U.S. patent application number 10/091009 was filed with the patent office on 2002-09-26 for methods for simultaneous control of lignin content and composition, and cellulose content in plants.
This patent application is currently assigned to Board of Control of Michigan Technological University. Invention is credited to Chiang, Vincent Lee C., Li, Laigeng.
Application Number | 20020138870 10/091009 |
Document ID | / |
Family ID | 22863901 |
Filed Date | 2002-09-26 |
United States Patent
Application |
20020138870 |
Kind Code |
A1 |
Chiang, Vincent Lee C. ; et
al. |
September 26, 2002 |
Methods for simultaneous control of lignin content and composition,
and cellulose content in plants
Abstract
The present invention relates to a method of concurrently
introducing multiple genes into plants and trees is provided. The
method includes simultaneous transformation of plants with multiple
genes from the phenylpropanoid pathways including 4CL, CAld5H,
AldOMT, SAD and CAD genes and combinations thereof to produce
various lines of transgenic plants displaying altered agronomic
traits. The agronomic traits of the plants are regulated by the
orientation of the specific genes and the selected gene
combinations, which are incorporated into the plant genome.
Inventors: |
Chiang, Vincent Lee C.;
(Hancock, MI) ; Li, Laigeng; (Houghton,
MI) |
Correspondence
Address: |
MICHAEL BEST & FRIEDRICH, LLP
100 E WISCONSIN AVENUE
MILWAUKEE
WI
53202
US
|
Assignee: |
Board of Control of Michigan
Technological University
Houghton
MI
|
Family ID: |
22863901 |
Appl. No.: |
10/091009 |
Filed: |
March 6, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10091009 |
Mar 6, 2002 |
|
|
|
09947027 |
Sep 5, 2001 |
|
|
|
60230086 |
Sep 5, 2000 |
|
|
|
Current U.S.
Class: |
800/278 |
Current CPC
Class: |
C12N 15/8246 20130101;
C12N 15/8255 20130101; C12N 9/0006 20130101 |
Class at
Publication: |
800/278 |
International
Class: |
A01H 005/00 |
Goverment Interests
[0002] This invention was made with United States government
support awarded by the Energy Biosciences Program, United States
Department of Energy, and the United States Department of
Agriculture research grant numbers USDA 99-35103-7986, USDA
01-03749, and DOE DE-FG02-01ER15179. The United States government
has certain rights in this invention.
Claims
What is claimed is:
1. A method of genetically transforming a plant simultaneously with
multiple genes from the phenylpropanoid pathways, comprising
incorporating into the genome of the plant a plurality of genes,
the genes selected from the group consisting of 4CL, CAld5H,
AldOMT, CAD, and SAD, substantially similar fragments thereof, and
combinations thereof to produce plants displaying altered agronomic
traits.
2. The method of claim 1 wherein the genes incorporated into the
genome are CAld5H, AldOMT, and SAD genes, substantially similar
fragments thereof or combinations thereof in sense orientation, to
produce increased syringyl lignin in the plant compared to a
non-transformed plant.
3. The method of claim 1, wherein the genes incorporated into its
genome are 4CL gene or substantially similar fragments thereof in a
sense or antisense orientation and CAld5H, AldOMT, and SAD genes,
substantially similar fragments thereof or combinations thereof in
sense orientation to downregulate 4CL gene expression in the plant
compared to a non-transformed plant.
4. The method of claim 3 wherein the down regulation of 4CL
correlates with decreased lignin content, increased
syringyl/guaiacyl (S/G) lignin ratio and increased cellulose
content compared to a non-transformed plant.
5. The method of claim 1, wherein the genes incorporated into its
genome are 4CL and CAD genes or substantially similar fragments
thereof in sense or antisense orientation and CAld5H, AldOMT, and
SAD genes, substantially similar fragments thereof or combinations
thereof in sense orientation to downregulate 4CL and CAD gene
expression in the plant compared to a non-transformed plant.
6. The method of claim 5 wherein the down regulation of 4CL and CAD
correlates with decreased lignin content, increased S/G lignin
ratio and increased cellulose content as compared to a
non-transformed plant.
7. The method of claim 1 wherein the gene incorporated into the
genome of the plant is 4CL gene or substantially similar fragments
thereof in the sense orientation, to upregulate 4CL gene expression
in the plant compared to a non-transformed plant.
8. The method of claim 7, wherein the upregulation of 4CL gene
correlates to increased lignin content in the plant compared to a
non-transformed plant.
9. A method of claim 1 wherein the genes incorporated into the
genome of the plant are 4CL, CAld5H, AldOMT, and SAD genes,
substantially similar fragments thereof or combinations thereof in
the sense orientation, to upregulate 4CL, CAld5H, AldOMT, and SAD
gene expression
10. The method of claim 9 wherein the upregulation of 4CL, CAld5H,
AldOMT, and SAD genes correlates to an increased lignin content and
increased S/G ratio compared to a non-transformed plant.
11. The method of claim 1 wherein the genes incorporated into the
genome of the plant 4CL, CAld5H, AldOMT, and SAD genes,
substantially similar fragments thereof or combinations thereof in
the sense orientation and the CAD gene or substantially similar
fragments thereof in the antisense orientation, to upregulate 4CL,
CAld5H, AldOMT, and SAD gene expression and to downregulate CAD
gene expression in the plant compared to a non-transformed
plant.
12. The method of claim 11, wherein the upregulation of 4CL,
CAld5H, AldOMT, and SAD gene expression and the downregulation of
CAD gene expression correlate with an increased lignin content and
an increased S/G ratio compared to a non-transformed plant.
13. The method of claim 2 wherein the plant is an angiosperm or a
gymnosperm.
14. The method of claim 3 wherein the plant is an angiosperm or a
gymnosperm.
15. The method of claim 5 wherein the plant is an angiosperm or a
gymnosperm.
16. A method of preparing plant cells having in their genome a
plurality of DNA constructs, the method comprising a) incorporating
into the genome of the cells a plurality of DNA constructs to yield
transformed cells, each construct comprising a polynucleotide
sequence encoding a protein selected from the group consisting of
4CL, CAld5H, AldOMT, CAD, and SAD, substantially similar fragments
thereof, and combinations thereof, operably linked to a promoter
sequence functional in the cells, and a termination sequence b)
identifying the transformed plant cells, the genome of which is
augmented with DNA from the different DNA constructs.
17. The method of claim 16 wherein the expression of the protein is
associated with an agronomic trait in the plant cells.
18. The method of claim 17 wherein the trait is lignin
biosynthesis, cellulose biosynthesis, growth, wood quality, stress
resistance, sterility, grain yield or nutritional value.
19. The method of claim 16 further comprising regenerating the
identified transformed plants cells to yield a transgenic
plant.
20. The method of claim 16 wherein the plant cells are
regenerable.
21. The method of claim 16 wherein the plant cells are tree
cells.
22. The method of claim 16 wherein the plant cells are angiosperm
cells.
23. The method of claim 16 wherein the plant cells are gymnosperm
cells.
24. A method of preparing transgenic plants having altered lignin
and cellulose compositions, the method comprising a) providing the
genome of the plants with a plurality of DNA constructs to yield
transformed plant cells, each construct comprising a polynucleotide
sequence encoding a protein selected from the group consisting of
4CL, CAld5H, AldOMT, CAD, and SAD, substantially similar fragments
thereof, and combinations thereof, the polynucleotide sequence
operably linked to a promoter sequence functional in the plant
cells, and a termination sequence; b) regenerating the transformed
plant cells to yield transgenic plants, the genome of which is
augmented with DNA from different DNA constructs, and c) expressing
the DNA constructs in the cells of the transgenic plants in an
amount effective to alter the lignin and cellulose composition in
the plants.
25. A plant of claim 24 wherein the promoter sequence can be
constitutive or tissue-specific.
26. A plant of claim 24 wherein the promoter sequence can be
homologous or heterologous.
27. A plant if claim 24 wherein the promoter sequence provides for
transcription in xylem.
28. A method of claim 24, wherein the plant is a plant cell, plant
organ, or an entire plant.
29. A method of claim 24, wherein the plant is a plant fruit, seeds
and progeny thereof.
30. The method of claim 24 wherein the plants are trees.
31. The method of claim 24 wherein the plants are angiosperms.
32. The method of claim 24 wherein the plants are gymnosperms.
33. A transgenic plant prepared by the method of claim 24.
34. A progeny plant of the transgenic plant of claim 32.
35. A method of preparing a transgenic tree comprising a)
incorporating into the genome of the tree a plurality of desired
DNA constructs to produce transformed tree cells, each construct
comprising a polynucleotide sequence encoding a protein selected
from the group consisting of 4CL, CAld5H, AldOMT, CAD, and SAD,
substantially similar fragments thereof, and combinations thereof,
operably linked to a promoter sequence functional in the cells, and
a termination sequence; b) regenerating the transformed tree cells
to yield transgenic trees, the genome of which is augmented with
the plurality of DNA constructs; and c) expressing the DNA
construct in the cells of the transgenic tree in an amount
effective to alter the lignin and cellulose composition of the
tree.
36. A transgenic tree prepared by the method of claim 34.
37. The method of claim 34 wherein the transgenic tree is a Populus
tremuloides.
38. A plant having incorporated into its genome a DNA construct
comprising a polynucleotide sequence encoding a protein selected
from the group consisting of 4CL, CAld5H, AldOMT, CAD, and SAD,
substantially similar fragments thereof, and combinations thereof,
operably linked to a promoter sequence, and a termination
sequence.
39. A plant of claim 38 wherein the promoter sequence can be
constitutive or tissue-specific.
40. A plant of claim 38 wherein the promoter sequence can be
homologous or heterologous.
41. A plant of claim 38 wherein the promoter sequence provides for
transcription in xylem.
42. The plant of claim 38 which is a tree.
43. A plant of claim 38 wherein the plant is a gymnosperm.
44. The plant of claim 43 wherein the nucleotide sequence encodes
CAld5H, AldOMT, and SAD genes, substantially similar fragments
thereof and combinations thereof, in sense orientation, yielding
increased syringyl lignin as compared to a non-transformed
plant.
45. The plant of claim 43 wherein the nucleotide sequences encodes
4CL gene or substantially similar fragments thereof in sense or
antisense orientation and CAld5H, AldOMT, and SAD genes,
substantially similar fragments thereof, and combinations thereof,
in sense orientation, yielding decreased lignin content, increased
syringyl/guaiacyl (S/G) lignin ratio and increased cellulose
content as compared to a non-transformed plant.
46. The plant of claim 43 wherein the nucleotide sequences encodes
4CL and CAD genes or substantially similar fragments thereof in
sense or antisense orientation and CAld5H, AldOMT, and SAD genes,
substantially similar fragments thereof, and combinations thereof,
in sense orientation, yielding decreased lignin content, increased
S/G lignin ratio and increased cellulose content as compared to a
non-transformed plant.
47. The plant of claim 43 wherein the nucleotide sequences encodes
4CL gene or substantially similar fragments thereof in the sense
orientation yielding increased lignin content as compared to a
non-transformed plant.
48. The plant of claim 43 wherein the polynucleotide sequences
incorporated into the genome are 4CL, CAld5H, AldOMT, and SAD
genes, substantially similar fragments thereof, and combinations
thereof, in the sense orientation, yielding increased lignin
content and increased S/G ratio as compared to a non-transformed
plant.
49. The plant of claim 43 wherein the polynucleotide sequences
encodes 4CL, CAld5H, AldOMT, and SAD genes, substantially similar
fragments thereof and combinations thereof in the sense orientation
and the CAD gene, or substantially similar fragments thereof in the
antisense orientation, yielding increased lignin content and
increased S/G ratio as compared to a non-transformed plant.
50. A plant of claim 38 wherein the plant is an angiosperm.
51. The plant of claim 50 wherein the polynucleotide sequences
encodes CAld5H, AldOMT, and SAD genes, substantially similar
fragments thereof and combinations thereof, in sense orientation,
yielding increased S/G lignin ratio as compared to a
non-transformed plant.
52. The plant of claim 51 wherein the polynucleotide sequences
encode the 4CL gene or substantially similar fragments thereof in
sense or antisense orientation, and CAld5H, AldOMT, and SAD genes,
substantially similar fragment thereof, and combinations thereof in
sense orientation, yielding decreased lignin content, increased S/G
lignin ratio and increased cellulose content as compared to a
non-transformed plant.
53. The plant of claim 50 wherein the nucleotide sequences encodes
4CL and CAD genes or substantially similar fragments thereof, and
combinations thereof by sense or antisense orientation and CAld5H,
AldOMT, and SAD genes, substantially similar fragments thereof, and
combinations thereof in sense orientation, yielding decreased
lignin content, increased S/G lignin ratio and increased cellulose
content as compared to a non-transformed plant.
54. The plant of claim 50 wherein the nucleotide sequences encodes
4CL gene or substantially similar fragment thereof, by sense
orientation, yielding increased lignin content as compared to a
non-transformed plant.
55. The plant of claim 50 wherein the nucleotide sequences encodes
4CL, CAld5H, AldOMT, and SAD genes, substantially similar fragment
thereof, and combinations thereof, in sense orientation, yielding
increased lignin content and increased S/G ratio as compared to a
non-transformed plant.
56. The plant of claim 50 wherein the nucleotide sequences encode
4CL CAld5H, AldOMT, and SAD genes, substantially similar fragment
thereof, and combinations thereof, in sense orientation, and CAD
gene, substantially similar fragment thereof, and combinations
thereof in antisense orientation, yielding increased lignin content
and increased S/G ratio as compared to a non-transformed plant.
57. A plurality of DNA constructs, each construct comprising in the
5'-3' direction: a) a gene promoter sequence, b) a gene termination
sequence; and c) a polynucleotide sequence encoding a protein
selected from the group consisting of 4CL, CAld5H, AldOMT, CAD, and
SAD, substantially similar fragments thereof, and combinations
thereof involved in a lignin biosynthetic pathway, the
polynucleotide sequence operably linked to the promoter and
termination sequences.
58. A plurality of DNA constructs of claim 57 wherein the gene
promoter sequence is a constitutive or tissue-specific
promoter.
59. A plurality of DNA constructs of claim 57 wherein the gene
promoter sequence is homologous or heterologous.
60. A plurality of DNA constructs of claim 57 wherein the gene
promoter sequences are xylem-specific.
61. A plurality of DNA constructs incorporated into the genome of
gymnosperms, the constructs comprising nucleotide sequences
encoding CAld5H, AldOMT, and SAD genes, a substantially similar
fragments thereof and combinations thereof, in sense orientation,
to produce syringyl lignin as compared to a non-transformed
plant.
62. A plurality of DNA constructs incorporated into the genome of
gymnosperm, the constructs comprising 4CL gene or substantially
similar fragments thereof in sense or antisense orientation and
CAld5H, AldOMT, and SAD genes, substantially similar fragments
thereof and combination thereof in sense orientation to decrease
lignin content, increase syringyl/guaiacyl (S/G) lignin ratio and
increase cellulose content as compared to a non-transformed
plant.
63. A plurality of DNA constructs incorporated into the genome of
gymnosperms, the constructs comprising 4CL and CAD genes or
substantially similar fragments thereof in sense or antisense
orientation and CAld5H, AldOMT, and SAD genes, substantially
similar fragments thereof and combination thereof in sense
orientation to decrease lignin content, increase S/G lignin ratio
and increase cellulose content as compared to a non-transformed
plant.
64. A DNA construct incorporated into the genome of plants,
comprising 4CL gene or substantially similar fragments thereof in
the sense orientation to increase lignin content compared to a
non-transformed plant.
65. A DNA construct of claim 63 wherein the plant is an angiosperm
or a gymnosperm.
66. A plurality of DNA constructs incorporated into the genome of
plants, the constructs comprising 4CL, CAld5H, AldOMT, and SAD
genes, substantially similar fragments thereof or combination
thereof, in the sense orientation, to increase lignin content and
increase S/G ratio compared to a non-transformed plant.
67. A plurality of DNA constructs of claim 65 wherein the plant is
an angiosperm or a gymnosperm.
68. A plurality of DNA constructs incorporated into the genome of
plants, the constructs comprising 4CL, CAld5H, AldOMT, and SAD
genes, substantially similar fragments thereof and combination
thereof in the sense orientation and CAD gene or substantially
similar fragments thereof in the antisense orientation to increase
lignin content and increase S/G ratio compared to a non-transformed
plant.
69. A plurality of DNA constructs of claim 67 wherein the plant is
an angiosperm or a gymnosperm.
70. A plurality of DNA constructs incorporated into the genome of
angiosperms, the constructs comprising CAld5H, AldOMT, and SAD
genes, substantially similar fragments thereof and combinations
thereof in sense orientation to engineer high S/G lignin ratio
compared to a non-transformed plant.
71. A plurality of DNA constructs incorporated incorporating into
the genome of angiosperms, the constructs comprising 4CL gene or
substantially similar fragment thereof in sense or antisense
orientation and CAld5H, AldOMT, and SAD genes, substantially
similar fragment thereof, and combinations thereof, in sense
orientation, to decrease lignin content, increase S/G lignin ratio
and increase cellulose content compared to a non-transformed
plant.
72. A plurality of DNA constructs incorporated into the genome of
angiosperms, the constructs comprising 4CL and CAD genes,
substantially similar fragments thereof, and combinations thereof
by sense or antisense orientation and CAld5H, AldOMT, and SAD
genes, or substantially similar fragments thereof, and combinations
thereof, in sense orientation, to decrease lignin content, increase
S/G lignin ratio and increase cellulose content compared to a
non-transformed plant.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/230,086, filed on Sep. 5, 2000, and is
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] The invention provides a method of introducing two or more
genes, involved in lignin biosynthesis, into plant cells. The
method of the invention employs either an Agrobacterium-mediated or
other appropriate plant gene delivery system by which multiple
genes together with a single selectable marker gene are
simultaneously transferred and inserted into the genome of plants
with high frequencies.
[0004] The ability to introduce foreign genes into plants is a
prerequisite for engineering agronomic traits in plants. Many
systems have been developed for introducing a foreign gene into
plant cells, which involve mainly either Agrobacterium- or
microprojectile bombardment-mediated transformation (Christou,
1996). The principle of all these systems involves the insertion of
a target gene into the host plant genome together with a selectable
marker gene encoding either antibiotic or herbicide resistance to
aid in the selection of transgenic cells from non-transgenic cells.
These systems generally are only effective for introducing a single
target gene into the host plant.
[0005] To alter agronomic traits, which generally are polygenic in
nature, multiple genes involved in complex biosynthetic pathways
must be introduced and expressed in plant cells. In this context,
the traditional single-gene transfer systems are essentially
useless for the following two reasons: 1) it is impractical to
introduce multiple genes by repetitive insertion of single genes
into transgenic plants due to the time and effort required for
recovery of the transgenic tissues; in particular, a repetitive
single-gene approach is highly impractical for plant species such
as trees which, depending upon the species, require two to three
years for transgenic tissue selection and regeneration into a tree;
and 2) the presence of a selectable marker gene in a transgenic
line precludes the use of the same marker gene in subsequent
transformations of plant material from that line. Moreover, the
number of available marker genes is limited, and many plant species
are recalcitrant to regeneration unless appropriate antibiotic or
herbicide selection is used.
[0006] Chen et aL (1998) recently reported the genetic
transformation of rice with multiple genes by cobombardment of
several gene constructs into embryogenic suspension tissues.
However, particle bombardment-mediated gene transfer into
embryogenic tissues is highly species-dependent, and regeneration
of whole plants from embryogenic cells cannot be achieved for a
variety of plant species (Horsch et al., 1985).
[0007] In contrast, Agrobacterium-mediated gene transfer and whole
plant regeneration through organogenesis is a simple process and a
less species-dependent system than bombardment-mediated
transformation and regeneration via embryogenesis. However, the
introduction of more than one gene in a single plasmid vector via
Agrobacterium may be technically troublesome and limited by the
number or the size of the target genes (Chen et al., 1998). For
example, Tricoli et al. (1995) reported the transfer of three
target genes to squash via Agrobacterium-mediated gene transfer. A
binary plasmid vector containing the three target genes was
incorporated into an Agrobacterium strain, which was subsequently
used to infect the leaf tissue of squash. As only one line was
recovered from numerous infected squash tissues that contained all
of the target genes, the use of a single binary vector with a
number of genes appears to be a highly inefficient method to
produce transgenic plants with multiple gene transfers. Therefore,
it was commonly accepted that transfer of multiple genes via
Agrobacterium-mediated transformation was impractical (Ebinuma et
al., 1997), until success of multiple gene transfer via
Agrobacterium was first reported in co-pending, commonly owned PCT
application, PCT/US/0027704, filed Oct. 6, 2000, entitled "Method
of Introducing a Plurality of Genes into Plants" by Chiang et al,
incorporated herein by reference. However, homologous
tissue-specific preparation of transgenic trees to specifically
alter lignin content, increase S/G (syringyl:guaiacyl) lignin ratio
and increase cellulose quantity, as compared to an untransformed
plant was unsuccessful.
[0008] Yet, the altering of lignin content and composition in
plants has been a goal of genetically engineered traits in plants.
Lignin, a complex phenolic polymer, is a major part of the
supportive structure of most woody plants including angiosperm and
gymnosperm trees, which, in turn, are the principal sources of
fiber for making paper and cellulosic products. Lignin generally
constitutes about 25% of the dry weight of the wood, making it the
second most abundant organic compound on earth after cellulose.
Lignin provides rigidity to wood for which it is well suited due,
in part, to its resistance to biochemical degradation.
[0009] Despite its importance to plant growth and structure, lignin
is nonetheless problematic to post-harvest, cellulose-based
wood/crop processing for fiber, chemical, and energy production
because it must be removed or degraded from cellulose at great
expense. Certain structural constituents of lignin, such as the
guaiacyl (G) moiety, promote monomer cross-linkages that increase
lignin resistance to degradation (Sarkanen, 1971; Chang and
Sarkanen, 1973; Chiang and Funaoka, 1990). In angiosperms, lignin
is composed of a mixture of guaiacyl (G) and syringyl (S)
monolignols, and can be degraded at considerably less energy and
chemical cost than gymnosperm lignin, which consists almost
entirely of guaiacyl moieties (Freudenberg, 1965). It has been
estimated that, if syringyl lignin could be genetically
incorporated into gymnosperm guaiacyl lignin or into angiosperms to
increase the syringyl lignin content, the annual saving in
processing of such genetically engineered plants as opposed to
their wild types would be in the range of $6 to $10 billion in the
U.S. alone. Consequently, there has been long-standing incentive to
understand the biosynthesis of syringyl monolignol to genetically
engineer plants to contain more syringyl lignin, thus, facilitating
wood/crop processing (Trotter, 1990; Bugos et al., 1991; Boudet et
al., 1995; Hu et al., 1999).
[0010] Depending on the use for the plant, genetic engineering of
certain traits has been attempted. For some plants, as indicated
above, there has been a long-standing incentive to genetically
modify lignin and cellulose to decrease lignin and increase
cellulose contents. For example, it has been demonstrated that the
digestibility of forage crops by ruminants is inversely
proportional to lignin content in plants (Buxton and Roussel, 1988,
Crop. Sci., 28, 553-558; Jung and Vogel, 1986, J. Anim., Sci., 62,
1703-1712). Therefore, decreased lignin and high cellulose plants
are desirable in forage crops to increase their digestibility by
ruminants, thereby providing the animal with more nutrients per
unit of forage.
[0011] In other plants, genetically increasing the S/G ratio of the
lignin has been sought. As noted above, lignin in angiosperms is
composed of guaiacyl (G) and syringyl (S) monomeric units, whereas
gymnosperm lignin consists entirely of G units. The structural
characteristics of G units in gymnosperm lignin promote monomer
cross-linkages that increase lignin resistance to chemical
extraction during wood pulp production. However, the S units
present in angiosperm lignin prevent such chemical resistant
cross-links. Therefore, without exception, chemical extraction of G
lignin in pulping of gymnosperms is more difficult and requires
more chemicals, longer reaction times and higher energy levels than
the extraction of G-S lignin during pulping of angiosperms
(Sarkanen, K. V., 1971, in Lignins: Occurrence, Formation,
Structure and Reaction, Sarkanen, K. V. & Ludwig, C. H., eds.,
Wiley-Interscience, New York; Chang, H. M. and Sarkanen, K. V.,
1973, TAPPI, 56:132-136). As a rule, the reaction rate of
extracting lignin during wood pulping is directly proportional to
the quantity of the S unit in lignin (Chang, H. M. and Sarkanen, K.
V., 1973, TAPPI, 56:132-136). Hence, altering lignin into more
reactive G-S type in gymnosperms and into high S/G ratio in
angiosperms would represent a pivotal opportunity to enhance
current pulping and bleaching efficiency and to provide better,
more economical, and more environmentally sound utilization of
wood.
[0012] Recent results have indicated that high S/G ratio may also
add further mechanical advantages to plants, balancing the likely
loss of sturdiness of plants with severe lignin reduction (Li et
al., 2001, Plant Cell, 13:1567-1585). Moreover, a high S/G lignin
ratio would also improve the digestibility of forage crops by
ruminants (Buxton and Roussel, 1988, Crop. Sci., 28, 553-558; Jung
and Vogel, 1986, J. Anim., Sci., 62, 1703-1712).
[0013] In some applications, both a high lignin content and high
S/G ratio have been sought (i.e., combining these two traits in
plants). For example, it has been demonstrated that when lignin is
extracted out from wood during chemical pulping, lignin in the
pulping liquor is normally used as a fuel source to provide energy
to the pulping and bleaching operations. This lignin-associated
energy source, which is not necessary for pulp mills using
purchased fuel for energy, is essential to some pulp mills which
depend upon internal sources, such as extracted lignin, to be
self-sufficient in energy. Therefore, for this purpose, it may be
desirable to increase lignin content in pulpwood species, and at
the same time to increase the S/G ratio in these species to
facilitate the extraction of more lignin to be used as fuel.
[0014] Additionally, for grain production and other non-related
purposes, increased lignin content and/or S/G lignin ratio are
desirable to provide extra sturdiness in plants to prevent the loss
of socially and economically important food crops due to dislodging
and due to damage to the aerial parts of the plant.
[0015] The plant monolignol biosynthetic pathway is set forth in
FIG. 1 and will be explained in more detail hereinbelow. The key
lignin control sites in the monolignol biosynthetic pathway are
mediated by genes encoding the enzymes 4-coumarate-CoA ligase (4CL)
(Lee et al., 1997), coniferyl aldehyde 5-hydroxylase (CAld5H)
(Osakabe et al., 1999) and S-adenosyl-L-methionine (SAM)-dependent
5-hydroxyconiferaldehyde O-methyltransferase (AldOMT) (Li et al.,
2000), respectively, for the formation of sinapaldehyde (see, FIG.
1). Further, coniferyl alcohol dehydrogenase (CAD) (MacKay et al.,
1997) catalyzes the reaction including the substrate
coniferaldehyde to coniferyl alcohol. It has recently been
discovered that sinapyl alcohol dehydrogenase (SAD) enzymatically
converts sinapaldehyde into sinapyl alcohol, the syringyl
monolignol, for the biosynthesis of syringyl lignin in plants (see,
FIG. 1). See, concurrently filed, commonly owned U.S.
non-provisional application entitled "Genetic Engineering of
Syringyl-Enriched Lignin in Plants," incorporated herein by
reference. It should be noted that the gene encoding the enzyme
sinapyl alcohol dehydrogenase (SAD) represents the last gene that
is indispensable for genetic engineering of syringyl lignin in
plants.
[0016] A summary of the conserved regions contained within the
coding sequence of each of the above listed proteins is described
below. Because SAD is a recently discovered enzyme in Aspen,
sequence alignments with other representative species were unable
to be performed.
[0017] The protein sequence alignments of plant AldOMTs are shown
in FIG. 9. All AldOMTs have three conserved sequence motifs (I, II,
and III) which are the binding sites of S-adenosyl-L-methionine
(SAM), the co-substrate or methyl donor for the OMT reaction
(Ibrahim, 1997, Trends Plant Sci., 2:249-250; Li et al., 1997,
Proc. Natl. Acad. Sci. USA, 94:5461-5466; Joshi and Chiang, 1998,
Plant Mol. Biol., 37:663-674). These signature sequence motifs and
the high sequence homology of these proteins to PtAldOMT attest to
their function as an AldOMT specific for converting
5-hydroxyconiferaldehyde into sinapaldehyde (Li et al., 2000, J.
Biol. Chem., 275:6537-6545). This AldOMT, like CAld5H, also
operates at the aldehyde level of the plant monolignol biosynthetic
pathway.
[0018] The protein sequence alignments of plant CADs are shown in
FIG. 10. It was recently proven that CADs are actually guaiacyl
monolignol pathway specific (Li et al., 2001, Plant Cell,
13:1567-1585). Based on high sequence homology, the alignment
program picked up CADs from angiosperms as well as gymnosperms
(radiata pine, loblolly pine and spruce) which have only G-lignin.
All CADs have the Zn1 binding motif and structural Zn2 consensus
region, as well as a NADP binding site (Jornvall et al., 1987, Eur.
J. Biochem., 167:195-201; MacKay et al., 1995, Mol. Gen. Genet.,
247:537-545). All these sequence characteristics and high sequence
homology to PtCAD attest to these CAD function as a G-monolignol
specific CAD (Li et al., 2001, Plant Cell, 13:1567-1585).
[0019] The protein sequence alignments of plant Cald5Hs are shown
in FIG. 11. Although, there are different types of 5-hydroxylases,
i.e., F5H, CAld5H is the sole enzyme catalyzing specifically the
conversion of coniferaldehyde into 5-hydroxyconiferaldehyde. All
full-length CAld5Hs have the proline-rich region located from amino
acid 40 to 45 which is believed to be involved in the process of
correct folding of microsomal P450s and is also important in heme
incorporation into P450s (Yamazaki et al. 1993, J. Biochem.
114:652-657). Also they all have the heme-binding domain
(PFGXGXXXCXG) that is conserved in all P450 proteins Nelson et al.
1996, Pharmacogenetics, 6:1-41). These signature sequences and the
high sequence homology of these proteins to PtCAld5H their function
as a 5-hydroxylase that is specific for converting coniferaldehyde
into 5-hydroxyconiferaldehyde (Osakabe et al., 1999, Proc. Natl.
Acad. Sci. USA, 96:8955-8960).
[0020] The protein sequence alignment of plant 4CLs are shown in
FIG. 12. In general, 4CL catalyzes the activation of the
hydroxycinnamic acids to their corresponding hydroxycinnamoyl-CoA
esters. 4CL has the highest activity with .rho.-coumaric acid. 4CL
cDNA sequences have been reported from a number of representative
angiosperms and gymnosperms, revealing two highly conserved
regions, a putative AMP-binding region (SSGTTGLPKGV), and a
catalytic motif (GEICIRG). The amino acid sequences of 4CL from
plants contain a total of five conserved Cys residues.
[0021] Despite recognition of these key enzymes in lignin
biosynthesis, there continues to be a need to develop an improved
method to simultaneously control the lignin quantity, lignin
compositions, and cellulose contents in plants by introducing
multiple genes into plant cells.
BRIEF SUMMARY OF THE INVENTION
[0022] The invention provides a method of introducing two or more
genes involved in lignin biosynthesis present in one or more
independent vectors into plant cells. The method of the invention
suitably employs an Agrobacterium-mediated or another gene delivery
system by which multiple genes together with a single selectable
marker gene are simultaneously transferred and inserted into the
genome of plants with high frequencies.
[0023] If an Agrobacterium-mediated gene delivery system is used,
each gene of interest is present in a binary vector that has been
introduced into Agrobacterium to yield an isolated Agrobacterium
strain comprising the binary vector. Moreover, more than one gene
of interest may be present in each binary vector. Plant materials
comprising plant cells, e.g., plant seed, plant parts or plant
tissue including explant materials such as leaf discs, from a
target plant species are suitably inoculated with at least two,
preferably at least three, and more preferably at least four or
more, of the isolated Agrobacterium strains, each containing a
different gene of interest. A mixture of the strains is suitably
contacted with plant cells. At least one of the binary vectors in
the isolated Agrobacterium strains contains a marker gene, and any
marker gene encoding a trait for selecting transformed cells from
non-transformed cells may be used. Transformed plant cells are
regenerated to yield a transgenic plant, the genome of which is
augmented with DNA from at least two, preferably at least three,
and more preferably at least four, and even more preferably at
least five of the binary vectors.
[0024] The method of the invention is thus applicable to all plant
species that are susceptible to the transfer of genetic information
by Agrobacterium or other gene delivery system. Suitable plant
species useful in the method of the invention include agriculture
and forage crops, as well as monocots. In particular, plant species
useful in the method of the invention include trees, e.g.,
angiosperms and gymnosperms, and more suitably a forest tree, but
are not limited to the tree.
[0025] The method of the invention is suitably employed to enhance
a desired agronomic trait by altering the expression of two or more
genes. Such traits include alterations in lignin biosynthesis
(e.g., reduction, augmentation and/or structural changes),
cellulose biosynthesis (e.g., augmentation, reduction, and/or
quality including high degree of polymerization and crystallinity),
growth, wood quality (e.g., high density, low juvenile wood, high
mature wood, low reaction wood, desirable fiber angle), stress
resistance (e.g., cold-, heat-, and salt-tolerance, pathogen-,
insect- and other disease-resistance, herbicide-resistance),
sterility, high grain yield (for forage and food crops), and
increased nutrient level.
[0026] Thus, the present invention advantageously provides
gymnosperm and angiosperm plants with decreased lignin content,
increased syringyl/guaiacyl (S/G) lignin ratio and increased
cellulose content in which a single trait or multiple traits are
changed.
[0027] In another aspect, the invention provides gymnosperm plants
with syringyl enriched lignin and/or increased lignin content
and/or increased syringyl/guaiacyl (S/G) lignin ratio.
[0028] Similarly, the present invention also provides angiosperm
plants with increased lignin content.
[0029] Other advantages and a fuller appreciation of specific
attributes and variations of the invention will be gained upon an
examination of the following detailed description of exemplary
embodiments and the like in conjunction with the appended
claims.
BRIEF DESCRIPTION OF THE DRAWING(S)
[0030] FIG. 1 is a schematic representation of plant monolignol
pathways for production of coniferyl alcohol and sinapyl
alcohol;
[0031] FIG. 2 is the SAD polynucleotide DNA sequence (SEQ ID NO: 1)
and the SAD amino acid sequence (SEQ ID NO: 2) respectively FIG. 2A
and 2B;
[0032] FIG. 3 is the CAld5H polynucleotide DNA sequence (SEQ ID NO:
3) and the CAld5H amino acid sequence (SEQ ID NO: 4) respectively
FIG. 3A and 3B;
[0033] FIG. 4 is the AldOMT polynucleotide DNA sequence (SEQ ID NO:
5) and the AldOMT amino acid sequence (SEQ ID NO: 6) respectively
FIG. 4A and 4B;
[0034] FIG. 5 is the 4CL polynucleotide DNA sequence (SEQ ID NO: 7)
and the 4CL amino acid sequence (SEQ ID NO: 10) respectively FIG.
5A and 5B;
[0035] FIG. 6 is the CAD polynucleotide DNA sequence (SEQ ID NO: 8)
and the CAD amino acid sequence (SEQ ID NO: 9) respectively FIG. 6A
and 6B;
[0036] FIG. 7 is a map of the DNA construct, pBKPpt.sub.4CL
Pt4CL1-a, positioned in a plant transformation binary vector.
[0037] FIG. 8 is a map of the DNA construct, pBKPpt.sub.4CL
PtCAld5H-s, positioned in a plant transformation binary vector.
[0038] FIG. 9 is the protein sequence alignment of AldOMTs for
representative species of plants.
[0039] FIG. 10 is the protein sequence alignment of CADs for
representative species of plants.
[0040] FIG. 11 is the protein sequence alignment of CAld5Hs for
representative species of plants.
[0041] FIG. 12 is the protein sequence alignment of 4CLs for
representative species of plants.
[0042] It is expressly understood that the figures of the drawing
are for the purposes of illustration and description only and are
not intended as a definition of the limits of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0043] The present invention provides a method and DNA constructs
useful for the transformation of plant tissue for the alteration of
lignin monomer composition, increased syringyl/guaiacyl (S/G)
lignin ratio and increased cellulose content and transgenic plants
resulting from such transformations. The present invention is of
particular value to the paper and pulp industries because lignin
containing higher syringyl monomer content is more susceptible to
chemical delignification. Woody plants transformed with the DNA
constructs provided herein offer a significant advantage in the
delignification process over conventional paper feedstocks.
Similarly, modification of the lignin composition in grasses by the
insertion and expression of a heterologous SAD gene offers a unique
method for increasing the digestibility of grasses and is of
significant potential economic benefit to the farm and agricultural
industries.
[0044] The terms used in this specification generally have their
ordinary meanings in the art, within the context of the invention
and in the specific context where each term is used. Certain terms
are discussed below, or elsewhere in the specification, to provide
additional guidance to the person of skill in the art in describing
the compositions and methods of the invention and how to make and
use them. It will be appreciated that the same thing can be said in
more than one way. Consequently, alternative language and synonyms
may be used for any one or more of the terms discussed herein, nor
is any special significance to be placed upon whether or not a term
is elaborated or discussed herein. Synonyms for certain terms are
provided. A recital of one or more synonyms does not exclude the
use of other synonyms. The use of examples anywhere in this
specification, including examples of any terms discussed herein, is
illustrative only, and in no way limits the scope and meaning of
the invention or of any exemplified term. Likewise, the invention
is not limited to the preferred embodiments.
[0045] As used herein, "gene" refers to a nucleic acid fragment
that expresses a specific protein including the regulatory
sequences preceding (5' noncoding) and following (3' noncoding) the
coding region or coding sequence (See, below). "Native" gene refers
to the gene as found in nature with its own regulatory
sequences.
[0046] "Endogenous gene" refers to the native gene normally found
in its natural location in the genome.
[0047] "Transgene" refers to a gene that is introduced by gene
transfer into the host organism.
[0048] "Coding sequence" or "Coding Region" refers to that portion
of the gene that contains the information for encoding a
polypeptide. The boundaries of the coding sequence are determined
by a start codon at the 5' (amino) terminus and a translation stop
codon at the 3' (carboxyl) terminus. A coding sequence can include,
for example, prokaryotic sequences, cDNA from eukaryotic mRNA,
genomic DNA, and even synthetic DNA sequences.
[0049] "Promoter" or "Promoter Sequence" refers to a DNA sequence,
in a given gene, which sequence controls the expression of the
coding sequence by providing the recognition site for RNA
polymerase and other factors required for proper transcription.
Most genes have regions of DNA sequence that are promoter sequences
which regulate gene expression. Promoter regions are typically
found in the 5' flanking DNA sequence upstream from the coding
sequence in both prokaryotic and eukaryotic cells. A promoter
sequence provides for regulation of transcription of the downstream
gene sequence and typically includes from about 50 to about 2000
nucleotide base pairs. Promoter sequences also contain regulatory
sequences such as enhancer sequences that can influence the level
of gene expression. Some isolated promoter sequences can provide
for gene expression of heterologous DNAs, that is DNA different
from the natural homologous DNA. Promoter sequences are also known
to be strong or weak or inducible. A strong promoter provides for a
high level of gene expression, whereas a weak promoter provides for
a very low level of gene expression. An inducible promoter is a
promoter that provides for turning on and off of gene expression in
response to an exogenously added agent or to an environmental or
developmental stimulus. An isolated promoter sequence that is a
strong promoter for heterologous DNAs is advantageous because it
provides for a sufficient level of gene expression to allow for
easy detection and selection of transformed cells, and provides for
a high level of gene expression when desired. A promoter may also
contain DNA sequences that are involved in the binding of protein
factors which control the effectiveness of transcription initiation
in response to physiological or developmental conditions.
[0050] "Regulatory sequence(s)" refers to nucleotide sequences
located upstream (5'), within, and/or downstream (3') of a coding
sequence, which control the transcription and/or expression of the
coding sequences in conjunction with the protein biosynthetic
apparatus of the cell. Regulatory sequences include promoters,
translation leader sequences, transcription termination sequences
and polyadenylation sequences.
[0051] "Encoding" and "coding" refer to the process by which a
gene, through the mechanisms of transcription and translation,
provides the information to a cell from which a series of amino
acids can be assembled into a specific amino acid sequences to
produce an active enzyme. It is understood that the process of
encoding a specific amino acid sequence includes DNA sequences that
may involve base changes that do not cause a change in the encoded
amino acid, or which involve base changes which may alter one or
more amino acids, but do not affect the functional properties of
the protein encoded by the DNA sequence. It is therefore understood
that the invention encompasses more than the specific exemplary
sequences. Modifications to the sequences, such as deletions,
insertions or substitutions in the sequence which produce silent
changes that do not substantially affect the functional properties
of the resulting protein molecule are also contemplated. For
example, alterations in the gene sequence which reflect the
degeneracy of the genetic code, or which result in the production
of a chemically equivalent amino acid at a given site, are
contemplated. Thus, a codon for the amino acid alanine, a
hydrophobic amino acid, may be substituted by a codon encoding
another less hydrophobic residue, such as glycine, or a more
hydrophobic residue, such as valine, leucine or isoleucine.
Similarly, changes which result in substitution of one negatively
charged residue for another, such as aspartic acid for glutamic
acid, or one positively charged residue for another, such as lysine
for arginine, can also be expected to produce a biologically
equivalent product. Nucleotide changes which result in alteration
of the N-terminal and C-terminal portions of the protein molecule
would also not be expected to alter the activity of the protein. In
some cases, it may in fact be desirable to make mutants of the
sequence to study the effect of retention of biological activity of
the protein. Each of these proposed modifications is well within
the routine skill in the art, as is the determination of retention
of biological activity in the encoded products. Moreover, the
skilled artisan recognizes that sequences encompassed by this
invention are also defined by their ability to hybridize, under
stringent condition, with the sequences exemplified herein.
[0052] "Expression" is meant to refer to the production of a
protein product encoded by a gene. "Overexpression" refers to the
production of a gene product in transgenic organisms that exceed
levels of production in normal or non-transformed organisms.
[0053] "Functional portion" or "functional fragment" or "functional
equivalents" of an enzyme is that portion, fragment or equivalent
section which contains the active site for binding one or more
reactants or is capable of improving or regulating the rate of
reaction. The active site may be made up of separate portions
present on one or more polypeptide chains and will generally
exhibit high substrate specificity.
[0054] "Enzyme encoded by a nucleotide sequence" includes enzymes
encoded by a nucleotide sequence which includes partial isolated
DNA sequences.
[0055] "Transformation" refers to the transfer of a foreign gene
into the genome of a host organism and its genetically stable
inheritance.
[0056] "% identity" refers to the percentage of the
nucleotides/amino acids of one polynucleotide/polypeptide that are
identical to the nucleotides/amino acids of another sequence of
polynucleotide/polypeptide as identified by a program such as GAP
from Genetics Computer Group Wisconsin (GCG) package (version 9.0)
(Madison, Wis.). GAP uses the algorithm of Needleman and Wunsch (J.
Mol. Biol. 48:443-453, 1970) to find the alignment of two complete
sequences that maximizes the number of matches and minimizes the
number of gaps. When parameters required to run the above algorithm
are not specified, the default values offered by the program are
contemplated.
[0057] "Substantial homology" or "substantial similarity" refers to
a 70% or more similarity or 70% homology wherein "% similarity" or
"% homology" between two polypeptide sequences is a function of the
number of similar positions shared by two sequences on the basis of
the scoring matrix used divided by the number of positions compared
and then multiplied by 100. This comparison is made when two
sequences are aligned (by introducing gaps if needed) to determine
maximum homology. The PowerBlast program, implemented by the
National Center for Biotechnology Information, can be used to
compute optimal, gapped alignments. GAP program from Genetics
Computer Group Wisconsin package (version 9.0) (Madison, Wis.) can
also be used.
[0058] "Lignin monomer composition" refers to the relative ratios
of guaiacyl monomer and syringyl monomer found in lignified plant
tissue.
[0059] "Plant" includes whole plants and portions of plants,
including plant organs (e.g., roots, stems, leaves, etc).
[0060] "Angiosperm" refers to plants that produce seeds encased in
an ovary. A specific example of an angiosperm is Liquidambar
styraciflua (L.)[sweetgum].
[0061] "Gymnosperm" refers to plants that produce naked seeds,
i.e., seeds that are not encased in an ovary. A specific example of
a gymnosperm is Pinus taeda (L.)[loblolly pine].
[0062] As used herein, the terms "isolated and/or purified" with
reference to a nucleic acid molecule or polypeptide refer to in
vitro isolation of a nucleic acid or polypeptide molecule from its
natural cellular environment, and from association with other
components of the cell, such as nucleic acid or polypeptide, so
that it can be sequenced, replicated and/or expressed.
[0063] An "isolated" strain of Agrobacterium refers to cells
derived from a clone of Agrobacterium that is transformed in vitro
with an isolated binary vector.
[0064] A "vector" is a recombinant nucleic acid construct, such as
plasmid, phage genome, virus genome, cosmid, or artificial
chromosome to which a polynucleotide in accordance with the
invention may be attached. In a specific embodiment, the vector may
bring about the replication of the attached segment, e.g., in the
case of a cloning vector.
[0065] "Sinapyl alcohol dehydrogenase" or "SAD", coniferyl alcohol
dehydrogenase or "CAD", coniferaldeyde 5-hydroxylase or "Cald5H",
5-hydroxyconiferaldehyde O-methyltransferase or "AldOMT", and
4-coumarate-CoA ligase or "4CL" refer to enzymes in the plant
phenylpropanoid biosynthetic pathway. In the illustrated
embodiments of the present invention, the DNA sequences encoding
these enzymes were identified from quaking aspen Populus
tremuloides. It is understood that each sequence can be used as a
probe to clone its equivalent from any plant species by techniques
(EST, PCR, RT-PCR, antibodies, etc.) well known in the art.
[0066] The Phenyl Propanoid Biosynthetic Pathway
[0067] Reference is made to FIG. 1 which shows different steps in
the biosynthetic pathways from 4-coumarate (1) to guaiacyl
(coniferyl alcohol (6)) and syringyl (sinapyl alcohol (9))
monolignols for the formation of guaiacyl-syringyl lignin together
with the enzymes responsible for catalyzing each step. The enzymes
indicated for each of the reaction steps are: 4-coumaric acid
3-hydroxylase (C3H) which converts 4-coumarate (1) to caffeate (2);
4-coumarate-CoA ligase (4CL) converts caffeate (2) to caffeoyl CoA
(3) which in turn is converted to feruloyl CoA (4) by caffeoyl-CoA
O-methyltransferase (CCoAOMT); cinnamoyl-CoA reductase (CCR)
converts feruloyl CoA (4) to coniferaldehyde (5); coniferyl alcohol
dehydrogenase (CAD) converts coniferaldehyde (5) to the guaiacyl
monolignol coniferyl alcohol (6); at coniferaldehyde (5), the
pathway splits wherein coniferaldehyde (5) can also be converted to
5-hydroxyconiferaldehyde (7) by coniferaldeyde 5-hydroxylase
(Cald5H); 5-hydroxyconiferaldehyde O-methyltransferase (AldOMT)
converts 5-hydroxconiferaldehyde (7) to sinapaldehyde (8) which, in
turn, is converted to the syringyl monolignol, sinapyl alcohol (9)
by sinapyl alcohol dehydrogenase (SAD).
[0068] DNA Constructs
[0069] According to the present invention, a DNA construct is
provided which is a plant DNA having a promoter sequence, a coding
region and a terminator sequence. The coding region encodes a
combination of enzymes essential to lignin biosynthesis,
specifically, SAD, CAD, Cald5H, AldOMT, and 4CL protein sequences,
substantially similar sequences, or functional fragments thereof.
The coding region is suitably a minimum size of 50 bases. The gene
promoter is positioned at the 5'-end of a transgene (e.g., 4CL
alone or together with SAD, Cald5H, and AldOMT, and combinations
thereof, or 4CL and CAD alone, or together with CAld5H, SAD, and
AldOMT, and combinations thereof, as described hereinafter) for
controlling the transgene expression, and a gene termination
sequence that is located at the 3'-end of the transgene for
signaling the end of the transcription of the transgene.
[0070] The DNA construct in accordance with the present invention
can be incorporated into the genome of a plant by transformation to
alter lignin biosynthesis, increase syringyl/guaiacyl (S/G) lignin
ratio and increase cellulose content. The DNA construct may include
clones of CAld5H, SAD, AldOMT, CAD, and 4CL, and variants thereof
such as are permitted by the degeneracy of the genetic code and the
functional equivalents thereof.
[0071] The DNA constructs of the present invention may be inserted
into plants to regulate production the following enzymes: CAld5H,
SAD, AldOMT, CAD, and 4CL. Depending on the nature of the
construct, the production of the protein may be increased or
decreased, either throughout or at particular stages in the life of
the plant, relative to a similar control plant that does not
incorporate the construct into its genome. For example, the
orientation of the DNA coding sequence, promoter, and termination
sequence can serve to either suppress lignin formation or amplify
lignin formation. For the down-regulation of lignin synthesis, the
DNA is in the antisense orientation. For the amplification of
lignin biosynthesis, the DNA is in the sense orientation, thus to
provide one or more additional copies of the DNA in the plant
genome. In this case, the DNA is suitably a full-length cDNA copy.
It is also possible to target expression of the gene to specific
cell types of the plants, such as the epidermis, the xylem, the
roots, etc. Constructs in accordance with the present invention may
be used to transform cells of both monocotyledons and dicotyledons
plants in various ways known in the art. In many cases, such plant
cells may be cultured to regenerate whole plants which subsequently
reproduce to give successive generations of genetically modified
plants. Examples of plants that are suitably genetically modified
in accordance with the present invention, include but are not
limited to, trees such a aspen, poplar, pine and eucalyptus.
[0072] Promoters and Termination Sequences
[0073] Various gene promoter sequences are well known in the art
and can be used in the DNA constructs of present invention. The
promoter in the constructs in accordance with the present invention
suitably provides for expression of the linked DNA segment. The
promoter can also be inducible so that gene expression can be
turned on or off by an exogenously added agent. It may also be
preferable to combine the desired DNA segment with a promoter that
provides tissue specific expression or developmentally regulated
gene expression in plants.
[0074] The promoter may be selected from promoters known to operate
in plants, e.g., CaMV35S, GPAL2, GPAL3 and endogenous plant
promoter controlling expression of the enzyme of interest. Use of a
constitutive promoter such as the CaMV35S promoter (Odell et al.
1985), or CaMV 19S (Lawton et al., 1987) can be used to drive the
expression of the transgenes in all tissue types in a target plant.
Other promoters are nos (Ebert et al. 1987), Adh (Walker et al.,
1987), sucrose synthase (Yang et al., 1990), .DELTA.-tubulin,
ubiquitin, actin (Wang et al., 1992), cab (Sullivan et al., 1989),
PEPCase (Hudspeth et al., 1989) or those associate with the R gene
complex (Chandler et al., 1989). On the other hand, use of a tissue
specific promoter permits functions to be controlled more
selectively. The use of a tissue-specific promoter has the
advantage that the desired protein is only produced in the tissue
in which its action is required. Suitably, tissue-specific
promoters, such as those would confine the expression of the
transgenes in developing xylem where lignification occurs, may be
used in the inventive DNA constructs.
[0075] A DNA segment can be combined with the promoter by standard
methods as described in Sambrook et al., 2nd ed. (1982). Briefly, a
plasmid containing a promoter such as the CaMV 35S promoter can be
constructed as described in Jefferson (1987) or obtained from
Clontech Lab, Palo Alto, Calif. (e.g., pBI121 or pBI221).
Typically, these plasmids are constructed to provide for multiple
cloning sites having specificity for different restriction enzymes
downstream from the promoter. The DNA segment can be subcloned
downstream from the promoter using restriction enzymes to ensure
that the DNA is inserted in proper orientation with respect to the
promoter so that the DNA can be expressed.
[0076] The gene termination sequence is located 3' to the DNA
sequence to be transcribed. Various gene termination sequences
known in the art may be used in the present inventive constructs.
These include nopaline synthase (NOS) gene termination sequence
(see, e.g., references cited in co-pending, commonly-owned PCT
application, PCT/US/0027704, filed Oct. 6, 2000, entitled "Method
of Introducing a Plurality of Genes into Plants," incorporated
herein by reference.)
[0077] Marker Genes
[0078] A marker gene may also be incorporated into the inventive
DNA constructs to aid the selection of plant tissues with positive
integration of the transgene. "Marker genes" are genes that impart
a distinct phenotype to cells expressing the marker gene, and thus,
allow such transformed cells to be distinguished from cells that do
not have the marker. Many examples of suitable marker genes are
known to the art and can be employed in the practice of the
invention, such as neomycin phosphotransferase II (NPT II) gene
that confers resistance to kanamycin or hygromycin antibiotics
which would kill the non-transformed plant tissues containing no
NPT II gene (Bevan et al., 1983). Numerous other exemplary marker
genes used in the method, in accordance with the present invention
are listed in Table 1 of co-pending, commonly owned of
PCT/US/0027704, filed Oct. 6, 2000, entitled "Method of Introducing
a Plurality of Genes into Plants," incorporated herein by
reference.
[0079] Therefore, it will be understood that the following
discussion is exemplary rather than exhaustive. In light of the
techniques disclosed herein and the general recombinant techniques
which are known in the art, the present invention renders possible
the introduction of any gene, including marker genes, into a
recipient cell to generate a transformed plant.
[0080] Optional Sequences in the Expression Cassette
[0081] The expression cassette containing DNA sequences in
accordance with the present invention can also optionally contain
other DNA sequences. Transcription enhancers or duplications of
enhancers can be used to increase expression from a particular
promoter. One may wish to obtain novel tissue-specific promoter
sequences for use in accordance with the present invention. To
achieve this, one may first isolate CDNA clones from the tissue
concerned and identify those clones which are expressed
specifically in that tissue, for example, using Northern blotting.
Ideally, one would like to identify a gene that is not present in a
high copy number, but which gene product is relatively abundant in
specific tissues. The promoter and control elements of
corresponding genomic clones may then be localized using the
techniques of molecular biology known to those of skill in the
art.
[0082] Expression of some genes in transgenic plants will occur
only under specified conditions. It is known that a large number of
genes exist that respond to the environment. In some embodiments of
the present invention expression of a DNA segment in a transgenic
plant will occur only in a certain time period during the
development of the plant. Developmental timing is frequently
correlated with tissue specific gene expression.
[0083] As the DNA sequence inserted between the transcription
initiation site and the start of the coding sequence, i.e., the
untranslated leader sequence, can influence gene expression, one
can also employ a particular leader sequence. Preferred leader
sequence include those which comprise sequences selected to direct
optimum expression of the attached gene, i.e., to include a
preferred consensus leader sequence which can increase or maintain
mRNA stability and prevent inappropriate initiation of translation
(Joshi, 1987). Such sequences are known to those of skill in the
art. Sequences that are derived from genes that are highly
expressed in plants will be most preferred.
[0084] Additionally, expression cassettes can be constructed and
employed to target the gene product of the DNA segment to an
intracellular compartment within plant cells or to direct a protein
to the extracellular environment. This can generally be achieved by
joining a DNA sequence encoding a transit or signal peptide
sequence to the coding sequence of the DNA segment. Also, the DNA
segment can be directed to a particular organelle, such as the
chloroplast rather than to the cytoplasm.
[0085] Alternatively, the DNA fragment coding for the transit
peptide may be chemically synthesized either wholly or in part from
the known sequences of transit peptides such as those listed above.
The description of the optional sequences in the expression
cassette, is commonly owned, co-pending PCT/US/0027704, filed Oct.
6, 2000, entitled "Method of Introducing a Plurality of Genes into
Plants," incorporated herein by reference.
[0086] Transformation
[0087] Transformation of cells from plants, e.g., trees, and the
subsequent production of transgenic plants using e.g.,
Agrobacterium-mediated transformation procedures known in the art,
and further described herein, is one example of a method for
introducing a foreign gene into plants. Although, the method of the
invention can be performed by other modes of transformation,
Agrobacterium-mediated transformation procedures are cited as
examples, herein. For example, transgenic plants may be produced by
the following steps: (i) culturing Agrobacterium in low-pH
induction medium at low temperature and preconditioning, i.e.,
coculturing bacteria with wounded tobacco leaf extract in order to
induce a high level of expression of the Agrobacterium vir genes
whose products are involved in the T-DNA transfer; (ii) coculturing
desired plant tissue explants, including zygotic and/or somatic
embryo tissues derived from cultured explants, with the incited
Agrobacterium; (iii) selecting transformed callus tissue on a
medium containing antibiotics; and (iv) converting the embryos into
platelets.
[0088] Any non-tumorigenic A. tumefaciens strain harboring a
disarmed Ti plasmid may be used in the method in accordance with
the invention. Any Agrobacterium system may be used. For example,
Ti plasmid/binary vector system or a cointegrative vector system
with one Ti plasmid may be used. Also, any marker gene or
polynucleotide conferring the ability to select transformed cells,
callus, embryos or plants and any other gene, such as for example a
gene conferring resistance to a disease, or one improving lignin
content or structure or cellulose content, may also be used. A
person of ordinary skill in the art can determine which markers and
genes are used depending on particular needs.
[0089] To increase the infectivity of the bacteria, Agrobacterium
is cultured in low-pH induction medium, i.e., any bacterium culture
media with a pH value adjusted to from 4.5 to 6.0, most preferably
about 5.2, and at low temperature such as for example about
19-30.degree. C., preferably about 21-26.degree. C. The conditions
of low-pH and low temperature are among the well-defined critical
factors for inducing virulence activity in Agrobacterium (e.g.,
Altmorbe et al., 1989; Fullner et al., 1996; Fullner and Nester,
1996).
[0090] The bacteria is preconditioned by coculturing with wounded
tobacco leaf extract (prepared according to methods known generally
in the art) to induce a high level of expression of the
Agrobacterium vir genes. Prior to inoculation of plant somatic
embryos, Agrobacterium cells can be treated with a tobacco extract
prepared from wounded leaf tissues of tobacco plants grown in
vitro. To achieve optimal stimulation of the expression of
Agrobacterium vir genes by wound-induced metabolites and other
cellular factors, tobacco leaves can be wounded and pre-cultured
overnight. Culturing of bacteria in low pH medium and at low
temperature can be used to further enhance the bacteria vir gene
expression and infectivity. Preconditioning with tobacco extract
and the vir genes involved in the T-DNA transfer process are
generally known in the art.
[0091] Agrobacterium treated as described above is then cocultured
with a plant tissue explant, such as for example, zygotic and/or
somatic embryo tissue. Non-zygotic (i.e., somatic) or zygotic
tissues can be used. Any plant tissue may be used as a source of
explants. For example, cotyledons from seeds, young leaf tissue,
root tissues, parts of stems including nodal explants, and tissues
from primary somatic embryos such as the root axis may be used.
Generally, young tissues are a preferred source of explants.
[0092] The above-described transformation and regeneration protocol
is readily adaptable to other plant species. Other published
transformation and regeneration protocols for plant species include
Danekar et al, 1987; McGranahan et al, 1988; McGranahan et al.,
1990; Chen, Ph.D. Thesis, 1991; Sullivan et al, 1993; Huang et al.,
1991; Wilde et al., 1992; Minocha et al., 1986; Parsons et al.,
1986; Fillatti et al., 1987; Pythoud et al., 1987; De Block, 1990;
Brasileiro et al., 1991; Brasileiro et al., 1992; Howe et al.,
1991; Klopfenstein et al., 1991; Leple et al., 1992; and Nilsson et
al., 1992.
[0093] Characterization
[0094] To confirm the presence of the DNA segment(s) or
"transgene(s)" in the regenerated plants, a variety of assays may
be performed. Such assays include, for example, "molecular
biological" assays well known to those of skill in the art, such as
Southern and Northern blotting and PCR; "biochemical" assays, such
as detecting the presence of a protein product, e.g., by
immunological means (ELISAs and Western blots) or by enzymatic
function; plant part assays, such as leaf or root assays; and also,
by analyzing the phenotype of the whole regenerated plant.
[0095] 1. DNA Integration, RNA Expression and Inheritance
[0096] Genomic DNA may be isolated from callus cell lines or any
plant parts to determine the presence of the DNA segment through
the use of techniques well known to those skilled in the art. Note
that intact sequences will not always be present, presumably due to
rearrangement or deletion of sequences in the cell.
[0097] The presence of DNA elements introduced through the methods
of this invention may be determined by polymerase chain reaction
(PCR). Using this technique, discreet fragments of DNA are
amplified and detected by gel electrophoresis. This type of
analysis permits one to determine whether a DNA segment is present
in a stable transformant, but does not prove integration of the
introduced DNA segment into the host cell genome. In addition, it
is not possible using PCR techniques to determine whether
transformants have exogenous genes introduced into different sites
in the genome, i.e., whether transformants are of independent
origin. It is contemplated that using PCR techniques it would be
possible to clone fragments of the host genomic DNA adjacent to an
introduced DNA segment.
[0098] Positive proof of DNA integration into the host genome and
the independent identities of transformants may be determined using
the technique of Southern hybridization. Using this technique,
specific DNA sequences that were introduced into the host genome
and flanking host DNA sequences can be identified. Hence the
Southern hybridization pattern of a given transformant serves as an
identifying characteristic of that transformant. In addition, it is
possible through Southern hybridization to demonstrate the presence
of introduced DNA segments in high molecular weight DNA, i.e.,
confirm that the introduced DNA segment has been integrated into
the host cell genome. The technique of Southern hybridization
provides information that is obtained using PCR, e.g., the presence
of a DNA segment, but also demonstrates integration into the genome
and characterizes each individual transformant.
[0099] It is contemplated that by using the techniques of dot or
slot blot hybridization which are modifications of Southern
hybridization techniques, one could obtain the same information
that is derived from PCR, e.g., the presence of a DNA segment.
[0100] Both PCR and Southern hybridization techniques can be used
to demonstrate transmission of a DNA segment to progeny. In most
instances the characteristic Southern hybridization pattern for a
given transformant will segregate in progeny as one or more
Mendelian genes (Spencer et al., 1992; Laursen et al.,1994)
indicating stable inheritance of the gene.
[0101] Whereas DNA analysis techniques may be conducted using DNA
isolated from any part of a plant, RNA may only be expressed in
particular cells or tissue types, and hence, it will be necessary
to prepare RNA for analysis from these tissues. PCR techniques may
also be used for detection and quantitation of RNA produced from
introduced DNA segments. In this application of PCR, it is first
necessary to reverse transcribe RNA into DNA, using enzymes such as
reverse transcriptase, and then through the use of conventional PCR
techniques amplify the DNA. In most instances, PCR techniques,
while useful, will not demonstrate integrity of the RNA product.
Further information about the nature of the RNA product may be
obtained by Northern blotting. This technique will demonstrate the
presence of an RNA species and give information about the integrity
of that RNA. The presence or absence of an RNA species can also be
determined using dot or slot blot Northern hybridizations. These
techniques are modifications of Northern blotting and demonstrate
only the presence or absence of an RNA species.
[0102] 2. Gene Expression
[0103] While Southern blotting and PCR may be used to detect the
DNA segment in question, they do not provide information as to
whether the DNA segment is being expressed. Expression may be
evaluated by specifically identifying the protein products of the
introduced DNA segments or evaluating the phenotypic changes
brought about by their expression.
[0104] Assays for the production and identification of specific
proteins may make use of physical-chemical, structural, functional,
or other properties of the proteins. Unique physical-chemical or
structural properties allow the proteins to be separated and
identified by electrophoretic procedures, such as native or
denaturing gel electrophoresis or isoelectric focussing, or by
chromatographic techniques such as ion exchange or gel exclusion
chromatography. The unique structures of individual proteins also
offer opportunities for use of specific antibodies to detect their
presence in formats such as an ELISA assay. Combinations of
approaches may be employed with even greater specificity such as
western blotting in which antibodies are used to locate individual
gene products that have been separated by electrophoretic
techniques. Additional techniques may be employed to absolutely
confirm the identity of the product of interest such as evaluation
by amino acid sequencing following purification. Although these are
among the most commonly employed, other procedures may be
additionally used.
[0105] Assay procedures may also be used to identify the expression
of proteins by their functionality, especially the ability of
enzymes to catalyze specific chemical reactions involving specific
substrates and products. These reactions may be followed by
providing and quantifying the loss of substrates or the generation
of products of the reactions by physical or chemical procedures.
Examples are as varied as the enzyme to be analyzed and may include
assays for PAT enzymatic activity by following production of
radiolabelled acetylated phosphinothricin from
phosphinothricin.
[0106] Very frequently the expression of a gene product is
determined by evaluating the phenotypic results of its expression.
These assays also may take many forms including but not limited to
analyzing changes in the chemical composition, morphology, or
physiological properties of the plant. Chemical composition may be
altered by expression of DNA segments encoding enzymes or storage
proteins which change amino acid composition and may be detected by
amino acid analysis, or by enzymes which change starch quantity
which may be analyzed by near infrared reflectance spectrometry.
Morphological changes may include greater stature or thicker
stalks. Most often changes in response of plants or plant parts to
imposed treatments are evaluated under carefully controlled
conditions termed bioassays.
[0107] The invention will be further described by the following
non-limiting examples.
EXAMPLE 1
Preparation of Transgenic Aspen
[0108] Construction of binary vectors
[0109] pBKPpt.sub.4CL Pt4CL1-a: Aspen 4CL1 xylem specific promoter
(Ppt.sub.4CL, 1.1 kb, GenBank AF041051) was prepared and linked to
aspen 4CL1 cDNA (Pt4CL1, GenBank AF041049) which was orientated in
the antisense direction. Then the cassette containing aspen 4CL1
promoter and antisense aspen 4CL1 cDNA was positioned in a plant
transformation binary vector, as shown in FIG. 1. (pBKPpt.sub.4CL
Pt4CL1-a construct)
[0110] pBKPpt.sub.4cl PtCAld5H-s: From pBKPpt.sub.4CL Pt4CL-a
construct, the antisense Pt4CL1 was replaced with PtCAld5H cDNA in
a sense orientation, yielding a pBKPpt.sub.4CL PtCAld5H-s
transformation binary construct, as shown in FIG. 2.
[0111] Also, Example 1 of PCT application PCT/US/0027704, filed
Oct. 6, 2000, entitled "Method of Introducing a Plurality of Genes
into Plants," incorporated herein by reference, describes a number
of other gene constructs for preparing transgenic plants. The
plants are transformed with a genes from the phenylpropanoid
pathway (i.e., 4CL, AEOMT, CoAOMT, and CAld5H) using an operably
linked to either a homologous or a heterologous and either a
constitutive or tissue-specific promoter
[0112] Incorporation of binary vector into Agrobacterium
[0113] According to the protocol described in Tsai et al. (1994,
Plant Cell Reports, 14:94-97) Agrobacterium C58/pMP90 strain was
grown in LB with selection of gentamicin at 28.degree. C.
overnight. Cells were harvested by centrifugation at 10,000 rpm for
10 minutes at 4.degree. C. The cell pellet was washed with 0.5
volume of ice-cold 20 mM CaCl.sub.2, and centrifuged again. The
cells were then resuspended in 0.1 volume of ice-cold 20 mM
CaCl.sub.2 in a sample tube. About 1 .mu.g of binary vector DNA was
added to 200 .mu.L of the cell suspension and mixed by pipetting.
The sample tube was chilled in liquid N.sub.2 for 5 minutes and
thawed at 37.degree. C. in a water bath for 5 minutes. One mL of LB
medium was added and the mixture was incubated at 28.degree. C. for
3 hours with gentle shaking. Twenty .mu.L of the cells were spread
onto a LB plate containing 25 .mu.g/mL gentamicin and 50 .mu.g/mL
kanamycin and incubated at 28.degree. C. for 2 days. PCR
(amplification conditions, cycling parameters and primers are
described below) was used to verify the presence of DNA from the
vector in the transformed colonies.
[0114] Simultaneous transformation of Aspen with multiple genes via
engineered Agrobacterium strains
[0115] For simultaneous transformation of multiple genes,
pBKPpt.sub.4cl Pt4CL-a and pBKPpt.sub.4cl PtCal5H Agrobacterium
clones were cultured in LB medium at 28.degree. C. overnight
separately. The Agrobacterium strains were subcultured individually
by a 100-fold dilution into 50 mL of LB (pH 5.4) containing 50
.mu.g/mL kanamycin, 25 .mu.g/mL gentamycin and 20 .mu.M
acetosyringone (in DMSO), and grown overnight at 28.degree. C. with
shaking. An equal volume of the same density of individually
cultured Agrobacterium strains was then mixed. Leaves excised from
sterile tobacco plants were cut into pieces with a size of about 5
mm.sup.2 and the leaf discs were then immersed in the Agrobacterium
mixture for 5 minutes.
[0116] After removing excess Agrobacterium cells, the treated leaf
discs were placed on callus induction medium (WPM:Woody Plant
Medium, BA: 6-benzyladenine +2,4-D: 2,4-dichlorophenoxyacetic acid;
Tsai et al. 1994, Plant Cell Reports, 14:94-97) and cultured for 2
days. Then, the pre-cultured leaf discs were rinsed with sterile
water several times to remove the Agrobacterium cells and washed in
1 mg/mL claforan and 1 mg/mL ticarcillin with shaking for 3 hours
to kill Agrobacterium. After briefly blot-drying, the pre-cultured
and washed leaf discs were cultured on callus induction medium
containing 50 .mu.g/mL kanamycin and 300 .mu.g/mL claforan for
selection of transformed cells. After 2 to 3 subcultures (10
days/subculture), the calli grown on the leaf discs were excised
and transferred onto shoot induction medium (WPM+TDZ:
N-phenyl-N'-1,2,3-thiad- iazol-5-yl-urea) containing 50 .mu.g/ml
kanamycin and 300 .mu.g/ml claforan for regenerating shoots. After
shoots were grown to about 0.5 cm high, they excised and planted to
rooting media (WPM with kanamycin and claforan). Whole plants about
7 cm high were transplanted into soil and maintained in a
greenhouse for subsequent molecular characterization.
[0117] Genomic DNA isolation
[0118] Genomic DNA was isolated according to Hu et al. (1998).
About 100 mg of young leaves were collected from each plant growing
in the greenhouse and ground in liquid N.sub.2 to fine powder for
DNA isolation using QIAGEN plant DNA isolation kit (Valencia,
Calif.). Specifically, the powdered tissue was added to extract
buffer containing 2% hexadecyltrimethylammonium bromide (CTAB), 100
mM Tris-HC1, pH 8.0, 20 mM EDTA, 1.4 M NaCl and 30 mM
.beta.-mercaptoethanol at 5 mL/g tissue. The extraction mixture was
incubated in a tube at 60.degree. C. for 1 hour with occasional
shaking. One volume of chloroform-isoamyl alcohol (24:1) was added
and mixed gently. The two phases were separated by centrifugation
at 10,000.times.g for 10 minutes. The aqueous phase was transferred
to a new tube and extracted with chloroform in the presence of 1%
CTAB and 0.7 M NaCl. The DNA was precipitated by addition of 2/3
volume of isopropanol (-20.degree. C.) and kept at -20.degree. C.
for 20 minutes. Following the centrifugation at 10,000.times.g for
10 minutes, the pelleted DNA was washed with 70% ethanol-10 mM
ammonia acetate. Then the pellet was dissolved in 2 mL TE buffer
(10 mM Tris-HC1/0.1 mM EDTA, pH 8) and treated with 2 .mu.g RNase A
at 37.degree. C. for 20 minutes. The DNA was precipitated by
addition of 2 mL of 5 M ammonia acetate and 10 mL of 95% ethanol at
-20.degree. C. for 20 minutes. After centrifugation, the pellet was
washed with 70% ethanol. After a brief drying, genomic DNA was
dissolved in TE buffer.
[0119] PCR verification of foreign gene insertion in host plant
genome
[0120] PCR was used to verify the integration of the gene
constructs in the genome of transgenic plants. Two specific primers
were synthesized for each construct and used to PCR-amplify the
corresponding construct in genome of transgenic Aspen. For the
PBKPpt.sub.4CL Pt4CL1-a construct, two specific primers were
synthesized that amplify a 4CL cDNA fragment. Pt4CL1 promoter sense
primer (5'CAGGAATGCTCTGCACTCTG3') (SEQ ID NO:11) and Pt4CL1 sense
primer (5'ATGAATCCACAAGAATTCAT3') (SEQ ID NO:12). at the
translation start region. Primers for PCR verification of
pBKPpt.sub.4CL PtCald5H-s construct are Pt4CL1 promoter sense
primer (5'CAGGAATGCTCTGCACTCTG3') (SEQ ID NO:13) and PtCald5H
antisense primer (5'TTAGAGAGGACAGAGCACACG3') (SEQ ID NO:14) at
translation stop region.
[0121] The PCR reaction mixture contained 100 ng genomic DNA of
transformed aspen, and 0.2 .mu.M of each primer, 100 .mu.M of each
deoxyribonucleotide triphosphate, 1.times.PCR buffer and 2.5 Units
of Taq DNA polymerase (Promega Madison, Wis.) in a total volume of
50 .mu.L. The cycling parameters were as follows: 94.degree. C. for
1 minute, 56.degree. C. for 1 minute (for 4CL and CAld5H or can
vary between cDNA templates used) according to different gene
checked) and 72.degree. C. for 2 minute, for 40 cycles, with 5
minutes at 72.degree. C. extension. The PCR products were
electrophoresized on a 1% agarose gel.
EXAMPLE 2
Preparation of other transgenic plants
[0122] It is important to recognize that there is a substantial
percentage of sequence homology among the plant genes involved in
the lignin biosynthetic pathway, discussed herein. This substantial
sequence homology allows the method in accordance with the
invention disclosed herein to be applicable to all plants that
possess the requisite genes involved in the lignin biosynthetic
pathway. To demonstrate the substantial sequence homology among
plant genes, the percentage sequence homology is set forth in
tabular form, for example, CAld5H genes (Table 1), AldOMT genes
(Table 2), CAD genes (Table 3), and 4CL genes (See FIG. 12).
Therefore, it is possible to alter lignin monomer composition,
increase S/G lignin ratio, and increase cellulose content in all
plants by using the method in accordance with the invention,
described herein.
1TABLE 1 Protein sequence homology (%) of plant Coniferyl Aldehyde
5-hydroxylase (CAld5H) from 1) Aspen; 2) Poplar, AJ010324; 3)
Sweetgum, AF139532; 4) Arabidopsis (Ferulic Acid 5-hydroxylase,
F5H) 1 2 3 4 1 2 99 3 84 84 4 81 83 83
[0123]
2TABLE 2 Protein sequence homology (%) of plant AldOMTs from 1)
Aspen, X62096; 2) Poplar, M73431; 3) Almond, X83217; 4) Strawberry,
AF220491; 5) Alfalfa, M63853; 6) Eucalyptus, X74814; 7) Clarkia
breweri, AF006009; 8) Sweetgum, AF139533; 9) Arabidopsis, U70424;
10) Tobacco, X74452; 11) Vitis vinifera, AF239740 1 2 3 4 5 6 7 8 9
10 11 1 2 99 3 92 92 4 91 90 94 5 90 90 89 89 6 89 89 89 87 87 7 88
88 89 88 87 90 8 88 87 88 87 86 85 83 9 84 84 85 86 82 82 82 83 10
83 83 83 82 81 82 80 83 77 11 80 80 78 77 78 77 78 80 76 77
[0124]
3TABLE 3 Protein sequence homology (%) of plant CADs from 1) Aspen,
AF217957; 2) Cottonwood, Z19568 and 3) Udo, D13991; 4) Tobacco,
X62343; 5) Tobacco, X62344; 6) Eucalyptus, AF038561; 7) Eucalyptus,
X65631; 8) Lucerne, AF083332; 9) Lucerne, Z19573; 10) Maize,
AJ005702; 11) Maize, Y13733; 12) Sugarcane, AJ231135; 13) Radiata
pine, U62394; 14) Loblolly pine, Z37992; 15) Loblolly pine, Z37991;
16) Norway spruce, X72675. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1
2 97 3 85 84 4 82 82 84 5 80 80 81 94 6 81 81 82 80 78 7 81 80 81
80 78 80 8 79 79 80 80 79 79 79 9 79 80 80 79 78 78 79 99 10 78 77
79 76 74 76 77 73 73 11 78 78 79 77 74 76 76 73 72 99 12 77 76 78
74 73 75 74 73 73 95 96 13 70 71 69 70 70 69 68 67 68 67 68 68 14
69 70 69 69 69 69 68 68 68 67 67 67 99 15 69 70 68 69 69 68 68 67
67 67 67 67 99 95 16 69 69 70 70 69 68 68 68 67 69 69 67 95 95
94
[0125] To further demonstrate the versatility of this invention in
transferring a variety of foreign genes and the applicability of
this invention to plants other than the herbaceous species,
different binary vectors were constructed and transferred into
aspen (Populus tremuloides) tree. Two binary vectors, each
containing a cDNA sequence and a neomycin phosphotransferase (NPT
II) cDNA encoding kanamycin resistance, were constructed. Each
vector was then individually mobilized into Agrobacterium strain
C58 to create two isolated (engineered) Agrobacterium strains. It
should be noted that about 50 transgenic tobacco plants were
generated by the same technique harboring 4 different sets of
foreign genes, as described in the PCT application PCTUS0027704
filed Oct. 6, 2000, entitled "Method of Introducing a Plurality of
Genes into Plants," incorporated herein by reference.
[0126] Table 4 summarizes the numerical results from simultaneous
manipulating xylem-specific expression of 4CL and CAld5H in
transgenic aspen. After DNA constructs were incorporated into plant
cells by Agrobacterium mediated transformation, as set forth by the
method in accordance with the invention and after PCR confirmation
of transgene integration, 14 positive transgenic trees were
randomly selected, representing three different trangenic groups,
i.e., Groups I, II and III. Group I (plant #21, 22, 23, 25, and 37)
consists of those with the integration of only antisense Pt4CL1
cDNA (Table 4). Group II plants (# 32, 84, 93, and 94) harbored
only sense PtCAld5H cDNA, whereas Group III plants (#71, 72, 74,
and 141) contained both antisense Pt4CL1 and sense PtCAld5H
transgenes. These transgenic trees were then further analyzed for
their lignin and cellulose contents and lignin S/G ratio (Table 4).
It is clear that, when compared with the control, untransformed
aspen, transgenic plants (#21, 22, 23, 25, and 37) engineered for
the suppression of 4CL gene with antisense Pt4CL1 transgene had
drastic reductions in their lignin content, with significant
increases in their cellulose content. Transgenic plants (#32, 84,
93, 94, and 108) engineered for the overexpression of CAld5H with
sense PtCAld5H transgene had pronounced increases in their S/G
ratio, but their lignin and cellulose contents remained essentially
unaffected. When engineered for the simultaneous suppression of 4CL
gene and overexpression of CAld5H gene, transgenic plants (#71, 72,
74, and 141) all exhibited low lignin content, high S/G ratio and
elevated cellulose quantity. In summary, these results show that
multiple genes carried by individual Agrobacterium strains can be
integrated simultaneously into the plant genome.
[0127] Moreover, it was demonstrated as shown herein below, that
transgenic plants with a nearly 30% increase in cellulose content
and over 50% lignin quantity reduction, accompanied with a
significant augmentation of the S/G ratio, can be easily produced.
It is conceivable that more genes can also be efficiently
transferred at one time. Only one suitable marker gene is required
for this system, although a number of marker genes can also be
employed.
4TABLE 4 Simultaneous manipulating xylem-specific expression of 4CL
and CAld5H in transgenic aspen. Plant # Control 21 22 23 25 37 32
84 93 94 108 71 72 74 141 Gene 4CL-a Y Y Y Y Y Y Y Y Y integrated
CAld5H-s Y Y Y Y Y Y Y Y Y Lignin content (%) 22.4 16.0 15.3 14.4
13.1 14.9 22.4 21.6 21.1 20.7 19.7 13.2 13.7 12.4 10.7 Lignin S/G
ratio 2.2 2.1 2.0 2.2 2.3 2.1 4.8 4.0 5.5 4.9 3.0 3.3 3.6 3.4 2.7
Cellulose content (%) 41.4 43.1 ND ND 47.3 ND 40.0 ND 44.7 ND ND ND
49.2 ND 53.3 ND: not determined
EXAMPLE 3
Production of commercially desirable agronomic traits in
transformed plants.
[0128] The following genetic transformations illustrate the
production of commercially desirable agronomic traits in
plants.
[0129] Gymnosperms
[0130] A. To produce syringyl-enriched lignin in gymnosperm plants,
gymnosperm plants are genetically transformed with SAD, CAld5H, and
AldOMT genes in the sense orientation driven by any appropriate
promoter and via any appropriate genetic transformation system
allows. These three genes can be transferred into the host plant
either simultaneously (in one or individual constructs) or
sequentially (in individual constructs) in any order.
[0131] B. To produce decreased lignin content, increased
syringyl/guaiacyl (S/G) lignin ratio and increased cellulose
quantity in gymnosperm plants, gymnosperm plants are genetically
transformed with SAD, CAld5H and AldOMT genes in the sense
orientation and 4CL gene in either sense or antisense orientation
driven by any appropriate promoter and via any appropriate genetic
transformation system. These four genes can be transferred into the
host plant either simultaneously (in one or individual constructs)
or sequentially (in individual constructs) in any order.
[0132] C. To produce decreased lignin content, increased
syringyl/guaiacyl (S/G) lignin ratio and increased cellulose
quantity in gymnosperm plants, gymnosperm plants are genetically
transformed with SAD, CAld5H and AldOMT genes in the sense
orientation and 4CL and CAD genes in either sense or antisense
orientation driven by any appropriate promoter and via any
appropriate genetic transformation system. These five genes can be
transferred into the host plant either simultaneously (in one or
individual constructs) or sequentially (in individual constructs)
in any order.
[0133] D. To produce increased lignin content in gymnosperm plants,
gymnosperm plants are genetically transformed with 4CL gene in the
sense orientation driven by any appropriate promoter and via any
appropriate genetic transformation system.
[0134] E. To produce increased lignin content and increased
syringyl/guaiacyl (S/G) lignin ratio in gymnosperm plants,
gymnosperm plants are genetically transformed with SAD, CAld5H,
AldOMT, and 4CL genes in the sense orientation driven by any
appropriate promoter and via any appropriate genetic transformation
system. These four genes can be transferred into the host plant
either simultaneously (in one or individual constructs) or
sequentially (in individual constructs) in any order.
[0135] F. To produce increased lignin content, increased
syringyl/guaiacyl (S/G) lignin ratio in gymnosperm plants,
gymnosperm plants are genetically transformed with SAD, CAld5H,
AldOMT, and 4CL genes in the sense orientation and CAD gene in the
antisense orientation driven by any appropriate promoter and via
any appropriate genetic transformation system. These four genes can
be transferred into the host plant either simultaneously (in one or
individual constructs) or sequentially (in individual constructs)
in any order.
[0136] Angiosperms
[0137] A. To produce increased S/G lignin ratio in angiosperm
plants, angiosperm plants are genetically transformed with either
CAld5H, AldOMT, or SAD genes in sense orientation driven by any
appropriate promoter and via any appropriate genetic transformation
system. These three genes can be transferred into the host plant
either simultaneously (in one or individual constructs) or
sequentially (in individual constructs) in any order.
[0138] B. To produce decreased lignin content, increased S/G lignin
ratio and increased cellulose quantity in angiosperm plants,
angiosperm plants are genetically transformed with either SAD,
CAld5H, or AldOMT genes in the sense orientation and 4CL gene in
the sense or antisense orientation driven by any appropriate
promoter and via any appropriate genetic transformation system.
These four genes can be transferred into the host plant either
simultaneously (in one or individual constructs) or sequentially
(in individual constructs) in any order.
[0139] C. To produce decreased lignin content, increased S/G lignin
ratio and increased cellulose quantity in angiosperm plants,
angiosperm plants are genetically transformed with either SAD,
CAld5H, or AldOMT genes in the sense orientation and 4CL and CAD
genes in the sense or antisense orientation driven by any
appropriate promoter and via any appropriate genetic transformation
system. These five genes can be transferred into the host plant
either simultaneously (in one or individual constructs) or
sequentially (in individual constructs) in any order.
[0140] D. To produce increased lignin content in angiosperm plants,
angiosperm plants are genetically transformed with 4CL gene in the
sense orientation driven by any appropriate promoter and via any
appropriate genetic transformation system.
[0141] E. To produce increased lignin content and increased S/G
ratio in angiosperm plants, angiosperm plants are genetically
transformed with 4CL in the sense orientation and either SAD,
CAld5H, or AldOMT genes also in the sense orientation driven by any
appropriate promoter and via any appropriate genetic transformation
system. These four genes can be transferred into the host plant
either simultaneously (in one or individual constructs) or
sequentially (in individual constructs) in any order.
[0142] F. To produce increased lignin content and increased S/G
ratio in angiosperm plants, angiosperm plants are genetically
transformed with 4CL in the sense orientation and either SAD,
CAld5H, or AldOMT genes also in the sense orientation and CAD in
the antisense orientation driven by any appropriate promoter and
via any appropriate genetic transformation system. These four genes
can be transferred into the host plant either simultaneously (in
one or individual constructs) or sequentially (in individual
constructs) in any order.
[0143] All publications, patents and patent applications cited
herein are incorporated herein by reference. While in the foregoing
specification, this invention has been described in relation to
certain preferred embodiments thereof, and many details have been
set forth for purposes of illustration, it will be apparent to
those skilled in the art that the invention is susceptible to
additional embodiments and that certain of the details herein may
be varied considerably without departing from the basic principles
of the invention. Accordingly, it is intended that the present
invention be solely limited by the broadest interpretation that can
be accorded the appended claims.
REFERENCES
[0144] Bugos et al., 1991, Plant Mol. Biol. 17:203.
[0145] Chang, H. M., and Sarkanen, K. V., 1973, Tappi 56:132.
[0146] Chiang, V. L., and Funaoka, M., 1990, Holzforschung
44:309.
[0147] Hu et al., 1999, Nature Biotech. 17:808.
[0148] Sarkanen, K. V., and Ludwig, C. H., eds (Wiley-Interscience,
New York), 639.
[0149] Tsai et al., 1994, Plant Cell Report 14:94.
[0150] Boudet et al., 1995, New Phytol. 129:203.
[0151] Ibrahim, 1997, Trends Plant Sci. 2:249.
[0152] Li et al., 1997, Proc. Natl. Acad. Sci. USA 94:5461.
[0153] Joshi and Chiang, 1998, Plant Mol. Biol. 37:663.
[0154] Brasileiro et al., 1991, Plant Mol. Bio. 17:441.
[0155] Brasileiro et al., 1992, Transgenic Res. 1:133.
[0156] Chen et al., 1998, Nature Biotechnology 16, 11:1060.
[0157] Chen, Ph.D. Thesis, 1991, North Carolina State University,
Raleigh, N.C.
[0158] Chen et al.,1999, Planta 207:597.
[0159] Christou, 1996, Bio/Technology 10:667.
[0160] Chandler et al., 1989.
[0161] Danekar et al., 1987, Bio/Technology 5:587.
[0162] De Block, 1990, Plant Physiol. 93:1110.
[0163] Ebinuma et al., 1997, Proceedings of the National Academic
of Sciences 94:2117.
[0164] Ebert et al. 1987.
[0165] Fillatti et al., 1987, Mol. Gen. Genet. 206:192.
[0166] Freudenberg, 1965.
[0167] Horsch et al., 1985, Science 227:1229.
[0168] Howe et al., 1991, Woody Plant Biotech. Plenum Press, New
York, 283.
[0169] Huang et al., 1991, In Vitro Cell Dev. Bio. 4:201.
[0170] Hudspeth et al., 1989, Plant Mol. Biol., 12:579.
[0171] Hu et al., 1998, Proc. Natl. Acad. Sci. USA 95:5407.
[0172] Hu et al., 1999, Nat. Biotechnol. 17:808.
[0173] Humphreys et al., 1999, Proc. Nat. Acad. Sci. USA
96:10045.
[0174] Jornvall et al., 1987, Eur. J. Biochem. 167:195.
[0175] Jefferson et al.,1987.
[0176] Klopfenstein et al., 1991, Can. J For. Res. 21:1321.
[0177] Lawton et al., 1987, Plant Mol. Biol. 9:31F.
[0178] Buxton and Roussel, 1988, Crop. Sci. 28,:553.
[0179] Jung and Vogel, 1986, J. Anim., Sci. 62:1703.
[0180] Leple et al., 1992, Plant Cell Reports 11:137.
[0181] Li et al., 1997, Proc. Natl. Acad. Sci. USA, 94:5461.
[0182] Li et al., 2001, Plant Cell, 13:1567.
[0183] Li et al, 1997, Proc. Natl. Acad. Sci. USA 94:5431.
[0184] Li et al., 1999, Plant Mol. Biol. 40:555.
[0185] Li et al., 2000, J. Biol. Chem. 275:6537.
[0186] MacKay et al., 1995, Mol. Gen. Genet. 247:537.
[0187] MacKay et al., 1997.
[0188] McGranahan et al., 1988, Bio/Technology 6:800.
[0189] McGranahan et al., 1990, Plant Cell Reports 8:512.
[0190] Minocha et al., 1986, Proc. TAPPI Research and Development
Conference, TAPPI Press, Atlanta, 89.
[0191] Nelson et al. 1996, Pharmacogenetics 6: 1.
[0192] Odell et al., 1985, Nature 313:810.
[0193] Osakabe et al., 1999, Proc. Nati. Acad. Sci. USA
96:8955.
[0194] Parsons et al., 1986, Bio/Technology 4:533.
[0195] Pythoud et al., 1987, Bio/Technology 5:1323.
[0196] Sambrook et al., 2.sup.nd ed. 1982.
[0197] Sullivan et al., 1993, Plant Cell Reports 12:303.
[0198] Sarkanen, K. V., and Hergert, H. L., 1971, Lignins:
Occurrence, Formation, Structure and Reaction, K. V. Sarkanen and
C. H. Ludwig, eds (New York: Wiley-Interscience), 43.
[0199] Trotter, P. C., 1990, Tech. Assoc. Pulp Paper Ind. J.
73:198.
[0200] Tsai et al., 1998, Plant Physiol. 117:101.
[0201] Tsai et al., Plant Cell Reports 14:94.
[0202] Tricoli et al., 1995.
[0203] Walker et al., 1987, PNAS USA 84:6624.
[0204] Wang et al., 1992, Mol. Cell. Biol. 12:3399.
[0205] Wu et al., 2000, Plant J. 22:495.
[0206] Yang et al., 1990, PNAS USA 87:4144.
[0207] Yamazaki et al., 1993, J. Biochem. 114:652.
[0208] Zhang, X.-H., and Chiang, V. L., 1997, Plant Physiol.
113:65.
Sequence CWU 1
1
14 1 1446 DNA aspen populus tremuloides misc_feature SAD 1
tttttttttt tttcctagcc ttccttctcg acgatatttc tctatctgaa gcaagcacca
60 tgtccaagtc accagaagaa gaacaccctg tgaaggcctt cgggtgggct
gctagggatc 120 aatctggtca tctttctccc ttcaacttct ccaggagggc
aactggtgaa gaggatgtga 180 ggttcaaggt gctgtactgc gggatatgcc
attctgacct tcacagtatc aagaatgact 240 ggggcttctc catgtaccct
ttggttcctg ggcatgaaat tgtgggggaa gtgacagaag 300 ttgggagcaa
ggtgaaaaag gttaatgtgg gagacaaagt gggcgtggga tgcttggttg 360
gtgcatgtca ctcctgtgag agttgtgcca atgatcttga aaattactgt ccaaaaatga
420 tcctgacata cgcctccatc taccatgacg gaaccatcac ttacggtggc
tactcagatc 480 acatggtcgc taacgaacgc tacatcattc gattccccga
taacatgccg cttgacggtg 540 gcgctcctct cctttgtgcc gggattacag
tgtatagtcc cttgaaatat tttggactag 600 atgaacccgg taagcatatc
ggtatcgttg gcttaggtgg acttggtcac gtggctgtca 660 aatttgccaa
ggcctttgga tctaaagtga cagtaattag tacctcccct tccaagaagg 720
aggaggcttt gaagaacttc ggtgcagact catttttggt tagtcgtgac caagagcaaa
780 tgcaggctgc cgcaggaaca ttagatggca tcatcgatac agtttctgca
gttcaccccc 840 ttttgccatt gtttggactg ttgaagtctc acgggaagct
tatcttggtg ggtgcaccgg 900 aaaagcctct tgagctacct gccttttctt
tgattgctgg aaggaagata gttgccggga 960 gtggtattgg aggcatgaag
gagacacaag agatgattga ttttgcagca aaacacaaca 1020 tcacagcaga
tatcgaagtt atttcaacgg actatcttaa tacggcgata gaacgtttgg 1080
ctaaaaacga tgtcagatac cgattcgtca ttgacgttgg caatactttg gcagctacga
1140 agccctaagg agaagatccc atgttctcga accctttata aaatctgata
acatgtgttg 1200 atttcatgaa taaatagatt atctttggga tttttcttta
ataaacgaag tgttctcgaa 1260 aacttaacat cggcaatacc ctggcagcta
cgagaaacgc tttagaattg tttgtaagtt 1320 tgtttcatta gggtgatacc
atgctctcga gtcctttgta agatccattt atagttgcgt 1380 gaatgctatg
aacaaataat atgtttgcgg cttctcttca aaaaaaaaaa aaaaaaaaaa 1440 aaaaaa
1446 2 362 PRT aspen populus tremuloides 2 Met Ser Lys Ser Pro Glu
Glu Glu His Pro Val Lys Ala Phe Gly Trp 1 5 10 15 Ala Ala Arg Asp
Gln Ser Gly His Leu Ser Pro Phe Asn Phe Ser Arg 20 25 30 Arg Ala
Thr Gly Glu Glu Asp Val Arg Phe Lys Val Leu Tyr Cys Gly 35 40 45
Ile Cys His Ser Asp Leu His Ser Ile Lys Asn Asp Trp Gly Phe Ser 50
55 60 Met Tyr Pro Leu Val Pro Gly His Glu Ile Val Gly Glu Val Thr
Glu 65 70 75 80 Val Gly Ser Lys Val Lys Lys Val Asn Val Gly Asp Lys
Val Gly Val 85 90 95 Gly Cys Leu Val Gly Ala Cys His Ser Cys Glu
Ser Cys Ala Asn Asp 100 105 110 Leu Glu Asn Tyr Cys Pro Lys Met Ile
Leu Thr Tyr Ala Ser Ile Tyr 115 120 125 His Asp Gly Thr Ile Thr Tyr
Gly Gly Tyr Ser Asp His Met Val Ala 130 135 140 Asn Glu Arg Tyr Ile
Ile Arg Phe Pro Asp Asn Met Pro Leu Asp Gly 145 150 155 160 Gly Ala
Pro Leu Leu Cys Ala Gly Ile Thr Val Tyr Ser Pro Leu Lys 165 170 175
Tyr Phe Gly Leu Asp Glu Pro Gly Lys His Ile Gly Ile Val Gly Leu 180
185 190 Gly Gly Leu Gly His Val Ala Val Lys Phe Ala Lys Ala Phe Gly
Ser 195 200 205 Lys Val Thr Val Ile Ser Thr Ser Pro Ser Lys Lys Glu
Glu Ala Leu 210 215 220 Lys Asn Phe Gly Ala Asp Ser Phe Leu Val Ser
Arg Asp Gln Glu Gln 225 230 235 240 Met Gln Ala Ala Ala Gly Thr Leu
Asp Gly Ile Ile Asp Thr Val Ser 245 250 255 Ala Val His Pro Leu Leu
Pro Leu Phe Gly Leu Leu Lys Ser His Gly 260 265 270 Lys Leu Ile Leu
Val Gly Ala Pro Glu Lys Pro Leu Glu Leu Pro Ala 275 280 285 Phe Ser
Leu Ile Ala Gly Arg Lys Ile Val Ala Gly Ser Gly Ile Gly 290 295 300
Gly Met Lys Glu Thr Gln Glu Met Ile Asp Phe Ala Ala Lys His Asn 305
310 315 320 Ile Thr Ala Asp Ile Glu Val Ile Ser Thr Asp Tyr Leu Asn
Thr Ala 325 330 335 Ile Glu Arg Leu Ala Lys Asn Asp Val Arg Tyr Arg
Phe Val Ile Asp 340 345 350 Val Gly Asn Thr Leu Ala Ala Thr Lys Pro
355 360 3 1764 DNA aspen populus tremuloides misc_feature CAld5H 3
taaagtcttg tggattacac aaaatacaga ctgaaaacat ccataggcac caacacataa
60 accatccatg gattctcttg tccaatcttt gcaagcttca cccatgtctc
tcttcttgat 120 cgttatctct tcactcttct tcttcggtct cctctctcgc
cttcgccgaa gattgccata 180 tccaccaggg cctaaagggt tgccacttgt
aggtagcatg cacatgatgg accaaataac 240 tcaccgtggg ttagctaaac
tagctaagca atatggtggg ctctttcata tgcgcatggg 300 gtacttgcat
atggtcactg tttcatctcc tgaaatagct cgccaagttc tgcaggtcca 360
ggacaacatt ttctccaaca gaccagccaa catagccata agttacttaa cctatgatcg
420 tgcagatatg gcctttgccc actacggtcc tttctggcga cagatgcgta
agctctgcgt 480 catgaagctt tttagccgga aaagggctga atcatgggag
tctgtgagag atgaggtgga 540 ctcaatgctt aagacagttg aagccaatat
aggcaagcct gtgaatcttg gggaattgat 600 ttttacgttg accatgaaca
tcacttacag agcagctttc ggggctaaaa atgaaggaca 660 ggatgagttc
atcaagattt tgcaggagtt ctctaagctt tttggagcat tcaacatgtc 720
tgatttcatt ccctggctgg gctggattga cccccaaggg ctcagcgcta gacttgtcaa
780 ggctcgcaag gctcttgata gattcatcga ctctatcatc gatgatcata
tccagaaaag 840 aaaacagaat aagttctctg aagatgctga aaccgatatg
gtcgatgaca tgctagcctt 900 ttatggtgaa gaagcaagga aagtagatga
atcagatgat ttacaaaaag ccatcagcct 960 tactaaagac aacatcaaag
ccataatcat ggatgtgatg tttggtggga cagagacggt 1020 ggcgtcggca
atagagtggg tcatggcgga gctaatgaag agtccagagg atcaaaaaag 1080
agtccagcaa gagctcgcag aggtggtggg tttagagcgg cgcgtggagg aaagtgatat
1140 tgacaaactt acgttcttga aatgcgccct caaagaaacc ttaaggatgc
acccaccaat 1200 cccacttctc ttacatgaaa cttctgagga tgctgaggtt
gctggttatt tcattccaaa 1260 gcaaacaagg gtgatgatca atgcttatgc
tattgggaga gacaagaatt catgggaaga 1320 tcctgatgct tttaagcctt
caaggttttt gaaaccaggg gtgcctgatt ttaaagggaa 1380 tcactttgag
tttattcctt tcgggtctgg tcggaggtct tgccccggta tgcagcttgg 1440
gttatacaca cttgatttgg ctgttgctca cttgcttcat tgttttacat gggaattgcc
1500 tgatggcatg aaaccgagtg aacttgacat gactgatatg tttggactca
ccgcgccaag 1560 agcaactcga ctcgttgccg ttccgagcaa gcgtgtgctc
tgtcctctct aaggaaggga 1620 aaaaggtaag ggatggaaat gaatgggatt
cccttctttc gtggattcta tacagaattg 1680 aggccatggt gacaaagggt
caatttgcag gttttttttt ttatatatat atatatataa 1740 ttgggttaaa
aaaaaaaaaa aaaa 1764 4 514 PRT aspen populus tremuloides 4 Met Asp
Ser Leu Val Gln Ser Leu Gln Ala Ser Pro Met Ser Leu Phe 1 5 10 15
Leu Ile Val Ile Ser Ser Leu Phe Phe Phe Gly Leu Leu Ser Arg Leu 20
25 30 Arg Arg Arg Leu Pro Tyr Pro Pro Gly Pro Lys Gly Leu Pro Leu
Val 35 40 45 Gly Ser Met His Met Met Asp Gln Ile Thr His Arg Gly
Leu Ala Lys 50 55 60 Leu Ala Lys Gln Tyr Gly Gly Leu Phe His Met
Arg Met Gly Tyr Leu 65 70 75 80 His Met Val Thr Val Ser Ser Pro Glu
Ile Ala Arg Gln Val Leu Gln 85 90 95 Val Gln Asp Asn Ile Phe Ser
Asn Arg Pro Ala Asn Ile Ala Ile Ser 100 105 110 Tyr Leu Thr Tyr Asp
Arg Ala Asp Met Ala Phe Ala His Tyr Gly Pro 115 120 125 Phe Trp Arg
Gln Met Arg Lys Leu Cys Val Met Lys Leu Phe Ser Arg 130 135 140 Lys
Arg Ala Glu Ser Trp Glu Ser Val Arg Asp Glu Val Asp Ser Met 145 150
155 160 Leu Lys Thr Val Glu Ala Asn Ile Gly Lys Pro Val Asn Leu Gly
Glu 165 170 175 Leu Ile Phe Thr Leu Thr Met Asn Ile Thr Tyr Arg Ala
Ala Phe Gly 180 185 190 Ala Lys Asn Glu Gly Gln Asp Glu Phe Ile Lys
Ile Leu Gln Glu Phe 195 200 205 Ser Lys Leu Phe Gly Ala Phe Asn Met
Ser Asp Phe Ile Pro Trp Leu 210 215 220 Gly Trp Ile Asp Pro Gln Gly
Leu Ser Ala Arg Leu Val Lys Ala Arg 225 230 235 240 Lys Ala Leu Asp
Arg Phe Ile Asp Ser Ile Ile Asp Asp His Ile Gln 245 250 255 Lys Arg
Lys Gln Asn Lys Phe Ser Glu Asp Ala Glu Thr Asp Met Val 260 265 270
Asp Asp Met Leu Ala Phe Tyr Gly Glu Glu Ala Arg Lys Val Asp Glu 275
280 285 Ser Asp Asp Leu Gln Lys Ala Ile Ser Leu Thr Lys Asp Asn Ile
Lys 290 295 300 Ala Ile Ile Met Asp Val Met Phe Gly Gly Thr Glu Thr
Val Ala Ser 305 310 315 320 Ala Ile Glu Trp Val Met Ala Glu Leu Met
Lys Ser Pro Glu Asp Gln 325 330 335 Lys Arg Val Gln Gln Glu Leu Ala
Glu Val Val Gly Leu Glu Arg Arg 340 345 350 Val Glu Glu Ser Asp Ile
Asp Lys Leu Thr Phe Leu Lys Cys Ala Leu 355 360 365 Lys Glu Thr Leu
Arg Met His Pro Pro Ile Pro Leu Leu Leu His Glu 370 375 380 Thr Ser
Glu Asp Ala Glu Val Ala Gly Tyr Phe Ile Pro Lys Gln Thr 385 390 395
400 Arg Val Met Ile Asn Ala Tyr Ala Ile Gly Arg Asp Lys Asn Ser Trp
405 410 415 Glu Asp Pro Asp Ala Phe Lys Pro Ser Arg Phe Leu Lys Pro
Gly Val 420 425 430 Pro Asp Phe Lys Gly Asn His Phe Glu Phe Ile Pro
Phe Gly Ser Gly 435 440 445 Arg Arg Ser Cys Pro Gly Met Gln Leu Gly
Leu Tyr Thr Leu Asp Leu 450 455 460 Ala Val Ala His Leu Leu His Cys
Phe Thr Trp Glu Leu Pro Asp Gly 465 470 475 480 Met Lys Pro Ser Glu
Leu Asp Met Thr Asp Met Phe Gly Leu Thr Ala 485 490 495 Pro Arg Ala
Thr Arg Leu Val Ala Val Pro Ser Lys Arg Val Leu Cys 500 505 510 Pro
Leu 5 1503 DNA aspen populus tremuloides misc_feature AldOMT;
GenBank accession number X62096 5 tcacttcctt tccttacacc ttcttcaacc
ttttgtttcc ttgtagaatt caatctcgat 60 caagatgggt tcaacaggtg
aaactcagat gactccaact caggtatcag atgaagaggc 120 acacctcttt
gccatgcaac tagccagtgc ttcagttcta ccaatgatcc tcaaaacagc 180
cattgaactc gaccttcttg aaatcatggc taaagctggc cctggtgctt tcttgtccac
240 atctgagata gcttctcacc tccctaccaa aaaccctgat gcgcctgtca
tgttagaccg 300 tatcctgcgc ctcctggcta gctactccat tcttacctgc
tctctgaaag atcttcctga 360 tgggaaggtt gagagactgt atggcctcgc
tcctgtttgt aaattcttga ccaagaacga 420 ggacggtgtc tctgtcagcc
ctctctgtct catgaaccag gacaaggtcc tcatggaaag 480 ctggtattat
ttgaaagatg caattcttga tggaggaatt ccatttaaca aggcctatgg 540
gatgactgca tttgaatatc atggcacgga tccaagattc aacaaggtct tcaacaaggg
600 aatgtctgac cactctacca ttaccatgaa gaagattctt gagacctaca
aaggctttga 660 aggcctcacg tccttggtgg atgttggtgg tgggactgga
gccgtcgtta acaccatcgt 720 ctctaaatac ccttcaatca agggcattaa
cttcgatctg ccccacgtca ttgaggatgc 780 cccatcttat cccggagtgg
agcatgttgg tggcgacatg tttgttagtg tgcccaaagc 840 agatgccgtt
ttcatgaagt ggatatgcca tgattggagc gacgcccact gcttaaaatt 900
cttgaagaat tgctatgacg cgttgccgga aaacggcaag gtgatacttg ttgagtgcat
960 tcttcccgtg gctcctgaca caagccttgc caccaaggga gtcgtgcacg
ttgatgtcat 1020 catgctggcg cacaaccccg gtgggaaaga gaggaccgag
aaggaatttg agggcttagc 1080 taagggagct ggcttccaag gttttgaagt
aatgtgctgt gcattcaaca cacatgtcat 1140 tgaattccgc aagaaggcct
aaggcccatg tccaagctcc aagttacttg gggttttgca 1200 gacaacgttg
ctgctgtctc tgcgtttgat gtttctgatt gctttttttt atacgaggag 1260
tagctatctc ttatgaaaca tgtaaggata agattgcgtt ttgtatgcct gattttctca
1320 aataacttca ctgcctccct caaaattctt aatacatgtg aaaagatttc
ctattggcct 1380 tctgcttcaa acagtaaaga cttctgtaac ggaaaagaaa
gcaattcatg atgtatgtat 1440 cttgcaagat tatgagtatt gttctaagca
ttaagtgatt gttcaaaaaa aaaaaaaaaa 1500 aaa 1503 6 365 PRT aspen
populus tremuloides 6 Met Gly Ser Thr Gly Glu Thr Gln Met Thr Pro
Thr Gln Val Ser Asp 1 5 10 15 Glu Glu Ala His Leu Phe Ala Met Gln
Leu Ala Ser Ala Ser Val Leu 20 25 30 Pro Met Ile Leu Lys Thr Ala
Ile Glu Leu Asp Leu Leu Glu Ile Met 35 40 45 Ala Lys Ala Gly Pro
Gly Ala Phe Leu Ser Thr Ser Glu Ile Ala Ser 50 55 60 His Leu Pro
Thr Lys Asn Pro Asp Ala Pro Val Met Leu Asp Arg Ile 65 70 75 80 Leu
Arg Leu Leu Ala Ser Tyr Ser Ile Leu Thr Cys Ser Leu Lys Asp 85 90
95 Leu Pro Asp Gly Lys Val Glu Arg Leu Tyr Gly Leu Ala Pro Val Cys
100 105 110 Lys Phe Leu Thr Lys Asn Glu Asp Gly Val Ser Val Ser Pro
Leu Cys 115 120 125 Leu Met Asn Gln Asp Lys Val Leu Met Glu Ser Trp
Tyr Tyr Leu Lys 130 135 140 Asp Ala Ile Leu Asp Gly Gly Ile Pro Phe
Asn Lys Ala Tyr Gly Met 145 150 155 160 Thr Ala Phe Glu Tyr His Gly
Thr Asp Pro Arg Phe Asn Lys Val Phe 165 170 175 Asn Lys Gly Met Ser
Asp His Ser Thr Ile Thr Met Lys Lys Ile Leu 180 185 190 Glu Thr Tyr
Lys Gly Phe Glu Gly Leu Thr Ser Leu Val Asp Val Gly 195 200 205 Gly
Gly Thr Gly Ala Val Val Asn Thr Ile Val Ser Lys Tyr Pro Ser 210 215
220 Ile Lys Gly Ile Asn Phe Asp Leu Pro His Val Ile Glu Asp Ala Pro
225 230 235 240 Ser Tyr Pro Gly Val Glu His Val Gly Gly Asp Met Phe
Val Ser Val 245 250 255 Pro Lys Ala Asp Ala Val Phe Met Lys Trp Ile
Cys His Asp Trp Ser 260 265 270 Asp Ala His Cys Leu Lys Phe Leu Lys
Asn Cys Tyr Asp Ala Leu Pro 275 280 285 Glu Asn Gly Lys Val Ile Leu
Val Glu Cys Ile Leu Pro Val Ala Pro 290 295 300 Asp Thr Ser Leu Ala
Thr Lys Gly Val Val His Val Asp Val Ile Met 305 310 315 320 Leu Ala
His Asn Pro Gly Gly Lys Glu Arg Thr Glu Lys Glu Phe Glu 325 330 335
Gly Leu Ala Lys Gly Ala Gly Phe Gln Gly Phe Glu Val Met Cys Cys 340
345 350 Ala Phe Asn Thr His Val Ile Glu Phe Arg Lys Lys Ala 355 360
365 7 1915 DNA aspen populus tremuloides misc_feature 4CL 7
ccctcgcgaa actccgaaaa cagagagcac ctaaaactca ccatctctcc ctctgcatct
60 ttagcccgca atggacgcca caatgaatcc acaagaattc atctttcgct
caaaattacc 120 agacatctac atcccgaaaa accttcccct gcattcatac
gttcttgaga acttgtctaa 180 acattcatca aaaccttgcc tgataaatgg
cgcgaatgga gatgtctaca cctatgctga 240 tgttgagctc acagcaagaa
gagttgcttc tggtctgaac aagattggta ttcaacaagg 300 tgacgtgatc
atgctcttcc taccaagttc acctgaattc gtgcttgctt tcctaggcgc 360
ttcacacaga ggtgccatga tcactgctgc caatcctttc tccacccctg cagagctagc
420 aaaacatgcc aaggcctcga gagcaaagct tctgataaca caggcttgtt
actacgagaa 480 ggttaaagat tttgcccgag aaagtgatgt taaggtcatg
tgcgtggact ctgccccgga 540 cggtgcttca cttttcagag ctcacacaca
ggcagacgaa aatgaagtgc ctcaggtcga 600 cattagtcct gatgatgtcg
tagcattgcc ttattcatca gggactacag ggttgccaaa 660 aggggtcatg
ttaacgcaca aagggctaat aaccagtgtg gctcaacagg tagatggaga 720
caatcctaac ctgtattttc acagtgaaga tgtgattctg tgtgtgcttc ctatgttcca
780 tatctatgct ctgaattcaa tgatgctctg tggtctgaga gttggtgcct
cgattttgat 840 aatgccaaag tttgagattg gttctttgct gggattgatt
gagaagtaca aggtatctat 900 agcaccagtt gttccacctg tgatgatggc
aattgctaag tcacctgatc ttgacaagca 960 tgacctgtct tctttgagga
tgataaaatc tggaggggct ccattgggca aggaacttga 1020 agatactgtc
agagctaagt ttcctcaggc tagacttggt cagggatatg gaatgaccga 1080
ggcaggacct gttctagcaa tgtgcttggc atttgccaag gaaccattcg acataaaacc
1140 aggtgcatgt ggaactgtag tcaggaatgc agagatgaag attgttgacc
cagaaacagg 1200 ggtctctcta ccgaggaacc agcctggtga gatctgcatc
cggggtgatc agatcatgaa 1260 aggatatctt aatgaccccg aggcaacctc
aagaacaata gacaaagaag gatggctgca 1320 cacaggcgat atcggctaca
ttgatgatga tgatgagctt ttcatcgttg acagattgaa 1380 ggaattgatc
aagtataaag ggtttcaggt tgctcctact gaactcgaag ctttgttaat 1440
agcccatcca gagatatccg atgctgctgt agtaggattg aaagatgagg atgcgggaga
1500 agttcctgtt gcatttgtag tgaaatcaga aaagtctcag gccaccgaag
atgaaattaa 1560 gcagtatatt tcaaaacagg tgatcttcta caagagaata
aaacgagttt tcttcattga 1620 agcaattccc aaggcaccat caggcaagat
cctgaggaag aatctgaaag agaagttgcc 1680 aggcatataa ctgaagatgt
tactgaacat ttaaccctct gtcttatttc tttaatactt 1740 gcgaatcatt
gtagtgttga accaagcatg cttggaaaag acacgtaccc aacgtaagac 1800
agttactgtt cctagtatac aagctcttta atgttcgttt tgaacttggg aaaacataag
1860 ttctcctgtc gccatatgga gtaattcaat tgaatatttt ggtttcttta atgat
1915 8 1395 DNA aspen populus tremuloides misc_feature CAD; GenBank
accession number AF217957 8 aaactccatc cctctctctt agcctcgttg
tttcaagaaa atgggtagcc ttgaaacaga 60 gagaaaaatt gtaggatggg
cagcaacaga ctcaactggg catctcgctc cttacaccta 120 tagtctcaga
gatacggggc cagaagatgt tcttatcaag gttatcagct gtggaatttg 180
ccataccgat atccaccaaa tcaaaaatga tcttggcatg tcacactatc
ctatggtccc
240 tggccatgaa gtggttggtg aggttgttga ggtgggatca gatgtgacaa
agttcaaagc 300 tggagatgtt gttggtgttg gagtcatcgt tggaagctgc
aagaattgtc atccatgcaa 360 atcagagctt gagcaatact gcaacaagaa
aatctggtct tacaatgatg tctacactga 420 tggcaaaccc acccaaggag
gctttgctga atccatggtt gtcgatcaaa agtttgtggt 480 gagaattcct
gatgggatgt caccagaaca agcagcgccg ctgttgtgcg ctggattgac 540
agtttacagc ccactcaaac actttggact gaaacagagt gggctaagag gagggatttt
600 aggacttgga ggagtagggc acatgggggt gaagatagca aaggcaatgg
gacaccatgt 660 aactgtgatt agttcttctg acaagaagcg ggaggaggct
atggaacatc ttggtgctga 720 tgaatacctg gtcagctcgg atgtggaaag
catgcaaaaa gctgctgatc aacttgacta 780 tatcatcgat actgtgcctg
tggttcaccc tctcgagcct tacctttctc tattgaaact 840 tgatggcaag
ctgatcttga tgggtgttat taatacccca ttgcagtttg tttcgccaat 900
ggttatgctt gggagaaagt cgatcaccgg gagcttcata gggagcatga aggagacaga
960 ggagatgctt gagttctgca aggaaaaggg attggcctcc atgattgaag
tgatcaaaat 1020 ggattatatc aacacagcat tcgagaggct tgagaaaaat
gatgtgagat atagattcgt 1080 tgtcgatgtt gctggtagca agcttattcc
ctgaacgaca ataccattca tattcgaaaa 1140 aacgcgatat acattgatac
ctgtttcaga cttgacttta ttttcgagtg atgtgttttg 1200 tggttcaaat
gtgacagttt gtctttgctt ttaaaataaa gaaaaagttg agttgttttt 1260
ttattttcat taatgggcat gcgttacctt gtaattgaat gcgctgcatc tggtgatctg
1320 tcccataaac taatctcttg tggcaatgaa agatgacgaa ctttctgaaa
aaaaaaaaaa 1380 aaaaaaaaaa aaaaa 1395 9 357 PRT aspen populus
tremuloides 9 Met Gly Ser Leu Glu Thr Glu Arg Lys Ile Val Gly Trp
Ala Ala Thr 1 5 10 15 Asp Ser Thr Gly His Leu Ala Pro Tyr Thr Tyr
Ser Leu Arg Asp Thr 20 25 30 Gly Pro Glu Asp Val Leu Ile Lys Val
Ile Ser Cys Gly Ile Cys His 35 40 45 Thr Asp Ile His Gln Ile Lys
Asn Asp Leu Gly Met Ser His Tyr Pro 50 55 60 Met Val Pro Gly His
Glu Val Val Gly Glu Val Val Glu Val Gly Ser 65 70 75 80 Asp Val Thr
Lys Phe Lys Ala Gly Asp Val Val Gly Val Gly Val Ile 85 90 95 Val
Gly Ser Cys Lys Asn Cys His Pro Cys Lys Ser Glu Leu Glu Gln 100 105
110 Tyr Cys Asn Lys Lys Ile Trp Ser Tyr Asn Asp Val Tyr Thr Asp Gly
115 120 125 Lys Pro Thr Gln Gly Gly Phe Ala Glu Ser Met Val Val Asp
Gln Lys 130 135 140 Phe Val Val Arg Ile Pro Asp Gly Met Ser Pro Glu
Gln Ala Ala Pro 145 150 155 160 Leu Leu Cys Ala Gly Leu Thr Val Tyr
Ser Pro Leu Lys His Phe Gly 165 170 175 Leu Lys Gln Ser Gly Leu Arg
Gly Gly Ile Leu Gly Leu Gly Gly Val 180 185 190 Gly His Met Gly Val
Lys Ile Ala Lys Ala Met Gly His His Val Thr 195 200 205 Val Ile Ser
Ser Ser Asp Lys Lys Arg Glu Glu Ala Met Glu His Leu 210 215 220 Gly
Ala Asp Glu Tyr Leu Val Ser Ser Asp Val Glu Ser Met Gln Lys 225 230
235 240 Ala Ala Asp Gln Leu Asp Tyr Ile Ile Asp Thr Val Pro Val Val
His 245 250 255 Pro Leu Glu Pro Tyr Leu Ser Leu Leu Lys Leu Asp Gly
Lys Leu Ile 260 265 270 Leu Met Gly Val Ile Asn Thr Pro Leu Gln Phe
Val Ser Pro Met Val 275 280 285 Met Leu Gly Arg Lys Ser Ile Thr Gly
Ser Phe Ile Gly Ser Met Lys 290 295 300 Glu Thr Glu Glu Met Leu Glu
Phe Cys Lys Glu Lys Gly Leu Ala Ser 305 310 315 320 Met Ile Glu Val
Ile Lys Met Asp Tyr Ile Asn Thr Ala Phe Glu Arg 325 330 335 Leu Glu
Lys Asn Asp Val Arg Tyr Arg Phe Val Val Asp Val Ala Gly 340 345 350
Ser Lys Leu Ile Pro 355 10 535 PRT aspen populus tremuloides 10 Met
Asn Pro Gln Glu Phe Ile Phe Arg Ser Lys Leu Pro Asp Ile Tyr 1 5 10
15 Ile Pro Lys Asn Leu Pro Leu His Ser Tyr Val Leu Glu Asn Leu Ser
20 25 30 Lys His Ser Ser Lys Pro Cys Leu Ile Asn Gly Ala Asn Gly
Asp Val 35 40 45 Tyr Thr Tyr Ala Asp Val Glu Leu Thr Ala Arg Arg
Val Ala Ser Gly 50 55 60 Leu Asn Lys Ile Gly Ile Gln Gln Gly Asp
Val Ile Met Leu Phe Leu 65 70 75 80 Pro Ser Ser Pro Glu Phe Val Leu
Ala Phe Leu Gly Ala Ser His Arg 85 90 95 Gly Ala Met Ile Thr Ala
Ala Asn Pro Phe Ser Thr Pro Ala Glu Leu 100 105 110 Ala Lys His Ala
Lys Ala Ser Arg Ala Lys Leu Leu Ile Thr Gln Ala 115 120 125 Cys Tyr
Tyr Glu Lys Val Lys Asp Phe Ala Arg Glu Ser Asp Val Lys 130 135 140
Val Met Cys Val Asp Ser Ala Pro Asp Gly Ala Ser Leu Phe Arg Ala 145
150 155 160 His Thr Gln Ala Asp Glu Asn Glu Val Pro Gln Val Asp Ile
Ser Pro 165 170 175 Asp Asp Val Val Ala Leu Pro Tyr Ser Ser Gly Thr
Thr Gly Leu Pro 180 185 190 Lys Gly Val Met Leu Thr His Lys Gly Leu
Ile Thr Ser Val Ala Gln 195 200 205 Gln Val Asp Gly Asp Asn Pro Asn
Leu Tyr Phe His Ser Glu Asp Val 210 215 220 Ile Leu Cys Val Leu Pro
Met Phe His Ile Tyr Ala Leu Asn Ser Met 225 230 235 240 Met Leu Cys
Gly Leu Arg Val Gly Ala Ser Ile Leu Ile Met Pro Lys 245 250 255 Phe
Glu Ile Gly Ser Leu Leu Gly Leu Ile Glu Lys Tyr Lys Val Ser 260 265
270 Ile Ala Pro Val Val Pro Pro Val Met Met Ala Ile Ala Lys Ser Pro
275 280 285 Asp Leu Asp Lys His Asp Leu Ser Ser Leu Arg Met Ile Lys
Ser Gly 290 295 300 Gly Ala Pro Leu Gly Lys Glu Leu Glu Asp Thr Val
Arg Ala Lys Phe 305 310 315 320 Pro Gln Ala Arg Leu Gly Gln Gly Tyr
Gly Met Thr Glu Ala Gly Pro 325 330 335 Val Leu Ala Met Cys Leu Ala
Phe Ala Lys Glu Pro Phe Asp Ile Lys 340 345 350 Pro Gly Ala Cys Gly
Thr Val Val Arg Asn Ala Glu Met Lys Ile Val 355 360 365 Asp Pro Glu
Thr Gly Val Ser Leu Pro Arg Asn Gln Pro Gly Glu Ile 370 375 380 Cys
Ile Arg Gly Asp Gln Ile Met Lys Gly Tyr Leu Asn Asp Pro Glu 385 390
395 400 Ala Thr Ser Arg Thr Ile Asp Lys Glu Gly Trp Leu His Thr Gly
Asp 405 410 415 Ile Gly Tyr Ile Asp Asp Asp Asp Glu Leu Phe Ile Val
Asp Arg Leu 420 425 430 Lys Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val
Ala Pro Thr Glu Leu 435 440 445 Glu Ala Leu Leu Ile Ala His Pro Glu
Ile Ser Asp Ala Ala Val Val 450 455 460 Gly Leu Lys Asp Glu Asp Ala
Gly Glu Val Pro Val Ala Phe Val Val 465 470 475 480 Lys Ser Glu Lys
Ser Gln Ala Thr Glu Asp Glu Ile Lys Gln Tyr Ile 485 490 495 Ser Lys
Gln Val Ile Phe Tyr Lys Arg Ile Lys Arg Val Phe Phe Ile 500 505 510
Glu Ala Ile Pro Lys Ala Pro Ser Gly Lys Ile Leu Arg Lys Asn Leu 515
520 525 Lys Glu Lys Leu Pro Gly Ile 530 535 11 20 DNA aspen populus
tremuloides misc_feature Pt4CL1 promoter sense primer 11 caggaatgct
ctgcactctg 20 12 20 DNA aspen populus tremuloides misc_feature
Pt4CL1 sense primer 12 atgaatccac aagaattcat 20 13 20 DNA aspen
populus tremuloides misc_feature Pt4CL1 promoter sense primer 13
caggaatgct ctgcactctg 20 14 21 DNA aspen populus tremuloides
misc_feature PtCal5H antisense primer 14 ttagagagga cagagcacac g
21
* * * * *