A2,8F8CF1a T47727 187 54 -48 {fraction (95/142
)}(66%) {fraction (106/142 )}(73%) 31 III-03_21d9A2,8F8CFHomol
T47727 177 5 e - 45 {fraction (90/132 )}(68%) {fraction (100/132
)}(75%) 32 III-03_CMG,smalF1-3FCF300-1100 T46070 107 4 e - 27
{fraction (67/189 )}(35%) {fraction (89/189 )}(46%) 33
III-03_F3-2R1800-Cterm T47727 201 1 e - 64 {fraction (97/129
)}(75%) {fraction (113/129 )}(87%) 34 III-04_21d9A1,1E1R no
significant similarity 35 III-04_21d9A2,1B1 no significant
similarity 36 III-04_21d9A2,6D6mic no significant similarity 37
III-05_21d9A1,1C1GmxLaccase AB010692 153 2 e - 36 {fraction (80/124
)}(64%) {fraction (90/124 )}(72%) 38 III-05_21d9A2,4C4CFHomol
T46070 125 6 e - 28 {fraction (65/106 )}(61%) {fraction (72/106
)}(67%) 39 III-06_21d9A2,11A11laccasegene AC007020 67 3 e - 12
{fraction (30/49 )}(61%) {fraction (35/49 )}(71%) 40
III-07_21d9A1,2A2F no significant similarity 41 III-08_21d9A1,2A2R
no significant similarity 42 III-08_21d9A2,6F6 no significant
similarity 43 III-09_21d9A1,1E1 no significant similarity 44
III-09_21d9A1,2D2FNaH + hypothe AC007063 84 93 - 17 {fraction
(44/127 )}(34%) {fraction (74/127 )}(57%) 45
III-09_21d9A2,4E4Laccase AC007020 90 1 e - 32 {fraction (43/53
)}(81%) {fraction (46/53 )}(86%) 46 III-09_21d9A2,9A9 no
significant similarity 47 III-10_21d9A2,11C11 T47325 53 3 e - 06
{fraction (45/132 )}(34%) {fraction (65/132 )}(49%) 48
III-10_21d9A2,11C11hypothetical T47325 53 3 e - 06 {fraction
(45/132 )}(32%) {fraction (65/132 )}(49%) 49 III-11_21d9A1,1F1SatAT
no significant similarity 50 III-11_21d9A2,4A4F no significant
similarity 51 III-11_21d9A2,4F4SatTA no significant similarity 52
III-12_21d9A2,1F1NaHexchangine AC007063 126 3 e - 28 {fraction
(72/181 )}(39%) {fraction (108/181 )}(58%) 53
III-12_21d9A2,4A4RSatTAGA no significant similarity 54
III-13_21d9A1,1G1NaHexchanHypothe T00576 50 2 e - 05 {fraction
(31/83 )}(37%) {fraction (44/83 )}(52%) 55
III-13_21d9A1,8D8CF500-1000 T46070 84 4 e - 24 {fraction (48/127
)}(37%) {fraction (66/127 )}(51%) 56 III-13_21d9A2,4B4FSatGAAAA no
significant similarity 57 III-14_21d9A2,11E11GmxEST no significant
similarity 58 III-14_21d9A2,1G1 no significant similarity 59
III-15_21d9A1,8E8 no significant similarity 60
III-15_21d9A2,4C4FCF1600-1000 T46070 158 6 e - 38 {fraction (99/215
)}(46%) {fraction (113/215 )}(52%) 61 III-15_21d9A2,9D9NaHlonexch
AC007063 64 1 e - 09 {fraction (38/118 )}(32%) {fraction (59/118
)}(49%) 62 III-16_21d9A1,11D11laccase CAA74104 82 4 e - 17
{fraction (35/49 )}(71%) {fraction (43/49 )}(87%) 63
III-16_21d9A2,11F11MicS- atTA no significant similarity 64
III-16_21d9A2,4C4R300-1000 T46070 110 3 e - 32 {fraction (67/178
)}(37%) {fraction (86/178 )}(47%) 65 III-17_21d9A1,2A2SatGA no
significant similarity 66 III-17_21d9A1,2A2SatTAA no significant
similarity 73 II-01F2-4RCf1900-2400 T46070 187 6 e - 47 {fraction
(99/183 )}(54%) {fraction (123/183 )}(67%)
[0130]
3TABLE 2 best BLAST hit Score SEQ ID NO. inventor's reference
(ACCESSION) (bits) E value Identities Positives 67 3A Cf2
homologues to the +2ORF clone ID:07d9 T47727 189 4 e - 47 {fraction
(103/215 )}(47%) {fraction (127/215 )}(58%) 68 38 Cf2 homologues to
the -2ORF clone ID.05d7 T46070 148 8 e - 35 {fraction (76/157
)}(48%) {fraction (98/157 )}(62%) 69 3C Cf2 homologues to the +3
ORF clone ID:17P9 T47727 200 2 e - 50 {fraction (100/136 )}(73%)
{fraction (113/136 )}(82%) 70 3D Cf2 homologues to the -3ORF clone
ID:06d8 T46070 163 2 e - 39 {fraction (86/179 )}(48%) {fraction
(110/179 )}(61%) 71 II-00_F2-3RCF1900-2450 T47727 230 9 e - 60
{fraction (114/170 )}(67%) {fraction (134/170 )}(78%) 72
II-01CMGsmalF1-1F300-1000 T46070 76 4 e - 13 {fraction (49/147
)}(33%) {fraction (62/147 )}(41%) 73 II-01F2-4RCf1900-2400 T46070
187 6 e - 47 {fraction (99/183 )}(54%) {fraction (123/183 )}(67%)
74 II-02F3-1RCF2000-2500 T46070 170 7 e - 42 {fraction (79/105
)}(75%) {fraction (93/105 )}(88%) 75 II-03.21dA2,8F8CF1-500 T47727
187 5 e - 48 {fraction (95/142 )}(66%) {fraction (106/142 )}(73%)
76 II-03CMG,smalF1-3FCF300-1100 T46070 107 4 e - 27 {fraction
(67/189 )}(35%) {fraction (89/189 )}(46%) 77 II-03F3-2R1800-Cterm
T47727 201 1 e - 64 {fraction (97/129 )}(75%) {fraction (113/129
)}(87%) 78 II-04.21dA1,1E1R no significant similarity 79
II-05.21dA2,4C4CFhomol T46070 125 6 e - 28 {fraction (65/106
)}(61%) {fraction (72/106 )}(67%) 80 II-12CFLNO1F-CFNOIF T46070 135
2 e - 33 {fraction (74/165 )}(44%) {fraction (97/165 )}(57%) 81
II-12CFLNO1F-CFLNOIR T46070 273 2 e - 72 {fraction (133/183 )}(72%)
{fraction (156/183 )}(84%) 82 II-12CFLNO1F-CFLNNIF T46070 184 73 -
46 {fraction (91/128 )}(71%) {fraction (100/128 )}(78%) 83
II-12CFLNO1F-CFLNN2F T46070 109 3 e - 24 {fraction (69/189 )}(36%)
{fraction (89/189 )}(46%) 84 II-13.21dA1,8D8CF500-1000 T46070 84 4
e - 24 {fraction (48/127 )}(37%) {fraction (66/127 )}(51%) 85
II-15.21dA2,4C4FCF1600-1000 T46070 158 6 e - 38 {fraction (99/215
)}(46%) {fraction (113/215 )}(52%) 86 II-29.21dA2,8F8FCF500upstream
T47727 102 2 e - 39 {fraction (56/105 )}(53%) {fraction (67/105
)}(63%) 87 II-30.21d9A2,12E12ESTMedicago T47731 238 6 e - 62
{fraction (119/163 )}(73%) {fraction (132/163 )}(80%) 88
II-30.21d9A2,8F8RCFpromoter no significant similarity 89
II-30.E2,TetRP1downstreamtoRhg1 S05434 35 1.0 {fraction (30/109
)}(27%) {fraction (49/109 )}(44%) 90 II-32.E3,TetRP1CF1115-1249 no
significant similarity 91 II-Cf homol-01CMGsma1F1-2F T46070 76 4 e
- 13 {fraction (49/147 )}(33%) {fraction (62/147 )}(41%) 92 II-Cf
homol-CMGsmalFI-2F T46070 125 8 e - 32 {fraction (74/188 )}(39%)
{fraction (95/188 )}(50%) 93 II-Cf homol-03CMGsmalF1-3 T46070 105 1
e - 26 {fraction (66/188 )}(35%) {fraction (88/188 )}(46%) 94 II-Cf
homol-06CMGsmalF2-2F T46070 123 2 e - 27 {fraction (80/224 )}(35%)
{fraction (105/224 )}(46%) 95 II-Cf homol-07CMGsmalF2-3F T46070 123
2 e - 27 {fraction (80/224 )}(35%) {fraction (105/224 )}(46%) 96
II-Cf homol-08CMGsmalF2-4F03 T46070 118 6 e - 29 {fraction (71/183
)}(38%) {fraction (90/183 )}(48%) 97 II-Cf homol-10CMGsmalF3-2F
T46070 184 7 e - 46 {fraction (91/128 )}(71%) {fraction (100/128
)}(78%) 98 II-Cf homol-09CMGsmalF3-1F T46070 184 6 e - 46 {fraction
(91/128 )}(71%) {fraction (100/128 )}(78%) 99 II-Cf homol-smalF3-3F
T46070 265 2 e - 70 {fraction (128/174 )}(73%) {fraction (151/174
)}(86%) 100 II-Cf homol-12CMGsmalF3-4F T46070 184 7 e - 46
{fraction (89/107 )}(83%) {fraction (97/107 )}(90%) 101 II-Cf
homol-13CMGsma1F1-1R T46070 279 3 e - 74 {fraction (136/191 )}(71%)
{fraction (159/191 )}(83%) 102 II-Cf homol-14CMGsmalF1-2R T46070
261 3 e - 69 {fraction (127/176 )}(72%) {fraction (148/176 )}(83%)
103 II-Cf homol-15CMGsmalF1-3R T47727 246 1 e - 64 {fraction
(120/162 )}(74%) {fraction (140/162 )}(86%) 104 II-Cf
homol-16CMGsmalF1-4R T46070 263 1 e - 70 {fraction (128/176 )}(73%)
{fraction (149/176 )}(83%) 105 II-Cf homol-17CMGsmalF2-1R T46070
268 5 e - 71 {fraction (131/183 )}(71%) {fraction (155/183 )}(84%)
106 II-Cf homol-18CMGsmalF2-2R T46070 244 4 e - 65 {fraction
(118/159 )}(74%) {fraction (137/159 )}(85%) 107 II-Cf homol-05F3-4R
T46070 187 6 e - 47 {fraction (90/136 )}(66%) {fraction (111/136
)}(86%) 108 II-Cf homol-00F2-3R T46070 224 3 e - 58 {fraction
(108/148 )}(72%) {fraction (127/148 )}(84%) 109 II-Cf homol-01F2-4R
T46070 187 6 e - 47 {fraction (99/183 )}(54%) {fraction (123/183
)}(67%) 110 II-Cf homol02F3-1R T46070 170 7 e - 42 {fraction
(79/105 )}(75%) {fraction (93/105 )}(88%) 111 II-Cf homol-03F3-2R
T47727 202 9 e - 65 {fraction (97/133 )}(72%) {fraction (11/133
)}(84%) 114 II-Cf homol-04F3-3R T46070 128 1 e - 30 {fraction
(65/108 )}(60%) {fraction (72/108 )}(66%) 114 II-Cf
homol-05CMGsmalF2-F T46070 184 6 e - 46 {fraction (91/128 )}(71%)
{fraction (100/128 )}(78%) 114 II-downstream to Rhg1 no significant
similarity
III.D. SCN/SDS Resistance Gene Promoters
[0131] The term "promoter region" defines a nucleotide sequence
within a gene that is positioned 5' to a coding sequence of a same
gene and functions to direct transcription of the coding sequence.
The promoter region includes a transcriptional start site and at
least one cis-regulatory element. The present invention encompasses
nucleic acid sequences that comprise a promoter region of an
SCN/SDS resistance gene, or functional portion thereof.
[0132] The terms "cis-acting regulatory sequence" or
"cis-regulatory motif" or "response element", as used herein, each
refer to a nucleotide sequence that enables responsiveness to a
regulatory transcription factor. Responsiveness can encompass a
decrease or an increase in transcriptional output and is mediated
by binding of the transcription factor to the DNA molecule
comprising the response element.
[0133] The term "transcription factor" generally refers to a
protein that modulates gene expression by interaction with the
cis-regulatory element and cellular components for transcription,
including RNA Polymerase, Transcription Associated Factors (TAFs),
chromatin-remodeling proteins, and any other relevant protein that
impacts gene transcription.
[0134] The term "gene expression" generally refers to the cellular
processes by which a biologically active polypeptide is produced
from a DNA sequence.
[0135] A "functional portion" of a promoter gene fragment is a
nucleotide sequence within a promoter region that is required for
normal gene transcription. To determine nucleotide sequences that
are functional, the expression of a reporter gene is assayed when
variably placed under the direction of a promoter region
fragment.
[0136] Promoter region fragments can be conveniently made by
enzymatic digestion of a larger fragment using restriction
endonucleases or DNAse I. Preferably, a functional promoter region
fragment comprises about 5,000 nucleotides, more preferably 2,000
nucleotides, more preferably about 1,000 nucleotides, more
preferably a functional promoter region fragment comprises about
500 nucleotides, even more preferably a functional promoter region
fragment comprises about 100 nucleotides, and even more preferably
a functional promoter region fragment comprises about 20
nucleotides.
[0137] Within a candidate promoter region or response element, the
presence of regulatory proteins bound to a nucleic acid sequence
can be detected using a variety of methods well known to those
skilled in the art (Ausubel et al., 1992). Briefly, in vivo
footprinting assays demonstrate protection of DNA sequences from
chemical and enzymatic modification within living or permeabilized
cells. Similarly, in vitro footprinting assays show protection of
DNA sequences from chemical or enzymatic modification using protein
extracts. Nitrocellulose filter-binding assays and gel
electrophoresis mobility shift assays (EMSAs) track the presence of
radiolabeled regulatory DNA elements based on provision of
candidate transcription factors.
[0138] The terms "reporter gene" or "marker gene" or "selectable
marker" each refer to a heterologous gene encoding a product that
is readily observed and/or quantitated. A reporter gene is
heterologous in that it originates from a source foreign to an
intended host cell or, if from the same source, is modified from
its original form. Non-limiting examples of detectable reporter
genes that can be operably linked to a transcriptional regulatory
region can be found in brown and PCT International Publication No.
WO 97/47763. Preferred reporter genes for transcriptional analyses
include the lacZ gene (See, e.g., Rose & Botstein (1983) Meth
Enzymol 101:167-180), Green Fluorescent Protein (GFP) (Cubitt et
al. (1995) Trends Biochem Sci 20:448-455), luciferase, or
chloramphenicol acetyl transferase (CAT). Preferred reporter genes
for stable transformation include but are not limited to antibiotic
resistance genes. Any suitable reporter and detection method can be
used, and it will be appreciated by one of skill in the art that no
particular choice is essential to or a limitation of the present
invention.
[0139] An amount of reporter gene can be assayed by any method for
qualitatively or preferably, quantitatively determining presence or
activity of the reporter gene product. The amount of reporter gene
expression directed by each test promoter region fragment is
compared to an amount of reporter gene expression to a control
construct comprising the reporter gene in the absence of a promoter
region fragment. A promoter region fragment is identified as having
promoter activity when there is significant increase in an amount
of reporter gene expression in a test construct as compared to a
control construct. The term "significant increase", as used herein,
refers to an quantified change in a measurable quality that is
larger than the margin of error inherent in the measurement
technique, preferably an increase by about 2-fold or greater
relative to a control measurement, more preferably an increase by
about 5-fold or greater, and most preferably an increase by about
10-fold or greater.
[0140] A representative SCN/SDS resistance gene promoter, the rhg1
promoter, is set forth as SEQ ID NO:15. The rhg1 promoter is useful
for directing gene expression of heterologous sequences in vivo or
in assays to identify modulators of rhg1 expression, described
further herein below.
[0141] The present invention further provides an isolated SCN/SDS
resistance gene promoter region, or functional portion thereof,
comprising an about 90 kb fragment of soybean genomic clone 73P6
between BamHI restriction sites and 21d9 between HinDIII
restriction site. The genomic clone is available from the Forrest
BAC library described in Meksem et al (2000), Theor Appl Genet 101
5/6: 747-755, available through Southern Illinois
University-Carbondale (Carbondale, Ill.), Texas A&M University
BAC center (College Station, Tex.), and Research Genetics
(Huntsville, Ala.). An isolated SCN/SDS resistance gene promoter
region, or functional portion thereof, comprising an about 4.5 kb
fragment of soybean genomic clone 21d9A2 8F8 between EcoRI
restriction sites is also disclosed.
III.E. Chimeric Genes
[0142] The present invention also encompasses chimeric genes
comprising the disclosed SCN/SDS resistance gene sequences. The
term "chimeric gene", as used herein, refers to an SCN/SDS
resistance gene promoter region operably linked to an open reading
frame, wherein the nucleotide sequence created is not naturally
occurring. In this regard, the open reading frame is also described
as a "heterologous sequence". The term "chimeric gene" also
encompasses a promoter region operably linked to an SCN/SDS
resistance gene coding sequence, a nucleotide sequence producing an
antisense RNA molecule, a RNA molecule having tertiary structure,
such as a hairpin structure, or a double-stranded RNA molecule.
[0143] The term "operably linked", as used herein, refers to a
promoter region that is connected to a nucleotide sequence in such
a way that the transcription of that nucleotide sequence is
controlled and regulated by that promoter region. Techniques for
operatively linking a promoter region to a nucleotide sequence are
well known in the art.
[0144] The terms "heterologous gene", "heterologous DNA sequence",
"heterologous nucleotide sequence", "exogenous nucleic acid
molecule", or "exogenous DNA segment", as used herein, each refer
to a sequence that originates from a source foreign to an intended
host cell or, if from the same source, is modified from its
original form. Thus, a heterologous gene in a host cell includes a
gene that is endogenous to the particular host cell but has been
modified, for example by mutagenesis or by isolation from native
cis-regulatory sequences. The terms also include non-naturally
occurring multiple copies of a naturally occurring nucleotide
sequence. Thus, the terms refer to a DNA segment that is foreign or
heterologous to the cell, or homologous to the cell but in a
position within the host cell nucleic acid wherein the element is
not ordinarily found.
IV. Polypeptide Sequences of SCN/SDS Resistance Proteins
[0145] The polypeptides provided by the present invention include
the isolated polypeptide of SEQ ID NO: 14, fusion proteins
comprising SCN/SDS resistance gene amino acid sequences,
biologicallyfunctional analogs, and polypeptides that cross-react
with an antibody that specifically recognizes an SCN/SDS resistance
gene polypeptide.
[0146] The term "isolated", as used in the context of a
polypeptide, indicates that the polypeptide exists apart from its
native environment and is not a product of nature. An isolated
polypeptide can exist in a purified form or can exist in a
non-native environment such as, for example, in a transgenic host
cell.
[0147] The term "purified", when applied to a polypeptide, denotes
that the polypeptide is essentially free of other cellular
components with which it is associated in the natural state.
Preferably, a polypeptide is a homogeneous solid or aqueous
solution. Purity and homogeneity are typically determined using
analytical chemistry techniques such as polyacrylamide gel
electrophoresis or high performance liquid chromatography. A
polypeptide that is the predominant species present in a
preparation is substantially purified. The term "purified" denotes
that a polypeptide gives rise to essentially one band in an
electrophoretic gel. Particularly, it means that the polypeptide is
at least about 50% pure, more preferably at least about 85% pure,
and most preferably at least about 99% pure.
[0148] The term "substantially identical" in the context of two or
more polypeptides sequences is measured by (a) polypeptide
sequences having about 35%, or 45%, or preferably from 45-55%, or
more preferably 55-65%, or most preferably 65% or greater amino
acids that are identical or functionally equivalent. Percent
"identity" and methods for determining identity are defined herein
under the heading Nucleotide and Amino Acid Sequence
Comparisons.
[0149] Substantially identical polypeptides also encompass two or
more polypeptides sharing a conserved three-dimensional structure.
Computational methods can be used to compare structural
representations, and structural superpositions can be generated and
easily tuned to identify similarities around important active sites
or ligand binding sites. See Henikoff et al. (2000) Electrophoresis
21(9):1700-1706; Huang et al. (2000) Pac Symp Biocomput 230-241;
Saqi et al.,1 999; and Barton (1998) Acta Crystallogr D Biol
Crystallogr 54:1139-1146.
[0150] The term "functionally equivalent" in the context of amino
acid sequences is well known in the art and is based on the
relative similarity of the amino acid side-chain substituents. See
Henikoff and Henikoff (2000) Adv Protein Chem 54:73-97. Relevant
factors for consideration include side-chain hydrophobicity,
hydrophilicity, charge, and size. For example, arginine, lysine,
and histidine are all positively charged residues; that alanine,
glycine, and serine are all of similar size; and that
phenylalanine, tryptophan, and tyrosine all have a generally
similar shape. By this analysis, described further herein below,
arginine, lysine, and histidine; alanine, glycine, and serine; and
phenylalanine, tryptophan, and tyrosine; are defined herein as
biologically functional equivalents.
[0151] In making biologically functional equivalent amino acid
substitutions, the hydropathic index of amino acids can be
considered. Each amino acid has been assigned a hydropathic index
on the basis of their hydrophobicity and charge characteristics,
these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8);
phenylalanine (+2.8); cysteine (+2.5); methionine (+1.9); alanine
(+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan
(-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2);
glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine
(-3.5); lysine (-3.9); and arginine (-4.5).
[0152] The importance of the hydropathic amino acid index in
conferring interactive biological function on a protein is
generally understood in the art (Kyte et al. (1982) J Mol Biol
157:105.). It is known that certain amino acids can be substituted
for other amino acids having a similar hydropathic index or score
and still retain a similar biological activity. In making changes
based upon the hydropathic index, the substitution of amino acids
whose hydropathic indices are within .+-.2 of the original value is
preferred, those which are within .+-.1 of the original value are
particularly preferred, and those within .+-.0.5 of the original
value are even more particularly preferred.
[0153] It is also understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity. U.S. Pat. No. 4,554,101 states that the greatest
local average hydrophilicity of a protein, as governed by the
hydrophilicity of its adjacent amino acids, correlates with its
immunogenicity and antigenicity, i.e. with a biological property of
the protein. It is understood that an amino acid can be substituted
for another having a similar hydrophilicity value and still obtain
a biologically equivalent protein.
[0154] As detailed in U.S. Pat. No. 4,554,101, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (+3.0); lysine (+3.0); aspartate (+3.0.+-.1); glutamate
(+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine (-0.5);
histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine
(-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3);
phenylalanine (-2.5); tryptophan (-3.4).
[0155] In making changes based upon similar hydrophilicity values,
the substitution of amino acids whose hydrophilicity values are
within .+-.2 of the original value is preferred, those which are
within .+-.1 of the original value are particularly preferred, and
those within .+-.0.5 of the original value are even more
particularly preferred.
[0156] The present invention also encompasses SCN/SDS resistance
gene polypeptide fragments or functional portions of an SCN/SDS
resistance gene polypeptide. Such functional portion need not
comprise all or substantially all of the amino acid sequence of a
native resistance gene product. The term "functional" includes any
biological activity or feature of SCN/SDS resistance gene,
including immunogenicity.
[0157] The present invention also includes longer sequences
comprising an SCN/SDS resistance gene polypeptide, or portion
thereof. For example, one or more amino acids can be added to the
N-terminal or C-terminal of an SCN/SDS resistance gene polypeptide.
Fusion proteins comprising SCN/SDS resistance gene polypeptide
sequences are also provided within the scope of the present
invention. Methods of preparing such proteins are known in the
art.
[0158] The present invention also encompasses functional analogs of
an SCN/SDS resistance gene polypeptide. Functional analogs share at
least one biological function with an SCN/SDS resistance gene
polypeptide. An exemplary function is immunogenicity. In the
context of amino acid sequence, biologically functional analogs, as
used herein, are peptides in which certain, but not most or all, of
the amino acids can be substituted. Functional analogs can be
created at the level of the corresponding nucleic acid molecule,
altering such sequence to encode desired amino acid changes. In one
embodiment, changes can be introduced to improve the antigenicity
of the protein. In another embodiment, an SCN/SDS resistance gene
polypeptide sequence is varied so as to assess the activity of a
mutant SCN/SDS resistance gene polypeptide. In still another
embodiment, amino acid changes can be made to improve the stability
of the polypeptide.
[0159] Isolated polypeptides and recombinantly produced
polypeptides can be purified and characterized using a variety of
standard techniques that are well known to the skilled artisan.
See, e.g. Ausubel et al. (1992); Bodanszky et al., 1976; and Zimmer
et al. (1993) Peptides, pp. 393B394, ESCOM Science Publishers, B.
V.
V. Nucleotide and Amino Acid Sequence Comparisons
[0160] The terms "identical" or percent "identity" in the context
of two or more nucleotide or polypeptide sequences, refer to two or
more sequences or subsequences that are the same or have a
specified percentage of amino acid residues or nucleotides that are
the same, when compared and aligned for maximum correspondence, as
measured using one of the sequence comparison algorithms disclosed
herein or by visual inspection.
[0161] The term "substantially identical" in regards to a
nucleotide or polypeptide sequence means that a particular sequence
varies from the sequence of a naturally occurring sequence by one
or more deletions, substitutions, or additions, the net effect of
which is to retain at least some of biological activity of the
natural gene, gene product, or sequence. Such sequences include
"mutant" sequences, or sequences wherein the biological activity is
altered to some degree but retains at least some of the original
biological activity. The term "naturally occurring", as used
herein, is used to describe a composition that can be found in
nature as distinct from being artificially produced by man. For
example, a protein or nucleotide sequence present in an organism,
which can be isolated from a source in nature and which has not
been intentionally modified by man in the laboratory, is naturally
occurring.
[0162] For sequence comparison, typically one sequence is regarded
as a reference sequence to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer program, subsequence coordinates are
designated if necessary, and sequence algorithm program parameters
are selected. The sequence comparison algorithm then calculates the
percent sequence identity for the designated test sequence(s)
relative to the reference sequence, based on the selected program
parameters.
[0163] Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman (1981) Adv Appl Math 2:482, by the homology alignment
algorithm of Needleman & Wunsch (1970) J Mol Biol 48:443, by
the search for similarity method of Pearson & Lipman (1988)
Proc Natl Acad Sci USA 85:2444, by computerized implementations of
these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, Madison, Wis.),
or by visual inspection. See generally, Ausubel et al. (1992).
[0164] A preferred algorithm for determining percent sequence
identity and sequence similarity is the BLAST algorithm, which is
described in Altschul et al. (1990) J Mol Biol 215: 403-410.
Software for performing BLAST analyses is publicly available
through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/). This algorithm involves first
identifying high scoring sequence pairs (HSPs) by identifying short
words of length W in the query sequence, which either match or
satisfy some positive-valued threshold score T when aligned with a
word of the same length in a database sequence. T is referred to as
the neighborhood word score threshold. These initial neighborhood
word hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are then extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always >0) and N (penalty score for
mismatching residues; always <0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when the cumulative
alignment score falls off by the quantity X from its maximum
achieved value, the cumulative score goes to zero or below due to
the accumulation of one or more negative-scoring residue
alignments, or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength W=11, an expectation E=10,
a cutoff of 100, M=5, N=-4, and a comparison of both strands. For
amino acid sequences, the BLASTP program uses as defaults a
wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62
scoring matrix. See Henikoff and Henikoff (1989) Proc Natl Acad Sci
USA 89:10915.
[0165] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences. See, e.g., Karlin and Altschul
(1993) Proc Natl Acad Sci USA 90:5873-5887. One measure of
similarity provided by the BLAST algorithm is the smallest sum
probability (P(N)), which provides an indication of the probability
by which a match between two nucleotide or amino acid sequences
would occur by chance. For example, a test nucleic acid sequence is
considered similar to a reference sequence if the smallest sum
probability in a comparison of the test nucleic acid sequence to
the reference nucleic acid sequence is less than about 0.1, more
preferably less than about 0.01, and most preferably less than
about 0.001.
VI. Method for Detecting a Nucleic Acid Molecule Associated with
SCN/SDS Resistance
[0166] In another aspect of the invention, a method is provided for
detecting a nucleic acid molecule that encodes an SCN/SDS
resistance polypeptide. Such methods can be used to detect SCN/SDS
resistance gene variants and related resistance gene sequences. The
disclosed methods facilitate genotyping, cloning, gene mapping, and
gene expression studies.
VI.A. Genetic Variants
[0167] In one embodiment, genetic assays based on nucleic acid
molecules of the present invention can be used to screen for
genetic variants by a number of PCR-based techniques, including
single-strand conformation polymorphism (SSCP) analysis (Orita et
al. (1989) Proc Natl Acad Sci USA 86(8):2766-2770),
SSCP/heteroduplex analysis, enzyme mismatch cleavage, direct
sequence analysis of amplified exons (Kestila et al. (1998) Mol
Cell 1 (4):575-582; Yuan et al. (1999) Hum Mutat 14(5):440-446),
allele-specific hybridization (Stoneking et al. (1991) Am J Hum
Genet48(2):370-82), and restriction analysis of amplified genomic
DNA containing the specific mutation. Automated methods can also be
applied to large-scale characterization of single nucleotide
polymorphisms (Brookes (1999) Gene 234(2):177-186; Wang et al.
(1998) Science 280(5366):1077-82). Preferred detection methods are
non-electrophoretic, including, for example, the TaqMan.TM. allelic
discrimination assay, PCR-OLA, molecular beacons, padlock probes,
and well fluorescence. See Landegren et al. (1998) Genome Res
8:769-776.
[0168] In a preferred embodiment, genetic markers for SCN/SDS
resistance disclosed herein are used in a PCR-based genotyping
assay, preferably, a TaqMan.TM. assay as disclosed in Example 6.
The TaqMan.TM. allelic discrimination assay is based on the 5'
nuclease activity of Taq polymerase and detection of a fluorescent
reporter during or after PCR reactions (Livak et al. (1995) PCR
Meth and Applic 4:357-362; Livak et al. (1995) Nat Genet
9:341-342). Each TaqMan.TM. probe consists of a 25-35 base
oligonucleotide complementary to one of two alleles with a 3'
quencher dye attached (6-carboxy-N, N, N'5N'
tetrachlorofluorescein; TAMRA). The oligomer complimentary to
allele 1 is linked covalently to a 5' reporter dye (6-carboxy-4, 7,
2', 7', tetrachlorofluorescenin; TET) while allele 2 is linked to a
dye that fluoresces at a distinct wavelength (6-carboxyfluorescein;
FAM). PCR directed by flanking oligomers of 18-20 bases causes
degradation during the extension phase of the oligomer that
hybridizes most efficiently to the polymorphic site(s) in the
sample. Adaptations can make the assay chemistry suitable for
multiplexing (Nasarabadi et al. (1999) Bio Techniques 27:1116-1117)
and miniaturization (Kalinina et al. (1997) Nucl Acids Res
25:1999-2004) to reduce cost and increase throughput.
[0169] The present invention discloses sequences suitable for use
with the TaqMan.TM. method for genotyping SCN/SDS resistance,
further disclosed in Example 6. As one example, the TaqMan.TM.
assay was used to distinguish between two insertion polymorphisms
in alleles of an AFLP marker that is located about 50 kbp from the
Rhg4 gene (FIG. 4). Genomic DNA samples were analyzed using the
TaqMan.TM. PCR protocol (Livak et al.,1995a,1995b). Using the raw
fluorescence signals of the reporter dyes FAM and TET from the "dye
component" field of the sequence detection software, two grouping
methods were performed. Each method detected four distinct
populations (FIG. 5). The four populations could be assigned
according to the FAM:TET ratio based on where the heterogeneous
class cut-off was placed.
[0170] For the TaqMan.TM. selection, two grouping methods were
arbitrarily selected to attempt to accurately separate
heterogeneous lines from homogeneous lines at each allele. For
grouping method 1 (Taqman.TM. 1) a stringent cut-off was used to
reduce the number called as potentially heterogeneous. Fluorophore
ratios were as follows; no amplification (FAM and TET both less
than 6 units); allele 1 homozygous (FAM less than 7, TET greater
than 7); allele 2 homozygous (FAM greater than 1 0, TET less than
5); and heterogeneous for allele 1 and allele 2 (FAM greater than
7, TET 5-8). For TaqMan.TM. selection grouping method 2 (TaqMan.TM.
2), a lower stringency cut-off value was used to increase the
number called as potentially heterogeneous. Ratios were: no
amplification (FAM and TET both less than 6 units); allele 1
homozygous (FAM less than 5, TET greater than 7); allele 2
homozygous (FAM greater than10, TET less than 5); and heterogeneous
for allele 1 and allele 2 (FAM greater than 5, TET 5-9).
[0171] Based on the Fl of the ExF RIL population, the 86 selected
individuals were classified into 3 classes: 15 resistant, 60
susceptible and 11 segregating lines. TaqMan.TM. analysis of 86
individuals from the RILs by method 1 (high stringency) shows a
strong agreement between allele 1 and susceptibility to SCN (56
from the 60 susceptible lines were allele 1 type). However, there
was lesser agreement between allele 2 and resistance to SCN (only
15 lines from the 23 lines showing the presence of allele 2 were
resistant by phenotype) due to the segregation of rhg1, the second
gene necessary for resistance to SCN in Forrest. Of the 11 lines
known to be heterogeneous for the resistance to SCN phenotype, five
should segregate at Rhg4. TaqMan.TM. method 1 identified one among
the five classified as heterogenous (the 5 include 4
miss-classified lines, see below). TaqMan.TM. method 2 identified
all five among the 11 classified as heterogenous, however the 11
include 6 miss-classified lines.
[0172] To validate the specificity of TaqMan.TM. genotyping,
samples of each of the RILs classified by the TaqMan.TM. method
(FIG. 5) were re-scored by PCR and gel electrophoresis (FIG. 6)
according to methods described in Example 7. The classifications
produced by the two methods agreed with Taqman.TM. assay 1 most
closely but with eight exceptions. The miss-scores were as follows
(annotated as RIL#; FI phenotype; allele with TaqMan.TM. grouping
method 2; allele with TaqMan.TM. grouping method 1; allele by gel
marker score): 4;S;H;H;S: 21;R;H;H;R: 32;R;H;H;R: 44;S;S;S;H:
51;S;S;S;H: 59;R;H;H;R: 63;S;S;S;R: 78;R;H;H;R.
[0173] The majority of disagreements resulted from resistant lines
that were scored as heterogeneous by TaqMan.TM. but not gel
electrophoresis or phenotype (4 of 8) and phenotypically
susceptible lines that were scored incorrectly by gel
electrophoresis (3 of 8). One genotype (RIL84) was miss-scored
relative to phenotype (84SRRR) by all the allele genotyping methods
and may represent a recombination event between A2D8 and Rhg4.
[0174] The genoytpe and phenotype were generally in close agreement
among the eighty six genomic DNA samples analyzed using the
TaqMan.TM. PCR protocol. The lesser agreement between Allele 2 and
resistance to SCN (15 of 23) was shown to be due to the segregation
of rhg1, by scoring of the BARC-Satt 309 marker (Meksem et al.,
1999). The bias toward a higher frequency of allele 1 is caused by
sampling error (Chang et al., 1997). The accuracy of genotyping was
high by the TaqMan.TM. assay and was better than one pass gel
electrophoresis (Prabhu et al., 1999). Even compared to a highly
optimized gel electrophoresis assay reported herein the assays were
not significantly different in accuracy for detecting the genotypes
within the F.sub.5 derived RILs in a single pass assay. Exactly 78
of the 86 tested with both, TaqMan.TM. and gel electrophoresis
results agreed. There were 5 errors with Taqman.TM. (94% accurate)
and 3 errors with gel electrophoresis (96% accurate) judged by
replicated genotyping (not shown) and the phenotype. Low
frequencies of error are important to the accurate selection of
resistance (Cregan et al., 1999a; Prabhu et al., 1999) and in the
generation of accurate genetic maps (Cregan et al., 1999b).
VI.B. Cloning of SCN/SDS Resistance Genes and Related Genes
[0175] The nucleic acids of the present invention can be used to
clone genes and genomic DNA comprising the sequences.
Alternatively, the nucleic acids of the present invention can be
used to clone genes and genomic DNA of related sequences. For this
purpose, representative probes, hybridization conditions, and PCR
primers are described in the section entitled Nucleotide Sequences
of SCN/SDS Resistance Genes and Associated Markers herein above and
in Examples 4 and 5. Preferably, the nucleic acids used for this
method comprise sequences set forth as any one of SEQ ID NOs:13,
15-114, more preferably SEQ ID NOs: 13 and 16-19.
[0176] In another embodiment, the present invention provides a
method of positional cloning of genes and other sequences located
adjacent or near the disclosed sequences within the soybean genome.
The method comprises: (a) identifying a first nucleic acid
genetically linked to a SCN/SDS resistance locus; and (b) cloning
the first nucleic acid. Optionally, the first nucleic acid can
comprise the rhg1 and SDS locus or the Rhg4 locus. Preferably, the
SCN/SDS resistance locus corresponds to a nucleic acid selected
from any one of SEQ ID NOs:13 and 16-19.
[0177] Positional cloning first involves creating a physical map of
a contig (contiguous overlapping of cloned DNA inserts), in the
genomic region encompassing one or more marker loci and the target
gene. The target gene is then identified and isolated within one or
more clones residing in the contig. The cloned gene can be used
according to any suitable method known in the art, including, for
example, genetic studies, transformation, and the development of
novel phenotypes.
[0178] Mapped SCN, SDS, or SCN and SDS markers, especially those
most closely linked to SCN/SDS resistance can be used to identify
homologous clones from soybean genomic libraries, including, for
example, soybean genomic libraries made in bacterial artificial
chromosomes (BAC), yeast artificial chromosomes (YAC), or P1
bacteriophage. These types of vectors are preferred for positional
cloning because they have the capacity to carry larger DNA inserts
than possible with other vector technologies. These larger DNA
inserts allow the researcher to move physically farther along the
chromosome by identifying overlapping clones. Exemplary libraries
available for positional cloning efforts in soybean include those
described by Meksem et al., 2000; Kanazin et al. (1996) Proc Natl
Acad Sci USA 93(21):11746-11750; Zhu et al. (1996) Mol Gen Genet
252:483-488. Exemplary hybridization methods are disclosed in
Examples 4 and 5.
[0179] Mapped SCN, SDS, or SCN and SDS markers can be used as DNA
probes to hybridize and select homologous genomic clones from such
libraries. Alternatively, the DNA of mapped marker clones are
sequenced to design PCR primers that amplify and therefore identify
homologous genomic clones from such libraries. Either method is
used to identify large-insert soybean clones that is then used to
start or finish a contig constructed in chromosome walking to clone
an SCN, SDS, or SCN and SDS resistance QTL.
[0180] As examples, the positional cloning strategy was
successfully used to clone the cystic fibrosis gene in humans
(Rommens et al. (1989) Science 245:1059-1065), an omega-3
desaturase gene in Arabidopsis Arondel et al. (1992) Science
258:1353-1355), a protein kinase gene (Pto) conferring fungal
resistance in tomato (Martin et al. (1993) Science 262:1432-1436),
a YAC clone containing the jointless gene that suppresses
abscission of flowers and fruit in tomato (Zhang et al. (1994) Mol
Gen Genet 244:613-621), and sequences comprising the rhg1 and Rhg4
genes, disclosed herein.
VI.C. Mapping Methods
[0181] The isolated and purified polynucleotide sequences disclosed
herein can also be used in a variety of applications pertaining to
mapping SCN and SDS resistance. For example, the isolated
polynucleotides disclosed herein are useful in studies of genome
organization; in gene structure and organization experiments; in
BAC-FISH experiments; in chromosome painting techniques; and in
chromosome manipulation.
[0182] Thus, in accordance with the present invention, the nucleic
acid sequences which encode SCN/SDS resistance polypeptides can
also be used to generate hybridization probes which are useful for
mapping naturally occurring genomic sequences and/or resistance
loci. The sequences can be mapped to a particular chromosome or to
a specific region of the chromosome using well-known techniques.
Such techniques include FISH, FACS, or artificial chromosome
constructions, such as yeast artificial chromosomes, bacterial
artificial chromosomes, bacterial P1 constructions or single
chromosome cDNA libraries as reviewed in Price (1 993) Blood Rev
7:127-134, and Trask (1991) Trends Genet 7:149-154.
[0183] FISH (as described in Verma et al. (1988) Human Chromosomes:
A Manual of Basic Techniques, Pergamon Press, New York, N.Y.) can
be correlated with other physical chromosome mapping techniques and
genetic map data. Examples of genetic map data can be found in the
1994 Genome Issue of Science (265:1981f). Correlation between the
location of the gene encoding SCN, SDS, or both SCN and SDS
resistance on a physical chromosomal map and another resistance
characteristic, or lack thereof, can help delimit the region of DNA
associated with that genetic characteristic. The nucleotide
sequences of the subject invention can be used to detect
differences in gene sequences between normal, carrier, or
susceptible individuals.
[0184] In situ hybridization of chromosomal preparations and
physical mapping techniques such as linkage analysis and
chromosomal painting using established chromosomal markers can be
used for extending genetic maps. Often the placement of a gene on
the chromosome of another plant species, such as tomato species or
other soybean species, reveals associated markers also found in
other plants such as soybeans even if the number or arm of a
particular chromosome is not known. New sequences can be assigned
to chromosomal arms, or parts thereof, by physical mapping. This
provides valuable information to investigators searching for
resistance or other genes using positional cloning or other gene
discovery techniques. Once the resistance or other gene has been
crudely localized by genetic linkage to a particular genomic
region, any sequences mapping to that area can represent associated
or regulatory genes for further investigation. The nucleotide
sequences of the present invention can thus also be used to detect
differences in the chromosomal location due to translocation,
inversion, etc. among normal, carrier, or susceptible individuals,
and to detect gene regulatory sequences (e.g. promoters).
[0185] Hybridization of the subject DNAs to reference chromosomes
can also be performed to give information on relative copy numbers
of sequences. Normalization is required to obtain absolute copy
number information. One convenient method to do this is to
hybridize a probe, for example a cosmid specific to some single
locus in the normal haploid genome, to the interphase nuclei of the
subject cell or cell population(s) (or those of an equivalent cell
or representative cells therefrom, respectively). Quantiation of
the hybridization signals in a representative population of such
nuclei gives the absolute sequence copy number at that location.
Given that information at one locus, the intensity (ratio)
information from the hybridization of the subject DNA(s) to the
reference condensed chromosomes gives the absolute copy number over
the rest of the genome. In practice, use of more than one reference
locus can be desirable. In this case, the best fit of the intensity
(ratio) data through the reference loci can give a more accurate
determination of absolute sequence copy number over the rest of the
genome.
[0186] Thus, the methods of the present invention can provide
information on the absolute copy numbers of substantially all RNA
or DNA sequences in subject cell(s) or cell population(s) as a
function of the location of those sequences in a reference genome.
Additionally, chromosome painting probes can be prepared using the
markers and sequence data herein disclosed. Hybridization with one
or more of such probes indicates the absolute copy numbers of the
sequences to which the probes bind.
[0187] Further, when the subject nucleic acid sequences are DNA,
the reference copy numbers can be determined by Southern analysis.
When the subject nucleic acid sequences are RNA, the reference copy
numbers can be determined by Northern analysis.
VI.D. Assays Kits
[0188] In another aspect, the present invention provides assay kits
for detecting the presence, in biological samples, of a
polynucleotide that encodes a polypeptide of the present invention
or of a chromosome bearing a gene or locus of the present
invention, the kits comprising a first container that contains a
second polynucleotide identical or complementary to a segment of at
least 10 contiguous nucleotide bases of, as a preferred example,
any of SEQ ID NOs:13 and 16-19.
VII. Recombinant Expression B Expression Cassettes
[0189] The term "expression cassette" as used herein means a DNA
sequence capable of directing expression of a particular nucleotide
sequence in an appropriate host cell, comprising a promoter
operably linked to the nucleotide sequence of interest which is
operably linked to termination signals. It also typically comprises
sequences required for proper translation of the nucleotide
sequence. The expression cassette comprising the nucleotide
sequence of interest can be chimeric. The expression cassette can
also be one which is naturally occurring but has been obtained in a
recombinant form useful for heterologous expression. The expression
cassettes can also comprise any further sequences required or
selected for the expression of the transgene. Such sequences
include, but are not restricted to, transcription terminators,
extraneous sequences to enhance expression such as introns, vital
sequences, and sequences intended for the targeting of the gene
product to specific organelles and cell compartments.
VII.A. Promoters
[0190] The expression of the nucleotide sequence in the expression
cassette can be under the control of a constitutive promoter or an
inducible promoter which initiates transcription only when the host
cell is exposed to some particular external stimulus. For bacterial
production of a SCN/SDS resistance polypeptide, exemplary promoters
include Simian virus 40 early promoter, a long terminal repeat
promoter from retrovirus, an actin promoter, a heat shock promoter,
and a metallothionein protein. For in vivo production of a SCN/SDS
resistance polypeptide in plants, exemplary constituitve promoters
are derived from the CaMV 35S, rice actin, and maize ubiquitin
genes, each described herein below. Exemplary inducible promoters
for this purpose include the chemicaly inducible PR-1a promoter and
a wound-inducible promoter, also described herein below.
[0191] Selected promoters can direct expression in specific cell
types (such as leaf epidermal cells, mesophyll cells, root cortex
cells) or in specific tissues or organs (roots, leaves or flowers,
for example). Exemplary tissue-specific promoters include
well-characterized root-, pith-, and leaf-specific promoters, each
described herein below.
[0192] Depending upon the host cell system utilized, any one of a
number of suitable promoters can be used. Promoter selection can be
based on expression profile and expression level. The following are
non-limiting examples of promoters that can be used in the
expression cassettes.
VII.A.1.Constituitive Expression
[0193] 35S Promoter. The CaMV 35S promoter can be used to drive
constituitive gene expression. Construction of the plasmid pCGN1761
is described in the published patent application EP 0 392 225,
which is hereby incorporated by reference. pCGN1761 contains the
"double" CaMV 35S promoter and the tml transcriptional terminator
with a unique EcoRI site between the promoter and the terminator
and has a pUC-type backbone. A derivative of pCGN1761 is
constructed which has a modified polylinker which includes NotI and
XhoI sites in addition to the existing EcoRI site. This derivative
is designated pCGN1761ENX. pCGN1761ENX is useful for the cloning of
cDNA sequences or gene sequences (including microbial ORF
sequences) within its polylinker for the purpose of their
expression under the control of the 35S promoter in transgenic
plants. The entire 35S promoter-gene sequence-tmI terminator
cassette of such a construction can be excised by HindIII, SphI,
SaII, and XbaI sites 5' to the promoter and XbaI, BamHI and BgII
sites 3' to the terminator for transfer to transformation vectors
such as those described below. Furthermore, the double 35S promoter
fragment can be removed by 5' excision with HindIII, SphI, SaII,
XbaI, or PstI, and 3' excision with any of the polylinker
restriction sites (EcoRI, NotI or XhoI) for replacement with
another promoter.
[0194] Actin Promoter. Several isoforms of actin are known to be
expressed in most cell types and consequently the actin promoter is
a good choice for a constitutive promoter. In particular, the
promoter from the rice ActI gene has been cloned and characterized
(McElroy et al. (1990) Plant Cell 2:163-171). A 1.3 kb fragment of
the promoter was found to contain all the regulatory elements
required for expression in rice protoplasts. Furthermore, numerous
expression vectors based on the ActI promoter have been constructed
specifically for use in monocotyledons (McElroy et al. (1991) Mol
Gen Genet 231:150-160). These incorporate the ActI-intron 1, AdhI
5' flanking sequence and AdhI-intron I (from the maize alcohol
dehydrogenase gene) and sequence from the CaMV 35S promoter.
Vectors showing highest expression were fusions of 35S and ActI
intron or the ActI 5' flanking sequence and the ActI intron.
Optimization of sequences around the initiating ATG (of the GUS
reporter gene) also enhanced expression. The promoter expression
cassettes described by McElroy et al. (1991) can be easily modified
for gene expression and are particularly suitable for use in
monocotyledonous hosts. For example, promoter-containing fragments
is removed from the McElroy constructions and used to replace the
double 35S promoter in pCGN1761ENX, which is then available for the
insertion of specific gene sequences. The fusion genes thus
constructed can then be transferred to appropriate transformation
vectors. In a separate report, the rice ActI promoter with its
first intron has also been found to direct high expression in
cultured barley cells (Chibbar et al. (1993) Plant Cell Rep
12:506-509).
[0195] Ubiguitin Promoter. Ubiquitin is another gene product known
to accumulate in many cell types and its promoter has been cloned
from several species for use in transgenic plants (e.g.
sunflower--Binet et al. (1991) Plant Science 79: 87-94 and
maize--Christensen et al. (1989) Plant Molec Biol 12:619-632). The
maize ubiquitin promoter has been developed in transgenic monocot
systems and its sequence and vectors constructed for monocot
transformation are disclosed in the patent publication EP 0 342 926
which is herein incorporated by reference. Taylor et al. (1993)
Plant Cell Rep 12:491-495 describe a vector (pAHC25) that comprises
the maize ubiquitin promoter and first intron and its high activity
in cell suspensions of numerous monocotyledons when introduced via
microprojectile bombardment. The ubiquitin promoter is suitable for
gene expression in transgenic plants, especially monocotyledons.
Suitable vectors are derivatives of pAHC25 or any of the
transformation vectors described in this application, modified by
the introduction of the appropriate ubiquitin promoter and/or
intron sequences.
VII.A.2. Inducible Expression
[0196] Chemically Inducible PR-1a Promoter. The double 35S promoter
in pCGN1761ENX can be replaced with any other promoter of choice
which will result in suitably high expression levels. By way of
example, one of the chemically regulatable promoters described in
U.S. Pat. No.5,614,395 can replace the double 35S promoter. The
promoter of choice is preferably excised from its source by
restriction enzymes, but can alternatively be PCR-amplified using
primers that carry appropriate terminal restriction sites. Should
PCR-amplification be undertaken, then the promoter should be
re-sequenced to check for amplification errors after the cloning of
the amplified promoter in the target vector. The chemical/pathogen
regulated tobacco PR-1a promoter is cleaved from plasmid pCIB1004
(for construction, see EP 0 332 104, which is hereby incorporated
by reference) and transferred to plasmid pCGN1761 ENX (Uknes et al.
(1992) The Plant Cell 4:645-656).
[0197] pCIB1004 is cleaved with NcoI and the resultant 3' overhang
of the linearized fragment is rendered blunt by treatment with T4
DNA polymerase. The fragment is then cleaved with HindIII and the
resultant PR-1a promoter-containing fragment is gel purified and
cloned into pCGN1761ENX from which the double 35S promoter has been
removed. This is done by cleavage with XhoI and blunting with T4
polymerase, followed by cleavage with HindIII and isolation of the
larger vector-terminator containing fragment into which the
pCIB1004 promoter fragment is cloned. This generates a pCGN1761 ENX
derivative with the PR-1a promoter and the tml terminator and an
intervening polylinker with unique EcoRI and NotI sites. The
selected coding sequence can be inserted into this vector, and the
fusion products (i.e. promoter-gene-terminator) can subsequently be
transferred to any selected transformation vector, including those
described below. Various chemical regulators can be employed to
induce expression of the selected coding sequence in the plants
transformed according to the present invention, including the
benzothiadiazole, isonicotinic acid, and salicylic acid compounds
disclosed in U.S. Pat. Nos. 5,523,311 and 5,614,395, herein
incorporated by reference.
[0198] Wound-Inducible Promoters. Wound-inducible promoters can
also be suitable for gene expression. Numerous such promoters have
been described (e.g. Xu et al. (1993) Plant Molec Biol 22:573-588;
Logemann et al. (1989) Plant Cell 1:151-158; Rohrmeier & Lehle
(1993) Plant Molec Biol 22:783-792; Firek et al. (1993) Plant Molec
Biol 22:129-142; Warner et al. (1993) Plant J 3:191-201) and all
are suitable for use with the instant invention. Logemann et al.
(1989) describe the 5' upstream sequences of the dicotyledonous
potato wunI gene. Xu et al. (1993) show that a wound-inducible
promoter from the dicotyledon potato (pin2) is active in the
monocotyledon rice. Further, Rohrmeier & Lehle (1993) describe
the cloning of the maize Wipl cDNA which is wound induced and which
can be used to isolate the cognate promoter using standard
techniques. Similarly, Firek et al. (1993) and Warner et al. (1993)
have described a wound-induced gene from the monocotyledon
Asparagus officinalis, which is expressed at local wound and
pathogen invasion sites. Using cloning techniques well known in the
art, these promoters can be transferred to suitable vectors, fused
to the genes pertaining to this invention, and used to express
these genes at the sites of plant wounding.
VII.A.3. Tissue-Specific Expression
[0199] Root Promoter. Another pattern of gene expression is root
expression. A suitable root promoter is described by de Framond
(1991) FEBS 290:103-106 and also in the published patent
application EP 0 452 269, which is herein incorporated by
reference. This promoter is transferred to a suitable vector such
as pCGN1761ENX for the insertion of a selected gene and subsequent
transfer of the entire promoter-gene-terminator cassette to a
transformation vector of interest.
[0200] Pith Promoter. International Publication No. WO 93/07278,
which is herein incorporated by reference, describes the isolation
of the maize trpA gene, which is preferentially expressed in pith
cells. The gene sequence and promoter extending up to -1726 bp from
the start of transcription are presented. Using standard molecular
biological techniques, this promoter, or parts thereof, can be
transferred to a vector such as pCGN1761 where it can replace the
35S promoter and be used to drive the expression of a foreign gene
in a pith-preferred manner. In fact, fragments containing the
pith-preferred promoter or parts thereof can be transferred to any
vector and modified for utility in transgenic plants.
[0201] Leaf Promoter. A maize gene encoding phosphoenol carboxylase
(PEPC) has been described by Hudspeth & Grula (1989) Plant
Molec Biol 12:579-589. Using standard molecular biological
techniques the promoter for this gene can be used to drive the
expression of any gene in a leaf-specific manner in transgenic
plants.
VII.B. Transcriptional Terminators
[0202] A variety of transcriptional terminators are available for
use in expression cassettes. These are responsible for the
termination of transcription beyond the transgene and its correct
polyadenylation. Appropriate transcriptional terminators are those
that are known to function in plants and include the CaMV 35S
terminator, the tml terminator, the nopaline synthase terminator
and the pea rbcS E9 terminator. These can be used in both
monocotyledons and dicotyledons.
VII.C. Sequences for the Enhancement or Regulation of
Expression
[0203] Numerous sequences have been found to enhance gene
expression from within the transcriptional unit and these sequences
can be used in conjunction with the genes of this invention to
increase their expression in transgenic plants.
[0204] If desired, modifications around the cloning sites can be
made by the introduction of sequences that can enhance translation.
This is particularly useful when overexpression is desired. For
example, pCGN1761 ENX can be modified by optimization of the
translational initiation site as disclosed in U.S. Pat. No.
5,639,949, incorporated herein by reference.
[0205] Various intron sequences have been shown to enhance
expression, particularly in monocotyledonous cells. For example,
the introns of the maize AdhI gene have been found to significantly
enhance the expression of the wild-type gene under its cognate
promoter when introduced into maize cells. Intron 1 was found to be
particularly effective and enhanced expression in fusion constructs
with the chloramphenicol acetyltransferase gene (Callis et al.
(1987) Genes Develop 1:1 183-1200 ). In the same experimental
system, the intron from the maize bronzel gene had a similar effect
in enhancing expression. Intron sequences have been routinely
incorporated into plant transformation vectors, typically within
the non-translated leader.
[0206] A number of non-translated leader sequences derived from
viruses are also known to enhance expression, and these are
particularly effective in dicotyledonous cells. Specifically,
leader sequences from Tobacco Mosaic Virus (TMV, the "W-sequence"),
Maize Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMV)
have been shown to be effective in enhancing expression (e.g.
Gallie et al. (1987) Nucl Acids Res 15:8693-8711; Skuzeski et al.
(1990) Plant Molec Biol 15:65-79).
VII.D. Targeting of the Gene Product Within the Cell
[0207] Various mechanisms for targeting gene products are known to
exist in plants and the sequences controlling the functioning of
these mechanisms have been characterized in some detail. For
example, the targeting of gene products to the chloroplast is
controlled by a signal sequence found at the amino terminal end of
various proteins which is cleaved during chloroplast import to
yield the mature protein (e.g. Comai et al. (1988) J Biol Chem
263:15104-15109). These signal sequences can be fused to
heterologous gene products to effect the import of heterologous
products into the chloroplast (van den Broeck et al. (1985) Nature
313:358-363). DNA encoding for appropriate signal sequences can be
isolated from the 5' end of the cDNAs encoding the RUBISCO protein,
the CAB protein, the EPSP synthase enzyme, the GS2 protein and many
other proteins which are known to be chloroplast localized. See
also, U.S. Pat. No. 5,639,949, herein incorporated by
reference.
[0208] Other gene products are localized to other organelles such
as the mitochondrion and the peroxisome (e.g. Unger et al. (1989)
Plant Molec Biol 13:411-418). The cDNAs encoding these products can
also be manipulated to effect the targeting of heterologous gene
products to these organelles. Examples of such sequences are the
nuclear-encoded ATPases and specific aspartate amino transferase
isoforms for mitochondria. Targeting cellular protein bodies has
been described by Rogers et al. (1989) Proc Natl Acad Sci USA
82:6512-6516).
[0209] In addition, sequences have been characterized which cause
the targeting of gene products to other cell compartments. Amino
terminal sequences are responsible for targeting to the ER, the
apoplast, and extracellular secretion from aleurone cells (Koehler
& Ho (1990) Plant Cell 2:769-783). Additionally, amino terminal
sequences in conjunction with carboxy terminal sequences are
responsible for vacuolar targeting of gene products (Shinshi et al.
(1990) Plant Molec Biol 14:357-368).
[0210] By the fusion of the appropriate targeting sequences
described above to transgene sequences of interest, it is possible
to direct the transgene product to any organelle or cell
compartment. For chloroplast targeting, for example, the
chloroplast signal sequence from the RUBISCO gene, the CAB gene,
the EPSP synthase gene, or the GS2 gene is fused in frame to the
amino terminal ATG of the transgene. The signal sequence selected
should include the known cleavage site, and the fusion constructed
should take into account any amino acids after the cleavage site
which are required for cleavage. In some cases this requirement can
be fulfilled by the addition of a small number of amino acids
between the cleavage site and the transgene ATG or, alternatively,
replacement of some amino acids within the transgene sequence.
Fusions constructed for chloroplast import can be tested for
efficacy of chloroplast uptake by in vitro translation of in vitro
transcribed constructions followed by in vitro chloroplast uptake
using techniques described by Bartlett et al. (1982) in Methods in
Chloroplast Molecular Biology, Edelmann et al. (Eds.), pp
1081-1091, Elsevier and Wasmann et al. (1986) Mol Gen Genet
205:446-453.
[0211] These construction techniques are well known in the art and
are equally applicable to mitochondria and peroxisomes.
[0212] The above-described mechanisms for cellular targeting can be
utilized not only in conjunction with their cognate promoters, but
also in conjunction with heterologous promoters so as to effect a
specific cell-targeting goal under the transcriptional regulation
of a promoter that has an expression pattern different to that of
the promoter from which the targeting signal derives.
VIII. Recombinant Expression B Vectors
[0213] Suitable expression vectors which can be used include, but
are not limited to, the following vectors or their derivatives:
human or animal viruses such as vaccinia virus or adenovirus, yeast
vectors, bacteriophage vectors (e.g., lambda phage), and plasmid
and cosmid DNA vectors.
[0214] Numerous vectors available for plant transformation are
known to those of ordinary skill in the plant transformation arts,
and the genes pertinent to this invention can be used with any such
vectors. Exemplary vectors include pCIB200, pCIB2001, pCIB10,
pCIB3064, pSOG19, and pSOG35, each described herein below. The
selection of vector will depend upon the preferred transformation
technique and the target species for transformation.
VIII.A. Agrobacterium Transformation Vectors.
[0215] Many vectors are available for transformation using
Agrobacterium tumefaciens. These typically carry at least one T-DNA
border sequence and include vectors such as pBIN19 (Bevan
(1984)Nucl Acids Res 12:8711-8721) and pXYZ. Below, the
construction of two typical vectors suitable for Agrobacterium
transformation is described.
[0216] pCIB200 and pCIB2001. The binary vectors pcIB200 and
pCIB2001 are used for the construction of recombinant vectors for
use with Agrobacterium and are constructed in the following manner.
pTJS75kan is created by NarI digestion of pTJS75 (Schmidhauser
& Helinski (1985) J Bacteriol 164:446-455) allowing excision of
the tetracycline-resistance gene, followed by insertion of an AccI
fragment from pUC4K carrying an NPTII (Messing & Vierra (1982)
Gene 19:259-268; Bevan et al. (1983) Nature 304:184-187; McBride et
al. (1990) Plant Molecular Biology 14:266-276). XhoI linkers are
ligated to the EcoRV fragment of PCIB7 which contains the left and
right T-DNA borders, a plant selectable nos/nptll chimeric gene and
the pUC polylinker (Rothstein et al. (1987) Gene 53:153-161), and
the XhoI-digested fragment are cloned into SaII-digested pTJS75kan
to create pCIB200 (see also EP 0 332 104, herein incorporated by
reference).
[0217] pCIB200 contains the following unique polylinker restriction
sites: EcoRI, SstI, KpnI, Bg/II, XbaI, and Sa/I. pCIB2001 is a
derivative of pCIB200 created by the insertion into the polylinker
of additional restriction sites. Unique restriction sites in the
polylinker of pCIB2001 are EcoRI, SstI, KpnI, Bg/II, XbaI, Sa/I,
MluI, Bc/I, AvrII, ApaI, HpaI, and StuI. pCIB2001,in addition to
containing these unique restriction sites also has plant and
bacterial kanamycin selection, left and right T-DNA borders for
Agrobacterium-mediated transformation, the RK2-derived trfA
function for mobilization between E. coli and other hosts, and the
OriT and OriV functions also from RK2. The pCIB2001 polylinker is
suitable for the cloning of plant expression cassettes containing
their own regulatory signals.
[0218] pCIB10 and Hycromycin Selection Derivatives thereof. The
binary vector pCIB10 contains a gene encoding kanamycin resistance
for selection in plants and T-DNA right and left border sequences
and incorporates sequences from the wide host-range plasmid pRK252
allowing it to replicate in both E. coli and Agrobacterium. Its
construction is described by Rothstein et al. (1987). Various
derivatives of pCIB10 are constructed which incorporate the gene
for hygromycin B phosphotransferase described by Gritz et al.
(1983) Gene 25:179-188. These derivatives enable selection of
transgenic plant cells on hygromycin only (pCIB743), or hygromycin
and kanamycin (pCIB715, pCIB717).
VIII.B. Other Plant Transformation Vectors
[0219] Transformation without the use of Agrobacterium tumefaciens
circumvents the requirement for T-DNA sequences in the chosen
transformation vector and consequently vectors lacking these
sequences can be utilized in addition to vectors such as the ones
described above which contain T-DNA sequences. Transformation
techniques that do not rely on Agrobacterium include transformation
via particle bombardment, protoplast uptake (e.g. PEG and
electroporation) and microinjection. The choice of vector depends
largely on the preferred selection for the species being
transformed. Below, the construction of typical vectors suitable
for non-Agrobacterium transformation is described.
[0220] pCIB3064. pCIB3064 is a pUC-derived vector suitable for
direct gene transfer techniques in combination with selection by
the herbicide basta (or phosphinothricin). The plasmid pCIB246
comprises the CaMV 35S promoter in operational fusion to the E.
coli GUS gene and the CaMV 35S transcriptional terminator and is
described in the Internation Publication No. WO 93/07278. The 35S
promoter of this vector contains two ATG sequences 5' of the start
site. These sites are mutated using standard PCR techniques in such
a way as to remove the ATGs and generate the restriction sites SspI
and PvuII. The new restriction sites are 96 and 37 bp away from the
unique SaII site and 101 and 42 bp away from the actual start site.
The resultant derivative of pCIB246 is designated pCIB3025.
[0221] The GUS gene is then excised from pCIB3025 by digestion with
SaII and SacI, the termini rendered blunt and religated to generate
plasmid pCIB3060. The plasmid pJIT82 is obtained from the John
Innes Centre, Norwich and the a 400 bp SmaI fragment containing the
bar gene from Streptomyces viridochromogenes is excised and
inserted into the HpaI site of pCIB3060 (Thompson et al. (1987)
EMBO J 6:2519-2523). This generated pCIB3064, which comprises the
bar gene under the control of the CaMV 35S promoter and terminator
for herbicide selection, a gene for ampicillin resistance (for
selection in E. coli) and a polylinker with the unique sites SphI,
PstI, HindIII, and BamHI. This vector is suitable for the cloning
of plant expression cassettes containing their own regulatory
signals.
[0222] pSOG19 and pSOG35. pSOG35 is a transformation vector that
utilizes the E. coli gene dihydrofolate reductase (DFR) as a
selectable marker conferring resistance to methotrexate. PCR is
used to amplify the 35S promoter (-800 bp), intron 6 from the maize
Adh1 gene (-550 bp) and 18 bp of the GUS untranslated leader
sequence from pSOG10. A 250-bp fragment encoding the E. coli
dihydrofolate reductase type II gene is also amplified by PCR and
these two PCR fragments are assembled with a SacI-PstI fragment
from pB1221 (Clontech, Palo Alto, Calif.) which comprises the pUC19
vector backbone and the nopaline synthase terminator. Assembly of
these fragments generates pSOG 19 which contains the 35S promoter
in fusion with the intron 6 sequence, the GUS leader, the DHFR gene
and the nopaline synthase terminator. Replacement of the GUS leader
in pSOG19 with the leader sequence from Maize Chlorotic Mottle
Virus (MCMV) generates the vector pSOG35. pSOG19 and pSOG35 carry
the pUC gene for ampicillin resistance and have HindIII, SphI, PstI
and EcoRI sites available for the cloning of foreign
substances.
VII I .C. Selectable Markers
[0223] For certain target species, different antibiotic or
herbicide selection markers can be preferred. Selection markers
used routinely in transformation include the nptII gene, which
confers resistance to kanamycin and related antibiotics (Messing
& Vierra (1982) Gene 19:259-268; Bevan et al., 1983), the bar
gene, which confers resistance to the herbicide phosphinothricin
(White et al. (1990) Nucl Acids Res 18:1062; Spencer et al. (1990)
Theor Appl Genet 79:625-631), the hph gene, which confers
resistance to the antibiotic hygromycin (Blochlinger &
Diggelmann (1984) Mol Cell Biol 4:2929-2931), the dhfr gene, which
confers resistance to methatrexate (Bourouis et al., (1983) EMBO J
2(7):1099-1104), and the EPSPS gene, which confers resistance to
glyphosate (U.S. Pat. Nos. 4,940,935 and 5,188,642).
IX. Recombinant Expression B Host Cells
[0224] The term "host cell", as used herein, refers to a cell into
which a heterologous nucleic acid molecule has been introduced.
Transformed cells, tissues, or organisms are understood to
encompass not only the end product of a transformation process, but
also transgenic progeny thereof. A host cell strain can be chosen
which modulates the expression of the inserted sequences, or
modifies and processes the gene product in the specific fashion
desired. For example, different host cells have characteristic and
specific mechanisms for the translational and post-translational
processing and modification (e.g., glycosylation, phosphorylation
of proteins). Appropriate cell lines or host systems can be chosen
to ensure the desired modification and processing of the foreign
protein expressed. Expression in a bacterial system can be used to
produce a non-glycosylated core protein product. Expression in
yeast will produce a glycosylated product. Expression in plant
cells can be used to ensure "native" glycosylation of a
heterologous protein.
[0225] The present invention provides methods for recombinant
expression of SCN/SDS resistance genes in plants by the
construction of transgenic plants. The phrase "a plant, or parts
thereof" as used herein shall mean an entire plant; and shall mean
the individual parts thereof, including but not limited to seeds,
leaves, stems, and roots, as well as plant tissue cultures.
Transgenic plants of the present invention are understood to
encompass not only the end product of a transformation method, but
also transgenic progeny thereof. The term "converted plant" as used
herein shall mean any plant (1) having resistance to SDS or
resistance to SCN and (2) and was derived by genetic selection
employing RFLP, RADP, AFLP, or microsatellite (SSR) data for at
least one of the loci herein defined.
[0226] Preferably, the plant is a soybean plant. However, disease
resistance can be conferred to a wide variety of plant cells,
including those of gymnosperms, monocots, and dicots. Although the
gene can be inserted into any plant cell falling within these broad
classes, it is particularly useful in crop plant cells, such as
rice, wheat, barley, rye, corn, potato, carrot, sweet potato, sugar
beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli,
turnip, radish, spinach, asparagus, onion, garlic, eggplant,
pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple,
pear, quince, melon, plum, cherry, peach, nectarine, apricot,
strawberry, grape, raspberry, blackberry, pineapple, avocado,
papaya, mango, banana, tobacco, tomato, sorghum and sugarcane.
X. Recombinant Expression B Transfection and Transformation
Methods
[0227] Expression constructs are transfected into a host cell by a
standard method suitable for the selected host, including
electroporation, calcium phosphate precipitation, DEAE-Dextran
transfection, liposome-mediated transfection, infection using a
retrovirus, transposon-mediated transfer, and particle bombardment
techniques. The SCN/SDS resistance gene-encoding nucleotide
sequence carried in the expression construct can be stably
integrated into the genome of the host or it can be present as an
extrachromosomal molecule. Below are descriptions of representative
techniques for transforming both dicotyledonous and
monocotyledonous plants.
X.A. Transformation of Dicotyledons
[0228] Transformation techniques for dicotyledons are well known in
the art and include Agrobacterium-based techniques and techniques
that do not require Agrobacterium. Non-Agrobacterium techniques
involve the uptake of exogenous genetic material directly by
protoplasts or cells. This can be accomplished by PEG or
electroporation mediated uptake, particle bombardment-mediated
delivery, or microinjection. Examples of these techniques are
described by Paszkowski et al. (1984) EMBO J 3:2717-2722; Potrykus
et al. (1985) Mol Gen Genet 199:169-177; Reich et al. (1986)
Biotechnology 4:1001-1004; and Klein et al. (1987) Nature
327:70-73. In each case the transformed cells are regenerated to
whole plants using standard techniques known in the art.
[0229] Agrobacterium-mediated transformation is a preferred
technique for transformation of dicotyledons because of its high
efficiency of transformation and its broad utility with many
different species. Agrobacterium transformation typically involves
the transfer of the binary vector carrying the foreign DNA of
interest (e.g. pCIB200 or pCIB2001) to an appropriate Agrobacterium
strain, which can depend of the complement of vir genes carried by
the host Agrobacterium strain either on a co-resident Ti plasmid or
chromosomally (e.g. strain CIB542 for pCIB200 and pCIB2001 (Uknes
et al. (1993) Plant Cell 5:159-169). The transfer of the
recombinant binary vector to Agrobacterium is accomplished by a
triparental mating procedure using E. coli carrying the recombinant
binary vector, a helper E. coli strain which carries a plasmid such
as pRK2013 and which is able to mobilize the recombinant binary
vector to the target Agrobacterium strain. Alternatively, the
recombinant binary vector can be transferred to Agrobacterium by
DNA transformation (Hofgen & Willmitzer (1988) Nucl Acids Res
16:9877).
[0230] Transformation of the target plant species by recombinant
Agrobacterium usually involves co-cultivation of the Agrobacterium
with explants from the plant and follows protocols well known in
the art. Transformed tissue is regenerated on selectable medium
carrying the antibiotic or herbicide resistance marker present
between the binary plasmid T-DNA borders.
[0231] Another approach to transforming plant cells with a gene
involves propelling inert or biologically active particles at plant
tissues and cells. This technique is disclosed in U.S. Pat. Nos.
4,945,050, 5,036,006, and 5,100,792. Generally, this procedure
involves propelling inert or biologically active particles at the
cells under conditions effective to penetrate the outer surface of
the cell and afford incorporation within the interior thereof. When
inert particles are utilized, the vector can be introduced into the
cell by coating the particles with the vector containing the
desired gene. Alternatively, the target cell can be surrounded by
the vector so that the vector is carried into the cell by the wake
of the particle. Biologically active particles (e.g., dried yeast
cells, dried bacterium or a bacteriophage, each containing DNA
sought to be introduced) can also be propelled into plant cell
tissue.
X.B. Transformation of Monocotyledons
[0232] Transformation of most monocotyledon species has now also
become routine. Preferred techniques include direct gene transfer
into protoplasts using PEG or electroporation techniques, and
particle bombardment into callus tissue. Transformations can be
undertaken with a single DNA species or multiple DNA species (i.e.
co-transformation) and both these techniques are suitable for use
with this invention. Co-transformation can have the advantage of
avoiding complete vector construction and of generating transgenic
plants with unlinked loci for the gene of interest and the
selectable marker, enabling the removal of the selectable marker in
subsequent generations, should this be regarded desirable. However,
a disadvantage of the use of co-transformation is the less than
100% frequency with which separate DNA species are integrated into
the genome (Schocher et al. (1986) Biotechnology 4:1093-1096).
[0233] Patent application Nos. EP 0 292 435, EP 0 392 225, and
International Publication No. WO 93/07278 describe techniques for
the preparation of callus and protoplasts from an elite inbred line
of maize, transformation of protoplasts using PEG or
electroporation, and the regeneration of maize plants from
transformed protoplasts. Gordon-Kamm et al. (1990) Plant Cell
2:603-618 and Fromm et al. (1990) Biotechnology 8:833-839 have
published techniques for transformation of A188-derived maize line
using particle bombardment. Furthermore, International Publication
No. WO 93/07278 and Koziel et al. (1993) Biotechnology 11:194-200
describe techniques for the transformation of elite inbred lines of
maize by particle bombardment. This technique utilizes immature
maize embryos of 1.5-2.5 mm length excised from a maize ear 14-15
days after pollination and a PDS-1000He BIOLISTICS.RTM. device for
bombardment.
[0234] Transformation of rice can also be undertaken by direct gene
transfer techniques utilizing protoplasts or particle bombardment.
Protoplast-mediated transformation has been described for
Japonica-types and Indica-types (Zhang et al. (1988) Plant Cell Rep
7:379-384; Shimamoto et al. (1989) Nature 338:274-277; Datta et al.
(1990) Biotechnology 8:736-740). Both types are also routinely
transformable using particle bombardment (Christou et al. (1991)
Biotechnology 9:957-962). Furthermore, Internation Publication
Number WO 93/21335 describes techniques for the transformation of
rice via electroporati on. Patent application EP 0 332 581
describes techniques for the generation, transformation and
regeneration of Pooideae protoplasts. These techniques allow the
transformation of Dactylis and wheat. Furthermore, wheat
transformation has been described by Vasil et al. (1992)
Biotechnology 10:667-674 using particle bombardment into cells of
type C long-term regenerable callus, and also by Vasil et al.
(1993) Biotechnology 11:1553-1558 and Weeks et al. (1993) Plant
Physiol 102:1077-1084 using particle bombardment of immature
embryos and immature embryo-derived callus. A preferred technique
for wheat transformation, however, involves the transformation of
wheat by particle bombardment of immature embryos and includes
either a high sucrose or a high maltose step prior to gene
delivery. Prior to bombardment, any number of embryos (0.75-1 mm in
length) are plated onto MS medium with 3% sucrose (Murashiga &
Skoog (1962) Physiologia Plantarum 15:473-497) and 3 mg/l 2,4-D for
induction of somatic embryos, which is allowed to proceed in the
dark. On the chosen day for bombardment, embryos are removed from
the induction medium and placed onto the osmoticum (i.e. induction
medium with sucrose or maltose added at the desired concentration,
typically 15%). The embryos are allowed to plasmolyze for 2-3 h and
are then bombarded. Twenty embryos per target plate is typical,
although not critical.
[0235] An appropriate gene-carrying plasmid (such as pCIB3064 or
pSG35) is precipitated onto micrometer size gold particles using
standard procedures. Each plate of embryos is shot with the DuPont
BIOLISTICS.RTM. helium device using a burst pressure of about 1000
psi using a standard 80 mesh screen. After bombardment, the embryos
are placed back into the dark to recover for about 24 hours (still
on osmoticum). After 24 hours, the embryos are removed from the
osmoticum and placed back onto induction medium where they stay for
about a month before regeneration. Approximately one month later
the embryo explants with developing embryogenic callus are
transferred to regeneration medium (MS+1 mg/liter NAA, 5 mg/liter
GA), further containing the appropriate selection agent (10 mg/l
basta in the case of pCIB3064 and 2 mg/l methotrexate in the case
of pSOG35). After approximately one month, developed shoots are
transferred to larger sterile containers known as "GA7s" which
contain half-strength MS, 2% sucrose, and the same concentration of
selection agent.
[0236] More recently, tranformation of monocotyledons using
Agrobacterium has been described. See WO 94/00977 and U.S. Pat. No.
5,591,616, both of which are incorporated herein by reference.
XI. Antibodies
[0237] The present invention also provides an antibody
immunoreactive with an SCN/SDS resistance polypeptide. The term
"antibody" indicates an immunoglobulin protein, or functional
portion thereof, including a polyclonal antibody, a monoclonal
antibody, a chimeric antibody, a single chain antibody, Fab
fragments, and an Fab expression library. "Functional portion"
refers to the part of the protein that binds a molecule of
interest. In a preferred embodiment, an antibody of the invention
is a monoclonal antibody. Techniques for preparing and
characterizing antibodies are well known in the art (See, e.g.,
Harlow and Lane (1988). A monoclonal antibody of the present
invention can be readily prepared through use of well-known
techniques such as the hybridoma techniques exemplified in U.S.
Pat. No 4,196,265 and the phage-displayed techniques disclosed in
U.S. Pat. No. 5,260,203.
[0238] The phrase "specifically (or selectively) binds to an
antibody", or "specifically (or selectively) immunoreactive with",
when referring to a protein or peptide, refers to a binding
reaction which is determinative of the presence of the protein in a
heterogeneous population of proteins and other biological
materials. Thus, under designated immunoassay conditions, the
specified antibodies bind to a particular protein and do not show
significant binding to other proteins present in the sample.
Specific binding to an antibody under such conditions can require
an antibody that is selected for its specificity for a particular
protein. For example, antibodies raised to a protein with an amino
acid sequence encoded by the nucleic acid sequence of SEQ ID No:13
can be selected to obtain antibodies specifically immunoreactive
with that protein and not with unrelated proteins.
[0239] The use of a molecular cloning approach to generate
antibodies, particularly monoclonal antibodies, and more
particularly single chain monoclonal antibodies, are also provided.
The production of single chain antibodies has been described in the
art. See, e.g., U.S. Pat. No. 5,260,203. For this approach,
combinatorial immunoglobulin phagemid libraries are prepared from
RNA isolated from the spleen of the immunized animal, and phagemids
expressing appropriate antibodies are selected by panning on
endothelial tissue. The advantages of this approach over
conventional hybridoma techniques are that approximately 10.sup.4
times as many antibodies can be produced and screened in a single
round, and that new specificities are generated by heavy (H) and
light (L) chain combinations in a single chain, which further
increases the chance of finding appropriate antibodies. Thus, an
antibody of the present invention, or a "derivative" of an antibody
of the present invention, pertains to a single polypeptide chain
binding molecule which has binding specificity and affinity
substantially similar to the binding specificity and affinity of
the light and heavy chain aggregate variable region of an antibody
described herein.
[0240] The term "immunochemical reaction", as used herein, refers
to any of a variety of immunoassay formats used to detect
antibodies specifically bound to a particular protein, including
but not limited to, competitive and non-competitive assay systems
using techniques such as radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoradiometric
assays, gel diffusion precipitin reactions, immunodiffusion assays,
in situ immunoassays (e.g., using colloidal gold, enzyme or
radioisotope labels), western blots, precipitation reactions,
agglutination assays (e.g., gel agglutination assays,
hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. See Harlow and Lane (1988) for a
description of immunoassay formats and conditions.
XII. Method for Detecting a SCN/SDS Resistance Polypeptide
[0241] In another aspect of the invention, a method is provided for
detecting a level of SCN/SDS resistance polypeptide using an
antibody that specifically recognizes a SCN/SDS resistance
polypeptide, or portion thereof. In a preferred embodiment,
biological samples from an experimental plant and a control plant
are obtained, and SCN/SDS resistance polypeptide is detected in
each sample by immunochemical reaction with the SCN/SDS resistance
polypeptide antibody. More preferably, the antibody recognizes
amino acids of SEQ ID NO:14 and is prepared according to a method
of the present invention for producing such an antibody.
[0242] In one embodiment, a SCN/SDS resistance polypeptide antibody
is used to screen a biological sample for the presence of a SCN/SDS
resistance polypeptide. A biological sample to be screened can be a
biological fluid such as extracellular or intracellular fluid, or a
cell or tissue extract or homogenate. A biological sample can also
be an isolated cell (e.g., in culture) or a collection of cells
such as in a tissue sample. A tissue sample can be suspended in a
liquid medium or fixed onto a solid support such as a microscope
slide. In accordance with a screening assay method, a biological
sample is exposed to an antibody immunoreactive with an SCN/SDS
resistance polypeptide whose presence is being assayed, and the
formation of antibody-polypeptide complexes is detected. Techniques
for detecting such antibody-antigen conjugates or complexes are
well known in the art and include but are not limited to
centrifugation, affinity chromatography and the like, and binding
of a labeled secondary antibody to the antibody-candidate receptor
complex.
XIII. Identification of Modulators of SCN/SDS Resistance
[0243] The present invention further discloses a method for
identifying a compound that modulates SCN/SDS resistance. As used
herein, the terms "candidate substance" and "candidate compound"
are used interchangeably and refer to a substance that is believed
to interact with another moiety, wherein a biological activity is
modulated. For example, a representative candidate compound is
believed to interact with a complete, or a fragment of, a SCN/SDS
resistance polypeptide, and which can be subsequently evaluated for
such an interaction. Exemplary candidate compounds that can be
investigated using the methods of the present invention include,
but are not restricted to, compounds that confer SCN/SDS
resistance, viral epitopes, peptides, enzymes, enzyme substrates,
co-factors, lectins, sugars, oligonucleotides or nucleic acids,
oligosaccharides, proteins, chemical compounds small molecules, and
monoclonal antibodies. A candidate compound to be tested by these
methods can be a purified molecule, a homogenous sample, or a
mixture of molecules or compounds.
[0244] As used herein, the term "modulate" means an increase,
decrease, or other alteration of any or all chemical and biological
activities or properties of a wild-type SCN/SDS resistance
polypeptide, preferably a SCN/SDS resistance polypeptide of SEQ ID
NO:14. Preferably, a SCN/SDS resistance modulator is an agonist of
SCN/SDS resistance protein activity. As used herein, the term
"agonist" means a substance that supplements or potentiates the
biological activity of a functional SCN/SDS resistance protein.
[0245] In accordance with the present invention there is also
provided a rapid and high throughput screening method that relies
on the methods described above. This screening method comprises
separately contacting each compound with a plurality of
substantially identical samples. In such a screening method the
plurality of samples preferably comprises more than about 10.sup.4
samples, or more preferably comprises more than about
5.times.10.sup.4 samples. In an alternative high-throughput
strategy, each sample can be contacted with a plurality of
candidate compounds.
XIII.A. Methods for Identifying Modulators of SCN/SDS Resistance
Gene Expression
[0246] The nucleic acid sequences of the present invention can be
used to identify regulators of SCN/SDS resistance polypeptide gene
expression. Several molecular cloning strategies can be used to
identify substances that specifically bind SCN/SDS resistance
polypeptide cis-regulatory elements. A preferred promoter region to
be used in such assays is an SCN/SDS resistance polypeptide
promoter region from soybean, more preferably the promoter region
includes some or all amino acids of SEQ ID NO:14.
[0247] In one embodiment, a cDNA library in an expression vector,
such as the lambda-gt11 vector, can be screened for cDNA clones
that encode an SCN/SDS resistance polypeptide regulatory element
DNA-binding activity by probing the library with a labeled SCN/SDS
resistance polypeptide DNA fragment, or synthetic oligonucleotide
(Singh et al. (1989) Biotechniques 7:252-261). Preferably the
nucleotide sequence selected as a probe has already been
demonstrated as a protein binding site using a protein-DNA binding
assay described above.
[0248] In another embodiment, transcriptional regulatory proteins
are identified using the yeast one-hybrid system (Luo et al. (1996)
Biotechniques 20(4):564-568; Vidal et al. (1996) Proc Natl Acad Sci
USA 93(19):10315-10320; Li and Herskowitz (1993) Science
262:1870-1874). In this case, a cis-regulatory element of a SCN/SDS
resistance gene is operably fused as an upstream activating
sequence (UAS) to one, or typically more, yeast reporter genes such
as the lacZ gene, the URA3 gene, the LEU2 gene, the HIS3 gene, or
the LYS2 gene, and the reporter gene fusion construct(s) is
inserted into an appropriate yeast host strain. It is expected that
the reporter genes are not transcriptionally active in the
engineered yeast host strain, for lack of a transcriptional
activator protein to bind the UAS derived from the SCN/SDS
resistance gene promoter region. The engineered yeast host strain
is transformed with a library of cDNAs inserted in a yeast
activation domain fusion protein expression vector, e.g. pGAD,
where the coding regions of the cDNA inserts are fused to a
functional yeast activation domain coding segment, such as those
derived from the GAL4 or VP16 activators. Transformed yeast cells
that acquire a cDNA encoding a protein that binds a cis-regulatory
element of a SCN/SDS resistance gene can be identified based on the
concerted activation the reporter genes, either by genetic
selection for prototrophy (e.g. LEU2, HIS3, or LYS2 reporters) or
by screening with chromogenic substrates (lacZ reporter) by methods
known in the art.
[0249] The present invention also provides an in vivo assay for
discovery of modulators of SCN/SDS resistance gene expression. In
this case, a transgenic plant is made such that a transgene
comprising a SCN/SDS resistance gene promoter and a reporter gene
is expressed and a level of reporter gene expression is assayable.
Such transgenic animals can be used for the identification of
compounds that are effective in modulating SCN/SDS resistance gene
expression.
[0250] In vitro or in vivo screening approaches may survey more
than one modulatable transcriptional regulatory sequence
simultaneously.
XIII.B. Methods for Identifying Modulators of SCN/SDS Resistance
Polypeptides
[0251] According to the method, a SCN/SDS resistance polypeptide is
exposed to a plurality of candidate substances, and binding of a
candidate substance to the SCN/SDS resistance polypeptide is
assayed. A compound is selected that demonstrates specific binding
to the SCN/SDS resistance polypeptide. Preferably, the SCN/SDS
resistance polypeptide used in the binding assay of the method
includes some or all amino acids of SEQ ID NO:14.
[0252] The term "binding" refers to an affinity between two
molecules, for example, a ligand and a receptor, means a
preferential binding of one molecule for another in a mixture of
molecules. The binding of the molecules can be considered specific
if the binding affinity is about 1.times.10.sup.4 M.sup.-1 to about
1.times.10.sup.6 M.sup.-1 or greater. Binding of two molecules also
encompasses a quality or state of mutual action such that an
activity of one protein or compound on another protein is
inhibitory (in the case of an antagonist) or enhancing (in the case
of an agonist).
[0253] Several techniques can be used to detect interactions
between a protein and a chemical ligand without employing an in
vivo ligand. Representative methods include, but are not limited
to, fluorescence correlation spectroscopy, surface-enhanced laser
desorption/ionization, and biacore technology, each described
herein below. These methods are amenable to automated,
high-throughput screening.
[0254] Fluorescence Correlation Spectroscopy (FCS). FCS measures
the average diffusion rate of a fluorescent molecule within a small
sample volume (Madge et al. (1972) Phys Re Lett 29:705-708, Maiti
et al. (1997) Proc Natl Acad Sci USA, 94:11753-11757). The sample
size can be as low as 10.sup.3 fluorescent molecules and the sample
volume as low as the cytoplasm of a single bacterium. The diffusion
rate is a function of the mass of the molecule and decreases as the
mass increases. FCS can therefore be applied to protein-ligand
interaction analysis by measuring the change in mass and therefore
in diffusion rate of a molecule upon binding. In a typical
experiment, the target to be analyzed is expressed as a recombinant
protein with a sequence tag, such as a poly-histidine sequence,
inserted at the N-terminus or C-terminus. The target protein is
expressed in E. coli, yeast, or plant cells. The protein is
purified by chromatography. For example, the poly-histidine tag can
be used to bind the expressed protein to a metal chelate column
such as Ni.sup.2+ chelated on iminodiacetic acid agarose. The
protein is then labeled with a fluorescent tag such as
carboxytetramethylrhodamine or BODIPY.TM. (Molecular Probes,
Eugene, Oreg.). The protein is then exposed in solution to a
candidate compound, and its diffusion rate is determined by FCS ,
using for example, instrumentation available from Carl Zeiss, Inc.
(Thornwood, N.Y.). Ligand binding is determined by changes in the
diffusion rate of the protein.
[0255] Surface-Enhanced Laser Desorption/lonization (SELDI). SELDI
can be used in combination with a time-of-flight mass spectrometer
(TOF) to provide a means to rapidly analyze molecules retained on a
chip (Hutchens and Yip (1993) Rapid Commun Mass Spectrom
7:576-580). It can be applied to ligand-protein interaction
analysis by covalently binding the target protein on the chip and
using mass spectroscopy to analyze the small molecules that bind to
the target protein (Worrall et al. (1998) Anal Biochem 70:750-756).
In a typical experiment, the target to be analyzed is recombinantly
expressed, optionally with a tag, such as poly-histidine, to
facilitate purification and handling. The purified protein is bound
to the SELDI chip either by utilizing the poly-histidine tag or by
other interaction such as ion exchange or hydrophobic interaction.
The chip thus prepared is then exposed to a candidate compound via,
for example, a delivery system able to pipet the ligands in a
sequential manner (autosampler). The chip is then washed in buffers
of increasing stringency, for example a series of buffer solutions
containing incrementally increasing ionic strength. After each
wash, the bound material is analyzed by SELDI-TOF. Compounds that
specifically bind the target are identified by elution in high
stringency wahes.
[0256] Biacore. Biacore technology utilizes changes in the
refractive index at the surface layer upon binding of a ligand to a
protein immobilized on the layer. In this system, a collection of
small ligands is injected sequentially in a 2-5 microliter cell,
wherein the protein is immobilized within the cell. Binding is
detected by surface plasmon resonance (SPR) of laser light
refracting from the surface. In general, the refractive index
change for a given change of mass concentration at the surface
layer is practically the same for all proteins and peptides,
allowing a single method to be applicable for any protein (Liedberg
et al. (1983) Sensors Actuators 4:299-304; Malmquist (1993) Nature
361:186-187). In a typical experiment, the target protein to be
analyzed is recombinantly expressed an purified according to
standard methods. It is bound to the Biacore chip either by
utilizing a poly-histidine tag or by other interaction such as ion
exchange or hydrophobic interaction. The chip thus prepared is then
exposed to a candidate compound via the delivery system
incorporated in the instruments sold by Biacore (Uppsala, Sweden)
to pipet the ligands in a sequential manner (autosampler). The SPR
signal on the chip is recorded and changes in the refractive index
indicate an interaction between the immobilized target and the
ligand. Analysis of the signal kinetics on rate and off rate allows
the discrimination between non-specific and specific
interaction.
[0257] Rational Drug Design. Similarly, the knowledge of the
structure a native SCN/SDS resistance polypeptide provides an
approach for rational drug design. The structure of an SCN/SDS
resistance polypeptide can be determined by X-ray crystallography
or by computational algorithms that generate three-dimensional
representations. See Huang et al. (2000) and Saqi et al. (1999)
Computer models can further predict binding of a protein structure
to various substrate molecules, that can be synthesized and tested.
Additional drug design techniques are described in U.S. Pat. Nos.
5,834,228 and 5,872,011.
XIV. Modulation of SCN/SDS Resistance in a Plant
[0258] In accordance with the present invention a method of
modulating SCN/SDS resistance in a plant is also provided. The
method comprises the step of administering to the plant an
effective amount of a substance that modulates expression of an
SCN/SDS resistance activity-encoding nucleic acid molecule in the
plant to thereby modulate SCN/SDS resistance in the plant.
Preferably, the substance that modulates expression of an SCN/SDS
resistance activity-encoding nucleic acid molecule comprises a
ligand for a modulatable transcriptional regulatory sequence of an
SCN/SDS resistance activity-encoding nucleic acid molecule
identified in accordance with the methods described above. More
preferably, the plant is a soybean plant.
[0259] Particularly, provided chemical entities (e.g. small
molecule mimetics) do not naturally occur in any cell of a lower
eucaryotic organism such as yeast. More particularly, provided
chemical entities do not naturally occur in any cell, whether of a
multicellular or a unicellular organism. Even more particularly,
the provided chemical entity is not a naturally occurring molecule,
e.g. it is a chemically synthesized entity. Provided chemical
entities can be hydrophobic, polycyclic, or both, molecules, and
are typically about 500-1,000 daltons in molecular weight.
XV. Method for Providing SCN/SDS Resistance B Transgenic Plants
[0260] A "transgenic plant" is a plant that has been genetically
modified to contain and express heterologous DNA sequences, either
as regulatory RNA molecules or as proteins. As specifically
exemplified herein, a transgenic plant is genetically modified to
contain and express at least one heterologous DNA sequence operably
linked to and under the regulatory control of transcriptional
control sequences which function in plant cells or tissue or in
whole plants. As used herein, a transgenic plant also refers to
progeny of the initial transgenic plant where those progeny contain
and are capable of expressing the heterologous coding sequence
under the regulatory control of the plant-expressible transcription
control sequences described herein. Seeds containing transgenic
embryos are encompassed within this definition as are cuttings and
other plant materials for vegetative propagation of a transgenic
plant.
[0261] When plant expression of a heterologous gene or coding
sequence of interest is desired, that coding sequence is operably
linked in the sense orientation to a suitable promoter and
advantageously under the regulatory control of DNA sequences which
quantitatively regulate transcription of a downstream sequence in
plant cells or tissue or in planta, in the same orientation as the
promoter, so that a sense (i.e., functional for translational
expression) mRNA is produced. A transcription termination signal,
for example, as polyadenylation signal, functional in a plant cell
is advantageously placed downstream of the SCN/SDS resistance
coding sequence, and a selectable marker which can be expressed in
a plant, can be covalently linked to the inducible expression unit
so that after this DNA molecule is introduced into a plant cell or
tissue, its presence can be selected and plant cells or tissue not
so transformed will be killed or prevented from growing.
[0262] In the present invention, the SCN/SDS resistance coding
sequence can optionally serve as a selectable marker for
transformation of plant cells or tissue. Where constitutive gene
expression is desired, suitable plant-expressible promoters include
a native promoter (e.g. SEQ ID NO:15) of the SCN/SDS coding
sequences set forth herein as the native promoter is activated in
the presence of SCN; the 35S or 19S promoters of Cauliflower Mosaic
Virus; the nos, ocs or mas promoters of Agrobacterium tumefaciens
Ti plasmids; and others known to the art.
[0263] Indeed, a native promoter (e.g. SEQ ID NO:15) of the SCN/SDS
coding sequences set forth herein is activated in the presence of
SCN and thus can be used to produce transgenic plants in accordance
with the techniques disclosed herein. Particularly, the native
promoter can be linked to a nucleic acid encoding a polypeptide of
interest in a construct, and the construct can be used to a prepare
a transgenic plant in accordance with techniques described herein.
Other techniques are disclosed in U.S. Pat. Nos. 5,994,526 and
5,994,527, herein incorporated by reference in their entirety. The
polypeptide of interest is then expressed in the plant when the
promoter is activated, such as in the presence of SCN or other
environmental stimulus.
[0264] Where tissue-specific expression of the SCN/SDS resistance
coding sequence is desired, the skilled artisan will choose from a
number of well-known sequences to mediate that form of gene
expression as disclosed herein. Environmentally regulated promoters
are also well known in the art, and the skilled artisan can choose
from well known transcription regulatory sequences to achieve the
desired result.
[0265] A method for providing a resistance characteristic to a
plant is therefore disclosed. The method comprises introducing to
said plant a construct comprising a nucleic acid sequence encoding
an SCN/SDS resistance gene product operatively linked to a
promoter, wherein production of the SCN/SDS resistance gene product
in the plant provides a resistance characteristic to the plant. The
construct can further comprises a vector selected from the group
consisting of a plasmid vector or a viral vector. The SCN/SDS
resistance gene product comprises a protein having an amino acid
sequence as set forth as SEQ ID NO:14. The nucleic acid sequence
can be a nucleic acid sequence set forth as SEQ ID NO:13, or a
nucleic acid that is substantially similar to SEQ ID NO:13, and
which encodes an SCN/SDS resistance polypeptide.
[0266] The resistance characteristic is preferably nematode
resistance, fungal resistance or combinations thereof. More
preferably, the nematode resistance is H. glycines resistance or
root knot nematode resistance.
[0267] In an alternative embodiment, the construct further
comprises another nucleic acid molecule encoding a polypeptide that
provides an additional desired characteristic to the plant. Other
desired characteristics include yield, drought resistance, chemical
resistance (e.g. herbicide or pesticide resistance), spoilage
resistance or any or other desired characteristic as would be
apparent to one of ordinary skill in the art after review of the
disclosure of the present invention. Representative nucleic acids
sequences are described in the following U.S. patents (incorporated
herein by reference in their entirety): U.S. Pat. No. 5,948,953 to
Webb (brown rot fungus resistance); U.S. Pat. No. RE36,449 to
Lebrun et al. (herbicide resistance); U.S. Pat. No.5,952,546 to
Bedbrook et al. (delayed ripening tomato plants); and U.S. Pat. No.
5,986,173 to Smeekens et al. (transgenic plants showing a modified
fructan pattern).
[0268] Optionally, the method further comprises monitoring an
insertion point for the construct in the plant genome; and
providing for insertion of the construct into the plant genome at a
location not associated with the resistance characteristic, the
desired characteristic, or both the resistance or the desired
characteristic.
XVI. Method for Providing SCN/SDS Resistance B Marker-Assisted
Selection and Development of a Breeding Program
[0269] The present invention relates to a novel and useful method
for introgressing, in a reliable and predictable manner, SCN/SDS
resistance into non-resistant soybean germplasm. The method
involves the genetic mapping of loci associated with SCN/SDS
resistance, definition of genetic markers that are linked with
SCN/SDS resistance, and a high-throughput PCR-based assay for
detecting such a genetic marker. Markers useful in a preferred
embodiment of the invention include the following: a locus mapping
to linkage group G and mapped by one or more of the markers set
forth SEQ ID NOs:1-6, a locus mapping to linkage group A2 and
mapped by one or more of the markers set forth as SEQ ID NOs:7-12;
or combinations thereof. Also preferably, a genetic marker used for
marker-assisted selection comprises a sequence, or portion thereof,
of any one of SEQ ID NOs:13 and 16-19, or combinations thereof.
[0270] From the sequence data found in SEQ ID NOs:1-13 and 16-19,
and from the other markers identified herein, primer pairs, as for
example, PCR primer pairs, capable of distinguishing differences
among these genotypes are developed. Simple assays for the markers
and genes use a label, such as, but not limited to, a covalently
attached chromophores, that do not need electrophoresis are
developed to increase the capacity of marker assisted selection to
help plant breeders. A preferred assay is the TaqMan.TM. assay
disclosed in Example 6. Non-destructive sampling of dried seed for
DNA preparations are developed to allow selection prior to
planting, for example, using the methods set forth in Example 9.
This enables the testing of the effectiveness of marker assisted
selection in predicting field resistance to SCN and SDS.
[0271] A preferred manner for providing SCN/SDS resistance to a
plant involves providing one or more plants from a parental soybean
plant line which comprises in its genome one or more molecular
markers comprising a sequence, or portion thereof, set forth as any
one of SEQ ID NOs:1-13 and 16-19. Preferably, the parental plant is
purebreeding for one or more of the molecular markers, more
preferably the parent plant is purebreeding for molecular markers
comprising a sequence, or portion thereof, set forth as any one of
SEQ ID NOs: 1-13 and 16-19. In one preferred embodiment, the
parental line is "Forrest" or a line derived therefrom.
[0272] The SCN/SDS resistance trait can be introgressed into a
recipient soybean plant line which is non-resistant or less
resistant to SCN/SDS by performing marker-assisted selection based
on the molecular markers of the present invention as set forth as
SEQ ID NOs:1-13 and 16-19.
[0273] Introgressing can be accomplished by any method known in the
art, including but not limited to single seed descent, pedigree
method, or backcrossing, each described herein below. Additional
methods for introgressing are disclosed in U.S. Pat. Nos.5,948,953
and 6,162,967. Any suitable method can be used, the critical
feature being marker-assisted selection of a marker of the present
invention using a nucleotide sequence assay.
[0274] Single Seed Descent. According to this method, "Forrest" can
be crossed to "Essex", and the seed planted in a field. The
resulting seed (F2) is planted in the greenhouse and the resulting
seeds (F3) are harvested while keeping separate the seeds from each
plant. A random F3 seed from each of approximately 200 plants is
planted and the resulting F4 seed is harvested. The seeds from each
individual plant are again kept separate. A random F4 seed from
each of the approximately 200 plants is planted and the resulting
F5 seed is harvested. This selection process is repeated until F7
seed is harvested and identified as an inbred line. At each
generation beginning with the F3 generation, plants are screened
with soybean cyst nematodes, and plants were selected for
advancement based upon the presence of SCN resistance and other
phenotypic characteristics. Alternatively, plants are screened for
the presence of one or more of the molecular markers listed herein
using a TaqMan.TM. genotyping assay and selected for advancement
based upon the presence of one or more of the markers.
[0275] Pedigree Method. Using a SCN resistant recombinant inbred
line, produced for example by single seed descent, as a donor
source, the SCN resistant trait can be introgressed into other germ
plasm sources. To develop new germplasm, the SCN resistant
recombinant inbred line is used as one of the parents. The
resulting progenies are evaluated and selected at various locations
for a variety of traits, including SCN resistance. SCN resistance
is determined by phenotypic screening or by genotyping based upon
the presence of the molecular markers listed herein.
[0276] Backcrossing. Using a SCN resistant recombinant inbred line,
produced for example by single seed descent, as a donor source, the
SCN resistant trait is introgressed into other soybean plant lines.
The SCN resistant recombinant inbred line is crossed to a line that
demonstrates little or non SCN resistance (the recipient). The
resulting plants are crossed back to the recipient soybean plant
line that is being converted to SCN resistance. This crossing back
to the parental line that is being converted may be repeated
several times. After each round of backcrossing, plants are
selected for SCN resistance, which can be determined by either
phenotypic screening or by the selection of molecular markers
linked to SCN resistance loci. Besides selecting for SCN
resistance, the plants are also selected that most closely resemble
the original plant line being converted to SCN resistance. This
selection for the original plant line is done phenotypically or
with molecular markers.
[0277] In one specific preferred method, BC.sub.NF1 plants are
genotypically screened for the presence of one or more markers
linked to SCN resistance genomic loci. As used herein, the term
"BC.sub.NF1 plant" is intended to refer to a plant in the first
generation after a specific backcross event, the specific backcross
event being designated by the term "N", irrespective of the number
of previous backcross events employed to produce the plant. Plants
having the one or more markers present may preferably be
backcrossed with plants of the parental line or, alternatively, be
selfed, the plants resulting from either of these events also being
genotypically screened for the presence of one or more markers
linked to SCN resistance genomic loci. This procedure can be
repeated several times.
[0278] In another specific preferred method, BC.sub.NF1 plants are
selfed to produce BC.sub.NF2 seeds. BC.sub.NF2 plants are then
screened either genotypically using, for example a TaqMan.TM. assay
as disclosed in Example 6, or by phenotypic assessment of SCN
resistance. Those plants having present one or more molecular
markers linked to SCN resistance, or those plants displaying
resistance, depending upon the screening method used, are
backcrossed with plants of the parental line to produce BC.sub.NF3
seeds and plants. This procedure can be repeated several times. In
a soybean breeding program, the methods of the present invention
can be used for marker-assisted selection of the molecular markers
described herein. Genetic markers closely linked to SCN/SDS
resistance genes can be used to indirectly select for favorable
alleles more efficiently than phenotypic selection. Genetic markers
comprising SCN/SDS resistance genes, as disclosed herein, can be
used to select for SCN/SDS resistance genes with optimal efficiency
and accuracy.
[0279] Marker-assisted selection can be employed to select one or
more loci at a wide variety of population development stages in a
two-parent population, multiple parent population, or a backcross
population. Such populations are described in Fehr (1987) Breeding
Methods for Cultivar Development J. R. Wilcox (ed.) and Soybeans:
Improvement, Production, and Uses, 2nd ed..
[0280] Marker-assisted selection according to art-recognized
methods can be made, for example, step-wise, whereby the different
SCN resistance loci are selected in more than one generation; or,
as an alternative example, simultaneously, whereby all loci are
selected in the same generation. Marker-assisted selection for SCN
resistance can be done before, in conjunction with, or after
testing and selection for other traits such as seed yield, plant
height, seed type, etc. The DNA from target populations, isolated
for use in accordance with genetic marker detection, can be
obtained from any plant part, and each DNA sample can represent the
genotype of single or multiple plant individuals, including
seed.
[0281] Marker-assisted selection can also be used to confirm
previous selection for SCN resistance or susceptibility made by
challenging plants with SCNs in the field or greenhouse and scoring
the resulting phenotypes. Alternatively, plants can be analyzed by
TaqMan.TM. genotyping to determine the presence of the
above-described molecular markers, thus confirming the presence of
a genomic locus associated with SCN resistance.
[0282] As such, also provided by the present invention are methods
for determining the presence or absence of SCN resistance in a
soybean plant, or alternatively in a soybean seed. These methods
comprise analyzing genomic DNA from a plant or a seed for the
presence of one or more of the molecular markers set forth as SEQ
ID NOs:1-13 and 16-19. According to this method, the analyzing
comprises performing a TaqMan.TM. assay as disclosed in Example 6,
or any other suitable method known in the art.
[0283] The ability to distinguish heterozygotes and their derived
heterogeneous lines is important to early generation selection
(before the F.sub.5) in soybean breeding programs when within
population variability is high (Bernard et al. (1988) USDA Tech
Bull 1796; Brown et al., 1987). The lower stringency TaqMan.TM. 2
assay disclosed herein was most effective for identifying most of
the heterogeneous lines in this population. However, the cutoff
values of FAM and TET for the efficient identification of
heterogeneous lines (or heterozygous F2 lines) is likely to vary
across assays and should be set arbitrarily according to
expectations of the number of lines that are expected to contain
both alleles. The assay was used for analyzing 2,000 lines derived
from specific cultivar crosses over 3 days. A single researcher can
process 768 sample per day (8.times.96 samples) since the reading
time of the machine is 15 minutes for one 96 well plate and the
thermal cycler stage takes about 2 hours.
[0284] Table 3 shows that with genomic DNA from 94 cultivars the
standard TaqMan.TM. allelic discrimination assays and PCR assays
provided allele scores that were in good agreement with the
cultivar phenotypes (Concibidio, 1997; Bernard et al., 1988).
Cultivars, plant introductions (PI), breeding lines and germplasm
releases listed in Table 3 were parents in the SCN molecular
breeding program at Southern Illinois University-Carbondale (SIUC)
from 1997-1999. The prevalence of allele 1 was in good agreement
with allele frequencies for markers that are closely linked to Rhg4
(Cregan et al. 1999; Mathews et al. (1998) Theor Appl Genet
97:1047-1052; Mahalingam et al., 1995). Those resistant cultivars
sharing allele 1 with the susceptible lines may not require the
presence of Rhg4 for resistance to SCN or have derived their
resistance to SCN at the Rhg4 locus from alleles derived from
cultivars other than Forrest. In addition, some soybean breeders
may have been effective in separating even the most closely linked
marker from resistance genes using phenotypic selection. However,
this is probably infrequent since selection to generate the
resistance allele 2 in susceptible cultivars has not occurred
frequently. Only three cultivars with allele 2 were
susceptible.
4 TABLE 3 Resistant Susceptible Allele 2 Forrest, Hartwig, Fayette,
Pharaoh, Picket, MD93-5298 Accomac, Bedford, Delsoy4710, Peking,
Pace PI88788, PI209332, PI90763, PI437654, Holladay LS92-1088,
LS92-4173, LS94-3207, LS95-0259, LS95-0709, LS95-1454, LS96-1631,
LS90-1920, LS94-3545, S92- 1679, S92-2711A, S94-2086, LN94-10527,
A5560K1390, K1425 Allele 1 Manokin, Mustang, Dwight, Pana, Ina,
Essex, Bragg, Dunfield, Hill, CNS, PI 398680, IA2036, IA3005,
LS92-3660, Lee, Noir1, Ogden, Calhoun, LS93-0292, LS93-0375,
LS94-2435, Chesapeake, Choska, Stressland, LS96-0735, LS96-3813,
LS96-5009, Macon, Misuzudaiza, Nakasennari, LN92-10725, GX93-1573,
SS94-7546, PI 520733, PI567445B, PI567583C, SS94-4337, S95-1908,
A4138, A95-483010, PI567650B, PI 567374, PI 567650B, M92-1645,
M92-1708, M90-184111, K1423, IA3010, IA1006, TN96-58, N96-180,
K1424 LN93-11632, LN93-11945, LN95- 5417, A94-674017, A94-774021,
A96-494018, C1963, HC93- 2690, HS93-4118, K1410
[0285] Summarily, the sequences and methods disclosed herein enable
automated, high throughput, rapid genotyping of DNA polymorphisms
for selection of SCN/SDS resistance in breeding programs.
EXAMPLES
[0286] The following Examples have been included to illustrate
preferred modes of the invention. Certain aspects of the following
Examples are described in terms of techniques and procedures found
or contemplated by the present inventors to work well in the
practice of the invention. These Examples are exemplified through
the use of standard laboratory practices of the inventors. In light
of the present disclosure and the general level of skill in the
art, those of skill will appreciate that the following Examples are
intended to be exemplary only and that numerous changes,
modifications and alterations can be employed without departing
from the spirit and scope of the invention.
Example 1
Plant Material
[0287] A mapping population consisted of approximately 100
recombinant inbred lines derived at the F5 generation from a cross
of `Essex` (Smith & Camper (1973) Crop Sci 13:459) by `Forrest`
(Hartwig & Epps (1973) Crop Sci 13:287). The recombinant inbred
line (RILs) population was advanced to the F5:13 generation from
300 plants per RIL per generation (Hnetkovsky et al., 1996).
Forrest is resistant to the soybean cyst nematode (SCN) populations
classified as race 3 and Essex is susceptible to all populations of
SCN (Chang et al., 1997; Meksem et al. 1999).
Example 2
SCN Female Index (FI) Determination
[0288] The number of white female cysts was compared on each
genotype to the number of white female cysts on a susceptible
control, such as Essex, to determine the female index (FI) for each
population (Meksem et al., 1999). Seedlings were inoculated with
2000+/-25 eggs from a homogenous isolate of H. glycines. All
experiments used five single-plant replications per line. The mean
number of white female cysts on each genotype and the susceptible
control were determined and Fl was calculated as the ratio of the
mean number of cysts on each genotype to the mean number of cysts
on the susceptible check.
Example 3
Characterization of New Markers for SCN/SDS Resistance
[0289] Soybean genomic DNA used for AFLP analysis was extracted and
purified using the Qiagen (Hilden, Germany) Plant Easy DNA
Extraction Kit. Primary template DNA was prepared using the
restriction enzymes EcoRI and Msel.
[0290] AFLP analysis was performed as described by Vos et al.
(1995) Nuc Acids Res 23:4407-4414 except that the streptavidin bead
selection step was omitted. PCR reactions were performed with using
primer pairs derived from each of two sets of primers. Primers
within EcoRI set all included the core sequence E: 5'- GAC TGC GTA
CCAATT C (SEQ ID NO:115) with 1 or3 base pair extensions. Primers
of the MseI set have the sequence M: 5'- GAT GAG TCC TGA GTA A (SEQ
ID NO:116) with 1 or 3 base pair extensions. The primer
combinations (EA and MC) and (EC and MA) were used for
pre-amplification of primary template. Three selective nucleotides
per primer were used to generate AFLP fragments from the secondary
templates. AFLP bands were labeled with .sup.33P by primer
phosphorylation, separated by electrophoresis on 4% (w/v) PAGE and
visualized by exposing X-ray film to the dried gel.
[0291] Target AFLP bands on the autoradiograph were matched to the
corresponding area in the gel and the appropriate AFLP fragment was
excised from the dried gel. The band was eluted from the gel by
incubation in 100 ml of water at 4.degree. C. for 1 hour. Sequence
isolation in bacterial clones was performed as described by Meksem
et al. (1995) Mol Gen Genet 249:74-81 with the modification that
the pGEM-T vector (Promega, Madison, Wis.) was ligated to PCR
amplified, gel eluted DNA. DNA sequencing of clones allowed PCR
primers to be designed for each unique DNA sequence using Oligo 5.0
software (PE Biosystems, Foster City, Calif.). The PCR product was
analyzed on 4% (w/v) Metaphor7 (FMC, Rockland, Me.) agarose
gel.
[0292] AFLP markers that were dominant or co-dominant, in repulsion
and in coupling phases were used. For dominant AFLP markers, the
band of the dominant allele was cloned and sequenced. The
corresponding marker for the recessive allele was isolated by PCR
using primers designed from the dominant band sequence. For
apparently co-dominant AFLP markers, both, the coupling and
repulsion phase bands were cloned simultaneously from the
acrylamide gel.
[0293] The general strategy employed to identify the specific
sequence underlying AFLP band polymorphisms was as follows. If the
polymorphism was dominant (e.g. E.sub.ATGM.sub.CGA87) a primer pair
was designed to flank each of the unique sequences derived from the
AFLP band. Each primer pair was used to amplify genomic DNA from
both Essex and Forrest. Any primer set that revealed polymorphism
(dominant or co-dominant) between the two parents was used to
amplify members of the RIL mapping population. The primer pair that
generated a marker on the map corresponding to the map position of
the original AFLP band was inferred to be the specific marker
STS.
[0294] For some AFLP bands the above strategy was ineffective,
presumably because polymorphism was within or close to the
restriction site used for AFLP linker ligation (e.g.
E.sub.CGGM.sub.AGA116). In such cases genomic DNA from the parents
and mapping population was used in a modified AFLP protocol as
follows. The pre-amplification step was omitted and the six
selective nucleotide step was replaced by an extended highly
selective MseI primer to which we added the first 7 bases of the
sequenced band, combined with a non selective EcoRI primer E (e.g.
MseI primer M AGAGACT and EcoRI primer E). The MseI primer was
end-labeled by phosphorylating the 5' end with 5 ml [g-.sup.33P]
ATP (3000 Ci/mmol) for 30 min at 37.degree. C. with 10 units of T4
Kinase (Pharmacia, Piscataway, N.J.). Any primer set that revealed
polymorphism (dominant or co-dominant) between the two parents was
used to amplify members of the RIL mapping population. The primer
pair that generated a marker on the map corresponding to the map
position of the original AFLP band was inferred to be the specific
marker STS.
Example 4
Cloning of SCN/SDS Resistance Genes in Linkage Groups G and A2
[0295] The cloned AFLP bands of Example 3 were used to screen the
soybean Forrest BamHI or HindIII BAC libraries by PCR as described
by Meksem et al. (2000).
[0296] Both plasmid and BAC DNA was prepared using the appropriate
kit (Qiagen, Hilden, Germany). Sequence determinations were
performed by the di-deoxy chain-termination method using Advanced
Biosystems (ABI, Foster city, Calif.) "big dye" cycle sequencing
separated on ABI 377 automated DNA sequencer.
[0297] Plasmids containing clones derived from AFLP bands were
sequenced using M13 universal forward and reverse primers. Direct
BAC insert sequencing was performed as above with the following
modifications: BAC DNA was heated for 30 min at 70.degree. C., and
sheared by pippeting into a narrow gauge tip for 2 min. Two primers
designed from the target AFLP band sequence were used for
sequencing. For the E.sub.ATGM.sub.CGA87 positive BAC insert DNA,
the forward primer, named ATG4BACF (SEQ ID NO:117), was 5'
gggtttcagataaccgtggtcg 3', the reverse primer was the complementary
strand sequences of the ATG4BACF primer. The PCR conditions used
was 95.degree. C. for 10 min, then 45 cycles of 95.degree. C. for
30 sec, 55.degree. C. for 20 sec and 60.degree. C. for 4 min.
Example 5
Tagman.TM. Genotyping Assay
[0298] PCR primers and TaqMan.TM. probes were designed with the
primer express program (Perkin-Elmer/Applied Biosystems, Foster
City, Calif.) and were custom synthesized by Perkin-Elmer. Two
TaqMan.TM. probes were designed to encompass the A2D8 (FIG. 1)
insertion polymorphisms (underlined). The A2D8 SCAR was derived
from the codominant AFLP bands E.sub.CCG-M.sub.AAC417 (Essex,
allele 1, GenBank Accession No. AF286701) and
E.sub.CCG-M.sub.AAC409 (Forrest, allele 2, GenBank Accession No.
AF286700) that contain a homolog (P=2e-05) of one component (Tic22;
GenBank Accession No. AAC64606.1) of the protein import apparatus
of the chloroplast inner envelope membrane. Allele 1:5'-TET-TTG CAG
ATA TTT TAG TTG ATT GGC C-TAMRA (SEQ ID NO: 118). Allele 2:
5'-6FAM-AGT TGA TTG GCT CM ACC ATG GCC-TAMRA (SEQ ID NO:119).
Reverse Primer: 5' d TTG CGT GTG ATC GGT ATT AC 3' (SEQ ID NO:
120). Forward primer: 5' d T ACC TGA GTT CTC TCA AGT C 3' (SEQ ID
NO:121).
[0299] TaqMan.TM. reactions were performed essentially as the
Perkin-Elmer TaqMan.TM. PCR Reagent Kit protocol describes except
the PCR reaction was performed in 384 well plates to reduce assay
volume and cost. Briefly, each reaction contained 10 ng of the
extracted DNA, 0.025 units/ml of AmpliTaq Gold.TM.
(Perkin-Elmer/Applied Biosystems, Foster City, Calif.), 400 nM of
the forward and reverse primers (Research Genetics, Huntsville,
Ala.), 50 nM of FAM fluorescent probe and 150 nM of TET fluorescent
probe (Perkin-Elmer/Applied Biosystems, Foster City, Calif.) in
1.times.universal master mix (Perkin-Elmer/Applied Biosystems,
Foster City, Calif.). The above ratio of primers and probes was
optimized using a series of primer/probe combinations to reach a
maximal signal and the balance of the two probes by reading in an
ABI 7200 sequence detector. The TaqMan.TM. universal PCR master mix
is a premix of all the components, except primer and probes,
necessary to perform a 5' nuclease assay. The final optimized
conditions represented a two step PCR protocol, with two holds
followed by cycling, on a 384 well thermal cycler (GeneAmp PCR
System 9700, Perkin-Elmer/Applied Biosystems, Foster City, Calif.).
The two hold cycles were 50.degree. C. for 2 min and 95.degree. C.
for 10 min. The 35 cycles were at 95.degree. C. for 15 sec,
60.degree. C. for 1 min. After amplification the plates were cooled
to room temperature and samples were transferred from a 384 well
plate to a 96 well MicroAmpJ optical tray and fluorescence was
detected on an ABI PrismJ 7200 Sequence Detector
(Perkin-Elmer/Applied Biosystems, Foster City, Calif.).
[0300] The results were analyzed by allelic discrimination of the
sequence detection software (Perkin-Elmer/Applied Biosystems,
Foster City, Calif.). Two grouping methods were used to attempt to
accurately separate heterogeneous lines from homogeneous lines at
each allele. In grouping method 1 (TaqMan.TM. 1) a stringent
cut-off for FAM (>7) was used for allele 1 compared to
heterogenous scores. This served to reduce the number called as
potentially heterogeneous to about the percentage expected from the
breeding method used for RIL development (6%). Fluorophore ratios
were as follows; no amplification (FAM and TET both less than 6
units); allele 1 homozygous (FAM less than 7, TET greater than 7);
allele 2 homozygous (FAM greater than 10, TET less than 5); and
heterogeneous for allele 1 and allele 2 (FAM greater than 7, TET
5-8). For TaqMan.TM. selection grouping method 2 ratios were; no
amplification (FAM and TET both less than 6 units); allele 1
homozygous (FAM less than 5, TET greater than 7); allele 2
homozygous (FAM greater than10, TET less than 5); and heterogeneous
for allele 1 and allele 2 (FAM greater than 5, TET 5-9). The FAM
and TET signals were stable in the dark for 2 days after PCR.
Example 6
Genotyping Assay Using Gel Electrophoresis Markers
[0301] PCR reactions were performed with DNA from the recombinant
inbred lines. The 114 and 120 base pair PCR products were generated
using the forward and reverse primers (SEQ ID NOs:120-121). The
final optimized conditions were 94.degree. C. for 10 min, then 35
cycles of 94.degree. C. for 25 sec, 56.degree. C. for 30 sec and
72.degree. C. for 60 sec. After the PCR reactions were completed,
the plates were cooled to room temperature and the PCR products
separated by electrophoresis on a 4% (w/v) agarose gel.
Example 7
Allele Distribution in Soybean Germplasm
[0302] Genotypes at A2D8 were determined from the genomic DNA of 94
cultivars that represented the parents of populations in the SIUC
soybean breeding program from 1997-1999 (Table 3). There were 38
cultivars susceptible to SCN and 56 cultivars resistant to SCN race
3. Allele 2 (R) was found in 32 of 94 cultivars tested. There were
very few susceptible genotypes with allele 2 (3 of 32) and the
majority of genotypes with allele 2 (29 of 32) were resistant to
SCN. In contrast, allele 1 (S) was found in 62 cultivars but
frequently in both resistant cultivars (27 of 56) and susceptible
cultivars (35 of 38).
Example 8
Selection of SCN/SDS Resistant Seeds
[0303] G.max L. seeds used to start cultures should be less than
six months old and have been stored in darkness at 4.degree. C.
Then, the seeds are cultured as folllows:
[0304] 1. Surface disinfect with 70% (v/v) ethanol for 2 min then
20% (v/v) bleach for 20 min. Rinse three times in sterile MS
media.
[0305] 2. Germinate the seed on MS media containing 10 g/l agar, 30
g/l sucrose but no PGRs for 3 days at 27.degree. C.
[0306] 3. Axenically remove the testa, remove the cotyledonary
notes, cut the cotyledons transversely in half and use the distal
cotyledonary halves to establish callus cultures.
[0307] To initiate callus growth, cotyledonary halves are placed on
MS medium with 30 g/l sucrose, 5 mM kinetin, 100 mg/l myoinositol,
0.5 mg/mL thiamine.HCI pH 5.7 at 27.degree. C. unless noted below.
The medium contains 5 mM indolebutyric acid as auxin. Place
cotyledonary halves in tubes containing 10 mL solidified media.
Incubate for 28 days.
[0308] To assay callus growth, pieces of callus each approximately
25 mg should be added to sterile tubes containing 10 mL media with
varying concentrations of H. glycines, F.solani or extracts
thereof. After 28 days at 28.degree. C. the explants are evaluated
for growth and growing sectors subcultured.
[0309] Cell suspensions are derived by placing 2 g of a macerated
callus in 40 mL of MS medium. The flask, a 125 mL Erlenmeyer flask,
should be capped with a foam plug. Subcultures should be made every
14 days into fresh media by allowing the cells to settle, removing
the old media by aspiration, adding twice the volume of fresh media
and splitting into two flasks.
[0310] Soybean tissue capable of regeneration to whole plants are
grown in the presence of H. glycines, F.solani or extracts thereof.
Cell lines representing mutants capable of continued growth are
regenerated and the heritability of SCN or SDS resistance
determined in these plants or their seed or tissue derived
progeny.
REFERENCES
[0311] The publications and other materials listed below and/or set
forth in the text above to illuminate the background of the
invention, and in particular cases, to provide additional details
respecting the practice, are incorporated in their entirety herein
by reference. Materials used herein include but are not limited to
the following listed references.
[0312] Adelman et al. (1983) DNA 2:183-193.
[0313] Alam and Cook (1990) Anal Biochem 188:245-254.
[0314] Altschul et al. (1990) J Mol Biol 215:403-410.
[0315] Arondel et al. (1992) Science 258:1353-1355.
[0316] Ausubel et al. (1992) Current Protocols in Molecular
Biology, John Wylie and Sons, Inc., New York.
[0317] Bartlett et al. (1982) in Methods in Chloroplast Molecular
Biology, Edelmann et al. (Eds.), pp 1081-1091, Elsevier.
[0318] Barton (1998) Acta Crystallogr D Biol Crystallogr
54:1139-1146.
[0319] Batzer et al. (1991) Nucleic Acid Res 19:3619-3623.
[0320] Bell-Johnson et al. (1998) Soybean Genet Newslett
25:115-118.
[0321] Bernard et al. (1988) USDA Tech Bull 1796.
[0322] Bevan (1984) Nucl Acids Res 12:8711-8721.
[0323] Bevan et al. (1983) Nature 304:184-187.
[0324] Binet et al. (1991) Plant Science 79: 87-94.
[0325] Blochlinger & Diggelmann (1984) Mol Cell Biol
4:2929-2931.
[0326] Bourouis et al., (1983) EMBO J2(7):1099-1104.
[0327] Bodanszky, et al. (1976) Peptide Synthesis, John Wiley and
Sons, Second Edition, New York.
[0328] Brookes (1999) Gene 234(2):177-186.
[0329] Brown et al. (1987) Principles and Practice of Nematode
Control in Crops, pp179-232, Academic Press, Orlando Fla.
[0330] Callis et al. (1987) Genes Develop 1 :1183-1200.
[0331] Chang et al. (1996) Crop Sci 36:965-971.
[0332] Chang et al. (1997) Crop Science 37(3):965-971.
[0333] Chase et al. (1997) Theor Appl Genet 94:724-730.
[0334] Chibbar et al. (1993) Plant Cell Rep 12:506-509.
[0335] Christou et al. (1991) Biotechnology 9:957-962.
[0336] Comai et al. (1988) J Biol Chem 263:15104-15109.
[0337] Concibido (1996) Theor Appl Genet 93:234-241.
[0338] Concibido et al. (1997) Crop Sci 37:258-264.
[0339] Conner et al. (1983) Proc Natl Acad Sci USA 80:278-282.
[0340] Cregan et al. (1999a) Crop Sci 39:1464-1490.
[0341] Cregan et al. (1999b) Theor Appl Genet 99:811-818.
[0342] Cregan et al. (1999c) Theor Appl Genet 99:918-928.
[0343] Cubitt et al. (1995) Trends Biochem Sci 20:448-455.
[0344] Datta et al. (1990) Biotechnology 8:736-740.
[0345] EP 0 292 435
[0346] EP 0 332 104
[0347] EP 0 332 581
[0348] EP 0 342 296
[0349] EP 0 392 225
[0350] EP 0 452 269
[0351] Fehr (1987) in Soybeans: Improvement Production and Uses 2nd
Ed., J. R. Wilcox (ed.), American Society of Agronomy, Madison,
Wis.
[0352] Firek et al. (1993) Plant Molec Biol 22:129-142.
[0353] Fromm et al. (1990) Biotechnology 8:833-839.
[0354] Gallie et al. (1987) Nucl Acids Res 15:8693-8711.
[0355] Glover, ed. (1985) DNA Cloning: A Practical Approach, MRL
Press, Ltd., Oxford, United Kingdom.
[0356] Gomez A. K. and A. A. Gomez (1984) Statistical Procedures
For Agricultural Research. 2nd ed. John Wiley & Sons New
York
[0357] Gordon-Kamm et al. (1990) Plant Cell 2:603-618.
[0358] Gritz et al. (1983) Gene 25:179-188.
[0359] Harlow and Lane (1988) Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[0360] Hartwig and Epps (1973) Crop Science 13:287.
[0361] Henikoff et al. (2000) Electrophoresis 21(9):1700-1706.
[0362] Henikoff and Henikoff (1989) Proc Natl Acad Sci USA
89:10915.
[0363] Henikoff and Henikoff (2000) Adv Protein Chem 54:73-97.
[0364] Hnetkovsky et al. (1996) Crop Science 36(2):393-400.
[0365] Hofgen & Willmitzer (1988) Nucl Acids Res 16:9877.
[0366] Huang et al. (2000) Pac Symp Biocomput 230-241.
[0367] Hudspeth & Grula (1989) Plant Molec Biol 12:579-589.
[0368] Hutchens and Yip (1993) Rapid Commun Mass Spectrom 7:
576-580.
[0369] Kalinina et al. (1997) Nucl Acids Res 25:1999-2004.
[0370] Kanazin et al. (1996) Proc Natl Acad Sci USA
93(21):11746-11750.
[0371] Karlin and Altschul (1993) Proc Natl Acad Sci USA
90:5873-87.
[0372] Keim et al. (1997) Crop Science 37:537-543.
[0373] Kestila et al. (1998) Mol Cell 1(4):575-582.
[0374] Klein et al. (1987) Nature 327:70-73.
[0375] Koduri and Poola (2001) Steroids 66(1):17-23.
[0376] Koziel et al. (1993) Biotechnology 11:194-200.
[0377] Kyte et al. (1982) J Mol Biol 157:105.
[0378] Landers & Botstein (1989) Genetics 121:185-199.
[0379] Landgren et al. (1988) Science 241:1007.
[0380] Landgren et al. (1988) Science 242:229-237.
[0381] Landegren et al. (1998) Genome Res 8:769-776.
[0382] Lark et al. (1993) Theor Appl Genet 86:901-906.
[0383] Li and Herskowitz (1993) Science 262:1870-1874.
[0384] Liedberg et al. (1983) Sensors Actuators 4:299-304.
[0385] Livak et al. (1995) PCR Meth and Applic 4:357-362.
[0386] Livak et al. (1995) Nat Genet 9:341-342.
[0387] Logemann et al. (1989) Plant Cell 1:151-158.
[0388] Luo et al. (1999) Plant Disease 83:1155-1159.
[0389] Madge et al. (1972) Phys Rev Lett 29:705-708.
[0390] Mahalingam et al. (1995) Breed Sci 45:435-445.
[0391] Mahalingham et al. (1996) Genome 39:986-998
[0392] Maiti et al. (1997) Proc Natl Acad Sci USA,
94:11753-11757.
[0393] Malmquist (1993) Nature 361:186-187.
[0394] Martin et al. (1993) Science 262:1432-1436.
[0395] Mathews et al. (1998) Theor Appl Genet 97:1047-1052.
[0396] Matthews et al. (1991) Soybean Genetics Newsletter.
[0397] McBride et al. (1990) Plant Molecular Biology
14:266-276.
[0398] McElroy et al. (1990) Plant Cell 2:163-171.
[0399] McElroy et al. (1991) Mol Gen Genet 231:150-160.
[0400] Meksem et al. (1995) Mol Gen Genet 249:74-81.
[0401] Meksem et al. (1999) Theor Appl Genet 99:1131-1142.
[0402] Meksem et al. (2000) Theor Appl Genet 101:747-755.
[0403] Messing & Vierra (1982) Gene 19:259-268.
[0404] Myers & Anand (1991), Euphytica 55:197-201.
[0405] Nasarabadi et al. (1999) BioTechniques 27:1116-1117.
[0406] Needleman & Wunsch (1970) J Mol Biol 48:443-453.
[0407] Njiti et al. (1996) Crop Science 36:1165-1170.
[0408] Ochman et al. (1990) in PCR protocols: a Guide to Methods
and Applications, Innis et al. (eds.), pp. 219-227, Academic Press,
San Diego, Calif.
[0409] Ohtsuka et al. (1985) J Biol Chem 260:2605-2608.
[0410] Orita et al. (1989) Proc Natl Acad Sci USA
86(8):2766-2770.
[0411] Paszkowski et al. (1984) EMBO J 3:2717-2722.
[0412] Paterson et al. (1990) Genetics 124:735-742.
[0413] Pearson & Lipman (1988) Proc Natl Acad Sci USA
85:24442448.
[0414] Potrykus et al. (1985) Mol Gen Genet 199:169-177.
[0415] Prabhu et al. (1999) Crop Science 39(4):982-987.
[0416] Price (1993) Blood Rev 7:127-134.
[0417] Rao-Arrelli et al. (1988) Crop Science 28:650-652.
[0418] Rao-Arrelli et al. (1992) Crop Science 32:862-864.
[0419] Regan et al. (2000) Anal Biochem 286(2):265-276.
[0420] Reich et al. (1986) Biotechnology 4:1001-1004.
[0421] Riggs and Schmidt (1988) J Nematol 20:392-395.
[0422] Rogers et al. (1989) Proc Natl Acad Sci USA
82:6512-6516.
[0423] Rohrmeier & Lehle (1993) Plant Molec Biol
22:783-792.
[0424] Rommens et al. (1989) Science 245:1059-1065.
[0425] Rose & Botstein (1983) Meth Enzymol 101:167-180.
[0426] Rossolini et al. (1994) Mol Cell Probes 8:91-98.
[0427] Rothstein et al. (1987) Gene 53:153-161.
[0428] Saiki et al. (1985) Bio/Technology 3:1008-1012.
[0429] Sambrook et al. eds. (1989) Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York, N.Y.
[0430] Saqi et al. (1999) Bioinformatics 15:521-522.
[0431] Sauer (1998) Methods 14(4):381-392.
[0432] Schmidhauser & Helinski (1985) J Bacteriol
164:446-455.
[0433] Schocher et al. (1986) Biotechnology 4:1093-1096.
[0434] Shimamoto et al. (1989) Nature 338:274-277.
[0435] Shinshi et al. (1990) Plant Molec Biol 14:357-368.
[0436] Shoemaker et al. (1995) Crop Science 35:436-446.
[0437] Silhavy et al. (1984) Experiments with Gene Fusions, Cold
Spring Harbor Laboratory, Cold Spring Harbor, New York, N.Y.
[0438] Singh et al. (1989) Biotechniques 7:252-261.
[0439] Skuzeski et al. (1990) Plant Molec Biol 15:65-79.
[0440] Smith & Waterman (1981) Adv Appl Math 2:482.
[0441] Smith & Camper (1973) Crop Science 13:459.
[0442] Spencer et al. (1990) Theor Appl Genet 79:625-631.
[0443] Staskawicz (1995) Science 268:661-667.
[0444] Stoneking et al. (1991) Am J Hum Genet 48(2):370-82.
[0445] Thompson et al. (1987) EMBO J 6:2519-2523.
[0446] Tijssen (1993) in Laboratory Techniques in Biochemistry and
Molecular Bioloqy-Hybridization with Nucleic Acid Probes, part 1
chapter 2, Elsevier, New York, N.Y.
[0447] Trask (1991) Trends Genet 7:149-154.
[0448] Uknes et al. (1992) The Plant Cell 4:645-656.
[0449] Uknes et al. (1993) The Plant Cell 5:159-169.
[0450] Unger et al. (1989) Plant Molec Biol 13:411-418.
[0451] U.S. Pat. No. 4,196,265
[0452] U.S. Pat. No. 4,554,101
[0453] U.S. Pat. No. 4,940,935
[0454] U.S. Pat. No. 4,945,050
[0455] U.S. Pat. No. 5,036,006
[0456] U.S. Pat. No. 5,100,792
[0457] U.S. Pat. No. 5,188,642
[0458] U.S. Pat. No. 5,260,203
[0459] U.S. Pat. No. 5,523,311
[0460] U.S. Pat. No. 5,591,616
[0461] U.S. Pat. No. 5,614,395
[0462] U.S. Pat. No. 5,629,158
[0463] U.S. Pat. No. 5,639,949
[0464] U.S. Pat. No. 5,834,228
[0465] U.S. Pat. No. 5,872,011
[0466] U.S. Pat. No. 5,948,953
[0467] U.S. Pat. No. 5,952,546
[0468] U.S. Pat. No. 5,958,624
[0469] U.S. Pat. No. 5,986,173
[0470] U.S. Pat. No. 5,994,526
[0471] U.S. Pat. No. 5,994,527
[0472] U.S. Pat. No. 6,096,555
[0473] U.S. Pat. No. 6,162,967
[0474] U.S. Pat. No. RE36,449
[0475] van den Broeck et al. (1985) Nature 313:358-363.
[0476] Vasil et al. (1992) Biotechnology 10:667-674.
[0477] Vasil et al. (1993) Biotechnology 11:1553-1558.
[0478] Vidal et al. (1996) Proc Natl Acad Sci USA
93(19):10315-10320.
[0479] Vos et al. (1995) Nucleic Acids Research 23:4407-4414.
[0480] Wang et al. (1998) Science 280(5366):1077-82.
[0481] Warner et al. (1993) Plant J 3:191-201.
[0482] Webb et al.(1995) Theor Appl Genet 91:574-581.
[0483] Weeks et al. (1993) Plant Physiol 102:1077-1084.
[0484] Weiseman et al. (1992) Theor Appl Genet 85:136-138
[0485] White et al. (1990) Nucl Acids Res 18:1062.
[0486] WO 93/07278
[0487] WO 93/21335
[0488] WO 94/00977
[0489] WO 97/47763
[0490] Worrall et al. (1998) Anal Biochem 70:750-756.
[0491] Wrather et al. (1995) Plant Disease 79:1076-1079.
[0492] Xu et al. (1993) Plant Molec Biol 22:573-588.
[0493] Yuan et al. (1999) Hum Mutat 14(5):440-446.
[0494] Zhang et al. (1988) Plant Cell Rep 7:379-384.
[0495] Zhang et al. (1994) Mol Gen Genet 244:613-621.
[0496] Zhu et al. (1996) Mol Gen Genet 252:483-488.
[0497] Zimmer et al. (1993) Peptides pp. 393B394, ESCOM Science
Publishers, B. V.
[0498] Zobrist et al. (2000) Soybean Genet Newslett 27:10-15.
[0499] It will be understood that various details of the invention
can be changed without departing from the scope of the invention.
Furthermore, the foregoing description is for the purpose of
illustration only, and not for the purpose of limitation--the
invention being defined by the claims.
Sequence CWU 1
1
122 1 87 DNA soybean 1 gaattcatgg tttctcttat gacattgttg ccaagtaata
ctactatata aattcagatt 60 tgggtttctg ataaccgtgg tcgttaa 87 2 92 DNA
soybean 2 gaattcatgg tttctcttat cttatgacat tgttgccaag taatactact
atataaattc 60 agatttgggt ttcagataac cgtggtcgtt aa 92 3 113 DNA
soybean 3 gaattcctaa tatacgagtg aatattattg taatgcttgt aaaaaaacat
gataaaatgc 60 aaaaatttgg ggtgaatttt tacgacatta gtgaaaaaaa
catatccctt taa 113 4 135 DNA soybean 4 ttaaagggat atgttttttt
cactaatgct gtaaaaattc acccagattt ttgcattttc 60 tttgaaaaaa
tgtactagat atatcatgtt tttttacaag cattacaata atattcactc 120
gtatattagg aattc 135 5 116 DNA soybean 5 gaattccggt tatctcagac
aacttttgtt tggtttggtt atagtaaaga cacgattatc 60 caggctttga
gaggcataga aataattttt ttatataaaa aaaaaagtct ctttaa 116 6 113 DNA
soybean 6 gaatttcggt tatctcagac aacttttgtt tggtttggtt atagtaaaga
cacgattatc 60 caggctttga gaggcataga aataattttt ttatataaaa
aaaagtctct tta 113 7 409 DNA soybean - Forrest 7 gagtaaaacc
ttgcgtgtga tcggtattac agtacgcagg gccaatcaac taaaatatct 60
gcaaacgata atataattat aagaaaaaga cacactttga gggcattttt gacttgagag
120 aactcaggta tcaatctaaa agcaacgctg ttcaccttga gctgaaacac
ctggaggaga 180 aagcaaagca aaccaaacgc gagagagaaa taaagaacgg
aaacagagag agagagagga 240 aggaccttgt tcaaagcaac ggggacaact
ttagagccct ggcgcgcgtg ggggtcaata 300 agcgtaacct ggctgaggag
agcctcggcg tcgtccttgc tgaagcagaa gaggaagagc 360 acgagaccaa
gagaaactcc tcggaagcaa cgggaattgg tacgcagtc 409 8 417 DNA soybean 8
gagtaaaacc ttgcgtgtga tcggtattac agtacgcagg gccatggttt gagccaatca
60 actaaaatat ttgcaaacga taatataatt ataagaaaaa gactcacttt
gagggcattt 120 ttgacttgag agaactcagg tatcaatcta aaagcaacgc
tgttcacctt gagctgaaac 180 acctggagga gaaagcaaag caaaccaaac
gcgagagaga aataaagaac ggaaacagag 240 agagaggaag gaccttgttc
aaagcaacgg ggacaacttt agagccctgg cgcgcgtggg 300 ggtcaataag
cgtaacctgg ctgaggagag cctcggcgcc gtccttgctg aagcagaaga 360
ggaagagccc gagaccaaga gaaactcctc ggaagcaacg ggaattggta cgcagtc 417
9 165 DNA soybean 9 gagtaaatga aaatcgatca aaatcaaata atatatgctt
tttttagttg tgttcaagta 60 actttttttt attgaaaaaa tcgacccaag
ttgaaacaca tgtttgagaa ttgttttgtg 120 catccaacgt ttttcttgta
caatcagctg tgagagggga attgg 165 10 164 DNA soybean 10 gagtaaatga
aaatcgatca aaatcaaata atatatgctt tttttagttg ggttcaagta 60
ctttttttta ttgaaaaaat cgacccaagt tgaaacacat gtttgagaat tgttttgtgc
120 atccaacgtt tttcttgtac aatcagctgt gagaggggaa ttgg 164 11 114 DNA
soybean 11 gaattcccag ctagatttgt atcaaacatg tattgtccac aaaatgttca
agcatcttag 60 ggaactgcta ttcttacttc taaatttttt attgacatcc
aaagtgtgct ttaa 114 12 114 DNA soybean 12 gaattcccag ccagatttgt
atcaaacatg tattgtccac aaaatgttca agcatcttag 60 ggaactgcta
ttcttacttc taaatttttt attgacatcc aaagtgtgct ttaa 114 13 3106 DNA
soybean misc_feature (1)..(3106) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 13 aatgggagga gtgggaaaga cagtggctat
ggagcttgtt ccggaggttg ggttggaatc 60 aagtgtgctc agggacaggt
tattgtgatc cagcttcctt ggaagggttt gaggggtcga 120 atcaccgaca
aaattggcca acttcaaggc ctcaggaagc ttagtcttca tgataaccaa 180
attggtggtt caatcccttc aactttggga cttcttccca accttagagg ggttcagtta
240 ttcaacaata ggcttacagg ttccatacct ctttctttag gtttctgcct
ttgcttcaag 300 tctcttgacc tcagcaacaa cttgctcaca ggagcaatcc
cttatagtct tgctaattcc 360 actaagcttt attggcttaa cttgagtttc
aactccttct ctggtccttt accagctagc 420 ctaactcact cattttctct
cacttttctt tctcttcaaa ataacaatct ttctggctcc 480 cttcctaact
cttggggtgg gaattccaag aatggcttct ttaggcttca aaatttgatc 540
ctagatcata actttttcac tggtgacgtt cctgcttctt tgggtagctt aagagagctc
600 aatgagattt cccttagtca taataagttt agtggagcta taccaaatga
aataggaacc 660 ctttctaggc ttaagacact tgacatttct aataatgcct
tgaatgggaa cttgcctgct 720 accctctcta atttatcctc acttacactg
ctgaatgcag agaacaacct ccttgacaat 780 caaatccctc aaagtttagg
tagattgcgt aatctttctg ttctgatttt gagtagaaac 840 caatttagtg
gacatattcc ttcaagcatt gcaaacattt cctcgcttag gcagcttgat 900
ttgtcactga ataatttcag tggagaaatt ccagtctcct ttgacagtca gcgcagtcta
960 aatctcttca atgtttccta caatagcctc tcaggttctg tcccccctct
gcttgccaag 1020 aaatttaact caagctcatt tgtgggaaat attcaactat
gtgggtacag cccttcaacc 1080 ccatgtcttt cccaagctcc atcacaagga
gtcattgccc cacctcctga agtgtcaaaa 1140 catcaccatc ataggaagct
aagcaccaaa gacataattc tcatagtagc aggagttctc 1200 ctcgtagtcc
tgattatact ttgttgtgtc ctgcttttct gcctgatcag aaagagatca 1260
acatctaggc cgggaacggc caagccaccc gagggtagag cggccactat gaggacagaa
1320 aaaggagtcc ctccagttgc tggtggtgat gttgaagcag gtggggaggc
tggagggaaa 1380 ctagtccatt ttgatggacc aatggctttt acagctgatg
atctcttgtg tgcaacagct 1440 gagatcatgg gaaagagcac ctatggaact
gtttataagg ctattttgga ggatggaagt 1500 caagttgcag taaagagatt
gagggaaaag atcactaaag gtcatagaga atttgaatca 1560 gaagtcagtg
ttctaggaaa aattagacac cccaatgttt tggctctgag ggcctattac 1620
ttgggaccca aaggggaaaa gcttctgggt tttgatacat gtctaaagga agtcttgctt
1680 ctttcctaca tggaaggttc gtgtgctggt tctttcatta aagtgttgtg
tgtgctggtc 1740 tttaattata atttggagtt ttaccttagt aatctgtata
attctaatcg gagaacagta 1800 caaacaaaaa cacctaagga acaacacctt
anctttaata taccatatca ataaagtgaa 1860 atattttctt ggtcatcttg
atgcaggggg aactgaacat tcattattgg ccacaagatt 1920 aaaatagccc
aagccttggc ccgggcttgt ttgccttcat tcccaggaga acatcataca 1980
tgggacctcn catccagcaa tgtgtggctt gatgaaaaac aaatgctaaa attcagattt
2040 tggtcttttt cgggttgatg tcaactgctg ctaattccaa cgtgatagct
acagctggag 2100 cattggatac cgggcacctg agctctcaaa gctcaagaaa
gcaaacacta aaactgatat 2160 ctacagtctt ggtgttatct tgttagaact
cctaacgagg aaatcacctg gggtgtctat 2220 gaatggacta gatttgcctc
agtgggttgc ctcagttgtc aaagaggagt ggacaaatga 2280 ggtttttgat
gcagacttga tgagagatgc atccacagtt ggcgacgagt tgctaaacac 2340
gttgaagctc gctttgcact gtgttgatcc ttctccatca gcacgaccag aagttcatca
2400 agttctccag cagctgaaga gattagacca gagagatcag tcacagccag
tcccggggac 2460 gatatcgtat agcacaaatt ttgcattgat ttttttgtgc
caaatgtagt aggcctacta 2520 tatatatgtt ctatgattct ttcattctta
tattattttt gcctgtttga atgcttgaat 2580 ttgtacatac tcatactaca
ataaggtgta gttctggtta attttacctc tacctcaaag 2640 ctggggtgta
attctgtttc ctccaaggca cataatagtt gaaaatagtt ctcaggagca 2700
ttcattgttt attctgcaag attctctttc acggctgcta tcttctatgc atgccctgcc
2760 cataaatgca ttatgaagaa ttgtaacggc tgtgtttttg gacttcttca
aaaagtttat 2820 gttattgcca ggtgtatata tcaacatgtt ttaaagattt
tcaaacaatc aggttttaga 2880 tgtgggtttg catgcatgag attggactag
tgcgcttgat gtagtataaa atataaattg 2940 tccaatcaag caccctctac
atgtccaaat aatgggcctt atgaaactta attttttaat 3000 tacaaactac
agtaatcttt ttgaataaag atttacaaat tacaacngac atgtgaagcn 3060
gcatctttna ttgncaatct ttcaagttac tctattattt tctgcn 3106 14 830 PRT
soybean misc_feature (1)..(830) Xaa is any amino acid 14 Asn Gly
Arg Ser Gly Lys Asp Ser Gly Tyr Gly Ala Cys Ser Gly Gly 1 5 10 15
Trp Val Gly Ile Lys Cys Ala Gln Gly Gln Val Ile Val Ile Gln Leu 20
25 30 Pro Trp Lys Gly Leu Arg Gly Arg Ile Thr Asp Lys Ile Gly Gln
Leu 35 40 45 Gln Gly Leu Arg Lys Leu Ser Leu His Asp Asn Gln Ile
Gly Gly Ser 50 55 60 Ile Pro Ser Thr Leu Gly Leu Leu Pro Asn Leu
Arg Gly Val Gln Leu 65 70 75 80 Phe Asn Asn Arg Leu Thr Gly Ser Ile
Pro Leu Ser Leu Gly Phe Cys 85 90 95 Pro Leu Leu Gln Ser Leu Asp
Leu Ser Asn Asn Leu Leu Thr Gly Ala 100 105 110 Ile Pro Tyr Ser Leu
Ala Asn Ser Thr Lys Leu Tyr Trp Leu Asn Leu 115 120 125 Ser Phe Asn
Ser Phe Ser Gly Pro Leu Pro Ala Ser Leu Thr His Ser 130 135 140 Phe
Ser Leu Thr Phe Leu Ser Leu Gln Asn Asn Asn Leu Ser Gly Ser 145 150
155 160 Leu Pro Asn Ser Trp Gly Gly Asn Ser Lys Asn Gly Phe Phe Arg
Leu 165 170 175 Gln Asn Leu Ile Leu Asp His Asn Phe Phe Thr Gly Asp
Val Pro Ala 180 185 190 Ser Leu Gly Ser Leu Arg Glu Leu Asn Glu Ile
Ser Leu Ser His Asn 195 200 205 Lys Phe Ser Gly Ala Ile Pro Asn Glu
Ile Gly Thr Leu Ser Arg Leu 210 215 220 Lys Thr Leu Asp Ile Ser Asn
Asn Ala Leu Asn Gly Asn Leu Pro Ala 225 230 235 240 Thr Leu Ser Asn
Leu Ser Ser Leu Thr Leu Leu Asn Ala Glu Asn Asn 245 250 255 Leu Leu
Asp Asn Gln Ile Pro Gln Ser Leu Gly Arg Leu Arg Asn Leu 260 265 270
Ser Val Leu Ile Leu Ser Arg Asn Gln Phe Ser Gly His Ile Pro Ser 275
280 285 Ser Ile Ala Asn Ile Ser Ser Leu Arg Gln Leu Asp Leu Ser Leu
Asn 290 295 300 Asn Phe Ser Gly Glu Ile Pro Val Ser Phe Asp Ser Gln
Arg Ser Leu 305 310 315 320 Asn Leu Ser Asn Val Ser Tyr Asn Ser Leu
Ser Gly Ser Val Pro Pro 325 330 335 Leu Leu Ala Lys Lys Phe Asn Ser
Ser Ser Phe Val Gly Asn Ile Gln 340 345 350 Leu Cys Gly Tyr Ser Pro
Ser Thr Pro Cys Leu Ser Gln Ala Pro Ser 355 360 365 Gln Gly Val Ile
Ala Pro Pro Pro Glu Val Ser Lys His His His His 370 375 380 Arg Lys
Leu Ser Thr Lys Asp Ile Ile Leu Ile Val Ala Gly Val Leu 385 390 395
400 Leu Val Val Leu Ile Ile Leu Cys Cys Val Leu Leu Phe Cys Leu Ile
405 410 415 Arg Lys Arg Ser Thr Ser Lys Ala Gly Asn Gly Gln Ala Thr
Glu Gly 420 425 430 Arg Ala Ala Thr Met Arg Thr Glu Lys Gly Val Pro
Pro Val Ala Gly 435 440 445 Gly Asp Val Glu Ala Gly Gly Glu Ala Gly
Gly Lys Leu Val His Phe 450 455 460 Asp Gly Pro Met Ala Phe Thr Ala
Asp Asp Leu Leu Cys Ala Thr Ala 465 470 475 480 Glu Ile Met Gly Lys
Ser Thr Tyr Gly Thr Val Tyr Lys Ala Ile Leu 485 490 495 Glu Asp Gly
Ser Gln Val Ala Val Lys Arg Leu Arg Glu Lys Ile Thr 500 505 510 Lys
Gly His Arg Glu Phe Glu Ser Glu Val Ser Val Leu Gly Lys Ile 515 520
525 Arg His Pro Asn Gly Leu Ala Leu Arg Ala Tyr Tyr Leu Gly Pro Lys
530 535 540 Gly Glu Lys Leu Leu Val Phe Asp Tyr Met Ser Lys Gly Gly
Leu Leu 545 550 555 560 Leu Phe Tyr Met Glu Gly Ser Cys Ala Gly Ser
Phe Ile Lys Val Leu 565 570 575 Cys Val Leu Val Phe Asn Tyr Asn Leu
Glu Phe Tyr Leu Ser Asn Leu 580 585 590 Tyr Asn Ser Asn Arg Arg Thr
Val Gln Thr Lys Thr Pro Lys Glu Gln 595 600 605 His Leu Xaa Phe Asn
Ile Pro Tyr Gln Xaa Ser Glu Ile Phe Ser Trp 610 615 620 Ser Ser Xaa
Cys Arg Gly Asn Xaa Thr Phe Ile Ile Gly His Lys Met 625 630 635 640
Lys Ile Xaa Gln Asp Leu Ala Val Ala Cys Ser Pro Ser Phe Pro Glu 645
650 655 Thr Ser Tyr Met Asp Leu Xaa Ser Ser Asn Val Cys Xaa Xaa Asn
Xaa 660 665 670 Met Leu Lys Leu Gln Phe Trp Ser Phe Ser Val Asp Val
Asn Cys Cys 675 680 685 Xaa Phe Gln Arg Asp Ser Tyr Ser Trp Ser Ile
Gly Ile Pro Gly Thr 690 695 700 Xaa Ala Leu Lys Ala Gln Glu Ser Lys
His Xaa Asn Xaa Tyr Leu Gln 705 710 715 720 Ser Trp Cys Tyr Leu Val
Arg Thr Pro Asn Glu Glu Ile Thr Trp Gly 725 730 735 Val Tyr Glu Trp
Thr Arg Phe Ala Ser Val Gly Cys Leu Ser Cys Gln 740 745 750 Arg Gly
Val Asp Lys Xaa Gly Phe Xaa Cys Arg Leu Asp Glu Arg Cys 755 760 765
Ile His Ser Trp Arg Arg Val Ala Lys His Val Glu Ala Arg Phe Ala 770
775 780 Leu Cys Xaa Ser Phe Ser Ile Ser Thr Thr Arg Ser Ser Ser Ser
Ser 785 790 795 800 Pro Ala Ala Gly Arg Asp Xaa Thr Arg Glu Ile Ser
His Ser Gln Ser 805 810 815 His Leu Pro Gly Arg Pro Leu Glu Pro Tyr
Ser Glu Ser Tyr 820 825 830 15 726 DNA soybean promoter_region
(1)..(726) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 15 gaatacgaat tccattttcg cgacagtagc tcagaatagg ttcatactcc
tgccatcttt 60 gaggcggnca atgcaacgtg taagacttca aggtgtctcc
atctatcctg ccatgaaagt 120 caagtttcag gacaagtaat gcagaattat
ggaaaagcaa tctgactaag acaaaagagc 180 ttcagagatt aacagaaaat
agtgagccag aaaaaagatt gcgagacaga aattggtcgc 240 caacaaaaag
ttgtctcttt tataattttt aattgaaatt ttcttaattt agctaacatg 300
acttcctacg gccacaattg cgtttgcaga cacttaaaaa acttgatgtt gcagcaaaaa
360 tcacgtttta tttattattg atgtcaatta tttaacagtt ttatgttagg
tttaataaca 420 gtaggttgat gcaagaggct aaacattaat cagaaattga
aaggcagggn tattacttct 480 tatccatata ctgattgagc gggtcctgaa
gaatagcggg aaaaacttca agcgccagag 540 acaatagttt tttcttttca
aacagcgcct atgcaaattc ttccaatctc aagcttcaat 600 tcctatcgtc
tcgaaccgga cttgntctgn ttnacctaaa tccccactcg gcattnatna 660
acttntcccc actttccttt ntctttccta tcgccaccgg tcttctatnc ccgcccgtcg
720 naatct 726 16 649 DNA soybean partial_cDNA (1)..(648) n is an
undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 16 aggagtggga
aagacagtgg ctatggagct tgttccggag gttgggttgg aatcaagtgt 60
gctcagggac aggttattgt gatccagctt ccttggaagg gtttgagggg tcgaatcacc
120 gacaaaattg gccaacttca aggcctcagg aagcttagtc ttcatgataa
ccaaattggt 180 ggttcaatcc cttcaacttt gggacttctt cccaacctta
gaggggttca gttattcaac 240 aataggctta caggttccat acctctttct
ttaggtttct gccctttgct tcagtctctt 300 gacctcagca acaacttgct
cacaggagca atcccttata gtcttgctaa ttccactaag 360 ctttattggc
ttaacttgag tttcaactcc ttctctggtc ctttaccagc tagcctaact 420
cactcatttt ctctcacttt tctttctctt caaaataaca atctttctgg ctcccttcct
480 aactcttggg gtgggaattc caagaatggc ttctttaggc ttcaaaattt
gatcctagat 540 cataactttt tcactggtga cgttcctgct tctttgggta
gcttaagaga gctcaatgag 600 aattccctta agcataataa ggttagggga
gctatcccaa atgaaatnt 649 17 558 DNA soybean partial_cDNA (1)..(558)
n is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 17
aggantgggn aagacantgg ctattttagc tttggtcccg gagggtgggt tggaatcaan
60 tgngctcaag gacaaggtat tgtgaaccaa cttnctttga aaggnttgag
ggggcgaaac 120 acccacaaaa atgggcaact tnaaagnctc angaagctta
atcttnatga aaaccaaaat 180 ggggggtcaa anccntcaac ttttggactt
ctttccaacc ttagaggggg tcaattattc 240 aacaataggn ttacagggtc
catacctctt tctttaaggt tctgcccttt gnttcagnct 300 cttgacctca
acaacaactt gctnacagga agcaatccct tatagtcttg ctaattccac 360
taagctttat tggcttaact ttgagnttca actnctttct ntgggncttt accaactagn
420 ctaactcact cattttctct cacttttttt tntntttaaa aaaacaaaca
tttntngntt 480 cccttctnac tcntgggggg gggaaaaaca annaaaggnt
tctttaggnt tcaaaaaatg 540 atcctanaac ataacttt 558 18 794 DNA
soybean partial_cds (1)..(794) n is an undetermined nucleotide
(dATP, dCTP, dGTP,or dTTP) 18 aatgggagga gtgggaaaga cagtggctat
ggagcttgtt ccggaggttg ggttggaatc 60 aagtgtgctc agggacaggt
tattgtgatc cagcttcctt ggaagggttt gaggggtcga 120 atcaccgaca
aaattggcca acttcaaggc ctcaggaagc ttagtcttca tgataaccaa 180
attggtggtt caatcccttc aactttggga cttcttccca accttagagg ggttcagtta
240 ttcaacaata ggcttacagg ttccatacct ctttctttag gtttctgccc
tttgcttcag 300 tctcttgacc tcagcaacaa cttgctcaca ggagcaatcc
cttatagtct tgctaattcc 360 actaagcttt attggcttaa cttgagtttc
aactccttct ctggccttta ccagctagcc 420 taactcactc attttctctc
acttttcttt ctcttcaaaa taacaatctt tctggctccc 480 ttcctaactc
ttggggnggg aatttcaaga atggcttctt taggcttcaa aatttgatcc 540
tagatcataa ctttttnctg gtgacgttcc tgcttctttg ggtagcttaa gagagcccna
600 tgagaattcc cttagtcatn ataagnttag tggagctttc caantgaaat
anggacccct 660 tntaggctta aacactngnc attctaataa tgccttgaat
gggaacctcc ctgttccctc 720 tttanttatc tcccttncnc ngctggangc
cagaccaccn cntgncaatn aatccctcaa 780 agttaggtac atcg 794 19 781 DNA
soybean partial_cds (1)..(781) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 19 ggaggagtgg gaaagacagt ggctatggag
cttgttccgg aggttgggtt ggaatcaagt 60 gtgctcaggg acaggttatt
gtgatccagc ttccttggaa ggggtttgag gggtcgaatc 120 accgacaaaa
ttggccaact tcaaggcctc aggaagctta gtcttcatga taaccaaatt 180
ggtggtcaat cccttcaact ttgggacttc ttccaacctt agaggggttc aagttattca
240 acaataggct tacaggttcc atacctcttt ctttaggttt ctgccctttg
cttcaagtct 300 cttgacctca gcaacaactt gctcacagga gcaatccctt
atagtcttgc taattccact 360 aagctttatt ggcttaactt gagtttcaac
tncttctctg gncctttacc agctagccta 420 actcactcat tttctctcac
ttttctttct cttcaaaaaa acaaactttc tgggtccttt 480 ctactcttgg
ggggggaatt ccagaatggn ttctttaggg ttnaaaattg atcctagaca 540
tactttttac tggggacgtc ctgcttcttt ggnagcttaa agagctcaat gagattncct
600 tagcataata agttaggggg gctttnccaa agnaatagga ncctttntag
ggttaaaaac 660 ctggcatttt taaaatgcct tgaangggac ttgnccgctn
cccctntaat tatccncctt 720 acnccgntgg anggagagaa aanccccttg
caaanaaaac cctcaaaggt tagggngatc 780 g 781
20 861 DNA soybean misc_feature (1)..(861) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 20 gaatgggagg agtgggaaag
acagtggcta tggagcttgt tccggaggtt gggttggaat 60 caagtgtgct
cagggacagg ttattgtgat ccagcttcct tggaagggtt tgaggggtcg 120
aatcaccgac aaaattggcc aacttcaagg cctcaggaag cttagtcttc atgataacca
180 aattggtggt tcaatccctt caactttggg acttcttccc aaccttagag
gggttcagtt 240 attcaacaat aggcttacag gttccatacc tctttcttta
ggtttctgcc ctttgcttca 300 gtctcttgac ctcagcaaca acttgctcac
aggagcaatc ccttatagtc ttgctaattc 360 cactaagctt tattggctta
acttgagttt caactccttc tctggtcctt taccagctag 420 cctaactcac
tcattttctc tcacttttct ttctcttcaa aataacaatc tttctggctc 480
ccttcctaac tcttggggtg ggaattccaa gaatggcttc tttaggcttc aaaatttgat
540 cctagatcat aactttttca ctggtgacgt tcctgcttct ttgggtagct
taagagagct 600 caatgagatt tcccttagtc ataataaagt ttaatggagc
tataccaaat gaaataggaa 660 ccctttctan gcttaaacac ttgacatttn
taataatgnc ttgaatggga acttgcctgc 720 taccctctnt aattatcctn
cttacactgn tgaatgcaaa aaacaacctc ttgcaataaa 780 tcccttaaan
ttangnnaat gggaaanttn tttntgattt gagtnaaacc aattaatggc 840
atattnttta acatttaaan t 861 21 761 DNA soybean misc_feature
(1)..(761) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 21 gaatgggagg agtgggaaag acatggggtt gaagggctgt acccacatag
ttgaatattt 60 cccacaaatg agcttgagtt aaatttcttg gcaagcagag
gggggacaga acctgagagg 120 ctattgtagg aaacattgaa gggatttaga
ctgcgctgac tgtcaaagga gactggaatt 180 tctccactga aattattcag
tgacaaatca agctgcctaa gcgaggaaat gtttgcaatg 240 cttgaaggaa
tatgtccact aaattggttt ctactcaaaa tcagaacaga aagattacgc 300
aatctaccta aactttgagg gatttgattg tcaaggaggt tgttctctgc attcagcagt
360 gtaagtgagg ataaattaga gagggtagca ggcaagttcc cattcaaggc
attattagaa 420 atgtcaagtg tcttaagcct anaaagggtt cctatttcat
ttggtatagc tccctaaact 480 tattatgact aagggaaatc tnattgagct
ctnttaactc ccaaagaaca ggacgtncca 540 gtgaaaaagt atnatctagg
atcaaatttg aacctaaaaa gcattttgga tccccccaaa 600 gtaggaagga
gcanaagatg tntttnaaaa anaaatanaa aatatagtag tactgtaagc 660
naaaaggtga ctaatagcat aantatgata caaattagga tttcttanaa ttttttnnaa
720 aatnnnangn aaccaaaaaa gngacntncn tttnaanacc c 761 22 856 DNA
soybean misc_feature (1)..(856) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 22 aatgggagga gtgggaaaga cagtggctat
ggagcttgtt ccggaggttg ggttggaatc 60 aagtgtgctc agggacaggt
tattgtgatc cagcttcctt ggaagggttt gaggggtcga 120 atcaccgaca
aaattggcca acttcaaggc ctcaggaagc ttagtcttca tgataaccaa 180
attggtggtt caatcccttc aactttggga cttcttccca accttagagg ggttcagtta
240 ttcaacaata ggcttacagg ttccatacct ctttctttag gtttctgcct
ttgcttcaag 300 tctcttgacc tcagcaacaa cttgctcaca ggagcaatcc
cttatagtct tgctaattcc 360 actaagcttt attggcttaa cttgagtttc
aactccttct ctggtccttt accagctagc 420 ctaactcact cattttctct
cacttttctt tctcttcaaa anaacaatct ttctggctcc 480 cttcctaact
cttggggtgg gaattccaag aatggcttct ttaggcttca aaaattgatc 540
ctagaacata acttttttac tggtgacgtt cctgcttttt ttggtaggct taaaganaag
600 ccaatgagaa tttccttagt catnataaag ttaaggggag cttttnccaa
atgaaaaaag 660 gaaccctttn taggcttaaa nanacttgac aatttntaat
aatgcccttg aatngggaac 720 ttgcctgcta ccccctttaa tttatcctac
ttaccctgnt ngaaggcaaa naacaacccc 780 tttgcaataa aaacccnaaa
gttaagggga angnggnact ttntntctnn tttngggnaa 840 accanttann ggcnct
856 23 826 DNA soybean misc_feature (1)..(826) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 23 gaatgggagg agtgggaaag
acatggggtt gaagggctgt acccacatag ttgaatattt 60 cccacaaatg
agcttgagtt aaatttcttg gcaagcagag gggggacaga acctgagagg 120
ctattgtagg aaacattgaa gggatttaga ctgcgctgac tgtcaaagga gactggaatt
180 tctccactga aattattcag tgacaaatca agctgcctaa gcgaggaaat
gtttgcaatg 240 cttgaaggaa tatgtccact aaattggttt ctactcaaaa
tcagaacaga aagattacgc 300 aatctaccta aactttgagg gatttgattg
tcaaggaggt tgttctctgc attcagcagt 360 gtaagtgagg ataaattaga
gagggtagca ggcaagttcc cattcaaggc attattagaa 420 atgtcaagtg
tcttaagcct agaaagggtt cctatttcat ttggtatagc ttcactaaac 480
ttattatgac taanggaaat ctcattgagc tctcttaagc tacccaaaga agcaggaacc
540 gtcaccagtg aaaaaagtta tgatctagga tcaaattttg aacctaaaaa
accattcttg 600 gaattccacc ccaagaatta ggaagggagc canaaagatt
gttattttga aaaaaaaaga 660 aaagtgagaa aaaatgagtg agttaggctt
actggtaaaa ggaccaaaaa aaggantttg 720 aaactnaaan ttaanccaat
aaaacttaat ggnaataaca aanactttta nggaattctc 780 ttttnaacaa
attnttnctt angncaaaaa anttaancaa aggnct 826 24 571 DNA soybean
misc_feature (1)..(571) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 24 tgggactggc tgtgactgat ctctctggtc taatctcttc
cagctgctgg agaacttgat 60 gaacttctgg tcgtgctgat ggagaaggat
caacacagtg caaagcgagc ttcaacgtgt 120 ttagcaactc gtcgccaact
gtggatgcat ctctcatcaa gtctgcatca aaaacctcat 180 ttgtccactc
ctctttgaca actgaggcaa cccactgagg caaatctagt ccattcatag 240
acaccccagg tgatttcctc gttaggagtt ctaacaagat aacaccaaga ctgtagatat
300 cagttttagt gtttgctttc ttgagctttg agagctcagg tgcccggtat
cccaatgctt 360 cagctgtagc tatcacgttg gaattagcag cagttgacat
caaccgagaa agaccaaaat 420 ctgcaatttt agcatttgna ttctcattaa
acaacacaat gntggatgng anggtnccat 480 ggatgaaggt cttctnggna
agnaagnaaa acaaagcacc gggccaaggn ttgggctaat 540 ttcaaccttg
gggggcaaac naanaaatgt t 571 25 727 DNA soybean misc_feature
(1)..(727) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 25 ttacaactag tgttatcgga gaatgaaaaa ttgaagaata ataagttcag
ctataataaa 60 ctcgagggag gaaaaacaaa gaaattcatg ataaatagat
ataacttatt aaatttaagg 120 ggtgtatttg cacaccctga attatagaga
ttcttatatc tttgagaaaa taattaaatt 180 gggaaaaaag agataatgac
tgattgagat ttgcctcaga attgttcgtt ttaatattgg 240 tacgaatcta
atggttttat cctgaaagat gctcacaagt attgagggac taataaattg 300
tttataaact actactaaat gagatgagac tttaaggtgt actgaagcaa tatcatttaa
360 aaaatgacta ctcgtatttg tgttgagaaa atttattttc aatgaaaaga
aaatatatac 420 atataagata aagtaattaa cataaccgaa aggaaataaa
atgcaacatt ataaaaacta 480 caactatata aatgatatat acaactccta
gcacatgcat tggattgtga attaattaaa 540 atgttgtatg gatggtaaaa
attcaaaact aaacccccca caatttaagt gacacagaat 600 ataattagcg
gtggtctttt tacagaaacg acgagaacaa aggtgtcaaa ggaaaggaga 660
tggatgcatg tggtatgagc tcatncaatt ccaacctgtt gtggaccaaa gccgaagtcc
720 ttgacnn 727 26 560 DNA soybean misc_feature (1)..(560) n is an
undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 26 attacgcnag
ctctatacga ctcactatag ggagacaagc ttgcatgcct gcaggtcgac 60
tctagaggat ccccgggtac cgagctcgaa ttcccaatgc cagagcttcc ctatcgtggg
120 ccccacctat gaagaataca cccacgttga aatacatgtt gttgttgttg
gacgcgccca 180 gccgagagtg ccggtccacg agtatcccca acgtgcatgg
cgcatgcgct tgaaacctag 240 tattcatctt cctgatggag gcagccacgt
gtccgacaag gtcaatgttg ccgttttcgt 300 gaaaagggat gataatgaaa
ggcaccatat tgtcttgggc gaggttgaaa atggcgtcgt 360 gcatgctctt
gtaaggtgcc acgttgatgt agggaagaac cttgactggc ccacttgagt 420
tgttggagta gttttcgaag gcttgcatga tgtggttggt gttggggtaa ttcacagaca
480 agaattttct gngacccgtg tctatgtttt atgggaagga gaatgggtgc
cttttcccca 540 cnagctngat naggnggact 560 27 630 DNA soybean
misc_feature (1)..(630) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 27 actgcatgca tgcaagcaaa tttaacttta cacaacacac
caccagagtg taagctgttt 60 cataaaaaat gattgtttcg ggctttcgga
tcacaaggct tgtttagtat tcggtaagaa 120 agaaagaaat aggtgataaa
taaagtggat agaaacataa aagaaaggaa taaagtaatg 180 aaaataaggg
agaagtagaa taatggaaat agataagaaa tagaatggat tcgatagtat 240
atctagttta agagaaataa gaaaaaataa gaacaagaaa aaaaattgca ttttaattta
300 ttatttgtac tgtatcgatg attggcacga gattataagt tttttttttc
gtgtttaccg 360 ttgaaggatt atatatcata ccatttgttt gtcaaccaac
acggaacttt aagtctcttg 420 atgttcaaaa gcacttaaaa ctaaggaatt
ttacatcata ttagtcgtct gtagactgat 480 acaggatttt aagcctatat
atctagcatt gatccggttg gcaatcaata tcacattaat 540 gatcggtaaa
ccattcatat aacccctttg attggtcaag aaatggcttt atgaatccca 600
ggattgagcc cagaancagg ngatactagn 630 28 756 DNA soybean
misc_feature (1)..(756) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 28 attggcttaa cttgagtttc aactccttct ctggtccttt
accagctagc ctaactcact 60 cattttctct cacttttctt tctcttcaaa
ataacaatct ttntggctcc cttnctaact 120 gtgggggggg gaatancaag
ggnggcttta ggctgcaaaa tttgatccta gatcataact 180 ttttcactgg
tgacgttcct gcttctttgg gtagcttaag agagctcaat gagatttccc 240
ttagtcataa taagtttagt ggagctatac caaatgaaat aggaaccctt tctaggctta
300 agacacttga catttctaat aatgccttga atgggaactt gcctgctacc
ctctctaatt 360 tatcctcact tacactgctg aatgcagaga acaacctcct
tgacaatcaa atccctcaaa 420 gtttaggtag attgcgtact ctttcctgtt
ccgattttga gtagaaacca atttagtgga 480 catattcctt caagcatngc
nnacatttcc tcgcttaggc agcttgattg tcactgaata 540 atttcaggtg
gagaaattnc agtctncttt gacagtcagc gcagtctaaa tcttcttcaa 600
tggttnctac aataggcctc tcagggtctg gccccccttt gnttggccaa ggaaanttaa
660 cttaagctta tttggngggg aaanattcaa ctatgggggg acncggccct
ttaaacccca 720 gggnttttcc caggttcctt ccaagggngc anttgt 756 29 566
DNA soybean misc_feature (1)..(566) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 29 gacccttgtt ctatagaacc gaattcgagc
tcggtacccg gggatcctct agagtcgacc 60 tgcaggcatg caagcttatt
attactacta ctacttatct tcactccacc acactgtgtc 120 actaaaaccg
gaaccatccc catacaaaat tctactgaag acaacatatc ccccaatatt 180
cccaatgcat cagcgttctc catgaaagtt gtcatttctt ttccattcaa agatccatca
240 ttgtggcgcc ttcccaccat cacaagatca tagtttcctt ccaaactatg
cactgcttcc 300 aacacctcca ccccatcgtc caccgtaatc tcgtaccaac
aaacgttacc aatgccatat 360 ttcatgctct tgaactcgtc aattaacccc
tcgtccaaca tggtatcttc ctcttcctct 420 tcacgctctt ctcttgcaaa
ataattttac aaccacacgg tttcttggtc acgataacaa 480 acctaaacaa
gctaccctcg tatctgcacg ctccgcattc gaattcccaa tgccagagct 540
tccctatcgg gggncccacc tatgaa 566 30 673 DNA soybean misc_feature
(1)..(673) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 30 gggactggct gtgactgatc tctctggtct aatctcttcc agctgctgga
gaacttgatg 60 aacttctggt cgtgctgatg gagaaggatc aacacagtgc
aaagcgagct tcaacgtgtt 120 tagcaactcg tcgccaactg tggatgcatc
tctcatcaag tctgcatcaa aaacctcatt 180 tgtccactcc tctttgacaa
ctgaggcaac ccactgaggc aaatctagtc cattcataga 240 caccccaggt
gatttcctcg ttaggagttc taacaagata acaccaagac tgtagatatc 300
agttttagtg tttgctttct tgagcttttg agaagctcag gtgcccggta tcccaaatgc
360 ttccagctgt agcttatcac cgttgggaat taagcagcaa gttggacatt
caacccggag 420 naaaagaccc aaaaattttg caaattttta agcaatttng
gnanttcttn aatcaaggcc 480 aaccaccaat tggnttggga atggtggaag
ggtttcccca atggtaattg gaagggtttc 540 ttccctnggg gaaaatggaa
aggggcaana aaacaaaggc ccaacngggg ccccaaaggt 600 nttttggggg
ccttattttt tncnaatncc ctttggnngg ggncccaaat tcnaaantgg 660
aaattggntt tnn 673 31 736 DNA soybean misc_feature (1)..(736) n is
an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 31
gttgnntagn tgcactatag aatncgaatt caatttaaac atttttaatt ttttgtcttt
60 gtattctatt ttttcataaa ttctaatctt gctaataatt tcaattcata
ttaagatcgg 120 taaatagaaa atctagaaaa aaaaacaaaa aaagtatttt
tttttcattg attttatttt 180 caattgattt gtcactaaca aactgattcc
tcttaaatct cacaaaagta catgtcgata 240 taaatatgag attataaatt
catgatatct attttcgatt tttacatata atgttttttt 300 tatctttttt
agttcctaat aagcattttt aaatgtctta tgttcctact ttgcatatca 360
gggacccatt aatgggacga ggtcactgcg agcatgaaca acgtgtcttt cgtctcccga
420 acaacgtgcc atcttgcagg ctcaccacct cggaatccct ggagtggtca
ccactgattt 480 tccggggaaa gcccgccggt gaaagtttga ttacaccggc
aatgtgagcc ggtcgctgtg 540 gcaaccctgg tnccgggaca aangcacacc
aagttgnaan tttgggtccg aggggngcca 600 naattggggt tgcanggata
ctaagcnntt ggnnacttnc ctggnnaacc cacccctaat 660 nccatntttc
aatggggnac cnaatttctt acaattggnt gcaananggg nttttngggn 720
aacctttnna ccccca 736 32 566 DNA soybean misc_feature (1)..(566) n
is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 32
gaccnnagac gctactatag ggagacaagc tattcgaagg ggaactgaga acgatccaaa
60 gcactccaag aaacagagag tttcacattg tttgttgtgt acataatgaa
gcaaacgtgc 120 gtggcatcac tgccttatta gaagagtgca acccagtgca
agagagcccc atatgcgtct 180 acgcagtcca ccttatcgag ctcgtgggga
aaagtgcacc cattctcctt cccataaaac 240 atagacacgg tcgcagaaaa
ttcttgtctg tgaattaccc caacaccaac cacatcatgc 300 aagccttcga
aaactactcc aacaactcaa gtgggccagt caaggttctt ccctacatca 360
acgtggcacc ttacaagagc atgcacgacg ccattttcaa cctcgcccaa gacaatatgg
420 tgcctttcat tatcatccct tttcacgaaa acggcaacat tgaccttgtc
ggacacgtgg 480 ctgcctccat caggaagatg aatactaggt ttcaagcgca
tgcgccatgc cgttggggat 540 actcgnggcc ggnactctng gtgggn 566 33 614
DNA soybean misc_feature (1)..(614) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 33 acaacaagca acgaacagct tttaacctta
aactaggcaa atgccaatat taaacaacaa 60 ataattaaaa ttgtaaggct
ggtcgagtat aaattaaaca aaaggccctc tattcaaacc 120 ttcatatatc
atacctgntt ttaattaacg cggactactt tttcatataa aaaaaagatc 180
attagaggat taatttaaag cgntttagtt tttaattacc aaagagtata attattatta
240 ggcgctttgg cccacaatca atcacctaaa caagaaaaag aaaaagaaaa
aaaaaggcaa 300 attggactaa tgcaaaagtg gcacaatctt tgncttgaac
tctttaatta gcaacaaatn 360 atactcttct gcacaaatca caagaatacc
ttacatgaaa agaatggnaa tntgacgggt 420 tacattaaat tatatgcagg
tttctgcagg gaatcaattn tcaagaattt aagggggggt 480 gggaattttc
aatagctagc ttgactagca aagggaaaga ataaaggnaa aangcttctt 540
ggctnggcct tttggganng gnatcctttt ngctaaaccg gaaanggnta tangaatggg
600 aaaggagana atcg 614 34 602 DNA soybean misc_feature (1)..(602)
n is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 34
aggctagctg gtaaaggacc agagaaggat ttgaaactca agttaagcca ataaagctta
60 gtggaattag caagactata agggattgct cctgtgagca agttgttgct
gaggtcaaga 120 gactgaagca aagggcagaa acctaaagaa agaggtatgg
aacctgtaag cctattgttg 180 aataactgaa cccctctaag gttgggaaga
agtcccaaag ttgaagggat tgaaccacca 240 atttggttat catgaagact
aagcttcctg aggccttgaa gttggccaat tttggcggtg 300 attcgacccc
tcaaaccctt ccaaggaagc tggatcacaa taacctgtcc ctgagcacac 360
ttgattccaa cccaacctcc ggaacaagct ccatagccac tggcattcca gctcccgcaa
420 gaacccttct ggatcagcca actcttgctt gaaagcttat cacatgtacc
tctctacaga 480 taggagggtg cttcttccct ttcactggnc tacctcttcg
ggaataagcc acctaatgag 540 aaagaaagan ctgggatagc taactctaca
tagnctcaag gcnagagata attagggaaa 600 ng 602 35 644 DNA soybean
misc_feature (1)..(644) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 35 ggaattttga agagaagtaa agtgagagaa aatgantgan
nnaggctagc tggtaaagga 60 ccagagaagg atttgaaact caagttaagc
caataaagct tagtggaatt agcaagacta 120 taagggattg ctcctgtgag
caagttgttg ctgaggtcaa gagactgaag caaagggcag 180 aaacctaaag
aaagaggtat ggaacctgta agcctattgt tgaataactg aacccctcta 240
aggttgggaa gaagtcccaa agttgaaggg attgaaccac caatttggtt atcatgaaga
300 ctaagcttcc tgaggccttg aagttggcca attttggcgg tgattcgacc
cctcaaaccc 360 ttccaaggaa gctggatcac aataacctgt ccctgagcac
acttgattcc aacccaacct 420 ccggaacaag ctccatagcc actggcattc
cagctcccgc aagaaccctt ctggatcagc 480 caactcttgc ttgaaagctt
atcacatgta cctctctaca gataggaggg tgcttcttcc 540 ctttcactgg
nctacctctt cgggaataag ccacctaatg agaaagaaag anctgggata 600
gctaactcta catagnctca aggcnagaga taattaggga aang 644 36 748 DNA
soybean misc_feature (1)..(748) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 36 attggcttaa cttgagtttc aactccttct
ctggtccttt accagctagc ctaactcact 60 cattttctct cacttttctt
tctcttcaaa ataacaatct ttctggctcc cttcctaact 120 cttggggtgg
gaattccaag aatggcttct ttaggcttca aaatttgatc ctagatcata 180
actttttcac tggtgacgtt cctgcttctt tgggtagctt aagagagctc aatgagattt
240 cccttagtca taataagttt aatggagctg taccaaatga aataggaacc
ctttctaggc 300 ttaagacact tgacatttct aataatgcct tgaatgggaa
cttgcctgct accctctcta 360 atttatcctc acttacactg ctgaatgcag
agaacaacct ccttgacaat caaatccctc 420 aaagtttagg tagattgcgt
aatctttctg ttctgatttt gggtagaaac caatttagtg 480 gacatattcc
ttcaagcatt gcaaacattt cctcgcttag gcagcttgat ttgcactgaa 540
taatttcagt ggagaaattc cagtctcctt tgacagtcaa gcgcaagtct aaatctcttc
600 aatgtttcct acaatagcct ctcanggtct gncccccctc tgcttgccaa
gaaatttaac 660 tcaagctcat ttgtgggaaa tattcaacta tgtgggacag
nccttcaacc ccatgttttn 720 ccaagcttca tacaaggagc atggccct 748 37 563
DNA soybean misc_feature (1)..(563) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 37 ctggctgtga ctgatctctc tggtctaatc
tcttccagct gctggagaac ttgatgaact 60 tctggtcgtg ctgatggaga
aggatcaaca cagtgcaaag cgagcttcaa cgtgtttagc 120 aactcgtcgc
caactgtgga tgcatctctc atcaagtctg catcaaaaac ctcatttgtc 180
cactcctctt tgacaactga ggcaacccac tgaggcaaat ctagtccatt catagacacc
240 ccaggtgatt tcctcgttag gagttctaac aagataacac caagactgta
gatatcagtt 300 ttagtgtttg ctttcttgag ctttgagagc tcaggtgccc
ggtatcccaa tgctccagct 360 gtagctatca cgttggaatt agcagcagtt
gacatcaacc cgagaaagac caaaatctgc 420 aattttagca tttgtattct
catcaagcaa cacattgctg gatgtgaggt tcccatgtat 480 gatgttctcc
tgggaatgaa ggcagaacaa gccacggcca agcttggcta tttcatcctt 540
gtggccaatc aatgaatggt cat 563 38 623 DNA soybean misc_feature
(1)..(623) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 38 gattttgcac atctacttga gtaggcttca catgattccg tgtattactt
ttattttggt 60 atatatacca tgtggagtat agtatcactt tttgtcctac
aaccacattt tatgagactt 120 gcattttatg tgacatgaac ataaaaaata
atgaaaaaga aaatgtcaca tatatatgat 180 acaatctttt taaaagtcaa
tttgaataat ttttcatcag gaggaaaaag aagagagaaa 240 atgaattaag
tttcttctaa
aaattaaaat caacttataa aaagaaaaaa ctttaatgaa 300 aaaaattcaa
aaagaaaaag aataaaatga tcaatagcct ttaggtttaa gcacaaggtg 360
aatccaaata aagaccccaa aagatagtac agaacccaac aatggtaaaa tctagaaata
420 tacatgtaaa gactgcattt atagaccatc atgactagca aatgcttaaa
ggcacataga 480 tgaattaatc tatgcaacaa aatctgnccc aagttttttt
tangcaagga aaatcatatc 540 attttattaa ggataactga gaggaccaat
ggtgtaatca attgaaatca tgcgaggctt 600 acatgaaatc tgtcaccaag tac 623
39 785 DNA soybean misc_feature (1)..(785) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 39 caattaggaa ataaatatat
tgaaaagaat tggtagtcag ttcaatgaaa gtgaggtcct 60 caaacaactt
gatgcagcan ctgtatgata caaaatatat taataactac accagcagaa 120
aaatataggt caatctatat ttgggaacca aataatattt aatttgtatc tgatagactc
180 aagaaattat aactaatttg gaagaaatgg atacctagta ttattaaaac
accaaaacac 240 agggcagatt atagtagcta aagaggaaga agctaactag
tcaaagtgtc acactattca 300 acactacaaa ggaccaatcc ccttttagag
agcctgacct ttctcaccca agagctaccc 360 aagagaatac acaccctctc
ctccatatcc cctcccatat aacacaatcc tcaccaacta 420 agcacctacc
tgacaattcc ctcctaacca actctctgct catcagggtt gattctcttc 480
tctttccaag actttgggct tttgttttga ctaagccaaa tttctatctg ctggcctggt
540 ccaacagtat cttttacaga caagtttaca aaatattcgt atttgttaga
atttattgat 600 attcctatta tggtccccac tgtgtgcaaa catttagaaa
ctaatattac aattaacagt 660 ttttggtgaa tgcagcaaaa ctaaatatat
ttgatataga aatcaacaaa ctgaaaaatt 720 atatngcaag gncaattgga
aaagaaaatt gatacccctt ttgnggnaat aaatatantg 780 nntac 785 40 640
DNA soybean misc_feature (1)..(640) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 40 tggaaggcgt ccttcaattc aatcacaaag
tctaaatcaa agacgagggg gctgaaatca 60 tgggggacat tgacaacgta
aggtaaccac taattaatta accactaata ttatcccatt 120 aatatcccat
taagagataa tacatataga gccaataaat aagcatctta acaagacaaa 180
taaattatcc attattcagc ttatgcccat ggtggtatta gaagtttagg aaaaaaaaat
240 tcatcatttg gcaattttgg gctcattagc ttgaattggt tacaaggtgt
ggtatggact 300 tttttctttt cttttctcta aattcttcct tctatgatat
acttttggtc aacttaaact 360 caatttctta tagctcaata ttttggattt
agattggaaa tatctaaaag ncacttaaat 420 tttatattta caaaaaaaaa
aaaagcatcg ntctttttct ttttataaca aagggggatc 480 aaaatcactc
tttttatgaa tccgcattat ccttnataat aattaacctc cactgggatt 540
taaagggnga ttaattaaat ccggaggcca tggaaggata tgggggaacc taatctaaaa
600 ntncatcctc aaccctaang ggaaaataaa ggaatngggg 640 41 808 DNA
soybean misc_feature (1)..(808) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 41 cttttgacac tatgaatacg aattcaaata
ttaaatattt ttattttttg tctttgtatt 60 ctattttttc ataaattcta
atnttgctaa taatttcaat tcatattaag atcggtaaat 120 agaaaatcta
gaaaaaaaaa caaaaaaagt attttttttt cattgatttt attttcaatt 180
gatttgtcac taacaaactg attcctctta aatctcacaa aagtacatgt cgatataaat
240 atgagattat aaattcatga tatctatttt cgatttttac atataatgtt
ttttttatct 300 tttttagttc ctaataagca tttttaaatg tcttatgttc
ctactttgca tatcagggac 360 ccattaatgg gacgaggttc actgcgagca
tgaacaacgt gtctttcgtt ctcccgaaca 420 acgtgtccat cttgcaggct
caccacctcg gaatccctgg agtgttcacc actgattttc 480 cggggaagcc
gccggtgaag tttgattaca ccggcaatgt gagccgttcg ctgtggcaac 540
ctgttcccgg gacaaaggca cacaagttga agtttgggtc cgagggtgca gattgtgttg
600 caggatacta gcattgtcac tcctgagaac caccctatcc atcttcatgg
gtcgatttct 660 acattgttgc agagggtttc gggaacttcg acccaaagaa
agatccgcga aattcaacct 720 tggtggatcc cctttgaaaa acacagtggc
tggcctgtaa atggatgggc aagtattcga 780 tttgggggct gataacccna gtaaatnt
808 42 605 DNA soybean misc_feature (1)..(605) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 42 ctcccgggtc ccaagtaata
ggcccctcag agccaaaaca ttgggggggc taatttttcc 60 tagaacactg
acttctgatt caaattctct atgaccttta gtgatctttt ccctcaatct 120
ctttactgca acttgacttc catcctccaa aatagcctta taaacagntc cataggtgct
180 ctttcccatg atctcagctg gtgcacacaa gagatcatca gctgtaaaag
ccattggtcc 240 atcaaaatgg actagtttcc ctccagcctc cccacctgct
tcaacatcac caccagcaac 300 tggagggact cctttttctg cctcatagtg
gccgctctac cctcggtggc ttggccgntc 360 ccggccttag atgntgatct
ctttctgatc aggcagaaaa gcaggacaca acaaagnata 420 atcaggacta
cgaggagaac tcctgctact atgagaatta tgnctttggg gcttagcttc 480
ctatgatggg gatggttnga cacttcanga gggggggcaa tgactccctg gganggagct
540 tgggaaagac atgggggtga aggnctgnac ccacataggn gaaaaattcc
cacaaangag 600 cnngn 605 43 275 DNA soybean misc_feature (1)..(275)
n is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 43
ctgaacggaa gtgactgcgt ttgtgtcggt tgtaagcagg gagtggaggc attataggtc
60 tcggttttgc tctttactcc tttggcacga tggtgagaat gcttattgtg
gtgattcggt 120 gatttgtatt cgagtatggc ggttgtagtg gtgttgtcga
aggcagcgtt ttgggcggat 180 tggtacgcac gcgccgccat gtagtagcgg
gaaggtggct ggtcnccggt gattaagacg 240 tcggcggttt gcccggggcc
cactatgagg acttt 275 44 632 DNA soybean misc_feature (1)..(632) n
is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 44
tgtatataat taaaatgagt ttaatattta tgtattaata gtataaaatt tatcatacat
60 gatgaatggt gaaattttga attatgatta aataattata taaaaaaatt
tacatgatga 120 atgaataact ttttttttct caattaaaat tatgatcctt
tgtcgatatg ttttactgtg 180 tcgacctttt ttttcggggg agaggggacc
agtaggagaa gtagtattta gtaaaagaag 240 ggagagagaa gttgacttat
cctttaatta gtttagagaa aattagacga gaaggaaaaa 300 aaataggcga
aagtcacttt ttctttctat ctctaccaag aatgttgatg aaaaagtggg 360
gagcagaatt ttaaattttt attttcatat ttatccttct ccacattttt ggtttcttcc
420 atttttttat aaaatgattt attttagggc ataggtaact tttcaatttt
tttcattcta 480 ttcgatcaaa taaatagaaa aataatttac ttttctttct
tttaaccttt ttcatatttc 540 tctcataacg accacttatt aattacctct
tttnccccac tttttgctat ncaaatctat 600 ctttgaattt cttccttttc
attttggtct cn 632 45 650 DNA soybean misc_feature (1)..(650) n is
an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 45
ttcacagaca tagcaaaatt ctgaagtaag aagcaagttc acgtgtgatg gcgaaaccca
60 ttatagaata tgttagactg aaaggtaaca aattaaaata tgttttattg
cagaaaccat 120 aaactaataa accttttggg tagatagaaa agtgataaat
catacataat aataactgaa 180 atactcagct tttaatcaat ttaattcaat
atatatctat ttttgaattt ttcaaagaga 240 tgcttagcta gggaggaaac
ctaatttagt ataaaaaaaa gaaacaaatt aaaaacataa 300 attgccattg
aatgcctctt aaaatattcc gatccattga tgtctacata ataatatata 360
ttattgatat aataaccgat tgaataaaat ggatatacct attacgtaat agcagatttg
420 tctacgcaaa agagacagtc aaaggtgcta attagaaatt aatcgcccca
taataaaatt 480 ctaaaccttt gaaaagataa atcaattctc aaaaagattt
attttactta tctcagtacc 540 atgcaccatg gatcatctta ctggtctggt
tangaatttt caaagctacg ccacaaattg 600 aaattgggct aaaaatcaaa
catgcatggt gtcacaacta tattactagt 650 46 628 DNA soybean
misc_feature (1)..(628) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 46 gaatgcacat tttataaacg tgttgatcct ctccccgnng
ggggaccaat taataaggta 60 ccctgttgcc cctaggggac attggatggc
catcagatgg tgcatataca caccaaagtt 120 tatacagcat tatagtgact
ttcaacctcc tcactccgag gtccccatat attctctcta 180 ttgaacttgt
aaagactaat gaacttatga agactatcac tgaaacccac tatggaagcc 240
ccagtagtaa aatggncatg catgctcacc aaaagtttat acagcattat agcgacatac
300 gacctcactc ccaggnccac atgctctatn gaacttctaa agctatctcn
gaaccctatt 360 atagcttcat gagggtaaca tgcattttag cgacttagaa
aactacatat cattgagcgt 420 gatcnttaag aaggcctcat tttgacacaa
aagaacatga tggatttgcc tttatattcg 480 gttactaacc ttgatagcta
ttttggncag agagaaaaat attgacatgc ccgnggaatc 540 aaaaggtaga
taatnattaa agagataaag aactatcccc ttgctagggg naaaaaaaaa 600
ntatatccct atttaaataa aanccatc 628 47 736 DNA soybean misc_feature
(1)..(736) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 47 tggtgtatat aattaaaatg agtttaatat ttatgtatta atagtataaa
atttatcata 60 catgatgaat ggtgaaattt tgaattatga ttaaataatt
atataaaaaa atttacatga 120 tgaatgaata actttttttt tctcaattaa
aattatgatc ctttgtcgat atgttttact 180 gtgtcgacct tttttttcgg
gggagagggg accagtagga gaagtagtat ttagtaaaag 240 aagggagaga
gaagttgact tatcctttaa ttagtttaga gaaaattaga cgagaaggaa 300
aaaaaatagg cgaaagtcac tttttctttc tatctctacc aagaatgttg atgaaaaagt
360 ggggagcaga attttaaatt tttattttca tatttatcct tctccacatt
tttgttttct 420 tccatttttt tataaaatga tttattttag ggcatagtta
acttttcaat ttttttcatt 480 tctattcgat caaataaata gaaaaataat
ttacttttct ttcttttaac cttttcatat 540 ttctctcata acgaacaact
tattaattta cctcttttcc cccacttttg tctatccaaa 600 ttctatcttt
gaattttctt ccttttcatt ttggttctca acccaaataa agaagaacga 660
gtttggataa atcataaagg ttatataccc tataantgga agaacattta aatggtccaa
720 ngggccttaa aattct 736 48 695 DNA soybean misc_feature
(1)..(695) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 48 atgccagagc tttccttatc gtggccccac ctatgaagaa tacacccacg
ttgaaataca 60 tgttgttgtt gttggacgcg cccagcccga gagtgccggt
ccacgagtat ccccaacgtg 120 catggcgcat gcgcttgaaa cctagtattc
atcttcctga tggaggcagc cacgtgtccg 180 acaaggtcaa tgttgccgtt
ttcgtgaaaa gggatgataa tgaaaggcac catattgtct 240 tgggcgaggt
tgaaaatggc gtcgtgcatg ctcttgtaag gtgccacgtt gatgtaggga 300
agaaccttga ctggcccact tgagttgttg gagtagtttt cgaaggcttg catgatgtgg
360 ttggtgttgg ggtaattcac agacaagaat tttctgcgac cgtgtctatg
ttttatggga 420 aggagaatgg gtgcactttt cccacgagct cgataaaggt
ggactgcgta naccatatgg 480 gctctnttgc actgggttgc actcttctaa
taanggcagn gatgccncnc nccgtttgct 540 tnattatgta cncaacaaac
aatgngaaac tctctgnttn ttgggagngc tttggatcgn 600 tctcanntnc
ccttnnaata anctttntnn gngnacttnn agggcgangc ttnnncnata 660
tgntaaccaa gggngntacn annnnnggnt ntaan 695 49 625 DNA soybean
misc_feature (1)..(625) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 49 tttcccacaa tctttaatct tgctaataat ttcaattcat
attaagatcg gaaaatagaa 60 aatctataaa aaaaaacaaa aaaagtattt
ttttttcatt gattttattt tcaattgatt 120 tgtcactaac aaactgattc
ctcttaaatc tcacaaaagt acatgtcgat ataaatatga 180 gattataaat
tcatgatatc tattttcgat ttttacatat aatgtttttt ttatcttttt 240
tagttcctaa taagcatttt taaatggctt atgttcctac tttgcatatc agggacccat
300 taatgggacg aggttcactg cgagcatgaa caacgtggct ttcgttctcc
cgaacaacgt 360 gtccatcttg caggctcacc acctcggaat ccctggagtg
ntcaccactg attttccggg 420 gaagccgccg gtgaagttng attacacccg
gcaatgtgag ccgntcgctg gggcaacctg 480 ntcccgggac aaaggcacac
aagttgaagt ttgggtcgag ggngcagatt ggggntgcan 540 gatactagca
ttgcactcct gagaaccacc ctatccatct tcatggggac caattctaca 600
ttggtgcaga nggttccggg aacnc 625 50 621 DNA soybean misc_feature
(1)..(621) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 50 actggtgtac gatttagtgt tactagctat cccatgtaat aaatatataa
atcttgaatc 60 acaaggaatg atgcaatata tggttcctct aatagtaagt
tatcccacca aatctgaata 120 taattaagaa gttgtattcg tctgaatgtt
gtgtctaaaa gggttgattg atgaatgatg 180 gctacatgtg agagtttgat
aacaacagct agctagccat tagccaagcc actaactaga 240 cattagtttt
ggttggttgt cagacaaacc gttagacctg agaacgaaag cgtattaaac 300
aaaagatgat atgtagactt ttaatataaa aagagatgga gaaaccaaat tgagatttga
360 taggtgaact ataaatcatg acagtgcatt agacaagttg gtagagtttg
ttactaactc 420 atcagattct taagaaaggc aaaaatagaa actacaccac
atgtcgctag cgataacgtg 480 caatttataa ataaataatg gcttcatttt
catggttagt tataaattaa tgggtcacaa 540 ttcttaattt attaggaacg
tatacttcat tttgagagtg tataaagttg gaagaagaaa 600 agggatatag
aaagaataaa a 621 51 480 DNA soybean misc_feature (1)..(480) n is an
undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 51 aagctccgcn
cggggaacct nnagagtcta cctgaatccc caagntngaa cgaatacttg 60
ccaacacaaa tacgggcgat gggaaacatc tgaagaccgc tccaaagcgc cncatactaa
120 attgnnagga aaatttatat ctgacctttc atgggtgggg ggtgcatctg
ctataaggaa 180 gggttcattc tgggcaagat ctgtggaaaa caatattggg
gatcaaattt tagggagtga 240 tgctacaacc tcttcattat acatggattc
tgaaataagt ggtgtgaact ttaaagtgaa 300 cgaagacggc atgcaaatgc
ctggtattca tctagttgat ttatttgaga ctgacaccaa 360 tacaagcggc
gataaacatg attcccacta tgatgaagng ccatcatctt atgggtttga 420
gggcttacga cgatccaaac gtaggaacat acaacctgaa ccgntactct gattggggga
480 52 480 DNA soybean misc_feature (1)..(480) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 52 aagctccgcn cggggaacct
nnagagtcta cctgaatccc caagntngaa cgaatacttg 60 ccaacacaaa
tacgggcgat gggaaacatc tgaagaccgc tccaaagcgc cncatactaa 120
attgnnagga aaatttatat ctgacctttc atgggtgggg ggtgcatctg ctataaggaa
180 gggttcattc tgggcaagat ctgtggaaaa caatattggg gatcaaattt
tagggagtga 240 tgctacaacc tcttcattat acatggattc tgaaataagt
ggtgtgaact ttaaagtgaa 300 cgaagacggc atgcaaatgc ctggtattca
tctagttgat ttatttgaga ctgacaccaa 360 tacaagcggc gataaacatg
attcccacta tgatgaagng ccatcatctt atgggtttga 420 gggcttacga
cgatccaaac gtaggaacat acaacctgaa ccgntactct gattggggga 480 53 736
DNA soybean misc_feature (1)..(736) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 53 aatttattta gttgatataa ccactttcaa
aaatctgact tacaagactc tttagaattc 60 ataatagtga cacttgatta
agttagatta gactttataa aacacgagtt tgattttttt 120 tttaataata
attaaggttc tagcttatat atattatata gttgatatag actactttca 180
aaagtctgac ttaaaagtct ctttagtata cataataata taacctttta atttagttaa
240 aaaatttgtc cctaaataaa ttaataaatc caaacttata tacaagttaa
taggcttaag 300 tcttaaaaaa ataatatata tatatatata taaagcatta
aaacatttca atgaaaacaa 360 tataataata ataataataa atatattatt
gttattaatt catagatttt attattacta 420 ttatagaata atttgtgtgt
atatatataa atatatagag agagagaggg tcattttata 480 tgagtgagaa
aatttaaata ttattatgaa ttttcaaaat taaaatcaca tgccatatga 540
ttttcttaaa aaattacgta actttttttt ttacaaaagt aatcatatgg ttttaaaaac
600 taatttaaat aacttatata taactatatc agntaaaatt ngggtcataa
aataagtata 660 tcagntattt tacaaaaatt ataagtnttc ataaataaat
accaaatgat agtcccaggn 720 gatgggncag cttnng 736 54 642 DNA soybean
misc_feature (1)..(642) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 54 ttaactttac acaacacacc accagagtgt aagctgtttc
ataaaaaatg attgtttcgg 60 gctttcggat cacaaggctt gtttagtatt
cggtaagaaa gaaagaaata ggtgataaat 120 aaagtggata gaaacataaa
agaaaggaat aaagtaatga aaataaggga gaagtagaat 180 aatggaaata
gataagaaat agaatggatt cgatagtata tctagtttaa gagaaataag 240
aaaaaataag aacaagaaaa aaaattgcat tttaatttat tatttgtact gtatcgatga
300 ttggcacgag attataagtt ttttttttcg tgtttacgtt gaaggattat
atatcatacc 360 atttgtttgt caaccaacac ggaactttaa gtctcttgat
gttcaaaagc acttaaaact 420 aaggaatttt acatcatatt agtcgctgta
gactgataca ggattttaag cctatatatc 480 tagcattgat cgggtgtcaa
tcaatatcac attaatgatc ggtaaaccat tcatataacc 540 cctttgattg
gtcaagaaat ggctttatga atncccagga ttgagcccag aagacaggtg 600
atactaggtt caattcatgg ttttaggata ggctcgtaaa cc 642 55 659 DNA
soybean misc_feature (1)..(659) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 55 aaaaggacct aaaagcaaaa agaaaattga
gtatccttag gaattaaaaa tattccaata 60 aaaataaaat aaagatccaa
atgatagtgg gataaccgaa gaggaatgtc tttcaaccac 120 tgcctgaccg
ccaccactgc caacagccta gtatcaaccg aatccacata taccaacaat 180
cttcagacaa acacttctaa gttggtgctg aagagacaat atctcatggg tagatcaaat
240 taagagtgct accaataaca aaatcgggat catttgacta acaaacagtt
atgtgcattg 300 gatgttctac catagtacat tgctttatgt gaaattcttt
taattattca atattgacat 360 gntcttatat atatatatat atatatatat
atatatatat atatacgagg gattgnatta 420 tctctgaaaa aagattttat
cataaaatca taatgatttc tcataatgna tctttacatt 480 ttaaaggtag
ataaataaaa ttgatttaaa tnggnagata taattaaaat acataattaa 540
tatgactttt aaccaaattg atatataaac acttaaaaaa aagttcatga acgnccgggg
600 ngnattggnt gggncaaaaa aaaattaata ctatcaacct aattaaaaat
tatttatan 659 56 805 DNA soybean misc_feature (1)..(805) n is an
undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 56 ccaatgccag
agcttcccta tcgtgggccc cacctatgaa gaatacaccc acgttgaaat 60
acatgttgtt gttgttggac gcgcccagcc gagagtgccg gtccacgagt atccccaacg
120 tgcatggcgc atgcgcttga aacctagtat tcatcttcct gatggaggca
gccacgtgtc 180 cgacaaggtc aatgttgccg ttttcgtgaa aagggatgat
aatgaaaggc accatattgt 240 cttgggcgag gttgaaaatg gcgtcgtgca
tgctcttgta aggtgccacg ttgatgtagg 300 gaagaacctt gactggccca
cttgagttgt tggagtagtt ttcgaaggct tgcatgatgt 360 ggttggtgtt
ggggtaattc acagacaaga attttctgcg accgtgtcta tgttttatgg 420
gaaggagaat gggtgcactt ttccccacga gctcgataag gtggactgcg tagacgcata
480 tggggctctc ttgcactggg ttgcactctt ctaataaggc agtgatgcca
cgcacgtttg 540 ctttcattat gtacacaaca aaacaatgtg aaaactctct
gtttcttgga ggtgctttgg 600 atcgttctcn agttcccctt cgaataagct
ttctgcgtgn tacttcnagg ggcnnatgct 660 ttgtaccaat atgnttancc
caagggngnt tnccattncn ggtctttact accacnacat 720 aacacccnat
tnnttgaann gnanccnatc caacntctac naaancgtna tcaatnacnt 780
tnnattngat ttganncact ggccn 805 57 632 DNA soybean misc_feature
(1)..(632) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 57 tttagaattc ataatagtga cacttgatta agttagatta gactttataa
aacacgagtt 60 tgattttttt tttaataata attaaggttc tagcttatat
atattatata gttgatatag 120 actactttca aaagtctgac ttaaaagtct
ctttagtata cataataata taacctttta 180 atttagttaa aaaatttgtc
cctaaataaa ttaataaatc caaacttata tacaagttaa 240 taggcttaag
tcttaaaaaa ataatatata tatatatata taaagcatta aaacatttca 300
atgaaaacaa tataataata ataataataa atatattatt gttattaatt catagatttt
360 attattacta ttatagaata atttgtgtgt atatatataa atatatagag
agagagaggg 420 tcattttata tgagtgagaa aatttaaata ttattatgaa
ttttcaaaat taaaatcaca 480 tgccatatga ttttcttaaa aaattacgta
actttttttt ttacaaaagt aatcatatgg 540 ttttaaaaac taatttaaat
aacttatata taactatatc agttaaattt ggttcataaa 600 ataagtatat
cagttatttt acaaaattat aa 632 58 437 DNA soybean misc_feature n is
an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 58
cttttgacac
tatngaatac gaattcgaat gtcggagcgt gcagatacga gggtgagctt 60
gtttaggttt gttatcgtga acaagaaacc gtgtggttgt aaaattattt tgacaagaga
120 agagcgtgaa gaggaagagg aagataccat gttggacgag gggttaattg
acgagttcaa 180 gagcatgaaa tatggcattg gtaacgtttg ttggtacgag
attacggtgg acgatggggt 240 ggaggtgttg gaagcagtgc atagtttgga
aggaaactat gatcttgtga tggtgggaag 300 gcgccacaat gatggatctt
tgaatggaaa agaaatgaca actttcatgg agaacgctga 360 tgcattggga
atattgtggg atatgttccc ttcncccanc ntgnntggcn tngttccgct 420
tttttcgnct ntnngcc 437 59 681 DNA soybean misc_feature (1)..(681) n
is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 59
ggnttcttta gggcttcaaa atttgatcct agatcataac ttttttcact ggtgacgttc
60 ctgcttcttt gggtagctta agagagctca atgagatttc ccttagtcat
aataagttta 120 gtggagctat accaaatgaa ataggaaccc tttctaggct
taagacactt gacatttcta 180 ataatgcctt gaatgggaac ttgcctgcta
ccctctctaa tttatcctca cttacactgc 240 tgaatgcaga gaacaacctc
cttgacaatc aaatccctca aagtttaggt agattgcgta 300 atctttctgt
tctgattttg agtagaaacc aatttagtgg acatattcct tcaagcattg 360
caaacatttc ctcgcttagg cagcttgatt tgcactgaat aatttcagtg gagaaattcc
420 agtctccttt gacagtcaag cgcagctaaa tctcttcaat ggttcctaca
atagcctctc 480 agggtctgcc cccctctgct tggcaagaaa tttaactcaa
gctcatttgt gggaaatatt 540 caactatgtg gggtacagcc ttcaacccca
tggctttcca agctncatca caagggggca 600 ttggccccct cctgagnggc
aaacatcacc atcataggaa gctaacccca aagacataat 660 tctcatagta
nccaggaggt n 681 60 644 DNA soybean misc_feature (1)..(644) n is an
undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 60 acaacaagca
acgaacagct tttaacctta aactaggcta atgccaatat taaagaagaa 60
ataattaaaa ttgtaaggct ggtcgtgtat aaattaaaca aaaggccctc tattcaaacc
120 ttcatatatc atacctgttt ttaattaacg cggactactt tttcatataa
aaaaaagatc 180 attagaggat taatttaaag cgttttagtt tttaattacc
aaagagtata attattatta 240 ggcgctttgt cccacaatca atcacctaaa
caagaaaaag aaaaagaaaa aaaaagtcaa 300 attggactaa tgcaaaagtg
gcacaatctt tgtcttgaac tctttaatta gcaacaaatt 360 atactcttct
gcacaaatca caagaatacc ttacatgaaa agaatggtaa tttgacgggt 420
tacattaaat tatatgcagt tttctgcagg taattaattt tcaagaattt aagggtgggt
480 ggtaattttc aatagctagc ttgactagca aaggaaagaa taaaggtaaa
atgcttcttg 540 gtttggcctt ttggattggt atactttttg ctaaacggaa
atggttatat gaatggtaaa 600 ggagataaat tggtacatag ctaaaatggt
atagncttaa tccn 644 61 678 DNA soybean misc_feature (1)..(678) n is
an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 61
aaattcattt aacttctcta atttttaaat cgatcaaatt tggtttttca atctaaaata
60 taagaaacta tattttgtga tgggtttaaa atcgacatta agtgttctta
atctaccaca 120 aaaagcacat ttccaaaaaa ataaattaat tttaaaaatt
ataagatcaa attgaatcaa 180 ttttaaaaat taaaatatta aattgaaaaa
aaaaataaag gatcaaattg aacataaata 240 ataaatttga ggattaaaaa
actaatttaa cctttaattt tttctcactt atattaatat 300 taaaaaatta
tattgatttt cctaataact ccttatctca attaaaattt ccaaaaatta 360
attctagcat cttcaaacac tactcaccat gaaagttcat cacaaccatc tttctttctc
420 ttttctctac atcatgtttt cgcttcgcaa actttattgt gttcctagtc
ttagacgtct 480 gataatcttc cacaagtatt gaactataac acttattgga
cttgcaccgg taatagctaa 540 caccaaatga gacgtgcact tgacttttat
atcactaaga aaatttcaac acattgacca 600 agattagctc catcttgctt
taacacttgg ttgactagtc acttaagtgc aacaaccact 660 ttgatatcat tgggtgga
678 62 571 DNA soybean misc_feature (1)..(571) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 62 tcttttaaga ccattcgaca
ctatagaata cgaattccat aattaacaat aaagtcatct 60 tctattatat
attttttctt cttaaattac atgatagtat ttcatcatta tttgacaata 120
atgatatttt tatctcataa atattatttt gttttaaaaa tattcatagc acacacgagt
180 tttttatatc aacaaagagg tatcacttca gttggtcaat ttggtctaac
ttttagacaa 240 tgtcgtatag ttgaattgaa ttggaatttg gcagtatata
ttttactttt tgccccctta 300 ttttcaatca aattagagta gacgcctcgt
attattggca tacatggata ttggatcggc 360 acctgtgttt cagacctgag
tcacatctga ctcggatcga ttttatctta catgaaaatt 420 ccaaaataat
gaaagatatg gcaattggca ccatgtaact ctatggacac caatgcttca 480
ccgtagagct ctaaatttcg aggccttcta tatatagctt tgcgtgacta tgtnaaatta
540 ntcaatatcn tnttaatttt tttgnggccc c 571 63 856 DNA soybean
misc_feature (1)..(856) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 63 aattagttgt cttgtttatt cattaccttt tcaatttttt
taatcaccat aattaaggcc 60 tttcgaatcc ctttaagtga taaaagaaac
gtgcaattat gcgaacaaat aaattttcgt 120 tatgttacta tttagtcaag
gaggaaaaaa aagtgataag ggaagaaaca agggatattt 180 cctgttataa
caaacttaaa atggcgacta ttttgacgac attgcaaata ctcatagtac 240
gatataaatt ttgaatttaa tatacaatga ataggcatat tcattttcta ccccaaaaaa
300 gcatactcat ttatgtacat ttaattttct ctccatagag gaattaatgt
acaaccatgc 360 ataagggatg agcgaaaggg acagattatt gcaatccaga
agcatccaag gaaagttgga 420 taaacaaatc aattaatata tataaaaaaa
aaacaaaaat gctcctagta gaagattaaa 480 ggaagagttg gctatatatg
gcaaaccttt tctaactggt ttaccctctt ctcatcaccc 540 gcattgcatc
accaatacgg gaacttttcc cattacaaaa ctcattggaa gccaacatat 600
cccccaaaat tccactggat ctgcattgtc catgaaattt gacatttctt cttctacaaa
660 attcccatgc tatgtcgttt tccaccatcc taggtcatag tccttcttca
ttccccgaat 720 cgnttcacac ttgtatgcaa tcttccaccc cagcctcatg
ggaaacaccg ntaacactat 780 cactctaata tcattcttgg cataaactca
tctataaacc tctcgnccac gggctcttta 840 aattctcatc ttnttn 856 64 639
DNA soybean misc_feature (1)..(639) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 64 tcccctttgg gtcccaagta ataggccctc
agagccaaaa cattggggtg tctaattttt 60 cctagaacac tgacttctga
ttcaaattct ctatgacctt tagtgatctt ttccctcaat 120 ctctttactg
caacttgact tccatcctcc aaaatagcct tataaacagt tccataggtg 180
ctctttccca tgatctcagc tgttgcacac aagagatcat cagctgtaaa agccattggt
240 ccatcaaaat ggactagttt ccctccagcc tccccacctg cttcaacatc
accaccagca 300 actggaggga ctcctttttc tgtcctcata gtggccgctc
taccctcggt ggcttggccg 360 tcccggcctt agatgttgat ctctttctga
tcaggcagaa aagcaggaca caacaaagta 420 taatcaggac tacgaggaga
actcctgcta ctatgagaat tatgtctttg ggcttagctt 480 ctatgatggt
gatggtttga cacttcagga ggtggggcaa tgactccttg tgatggagct 540
tgggaaagac atggggttga agggctggac ccacatagtt gaatatttcc acaaatgagc
600 ttgagttaaa attcttggca agcananggg ggacagaan 639 65 495 DNA
soybean misc_feature (1)..(495) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 65 ttcccaatgc cggagcttcc ctatcgtggg
ccccacctat gangaataca ccctcgaatg 60 aaatacatgt tgttgntgnt
ggacgcgccc agccgagagt gccggtccac tagtatcccc 120 aacgtgcatg
gcgcatgcgc ttgaaaccta gtattcatct tcctgatgga ggcagccacg 180
tgtccgacaa ggtcaatgtt gccgttttcg tgaaaaggga tgataatgaa aggcaccata
240 ttgtcttggg cgaggttgaa aatggcgtcg tgcatgctct tgtaaggtgc
cacgttgatg 300 tagggaagaa ccttgactgg cccacttgag ttgttggagt
agttttcgaa ggcttgcatg 360 atgtggttgg tgttggggta attcacagac
aagaattttc tgcgaccggg tctatgtttt 420 atgggaagga gaatgggtgc
acttttccca cgagctcnat aagggggact gcntanacnc 480 atatggggct ctctt
495 66 480 DNA soybean misc_feature (1)..(480) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 66 cnttcttaga atcgaattct
ttggtatcag aacatatcag tcatttttaa agaataagaa 60 attaaattag
acttaatttt taagagtatg gattaaaatg taaaatttgt ggggattata 120
aacataaata agtaattttt cctatatgag acatttattg aaatcttaag ataagatacg
180 tacatgcaaa ttaaattgat gcatgataat agaattaggt gaatagtcca
atacctgaca 240 cctctttggt ccgaagtttt tggggcactt cttgatacct
aaacccacag tgaagaagag 300 gctctggtca atttcagtgg gtacttcaac
ttttctaggg cttctgaagc ttttgctgaa 360 ggaagtgact gcgtttgtgt
ccgttgtaag cagggagtgg aggcattata ggtttggttt 420 tgttctttac
tcctttggca cgatggtgag aatgcttatt gtggtgattc ggtgatttgt 480 67 669
DNA soybean misc_feature (1)..(669) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 67 atgcccaaaa aatttaccta aaagcaaata
aaaaagatga gtatttcttt taaattaaaa 60 atattttaat aaaaataaaa
taaagatcca aatgataatg tgataaccga agaggaatgt 120 ctttcaacca
ctgcctgacc gccaccactg ccaacagcct agtatcaacc gaatccacat 180
ataccaacaa tcttcagaca aacacttcta agttggtgct gaagagacaa tatctcatgg
240 gtagatcaaa ttaagagtgc taccaataac aaaatcggga tcatttgact
aacaaacagt 300 tatgtgcatt ggatgttcta ccatagtaca ttgctttatg
tgaaattctt ttaattattc 360 aatattgaca tgggtcttat atatatatat
atatatatat atatatatat atatatacga 420 gggattgtat tatctctgaa
aaaagatttt atcataaaat cataatgatt tctcataatg 480 gatctntaca
ttttaaaggt agataaataa aattgatttt aaatngggag atataattaa 540
aanacataat taatatgact tttaacaaat tgatatataa acacttaaaa aaaagntcca
600 tgacgcacng ggggnattgg tgggacaaaa aaaattatct atcactaatt
aaaantatta 660 taaatatan 669 68 486 DNA soybean misc_feature
(1)..(486) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 68 tggtgtatat aattaaaatg agtttaatat ttatgtatta atagtataaa
atttatcata 60 catgatgaat ggtgaaattt tgaattatga ttaaataatt
atataaaaaa atttacatga 120 tgaatgaata actttttttt tctcaattaa
aattatgatc ctttgtcgat atgttttact 180 gtgtcgacct tttttttcgg
gggagagggg accagtagga gaagtagtat ttagtaaaag 240 aagggagaga
gaagttgact tatcctttaa ttagtttaga gaaaattaga cgagaaggaa 300
aaaaaatagg cgaaagtcac tttttctttc tatctctacc aagaatgttg atgaaaaagt
360 ggggagcaga attttaaatt tttattttca tatttatcct tctccacatt
tttgntttct 420 tccatttttt tataaaanga tttattttag gcatagntaa
cttttcaatt tttttcattt 480 ctattc 486 69 779 DNA soybean
misc_feature (1)..(779) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 69 tatttgtaaa ttgtttttta taattgaaaa gaaaataagg
ttaaattatt ttcatataaa 60 aaatttaatt tgttcttata agttattttg
aaaattttat taaaataagt tgaaaacaat 120 ttataaataa atcataaact
ataattttat aagttttctt aaatacttac acgtatgcca 180 taaaataagt
tcagataaga tataaataaa ttcctccaaa cacatcttaa atctatattt 240
ttttaaaaca aactttcatc gttaaaagga tattataata ataataataa acttcaatca
300 ttaacaatta atatatgtgg ataaaagagc attcaaaatg atattttatt
agcacatgac 360 aaatcacatt actctcaagc tattttttta aactaataaa
aacttacata ttatatgata 420 tgatatatac tctctctata tttacacttt
tttgagataa acaaggataa aaaatgatgt 480 aaatatgacc gcatataata
ttatttataa tgtacggaat gccgtttttg acattttata 540 taatatatct
gggggcaatt attttcttaa ccaataatta gcaaattttt atcttgcttt 600
ttctccatgg gggctaaatt aaactaaagg gncgtaccca atccagtccc actttttttt
660 aaataattnn tttccntccc acttagnaaa ggagtntttn ggcttaaatn
ggcagnncca 720 ttaaccataa gcctttntgg taaggagtct taccaantaa
aatggggaag gcccccccc 779 70 677 DNA soybean misc_feature (1)..(677)
n is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 70
ttattggctt aacttgagtt tcaactcctt ctctggtcct ttaccagcta gcctaactca
60 ctcattttct ctcacttttc tttctcttca aaataacaat ctttctggct
cccttcctaa 120 ctcttggggt gggaattcca agaatggctt ctttaggctt
caaaatttga tcctagatca 180 taactttttc actggtgacg ttcctgcttc
tttgggtagc ttaagagagc tcaatgagat 240 ttcccttagt cataataagt
ttagtggagc tataccaaat gaaataggaa ccctttctag 300 gcttaagaca
cttgacattt ctaataatgc cttgaatggg aacttgcctg ctaccctctc 360
taatttatcc tcacttacac tgctgaatgc agagaacaac ctccttgaca atcaaatccc
420 tcaaagttta ggtagattgc gtaatctttc tgttctgatt ttgagtagaa
accaatttag 480 tggacatatt ccttcaagca ttgcaaacat ttcctcgctt
aggcagcttg atttgcactg 540 aataatttca gtggagaaat tccagctcct
ttgcagtcag cgcagctaaa tctcttcaat 600 ggttcctaca atagcctctc
anggtctgtc ccccctctgc ttgccaagaa atttaactca 660 agctcatttg tgggaat
677 71 571 DNA soybean misc_feature (1)..(571) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 71 tgggactggc tgtgactgat
ctctctggtc taatctcttc cagctgctgg agaacttgat 60 gaacttctgg
tcgtgctgat ggagaaggat caacacagtg caaagcgagc ttcaacgtgt 120
ttagcaactc gtcgccaact gtggatgcat ctctcatcaa gtctgcatca aaaacctcat
180 ttgtccactc ctctttgaca actgaggcaa cccactgagg caaatctagt
ccattcatag 240 acaccccagg tgatttcctc gttaggagtt ctaacaagat
aacaccaaga ctgtagatat 300 cagttttagt gtttgctttc ttgagctttg
agagctcagg tgcccggtat cccaatgctt 360 cagctgtagc tatcacgttg
gaattagcag cagttgacat caaccgagaa agaccaaaat 420 ctgcaatttt
agcatttgna ttctcattaa acaacacaat gntggatgng anggtnccat 480
ggatgaaggt cttctnggna agnaagnaaa acaaagcacc gggccaaggn ttgggctaat
540 ttcaaccttg gggggcaaac naanaaatgt t 571 72 756 DNA soybean
misc_feature (1)..(756) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 72 attggcttaa cttgagtttc aactccttct ctggtccttt
accagctagc ctaactcact 60 cattttctct cacttttctt tctcttcaaa
ataacaatct ttntggctcc cttnctaact 120 gtgggggggg gaatancaag
ggnggcttta ggctgcaaaa tttgatccta gatcataact 180 ttttcactgg
tgacgttcct gcttctttgg gtagcttaag agagctcaat gagatttccc 240
ttagtcataa taagtttagt ggagctatac caaatgaaat aggaaccctt tctaggctta
300 agacacttga catttctaat aatgccttga atgggaactt gcctgctacc
ctctctaatt 360 tatcctcact tacactgctg aatgcagaga acaacctcct
tgacaatcaa atccctcaaa 420 gtttaggtag attgcgtact ctttcctgtt
ccgattttga gtagaaacca atttagtgga 480 catattcctt caagcatngc
nnacatttcc tcgcttaggc agcttgattg tcactgaata 540 atttcaggtg
gagaaattnc agtctncttt gacagtcagc gcagtctaaa tcttcttcaa 600
tggttnctac aataggcctc tcagggtctg gccccccttt gnttggccaa ggaaanttaa
660 cttaagctta tttggngggg aaanattcaa ctatgggggg acncggccct
ttaaacccca 720 gggnttttcc caggttcctt ccaagggngc anttgt 756 73 557
DNA soybean misc_feature (1)..(557) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 73 tgtgactgat ctctctggtc taatctcttc
cagctgctgg agaacttgat gaacttctgg 60 tcgtgctgat ggagaaggat
caacacagtg caaagcgagc ttcaacgtgt ttagcaactc 120 gtcgccaact
gtggatgcat ctctcatcaa gtctgcatca aaaacctcat ttgtccactc 180
ctctttgaca actgaggcaa cccactgagg caaatctagt ccattcatag acnccccagg
240 tgatttcntc gttaggagtt ntaacaagat aacaccaaga ctgtagatat
cagttttagt 300 gtttgctttc ttgagctttg agagttaagg gncccggant
cccanngntc nagttgnagt 360 tatancgttg gaattagcag nagttgcntc
aaccgaaaaa gaccaaaatc tgaattttag 420 catttgtttt tcatcaagca
acacattgnt ggatgngagg tcccatgtat gatgttctcc 480 tgggaatgaa
ggcaaacaag cccgggccaa ggcttgggct attttaatcc ttggtggcca 540
aacaatgaaa ggttnat 557 74 673 DNA soybean misc_feature (1)..(673) n
is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 74
gggactggct gtgactgatc tctctggtct aatctcttcc agctgctgga gaacttgatg
60 aacttctggt cgtgctgatg gagaaggatc aacacagtgc aaagcgagct
tcaacgtgtt 120 tagcaactcg tcgccaactg tggatgcatc tctcatcaag
tctgcatcaa aaacctcatt 180 tgtccactcc tctttgacaa ctgaggcaac
ccactgaggc aaatctagtc cattcataga 240 caccccaggt gatttcctcg
ttaggagttc taacaagata acaccaagac tgtagatatc 300 agttttagtg
tttgctttct tgagcttttg agaagctcag gtgcccggta tcccaaatgc 360
ttccagctgt agcttatcac cgttgggaat taagcagcaa gttggacatt caacccggag
420 naaaagaccc aaaaattttg caaattttta agcaatttng gnanttcttn
aatcaaggcc 480 aaccaccaat tggnttggga atggtggaag ggtttcccca
atggtaattg gaagggtttc 540 ttccctnggg gaaaatggaa aggggcaana
aaacaaaggc ccaacngggg ccccaaaggt 600 nttttggggg ccttattttt
tncnaatncc ctttggnngg ggncccaaat tcnaaantgg 660 aaattggntt tnn 673
75 602 DNA soybean misc_feature (1)..(602) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 75 aggctagctg gtaaaggacc
agagaaggat ttgaaactca agttaagcca ataaagctta 60 gtggaattag
caagactata agggattgct cctgtgagca agttgttgct gaggtcaaga 120
gactgaagca aagggcagaa acctaaagaa agaggtatgg aacctgtaag cctattgttg
180 aataactgaa cccctctaag gttgggaaga agtcccaaag ttgaagggat
tgaaccacca 240 atttggttat catgaagact aagcttcctg aggccttgaa
gttggccaat tttggcggtg 300 attcgacccc tcaaaccctt ccaaggaagc
tggatcacaa taacctgtcc ctgagcacac 360 ttgattccaa cccaacctcc
ggaacaagct ccatagccac tggcattcca gctcccgcaa 420 gaacccttct
ggatcagcca actcttgctt gaaagcttat cacatgtacc tctctacaga 480
taggagggtg cttcttccct ttcactggnc tacctcttcg ggaataagcc acctaatgag
540 aaagaaagan ctgggatagc taactctaca tagnctcaag gcnagagata
attagggaaa 600 ng 602 76 748 DNA soybean misc_feature (1)..(748) n
is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 76
attggcttaa cttgagtttc aactccttct ctggtccttt accagctagc ctaactcact
60 cattttctct cacttttctt tctcttcaaa ataacaatct ttctggctcc
cttcctaact 120 cttggggtgg gaattccaag aatggcttct ttaggcttca
aaatttgatc ctagatcata 180 actttttcac tggtgacgtt cctgcttctt
tgggtagctt aagagagctc aatgagattt 240 cccttagtca taataagttt
aatggagctg taccaaatga aataggaacc ctttctaggc 300 ttaagacact
tgacatttct aataatgcct tgaatgggaa cttgcctgct accctctcta 360
atttatcctc acttacactg ctgaatgcag agaacaacct ccttgacaat caaatccctc
420 aaagtttagg tagattgcgt aatctttctg ttctgatttt gggtagaaac
caatttagtg 480 gacatattcc ttcaagcatt gcaaacattt cctcgcttag
gcagcttgat ttgcactgaa 540 taatttcagt ggagaaattc cagtctcctt
tgacagtcaa gcgcaagtct aaatctcttc 600 aatgtttcct acaatagcct
ctcanggtct gncccccctc tgcttgccaa gaaatttaac 660 tcaagctcat
ttgtgggaaa tattcaacta tgtgggacag nccttcaacc ccatgttttn 720
ccaagcttca tacaaggagc atggccct 748 77 563 DNA soybean misc_feature
(1)..(563) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 77 ctggctgtga ctgatctctc tggtctaatc tcttccagct gctggagaac
ttgatgaact 60 tctggtcgtg ctgatggaga aggatcaaca cagtgcaaag
cgagcttcaa cgtgtttagc 120 aactcgtcgc caactgtgga tgcatctctc
atcaagtctg catcaaaaac ctcatttgtc 180 cactcctctt tgacaactga
ggcaacccac tgaggcaaat ctagtccatt catagacacc 240 ccaggtgatt
tcctcgttag gagttctaac aagataacac caagactgta gatatcagtt 300
ttagtgtttg ctttcttgag ctttgagagc tcaggtgccc ggtatcccaa tgctccagct
360 gtagctatca cgttggaatt agcagcagtt gacatcaacc cgagaaagac
caaaatctgc 420 aattttagca tttgtattct catcaagcaa cacattgctg
gatgtgaggt tcccatgtat 480 gatgttctcc tgggaatgaa ggcagaacaa
gccacggcca agcttggcta tttcatcctt 540 gtggccaatc aatgaatggt cat 563
78 623 DNA soybean misc_feature (1)..(623) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 78 gattttgcac atctacttga
gtaggcttca catgattccg tgtattactt ttattttggt 60 atatatacca
tgtggagtat agtatcactt tttgtcctac aaccacattt tatgagactt 120
gcattttatg tgacatgaac ataaaaaata atgaaaaaga aaatgtcaca tatatatgat
180 acaatctttt taaaagtcaa tttgaataat ttttcatcag gaggaaaaag
aagagagaaa 240 atgaattaag tttcttctaa aaattaaaat caacttataa
aaagaaaaaa ctttaatgaa 300 aaaaattcaa aaagaaaaag aataaaatga
tcaatagcct ttaggtttaa gcacaaggtg 360 aatccaaata aagaccccaa
aagatagtac agaacccaac aatggtaaaa tctagaaata 420 tacatgtaaa
gactgcattt atagaccatc atgactagca aatgcttaaa ggcacataga 480
tgaattaatc tatgcaacaa aatctgnccc aagttttttt tangcaagga aaatcatatc
540 attttattaa ggataactga gaggaccaat ggtgtaatca attgaaatca
tgcgaggctt 600 acatgaaatc tgtcaccaag tac 623 79 605 DNA soybean
misc_feature (1)..(605) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 79 ctcccgggtc ccaagtaata ggcccctcag agccaaaaca
ttgggggggc taatttttcc 60 tagaacactg acttctgatt caaattctct
atgaccttta gtgatctttt ccctcaatct 120 ctttactgca acttgacttc
catcctccaa aatagcctta taaacagntc cataggtgct 180 ctttcccatg
atctcagctg gtgcacacaa gagatcatca gctgtaaaag ccattggtcc 240
atcaaaatgg actagtttcc ctccagcctc cccacctgct tcaacatcac caccagcaac
300 tggagggact cctttttctg cctcatagtg gccgctctac cctcggtggc
ttggccgntc 360 ccggccttag atgntgatct ctttctgatc aggcagaaaa
gcaggacaca acaaagnata 420 atcaggacta cgaggagaac tcctgctact
atgagaatta tgnctttggg gcttagcttc 480 ctatgatggg gatggttnga
cacttcanga gggggggcaa tgactccctg gganggagct 540 tgggaaagac
atgggggtga aggnctgnac ccacataggn gaaaaattcc cacaaangag 600 cnngn
605 80 711 DNA soybean misc_feature (1)..(711) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 80 ttaangncca acgactcact
atagggcgaa ttgggcccga cgtcgcatgc tcccggccgc 60 catggccgcg
ggattggctt aacttgagtt tcaactcctt ctctggtcct ttaccagcta 120
gcctaactca ctcattttct ctcacttttc tttctcttcn taaaataaca atctttctgg
180 ctcccttcct aactcttggg gtgggaattc caagaatggc ttctttaggc
ttcaaaattt 240 gatcctagat cataactttt tcactggtga cgttcctgct
tctttgggta gcttaagaga 300 gctcaatgag atttccctta gtcataataa
gtttagtgga gctataccaa atgaaatagg 360 aaccctttct aggcttaaga
cacttgacat ttctaataat gccttgaatg ggaacttgcc 420 tgctaccctc
tctaatttat cctcacttac actgctgaat gcagagaaca acctccttga 480
caatcaaatc cctcaaagtt taggtagatt gcgtaatctt tctgttctga ttttgagtag
540 aaaccaattt agtggacata ttccttcaag cattgcaaac atttcctcgc
ttaggcagct 600 tgatttgtca ctgaataatt tcagtggaga aattccagtc
tcctttgaca gtcagcgcag 660 tctaaatctc ttcaatgttt cctacaatag
cctctcaggg tctgtccccc n 711 81 716 DNA soybean misc_feature
(1)..(716) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 81 ttnntgaaaa ccctttgcta tttaggtgac actatagaat actcaagcta
tgcatccaac 60 gcgttgggag ctctcccata tggtcgacct gcaggcggcc
gcactagtga ttaatacgac 120 tcactatagg gctcgagcgg ccgcccgggc
aggtgggact ggctgtgact gatctctctg 180 gtctaatctc ttccagctgc
tggagaactt gatgaacttc tggtcgtgct gatggagaag 240 gatcaacaca
gtgcaaagcg agcttcaacg tgtttagcaa ctcgtcgcca actgtggatg 300
catctctcat caagtctgca tcaaaaacct catttgtcca ctcctctttg acaactgagg
360 caacccactg aggcaaatct agtccattca tagacacccc aggtgatttc
ctcgttagga 420 gttctaacaa gataacacca agactgtaga tatcagtttt
agtgtttgct ttcttgagct 480 ttgagagctc aggtgcccgg tatcccaatg
ctccagctgt agctatcacg ttggaattag 540 cagcagttga catcaaccga
gaaagaccaa aatctgcaat tttagcattt gtattctcat 600 caagcaacac
attgctggat gtgaggttcc catgtatgat gttctcctgg gaatgaaggc 660
agaacaagcc acgggccaag tcttgggcta ttttcatcct tggtgggcca atcaan 716
82 713 DNA soybean misc_feature (1)..(713) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 82 ttcctaangc ctacgactcc
tatagggcga attgggcccg acgtcgcatg ctcccggccg 60 ccatggccgc
gggattatac gactcactat agggctcgag cggccactat gaggacagaa 120
aaaggagtcc ctccagttgc tggtggtgat gttgaagcag gtggggaggc tggagggaaa
180 ctagtccatt ttgatggacc aatggctttt acagctgatg atctcttgtg
tgcaacagct 240 gagatcatgg gaaagagcac ctatggaact gtttataagg
ctattttgga ggatggaagt 300 caagttgcag taaagagatt gagggaaaag
atcactaaag gtcatagaga atttgaatca 360 gaagtcagtg ttctaggaaa
aattagacac cccaatgttt tggctctgag ggcctattac 420 ttgggaccca
aaggggaaaa gcttctggtt tttgattaca tgtctaaagg aagtcttgct 480
tctttcctac atggtaagtt tcgtgtgctg ttctttcatt aagtgttgtg tgtgctgttc
540 tttaattata atttggagtt ttaccttagt aatctgtata attctaatcg
gagaacagta 600 caaacaaaaa cacctaagga acaacacctt anctttaata
taccatatca ataagtgaat 660 tattttctta ttcatcttga tgcaggtggt
ggaactgaaa catttatttg atn 713 83 712 DNA soybean misc_feature
(1)..(712) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 83 nnnctaaggc ccnttactca ctatngggcg aattgggccc gacgtcgcat
gctcccggcc 60 gccatggccc gcgggattgg cttaacttga gtttcaactc
cttctctggt cctttaccag 120 ctagcctaac tcactcattt tctctcactt
ttctttctct ttaaaataac aatctttctg 180 gctcccttcc taactcttgg
ggtgggaatt ccaagaatgg cttctttagg cttcaaaatt 240 tgatcctaga
tcataacttt ttcactggtg acgttcctgc ttctttgggt agcttaagag 300
agctcaatga gatttccctt agtcataata agtttagtgg agctatacca aatgaaatag
360 gaaccctttc taggcttaag acacttgaca tttctaataa tgccttgaat
gggaacttgc 420 ctgctaccct ctctaattta tcctcactta cactgctgaa
tgcagagaac aacctccttg 480 acaatcaaat ccctcaaagt ttaggtagat
tgcgtaatct ttctgttctg attttgagta 540 gaaaccaatt tagtggacat
attccttcaa gcattgcaaa catttcctcg cttaggcagc 600 ttgatttgca
ctgaataatt tcagtggaga aattccagtc tcctttgcag tcagcgcagt 660
ctaaatctct tcaatggttn ctacaatagn ctctcagggt ctgncccccc tn 712 84
681 DNA soybean misc_feature (1)..(681) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 84 ggnttcttta gggcttcaaa
atttgatcct agatcataac ttttttcact ggtgacgttc 60 ctgcttcttt
gggtagctta agagagctca atgagatttc ccttagtcat aataagttta 120
gtggagctat accaaatgaa ataggaaccc tttctaggct taagacactt gacatttcta
180 ataatgcctt gaatgggaac ttgcctgcta ccctctctaa tttatcctca
cttacactgc 240 tgaatgcaga gaacaacctc cttgacaatc aaatccctca
aagtttaggt agattgcgta 300 atctttctgt tctgattttg agtagaaacc
aatttagtgg acatattcct tcaagcattg 360 caaacatttc ctcgcttagg
cagcttgatt tgcactgaat aatttcagtg gagaaattcc 420 agtctccttt
gacagtcaag cgcagctaaa tctcttcaat ggttcctaca atagcctctc 480
agggtctgcc cccctctgct tggcaagaaa tttaactcaa gctcatttgt gggaaatatt
540 caactatgtg gggtacagcc ttcaacccca tggctttcca agctncatca
caagggggca 600 ttggccccct cctgagnggc aaacatcacc atcataggaa
gctaacccca aagacataat 660 tctcatagta nccaggaggt n 681 85 639 DNA
soybean misc_feature (1)..(639) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 85 tcccctttgg gtcccaagta ataggccctc
agagccaaaa cattggggtg tctaattttt 60 cctagaacac tgacttctga
ttcaaattct ctatgacctt tagtgatctt ttccctcaat 120 ctctttactg
caacttgact tccatcctcc aaaatagcct tataaacagt tccataggtg 180
ctctttccca tgatctcagc tgttgcacac aagagatcat cagctgtaaa agccattggt
240 ccatcaaaat ggactagttt ccctccagcc tccccacctg cttcaacatc
accaccagca 300 actggaggga ctcctttttc tgtcctcata gtggccgctc
taccctcggt ggcttggccg 360 tcccggcctt agatgttgat ctctttctga
tcaggcagaa aagcaggaca caacaaagta 420 taatcaggac tacgaggaga
actcctgcta ctatgagaat tatgtctttg ggcttagctt 480 ctatgatggt
gatggtttga cacttcagga ggtggggcaa tgactccttg tgatggagct 540
tgggaaagac atggggttga agggctggac ccacatagtt gaatatttcc acaaatgagc
600 ttgagttaaa attcttggca agcananggg ggacagaan 639 86 661 DNA
soybean misc_feature (1)..(661) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 86 gaaggatggt tattttgaag agaaagaaaa
gtgagagaaa atgagtgagt taggctagct 60 ggtaaaggac cagagaagga
gttgaaactc aagttaagcc aataaagctt agtggaatta 120 gcaagactat
aagggattgc tcctgtgagc aagttgttgc tgaggtcaag agactgaagc 180
aaagggcaga aacctaaaga aagaggtatg gaacctgtaa gcctattgtt gaataactga
240 acccctctaa ggttgggaag aagtcccaaa gttgaaggga ttgaaccacc
aatttggtta 300 tcatgaagac taagcttctg aggccttgaa gttggccaat
tttgtcggtg attcgacccc 360 tcaaaccctt ccaaggaagc tggatcacaa
taacctgtcc ctgagcacac ttgattccaa 420 cccacctccg gaacaagctc
catagccact gtcattccag cttccgcaag aacccttctg 480 gatcagccaa
ctcttgcttg aaaagcttat cacatgtacc ttttacagat aggaggntgc 540
ttcttccttt cactggtcta cctcttcgga ataagccaac ctaatgagaa agaaagatct
600 gngatagctn acttacatac tnagncagag ataattantg naagcnnaag
ttaaacntnt 660 t 661 87 626 DNA soybean misc_feature (1)..(626) n
is an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 87
aattcgtggg ctacaaagga tgaacgtaaa ctatatgcac ctccagctgg ttcaggcttc
60 atatctggct ttacttctat ctcacgcaga tcttctgttg atagtactca
aaatctgtct 120 attccttttg gtccaagctc atacctttct gcacaggctc
gagtagttga tgagtattct 180 atgtcccaga ttatcttaca aaatgtgctt
gatggagggg tcactggtat gttaatagtt 240 gtcactggtg caagccatgt
tacatatgga tctagaggaa ctggagtgcc agcaagaatt 300 tcaggaaaaa
tacaaaagaa aaaccatgca gttatattac ttgaccctga aagacaattc 360
attcgcagag aaggagaagt tcctgttgct gattttttgt ggtattctgc tgcgagaccc
420 tgtagtagaa attgctttga ccgtgctgag attgctcggg ttatgaatgc
tgctgggcgg 480 aggcgagatg ccctcccaca ggtaaaccaa caattacagt
tactaatttg tttgactgtt 540 aatcttcttg ccccatagac cctncttcca
atttttagcc ctttatgtcc tctcattcct 600 agngggataa gggtttgggg gnggtg
626 88 627 DNA soybean misc_feature (1)..(627) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 88 tgaaaaactg aaggaccaaa
ttaaatctaa aaaataaata aattaaaaga ctaaaaaata 60 aatctatcca
aaattaaaag gtttattctt ggaagtaatg aaatgtattt tgactctttg 120
aagaatgcat tactataatg aaagagtagg tggagagagg ggataataaa atcccactaa
180 ataacatcca tgactatcac tataaaaaaa aatattatta ttaagataag
aagaattatc 240 taacttgaat aagagactac taccaaagtg agaaaaaggt
cttataacat agagtttttc 300 aagtttacct ataaaacttg taataagatt
tgttttccaa ccatctaatt ttttattagt 360 gtggactgca taaaaaaaat
atagtaacaa gaaactacta aattagactt tttgaactat 420 tcattgtatg
gctgccatga aacctacctg cctggagggg tgggtcccac gtaagactgt 480
aagagggagg agggaagcac tagtcacaca ccggcgcacg ttagcgaggc aatgttccta
540 gattgaaacg gagaaggtga ttagaggggc ggaaatctca aagcagacac
aggcaactaa 600 tttatcgcct ctttcctcat tcgctta 627 89 782 DNA soybean
misc_feature (1)..(782) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 89 cacataatta acaataaagt catcttctat tatatatttt
ttcttcttaa attacatgat 60 agtatttcat cattatttga caataatgat
atttttatct cataaatatt attttgtttt 120 aaaaatattc atagcacaca
cgagtttttt atatcaacaa agaggtatca cttcagttgg 180 tcaatttggt
ctaactttta gacaatgtcg tatagttgaa ttgaattgga atttggcagt 240
atatatttta ctttttgccc ccttattttc aatcaaatta gagtagacgc ctcgtattat
300 tggcatacat ggatattgga tcggcacctg tgtttcagac ctgagtcaca
tctgactcgg 360 atcgatttta tcttacatga aaattccaaa ataatgaaag
atatggtaat tggcaccatg 420 taactctatg gacaccaatg cttcacgtag
agctctaaat ttgaggcctt ctatatatag 480 tttgcgtgac tatgtaaatt
atcaatatca tttaattttt ttgcgaccac gaaatatacg 540 aatttattat
tgaacacaaa aagtagagtg tatattttaa gtctaggatt ttatgagagg 600
caaaaataag aataacctct tgatatattt tcttggatac actttcttta ttatatattt
660 tttaataatg gattataatt tattggaaac aatcaaatta tangggaaaa
ttcattggaa 720 taaaagaang aaatttaaaa aaaaatataa tttttaataa
atttaagtaa taaaaatcct 780 tt 782 90 160 DNA soybean misc_feature
(1)..(160) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 90 tggttgagat gtgtataaga gacagttgcc ccacctcctg aagtgtcaaa
acatcaccat 60 cataggaagc taagcaccaa agacataatt ctcatagtag
caggagttct cctcgtagtc 120 ctgattatac tttgttgtgt cctgcttttc
tgcctgatca 160 91 779 DNA soybean misc_feature (1)..(779) n is an
undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 91 tgctcccggc
gcatggccgn gggattggct taacttgagt ttcaactcct tctctggtcc 60
tttaccagct agcctaactc actcattttc tctcactttt ctttctcttc aaaataacaa
120 tctttntggc tcccttncta actgtggggg ggggaatanc aagggnggct
ttaggctgca 180 aaatttgatc ctagatcata actttttcac tggtgacgtt
cctgcttctt tgggtagctt 240 aagagagctc aatgagattt cccttagtca
taataagttt agtggagcta taccaaatga 300 aataggaacc ctttctaggc
ttaagacact tgacatttct aataatgcct tgaatgggaa 360 cttgcctgct
accctctcta atttatcctc acttacactg ctgaatgcag agaacaacct 420
ccttgacaat caaatccctc aaagtttagg tagattgcgt actctttcct gttccgattt
480 tgagtagaaa ccaatttagt ggacatattc cttcaagcat ngcnnacatt
tcctcgctta 540 ggcagcttga ttgtcactga ataatttcag gtggagaaat
tncagtctnc tttgacagtc 600 agcgcagtct aaatcttctt caatggttnc
tacaataggc ctctcagggt ctggcccccc 660 tttgnttggc caaggaaant
taacttaagc ttatttggng gggaaanatt caactatggg 720 gggacncggc
cctttaaacc ccagggnttt tcccaggttc cttccaaggg ngcanttgt 779 92 743
DNA soybean misc_feature (1)..(743) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 92 ttggcttaac ttgagtttca actccttctc
tggtccttta ccagctagcc taactcactc 60 attttctctc acttttcttt
ctcttcaaaa taacaatctt tctggctccc ttcctaactc 120 ttggggtggg
aattccaaga atggcttctt taggcttcaa aatttgatcc tagatcataa 180
ctttttcact ggtgacgttc ctgcttcttt gggtagctta agagagctca atgagatttc
240 ccttagtcat aataagttta gtggagctat accaaatgaa ataggaaccc
tttctaggct 300 taagacactt gacatttcta ataatgcctt gaatgggaac
ttgcctgcta ccctctctaa 360 tttatcctca cttacactgc tgaatgcaga
gaacaacctc cttgacaatc aaatccctca 420 aagtttaggt agattgcgta
atctttctgt tctgattttg agtagaaacc aatttagtgg 480 acatattcct
tcaagcattg caaacatttc ctcgcttagg cagcttgatt tgtcactgaa 540
taatttcagt ggagaaattc cagtctcctt tgacagtcag cgcagtctaa atctcttcaa
600 tgtttcctac aatagcctct cangttctgn cccccctctg cttgccaaga
aattaactca 660 agctcatttg tgggaaatat tcaactatgt gggacaggcc
ttcaacccca ngctttncca 720 agcttcatca caaggggcat tgg 743 93 742 DNA
soybean misc_feature (1)..(742) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 93 ttaacttgag tttcaactcc ttctctggtc
ctttaccagc tagcctaact cactcatttt 60 ctctcacttt tctttctctt
caaaataaca atctttctgg ctcccttcct aactcttggg 120 gtgggaattc
caagaatggc ttctttaggc ttcaaaattt gatcctagat cataactttt 180
tcactggtga cgttcctgct tctttgggta gcttaagaga gctcaatgag atttccctta
240 gtcataataa gtttaatgga gctgtaccaa atgaaatagg aaccctttct
aggcttaaga 300 cacttgacat ttctaataat gccttgaatg ggaacttgcc
tgctaccctc tctaatttat 360 cctcacttac actgctgaat gcagagaaca
acctccttga caatcaaatc cctcaaagtt 420 taggtagatt gcgtaatctt
tctgttctga ttttgggtag aaaccaattt agtggacata 480 ttccttcaag
cattgcaaac atttcctcgc ttaggcagct tgatttgcac tgaataattt 540
cagtggagaa attccagtct cctttgacag tcaagcgcaa gtctaaatct cttcaatgtt
600 tcctacaata gcctctcang gtctgncccc cctctgcttg ccaagaaatt
taactcaagc 660 tcatttgtgg gaaatattca actatgtggg acagnccttc
aaccccatgt tttnccaagc 720 ttcatacaag gagcatggcc ct 742 94 741 DNA
soybean misc_feature (1)..(741) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 94 cttaacttga gtttcaactc cttctctggt
cctttaccag ctagcctaac tcactcattt 60 tctctcactt ttctttctct
tcaaaataac aatctttctg gctcccttcc taactcttgg 120 ggtgggaatt
ccaagaatgg cttctttagg cttcaaaatt tgatcctaga tcataacttt 180
ttcactggtg acgttcctgc ttctttgggt agcttaagag agctcaatga gatttccctt
240 agtcataata agtttagtgg agctatacca aatgaaatag gaaccctttc
taggcttaag 300 acacttgaca tttctaataa tgccttgaat gggaacttgc
ctgctaccct ctctaattta 360 tcctcactta cactgctgaa tgcagagaac
aacctccttg acaatcaaat ccctcaaagt 420 ttaggtagat tgcgtaatct
ttctgttctg attttgagta gaaaccaatt tagtggacat 480 attccttcaa
gcattgcaaa catttcctcg cttaggcagc ttgatttgca ctgaataatt 540
tcagtggaga aattccagtc tcctttgaca gtcaagcgca gtctaaatct cttcaatgtt
600 tcctacaata gcctctcang ttctgccccc ctctgcttgc caagaaattt
aactcaagct 660 catttgtggg aaatattcaa ctatgtggga caggccttca
accccatgtt tttccaagct 720 ccatcacaag gggcattgcc t 741 95 743 DNA
soybean misc_feature (1)..(743) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 95 cttaacttga gtttcaactc cttctctggt
cctttaccag ctagcctaac tcactcattt 60 tctctcactt ttctttctct
tcaaaataac aatctttctg gctcccttcc taactcttgg 120 ggtgggaatt
ccaagaatgg cttctttagg cttcaaaatt tgatcctaga tcataacttt 180
ttcactggtg acgttcctgc ttctttgggt agcttaagag agctcaatga gatttccctt
240 agtcataata agtttagtgg agctatacca aatgaaatag gaaccctttc
taggcttaag 300 acacttgaca tttctaataa tgccttgaat gggaacttgc
ctgctaccct ctctaattta 360 tcctcactta cactgctgaa tgcagagaac
aacctccttg acaatcaaat ccctcaaagt 420 ttaggtagat tgcgtaatct
ttctgttctg attttgagta gaaaccaatt tagtggacat 480 attccttcaa
gcattgcaaa catttcctcg cttaggcagc ttgatttgca ctgaataatt 540
tcaaggggag aaattncagt ctcctttgac agtcaagcgc aagtctaaat ctcttcaatg
600 gttcctacaa taagcctctc anggtctgnc ccccctctgc ttgncaagaa
aattaactca 660 agctcatttg ggggaaatat tcaactatgn gggacagncc
ttcaacccat gttttccaag 720 ctccatacan gagcatggcc cnt 743 96 742 DNA
soybean misc_feature (1)..(742) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 96 cttaacttga gtttcaactc cttctctggt
cctttaccag ctagcctaac tcactcattt 60 tctctcactt ttctttctct
tcaaaataac aatctttctg gctcccttcc taactcttgg 120 ggtgggaatt
ccaagaatgg cttctttagg cttcaaaatt tgatcctaga tcataacttt 180
ttcactggtg acgttcctgc ttctttgggt agcttaagag agctcaatga gatttccctt
240 agtcataata agtttagtgg agctatacca aatgaaatag gaaccctttc
taggcttaag 300 acacttgaca tttctaataa tgccttgaat gggaacttgc
ctgctaccct ctctaattta 360 tcctcactta cactgctgaa tgcagagaac
aacctccttg acaatcaaat ccctcaaagt 420 ttaggtagat tgcgtaatct
ttctgttctg attttgagta gaaaccaatt tagtggacat 480 attccttcaa
gcattgcaaa catttcctcg cttaggcagc ttgatttgtc
actgaataat 540 ttcaggggga gaaattccag tctcctttga cagtcagcgc
aagtctaaat ctcttcaatg 600 gttcctacaa tagcctctca nggtctgncc
cccctctgct tgncaagaaa ttaactcaag 660 ctcatttgtg ggaaatattc
aactatgngg gacaggcctt caacccatgt ttttccaagc 720 ttcatacaag
gagtaatggc ct 742 97 716 DNA soybean misc_feature (1)..(716) n is
an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 97
ggacagaaaa aggagtccct ccagttgctg gtggtgatgt tgaagcaggt ggggaggctg
60 gagggaaact agtccatttt gatggaccaa tggcttttac agctgatgat
ctcttgtgtg 120 caacagctga gatcatggga aagagcacct atggaactgt
ttataaggct attttggagg 180 atggaagtca agttgcagta aagagattga
gggaaaagat cactaaaggt catagagaat 240 ttgaatcaga agtcagtgtt
ctaggaaaaa ttagacaccc caatgttttg gctctgaggg 300 cctattactt
gggacccaaa ggggaaaagc ttctggtttt tgattacatg tctaaaggaa 360
gtcttgcttc tttcctacat ggtaagtttc gtgtgctgnt ctttcattaa agtgntgggn
420 gggctggtct ttaattataa tttggagttt taccttanta atctgtataa
ttctaatcgg 480 agacaagtca aacaaaaacc ctaaggaaca acnccttanc
tttaatatnc catatcaata 540 angngaatta ttttnttggt tcatttgatg
cnngggggng gnacntnaaa cnttnatttg 600 ntgggccacn anggnnnnaa
aannncacaa ananttggnc cngnggnttn gnnntgcctt 660 tantnccang
anaaacatna tacanggnan ctnncntcnn naangtnntn gttngn 716 98 616 DNA
soybean misc_feature (1)..(616) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 98 ggacagaaaa aggagtccct ccagttgctg
gtggtgatgt tgaagcaggt ggggaggctg 60 gagggaaact agtccatttt
gatggaccaa tggcttttac agctgatgat ctcttgtgtg 120 caacagctga
gatcatggga aagagcacct atggaactgt ttataaggct attttggagg 180
atggaagtca agttgcagta aagagattga gggaaaagat cactaaaggt catagagaat
240 ttgaatcaga agtcagtgtt ctaggaaaaa ttagacaccc caatgttttg
gctctgaggg 300 cctattactt gggacccaaa ggggaaaagc ttctggtttt
tgattacatg tctaaaggaa 360 gtcttgcttc tttcctacat ggtaagtttc
gtgtgctgtt ctttcattaa gtgttgtgtg 420 tgctgttctt taattataat
ttggagnttt accttagtaa tctgtataat tctaatcgga 480 gaacagtcaa
acaaaacacc taaggaacaa caccttagct ttaatatcca tatcaataag 540
tgaatatttt cttggtcatc ttgatgcagg nggnggaact tgaacaatca ttgattggnc
600 caccanggat gaaaat 616 99 532 DNA soybean misc_feature
(1)..(532) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 99 actggctgtg actgatctct ctggtctaat ctcttccagc tgctggagaa
cttgatgaac 60 ttctggtcgt gctgatggag aaggatcaac acagtgcaaa
gcgagcttca acgtgtttag 120 caactcgtcg ccaactgtgg atgcatctct
catcaagtct gcatcaaaaa cctcatttgt 180 ccactcctct ttgacaactg
aggcaaccca ctgaggcaaa tctagtccat tcatagacac 240 cccaggtgat
ttcctcgtta ggagttctaa caagataaca ccaagactgt agatatcagt 300
tttagtgttt gctttcttga gctttgagag ctcaggtgcc cggtatccca atgctccagc
360 tgtagctatc acgttggaat tagcagcagt tgacatcaac cgagaaagac
caaaatctgc 420 aattttagca tttgtattct catcaagcaa cacattgctg
gatgtgaggt tcccatgtat 480 gatgttctcc tgggaatgaa ggcggaacaa
gccacgggcc aagtcttgtg ct 532 100 568 DNA soybean misc_feature
(1)..(568) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 100 tatgaggaca gaaanttnag tccctccagt tgctggtggt gatgttgaag
caggtgggga 60 ggctggaggg aaactagtcc attttgatgg accaatggct
tttacagctg atgatctctt 120 gtgtgcaaca gctgagatca tgggaaagag
cacctatgga actgtttata aggctatttt 180 ggaggatgga agtcaagttg
cagtaaagag attgagggaa aagatcacta aaggtcatag 240 agaatttgaa
tcagaagtca gtgttctagg aaaaattaga caccccaatg ttttggctct 300
gagggcctat tacttgggac ccaaagggga aaagcttctg gtttttgatt acatgtctaa
360 aggaagtctt gcttctttcc tacatggtaa gtttcgtgtg ctgttctttc
attaagtgtt 420 gtgtgtgctg ttctttaatt ataatttgga gttttacctt
agtaatctgt ataattctaa 480 tcggagaaca gtcaaacaaa aaccctaagg
aacacacctt actttaatat accatatcaa 540 taagngaatn atttcttggt catcttga
568 101 678 DNA soybean misc_feature (1)..(678) n is an
undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 101 ggtgggactg
gctgtgactg atctctctgg tctaatctct tccagctgct ggagaacttg 60
atgaacttct ggtcgtgctg atggagaagg atcaacacag tgcaaagcga gcttcaacgt
120 gtttagcaac tcgtcgccaa ctgtggatgc atctctcatc aagtctgcat
caaaaacctc 180 atttgtccac tcctctttga caactgaggc aacccactga
ggcaaatcta gtccattcat 240 agacacccca ggtgatttcc tcgttaggag
ttctaacaag ataacaccaa gactgtagat 300 atcagtttta gtgtttgctt
tcttgagctt tgagagctca ggtgcccggt atcccaatgc 360 tccagctgta
gctatcacgt tggaattagc agcagttgac atcaaccgag aaagaccaaa 420
atctgcaatt ttagcatttg tattctcatc aagcaacaca ttgctggatg tgaggttccc
480 atgtatgatg ttctcctggg aatgaaggca gaacaagcca cgggccaagt
cttgngctat 540 tttcatcctt ggtggccaat caatgaatgg ttcagttnca
ccacctgcat caagatgaac 600 aagaaaataa ttcacttatt gatatggnat
attaaaagct aaggggtggt ccctaggggg 660 tttggttgga ccggncnn 678 102
673 DNA soybean misc_feature (1)..(673) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 102 ggtgggactg gctgtgactg
atctctctgg tctaatctct tccagctgct ggagaacttg 60 atgaacttct
ggtcgtgctg atggagaagg atcaacacag tgcaaagcga gcttcaacgt 120
gtttagcaac tcgtcgccaa ctgtggatgc atctctcatc aagtctgcat caaaaacctc
180 atttgtccac tcctctttga caactgaggc aacccactga ggcaaatcta
gtccattcat 240 agacacccca ggtgatttcc tcgttaggag ttctaacaag
ataacaccaa gactgtagat 300 atcagtttta gtgtttgctt tcttgagctt
tgagagctca ggtgcccggt atcccaatgc 360 tccagctgta gctatcacgt
tggaattagc agcagttgac atcaaccgag aaagaccaaa 420 atctgcaatt
ttagcatttg tattctcatc aagcaacaca ttgctggatg tgagggtccc 480
atgtatgatg ttctcctggg aatgaaggca gaacaagcca cggccaagtc ttgngctatt
540 ttcatccttg ttggccaatc aatgaatggt tcaagttccc cacctgcatc
aagatgaaca 600 agaaaataat tcacttaatg gatatggnat attaaagcta
aggggtggtc cntaggggtt 660 ttgggttgnc cng 673 103 665 DNA soybean
misc_feature (1)..(665) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 103 ggtgggactg gctgtgactg atctctctgg
tctaatctct tccagctgct ggagaacttg 60 atgaacttct ggtcgtgctg
atggagaagg atcaacacag tgcaaagcga gcttcaacgt 120 gtttagcaac
tcgtcgccaa ctgtggatgc atctctcatc aagtctgcat caaaaacctc 180
atttgtccac tcctctttga caactgaggc aacccactga ggcaaatcta gtccattcat
240 agacacccca ggtgatttcc tcgttaggag ttctaacaag ataacaccaa
gactgtagat 300 atcagtttta gtgtttgctt tcttgagctt tgagagctca
ggtgcccggt atcccaatgc 360 tccagctgta gctatcacgt tggaattagc
agcagttgac atcaaccgag aaagaccaaa 420 atctgcaatt ttagcatttg
tattctcatc aagcaacaca ttgctggatg tgagggtccc 480 atgtatgatg
tctnctggga atgaaggcan aacaagccac ggccaagtct tgggctattt 540
tcatccttgt ggncaatcaa tgaatggtta anttcccccc ctgcttcaag atgaacaaga
600 aaataattca cttattggtt gggntatnaa actaaggggn gnccctaggg
gnttngntgn 660 ccnct 665 104 671 DNA soybean misc_feature
(1)..(671) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 104 ggtgggactg gctgtgactg atctctctgg tctaatctct tccagctgct
ggagaacttg 60 atgaacttct ggtcgtgctg atggagaagg atcaacacag
tgcaaagcga gcttcaacgt 120 gtttagcaac tcgtcgccaa ctgtggatgc
atctctcatc aagtctgcat caaaaacctc 180 atttgtccac tcctctttga
caactgaggc aacccactga ggcaaatcta gtccattcat 240 agacacccca
ggtgatttcc tcgttaggag ttctaacaag ataacaccaa gactgtagat 300
atcagtttta gtgtttgctt tcttgagctt tgagagctca ggtgcccggt atcccaatgc
360 tccagctgta gctatcacgt tggaattagc agcagttgac atcaaccgag
aaagaccaaa 420 atctgcaatt ttagcatttg tattctcatc aagcaacaca
ttgctggatg tgaggttccc 480 atgtatgatg ttctcctggg aatgaaggca
gaacaagcca cggccaagtc ttgngctatt 540 ttcatccttg gtggccaatc
aatgaatgtt tcagttccac cacctgcatc aagatgaaca 600 agaaaataat
tcacttattg atatggnata ttaaagctaa ggggtggtcc ntagggggtt 660
tngntggncc c 671 105 670 DNA soybean misc_feature (1)..(670) n is
an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 105
ggtgggactg gctgtgactg atctctctgg tctaatctct tccagctgct ggagaacttg
60 atgaacttct ggtcgtgctg atggagaagg atcaacacag tgcaaagcga
gcttcaacgt 120 gtttagcaac tcgtcgccaa ctgtggatgc atctctcatc
aagtctgcat caaaaacctc 180 atttgtccac tcctctttga caactgaggc
aacccactga ggcaaatcta gtccattcat 240 agacacccca ggtgatttcc
tcgttaggag ttctaacaag ataacaccaa gactgtagat 300 atcagtttta
gtgtttgctt tcttgagctt tgagagctca ggtgcccggt atcccaatgc 360
tccagctgta gctatcacgt tggaattagc agcagttgac atcaaccgag aaagaccaaa
420 atctgcaatt ttagcatttg tantctcatc aagcaacaca ttgctggatg
tgagggtccc 480 atgtatgatg tcctcctggg aatgaaggca gaacaagcca
cgggccaagt cttgggctat 540 tttcatcctt ggtgggccaa tcaatgaatg
gttcaanttc ancacctgcn tcaagangaa 600 caagaaaata attncntatg
gnnnggatat naaactaagg ggnggnccta ggggtntngn 660 nngnccggcn 670 106
662 DNA soybean misc_feature (1)..(662) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 106 ggtgggactg gctgtgactg
atctctctgg tctaatctct tccagctgct ggagaacttg 60 atgaacttct
ggtcgtgctg atggagaagg atcaacacag tgcaaagcga gcttcaacgt 120
gtttagcaac tcgtcgccaa ctgtggatgc atctctcatc aagtctgcat caaaaacctc
180 atttgtccac tcctctttga caactgaggc aacccactga ggcaaatcta
gtccattcat 240 agacacccca ggtgatttcc tcgttaggag ttctaacaag
ataacaccaa gactgtagat 300 atcagtttta gtgtttgctt tcttgagctt
tgagagctca ggtgcccggt atcccaatgc 360 tccagctgta gctatcacgt
tggaattagc agcagttgac atcaaccgag aaagaccaaa 420 atctgcaatt
ttagcatttg tattctcatc aagcaacaca ttgctggatg tgaggttcca 480
tgtatgatgt tctnctggga atgaaggcag aacaagccac gggccaagtc ttgngctatt
540 tcatccttgt gggcaatcaa tgaatgttta anttccncac ctgcttnaga
ggaccaagaa 600 aanattactt attggntggg tattaaagct aagggggggn
cctaaggggn tttggnnggc 660 cc 662 107 792 DNA soybean misc_feature
(1)..(792) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 107 tatttacaac tagtgttatc ggagaatgaa aaattgaaga ataataagtt
cagctataat 60 aaactcgagg gaggaaaaac aaagaaattc atgataaata
gatataactt attaaattta 120 aggggtgtat ttgcacaccc tgaattatag
agattcttat atctttgaga aaataattaa 180 attgggaaaa aagagataat
gactgattga gatttgcctc agaattgttc gttttaatat 240 tggtacgaat
ctaatggntt tatcctgaaa gatgctcaca agtattgagg gactaataaa 300
ttgnttataa actactacta aatgagatga gactttaagg ngtactgaag caatatcatt
360 taaaaaatga ctactcgcat ttgngttgag aaaatttatt ttcatgaaag
naaattttnt 420 ccnttttang ataaagccat ttnncttaac cnnangggga
nataaaatgg cccccnttca 480 taaaaaacct accanctata taaatggatn
tataccaacc ttcctangca ccatgccatt 540 gggatnggng gaattaaatt
naaaangntt gcnttggaat gggtaaaaaa ttccaaaact 600 tnaacccccn
ccacaatttt agtggccacn gnaatattnn ttanccgntg gncttttttc 660
caggaaaacg acccgtaacc aaanggggnn aaaagggaaa gggagatgga ttgcntgnng
720 gtntgaggct catcccnatt cccaaacatg ttngggnccc aaaaccgaag
tncccctgga 780 ccatggatgn cn 792 108 573 DNA soybean misc_feature
(1)..(573) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 108 gggactggct gtgactgatc tctctggtct aatctcttcc agctgctgga
gaacttgatg 60 aacttctggt cgtgctgatg gagaaggatc aacacagtgc
aaagcgagct tcaacgtgtt 120 tagcaactcg tcgccaactg tggatgcatc
tctcatcaag tctgcatcaa aaacctcatt 180 tgtccactcc tctttgacaa
ctgaggcaac ccactgaggc aaatctagtc cattcataga 240 caccccaggt
gatttcctcg ttaggagttc taacaagata acaccaagac tgtagatatc 300
agttttagtg tttgctttct tgagctttga gagctcaggt gcccggtatc caatgctcca
360 gctgtagcta tcacgttgga attagcagca gttgacatca acccgagaaa
gaccaaaatt 420 gcaatttagc anttgnattc ttatnaacaa cacaatggtt
ggatgngang gtnccaagga 480 ttgangtttt ctgggaatga aaggganaaa
caagccccgg gccaaagntt ggggttattt 540 tnaancctgg ngggncaaan
aaangaaagg ttn 573 109 673 DNA soybean misc_feature (1)..(673) n is
an undetermined nucleotide (dATP, dCTP, dGTP, or dTTP) 109
gggactggct gtgactgatc tctctggtct aatctcttcc agctgctgga gaacttgatg
60 aacttctggt cgtgctgatg gagaaggatc aacacagtgc aaagcgagct
tcaacgtgtt 120 tagcaactcg tcgccaactg tggatgcatc tctcatcaag
tctgcatcaa aaacctcatt 180 tgtccactcc tctttgacaa ctgaggcaac
ccactgaggc aaatctagtc cattcataga 240 caccccaggt gatttcctcg
ttaggagttc taacaagata acaccaagac tgtagatatc 300 agttttagtg
tttgctttct tgagcttttg agaagctcag gtgcccggta tcccaaatgc 360
ttccagctgt agcttatcac cgttgggaat taagcagcaa gttggacatt caacccggag
420 naaaagaccc aaaaattttg caaattttta agcaatttng gnanttcttn
aatcaaggcc 480 aaccaccaat tggnttggga atggtggaag ggtttcccca
atggtaattg gaagggtttc 540 ttccctnggg gaaaatggaa aggggcaana
aaacaaaggc ccaacngggg ccccaaaggt 600 nttttggggg ccttattttt
tncnaatncc ctttggnngg ggncccaaat tcnaaantgg 660 aaattggntt tnn 673
110 564 DNA soybean misc_feature (1)..(564) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 110 actggctgtg actgatctct
ctggtctaat ctcttccagc tgctggagaa cttgatgaac 60 ttctggtcgt
gctgatggag aaggatcaac acagtgcaaa gcgagcttca acgtgtttag 120
caactcgtcg ccaactgtgg atgcatctct catcaagtct gcatcaaaaa cctcatttgt
180 ccactcctct ttgacaactg aggcaaccca ctgaggcaaa tctagtccat
tcatagacac 240 cccaggtgat ttcctcgtta ggagttctaa caagataaca
ccaagactgt agatatcagt 300 tttagtgttt gctttcttga gctttgagag
ctcaggtgcc cggtatccca atgctccagc 360 tgtagctatc acgttggaat
tagcagcagt tgacatcaac ccgagaaaga ccaaaatctg 420 caattttagc
atttgtattc tcatcaagca acacattgct ggatgtgagg ttcccatgta 480
tgatgttctc ctgggaatga aggcagaaca agccacggcc aagcttggct atttcatcct
540 tgtggccaat caatgaatgg tcat 564 111 456 DNA soybean misc_feature
(1)..(456) n is an undetermined nucleotide (dATP, dCTP, dGTP, or
dTTP) 111 actatgagga cagaaaaagg agtccctcca gttgctggtg gtgatgttga
agcgggtggg 60 gaggctggag ggaaactagt ccattttgat ggaccaatgg
cttttacagc tgatgatctc 120 ttgtgtgcaa cagctgagat catgggaaag
agcacctatg gaactgttta taaggctatt 180 ttggaggatg gaagtcaagt
tgcagtaaag agattgaggg aaaagatcac taaaggtcat 240 agagaatttg
aatcanaagt cagtgttcta ggaaaaatta nacaccccaa tgttttggtt 300
ntgaggccta ttacttggga cccaaagggg aaaagcttnt ggtttttgat tcatgtntaa
360 aggaagtctt gcttntttcc tacatggnaa gtttcggggc tgtctttnat
taanggtngg 420 gngngctgnn tttaattata attnggngtt tacctt 456 112 592
DNA soybean misc_feature (1)..(592) n is an undetermined nucleotide
(dATP, dCTP, dGTP, or dTTP) 112 actatgagga cagaaaaagg agtccctcca
gttgctggtg gtgatgttga agcaggtggg 60 gaggctggag ggaaactagt
ccattttgat ggaccaatgg cttttacagc tgatgatctc 120 ttgtgtgcaa
cagctgagat catgggaaag agcacctatg gaactgttta taaggctatt 180
ttggaggatg gaagtcaagt tgcagtaaag agattgaggg aaaagatcac taaaggtcat
240 agagaatttg aatcagaagt cagtgttcta ggaaaaatta gacaccccaa
tgttttggct 300 ctgagggcct attacttggg acccaaaggg gaaaagcttc
tggtttttga ttacatgtct 360 aaaggaagtc ttgcttcttt cctacatggt
aagtttcgtg tgctgttctt tcattaagtg 420 ttgggtgtgc tggtctttaa
ttataatttg gagtttacct tannaatctg gataattcta 480 atcggagaac
agncaaacaa aanccctaag gaacaaccct tanctttaat atccatatca 540
ataagngaan tatttcttgg tcatcttgat gcaggggggg gnactgaaca tt 592 113
460 DNA soybean misc_feature (1)..(460) n is an undetermined
nucleotide (dATP, dCTP, dGTP, or dTTP) 113 gggactggct gtgactgatc
tctctggtct aatctcttcc agctgctgga gaacttgatg 60 aacttctggt
cgtgctgatg gagaaggatc aacacagtgc aaagcgagct tcaacgtgtt 120
tagcaactcg tcgccaactg tggatgcatc tctcatcaag tctgcatcaa aaacctcatt
180 tgtccactcc tctttgacaa ctgaggcaac ccactgaggc aaatctagtc
cattcataga 240 caccccaggt gatttcctcg ttaggagttc taacaagata
acaccaagac tgtagatatc 300 agttttagtg tttgctttct tgagctttga
gagctcaggt gcccggtatc ccaatgcttc 360 agctgtagct atcacgttgg
aattagcagc agttgacatc aaccgagaaa gaccaaaatc 420 tgcaatttta
gcatttgnat tctcattaaa caacacaatg 460 114 566 DNA soybean
misc_feature (1)..(566) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 114 gggactggct gtgactgatc tctctggtct
aatctcttcc agctgctgga gaacttgatg 60 aacttctggt cgtgctgatg
gagaaggatc aacacagtgc aaagcgagct tcaacgtgtt 120 tagcaactcg
tcgccaactg tggatgcatc tctcatcaag tctgcatcaa aaacctcatt 180
tgtccactcc tctttgacaa ctgaggcaac ccactgaggc aaatctagtc cattcataga
240 cnccccaggt gatttcntcg ttaggagttn taacaagata acaccaagac
tgtagatatc 300 agttttagtg tttgctttct tgagctttga gagttaaggg
ncccggantc ccanngntcn 360 agttgnagtt atancgttgg aattagcagn
agttgcntca accgaaaaag accaaaatct 420 gaattttagc atttgttttt
catcaagcaa cacattgntg gatgngaggt cccatgtatg 480 atgttctcct
gggaatgaag gcaaacaagc ccgggccaag gcttgggcta ttttaatcct 540
tggtggccaa acaatgaaag gttnat 566 115 16 DNA soybean 115 gactgcgtac
caattc 16 116 16 DNA soybean 116 gatgagtcct gagtaa 16 117 22 DNA
soybean 117 gggtttcaga taaccgtggt cg 22 118 25 DNA soybean 118
ttgcagatat tttagttgat tggcc 25 119 24 DNA soybean 119 agttgattgg
ctcaaaccat ggcc 24 120 20 DNA soybean 120 ttgcgtgtga tcggtattac 20
121 20 DNA soybean 121 tacctgagtt ctctcaagtc 20 122 252 DNA soybean
misc_feature (1)..(252) n is an undetermined nucleotide (dATP,
dCTP, dGTP, or dTTP) 122 gatttagact gcgctgactn tcaaaggaga
ctggaatttc tccactgaaa ttattcagtg 60 acaaatcaag ctgcctaagc
gaggaaatgt ttgcaatgct tgaaggaata tgtccactaa 120 attggtttct
actcaaaatc agaacagaaa gattacgcaa tctacctaaa ctttgaggga 180
tttgattgtc aaggaggttg ttctctgcat tcagcagtgt aagtgaggat aaattagaga
240 gggtagcagg ca 252
* * * * *
References