U.S. patent application number 09/927850 was filed with the patent office on 2002-09-26 for interferon-like molecules and uses thereof.
This patent application is currently assigned to Amgen, Inc.. Invention is credited to Kelley, Michael, Welcher, Andrew, Wen, Duanzhi.
Application Number | 20020137137 09/927850 |
Document ID | / |
Family ID | 26865319 |
Filed Date | 2002-09-26 |
United States Patent
Application |
20020137137 |
Kind Code |
A1 |
Welcher, Andrew ; et
al. |
September 26, 2002 |
Interferon-like molecules and uses thereof
Abstract
The present invention provides Interferon-Like (IFN-L)
polypeptides and nucleic acid molecules encoding the same. The
invention also provides selective binding agents, vectors, host
cells, and methods for producing IFN-L polypeptides. The invention
further provides pharmaceutical compositions and methods for the
diagnosis, treatment, amelioration, and/or prevention of diseases,
disorders, and conditions associated with IFN-L polypeptides.
Inventors: |
Welcher, Andrew; (Ventura,
CA) ; Wen, Duanzhi; (Thousand Oaks, CA) ;
Kelley, Michael; (Los Angeles, CA) |
Correspondence
Address: |
MCDONNELL BOEHNEN HULBERT & BERGHOFF
300 SOUTH WACKER DRIVE
SUITE 3200
CHICAGO
IL
60606
US
|
Assignee: |
Amgen, Inc.
|
Family ID: |
26865319 |
Appl. No.: |
09/927850 |
Filed: |
August 10, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09927850 |
Aug 10, 2001 |
|
|
|
09724860 |
Nov 28, 2000 |
|
|
|
60169720 |
Dec 8, 1999 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 530/350; 536/23.5 |
Current CPC
Class: |
C07K 2319/02 20130101;
A61K 38/00 20130101; G01N 33/6866 20130101; A01K 2217/05 20130101;
A61P 37/02 20180101; C07K 2319/00 20130101; C07K 2319/30 20130101;
A61P 25/00 20180101; A61K 48/00 20130101; C07K 14/555 20130101;
C12N 2799/021 20130101 |
Class at
Publication: |
435/69.1 ;
435/325; 435/320.1; 530/350; 536/23.5 |
International
Class: |
C07K 014/705; C07H
021/04; C12P 021/02; C12N 005/06 |
Claims
What is claimed is:
1. An isolated polypeptide comprising an amino acid sequence
selected from the group consisting of: (a) the amino acid sequence
as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5; and (b) the
amino acid sequence encoded by the DNA insert in ATCC Deposit No.
PTA-976.
2. An isolated polypeptide comprising an amino acid sequence
selected from the group consisting of: (a) the amino acid sequence
as set forth in either SEQ ID NO: 3 or SEQ ID NO: 6, optionally
further comprising an amino-terminal methionine; (b) an amino acid
sequence for an ortholog of either SEQ ID NO: 2 or SEQ ID NO:5; (c)
an amino acid sequence that is at least about 70 percent identical
to the amino acid sequence of either SEQ ID NO: 2 or SEQ ID NO: 5,
wherein the polypeptide has an activity of the polypeptide set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5; (d) a fragment of the
amino acid sequence set forth in either SEQ ID NO: 2 or SEQ ID NO:
5 comprising at least about 25 amino acid residues, wherein the
fragment has an activity of the polypeptide set forth in either SEQ
ID NO: 2 or SEQ ID NO: 5, or is antigenic; and (e) an amino acid
sequence for an allelic variant or splice variant of the amino acid
sequence as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5, the
amino acid sequence encoded by the DNA insert in ATCC Deposit No.
PTA-976, or the amino acid sequence of any of (a)-(c).
3. An isolated polypeptide comprising an amino acid sequence
selected from the group consisting of: (a) the amino acid sequence
as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least
one conservative amino acid substitution, wherein the polypeptide
has an activity of the polypeptide set forth in either SEQ ID NO: 2
or SEQ ID NO: 5; (b) the amino acid sequence as set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5 with at least one amino acid
insertion, wherein the polypeptide has an activity of the
polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO: 5; (c)
the amino acid sequence as set forth in either SEQ ID NO: 2 or SEQ
ID NO: 5 with at least one amino acid deletion, wherein the
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5; (d) the amino acid sequence as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5 that has a C- and/or
N-terminal truncation, wherein the polypeptide has an activity of
the polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO: 5;
and (e) the amino acid sequence as set forth in either SEQ ID NO: 2
or SEQ ID NO: 5 with at least one modification selected from the
group consisting of amino acid substitutions, amino acid
insertions, amino acid deletions, C-terminal truncation, and
N-terminal truncation, wherein the polypeptide has an activity of
the polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO:
5.
4. An isolated polypeptide encoded by a nucleic acid molecule
comprising a nucleotide sequence selected from the group consisting
of: (a) the nucleotide sequence as set forth in either SEQ ID NO: 1
or SEQ ID NO: 4; (b) the nucleotide sequence of the DNA insert in
ATCC Deposit No. PTA-976; (c) a nucleotide sequence encoding the
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5;
and (d) a nucleotide sequence that hybridizes under at least
moderately stringent conditions to the complement of any of
(a)-(c); wherein the polypeptide has an activity of the polypeptide
set forth in either SEQ ID NO: 2 or SEQ ID NO: 5.
5. An isolated polypeptide encoded by a nucleic acid molecule
comprising a nucleotide sequence selected from the group consisting
of: (a) a nucleotide sequence encoding a polypeptide that is at
least about 70 percent identical to the polypeptide as set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5; (b) a nucleotide sequence
encoding an allelic variant or splice variant of the nucleotide
sequence as set forth in either SEQ ID NO: 1 or SEQ ID NO: 4, the
nucleotide sequence of the DNA insert in ATCC Deposit No. PTA-976,
or the nucleotide sequence of (a); (c) a region of the nucleotide
sequence of either SEQ ID NO: 1 or SEQ ID NO: 4, the DNA insert in
ATCC Deposit No. PTA-976, or the nucleotide sequence of (a) or (b),
encoding a polypeptide fragment of at least about 25 amino acid
residues; (d) a region of the nucleotide sequence of either SEQ ID
NO: 1 or SEQ ID NO: 4, the DNA insert in ATCC Deposit No. PTA-976,
or the nucleotide sequence of any of (a)-(c), comprising a fragment
of at least about 16 nucleotides; and (e) a nucleotide sequence
that hybridizes under at least moderately stringent conditions to
the complement of any of (a)-(d); wherein the polypeptide has an
activity of the polypeptide set forth in either SEQ ID NO: 2 or SEQ
ID NO: 5.
6. An isolated polypeptide encoded by a nucleic acid molecule
comprising a nucleotide sequence selected from the group consisting
of: (a) a nucleotide sequence encoding a polypeptide as set forth
in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least one
conservative amino acid substitution; (b) a nucleotide sequence
encoding a polypeptide as set forth in either SEQ ID NO: 2 or SEQ
ID NO: 5 with at least one amino acid insertion; (c) a nucleotide
sequence encoding a polypeptide as set forth in either SEQ ID NO: 2
or SEQ ID NO: 5 with at least one amino acid deletion; (d) a
nucleotide sequence encoding a polypeptide as set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5 that has a C- and/or N-terminal
truncation; (e) a nucleotide sequence encoding a polypeptide as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least one
modification selected from the group consisting of amino acid
substitutions, amino acid insertions, amino acid deletions,
C-terminal truncation, and N-terminal truncation; (f) a nucleotide
sequence of any of (a)-(e) comprising a fragment of at least about
16 nucleotides; and (g) a nucleotide sequence that hybridizes under
at least moderately stringent conditions to the complement of any
of (a)-(f); wherein the polypeptide has an activity of the
polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO: 5.
7. The isolated polypeptide according to claim 2 or 3, wherein the
percent identity is determined using a computer program selected
from the group consisting of GAP, BLASTP, FASTA, BLASTA, BLASTX,
BestFit, and the Smith-Waterman algorithm.
8. A composition comprising the polypeptide of any of claims 1, 2,
or 3, and a pharmaceutically acceptable formulation agent.
9. The composition of claim 8, wherein the pharmaceutically
acceptable formulation agent is a carrier, adjuvant, solubilizer,
stabilizer, or anti-oxidant.
10. The composition of claim 8, wherein the polypeptide comprises
the amino acid sequence as set forth in either SEQ ID NO: 3 or SEQ
ID NO: 6.
11. A polypeptide comprising a derivative of the polypeptide of any
of claims 1, 2, or 3.
12. The polypeptide of claim 11 that is covalently modified with a
water-soluble polymer.
13. The polypeptide of claim 12, wherein the water-soluble polymer
is selected from the group consisting of polyethylene glycol,
monomethoxy-polyethylene glycol, dextran, cellulose, poly-(N-vinyl
pyrrolidone) polyethylene glycol, propylene glycol homopolymers,
polypropylene oxide/ethylene oxide co-polymers, polyoxyethylated
polyols, and polyvinyl alcohol.
14. A fusion polypeptide comprising the polypeptide of any of
claims 1, 2, or 3 fused to a heterologous amino acid sequence.
15. The fusion polypeptide of claim 14, wherein the heterologous
amino acid sequence is an IgG constant domain or fragment
thereof.
16. A polypeptide produced by a process comprising culturing a host
cell comprising a vector comprising a nucleic acid molecule
comprising a nucleotide sequence selected from the group consisting
of: (a) the nucleotide sequence as set forth in either SEQ ID NO: 1
or SEQ ID NO: 4; (b) the nucleotide sequence of the DNA insert in
ATCC Deposit No. PTA-976; (c) a nucleotide sequence encoding the
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5;
and (d) a nucleotide sequence that hybridizes under at least
moderately stringent conditions to the complement of any of
(a)-(c); under suitable conditions to express the polypeptide, and
optionally isolating the polypeptide from the culture.
17. A polypeptide produced by a process comprising culturing a host
cell comprising a vector comprising a nucleic acid molecule
comprising a nucleotide sequence selected from the group consisting
of: (a) a nucleotide sequence encoding a polypeptide that is at
least about 70 percent identical to the polypeptide as set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5, wherein the encoded
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5; (b) a nucleotide sequence encoding an
allelic variant or splice variant of the nucleotide sequence as set
forth in either SEQ ID NO: 1 or SEQ ID NO: 4, the nucleotide
sequence of the DNA insert in ATCC Deposit No. PTA-976, or the
nucleotide sequence of (a); (c) a region of the nucleotide sequence
of either SEQ ID NO: 1 or SEQ ID NO: 4, the DNA insert in ATCC
Deposit No. PTA-976, the nucleotide sequence (a) or (b), encoding a
polypeptide fragment of at least about 25 amino acid residues,
wherein the polypeptide fragment has an activity of the encoded
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5, or
is antigenic; (d) a region of the nucleotide sequence of either SEQ
ID NO: 1 or SEQ ID NO: 4, the DNA insert in ATCC Deposit No.
PTA-976, or the nucleotide sequence of any of (a)-(c), comprising a
fragment of at least about 16 nucleotides; and (e) a nucleotide
sequence that hybridizes under at least moderately stringent
conditions to the complement of any of (a)-(d); under suitable
conditions to express the polypeptide, and optionally isolating the
polypeptide from the culture.
18. A polypeptide produced by a process comprising culturing a host
cell comprising a vector comprising a nucleic acid molecule
comprising a nucleotide sequence selected from the group consisting
of: (a) a nucleotide sequence encoding a polypeptide as set forth
in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least one
conservative amino acid substitution, wherein the encoded
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5; (b) a nucleotide sequence encoding a
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5
with at least one amino acid insertion, wherein the encoded
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5; (c) a nucleotide sequence encoding a
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5
with at least one amino acid deletion, wherein the encoded
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5; (d) a nucleotide sequence encoding a
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5
that has a C- and/or N-terminal truncation, wherein the encoded
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO:2or SEQ ID NO: 5; (e) a nucleotide sequence encoding a
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5
with at least one modification selected from the group consisting
of amino acid substitutions, amino acid insertions, amino acid
deletions, C-terminal truncation, and N-terminal truncation,
wherein the encoded polypeptide has an activity of the polypeptide
set forth in either SEQ ID NO: 2 or SEQ ID NO: 5; (f) a nucleotide
sequence of any of (a)-(e) comprising a fragment of at least about
16 nucleotides; and (g) a nucleotide sequence that hybridizes under
at least moderately stringent conditions to the complement of any
of (a)-(f); under suitable conditions to express the polypeptide,
and optionally isolating the polypeptide from the culture.
19. The polypeptide of any of claims 16, 17, or 18, wherein the
host cell is a eukaryotic cell.
20. The polypeptide of any of claims 16, 17, or 18, wherein the
host cell is a prokaryotic cell.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to Interferon-Like (IFN-L)
polypeptides and nucleic acid molecules encoding the same. The
invention also relates to selective binding agents, vectors, host
cells, and methods for producing IFN-L polypeptides. The invention
further relates to pharmaceutical compositions and methods for the
diagnosis, treatment, amelioration, and/or prevention of diseases,
disorders, and conditions associated with IFN-L polypeptides.
BACKGROUND OF THE INVENTION
[0002] Technical advances in the identification, cloning,
expression, and manipulation of nucleic acid molecules and the
deciphering of the human genome have greatly accelerated the
discovery of novel therapeutics. Rapid nucleic acid sequencing
techniques can now generate sequence information at unprecedented
rates and, coupled with computational analyses, allow the assembly
of overlapping sequences into partial and entire genomes and the
identification of polypeptide-encoding regions. A comparison of a
predicted amino acid sequence against a database compilation of
known amino acid sequences allows one to determine the extent of
homology to previously identified sequences and/or structural
landmarks. The cloning and expression of a polypeptide-encoding
region of a nucleic acid molecule provides a polypeptide product
for structural and functional analyses. The manipulation of nucleic
acid molecules and encoded polypeptides may confer advantageous
properties on a product for use as a therapeutic.
[0003] In spite of the significant technical advances in genome
research over the past decade, the potential for the development of
novel therapeutics based on the human genome is still largely
unrealized. Many genes encoding potentially beneficial polypeptide
therapeutics or those encoding polypeptides, which may act as
"targets" for therapeutic molecules, have still not been
identified.
[0004] Accordingly, it is an object of the invention to identify
novel polypeptides, and nucleic acid molecules encoding the same,
which have diagnostic or therapeutic benefit.
SUMMARY OF THE INVENTION
[0005] The present invention relates to novel IFN-L nucleic acid
molecules and encoded polypeptides.
[0006] The invention provides for an isolated nucleic acid molecule
comprising a nucleotide sequence selected from the group consisting
of:
[0007] (a) the nucleotide sequence as set forth in either SEQ ID
NO: 1 or SEQ ID NO: 4;
[0008] (b) the nucleotide sequence of the DNA insert in ATCC
Deposit No. PTA-976;
[0009] (c) a nucleotide sequence encoding the polypeptide as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5;
[0010] (d) a nucleotide sequence which hybridizes under moderately
or highly stringent conditions to the complement of any of (a)-(c);
and
[0011] (e) a nucleotide sequence complementary to any of
(a)-(c).
[0012] The invention also provides for an isolated nucleic acid
molecule comprising a nucleotide sequence selected from the group
consisting of:
[0013] (a) a nucleotide sequence encoding a polypeptide which is at
least about 70 percent identical to the polypeptide as set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5, wherein the encoded
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5;
[0014] (b) a nucleotide sequence encoding an allelic variant or
splice variant of the nucleotide sequence as set forth in either
SEQ ID NO: 1 or SEQ ID NO: 4, the nucleotide sequence of the DNA
insert in ATCC Deposit No. PTA-976, or (a);
[0015] (c) a region of the nucleotide sequence of either SEQ ID NO:
1 or SEQ ID NO: 4, the DNA insert in ATCC Deposit No. PTA-976, (a),
or (b) encoding a polypeptide fragment of at least about 25 amino
acid residues, wherein the polypeptide fragment has an activity of
the encoded polypeptide as set forth in either SEQ ID NO: 2 or SEQ
ID NO: 5, or is antigenic;
[0016] (d) a region of the nucleotide sequence of either SEQ ID NO:
1 or SEQ ID NO: 4, the DNA insert in ATCC Deposit No. PTA-976, or
any of (a)-(c) comprising a fragment of at least about 16
nucleotides;
[0017] (e) a nucleotide sequence which hybridizes under moderately
or highly stringent conditions to the complement of any of (a)-(d);
and
[0018] (f) a nucleotide sequence complementary to any of
(a)-(d).
[0019] The invention further provides for an isolated nucleic acid
molecule comprising a nucleotide sequence selected from the group
consisting of:
[0020] (a) a nucleotide sequence encoding a polypeptide as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least one
conservative amino acid substitution, wherein the encoded
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5;
[0021] (b) a nucleotide sequence encoding a polypeptide as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least one
amino acid insertion, wherein the encoded polypeptide has an
activity of the polypeptide set forth in either SEQ ID NO: 2 or SEQ
ID NO: 5;
[0022] (c) a nucleotide sequence encoding a polypeptide as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least one
amino acid deletion, wherein the encoded polypeptide has an
activity of the polypeptide set forth in either SEQ ID NO: 2 or SEQ
ID NO: 5;
[0023] (d) a nucleotide sequence encoding a polypeptide as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5 which has a C- and/or
N-terminal truncation, wherein the encoded polypeptide has an
activity of the polypeptide set forth in either SEQ ID NO: 2 or SEQ
ID NO: 5;
[0024] (e) a nucleotide sequence encoding a polypeptide as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least one
modification selected from the group consisting of amino acid
substitutions, amino acid insertions, amino acid deletions,
C-terminal truncation, and N-terminal truncation, wherein the
encoded polypeptide has an activity of the polypeptide set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5;
[0025] (f) a nucleotide sequence of any of (a)-(e) comprising a
fragment of at least about 16 nucleotides;
[0026] (g) a nucleotide sequence which hybridizes under moderately
or highly stringent conditions to the complement of any of (a)-(f);
and
[0027] (h) a nucleotide sequence complementary to any of
(a)-(e).
[0028] The present invention provides for an isolated polypeptide
comprising an amino acid sequence selected from the group
consisting of:
[0029] (a) the amino acid sequence as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5; and
[0030] (b) the amino acid sequence encoded by the DNA insert in
ATCC Deposit No. PTA-976.
[0031] The invention also provides for an isolated polypeptide
comprising the amino acid sequence selected from the group
consisting of:
[0032] (a) the amino acid sequence as set forth in either SEQ ID
NO: 3 or SEQ ID NO: 6, optionally further comprising an
amino-terminal methionine;
[0033] (b) an amino acid sequence for an ortholog of either SEQ ID
NO: 2 or SEQ ID NO: 5;
[0034] (c) an amino acid sequence which is at least about 70
percent identical to the amino acid sequence of either SEQ ID NO: 2
or SEQ ID NO: 5, wherein the polypeptide has an activity of the
polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO: 5;
[0035] (d) a fragment of the amino acid sequence set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5 comprising at least about 25
amino acid residues, wherein the fragment has an activity of the
polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO: 5, or is
antigenic; and
[0036] (e) an amino acid sequence for an allelic variant or splice
variant of the amino acid sequence as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5, the amino acid sequence encoded by the DNA
insert in ATCC Deposit No. PTA-976, or any of (a)-(c).
[0037] The invention further provides for an isolated polypeptide
comprising the amino acid sequence selected from the group
consisting of:
[0038] (a) the amino acid sequence as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5 with at least one conservative amino acid
substitution, wherein the polypeptide has an activity of the
polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO: 5;
[0039] (b) the amino acid sequence as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5 with at least one amino acid insertion,
wherein the polypeptide has an activity of the polypeptide set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5;
[0040] (c) the amino acid sequence as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5 with at least one amino acid deletion,
wherein the polypeptide has an activity of the polypeptide set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5;
[0041] (d) the amino acid sequence as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5 which has a C- and/or N-terminal truncation,
wherein the polypeptide has an activity of the polypeptide set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5; and
[0042] (e) the amino acid sequence as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5 with at least one modification selected from
the group consisting of amino acid substitutions, amino acid
insertions, amino acid deletions, C-terminal truncation, and
N-terminal truncation, wherein the polypeptide has an activity of
the polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO:
5.
[0043] Also provided are fusion polypeptides comprising IFN-L amino
acid sequences.
[0044] The present invention also provides for an expression vector
comprising the isolated nucleic acid molecules as set forth herein,
recombinant host cells comprising the recombinant nucleic acid
molecules as set forth herein, and a method of producing an IFN-L
polypeptide comprising culturing the host cells and optionally
isolating the polypeptide so produced.
[0045] A transgenic non-human animal comprising a nucleic acid
molecule encoding an IFN-L polypeptide is also encompassed by the
invention. The IFN-L nucleic acid molecules are introduced into the
animal in a manner that allows expression and increased levels of
an IFN-L polypeptide, which may include increased circulating
levels. Alternatively, the IFN-L nucleic acid molecules are
introduced into the animal in a manner that prevents expression of
endogenous IFN-L polypeptide (i.e., generates a transgenic animal
possessing an IFN-L polypeptide gene knockout). The transgenic
non-human animal is preferably a mammal, and more preferably a
rodent, such as a rat or a mouse.
[0046] Also provided are derivatives of the IFN-L polypeptides of
the present invention.
[0047] Additionally provided are selective binding agents such as
antibodies and peptides capable of specifically binding the IFN-L
polypeptides of the invention. Such antibodies and peptides may be
agonistic or antagonistic.
[0048] Pharmaceutical compositions comprising the nucleotides,
polypeptides, or selective binding agents of the invention and one
or more pharmaceutically acceptable formulation agents are also
encompassed by the invention. The pharmaceutical compositions are
used to provide therapeutically effective amounts of the
nucleotides or polypeptides of the present invention. The invention
is also directed to methods of using the polypeptides, nucleic acid
molecules, and selective binding agents.
[0049] The IFN-L polypeptides and nucleic acid molecules of the
present invention may be used to treat, prevent, ameliorate, and/or
detect diseases and disorders, including those recited herein.
[0050] The present invention also provides a method of assaying
test molecules to identify a test molecule that binds to an IFN-L
polypeptide. The method comprises contacting an IFN-L polypeptide
with a test molecule to determine the extent of binding of the test
molecule to the polypeptide. The method further comprises
determining whether such test molecules are agonists or antagonists
of an IFN-L polypeptide. The present invention further provides a
method of testing the impact of molecules on the expression of
IFN-L polypeptide or on the activity of IFN-L polypeptide.
[0051] Methods of regulating expression and modulating (i.e.,
increasing or decreasing) levels of an IFN-L polypeptide are also
encompassed by the invention. One method comprises administering to
an animal a nucleic acid molecule encoding an IFN-L polypeptide. In
another method, a nucleic acid molecule comprising elements that
regulate or modulate the expression of an IFN-L polypeptide may be
administered. Examples of these methods include gene therapy, cell
therapy, and anti-sense therapy as further described herein.
[0052] In another aspect of the present invention, the IFN-L
polypeptides may be used for identifying receptors thereof ("IFN-L
polypeptide receptors"). Various forms of "expression cloning" have
been extensively used to clone receptors for protein ligands. See,
e.g., Simonsen and Lodish, 1994, Trends Pharmacol. Sci. 15:437-41
and Tartaglia et al., 1995, Cell 83:1263-71. The isolation of an
IFN-L polypeptide receptor is useful for identifying or developing
novel agonists and antagonists of the IFN-L polypeptide signaling
pathway. Such agonists and antagonists include soluble IFN-L
polypeptide receptors, anti-IFN-L polypeptide receptor-selective
binding agents (such as antibodies and derivatives thereof), small
molecules, and antisense oligonucleotides, any of which can be used
for treating one or more disease or disorder, including those
disclosed herein.
BRIEF DESCRIPTION OF THE FIGURES
[0053] FIGS. 1A-1B illustrate the nucleotide sequence of the rat
IFN-L gene (SEQ ID NO: 1) and the deduced amino acid sequence of
rat IFN-L polypeptide (SEQ ID NO: 2). The predicted signal peptide
is indicated (underlined);
[0054] FIGS. 2A-2B illustrate the nucleotide sequence of the human
IFN-L gene (SEQ ID NO: 4) and the deduced amino acid sequence of
human IFN-L polypeptide (SEQ ID NO: 5). The predicted signal
peptide is indicated (underlined);
[0055] FIG. 3 illustrates the amino acid sequence alignment of
human IFN-L polypeptide (huIFN-L; SEQ ID NO: 5), human IFN-.beta.
(huIFN-.beta.; SEQ ID NO: 7), rat IFN-L polypeptide (raIFN-L; SEQ
ID NO: 2), and those amino acid positions which share some
similarity (cons);
[0056] FIG. 4 illustrates the nucleotide sequence of the Nde I-Bam
HI pAMG21 insert (SEQ ID NO: 8) of Amgen strain #3729 and the
predicted amino acid sequence (SEQ ID NO: 9) encoded by this
insert;
[0057] FIG. 5 illustrates the nucleotide sequence of the Nde I-Bam
HI pAMG21 insert (SEQ ID NO: 10) of Amgen strain #3858 and the
predicted amino acid sequence (SEQ ID NO: 11) encoded by this
insert;
[0058] FIG. 6 illustrates the nucleotide sequence of the Xba I-Bam
HI pAMG21 insert (SEQ ID NO: 12) of Amgen strain #4047 and the
predicted amino acid sequence (SEQ ID NO: 13) encoded by this
insert;
[0059] FIG. 7 illustrates the nucleotide sequence of the Xba I-Bam
HI pAMG21 insert (SEQ ID NO: 14) of Amgen strain #3969 and the
predicted amino acid sequence (SEQ ID NO: 15) encoded by this
insert;
[0060] FIG. 8 illustrates the nucleotide sequence of the Nde I-Bam
HI pAMG21 insert (SEQ ID NO: 16) of Amgen strain #4182 and the
predicted amino acid sequence (SEQ ID NO: 17) encoded by this
insert.
DETAILED DESCRIPTION OF THE INVENTION
[0061] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All references cited in this application are
expressly incorporated by reference herein.
[0062] Definitions
[0063] The terms "IFN-L gene" or "IFN-L nucleic acid molecule" or
"IFN-L polynucleotide" refer to a nucleic acid molecule comprising
or consisting of a nucleotide sequence as set forth in either SEQ
ID NO: 1 or SEQ ID NO: 4, a nucleotide sequence encoding the
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5, a
nucleotide sequence of the DNA insert in ATCC Deposit No.
[0064] PTA-976, and nucleic acid molecules as defined herein.
[0065] The term "IFN-L polypeptide allelic variant" refers to one
of several possible naturally occurring alternate forms of a gene
occupying a given locus on a chromosome of an organism or a
population of organisms.
[0066] The term "IFN-L polypeptide splice variant" refers to a
nucleic acid molecule, usually RNA, which is generated by
alternative processing of intron sequences in an RNA transcript of
IFN-L polypeptide amino acid sequence as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5.
[0067] The term "isolated nucleic acid molecule" refers to a
nucleic acid molecule of the invention that (1) has been separated
from at least about 50 percent of proteins, lipids, carbohydrates,
or other materials with which it is naturally found when total
nucleic acid is isolated from the source cells, (2) is not linked
to all or a portion of a polynucleotide to which the "isolated
nucleic acid molecule" is linked in nature, (3) is operably linked
to a polynucleotide which it is not linked to in nature, or (4)
does not occur in nature as part of a larger polynucleotide
sequence. Preferably, the isolated nucleic acid molecule of the
present invention is substantially free from any other
contaminating nucleic acid molecule(s) or other contaminants that
are found in its natural environment that would interfere with its
use in polypeptide production or its therapeutic, diagnostic,
prophylactic or research use.
[0068] The term "nucleic acid sequence" or "nucleic acid molecule"
refers to a DNA or RNA sequence. The term encompasses molecules
formed from any of the known base analogs of DNA and RNA such as,
but not limited to 4-acetylcytosine, 8-hydroxy-N6-methyladenosine,
aziridinyl-cytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-fluorouracil, 5-bromouracil,
5-carboxymethylaminomethyl-2-thiouracil,
5-carboxy-methylaminomethyluracil, dihydrouracil, inosine,
N6-iso-pentenyladenine, 1-methyladenine, 1-methylpseudouracil,
1-methylguanine, 1-methylinosine, 2,2-dimethyl-guanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-methyladenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyamino-methyl-2-thiou- racil,
beta-D-mannosylqueosine, 5'-methoxycarbonyl-methyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
oxybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
[0069] The term "vector" is used to refer to any molecule (e.g.
nucleic acid, plasmid, or virus) used to transfer coding
information to a host cell.
[0070] The term "expression vector" refers to a vector that is
suitable for transformation of a host cell and contains nucleic
acid sequences that direct and/or control the expression of
inserted heterologous nucleic acid sequences. Expression includes,
but is not limited to, processes such as transcription,
translation, and RNA splicing, if introns are present.
[0071] The term "operably linked" is used herein to refer to an
arrangement of flanking sequences wherein the flanking sequences so
described are configured or assembled so as to perform their usual
function. Thus, a flanking sequence operably linked to a coding
sequence may be capable of effecting the replication, transcription
and/or translation of the coding sequence. For example, a coding
sequence is operably linked to a promoter when the promoter is
capable of directing transcription of that coding sequence. A
flanking sequence need not be contiguous with the coding sequence,
so long as it functions correctly. Thus, for example, intervening
untranslated yet transcribed sequences can be present between a
promoter sequence and the coding sequence and the promoter sequence
can still be considered "operably linked" to the coding
sequence.
[0072] The term "host cell" is used to refer to a cell which has
been transformed, or is capable of being transformed with a nucleic
acid sequence and then of expressing a selected gene of interest.
The term includes the progeny of the parent cell, whether or not
the progeny is identical in morphology or in genetic make-up to the
original parent, so long as the selected gene is present.
[0073] The term "IFN-L polypeptide" refers to a polypeptide
comprising the amino acid sequence of either SEQ ID NO: 2 or SEQ ID
NO: 5 and related polypeptides. Related polypeptides include IFN-L
polypeptide fragments, IFN-L polypeptide orthologs, IFN-L
polypeptide variants, and IFN-L polypeptide derivatives, which
possess at least one activity of the polypeptide as set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5. IFN-L polypeptides may be
mature polypeptides, as defined herein, and may or may not have an
amino-terminal methionine residue, depending on the method by which
they are prepared.
[0074] The term "IFN-L polypeptide fragment" refers to a
polypeptide that comprises a truncation at the amino-terminus (with
or without a leader sequence) and/or a truncation at the
carboxyl-terminus of the polypeptide as set forth in either SEQ ID
NO: 2 or SEQ ID NO: 5. The term "IFN-L polypeptide fragment" also
refers to amino-terminal and/or carboxyl-terminal truncations of
IFN-L polypeptide orthologs, IFN-L polypeptide derivatives, or
IFN-L polypeptide variants, or to amino-terminal and/or
carboxyl-terminal truncations of the polypeptides encoded by IFN-L
polypeptide allelic variants or IFN-L polypeptide splice variants.
IFN-L polypeptide fragments may result from alternative RNA
splicing or from in vivo protease activity. Membrane-bound forms of
an IFN-L polypeptide are also contemplated by the present
invention. In preferred embodiments, truncations and/or deletions
comprise about 10 amino acids, or about 20 amino acids, or about 50
amino acids, or about 75 amino acids, or about 100 amino acids, or
more than about 100 amino acids. The polypeptide fragments so
produced will comprise about 25 contiguous amino acids, or about 50
amino acids, or about 75 amino acids, or about 100 amino acids, or
about 150 amino acids, or about 200 amino acids. Such IFN-L
polypeptide fragments may optionally comprise an amino-terminal
methionine residue. It will be appreciated that such fragments can
be used, for example, to generate antibodies to IFN-L
polypeptides.
[0075] The term "IFN-L polypeptide ortholog" refers to a
polypeptide from another species that corresponds to IFN-L
polypeptide amino acid sequence as set forth in either SEQ ID NO: 2
or SEQ ID NO: 5. For example, mouse and human IFN-L polypeptides
are considered orthologs of each other.
[0076] The term "IFN-L polypeptide variants" refers to IFN-L
polypeptides comprising amino acid sequences having one or more
amino acid sequence substitutions, deletions (such as internal
deletions and/or IFN-L polypeptide fragments), and/or additions
(such as internal additions and/or IFN-L fusion polypeptides) as
compared to the IFN-L polypeptide amino acid sequence set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5 (with or without a leader
sequence). Variants may be naturally occurring (e.g., IFN-L
polypeptide allelic variants, IFN-L polypeptide orthologs, and
IFN-L polypeptide splice variants) or artificially constructed.
Such IFN-L polypeptide variants may be prepared from the
corresponding nucleic acid molecules having a DNA sequence that
varies accordingly from the DNA sequence as set forth in either SEQ
ID NO: 1 or SEQ ID NO: 4. In preferred embodiments, the variants
have from 1 to 3, or from 1 to 5, or from 1 to 10, or from 1 to 15,
or from 1 to 20, or from 1 to 25, or from 1 to 50, or from 1 to 75,
or from 1 to 100, or more than 100 amino acid substitutions,
insertions, additions and/or deletions, wherein the substitutions
may be conservative, or non-conservative, or any combination
thereof.
[0077] The term "IFN-L polypeptide derivatives" refers to the
polypeptide as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5,
IFN-L polypeptide fragments, IFN-L polypeptide orthologs, or IFN-L
polypeptide variants, as defined herein, that have been chemically
modified. The term "IFN-L polypeptide derivatives" also refers to
the polypeptides encoded by IFN-L polypeptide allelic variants or
IFN-L polypeptide splice variants, as defined herein, that have
been chemically modified.
[0078] The term "mature IFN-L polypeptide" refers to an IFN-L
polypeptide lacking a leader sequence. A mature IFN-L polypeptide
may also include other modifications such as proteolytic processing
of the amino-terminus (with or without a leader sequence) and/or
the carboxyl-terminus, cleavage of a smaller polypeptide from a
larger precursor, N-linked and/or O-linked glycosylation, and the
like. Exemplary mature IFN-L polypeptides are depicted by the amino
acid sequences of SEQ ID NO: 3 and SEQ ID NO: 6.
[0079] The term "IFN-L fusion polypeptide" refers to a fusion of
one or more amino acids (such as a heterologous protein or peptide)
at the amino- or carboxyl-terminus of the polypeptide as set forth
in either SEQ ID NO: 2 or SEQ ID NO: 5, IFN-L polypeptide
fragments, IFN-L polypeptide orthologs, IFN-L polypeptide variants,
or IFN-L derivatives, as defined herein. The term "IFN-L fusion
polypeptide" also refers to a fusion of one or more amino acids at
the amino- or carboxyl-terminus of the polypeptide encoded by IFN-L
polypeptide allelic variants or IFN-L polypeptide splice variants,
as defined herein.
[0080] The term "biologically active IFN-L polypeptides" refers to
IFN-L polypeptides having at least one activity characteristic of
the polypeptide comprising the amino acid sequence of either SEQ ID
NO: 2 or SEQ ID NO: 5. In addition, an IFN-L polypeptide may be
active as an immunogen; that is, the IFN-L polypeptide contains at
least one epitope to which antibodies may be raised.
[0081] The term "isolated polypeptide" refers to a polypeptide of
the present invention that (1) has been separated from at least
about 50 percent of polynucleotides, lipids, carbohydrates, or
other materials with which it is naturally found when isolated from
the source cell, (2) is not linked (by covalent or noncovalent
interaction) to all or a portion of a polypeptide to which the
"isolated polypeptide" is linked in nature, (3) is operably linked
(by covalent or noncovalent interaction) to a polypeptide with
which it is not linked in nature, or (4) does not occur in nature.
Preferably, the isolated polypeptide is substantially free from any
other contaminating polypeptides or other contaminants that are
found in its natural environment that would interfere with its
therapeutic, diagnostic, prophylactic or research use.
[0082] The term "identity," as known in the art, refers to a
relationship between the sequences of two or more polypeptide
molecules or two or more nucleic acid molecules, as determined by
comparing the sequences. In the art, "identity" also means the
degree of sequence relatedness between nucleic acid molecules or
polypeptides, as the case may be, as determined by the match
between strings of two or more nucleotide or two or more amino acid
sequences. "Identity" measures the percent of identical matches
between the smaller of two or more sequences with gap alignments
(if any) addressed by a particular mathematical model or computer
program (i.e., "algorithms").
[0083] The term "similarity" is a related concept, but in contrast
to "identity," "similarity" refers to a measure of relatedness
which includes both identical matches and conservative substitution
matches. If two polypeptide sequences have, for example, 10/20
identical amino acids, and the remainder are all non-conservative
substitutions, then the percent identity and similarity would both
be 50%. If in the same example, there are five more positions where
there are conservative substitutions, then the percent identity
remains 50%, but the percent similarity would be 75% (15/20).
Therefore, in cases where there are conservative substitutions, the
percent similarity between two polypeptides will be higher than the
percent identity between those two polypeptides.
[0084] The term "naturally occurring" or "native" when used in
connection with biological materials such as nucleic acid
molecules, polypeptides, host cells, and the like, refers to
materials which are found in nature and are not manipulated by man.
Similarly, "non-naturally occurring" or "non-native" as used herein
refers to a material that is not found in nature or that has been
structurally modified or synthesized by man.
[0085] The terms "effective amount" and "therapeutically effective
amount" each refer to the amount of an IFN-L polypeptide or IFN-L
nucleic acid molecule used to support an observable level of one or
more biological activities of the IFN-L polypeptides as set forth
herein.
[0086] The term "pharmaceutically acceptable carrier" or
"physiologically acceptable carrier" as used herein refers to one
or more formulation materials suitable for accomplishing or
enhancing the delivery of the IFN-L polypeptide, IFN-L nucleic acid
molecule, or IFN-L selective binding agent as a pharmaceutical
composition.
[0087] The term "antigen" refers to a molecule or a portion of a
molecule capable of being bound by a selective binding agent, such
as an antibody, and additionally capable of being used in an animal
to produce antibodies capable of binding to an epitope of that
antigen. An antigen may have one or more epitopes.
[0088] The term "selective binding agent" refers to a molecule or
molecules having specificity for an IFN-L polypeptide. As used
herein, the terms, "specific" and "specificity" refer to the
ability of the selective binding agents to bind to human IFN-L
polypeptides and not to bind to human non-IFN-L polypeptides. It
will be appreciated, however, that the selective binding agents may
also bind orthologs of the polypeptide as set forth in either SEQ
ID NO: 2 or SEQ ID NO: 5, that is, interspecies versions thereof,
such as mouse and rat IFN-L polypeptides.
[0089] The term "transduction" is used to refer to the transfer of
genes from one bacterium to another, usually by a phage.
"Transduction" also refers to the acquisition and transfer of
eukaryotic cellular sequences by retroviruses.
[0090] The term "transfection" is used to refer to the uptake of
foreign or exogenous DNA by a cell, and a cell has been
"transfected" when the exogenous DNA has been introduced inside the
cell membrane. A number of transfection techniques are well known
in the art and are disclosed herein. See, e.g., Graham et al.,
1973, Virology 52:456; Sambrook et al., Molecular Cloning, A
Laboratory Manual (Cold Spring Harbor Laboratories, 1989); Davis et
al., Basic Methods in Molecular Biology (Elsevier, 1986); and Chu
et al., 1981, Gene 13:197. Such techniques can be used to introduce
one or more exogenous DNA moieties into suitable host cells.
[0091] The term "transformation" as used herein refers to a change
in a cell's genetic characteristics, and a cell has been
transformed when it has been modified to contain a new DNA. For
example, a cell is transformed where it is genetically modified
from its native state. Following transfection or transduction, the
transforming DNA may recombine with that of the cell by physically
integrating into a chromosome of the cell, may be maintained
transiently as an episomal element without being replicated, or may
replicate independently as a plasmid. A cell is considered to have
been stably transformed when the DNA is replicated with the
division of the cell.
[0092] Relatedness of Nucleic Acid Molecules and/or
Polypeptides
[0093] It is understood that related nucleic acid molecules include
allelic or splice variants of the nucleic acid molecule of either
SEQ ID NO: 1 or SEQ ID NO: 4, and include sequences which are
complementary to any of the above nucleotide sequences. Related
nucleic acid molecules also include a nucleotide sequence encoding
a polypeptide comprising or consisting essentially of a
substitution, modification, addition and/or deletion of one or more
amino acid residues compared to the polypeptide in either SEQ ID
NO: 2 or SEQ ID NO: 5. Such related IFN-L polypeptides may
comprise, for example, an addition and/or a deletion of one or more
N-linked or O-linked glycosylation sites or an addition and/or a
deletion of one or more cysteine residues.
[0094] Related nucleic acid molecules also include fragments of
IFN-L nucleic acid molecules which encode a polypeptide of at least
about 25 contiguous amino acids, or about 50 amino acids, or about
75 amino acids, or about 100 amino acids, or about 150 amino acids,
or about 200 amino acids, or more than 200 amino acid residues of
the IFN-L polypeptide of either SEQ ID NO: 2 or SEQ ID NO:5.
[0095] In addition, related IFN-L nucleic acid molecules also
include those molecules which comprise nucleotide sequences which
hybridize under moderately or highly stringent conditions as
defined herein with the fully complementary sequence of the IFN-L
nucleic acid molecule of either SEQ ID NO: 1 or SEQ ID NO: 4, or of
a molecule encoding a polypeptide, which polypeptide comprises the
amino acid sequence as shown in either SEQ ID NO: 2 or SEQ ID NO:
5, or of a nucleic acid fragment as defined herein, or of a nucleic
acid fragment encoding a polypeptide as defined herein.
Hybridization probes may be prepared using the IFN-L sequences
provided herein to screen cDNA, genomic or synthetic DNA libraries
for related sequences. Regions of the DNA and/or amino acid
sequence of IFN-L polypeptide that exhibit significant identity to
known sequences are readily determined using sequence alignment
algorithms as described herein and those regions may be used to
design probes for screening.
[0096] The term "highly stringent conditions" refers to those
conditions that are designed to permit hybridization of DNA strands
whose sequences are highly complementary, and to exclude
hybridization of significantly mismatched DNAs. Hybridization
stringency is principally determined by temperature, ionic
strength, and the concentration of denaturing agents such as
formamide. Examples of "highly stringent conditions" for
hybridization and washing are 0.015 M sodium chloride, 0.0015 M
sodium citrate at 65-68.degree. C. or 0.015. M sodium chloride,
0.0015 M sodium citrate, and 50% formamide at 42.degree. C. See
Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory
Manual (2nd ed., Cold Spring Harbor Laboratory, 1989); Anderson et
al., Nucleic Acid Hybridisation: A Practical Approach Ch. 4 (IRL
Press Limited).
[0097] More stringent conditions (such as higher temperature, lower
ionic strength, higher formamide, or other denaturing agent) may
also be used--however, the rate of hybridization will be affected.
Other agents may be included in the hybridization and washing
buffers for the purpose of reducing non-specific and/or background
hybridization. Examples are 0.1% bovine serum albumin, 0.1%
polyvinyl-pyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium
dodecylsulfate, NaDodSO.sub.4, (SDS), ficoll, Denhardt's solution,
sonicated salmon sperm DNA (or another non-complementary DNA), and
dextran sulfate, although other suitable agents can also be used.
The concentration and types of these additives can be changed
without substantially affecting the stringency of the hybridization
conditions. Hybridization experiments are usually carried out at pH
6.8-7.4; however, at typical ionic strength conditions, the rate of
hybridization is nearly independent of pH. See Anderson et al.,
Nucleic Acid Hybridisation: A Practical Approach Ch. 4 (IRL Press
Limited).
[0098] Factors affecting the stability of DNA duplex include base
composition, length, and degree of base pair mismatch.
Hybridization conditions can be adjusted by one skilled in the art
in order to accommodate these variables and allow DNAs of different
sequence relatedness to form hybrids. The melting temperature of a
perfectly matched DNA duplex can be estimated by the following
equation:
T.sub.m(.degree. C.)=81.5+16.6(log[Na+])+0.41(% G+C)-600/N-0.72(%
formamide)
[0099] where N is the length of the duplex formed, [Na+] is the
molar concentration of the sodium ion in the hybridization or
washing solution, % G+C is the percentage of (guanine+cytosine)
bases in the hybrid. For imperfectly matched hybrids, the melting
temperature is reduced by approximately 1.degree. C. for each 1%
mismatch.
[0100] The term "moderately stringent conditions" refers to
conditions under which a DNA duplex with a greater degree of base
pair mismatching than could occur under "highly stringent
conditions" is able to form. Examples of typical "moderately
stringent conditions" are 0.015 M sodium chloride, 0.0015 M sodium
citrate at 50-65.degree. C. or 0.015 M sodium chloride, 0.0015 M
sodium citrate, and 20% formamide at 37-50.degree. C. By way of
example, "moderately stringent conditions" of 50.degree. C. in
0.015 M sodium ion will allow about a 21% mismatch. It will be
appreciated by those skilled in the art that there is no absolute
distinction between "highly stringent conditions" and "moderately
stringent conditions." For example, at 0.015 M sodium ion (no
formamide), the melting temperature of perfectly matched long DNA
is about 71.degree. C. With a wash at 65.degree. C. (at the same
ionic strength), this would allow for approximately a 6% mismatch.
To capture more distantly related sequences, one skilled in the art
can simply lower the temperature or raise the ionic strength.
[0101] A good estimate of the melting temperature in 1M NaCl* for
oligonucleotide probes up to about 20 nt is given by:
Tm=2.degree. C. per A-T base pair+4.degree. C. per G-C base
pair
[0102] The sodium ion concentration in 6X salt sodium citrate (SSC)
is 1M. See Suggs et al., Developmental Biology Using Purified Genes
683 (Brown and Fox, eds., 1981).
[0103] High stringency washing conditions for oligonucleotides are
usually at a temperature of 0-5.degree. C. below the Tm of the
oligonucleotide in 6X SSC, 0.1% SDS.
[0104] In another embodiment, related nucleic acid molecules
comprise or consist of a nucleotide sequence that is at least about
70 percent identical to the nucleotide sequence as shown in either
SEQ ID NO: 1 or SEQ ID NO: 4, or comprise or consist essentially of
a nucleotide sequence encoding a polypeptide that is at least about
70 percent identical to the polypeptide as set forth in either SEQ
ID NO: 2 or SEQ ID NO: 5. In preferred embodiments, the nucleotide
sequences are about 75 percent, or about 80 percent, or about 85
percent, or about 90 percent, or about 95, 96, 97, 98, or 99
percent identical to the nucleotide sequence as shown in either SEQ
ID NO: 1 or SEQ ID NO: 4, or the nucleotide sequences encode a
polypeptide that is about 75 percent, or about 80 percent, or about
85 percent, or about 90 percent, or about 95, 96, 97, 98, or 99
percent identical to the polypeptide sequence as set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5. Related nucleic acid molecules
encode polypeptides possessing at least one activity of the
polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO: 5.
[0105] Differences in the nucleic acid sequence may result in
conservative and/or non-conservative modifications of the amino
acid sequence relative to the amino acid sequence of either SEQ ID
NO: 2 or SEQ ID NO: 5.
[0106] Conservative modifications to the amino acid sequence of
either SEQ ID NO: 2 or SEQ ID NO: 5 (and the corresponding
modifications to the encoding nucleotides) will produce a
polypeptide having functional and chemical characteristics similar
to those of IFN-L polypeptides. In contrast, substantial
modifications in the functional and/or chemical characteristics of
IFN-L polypeptides may be accomplished by selecting substitutions
in the amino acid sequence of either SEQ ID NO: 2 or SEQ ID NO: 5
that differ significantly in their effect on maintaining (a) the
structure of the molecular backbone in the area of the
substitution, for example, as a sheet or helical conformation, (b)
the charge or hydrophobicity of the molecule at the target site, or
(c) the bulk of the side chain.
[0107] For example, a "conservative amino acid substitution" may
involve a substitution of a native amino acid residue with a
nonnative residue such that there is little or no effect on the
polarity or charge of the amino acid residue at that position.
Furthermore, any native residue in the polypeptide may also be
substituted with alanine, as has been previously described for
"alanine scanning mutagenesis."
[0108] Conservative amino acid substitutions also encompass
non-naturally occurring amino acid residues that are typically
incorporated by chemical peptide synthesis rather than by synthesis
in biological systems. These include peptidomimetics, and other
reversed or inverted forms of amino acid moieties.
[0109] Naturally occurring residues may be divided into classes
based on common side chain properties:
[0110] 1) hydrophobic:. norleucine, Met, Ala, Val, Leu, Ile;
[0111] 2) neutral hydrophilic: Cys, Ser, Thr;
[0112] 3) acidic: Asp, Glu;
[0113] 4) basic: Asn, Gln, His, Lys, Arg;
[0114] 5) residues that influence chain orientation: Gly, Pro;
and
[0115] 6) aromatic: Trp, Tyr, Phe.
[0116] For example, non-conservative substitutions may involve the
exchange of a member of one of these classes for a member from
another class. Such substituted residues may be introduced into
regions of the human IFN-L polypeptide that are homologous with
non-human IFN-L polypeptides, or into the non-homologous regions of
the molecule.
[0117] In making such changes, the hydropathic index of amino acids
may be considered. Each amino acid has been assigned a hydropathic
index on the basis of its hydrophobicity and charge
characteristics. The hydropathic indices are: isoleucine (+4.5);
valine (+4.2); leucine (+3.8); phenylalanine (+2.8);
cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine
(-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9);
tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate
(-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5);
lysine (-3.9); and arginine (-4.5).
[0118] The importance of the hydropathic amino acid index in
conferring interactive biological function on a protein is
generally understood in the art (Kyte et al., 1982, J. Mol. Biol.
157:105-31). It is known that certain amino acids may be
substituted for other amino acids having a similar hydropathic
index or score and still retain a similar biological activity. In
making changes based upon the hydropathic index, the substitution
of amino acids whose hydropathic indices are within .+-.2 is
preferred, those which are within .+-.1 are particularly preferred,
and those within .+-.0.5 are even more particularly preferred.
[0119] It is also understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity, particularly where the biologically functionally
equivalent protein or peptide thereby created is intended for use
in immunological embodiments, as in the present case. The greatest
local average hydrophilicity of a protein, as governed by the
hydrophilicity of its adjacent amino acids, correlates with its
immunogenicity and antigenicity, i.e., with a biological property
of the protein.
[0120] The following hydrophilicity values have been assigned to
these amino acid residues: arginine (+3.0); lysine (+3.0);
aspartate (+3.0 .+-.1); glutamate (+3.0.+-.1); serine (+0.3);
asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4);
proline (-0.5 +1); alanine (-0.5); histidine (-0.5); cysteine
(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8);
isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and
tryptophan (-3.4). In making changes based upon similar
hydrophilicity values, the substitution of amino acids whose
hydrophilicity values are within .+-.2 is preferred, those which
are within .+-.1 are particularly preferred, and those within
.+-.0.5 are even more particularly preferred. One may also identify
epitopes from primary amino acid sequences on the basis of
hydrophilicity. These regions are also referred to as "epitopic
core regions."
[0121] Desired amino acid substitutions (whether conservative or
non-conservative) can be determined by those skilled in the art at
the time such substitutions are desired. For example, amino acid
substitutions can be used to identify important residues of the
IFN-L polypeptide, or to increase or decrease the affinity of the
IFN-L polypeptides described herein. Exemplary amino acid
substitutions are set forth in Table I.
1TABLE I Amino Acid Substitutions Original Residues Exemplary
Substitutions Preferred Substitutions Ala Val, Leu, Ile Val Arg
Lys, Gln, Asn Lys Asn Gln Gln Asp Glu Glu Cys Ser, Ala Ser Gln Asn
Asn Glu Asp Asp Gly Pro, Ala Ala His Asn, Gln, Lys, Arg Arg Ile
Leu, Val, Met, Ala, Leu Phe, Norleucine Leu Norleucine, Ile, Ile
Val, Met, Ala, Phe Lys Arg, 1,4 Diamino-butyric Arg Acid, Gln, Asn
Met Leu, Phe, Ile Leu Phe Leu, Val, Ile, Ala, Leu Tyr Pro Ala Gly
Ser Thr, Ala, Cys Thr Thr Ser Ser Trp Tyr, Phe Tyr Tyr Trp, Phe,
Thr, Ser Phe Val Ile, Met, Leu, Phe, Leu Ala, Norleucine
[0122] A skilled artisan will be able to determine suitable
variants of the polypeptide as set forth in either SEQ ID NO: 2 or
SEQ ID NO: 5 using well-known techniques. For identifying suitable
areas of the molecule that may be changed without destroying
biological activity, one skilled in the art may target areas not
believed to be important for activity. For example, when similar
polypeptides with similar activities from the same species or from
other species are known, one skilled in the art may compare the
amino acid sequence of an IFN-L polypeptide to such similar
polypeptides. With such a comparison, one can identify residues and
portions of the molecules that are conserved among similar
polypeptides. It will be appreciated that changes in areas of the
IFN-L molecule that are not conserved relative to such similar
polypeptides would be less likely to adversely affect the
biological activity and/or structure of an IFN-L polypeptide. One
skilled in the art would also know that, even in relatively
conserved regions, one may substitute chemically similar amino
acids for the naturally occurring residues while retaining activity
(conservative amino acid residue substitutions). Therefore, even
areas that may be important for biological activity or for
structure may be subject to conservative amino acid substitutions
without destroying the biological activity or without adversely
affecting the polypeptide structure.
[0123] Additionally, one skilled in the art can review
structure-function studies identifying residues in similar
polypeptides that are important for activity or structure. In view
of such a comparison, one can predict the importance of amino acid
residues in an IFN-L polypeptide that correspond to amino acid
residues that are important for activity or structure in similar
polypeptides. One skilled in the art may opt for chemically similar
amino acid substitutions for such predicted important amino acid
residues of IFN-L polypeptides.
[0124] One skilled in the art can also analyze the
three-dimensional structure and amino acid sequence in relation to
that structure in similar polypeptides. In view of such
information, one skilled in the art may predict the alignment of
amino acid residues of IFN-L polypeptide with respect to its three
dimensional structure. One skilled in the art may choose not to
make radical changes to amino acid residues predicted to be on the
surface of the protein, since such residues may be involved in
important interactions with other molecules. Moreover, one skilled
in the art may generate test variants containing a single amino
acid substitution at each amino acid residue. The variants could be
screened using activity assays known to those with skill in the
art. Such variants could be used to gather information about
suitable variants. For example, if one discovered that a change to
a particular amino acid residue resulted in destroyed, undesirably
reduced, or unsuitable activity, variants with such a change would
be avoided. In other words, based on information gathered from such
routine experiments, one skilled in the art can readily determine
the amino acids where further substitutions should be avoided
either alone or in combination with other mutations.
[0125] A number of scientific publications have been devoted to the
prediction of secondary structure. See Moult, 1996, Curr. Opin.
Biotechnol. 7:422-27; Chou et al., 1974, Biochemistry 13:222-45;
Chou et al., 1974, Biochemistry 113:211-22; Chou et al., 1978, Adv.
Enzymol Relat. Areas Mol. Biol. 47:45-48; Chou et al., 1978, Ann.
Rev. Biochem. 47:251-276; and Chou et al., 1979, Biophys. J
26:367-84. Moreover, computer programs are currently available to
assist with predicting secondary structure. One method of
predicting secondary structure is based upon homology modeling. For
example, two polypeptides or proteins which have a sequence
identity of greater than 30%, or similarity greater than 40%, often
have similar structural topologies. The recent growth of the
protein structural database (PDB) has provided enhanced
predictability of secondary structure, including the potential
number of folds within the structure of a polypeptide or protein.
See Holm et al., 1999, Nucleic Acids Res. 27:244-47. It has been
suggested that there are a limited number of folds in a given
polypeptide or protein and that once a critical number of
structures have been resolved, structural prediction will become
dramatically more accurate (Brenner et al., 1997, Curr. Opin.
Struct. Biol. 7:369-76).
[0126] Additional methods of predicting secondary structure include
"threading" (Jones, 1997, Curr. Opin. Struct. Biol. 7:377-87; Sippl
et al., 1996, Structure 4:15-19), "profile analysis" (Bowie et al.,
1991, Science, 253:164-70; Gribskov et al., 1990, Methods Enzymol.
183:146-59; Gribskov et al., 1987, Proc. Nat. Acad. Sci. U.S.A.
84:4355-58), and "evolutionary linkage" (See Holm et al., supra,
and Brenner et al., supra).
[0127] Preferred IFN-L polypeptide variants include glycosylation
variants wherein the number and/or type of glycosylation sites have
been altered compared to the amino acid sequence set forth in
either SEQ ID NO: 2 or SEQ ID NO: 5. In one embodiment, IFN-L
polypeptide variants comprise a greater or a lesser number of
N-linked glycosylation sites than the amino acid sequence set forth
in either SEQ ID NO: 2 or SEQ ID NO: 5. An N-linked glycosylation
site is characterized by the sequence: Asn-X-Ser or Asn-X-Thr,
wherein the amino acid residue designated as X may be any amino
acid residue except proline. The substitution of amino acid
residues to create this sequence provides a potential new site for
the addition of an N-linked carbohydrate chain. Alternatively,
substitutions that eliminate this sequence will remove an existing
N-linked carbohydrate chain. Also provided is a rearrangement of
N-linked carbohydrate chains wherein one or more N-linked
glycosylation sites (typically those that are naturally occurring)
are eliminated and one or more new N-linked sites are created.
Additional preferred IFN-L variants include cysteine variants,
wherein one or more cysteine residues are deleted or substituted
with another amino acid (e.g., serine) as compared to the amino
acid sequence set forth in either SEQ ID NO: 2 or SEQ ID NO: 5.
Cysteine variants are useful when IFN-L polypeptides must be
refolded into a biologically active conformation such as after the
isolation of insoluble inclusion bodies. Cysteine variants
generally have fewer cysteine residues than the native protein, and
typically have an even number to minimize interactions resulting
from unpaired cysteines.
[0128] In other embodiments, related nucleic acid molecules
comprise or consist of a nucleotide sequence encoding a polypeptide
as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least
one amino acid insertion and wherein the polypeptide has an
activity of the polypeptide set forth in either SEQ ID NO: 2 or SEQ
ID NO: 5, or a nucleotide sequence encoding a polypeptide as set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least one
amino acid deletion and wherein the polypeptide has an activity of
the polypeptide set forth in either SEQ ID NO: 2 or SEQ ID NO: 5.
Related nucleic acid molecules also comprise or consist of a
nucleotide sequence encoding a polypeptide as set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5 wherein the polypeptide has a
carboxyl- and/or amino-terminal truncation and further wherein the
polypeptide has an activity of the polypeptide set forth in either
SEQ ID NO: 2 or SEQ ID NO: 5. Related nucleic acid molecules also
comprise or consist of a nucleotide sequence encoding a polypeptide
as set forth in either SEQ ID NO: 2 or SEQ ID NO: 5 with at least
one modification selected from the group consisting of amino acid
substitutions, amino acid insertions, amino acid deletions,
carboxyl-terminal truncations, and amino-terminal truncations and
wherein the polypeptide has an activity of the polypeptide set
forth in either SEQ ID NO: 2 or SEQ ID NO: 5.
[0129] In addition, the polypeptide comprising the amino acid
sequence of either SEQ ID NO: 2 or SEQ ID NO: 5, or other IFN-L
polypeptide, may be fused to a homologous polypeptide to form a
homodimer or to a heterologous polypeptide to form a heterodimer.
Heterologous peptides and polypeptides include, but are not limited
to: an epitope to allow for the detection and/or isolation of an
IFN-L fusion polypeptide; a transmembrane receptor protein or a
portion thereof, such as an extracellular domain or a transmembrane
and intracellular domain; a ligand or a portion thereof which binds
to a transmembrane receptor protein; an enzyme or portion thereof
which is catalytically active; a polypeptide or peptide which
promotes oligomerization, such as a leucine zipper domain; a
polypeptide or peptide which increases stability, such as an
immunoglobulin constant region; and a polypeptide which has a
therapeutic activity different from the polypeptide comprising the
amino acid sequence as set forth in either SEQ ID NO: 2 or SEQ ID
NO: 5, or other IFN-L polypeptide.
[0130] Fusions can be made either at the amino-terminus or at the
carboxyl-terminus of the polypeptide comprising the amino acid
sequence set forth in either SEQ ID NO: 2 or SEQ ID NO: 5, or other
IFN-L polypeptide. Fusions may be direct with no linker or adapter
molecule or may be through a linker or adapter molecule. A linker
or adapter molecule may be one or more amino acid residues,
typically from about 20 to about 50 amino acid residues. A linker
or adapter molecule may also be designed with a cleavage site for a
DNA restriction endonuclease or for a protease to allow for the
separation of the fused moieties. It will be appreciated that once
constructed, the fusion polypeptides can be derivatized according
to the methods described herein.
[0131] In a further embodiment of the invention, the polypeptide
comprising the amino acid sequence of either SEQ ID NO: 2 or SEQ ID
NO: 5, or other IFN-L polypeptide, is fused to one or more domains
of an Fc region of human IgG. Antibodies comprise two functionally
independent parts, a variable domain known as "Fab," that binds an
antigen, and a constant domain known as "Fc," that is involved in
effector functions such as complement activation and attack by
phagocytic cells. An Fc has a long serum half-life, whereas an Fab
is short-lived. Capon et al., 1989, Nature 337:525-31. When
constructed together with a therapeutic protein, an Fc domain can
provide longer half-life or incorporate such functions as Fc
receptor binding, protein A binding, complement fixation, and
perhaps even placental transfer. Id. Table II summarizes the use of
certain Fc fusions known in the art.
2TABLE II Fc Fusion with Therapeutic Proteins Form of Fc Fusion
partner Therapeutic implications Reference IgG1 N-terminus of
Hodgkin's disease; U.S. Pat. No. CD30-L anaplastic lymphoma; T-
5,480,981 cell leukemia Murine Fc.gamma.2a IL-10 anti-inflammatory;
Zheng et al., 1995, J transplant rejection Immunol. 154:5590-600
IgG1 TNF receptor septic shock Fisher et al., 1996, N. Engl; J.
Med. 334:1697- 1702; Van Zee et al., 1996, J. Immunol. 156:2221-30
IgG, IgA, IgM, TNF receptor inflammation, U.S. Pat. No. or IgE
autoimmune disorders 5,808,029 (excluding the first domain) IgG1
CD4 receptor AIDS Capon et al., 1989, Nature 337: 525-31 IgG1,
N-terminus anti-cancer, antiviral Harvill et al., 1995, IgG3 of
IL-2 Immunotech. 1:95-105 IgG1 C-terminus of osteoarthritis; WO
97/23614 OPG bone density IgG1 N-terminus of anti-obesity PCT/US
97/23183, filed leptin December 11, 1997 Human Ig C.gamma.1 CTLA-4
autoimmune disorders Linsley, 1991, J. Exp. Med., 174:561-69
[0132] In one example, a human IgG hinge, CH2, and CH3 region may
be fused at either the amino-terminus or carboxyl-terminus of the
IFN-L polypeptides using methods known to the skilled artisan. In
another example, a human IgG hinge, CH2, and CH3 region may be
fused at either the amino-terminus or carboxyl-terminus of an IFN-L
polypeptide fragment (e.g., the predicted extracellular portion of
IFN-L polypeptide).
[0133] The resulting IFN-L fusion polypeptide may be purified by
use of a Protein A affinity column. Peptides and proteins fused to
an Fc region have been found to exhibit a substantially greater
half-life in vivo than the unfused counterpart. Also, a fusion to
an Fc region allows for dimerization/multimerization of the fusion
polypeptide. The Fc region may be a naturally occurring Fc region,
or may be altered to improve certain qualities, such as therapeutic
qualities, circulation time, or reduced aggregation.
[0134] Identity and similarity of related nucleic acid molecules
and polypeptides are readily calculated by known methods. Such
methods include, but are not limited to those described in
Computational Molecular Biology (A. M. Lesk, ed., Oxford University
Press 1988); Biocomputing. Informatics and Genome Projects (D. W.
Smith, ed., Academic Press 1993); Computer Analysis of Sequence
Data (Part 1, A. M. Griffin and H. G. Griffin, eds., Humana Press
1994); G. von Heinle, Sequence Analysis in Molecular Biology
(Academic Press 1987); Sequence Analysis Primer (M. Gribskov and J.
Devereux, eds., M. Stockton Press 1991); and Carillo et al., 1988,
SIAM J. Applied Math., 48:1073.
[0135] Preferred methods to determine identity and/or similarity
are designed to give the largest match between the sequences
tested. Methods to determine identity and similarity are described
in publicly available computer programs. Preferred computer program
methods to determine identity and similarity between two sequences
include, but are not limited to, the GCG program package, including
GAP (Devereux et al., 1984, Nucleic Acids Res. 12:387; Genetics
Computer Group, University of Wisconsin, Madison, Wis.), BLASTP,
BLASTN, and FASTA (Altschul et al., 1990, J. Mol. Biol.
215:403-10). The BLASTX program is publicly available from the
National Center for Biotechnology Information (NCBI) and other
sources (Altschul et al, BLAST Manual (NCB NLM NIH, Bethesda, Md.);
Altschul et al., 1990, supra). The well-known Smith Waterman
algorithm may also be used to determine identity.
[0136] Certain alignment schemes for aligning two amino acid
sequences may result in the matching of only a short region of the
two sequences, and this small aligned region may have very high
sequence identity even though there is no significant relationship
between the two full-length sequences. Accordingly, in a preferred
embodiment, the selected alignment method (GAP program) will result
in an alignment that spans at least 50 contiguous amino acids of
the claimed is polypeptide.
[0137] For example, using the computer algorithm GAP (Genetics
Computer Group, University of Wisconsin, Madison, Wis.), two
polypeptides for which the percent sequence identity is to be
determined are aligned for optimal matching of their respective
amino acids (the "matched span," as determined by the algorithm). A
gap opening penalty (which is calculated as 3X the average
diagonal; the "average diagonal" is the average of the diagonal of
the comparison matrix being used; the "diagonal" is the score or
number assigned to each perfect amino acid match by the particular
comparison matrix) and a gap extension penalty (which is usually
0.1X the gap opening penalty), as well as a comparison matrix such
as PAM 250 or BLOSUM 62 are used in conjunction with the algorithm.
A standard comparison matrix is also used by the algorithm (see
Dayhoff et al., 5 Atlas of Protein Sequence and Structure (Supp. 3
1978)(PAM250 comparison matrix); Henikoff et al., 1992, Proc. Natl.
Acad. Sci USA 89:10915-19 (BLOSUM 62 comparison matrix)).
[0138] Preferred parameters for polypeptide sequence comparison
include the following:
[0139] Algorithm: Needleman and Wunsch, 1970, J. Mol. Biol.
48:443-53;
[0140] Comparison matrix: BLOSUM 62 (Henikoffet al., supra);
[0141] Gap Penalty: 12
[0142] Gap Length Penalty: 4
[0143] Threshold of Similarity: 0
[0144] The GAP program is useful with the above parameters. The
aforementioned parameters are the default parameters for
polypeptide comparisons (along with no penalty for end gaps) using
the GAP algorithm.
[0145] Preferred parameters for nucleic acid molecule sequence
comparison include the following:
[0146] Algorithm: Needleman and Wunsch, supra;
[0147] Comparison matrix: matches=+10, mismatch=0
[0148] Gap Penalty: 50
[0149] Gap Length Penalty: 3
[0150] The GAP program is also useful with the above parameters.
The aforementioned parameters are the default parameters for
nucleic acid molecule comparisons.
[0151] Other exemplary algorithms, gap opening penalties, gap
extension penalties, comparison matrices, and thresholds of
similarity may be used, including those set forth in the Program
Manual, Wisconsin Package, Version 9, September, 1997. The
particular choices to be made will be apparent to those of skill in
the art and will depend on the specific comparison to be made, such
as DNA-to-DNA, protein-to-protein, protein-to-DNA; and
additionally, whether the comparison is between given pairs of
sequences (in which case GAP or BestFit are generally preferred) or
between one sequence and a large database of sequences (in which
case FASTA or BLASTA are preferred).
[0152] Nucleic Acid Molecules
[0153] The nucleic acid molecules encoding a polypeptide comprising
the amino acid sequence of an IFN-L polypeptide can readily be
obtained in a variety of ways including, without limitation,
chemical synthesis, cDNA or genomic library screening, expression
library screening, and/or PCR amplification of cDNA.
[0154] Recombinant DNA methods used herein are generally those set
forth in Sambrook et al., Molecular Cloning: A Laboratory Manual
(Cold Spring Harbor Laboratory Press, 1989) and/or Current
Protocols in Molecular Biology (Ausubel et al., eds., Green
Publishers Inc. and Wiley and Sons 1994). The invention provides
for nucleic acid molecules as described herein and methods for
obtaining such molecules.
[0155] Where a gene encoding the amino acid sequence of an IFN-L
polypeptide has been identified from one species, all or a portion
of that gene may be used as a probe to identify orthologs or
related genes from the same species. The probes or primers may be
used to screen cDNA libraries from various tissue sources believed
to express the IFN-L polypeptide. In addition, part or all of a
nucleic acid molecule having the sequence as set forth in either
SEQ ID NO: 1 or SEQ ID NO: 4 may be used to screen a genomic
library to identify and isolate a gene encoding the amino acid
sequence of an IFN-L polypeptide. Typically, conditions of moderate
or high stringency will be employed for screening to minimize the
number of false positives obtained from the screening.
[0156] Nucleic acid molecules encoding the amino acid sequence of
IFN-L polypeptides may also be identified by expression cloning
which employs the detection of positive clones based upon a
property of the expressed protein. Typically, nucleic acid
libraries are screened by the binding an antibody or other binding
partner (e.g., receptor or ligand) to cloned proteins that are
expressed and displayed on a host cell surface. The antibody or
binding partner is modified with a detectable label to identify
those cells expressing the desired clone.
[0157] Recombinant expression techniques conducted in accordance
with the descriptions set forth below may be followed to produce
these polynucleotides and to express the encoded polypeptides. For
example, by inserting a nucleic acid sequence that encodes the
amino acid sequence of an IFN-L polypeptide into an appropriate
vector, one skilled in the art can readily produce large quantities
of the desired nucleotide sequence. The sequences can then be used
to generate detection probes or amplification primers.
Alternatively, a polynucleotide encoding the amino acid sequence of
an IFN-L polypeptide can be inserted into an expression vector. By
introducing the expression vector into an appropriate host, the
encoded IFN-L polypeptide may be produced in large amounts.
[0158] Another method for obtaining a suitable nucleic acid
sequence is the polymerase chain reaction (PCR). In this method,
cDNA is prepared from poly(A)+RNA or total RNA using the enzyme
reverse transcriptase. Two primers, typically complementary to two
separate regions of cDNA encoding the amino acid sequence of an
IFN-L polypeptide, are then added to the cDNA along with a
polymerase such as Taq polymerase, and the polymerase amplifies the
cDNA region between the two primers.
[0159] Another means of preparing a nucleic acid molecule encoding
the amino acid sequence of an IFN-L polypeptide is chemical
synthesis using methods well known to the skilled artisan such as
those described by Engels et al., 1989, Angew. Chem. Intl. Ed.
28:716-34. These methods include, inter alia, the phosphotriester,
phosphoramidite, and H-phosphonate methods for nucleic acid
synthesis. A preferred method for such chemical synthesis is
polymer-supported synthesis using standard phosphoramidite
chemistry. Typically, the DNA encoding the amino acid sequence of
an IFN-L polypeptide will be several hundred nucleotides in length.
Nucleic acids larger than about 100 nucleotides can be synthesized
as several fragments using these methods. The fragments can then be
ligated together to form the full-length nucleotide sequence of an
IFN-L gene. Usually, the DNA fragment encoding the amino-terminus
of the polypeptide will have an ATG, which encodes a methionine
residue. This methionine may or may not be present on the mature
form of the IFN-L polypeptide, depending on whether the polypeptide
produced in the host cell is designed to be secreted from that
cell. Other methods known to the skilled artisan may be used as
well.
[0160] In certain embodiments, nucleic acid variants contain codons
which have been altered for optimal expression of an IFN-L
polypeptide in a given host cell. Particular codon alterations will
depend upon the IFN-L polypeptide and host cell selected for
expression. Such "codon optimization" can be carried out by a
variety of methods, for example, by selecting codons which are
preferred for use in highly expressed genes in a given host cell.
Computer algorithms which incorporate codon frequency tables such
as "Eco_high.Cod" for codon preference of highly expressed
bacterial genes may be used and are provided by the University of
Wisconsin Package Version 9.0 (Genetics Computer Group, Madison,
Wis.). Other useful codon frequency tables include
"Celegans_high.cod," "Celegans_low.cod," "Drosophila_high.cod,"
"Human_high.cod," "Maize_high.cod," and "Yeast_high.cod."
[0161] In some cases, it may be desirable to prepare nucleic acid
molecules encoding IFN-L polypeptide variants. Nucleic acid
molecules encoding variants may be produced using site directed
mutagenesis, PCR amplification, or other appropriate methods, where
the primer(s) have the desired point mutations (see Sambrook et
al., supra, and Ausubel et al., supra, for descriptions of
mutagenesis techniques). Chemical synthesis using methods described
by Engels et al., supra, may also be used to prepare such variants.
Other methods known to the skilled artisan may be used as well.
[0162] Vectors and Host Cells
[0163] A nucleic acid molecule encoding the amino acid sequence of
an IFN-L polypeptide is inserted into an appropriate expression
vector using standard ligation techniques. The vector is typically
selected to be functional in the particular host cell employed
(i.e., the vector is compatible with the host cell machinery such
that amplification of the gene and/or expression of the gene can
occur). A nucleic acid molecule encoding the amino acid sequence of
an IFN-L polypeptide may be amplified/expressed in prokaryotic,
yeast, insect (baculovirus systems) and/or eukaryotic host cells.
Selection of the host cell will depend in part on whether an IFN-L
polypeptide is to be post-translationally modified (e.g.,
glycosylated and/or phosphorylated). If so, yeast, insect, or
mammalian host cells are preferable. For a review of expression
vectors, see Meth. Enz., vol. 185 (D. V. Goeddel, ed., Academic
Press 1990).
[0164] Typically, expression vectors used in any of the host cells
will contain sequences for plasmid maintenance and for cloning and
expression of exogenous nucleotide sequences. Such sequences,
collectively referred to as "flanking sequences" in certain
embodiments will typically include one or more of the following
nucleotide sequences: a promoter, one or more enhancer sequences,
an origin of replication, a transcriptional termination sequence, a
complete intron sequence containing a donor and acceptor splice
site, a sequence encoding a leader sequence for polypeptide
secretion, a ribosome binding site, a polyadenylation sequence, a
polylinker region for inserting the nucleic acid encoding the
polypeptide to be expressed, and a selectable marker element. Each
of these sequences is discussed below.
[0165] Optionally, the vector may contain a "tag"-encoding
sequence, i.e., an oligonucleotide molecule located at the 5' or 3'
end of the IFN-L polypeptide coding sequence; the oligonucleotide
sequence encodes polyHis (such as hexaHis), or another "tag" such
as FLAG, HA (hemaglutinin influenza virus), or myc for which
commercially available antibodies exist. This tag is typically
fused to the polypeptide upon expression of the polypeptide, and
can serve as a means for affinity purification of the IFN-L
polypeptide from the host cell. Affinity purification can be
accomplished, for example, by column chromatography using
antibodies against the tag as an affinity matrix. Optionally, the
tag can subsequently be removed from the purified IFN-L polypeptide
by various means such as using certain peptidases for cleavage.
[0166] Flanking sequences may be homologous (i.e., from the same
species and/or strain as the host cell), heterologous (i.e., from a
species other than the host cell species or strain), hybrid (i.e.,
a combination of flanking sequences from more than one source), or
synthetic, or the flanking sequences may be native sequences which
normally function to regulate IFN-L polypeptide expression. As
such, the source of a flanking sequence may be any prokaryotic or
eukaryotic organism, any vertebrate or invertebrate organism, or
any plant, provided that the flanking sequence is functional in,
and can be activated by, the host cell machinery.
[0167] Flanking sequences useful in the vectors of this invention
may be obtained by any of several methods well known in the art.
Typically, flanking sequences useful herein--other than the IFN-L
gene flanking sequences--will have been previously identified by
mapping and/or by restriction endonuclease digestion and can thus
be isolated from the proper tissue source using the appropriate
restriction endonucleases. In some cases, the full nucleotide
sequence of a flanking sequence may be known. Here, the flanking
sequence may be synthesized using the methods described herein for
nucleic acid synthesis or cloning.
[0168] Where all or only a portion of the flanking sequence is
known, it may be obtained using PCR and/or by screening a genomic
library with a suitable oligonucleotide and/or flanking sequence
fragment from the same or another species. Where the flanking
sequence is not known, a fragment of DNA containing a flanking
sequence may be isolated from a larger piece of DNA that may
contain, for example, a coding sequence or even another gene or
genes. Isolation may be accomplished by restriction endonuclease
digestion to produce the proper DNA fragment followed by isolation
using agarose gel purification, Qiagen.RTM. column chromatography
(Chatsworth, Calif.), or other methods known to the skilled
artisan. The selection of suitable enzymes to accomplish this
purpose will be readily apparent to one of ordinary skill in the
art.
[0169] An origin of replication is typically a part of those
prokaryotic expression vectors purchased commercially, and the
origin aids in the amplification of the vector in a host cell.
Amplification of the vector to a certain copy number can, in some
cases, be important for the optimal expression of an IFN-L
polypeptide. If the vector of choice does not contain an origin of
replication site, one may be chemically synthesized based on a
known sequence, and ligated into the vector.
[0170] For example, the origin of replication from the plasmid
pBR322 (New England Biolabs, Beverly, Mass.) is suitable for most
gram-negative bacteria and various origins (e.g., SV40, polyoma,
adenovirus, vesicular stomatitus virus (VSV), or papillomaviruses
such as HPV or BPV) are useful for cloning vectors in mammalian
cells. Generally, the origin of replication component is not needed
for mammalian expression vectors (for example, the SV40 origin is
often used only because it contains the early promoter).
[0171] A transcription termination sequence is typically located 3'
of the end of a polypeptide coding region and serves to terminate
transcription. Usually, a transcription termination sequence in
prokaryotic cells is a G-C rich fragment followed by a poly-T
sequence. While the sequence is easily cloned from a library or
even purchased commercially as part of a vector, it can also be
readily synthesized using methods for nucleic acid synthesis such
as those described herein.
[0172] A selectable marker gene element encodes a protein necessary
for the survival and growth of a host cell grown in a selective
culture medium. Typical selection marker genes encode proteins that
(a) confer resistance to antibiotics or other toxins, e.g.,
ampicillin, tetracycline, or kanamycin for prokaryotic host cells;
(b) complement auxotrophic deficiencies of the cell; or (c) supply
critical nutrients not available from complex media. Preferred
selectable markers are the kanamycin resistance gene, the
ampicillin resistance gene, and the tetracycline resistance gene. A
neomycin resistance gene may also be used for selection in
prokaryotic and eukaryotic host cells.
[0173] Other selection genes may be used to amplify the gene that
will be expressed. Amplification is the process wherein genes that
are in greater demand for the production of a protein critical for
growth are reiterated in tandem within the chromosomes of
successive generations of recombinant cells. Examples of suitable
selectable markers for mammalian cells include dihydrofolate
reductase (DHFR) and thymidine kinase. The mammalian cell
transformants are placed under selection pressure wherein only the
transformants are uniquely adapted to survive by virtue of the
selection gene present in the vector. Selection pressure is imposed
by culturing the transformed cells under conditions in which the
concentration of selection agent in the medium is successively
changed, thereby leading to the amplification of both the selection
gene and the DNA that encodes an IFN-L polypeptide. As a result,
increased quantities of IFN-L polypeptide are synthesized from the
amplified DNA.
[0174] A ribosome binding site is usually necessary for translation
initiation of mRNA and is characterized by a Shine-Dalgamo sequence
(prokaryotes) or a Kozak sequence (eukaryotes). The element is
typically located 3' to the promoter and 5' to the coding sequence
of an IFN-L polypeptide to be expressed. The Shine-Dalgarno
sequence is varied but is typically a polypurine (i.e., having a
high A-G content). Many Shine-Dalgarno sequences have been
identified, each of which can be readily synthesized using methods
set forth herein and used in a prokaryotic vector.
[0175] A leader, or signal, sequence may be used to direct an IFN-L
polypeptide out of the host cell. Typically, a nucleotide sequence
encoding the signal sequence is positioned in the coding region of
an IFN-L nucleic acid molecule, or directly at the 5' end of an
IFN-L polypeptide coding region. Many signal sequences have been
identified, and any of those that are functional in the selected
host cell may be used in conjunction with an IFN-L nucleic acid
molecule. Therefore, a signal sequence may be homologous (naturally
occurring) or heterologous to the IFN-L nucleic acid molecule.
Additionally, a signal sequence may be chemically synthesized using
methods described herein. In most cases, the secretion of an IFN-L
polypeptide from the host cell via the presence of a signal peptide
will result in the removal of the signal peptide from the secreted
IFN-L polypeptide. The signal sequence may be a component of the
vector, or it may be a part of an IFN-L nucleic acid molecule that
is inserted into the vector.
[0176] Included within the scope of this invention is the use of
either a nucleotide sequence encoding a native IFN-L polypeptide
signal sequence joined to an IFN-L polypeptide coding region or a
nucleotide sequence encoding a heterologous signal sequence joined
to an IFN-L polypeptide coding region. The heterologous signal
sequence selected should be one that is recognized and processed,
i.e., cleaved by a signal peptidase, by the host cell. For
prokaryotic host cells that do not recognize and process the native
IFN-L polypeptide signal sequence, the signal sequence is
substituted by a prokaryotic signal sequence selected, for example,
from the group of the alkaline phosphatase, penicillinase, or
heat-stable enterotoxin II leaders. For yeast secretion, the native
IFN-L polypeptide signal sequence may be substituted by the yeast
invertase, alpha factor, or acid phosphatase leaders. In mammalian
cell expression the native signal sequence is satisfactory,
although other mammalian signal sequences may be suitable.
[0177] In some cases, such as where glycosylation is desired in a
eukaryotic host cell expression system, one may manipulate the
various presequences to improve glycosylation or yield. For
example, one may alter the peptidase cleavage site of a particular
signal peptide, or add pro-sequences, which also may affect
glycosylation. The final protein product may have, in the -1
position (relative to the first amino acid of the mature protein)
one or more additional amino acids incident to expression, which
may not have been totally removed. For example, the final protein
product may have one or two amino acid residues found in the
peptidase cleavage site, attached to the amino-terminus.
Alternatively, use of some enzyme cleavage sites may result in a
slightly truncated form of the desired IFN-L polypeptide, if the
enzyme cuts at such area within the mature polypeptide.
[0178] In many cases, transcription of a nucleic acid molecule is
increased by the presence of one or more introns in the vector;
this is particularly true where a polypeptide is produced in
eukaryotic host cells, especially mammalian host cells. The introns
used may be naturally occurring within the IFN-L gene especially
where the gene used is a full-length genomic sequence or a fragment
thereof Where the intron is not naturally occurring within the gene
(as for most cDNAs), the intron may be obtained from another
source. The position of the intron with respect to flanking
sequences and the IFN-L gene is generally important, as the intron
must be transcribed to be effective. Thus, when an IFN-L cDNA
molecule is being transcribed, the preferred position for the
intron is 3' to the transcription start site and 5' to the poly-A
transcription termination sequence. Preferably, the intron or
introns will be located on one side or the other (i.e., 5' or 3')
of the cDNA such that it does not interrupt the coding sequence.
Any intron from any source, including viral, prokaryotic and
eukaryotic (plant or animal) organisms, may be used to practice
this invention, provided that it is compatible with the host cell
into which it is inserted. Also included herein are synthetic
introns. Optionally, more than one intron may be used in the
vector.
[0179] The expression and cloning vectors of the present invention
will typically contain a promoter that is recognized by the host
organism and operably linked to the molecule encoding the IFN-L
polypeptide. Promoters are untranscribed sequences located upstream
(i.e., 5') to the start codon of a structural gene (generally
within about 100 to 1000 bp) that control the transcription of the
structural gene. Promoters are conventionally grouped into one of
two classes: inducible promoters and constitutive promoters.
Inducible promoters initiate increased levels of transcription from
DNA under their control in response to some change in culture
conditions, such as the presence or absence of a nutrient or a
change in temperature. Constitutive promoters, on the other hand,
initiate continual gene product production; that is, there is
little or no control over gene expression. A large number of
promoters, recognized by a variety of potential host cells, are
well known. A suitable promoter is operably linked to the DNA
encoding IFN-L polypeptide by removing the promoter from the source
DNA by restriction enzyme digestion and inserting the desired
promoter sequence into the vector. The native IFN-L promoter
sequence may be used to direct amplification and/or expression of
an IFN-L nucleic acid molecule. A heterologous promoter is
preferred, however, if it permits greater transcription and higher
yields of the expressed protein as compared to the native promoter,
and if it is compatible with the host cell system that has been
selected for use.
[0180] Promoters suitable for use with prokaryotic hosts include
the beta-lactamase and lactose promoter systems; alkaline
phosphatase; a tryptophan (trp) promoter system; and hybrid
promoters such as the tac promoter. Other known bacterial promoters
are also suitable. Their sequences have been published, thereby
enabling one skilled in the art to ligate them to the desired DNA
sequence, using linkers or adapters as needed to supply any useful
restriction sites.
[0181] Suitable promoters for use with yeast hosts are also well
known in the art. Yeast enhancers are advantageously used with
yeast promoters. Suitable promoters for use with mammalian host
cells are well known and include, but are not limited to, those
obtained from the genomes of viruses such as polyoma virus, fowlpox
virus, adenovirus (such as Adenovirus 2), bovine papilloma virus,
avian sarcoma virus, cytomegalovirus, retroviruses, hepatitis-B
virus and most preferably Simian Virus 40 (SV40). Other suitable
mammalian promoters include heterologous mammalian promoters, for
example, heat-shock promoters and the actin promoter.
[0182] Additional promoters which may be of interest in controlling
IFN-L gene expression include, but are not limited to: the SV40
early promoter region (Bemoist and Chambon, 1981, Nature
290:304-10); the CMV promoter; the promoter contained in the 3'
long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980,
Cell 22:787-97); the herpes thymidine kinase promoter (Wagner et
al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1444-45); the
regulatory sequences of the metallothionine gene (Brinster et al.,
1982, Nature 296:39-42); prokaryotic expression vectors such as the
beta-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Natl.
Acad. Sci. U.S.A., 75:3727-31); or the tac promoter (DeBoer et al.,
1983, Proc. Natl. Acad. Sci. U.S.A., 80:21-25). Also of interest
are the following animal transcriptional control regions, which
exhibit tissue specificity and have been utilized in transgenic
animals: the elastase I gene control region which is active in
pancreatic acinar cells (Swift et al., 1984, Cell 38:639-46; Ornitz
et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50:399-409
(1986); MacDonald, 1987, Hepatology 7:425-515); the insulin gene
control region which is active in pancreatic beta cells (Hanahan,
1985, Nature 315:115-22); the immunoglobulin gene control region
which is active in lymphoid cells (Grosschedl et al., 1984, Cell
38:647-58; Adames et al., 1985, Nature 318:533-38; Alexander et
al., 1987, Mol. Cell. Biol., 7:1436-44); the mouse mammary tumor
virus control region which is active in testicular, breast,
lymphoid and mast cells (Leder et al., 1986, Cell 45:485-95); the
albumin gene control region which is active in liver (Pinkert et
al., 1987, Genes and Devel. 1:268-76); the alpha-feto-protein gene
control region which is active in liver (Krumlauf et al., 1985,
Mol. Cell. Biol., 5:1639-48; Hammer et al., 1987, Science
235:53-58); the alpha 1-antitrypsin gene control region which is
active in the liver (Kelsey et al., 1987, Genes and Devel.
1:161-71); the beta-globin gene control region which is active in
myeloid cells (Mogram et al., 1985, Nature 315:338-40; Kollias et
al., 1986, Cell 46:89-94); the myelin basic protein gene control
region which is active in oligodendrocyte cells in the brain
(Readhead et al., 1987, Cell 48:703-12); the myosin light chain-2
gene control region which is active in skeletal muscle (Sani, 1985,
Nature 314:283-86); and the gonadotropic releasing hormone gene
control region which is active in the hypothalamus (Mason et al.,
1986, Science 234:1372-78).
[0183] An enhancer sequence may be inserted into the vector to
increase the transcription of a DNA encoding an IFN-L polypeptide
of the present invention by higher eukaryotes. Enhancers are
cis-acting elements of DNA, usually about 10-300 bp in length, that
act on the promoter to increase transcription. Enhancers are
relatively orientation and position independent. They have been
found 5' and 3' to the transcription unit. Several enhancer
sequences available from mammalian genes are known (e.g., globin,
elastase, albumin, alpha-feto-protein and insulin). Typically,
however, an enhancer from a virus will be used. The SV40 enhancer,
the cytomegalovirus early promoter enhancer, the polyoma enhancer,
and adenovirus enhancers are exemplary enhancing elements for the
activation of eukaryotic promoters. While an enhancer may be
spliced into the vector at a position 5' or 3' to an IFN-L nucleic
acid molecule, it is typically located at a site 5' from the
promoter.
[0184] Expression vectors of the invention may be constructed from
a starting vector such as a commercially available vector. Such
vectors may or may not contain all of the desired flanking
sequences. Where one or more of the flanking sequences described
herein are not already present in the vector, they may be
individually obtained and ligated into the vector. Methods used for
obtaining each of the flanking sequences are well known to one
skilled in the art.
[0185] Preferred vectors for practicing this invention are those
which are compatible with bacterial, insect, and mammalian host
cells. Such vectors include, inter alia, pCRII, pCR3, and pcDNA3.1
(Invitrogen, San Diego, Calif.), pBSII (Stratagene, La Jolla,
Calif.), pET15 (Novagen, Madison, Wis.), pGEX (Pharmacia Biotech,
Piscataway, N.J.), pEGFP-N2 (Clontech, Palo Alto, Calif.), pETL
(BlueBacII, Invitrogen), pDSR-alpha (PCT Pub. No. WO 90/14363) and
pFastBacDual (Gibco-BRL, Grand Island, N.Y.).
[0186] Additional suitable vectors include, but are not limited to,
cosmids, plasmids, or modified viruses, but it will be appreciated
that the vector system must be compatible with the selected host
cell. Such vectors include, but are not limited to plasmids such as
Bluescript.RTM. plasmid derivatives (a high copy number ColE1-based
phagemid, Stratagene Cloning Systems, La Jolla Calif.), PCR cloning
plasmids designed for cloning Taq-amplified PCR products (e.g.,
TOPO.TM. TA Cloning.RTM. Kit, PCR2.1.RTM. plasmid derivatives,
Invitrogen, Carlsbad, Calif.), and mammalian, yeast or virus
vectors such as a baculovirus expression system (pBacPAK plasmid
derivatives, Clontech, Palo Alto, Calif.).
[0187] After the vector has been constructed and a nucleic acid
molecule encoding an IFN-L polypeptide has been inserted into the
proper site of the vector, the completed vector may be inserted
into a suitable host cell for amplification and/or polypeptide
expression. The transformation of an expression vector for an IFN-L
polypeptide into a selected host cell may be accomplished by well
known methods including methods such as transfection, infection,
calcium chloride, electroporation, microinjection, lipofection,
DEAE-dextran method, or other known techniques. The method selected
will in part be a function of the type of host cell to be used.
These methods and other suitable methods are well known to the
skilled artisan, and are set forth, for example, in Sambrook et
al., supra.
[0188] Host cells may be prokaryotic host cells (such as E. coli)
or eukaryotic host cells (such as a yeast, insect, or vertebrate
cell). The host cell, when cultured under appropriate conditions,
synthesizes an IFN-L polypeptide which can subsequently be
collected from the culture medium (if the host cell secretes it
into the medium) or directly from the host cell producing it (if it
is not secreted). The selection of an appropriate host cell will
depend upon various factors, such as desired expression levels,
polypeptide modifications that are desirable or necessary for
activity (such as glycosylation or phosphorylation) and ease of
folding into a biologically active molecule.
[0189] A number of suitable host cells are known in the art and
many are available from the American Type Culture Collection
(ATCC), Manassas, Va. Examples include, but are not limited to,
mammalian cells, such as Chinese hamster ovary cells (CHO), CHO
DHFR(-) cells (Urlaub et al., 1980, Proc. Natl. Acad. Sci. U.S.A.
97:4216-20), human embryonic kidney (HEK) 293 or 293T cells, or 3T3
cells. The selection of suitable mammalian host cells and methods
for transformation, culture, amplification, screening, product
production, and purification are known in the art. Other suitable
mammalian cell lines, are the monkey COS-1 and COS-7 cell lines,
and the CV-1 cell line. Further exemplary mammalian host cells
include primate cell lines and rodent cell lines, including
transformed cell lines. Normal diploid cells, cell strains derived
from in vitro culture of primary tissue, as well as primary
explants, are also suitable. Candidate cells may be genotypically
deficient in the selection gene, or may contain a dominantly acting
selection gene. Other suitable mammalian cell lines include but are
not limited to, mouse neuroblastoma N2A cells, HeLa, mouse L-929
cells, 3T3 lines derived from Swiss, Balb-c or NIH mice, BHK or HaK
hamster cell lines. Each of these cell lines is known by and
available to those skilled in the art of protein expression.
[0190] Similarly useful as host cells suitable for the present
invention are bacterial cells. For example, the various strains of
E. coli (e.g., HB101, DH5.alpha., DH10, and MC1061) are well-known
as host cells in the field of biotechnology. Various strains of B.
subtilis, Pseudomonas spp., other Bacillus spp., Streptomyces spp.,
and the like may also be employed in this method.
[0191] Many strains of yeast cells known to those skilled in the
art are also available as host cells for the expression of the
polypeptides of the present invention. Preferred yeast cells
include, for example, Saccharomyces cerivisae and Pichia
pastoris.
[0192] Additionally, where desired, insect cell systems may be
utilized in the methods of the present invention. Such systems are
described, for example, in Kitts et al., 1993, Biotechniques,
14:810-17; Lucklow, 1993, Curr. Opin. Biotechnol. 4:564-72; and
Lucklow et al., 1993, J. Virol., 67:4566-79. Preferred insect cells
are Sf-9 and Hi5 (Invitrogen).
[0193] One may also use transgenic animals to express glycosylated
IFN-L polypeptides. For example, one may use a transgenic
milk-producing animal (a cow or goat, for example) and obtain the
present glycosylated polypeptide in the animal milk. One may also
use plants to produce IFN-L polypeptides, however, in general, the
glycosylation occurring in plants is different from that produced
in mammalian cells, and may result in a glycosylated product which
is not suitable for human therapeutic use.
[0194] Polypeptide Production
[0195] Host cells comprising an IFN-L polypeptide expression vector
may be cultured using standard media well known to the skilled
artisan. The media will usually contain all nutrients necessary for
the growth and survival of the cells. Suitable media for culturing
E. coli cells include, for example, Luria Broth (LB) and/or
Terrific Broth (TB). Suitable media for culturing eukaryotic cells
include Roswell Park Memorial Institute medium 1640 (RPMI 1640),
Minimal Essential Medium (MEM) and/or Dulbecco's Modified Eagle
Medium (DMEM), all of which may be supplemented with serum and/or
growth factors as necessary for the particular cell line being
cultured. A suitable medium for insect cultures is Grace's medium
supplemented with yeastolate, lactalbumin hydrolysate, and/or fetal
calf serum as necessary.
[0196] Typically, an antibiotic or other compound useful for
selective growth of transfected or transformed cells is added as a
supplement to the media. The compound to be used will be dictated
by the selectable marker element present on the plasmid with which
the host cell was transformed. For example, where the selectable
marker element is kanamycin resistance, the compound added to the
culture medium will be kanamycin. Other compounds for selective
growth include ampicillin, tetracycline, and neomycin.
[0197] The amount of an IFN-L polypeptide produced by a host cell
can be evaluated using standard methods known in the art. Such
methods include, without limitation, Western blot analysis,
SDS-polyacrylamide gel electrophoresis, non-denaturing gel
electrophoresis, High Performance Liquid Chromatography (HPLC)
separation, immunoprecipitation, and/or activity assays such as DNA
binding gel shift assays.
[0198] If an IFN-L polypeptide has been designed to be secreted
from the host cells, the majority of polypeptide may be found in
the cell culture medium. If however, the IFN-L polypeptide is not
secreted from the host cells, it will be present in the cytoplasm
and/or the nucleus (for eukaryotic host cells) or in the cytosol
(for gram-negative bacteria host cells).
[0199] For an IFN-L polypeptide situated in the host cell cytoplasm
and/or nucleus (for eukaryotic host cells) or in the cytosol (for
bacterial host cells), the intracellular material (including
inclusion bodies for gram-negative bacteria) can be extracted from
the host cell using any standard technique known to the skilled
artisan. For example, the host cells can be lysed to release the
contents of the periplasm/cytoplasm by French press,
homogenization, and/or sonication followed by centrifugation.
[0200] If an IFN-L polypeptide has formed inclusion bodies in the
cytosol, the inclusion bodies can often bind to the inner and/or
outer cellular membranes and thus will be found primarily in the
pellet material after centrifugation. The pellet material can then
be treated at pH extremes or with a chaotropic agent such as a
detergent, guanidine, guanidine derivatives, urea, or urea
derivatives in the presence of a reducing agent such as
dithiothreitol at alkaline pH or tris carboxyethyl phosphine at
acid pH to release, break apart, and solubilize the inclusion
bodies. The solubilized IFN-L polypeptide can then be analyzed
using gel electrophoresis, immunoprecipitation, or the like. If it
is desired to isolate the IFN-L polypeptide, isolation may be
accomplished using standard methods such as those described herein
and in Marston et al., 1990, Meth. Enz., 182:264-75.
[0201] In some cases, an IFN-L polypeptide may not be biologically
active upon isolation. Various methods for "refolding" or
converting the polypeptide to its tertiary structure and generating
disulfide linkages can be used to restore biological activity. Such
methods include exposing the solubilized polypeptide to a pH
usually above 7 and in the presence of a particular concentration
of a chaotrope. The selection of chaotrope is very similar to the
choices used for inclusion body solubilization, but usually the
chaotrope is used at a lower concentration and is not necessarily
the same as chaotropes used for the solubilization. In most cases
the refolding/oxidation solution will also contain a reducing agent
or the reducing agent plus its oxidized form in a specific ratio to
generate a particular redox potential allowing for disulfide
shuffling to occur in the formation of the protein's cysteine
bridges. Some of the commonly used redox couples include
cysteine/cystamine, glutathione (GSH)/dithiobis GSH, cupric
chloride, dithiothreitol(DTT)/dithiane DTT, and
2-2-mercaptoethanol(bME)/dithio-b(ME). In many instances, a
cosolvent may be used or may be needed to increase the efficiency
of the refolding, and the more common reagents used for this
purpose include glycerol, polyethylene glycol of various molecular
weights, arginine and the like.
[0202] If inclusion bodies are not formed to a significant degree
upon expression of an IFN-L polypeptide, then the polypeptide will
be found primarily in the supernatant after centrifugation of the
cell homogenate. The polypeptide may be further isolated from the
supernatant using methods such as those described herein.
[0203] The purification of an IFN-L polypeptide from solution can
be accomplished using a variety of techniques. If the polypeptide
has been synthesized such that it contains a tag such as
Hexahistidine (IFN-L polypeptide/hexaHis) or other small peptide
such as FLAG (Eastman Kodak Co., New Haven, Conn.) or myc
(Invitrogen, Carlsbad, Calif.) at either its carboxyl- or
amino-terminus, it may be purified in a one-step process by passing
the solution through an affinity column where the column matrix has
a high affinity for the tag.
[0204] For example, polyhistidine binds with great affinity and
specificity to nickel. Thus, an affinity column of nickel (such as
the Qiagen.RTM. nickel columns) can be used for purification of
IFN-L polypeptide/polyHis. See, e.g. Current Protocols in Molecular
Biology .sctn. 10.11.8 (Ausubel et al, eds., Green Publishers Inc.
and Wiley and Sons 1993).
[0205] Additionally, IFN-L polypeptides may be purified through the
use of a monoclonal antibody that is capable of specifically
recognizing and binding to an IFN-L polypeptide.
[0206] Other suitable procedures for purification include, without
limitation, affinity chromatography, immunoaffinity chromatography,
ion exchange chromatography, molecular sieve chromatography, HPLC,
electrophoresis (including native gel electrophoresis) followed by
gel elution, and preparative isoelectric focusing ("Isoprime"
machine/technique, Hoefer Scientific, San Francisco, Calif.). In
some cases, two or more purification techniques may be combined to
achieve increased purity.
[0207] IFN-L polypeptides may also be prepared by chemical
synthesis methods (such as solid phase peptide synthesis) using
techniques known in the art such as those set forth by Merrifield
et al., 1963, J. Am. Chem. Soc. 85:2149; Houghten et al., 1985,
Proc Natl Acad. Sci. USA 82:5132; and Stewart and Young, Solid
Phase Peptide Synthesis (Pierce Chemical Co. 1984). Such
polypeptides may be synthesized with or without a methionine on the
amino-terminus. Chemically synthesized IFN-L polypeptides may be
oxidized using methods set forth in these references to form
disulfide bridges. Chemically synthesized IFN-L polypeptides are
expected to have comparable biological activity to the
corresponding IFN-L polypeptides produced recombinantly or purified
from natural sources, and thus may be used interchangeably with a
recombinant or natural IFN-L polypeptide.
[0208] Another means of obtaining IFN-L polypeptide is via
purification from biological samples such as source tissues and/or
fluids in which the IFN-L polypeptide is naturally found. Such
purification can be conducted using methods for protein
purification as described herein. The presence of the IFN-L
polypeptide during purification may be monitored, for example,
using an antibody prepared against recombinantly produced IFN-L
polypeptide or peptide fragments thereof.
[0209] A number of additional methods for producing nucleic acids
and polypeptides are known in the art, and the methods can be used
to produce polypeptides having specificity for IFN-L polypeptide.
See, e.g. Roberts et al., 1997, Proc. Natl. Acad. Sci. U.S.A.
94:12297-303, which describes the production of fusion proteins
between an mRNA and its encoded peptide. See also, Roberts, 1999,
Curr. Opin. Chem. Biol. 3:268-73. Additionally, U.S. Pat. No.
5,824,469 describes methods for obtaining oligonucleotides capable
of carrying out a specific biological function. The procedure
involves generating a heterogeneous pool of oligonucleotides, each
having a 5' randomized sequence, a central preselected sequence,
and a 3' randomized sequence. The resulting heterogeneous pool is
introduced into a population of cells that do not exhibit the
desired biological function. Subpopulations of the cells are then
screened for those that exhibit a predetermined biological
function. From that subpopulation, oligonucleotides capable of
carrying out the desired biological function are isolated.
[0210] U.S. Pat. Nos. 5,763,192; 5,814,476; 5,723,323; and
5,817,483 describe processes for producing peptides or
polypeptides. This is done by producing stochastic genes or
fragments thereof, and then introducing these genes into host cells
which produce one or more proteins encoded by the stochastic genes.
The host cells are then screened to identify those clones producing
peptides or polypeptides having the desired activity.
[0211] Another method for producing peptides or polypeptides is
described in PCT/US98/20094 (WO99/15650) filed by Athersys, Inc.
Known as "Random Activation of Gene Expression for Gene Discovery"
(RAGE-GD), the process involves the activation of endogenous gene
expression or over-expression of a gene by in situ recombination
methods. For example, expression of an endogenous gene is activated
or increased by integrating a regulatory sequence into the target
cell which is capable of activating expression of the gene by
non-homologous or illegitimate recombination. The target DNA is
first subjected to radiation, and a genetic promoter inserted. The
promoter eventually locates a break at the front of a gene,
initiating transcription of the gene. This results in expression of
the desired peptide or polypeptide.
[0212] It will be appreciated that these methods can also be used
to create comprehensive IFN-L polypeptide expression libraries,
which can subsequently be used for high throughput phenotypic
screening in a variety of assays, such as biochemical assays,
cellular assays, and whole organism assays (e.g., plant, mouse,
etc.).
[0213] Synthesis
[0214] It will be appreciated by those skilled in the art that the
nucleic acid and polypeptide molecules described herein may be
produced by recombinant and other means.
[0215] Selective Binding Agents
[0216] The term "selective binding agent" refers to a molecule that
has specificity for one or more IFN-L polypeptides. Suitable
selective binding agents include, but are not limited to,
antibodies and derivatives thereof, polypeptides, and small
molecules. Suitable selective binding agents may be prepared using
methods known in the art. An exemplary IFN-L polypeptide selective
binding agent of the present invention is capable of binding a
certain portion of the IFN-L polypeptide thereby inhibiting the
binding of the polypeptide to an IFN-L polypeptide receptor.
[0217] Selective binding agents such as antibodies and antibody
fragments that bind IFN-L polypeptides are within the scope of the
present invention. The antibodies may be polyclonal including
monospecific polyclonal; monoclonal (MAbs); recombinant; chimeric;
humanized, such as CDR-grafted; human; single chain; and/or
bispecific; as well as fragments; variants; or derivatives thereof.
Antibody fragments include those portions of the antibody that bind
to an epitope on the IFN-L polypeptide. Examples of such fragments
include Fab and F(ab') fragments generated by enzymatic cleavage of
full-length antibodies. Other binding fragments include those
generated by recombinant DNA techniques, such as the expression of
recombinant plasmids containing nucleic acid sequences encoding
antibody variable regions.
[0218] Polyclonal antibodies directed toward an IFN-L polypeptide
generally are produced in animals (e.g., rabbits or mice) by means
of multiple subcutaneous or intraperitoneal injections of IFN-L
polypeptide and an adjuvant. It may be useful to conjugate an IFN-L
polypeptide to a carrier protein that is immunogenic in the species
to be immunized, such as keyhole limpet hemocyanin, serum, albumin,
bovine thyroglobulin, or soybean trypsin inhibitor. Also,
aggregating agents such as alum are used to enhance the immune
response. After immunization, the animals are bled and the serum is
assayed for anti-IFN-L antibody titer.
[0219] Monoclonal antibodies directed toward IFN-L polypeptides are
produced using any method that provides for the production of
antibody molecules by continuous cell lines in culture. Examples of
suitable methods for preparing monoclonal antibodies include the
hybridoma methods of Kohler et al., 1975, Nature 256:495-97 and the
human B-cell hybridoma method (Kozbor, 1984, J. Immunol. 133:3001;
Brodeur et al., Monoclonal Antibody Production Techniques and
Applications 51-63 (Marcel Dekker, Inc., 1987). Also provided by
the invention are hybridoma cell lines that produce monoclonal
antibodies reactive with IFN-L polypeptides.
[0220] Monoclonal antibodies of the invention may be modified for
use as therapeutics. One embodiment is a "chimeric" antibody in
which a portion of the heavy (H) and/or light (L) chain is
identical with or homologous to a corresponding sequence in
antibodies derived from a particular species or belonging to a
particular antibody class or subclass, while the remainder of the
chain(s) is/are identical with or homologous to a corresponding
sequence in antibodies derived from another species or belonging to
another antibody class or subclass. Also included are fragments of
such antibodies, so long as they exhibit the desired biological
activity. See U.S. Pat. No. 4,816,567; Morrison et al., 1985, Proc.
Natl. Acad. Sci. 81:6851-55.
[0221] In another embodiment, a monoclonal antibody of the
invention is a "humanized" antibody. Methods for humanizing
non-human antibodies are well known in the art. See U.S. Pat. Nos.
5,585,089 and 5,693,762. Generally, a humanized antibody has one or
more amino acid residues introduced into it from a source that is
non-human. Humanization can be performed, for example, using
methods described in the art (Jones et al., 1986, Nature
321:522-25; Riechmann et al., 1998, Nature 332:323-27; Verhoeyen et
al., 1988, Science 239:1534-36), by substituting at least a portion
of a rodent complementarity-determining region (CDR) for the
corresponding regions of a human antibody.
[0222] Also encompassed by the invention are human antibodies that
bind IFN-L polypeptides. Using transgenic animals (e.g., mice) that
are capable of producing a repertoire of human antibodies in the
absence of endogenous immunoglobulin production such antibodies are
produced by immunization with an IFN-L polypeptide antigen (i.e.,
having at least 6 contiguous amino acids), optionally conjugated to
a carrier. See, e.g., Jakobovits et al., 1993, Proc. Natl. Acad.
Sci. 90:2551-55; Jakobovits et al., 1993, Nature 362:255-58;
Bruggermann et al., 1993, Year in Immuno. 7:33. In one method, such
transgenic animals are produced by incapacitating the endogenous
loci encoding the heavy and light immunoglobulin chains therein,
and inserting loci encoding human heavy and light chain proteins
into the genome thereof. Partially modified animals, that is those
having less than the full complement of modifications, are then
cross-bred to obtain an animal having all of the desired immune
system modifications. When administered an immunogen, these
transgenic animals produce antibodies with human (rather than,
e.g., murine) amino acid sequences, including variable regions
which are immunospecific for these antigens. See PCT App. Nos.
PCT/US96/05928 and PCT/US93/06926. Additional methods are described
in U.S. Pat. No. 5,545,807, PCT application Ser. Nos. PCT/US91/245
and PCT/GB89/01207, and in European Patent Nos. 546073B1 and
546073A1. Human antibodies can also be produced by the expression
of recombinant DNA in host cells or by expression in hybridoma
cells as described herein.
[0223] In an alternative embodiment, human antibodies can also be
produced from phage-display libraries (Hoogenboom et al., 1991, J
Mol. Biol. 227:381; Marks et al., 1991, J Mol. Biol. 222:581).
These processes mimic immune selection through the display of
antibody repertoires on the surface of filamentous bacteriophage,
and subsequent selection of phage by their binding to an antigen of
choice. One such technique is described in PCT application Ser. No.
PCT/US98/17364, which describes the isolation of high affinity and
functional agonistic antibodies for MPL- and msk- receptors using
such an approach.
[0224] Chimeric, CDR grafted, and humanized antibodies are
typically produced by recombinant methods. Nucleic acids encoding
the antibodies are introduced into host cells and expressed using
materials and procedures described herein. In a preferred
embodiment, the antibodies are produced in mammalian host cells,
such as CHO cells. Monoclonal (e.g., human) antibodies may be
produced by the expression of recombinant DNA in host cells or by
expression in hybridoma cells as described herein.
[0225] The anti-IFN-L antibodies of the invention may be employed
in any known assay method, such as competitive binding assays,
direct and indirect sandwich assays, and immunoprecipitation assays
(Sola, Monoclonal Antibodies: A Manual of Techniques 147-158 (CRC
Press, Inc., 1987)) for the detection and quantitation of IFN-L
polypeptides. The antibodies will bind IFN-L polypeptides with an
affinity that is appropriate for the assay method being
employed.
[0226] For diagnostic applications, in certain embodiments,
anti-IFN-L antibodies may be labeled with a detectable moiety. The
detectable moiety can be any one that is capable of producing,
either directly or indirectly, a detectable signal. For example,
the detectable moiety may be a radioisotope, such as .sup.3H,
.sup.14C, .sup.32P, .sup.35S, .sup.125I, .sup.99Tc, .sup.111In, or
.sup.67Ga; a fluorescent or chemiluminescent compound, such as
fluorescein isothiocyanate, rhodantine, or luciferin; or an enzyme,
such as alkaline phosphatase, .beta.-galactosidase, or horseradish
peroxidase (Bayer, et al., 1990, Meth. Enz. 184:138-63).
[0227] Competitive binding assays rely on the ability of a labeled
standard (e.g., an IFN-L polypeptide, or an immunologically
reactive portion thereof) to compete with the test sample analyte
(an IFN-L polypeptide) for binding with a limited amount of
anti-IFN-L antibody. The amount of an IFN-L polypeptide in the test
sample is inversely proportional to the amount of standard that
becomes bound to the antibodies. To facilitate determining the
amount of standard that becomes bound, the antibodies typically are
insolubilized before or after the competition, so that the standard
and analyte that are bound to the antibodies may conveniently be
separated from the standard and analyte which remain unbound.
[0228] Sandwich assays typically involve the use of two antibodies,
each capable of binding to a different immunogenic portion, or
epitope, of the protein to be detected and/or quantitated. In a
sandwich assay, the test sample analyte is typically bound by a
first antibody which is immobilized on a solid support, and
thereafter a second antibody binds to the analyte, thus forming an
insoluble three-part complex. See, e.g., U.S. Pat. No. 4,376,110.
The second antibody may itself be labeled with a detectable moiety
(direct sandwich assays) or may be measured using an
anti-immunoglobulin antibody that is labeled with a detectable
moiety (indirect sandwich assays). For example, one type of
sandwich assay is an enzyme-linked immunosorbent assay (ELISA), in
which case the detectable moiety is an enzyme.
[0229] The selective binding agents, including anti-IFN-L
antibodies, are also useful for in vivo imaging. An antibody
labeled with a detectable moiety may be administered to an animal,
preferably into the bloodstream, and the presence and location of
the labeled antibody in the host assayed. The antibody may be
labeled with any moiety that is detectable in an animal, whether by
nuclear magnetic resonance, radiology, or other detection means
known in the art.
[0230] Selective binding agents of the invention, including
antibodies, may be used as therapeutics. These therapeutic agents
are generally agonists or antagonists, in that they either enhance
or reduce, respectively, at least one of the biological activities
of an IFN-L polypeptide. In one embodiment, antagonist antibodies
of the invention are antibodies or binding fragments thereof which
are capable of specifically binding to an IFN-L polypeptide and
which are capable of inhibiting or eliminating the functional
activity of an IFN-L polypeptide in vivo or in vitro. In preferred
embodiments, the selective binding agent, e.g. an antagonist
antibody, will inhibit the functional activity of an IFN-L
polypeptide by at least about 50%, and preferably by at least about
80%. In another embodiment, the selective binding agent may be an
anti-IFN-L polypeptide antibody that is capable of interacting with
an IFN-L polypeptide binding partner (a ligand or receptor) thereby
inhibiting or eliminating IFN-L polypeptide activity in vitro or in
vivo. Selective binding agents, including agonist and antagonist
anti-IFN-L polypeptide antibodies, are identified by screening
assays that are well known in the art.
[0231] The invention also relates to a kit comprising IFN-L
selective binding agents (such as antibodies) and other reagents
useful for detecting IFN-L polypeptide levels in biological
samples. Such reagents may include a detectable label, blocking
serum, positive and negative control samples, and detection
reagents.
[0232] Microarrays
[0233] It will be appreciated that DNA microarray technology can be
utilized in accordance with the present invention. DNA microarrays
are miniature, high-density arrays of nucleic acids positioned on a
solid support, such as glass. Each cell or element within the array
contains numerous copies of a single nucleic acid species that acts
as a target for hybridization with a complementary nucleic acid
sequence (e.g., mRNA). In expression profiling using DNA microarray
technology, mRNA is first extracted from a cell or tissue sample
and then converted enzymatically to fluorescently labeled cDNA.
This material is hybridized to the microarray and unbound cDNA is
removed by washing. The expression of discrete genes represented on
the array is then visualized by quantitating the amount of labeled
cDNA that is specifically bound to each target nucleic acid
molecule. In this way, the expression of thousands of genes can be
quantitated in a high throughput, parallel manner from a single
sample of biological material.
[0234] This high throughput expression profiling has a broad range
of applications with respect to the IFN-L molecules of the
invention, including, but not limited to: the identification and
validation of IFN-L disease-related genes as targets for
therapeutics; molecular toxicology of related IFN-L molecules and
inhibitors thereof; stratification of populations and generation of
surrogate markers for clinical trials; and enhancing related IFN-L
polypeptide small molecule drug discovery by aiding in the
identification of selective compounds in high throughput
screens.
[0235] Chemical Derivatives
[0236] Chemically modified derivatives of IFN-L polypeptides may be
prepared by one skilled in the art, given the disclosures described
herein. IFN-L polypeptide derivatives are modified in a manner that
is different--either in the type or location of the molecules
naturally attached to the polypeptide. Derivatives may include
molecules formed by the deletion of one or more naturally-attached
chemical groups. The polypeptide comprising the amino acid sequence
of either SEQ ID NO: 2 or SEQ ID NO: 5, or other IFN-L polypeptide,
may be modified by the covalent attachment of one or more polymers.
For example, the polymer selected is typically water-soluble so
that the protein to which it is attached does not precipitate in an
aqueous environment, such as a physiological environment. Included
within the scope of suitable polymers is a mixture of polymers.
Preferably, for therapeutic use of the end-product preparation, the
polymer will be pharmaceutically acceptable.
[0237] The polymers each may be of any molecular weight and may be
branched or unbranched. The polymers each typically have an average
molecular weight of between about 2 kDa to about 100 kDa (the term
"about" indicating that in preparations of a water-soluble polymer,
some molecules will weigh more, some less, than the stated
molecular weight). The average molecular weight of each polymer is
preferably between about 5 kDa and about 50 kDa, more preferably
between about 12 kDa and about 40 kDa and most preferably between
about 20 kDa and about 35 kDa.
[0238] Suitable water-soluble polymers or mixtures thereof include,
but are not limited to, N-linked or O-linked carbohydrates, sugars,
phosphates, polyethylene glycol (PEG) (including the forms of PEG
that have been used to derivatize proteins, including
mono-(C.sub.1-C.sub.10), alkoxy-, or aryloxy-polyethylene glycol),
monomethoxy-polyethylene glycol, dextran (such as low molecular
weight dextran of, for example, about 6 kD), cellulose, or other
carbohydrate based polymers, poly-(N-vinyl pyrrolidone)
polyethylene glycol, propylene glycol homopolymers, polypropylene
oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.g.,
glycerol), and polyvinyl alcohol. Also encompassed by the present
invention are bifunctional crosslinking molecules which may be used
to prepare covalently attached IFN-L polypeptide multimers.
[0239] In general, chemical derivatization may be performed under
any suitable condition used to react a protein with an activated
polymer molecule. Methods for preparing chemical derivatives of
polypeptides will generally comprise the steps of: (a) reacting the
polypeptide with the activated polymer molecule (such as a reactive
ester or aldehyde derivative of the polymer molecule) under
conditions whereby the polypeptide comprising the amino acid
sequence of either SEQ ID NO: 2 or SEQ ID NO: 5, or other IFN-L
polypeptide, becomes attached to one or more polymer molecules, and
(b) obtaining the reaction products. The optimal reaction
conditions will be determined based on known parameters and the
desired result. For example, the larger the ratio of polymer
molecules to protein, the greater the percentage of attached
polymer molecule. In one embodiment, the IFN-L polypeptide
derivative may have a single polymer molecule moiety at the
amino-terminus. See, e.g., U.S. Pat. No. 5,234,784.
[0240] The pegylation of a polypeptide may be specifically carried
out using any of the pegylation reactions known in the art. Such
reactions are described, for example, in the following references:
Francis et al., 1992, Focus on Growth Factors 3:4-10; European
Patent Nos. 0154316 and 0401384; and U.S. Pat. No. 4,179,337. For
example, pegylation may be carried out via an acylation reaction or
an alkylation reaction with a reactive polyethylene glycol molecule
(or an analogous reactive water-soluble polymer) as described
herein. For the acylation reactions, a selected polymer should have
a single reactive ester group. For reductive alkylation, a selected
polymer should have a single reactive aldehyde group. A reactive
aldehyde is, for example, polyethylene glycol propionaldehyde,
which is water stable, or mono C.sub.1-C.sub.10 alkoxy or aryloxy
derivatives thereof (see U.S. Pat. No. 5,252,714).
[0241] In another embodiment, IFN-L polypeptides may be chemically
coupled to biotin. The biotin/IFN-L polypeptide molecules are then
allowed to bind to avidin, resulting in tetravalent
avidin/biotin/IFN-L polypeptide molecules. IFN-L polypeptides may
also be covalently coupled to dinitrophenol (DNP) or trinitrophenol
(TNP) and the resulting conjugates precipitated with anti-DNP or
anti-TNP-IgM to form decameric conjugates with a valency of 10.
[0242] Generally, conditions that may be alleviated or modulated by
the administration of the present IFN-L polypeptide derivatives
include those described herein for IFN-L polypeptides. However, the
IFN-L polypeptide derivatives disclosed herein may have additional
activities, enhanced or reduced biological activity, or other
characteristics, such as increased or decreased half-life, as
compared to the non-derivatized molecules.
[0243] Genetically Engineered Non-Human Animals
[0244] Additionally included within the scope of the present
invention are non-human animals such as mice, rats, or other
rodents; rabbits, goats, sheep, or other farm animals, in which the
genes encoding native IFN-L polypeptide have been disrupted (i.e.,
"knocked out") such that the level of expression of IFN-L
polypeptide is significantly decreased or completely abolished.
Such animals may be prepared using techniques and methods such as
those described in U.S. Pat. No. 5,557,032.
[0245] The present invention further includes non-human animals
such as mice, rats, or other rodents; rabbits, goats, sheep, or
other farm animals, in which either the native form of an IFN-L
gene for that animal or a heterologous IFN-L gene is over-expressed
by the animal, thereby creating a "transgenic" animal. Such
transgenic animals may be prepared using well known methods such as
those described in U.S. Pat. No 5,489,743 and PCT Pub. No. WO
94/28122.
[0246] The present invention further includes non-human animals in
which the promoter for one or more of the IFN-L polypeptides of the
present invention is either activated or inactivated (e.g., by
using homologous recombination methods) to alter the level of
expression of one or more of the native IFN-L polypeptides.
[0247] These non-human animals may be used for drug candidate
screening. In such screening, the impact of a drug candidate on the
animal may be measured. For example, drug candidates may decrease
or increase the expression of the IFN-L gene. In certain
embodiments, the amount of IFN-L polypeptide that is produced may
be measured after the exposure of the animal to the drug candidate.
Additionally, in certain embodiments, one may detect the actual
impact of the drug candidate on the animal. For example,
over-expression of a particular gene may result in, or be
associated with, a disease or pathological condition. In such
cases, one may test a drug candidate's ability to decrease
expression of the gene or its ability to prevent or inhibit a
pathological condition. In other examples, the production of a
particular metabolic product such as a fragment of a polypeptide,
may result in, or be associated with, a disease or pathological
condition. In such cases, one may test a drug candidate's ability
to decrease the production of such a metabolic product or its
ability to prevent or inhibit a pathological condition.
[0248] Assaying for Other Modulators of IFN-L Polypeptide
Activity
[0249] In some situations, it may be desirable to identify
molecules that are modulators, i.e., agonists or antagonists, of
the activity of IFN-L polypeptide. Natural or synthetic molecules
that modulate IFN-L polypeptide may be identified using one or more
screening assays, such as those described herein. Such molecules
may be administered either in an ex vivo manner or in an in vivo
manner by injection, or by oral delivery, implantation device, or
the like.
[0250] "Test molecule" refers to a molecule that is under
evaluation for the ability to modulate (i.e., increase or decrease)
the activity of an IFN-L polypeptide. Most commonly, a test
molecule will interact directly with an IFN-L polypeptide. However,
it is also contemplated that a test molecule may also modulate
IFN-L polypeptide activity indirectly, such as by affecting IFN-L
gene expression, or by binding to an IFN-L polypeptide binding
partner (e.g., receptor or ligand). In one embodiment, a test
molecule will bind to an IFN-L polypeptide with an affinity
constant of at least about 10.sup.-6 M, preferably about 10.sup.-8
M, more preferably about 10.sup.-9 M, and even more preferably
about 10.sup.-10 M.
[0251] Methods for identifying compounds that interact with IFN-L
polypeptides are encompassed by the present invention. In certain
embodiments, an IFN-L polypeptide is incubated with a test molecule
under conditions that permit the interaction of the test molecule
with an IFN-L polypeptide, and the extent of the interaction is
measured. The test molecule can be screened in a substantially
purified form or in a crude mixture.
[0252] In certain embodiments, an IFN-L polypeptide agonist or
antagonist may be a protein, peptide, carbohydrate, lipid, or small
molecular weight molecule that interacts with IFN-L polypeptide to
regulate its activity. Molecules which regulate IFN-L polypeptide
expression include nucleic acids which are complementary to nucleic
acids encoding an IFN-L polypeptide, or are complementary to
nucleic acids sequences which direct or control the expression of
IFN-L polypeptide, and which act as anti-sense regulators of
expression.
[0253] Once a test molecule has been identified as interacting with
an IFN-L polypeptide, the molecule may be further evaluated for its
ability to increase or decrease IFN-L polypeptide activity. The
measurement of the interaction of a test molecule with IFN-L
polypeptide may be carried out in several formats, including
cell-based binding assays, membrane binding assays, solution-phase
assays, and immunoassays. In general, a test molecule is incubated
with an IFN-L polypeptide for a specified period of time, and IFN-L
polypeptide activity is determined by one or more assays for
measuring biological activity.
[0254] The interaction of test molecules with IFN-L polypeptides
may also be assayed directly using polyclonal or monoclonal
antibodies in an immunoassay. Alternatively, modified forms of
IFN-L polypeptides containing epitope tags as described herein may
be used in solution and immunoassays.
[0255] In the event that IFN-L polypeptides display biological
activity through an interaction with a binding partner (e.g., a
receptor or a ligand), a variety of in vitro assays may be used to
measure the binding of an IFN-L polypeptide to the corresponding
binding partner (such as a selective binding agent, receptor, or
ligand). These assays may be used to screen test molecules for
their ability to increase or decrease the rate and/or the extent of
binding of an IFN-L polypeptide to its binding partner. In one
assay, an IFN-L polypeptide is immobilized in the wells of a
microtiter plate. Radiolabeled IFN-L polypeptide binding partner
(for example, iodinated IFN-L polypeptide binding partner) and a
test molecule can then be added either one at a time (in either
order) or simultaneously to the wells. After incubation, the wells
can be washed and counted for radioactivity, using a scintillation
counter, to determine the extent to which the binding partner bound
to the IFN-L polypeptide. Typically, a molecule will be tested over
a range of concentrations, and a series of control wells lacking
one or more elements of the test assays can be used for accuracy in
the evaluation of the results. An alternative to this method
involves reversing the "positions" of the proteins, i.e.,
immobilizing IFN-L polypeptide binding partner to the microtiter
plate wells, incubating with the test molecule and radiolabeled
IFN-L polypeptide, and determining the extent of IFN-L polypeptide
binding. See, e.g., Current Protocols in Molecular Biology, chap.
18 (Ausubel et al., eds., Green Publishers Inc. and Wiley and Sons
1995).
[0256] As an alternative to radiolabeling, an IFN-L polypeptide or
its binding partner may be conjugated to biotin, and the presence
of biotinylated protein can then be detected using streptavidin
linked to an enzyme, such as horse radish peroxidase (HRP) or
alkaline phosphatase (AP), which can be detected colorometrically,
or by fluorescent tagging of streptavidin. An antibody directed to
an IFN-L polypeptide or to an IFN-L polypeptide binding partner,
and which is conjugated to biotin, may also be used for purposes of
detection following incubation of the complex with enzyme-linked
streptavidin linked to AP or HRP.
[0257] A IFN-L polypeptide or an IFN-L polypeptide binding partner
can also be immobilized by attachment to agarose beads, acrylic
beads, or other types of such inert solid phase substrates. The
substrate-protein complex can be placed in a solution containing
the complementary protein and the test compound. After incubation,
the beads can be precipitated by centrifugation, and the amount of
binding between an IFN-L polypeptide and its binding partner can be
assessed using the methods described herein. Alternatively, the
substrate-protein complex can be immobilized in a column with the
test molecule and complementary protein passing through the column.
The formation of a complex between an IFN-L polypeptide and its
binding partner can then be assessed using any of the techniques
described herein (e.g., radiolabelling or antibody binding).
[0258] Another in vitro assay that is useful for identifying a test
molecule which increases or decreases the formation of a complex
between an IFN-L polypeptide binding protein and an IFN-L
polypeptide binding partner is a surface plasmon resonance detector
system such as the BIAcore assay system (Pharmacia, Piscataway,
N.J.). The BIAcore system is utilized as specified by the
manufacturer. This assay essentially involves the covalent binding
of either IFN-L polypeptide or an IFN-L polypeptide binding partner
to a dextran-coated sensor chip that is located in a detector. The
test compound and the other complementary protein can then be
injected, either simultaneously or sequentially, into the chamber
containing the sensor chip. The amount of complementary protein
that binds can be assessed based on the change in molecular mass
that is physically associated with the dextran-coated side of the
sensor chip, with the change in molecular mass being measured by
the detector system.
[0259] In some cases, it may be desirable to evaluate two or more
test compounds together for their ability to increase or decrease
the formation of a complex between an IFN-L polypeptide and an
IFN-L polypeptide binding partner. In these cases, the assays set
forth herein can be readily modified by adding such additional test
compound(s) either simultaneously with, or subsequent to, the first
test compound. The remainder of the steps in the assay are as set
forth herein.
[0260] In vitro assays such as those described herein may be used
advantageously to screen large numbers of compounds for an effect
on the formation of a complex between an IFN-L polypeptide and
IFN-L polypeptide binding partner. The assays may be automated to
screen compounds generated in phage display, synthetic peptide, and
chemical synthesis libraries.
[0261] Compounds which increase or decrease the formation of a
complex between an IFN-L polypeptide and an IFN-L polypeptide
binding partner may also be screened in cell culture using cells
and cell lines expressing either IFN-L polypeptide or IFN-L
polypeptide binding partner. Cells and cell lines may be obtained
from any mammal, but preferably will be from human or other
primate, canine, or rodent sources. The binding of an IFN-L
polypeptide to cells expressing IFN-L polypeptide binding partner
at the surface is evaluated in the presence or absence of test
molecules, and the extent of binding may be determined by, for
example, flow cytometry using a biotinylated antibody to an IFN-L
polypeptide binding partner. Cell culture assays can be used
advantageously to further evaluate compounds that score positive in
protein binding assays described herein.
[0262] Cell cultures can also be used to screen the impact of a
drug candidate. For example, drug candidates may decrease or
increase the expression of the IFN-L gene. In certain embodiments,
the amount of IFN-L polypeptide or an IFN-L polypeptide fragment
that is produced may be measured after exposure of the cell culture
to the drug candidate. In certain embodiments, one may detect the
actual impact of the drug candidate on the cell culture. For
example, the over-expression of a particular gene may have a
particular impact on the cell culture. In such cases, one may test
a drug candidate's ability to increase or decrease the expression
of the gene or its ability to prevent or inhibit a particular
impact on the cell culture. In other examples, the production of a
particular metabolic product such as a fragment of a polypeptide,
may result in, or be associated with, a disease or pathological
condition. In such cases, one may test a drug candidate's ability
to decrease the production of such a metabolic product in a cell
culture.
[0263] Internalizing Proteins
[0264] The tat protein sequence (from HIV) can be used to
internalize proteins into a cell. See, e.g., Falwell et al., 1994,
Proc. Natl. Acad. Sci. U.S.A. 91:664-68. For example, an 11 amino
acid sequence (Y-G-R-K-K-R-R-Q-R-R-R; SEQ ID NO: 18) of the HIV tat
protein (termed the "protein transduction domain," or TAT PDT) has
been described as mediating delivery across the cytoplasmic
membrane and the nuclear membrane of a cell. See Schwarze et al,
1999, Science 285:1569-72; and Nagahara et al., 1998, Nat. Med.
4:1449-52. In these procedures, FITC-constructs (FITC-labeled
G-G-G-G-Y-G-R-K-K-R-R-Q-R-R-R; SEQ ID NO: 19), which penetrate
tissues following intraperitoneal administration, are prepared, and
the binding of such constructs to cells is detected by
fluorescence-activated cell sorting (FACS) analysis. Cells treated
with a tat-.beta.-gal fusion protein will demonstrate .beta.-gal
activity. Following injection, expression of such a construct can
be detected in a number of tissues, including liver, kidney, lung,
heart, and brain tissue. It is believed that such constructs
undergo some degree of unfolding in order to enter the cell, and as
such, may require a refolding following entry into the cell.
[0265] It will thus be appreciated that the tat protein sequence
may be used to internalize a desired polypeptide into a cell. For
example, using the tat protein sequence, an IFN-L antagonist (such
as an anti-IFN-L selective binding agent, small molecule, soluble
receptor, or antisense oligonucleotide) can be administered
intracellularly to inhibit the activity of an IFN-L molecule. As
used herein, the term "IFN-L molecule" refers to both IFN-L nucleic
acid molecules and IFN-L polypeptides as defined herein. Where
desired, the IFN-L protein itself may also be internally
administered to a cell using these procedures. See also, Straus,
1999, Science 285:1466-67.
[0266] Cell Source Identification Using IFN-L Polypeptide
[0267] In accordance with certain embodiments of the invention, it
may be useful to be able to determine the source of a certain cell
type associated with an IFN-L polypeptide. For example, it may be
useful to determine the origin of a disease or pathological
condition as an aid in selecting an appropriate therapy. In certain
embodiments, nucleic acids encoding an IFN-L polypeptide can be
used as a probe to identify cells described herein by screening the
nucleic acids of the cells with such a probe. In other embodiments,
one may use anti-IFN-L polypeptide antibodies to test for the
presence of IFN-L polypeptide in cells, and thus, determine if such
cells are of the types described herein.
[0268] IFN-L Polypeptide Compositions and Administration
[0269] Therapeutic compositions are within the scope of the present
invention. Such IFN-L polypeptide pharmaceutical compositions may
comprise a therapeutically effective amount of an IFN-L polypeptide
or an IFN-L nucleic acid molecule in admixture with a
pharmaceutically or physiologically acceptable formulation agent
selected for suitability with the mode of administration.
Pharmaceutical compositions may comprise a therapeutically
effective amount of one or more IFN-L polypeptide selective binding
agents in admixture with a pharmaceutically or physiologically
acceptable formulation agent selected for suitability with the mode
of administration.
[0270] Acceptable formulation materials preferably are nontoxic to
recipients at the dosages and concentrations employed.
[0271] The pharmaceutical composition may contain formulation
materials for modifying, maintaining, or preserving, for example,
the pH, osmolarity, viscosity, clarity, color, isotonicity, odor,
sterility, stability, rate of dissolution or release, adsorption,
or penetration of the composition. Suitable formulation materials
include, but are not limited to, amino acids (such as glycine,
glutamine, asparagine, arginine, or lysine), antimicrobials,
antioxidants (such as ascorbic acid, sodium sulfite, or sodium
hydrogen-sulfite), buffers (such as borate, bicarbonate, Tris-HCl,
citrates, phosphates, or other organic acids), bulking agents (such
as mannitol or glycine), chelating agents (such as ethylenediamine
tetraacetic acid (EDTA)), complexing agents (such as caffeine,
polyvinylpyrrolidone, beta-cyclodextrin, or
hydroxypropyl-beta-cyclodextrin), fillers, monosaccharides,
disaccharides, and other carbohydrates (such as glucose, mannose,
or dextrins), proteins (such as serum albumin, gelatin, or
immunoglobulins), coloring, flavoring and diluting agents,
emulsifying agents, hydrophilic polymers (such as
polyvinylpyrrolidone), low molecular weight polypeptides,
salt-forming counterions (such as sodium), preservatives (such as
benzalkonium chloride, benzoic acid, salicylic acid, thimerosal,
phenethyl alcohol, methylparaben, propylparaben, chlorhexidine,
sorbic acid, or hydrogen peroxide), solvents (such as glycerin,
propylene glycol, or polyethylene glycol), sugar alcohols (such as
mannitol or sorbitol), suspending agents, surfactants or wetting
agents (such as pluronics; PEG; sorbitan esters; polysorbates such
as polysorbate 20 or polysorbate 80; triton; tromethamine;
lecithin; cholesterol or tyloxapal), stability enhancing agents
(such as sucrose or sorbitol), tonicity enhancing agents (such as
alkali metal halides--preferably sodium or potassium chloride--or
mannitol sorbitol), delivery vehicles, diluents, excipients and/or
pharmaceutical adjuvants. See Remington's Pharmaceutical Sciences
(18th Ed., A. R. Gennaro, ed., Mack Publishing Company 1990.
[0272] The optimal pharmaceutical composition will be determined by
a skilled artisan depending upon, for example, the intended route
of administration, delivery format, and desired dosage. See, e.g.,
Remington's Pharmaceutical Sciences, supra. Such compositions may
influence the physical state, stability, rate of in vivo release,
and rate of in vivo clearance of the IFN-L molecule.
[0273] The primary vehicle or carrier in a pharmaceutical
composition may be either aqueous or non-aqueous in nature. For
example, a suitable vehicle or carrier for injection may be water,
physiological saline solution, or artificial cerebrospinal fluid,
possibly supplemented with other materials common in compositions
for parenteral administration. Neutral buffered saline or saline
mixed with serum albumin are further exemplary vehicles. Other
exemplary pharmaceutical compositions comprise Tris buffer of about
pH 7.0-8.5, or acetate buffer of about pH 4.0-5.5, which may
further include sorbitol or a suitable substitute. In one
embodiment of the present invention, IFN-L polypeptide compositions
may be prepared for storage by mixing the selected composition
having the desired degree of purity with optional formulation
agents (Remington 's Pharnaceutical Sciences, supra) in the form of
a lyophilized cake or an aqueous solution. Further, the IFN-L
polypeptide product may be formulated as a lyophilizate using
appropriate excipients such as sucrose.
[0274] The IFN-L polypeptide pharmaceutical compositions can be
selected for parenteral delivery. Alternatively, the compositions
may be selected for inhalation or for delivery through the
digestive tract, such as orally. The preparation of such
pharmaceutically acceptable compositions is within the skill of the
art.
[0275] The formulation components are present in concentrations
that are acceptable to the site of administration. For example,
buffers are used to maintain the composition at physiological pH or
at a slightly lower pH, typically within a pH range of from about 5
to about 8.
[0276] When parenteral administration is contemplated, the
therapeutic compositions for use in this invention may be in the
form of a pyrogen-free, parenterally acceptable, aqueous solution
comprising the desired IFN-L molecule in a pharmaceutically
acceptable vehicle. A particularly suitable vehicle for parenteral
injection is sterile distilled water in which an IFN-L molecule is
formulated as a sterile, isotonic solution, properly preserved. Yet
another preparation can involve the formulation of the desired
molecule with an agent, such as injectable microspheres,
bio-erodible particles, polymeric compounds (such as polylactic
acid or polyglycolic acid), beads, or liposomes, that provides for
the controlled or sustained release of the product which may then
be delivered via a depot injection. Hyaluronic acid may also be
used, and this may have the effect of promoting sustained duration
in the circulation. Other suitable means for the introduction of
the desired molecule include implantable drug delivery devices.
[0277] In one embodiment, a pharmaceutical composition may be
formulated for inhalation. For example, IFN-L polypeptide may be
formulated as a dry powder for inhalation. IFN-L polypeptide or
nucleic acid molecule inhalation solutions may also be formulated
with a propellant for aerosol delivery. In yet another embodiment,
solutions may be nebulized. Pulmonary administration is further
described in PCT Pub. No. WO 94/20069, which describes the
pulmonary delivery of chemically modified proteins.
[0278] It is also contemplated that certain formulations may be
administered orally. In one embodiment of the present invention,
IFN-L polypeptides that are administered in this fashion can be
formulated with or without those carriers customarily used in the
compounding of solid dosage forms such as tablets and capsules. For
example, a capsule may be designed to release the active portion of
the formulation at the point in the gastrointestinal tract when
bioavailability is maximized and pre-systemic degradation is
minimized. Additional agents can be included to facilitate
absorption of the IFN-L polypeptide. Diluents, flavorings, low
melting point waxes, vegetable oils, lubricants, suspending agents,
tablet disintegrating agents, and binders may also be employed.
[0279] Another pharmaceutical composition may involve an effective
quantity of IFN-L polypeptides in a mixture with non-toxic
excipients that are suitable for the manufacture of tablets. By
dissolving the tablets in sterile water, or another appropriate
vehicle, solutions can be prepared in unit-dose form. Suitable
excipients include, but are not limited to, inert diluents, such as
calcium carbonate, sodium carbonate or bicarbonate, lactose, or
calcium phosphate; or binding agents, such as starch, gelatin, or
acacia; or lubricating agents such as magnesium stearate, stearic
acid, or talc.
[0280] Additional IFN-L polypeptide pharmaceutical compositions
will be evident to those skilled in the art, including formulations
involving IFN-L polypeptides in sustained- or controlled-delivery
formulations. Techniques for formulating a variety of other
sustained- or controlled-delivery means, such as liposome carriers,
bio-erodible microparticles or porous beads and depot injections,
are also known to those skilled in the art. See, e.g.
PCT/US93/00829, which describes the controlled release of porous
polymeric microparticles for the delivery of pharmaceutical
compositions.
[0281] Additional examples of sustained-release preparations
include semipermeable polymer matrices in the form of shaped
articles, e.g. films, or microcapsules. Sustained release matrices
may include polyesters, hydrogels, polylactides (U.S. Pat. No.
3,773,919 and European Patent No. 058481), copolymers of L-glutamic
acid and ganuna ethyl-L-glutamate (Sidman et al., 1983, Biopolymers
22:547-56), poly(2-hydroxyethyl-methacrylate) (Langer et al., 1981,
J. Biomed. Mater. Res. 15:167-277 and Langer, 1982, Chem. Tech.
12:98-105), ethylene vinyl acetate (Langer et al., supra) or
poly-D(-)-3-hydroxybutyric acid (European Patent No. 133988).
Sustained-release compositions may also include liposomes, which
can be prepared by any of several methods known in the art. See,
e.g., Eppstein et al., 1985, Proc. Natl. Acad. Sci. USA 82:3688-92;
and European Patent Nos. 036676, 088046, and 143949.
[0282] The IFN-L pharmaceutical composition to be used for in vivo
administration typically must be sterile. This may be accomplished
by filtration through sterile filtration membranes. Where the
composition is lyophilized, sterilization using this method may be
conducted either prior to, or following, lyophilization and
reconstitution. The composition for parenteral administration may
be stored in lyophilized form or in a solution. In addition,
parenteral compositions generally are placed into a container
having a sterile access port, for example, an intravenous solution
bag or vial having a stopper pierceable by a hypodermic injection
needle.
[0283] Once the pharmaceutical composition has been formulated, it
may be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or as a dehydrated or lyophilized powder. Such
formulations may be stored either in a ready-to-use form or in a
form (e.g., lyophilized) requiring reconstitution prior to
administration.
[0284] In a specific embodiment, the present invention is directed
to kits for producing a single-dose administration unit. The kits
may each contain both a first container having a dried protein and
a second container having an aqueous formulation. Also included
within the scope of this invention are kits containing single and
multi-chambered pre-filled syringes (e.g., liquid syringes and
lyosyringes).
[0285] The effective amount of an IFN-L pharmaceutical composition
to be employed therapeutically will depend, for example, upon the
therapeutic context and objectives. One skilled in the art will
appreciate that the appropriate dosage levels for treatment will
thus vary depending, in part, upon the molecule delivered, the
indication for which the IFN-L molecule is being used, the route of
administration, and the size (body weight, body surface, or organ
size) and condition (the age and general health) of the patient.
Accordingly, the clinician may titer the dosage and modify the
route of administration to obtain the optimal therapeutic effect. A
typical dosage may range from about 0.1 .mu.g/kg to up to about 100
mg/kg or more, depending on the factors mentioned above. In other
embodiments, the dosage may range from 0.1 .mu.g/kg up to about 100
mg/kg; or 1 .mu.g/kg up to about 100 mg/kg; or 5 .mu.g/kg up to
about 100 mg/kg.
[0286] The frequency of dosing will depend upon the pharmacokinetic
parameters of the IFN-L molecule in the formulation being used.
Typically, a clinician will administer the composition until a
dosage is reached that achieves the desired effect. The composition
may therefore be administered as a single dose, as two or more
doses (which may or may not contain the same amount of the desired
molecule) over time, or as a continuous infusion via an
implantation device or catheter. Further refinement of the
appropriate dosage is routinely made by those of ordinary skill in
the art and is within the ambit of tasks routinely performed by
them. Appropriate dosages may be ascertained through use of
appropriate dose-response data.
[0287] The route of administration of the pharmaceutical
composition is in accord with known methods, e.g., orally; through
injection by intravenous, intraperitoneal, intracerebral
(intraparenchymal), intracerebroventricular, intramuscular,
intraocular, intraarterial, intraportal, or intralesional routes;
by sustained release systems; or by implantation devices. Where
desired, the compositions may be administered by bolus injection or
continuously by infusion, or by implantation device.
[0288] Alternatively or additionally, the composition may be
administered locally via implantation of a membrane, sponge, or
other appropriate material onto which the desired molecule has been
absorbed or encapsulated. Where an implantation device is used, the
device may be implanted into any suitable tissue or organ, and
delivery of the desired molecule may be via diffusion,
timed-release bolus, or continuous administration.
[0289] In some cases, it may be desirable to use IFN-L polypeptide
pharmaceutical compositions in an ex vivo manner. In such
instances, cells, tissues, or organs that have been removed from
the patient are exposed to IFN-L polypeptide pharmaceutical
compositions after which the cells, tissues, or organs are
subsequently implanted back into the patient.
[0290] In other cases, an IFN-L polypeptide can be delivered by
implanting certain cells that have been genetically engineered,
using methods such as those described herein, to express and
secrete the IFN-L polypeptide. Such cells may be animal or human
cells, and may be autologous, heterologous, or xenogeneic.
Optionally, the cells may be immortalized. In order to decrease the
chance of an immunological response, the cells may be encapsulated
to avoid infiltration of surrounding tissues. The encapsulation
materials are typically biocompatible, semi-permeable polymeric
enclosures or membranes that allow the release of the protein
product(s) but prevent the destruction of the cells by the
patient's immune system or by other detrimental factors from the
surrounding tissues.
[0291] As discussed herein, it may be desirable to treat isolated
cell populations (such as stem cells, lymphocytes, red blood cells,
chondrocytes, neurons, and the like) with one or more IFN-L
polypeptides. This can be accomplished by exposing the isolated
cells to the polypeptide directly, where it is in a form that is
permeable to the cell membrane.
[0292] Additional embodiments of the present invention relate to
cells and methods (e.g., homologous recombination and/or other
recombinant production methods) for both the in vitro production of
therapeutic polypeptides and for the production and delivery of
therapeutic polypeptides by gene therapy or cell therapy.
Homologous and other recombination methods may be used to modify a
cell that contains a normally transcriptionally-silent IFN-L gene,
or an under-expressed gene, and thereby produce a cell which
expresses therapeutically efficacious amounts of IFN-L
polypeptides.
[0293] Homologous recombination is a technique originally developed
for targeting genes to induce or correct mutations in
transcriptionally active genes. Kucherlapati, 1989, Prog. in Nucl.
Acid Res. & Mol. Biol. 36:301. The basic technique was
developed as a method for introducing specific mutations into
specific regions of the mammalian genome (Thomas et al., 1986, Cell
44:419-28; Thomas and Capecchi, 1987, Cell 51:503-12; Doetschman et
al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8583-87) or to correct
specific mutations within defective genes (Doetschman et al., 1987,
Nature 330:576-78). Exemplary homologous recombination techniques
are described in U.S. Pat. No. 5,272,071; European Patent Nos.
9193051 and 505500; PCT/US90/07642, and PCT Pub No. WO
91/09955).
[0294] Through homologous recombination, the DNA sequence to be
inserted into the genome can be directed to a specific region of
the gene of interest by attaching it to targeting DNA. The
targeting DNA is a nucleotide sequence that is complementary
(homologous) to a region of the genomic DNA. Small pieces of
targeting DNA that are complementary to a specific region of the
genome are put in contact with the parental strand during the DNA
replication process. It is a general property of DNA that has been
inserted into a cell to hybridize, and therefore, recombine with
other pieces of endogenous DNA through shared homologous regions.
If this complementary strand is attached to an oligonucleotide that
contains a mutation or a different sequence or an additional
nucleotide, it too is incorporated into the newly synthesized
strand as a result of the recombination. As a result of the
proofreading function, it is possible for the new sequence of DNA
to serve as the template. Thus, the transferred DNA is incorporated
into the genome.
[0295] Attached to these pieces of targeting DNA are regions of DNA
that may interact with or control the expression of an IFN-L
polypeptide, e.g., flanling sequences. For example, a
promoter/enhancer element, a suppressor, or an exogenous
transcription modulatory element is inserted in the genome of the
intended host cell in proximity and orientation sufficient to
influence the transcription of DNA encoding the desired IFN-L
polypeptide. The control element controls a portion of the DNA
present in the host cell genome. Thus, the expression of the
desired IFN-L polypeptide may be achieved not by transfection of
DNA that encodes the IFN-L gene itself, but rather by the use of
targeting DNA (containing regions of homology with the endogenous
gene of interest) coupled with DNA regulatory segments that provide
the endogenous gene sequence with recognizable signals for
transcription of an IFN-L gene.
[0296] In an exemplary method, the expression of a desired targeted
gene in a cell (i.e., a desired endogenous cellular gene) is
altered via homologous recombination into the cellular genome at a
preselected site, by the introduction of DNA which includes at
least a regulatory sequence, an exon, and a splice donor site.
These components are introduced into the chromosomal (genomic) DNA
in such a manner that this, in effect, results in the production of
a new transcription unit (in which the regulatory sequence, the
exon, and the splice donor site present in the DNA construct are
operatively linked to the endogenous gene). As a result of the
introduction of these components into the chromosomal DNA, the
expression of the desired endogenous gene is altered.
[0297] Altered gene expression, as described herein, encompasses
activating (or causing to be expressed) a gene which is normally
silent (unexpressed) in the cell as obtained, as well as increasing
the expression of a gene which is not expressed at physiologically
significant levels in the cell as obtained. The embodiments further
encompass changing the pattern of regulation or induction such that
it is different from the pattern of regulation or induction that
occurs in the cell as obtained, and reducing (including
eliminating) the expression of a gene which is expressed in the
cell as obtained.
[0298] One method by which homologous recombination can be used to
increase, or cause, IFN-L polypeptide production from a cell's
endogenous IFN-L gene involves first using homologous recombination
to place a recombination sequence from a site-specific
recombination system (e.g., Cre/loxP, FLP/FRT) (Sauer, 1994, Curr.
Opin. Biotechnol., 5:521-27; Sauer, 1993, Methods Enzymol.,
225:890-900) upstream of (i.e., 5' to) the cell's endogenous
genomic IFN-L polypeptide coding region. A plasmid containing a
recombination site homologous to the site that was placed just
upstream of the genomic IFN-L polypeptide coding region is
introduced into the modified cell line along with the appropriate
recombinase enzyme. This recombinase causes the plasmid to
integrate, via the plasmid's recombination site, into the
recombination site located just upstream of the genomic IFN-L
polypeptide coding region in the cell line (Baubonis and Sauer,
1993, Nucleic Acids Res. 21:2025-29; O'Gorman et al, 1991, Science
251:1351-55). Any flanking sequences known to increase
transcription (e.g., enhancer/promoter, intron, translational
enhancer), if properly positioned in this plasmid, would integrate
in such a manner as to create a new or modified transcriptional
unit resulting in de novo or increased IFN-L polypeptide production
from the cell's endogenous IFN-L gene.
[0299] A further method to use the cell line in which the site
specific recombination sequence had been placed just upstream of
the cell's endogenous genomic IFN-L polypeptide coding region is to
use homologous recombination to introduce a second recombination
site elsewhere in the cell line's genome. The appropriate
recombinase enzyme is then introduced into the
two-recombination-site cell line, causing a recombination event
(deletion, inversion, and translocation) (Sauer, 1994, Curr. Opin.
Biotechnol., 5:521-27; Sauer, 1993, Methods Enzymol., 225:890-900)
that would create a new or modified transcriptional unit resulting
in de novo or increased IFN-L polypeptide production from the
cell's endogenous IFN-L gene.
[0300] An additional approach for increasing, or causing, the
expression of IFN-L polypeptide from a cell's endogenous IFN-L gene
involves increasing, or causing, the expression of a gene or genes
(e.g., transcription factors) and/or decreasing the expression of a
gene or genes (e.g., transcriptional repressors) in a manner which
results in de novo or increased IFN-L polypeptide production from
the cell's endogenous IFN-L gene. This method includes the
introduction of a non-naturally occurring polypeptide (e.g., a
polypeptide comprising a site specific DNA binding domain fused to
a transcriptional factor domain) into the cell such that de novo or
increased IFN-L polypeptide production from the cell's endogenous
IFN-L gene results.
[0301] The present invention further relates to DNA constructs
useful in the method of altering expression of a target gene. In
certain embodiments, the exemplary DNA constructs comprise: (a) one
or more targeting sequences, (b) a regulatory sequence, (c) an
exon, and (d) an unpaired splice-donor site. The targeting sequence
in the DNA construct directs the integration of elements (a)-(d)
into a target gene in a cell such that the elements (b)-(d) are
operatively linked to sequences of the endogenous target gene. In
another embodiment, the DNA constructs comprise: (a) one or more
targeting sequences, (b) a regulatory sequence, (c) an exon, (d) a
splice-donor site, (e) an intron, and (f) a splice-acceptor site,
wherein the targeting sequence directs the integration of elements
(a)-(f) such that the elements of (b)-(f) are operatively linked to
the endogenous gene. The targeting sequence is homologous to the
preselected site in the cellular chromosomal DNA with which
homologous recombination is to occur. In the construct, the exon is
generally 3' of the regulatory sequence and the splice-donor site
is 3' of the exon.
[0302] If the sequence of a particular gene is known, such as the
nucleic acid sequence of IFN-L polypeptide presented herein, a
piece of DNA that is complementary to a selected region of the gene
can be synthesized or otherwise obtained, such as by appropriate
restriction of the native DNA at specific recognition sites
bounding the region of interest. This piece serves as a targeting
sequence upon insertion into the cell and will hybridize to its
homologous region within the genome. If this hybridization occurs
during DNA replication, this piece of DNA, and any additional
sequence attached thereto, will act as an Okazaki fragment and will
be incorporated into the newly synthesized daughter strand of DNA.
The present invention, therefore, includes nucleotides encoding an
IFN-L polypeptide, which nucleotides may be used as targeting
sequences.
[0303] IFN-L polypeptide cell therapy, e.g., the implantation of
cells producing IFN-L polypeptides, is also contemplated. This
embodiment involves implanting cells capable of synthesizing and
secreting a biologically active form of IFN-L polypeptide. Such
IFN-L polypeptide-producing cells can be cells that are natural
producers of IFN-L polypeptides or may be recombinant cells whose
ability to produce IFN-L polypeptides has been augmented by
transformation with a gene encoding the desired IFN-L polypeptide
or with a gene augmenting the expression of IFN-L polypeptide. Such
a modification may be accomplished by means of a vector suitable
for delivering the gene as well as promoting its expression and
secretion. In order to minimize a potential immunological reaction
in patients being administered an IFN-L polypeptide, as may occur
with the administration of a polypeptide of a foreign species, it
is preferred that the natural cells producing IFN-L polypeptide be
of human origin and produce human IFN-L polypeptide. Likewise, it
is preferred that the recombinant cells producing IFN-L polypeptide
be transformed with an expression vector containing a gene encoding
a human IFN-L polypeptide.
[0304] Implanted cells may be encapsulated to avoid the
infiltration of surrounding tissue. Human or non-human animal cells
may be implanted in patients in biocompatible, semipermeable
polymeric enclosures or membranes that allow the release of IFN-L
polypeptide, but that prevent the destruction of the cells by the
patient's immune system or by other detrimental factors from the
surrounding tissue. Alternatively, the patient's own cells,
transformed to produce IFN-L polypeptides ex vivo, may be implanted
directly into the patient without such encapsulation.
[0305] Techniques for the encapsulation of living cells are known
in the art, and the preparation of the encapsulated cells and their
implantation in patients may be routinely accomplished. For
example, Baetge et al. (PCT Pub. No. WO 95/05452 and
PCT/US94/09299) describe membrane capsules containing genetically
engineered cells for the effective delivery of biologically active
molecules. The capsules are biocompatible and are easily
retrievable. The capsules encapsulate cells transfected with
recombinant DNA molecules comprising DNA sequences coding for
biologically active molecules operatively linked to promoters that
are not subject to down-regulation in vivo upon implantation into a
mammalian host. The devices provide for the delivery of the
molecules from living cells to specific sites within a recipient.
In addition, see U.S. Pat. Nos. 4,892,538; 5,011,472; and
5,106,627. A system for encapsulating living cells is described in
PCT Pub. No. WO 91/10425 (Aebischer et al.). See also, PCT Pub. No.
WO 91/10470 (Aebischer et al.); Winn et al., 1991, Exper. Neurol.
113:322-29; Aebischer et al., 1991, Exper. Neurol. 111:269-75; and
Tresco et al., 1992, ASAIO 38:17-23.
[0306] In vivo and in vitro gene therapy delivery of IFN-L
polypeptides is also envisioned. One example of a gene therapy
technique is to use the IFN-L gene (either genomic DNA, cDNA,
and/or synthetic DNA) encoding an IFN-L polypeptide which may be
operably linked to a constitutive or inducible promoter to form a
"gene therapy DNA construct." The promoter may be homologous or
heterologous to the endogenous IFN-L gene, provided that it is
active in the cell or tissue type into which the construct will be
inserted. Other components of the gene therapy DNA construct may
optionally include DNA molecules designed for site-specific
integration (e.g., endogenous sequences useful for homologous
recombination), tissue-specific promoters, enhancers or silencers,
DNA molecules capable of providing a selective advantage over the
parent cell, DNA molecules useful as labels to identify transformed
cells, negative selection systems, cell specific binding agents
(as, for example, for cell targeting), cell-specific
internalization factors, transcription factors enhancing expression
from-a vector, and factors enabling vector production.
[0307] A gene therapy DNA construct can then be introduced into
cells (either ex vivo or in vivo) using viral or non-viral vectors.
One means for introducing the gene therapy DNA construct is by
means of viral vectors as described herein. Certain vectors, such
as retroviral vectors, will deliver the DNA construct to the
chromosomal DNA of the cells, and the gene can integrate into the
chromosomal DNA. Other vectors will function as episomes, and the
gene therapy DNA construct will remain in the cytoplasm.
[0308] In yet other embodiments, regulatory elements can be
included for the controlled expression of the IFN-L gene in the
target cell. Such elements are turned on in response to an
appropriate effector. In this way, a therapeutic polypeptide can be
expressed when desired. One conventional control means involves the
use of small molecule dimerizers or rapalogs to dimerize chimeric
proteins which contain a small molecule-binding domain and a domain
capable of initiating a biological process, such as a DNA-binding
protein or transcriptional activation protein (see PCT Pub. Nos. WO
96/41865, WO 97/31898, and WO 97/31899). The dimerization of the
proteins can be used to initiate transcription of the
transgene.
[0309] An alternative regulation technology uses a method of
storing proteins expressed from the gene of interest inside the
cell as an aggregate or cluster. The gene of interest is expressed
as a fusion protein that includes a conditional aggregation domain
that results in the retention of the aggregated protein in the
endoplasmic reticulum. The stored proteins are stable and inactive
inside the cell. The proteins can be released, however, by
administering a drug (e.g., small molecule ligand) that removes the
conditional aggregation domain and thereby specifically breaks
apart the aggregates or clusters so that the proteins may be
secreted from the cell. See Aridor et al., 2000, Science 287:816-17
and Rivera et al., 2000, Science 287:826-30.
[0310] Other suitable control means or gene switches include, but
are not limited to, the systems described herein. Mifepristone
(RU486) is used as a progesterone antagonist. The binding of a
modified progesterone receptor ligand-binding domain to the
progesterone antagonist activates transcription by forming a dimer
of two transcription factors that then pass into the nucleus to
bind DNA. The ligand-binding domain is modified to eliminate the
ability of the receptor to bind to the natural ligand. The modified
steroid hormone receptor system is further described in U.S. Pat.
No. 5,364,791 and PCT Pub. Nos. WO 96/40911 and WO 97/10337.
[0311] Yet another control system uses ecdysone (a fruit fly
steroid hormone) which binds to and activates an ecdysone receptor
(cytoplasmic receptor). The receptor then translocates to the
nucleus to bind a specific DNA response element (promoter from
ecdysone-responsive gene). The ecdysone receptor includes a
transactivation domain, DNA-binding domain, and ligand-binding
domain to initiate transcription. The ecdysone system is further
described in U.S. Pat. No. 5,514,578 and PCT Pub. Nos. WO 97/38117,
WO 96/37609, and WO 93/03162.
[0312] Another control means uses a positive
tetracycline-controllable transactivator. This system involves a
mutated tet repressor protein DNA-binding domain (mutated tet R-4
amino acid changes which resulted in a reverse
tetracycline-regulated transactivator protein, i.e., it binds to a
tet operator in the presence of tetracycline) linked to a
polypeptide which activates transcription. Such systems are
described in U.S. Pat. Nos. 5,464,758, 5,650,298, and
5,654,168.
[0313] Additional expression control systems and nucleic acid
constructs are described in U.S. Pat. Nos. 5,741,679 and 5,834,186,
to Innovir Laboratories Inc.
[0314] In vivo gene therapy may be accomplished by introducing the
gene encoding IFN-L polypeptide into cells via local injection of
an IFN-L nucleic acid molecule or by other appropriate viral or
non-viral delivery vectors. Hefti, 1994, Neurobiology 25:1418-35.
For example, a nucleic acid molecule encoding an IFN-L polypeptide
may be contained in an adeno-associated virus (AAV) vector for
delivery to the targeted cells (see, e.g., Johnson, PCT Pub. No. WO
95/34670; PCT App. No. PCT/US95/07178). The recombinant AAV genome
typically contains AAV inverted terminal repeats flanking a DNA
sequence encoding an IFN-L polypeptide operably linked to
functional promoter and polyadenylation sequences.
[0315] Alternative suitable viral vectors include, but are not
limited to, retrovirus, adenovirus, herpes simplex virus,
lentivirus, hepatitis virus, parvovirus, papovavirus, poxvirus,
alphavirus, coronavirus, rhabdovirus, paramyxovirus, and papilloma
virus vectors. U.S. Pat. No. 5,672,344 describes an in vivo
viral-mediated gene transfer system involving a recombinant
neurotrophic HSV-1 vector. U.S. Pat. No. 5,399,346 provides
examples of a process for providing a patient with a therapeutic
protein by the delivery of human cells which have been treated in
vitro to insert a DNA segment encoding a therapeutic protein.
Additional methods and materials for the practice of gene therapy
techniques are described in U.S. Pat. Nos. 5,631,236 (involving
adenoviral vectors), 5,672,510 (involving retroviral vectors),
5,635,399 (involving retroviral vectors expressing cytokines).
[0316] Nonviral delivery methods include, but are not limited to,
liposome-mediated transfer, naked DNA delivery (direct injection),
receptor-mediated transfer (ligand-DNA complex), electroporation,
calcium phosphate precipitation, and microparticle bombardment
(e.g., gene gun). Gene therapy materials and methods may also
include inducible promoters, tissue-specific enhancer-promoters,
DNA sequences designed for site-specific integration, DNA sequences
capable of providing a selective advantage over the parent cell,
labels to identify transformed cells, negative selection systems
and expression control systems (safety measures), cell-specific
binding agents (for cell targeting), cell-specific internalization
factors, and transcription factors to enhance expression by a
vector as well as methods of vector manufacture. Such additional
methods and materials for the practice of gene therapy techniques
are described in U.S. Pat. Nos. 4,970,154 (involving
electroporation techniques), 5,679,559 (describing a
lipoprotein-containing system for gene delivery), 5,676,954
(involving liposome carriers), 5,593,875 (describing methods for
calcium phosphate transfection), and 4,945,050 (describing a
process wherein biologically active particles are propelled at
cells at a speed whereby the particles penetrate the surface of the
cells and become incorporated into the interior of the cells), and
PCT Pub. No. WO 96/40958 (involving nuclear ligands).
[0317] It is also contemplated that IFN-L gene therapy or cell
therapy can further include the delivery of one or more additional
polypeptide(s) in the same or a different cell(s). Such cells may
be separately introduced into the patient, or the cells may be
contained in a single implantable device, such as the encapsulating
membrane described above, or the cells may be separately modified
by means of viral vectors.
[0318] A means to increase endogenous IFN-L polypeptide expression
in a cell via gene therapy is to insert one or more enhancer
elements into the IFN-L polypeptide promoter, where the enhancer
elements can serve to increase transcriptional activity of the
IFN-L gene. The enhancer elements used will be selected based on
the tissue in which one desires to activate the gene--enhancer
elements known to confer promoter activation in that tissue will be
selected. For example, if a gene encoding an IFN-L polypeptide is
to be "turned on" in T-cells, the lck promoter enhancer element may
be used. Here, the functional portion of the transcriptional
element to be added may be inserted into a fragment of DNA
containing the IFN-L polypeptide promoter (and optionally, inserted
into a vector and/or 5' and/or 3' flanking sequences) using
standard cloning techniques. This construct, known as a "homologous
recombination construct," can then be introduced into the desired
cells either ex vivo or in vivo.
[0319] Gene therapy also can be used to decrease IFN-L polypeptide
expression by modifying the nucleotide sequence of the endogenous
promoter. Such modification is typically accomplished via
homologous recombination methods. For example, a DNA molecule
containing all or a portion of the promoter of the IFN-L gene
selected for inactivation can be engineered to remove and/or
replace pieces of the promoter that regulate transcription. For
example, the TATA box and/or the binding site of a transcriptional
activator of the promoter may be deleted using standard molecular
biology techniques; such deletion can inhibit promoter activity
thereby repressing the transcription of the corresponding IFN-L
gene. The deletion of the TATA box or the transcription activator
binding site in the promoter may be accomplished by generating a
DNA construct comprising all or the relevant portion of the IFN-L
polypeptide promoter (from the same or a related species as the
IFN-L gene to be regulated) in which one or more of the TATA box
and/or transcriptional activator binding site nucleotides are
mutated via substitution, deletion and/or insertion of one or more
nucleotides. As a result, the TATA box and/or activator binding
site has decreased activity or is rendered completely inactive.
This construct, which also will typically contain at least about
500 bases of DNA that correspond to the native (endogenous) 5' and
3' DNA sequences adjacent to the promoter segment that has been
modified, may be introduced into the appropriate cells (either ex
vivo or in vivo) either directly or via a viral vector as described
herein. Typically, the integration of the construct into the
genomic DNA of the cells will be via homologous recombination,
where the 5' and 3' DNA sequences in the promoter construct can
serve to help integrate the modified promoter region via
hybridization to the endogenous chromosomal DNA.
[0320] Therapeutic Uses
[0321] IFN-L nucleic acid molecules, polypeptides, and agonists and
antagonists thereof can be used to treat, diagnose, ameliorate, or
prevent a number of diseases, disorders, or conditions, including
those recited herein.
[0322] IFN-L polypeptide agonists and antagonists include those
molecules which regulate IFN-L polypeptide activity and either
increase or decrease at least one activity of the mature form of
the IFN-L polypeptide. Agonists or antagonists may be co-factors,
such as a protein, peptide, carbohydrate, lipid, or small molecular
weight molecule, which interact with IFN-L polypeptide and thereby
regulate its activity. Potential polypeptide agonists or
antagonists include antibodies that react with either soluble or
membrane-bound forms of IFN-L polypeptides that comprise part or
all of the extracellular domains of the said proteins. Molecules
that regulate IFN-L polypeptide expression typically include
nucleic acids encoding IFN-L polypeptide that can act as anti-sense
regulators of expression.
[0323] IFN-L polypeptides may play a role in controlling the growth
and maintenance of cancer cells based on the homology of IFN-L
polypeptides to known interferons. Accordingly, IFN-L nucleic acid
molecules, polypeptides, and agonists and antagonists thereof may
be useful for the diagnosis and/or treatment of cancer. Examples of
such cancers include, but are not limited to, chronic myelogenous
leukemia, hairy cell leukemia, Kaposi's sarcoma, melanomas, lung
cancer, brain cancer, breast cancer, cancers of the hematopoetic
system, prostate cancer, ovarian cancer, and testicular cancer.
Other cancers are encompassed within the scope of the invention
[0324] IFN-L poylpeptides may play a role in the modulation of the
immune system based on the homology of IFN-polypeptides to known
interferons. Accordingly, IFN-L nucleic acid molecules,
polypeptides, and agonists and antagonists thereof may be useful
for the diagnosis and/or treatment of dysfunction of the immune
system. Examples of such diseases include, but are not limited to,
multiple sclerosis, rheumatoid arthritis, psioriatic arthritis,
inflammatory arthritis, osteoarthritis, inflammatory joint disease,
autoimmune disease, lupus, diabetes, inflammatory bowel disease,
transplant rejection, and graft vs. host disease. Other diseases
influenced by the dysfinction of the immune system are encompassed
within the scope of the invention.
[0325] IFN-L polypeptides may play a role in the control of viral
and microbial infections based on the homology of IFN-polypeptides
to known interferons. Accordingly, IFN-L nucleic acid molecules,
polypeptides, and agonists and antagonists thereof may be useful
for the diagnosis and/or treatment of infections. Examples of such
diseases include, but are not limited to, hepatitis, human
immunodeficiency virus, human papilloma virus, and chronic
granulamatous. Other diseases caused by infections are encompassed
within the scope of the invention.
[0326] IFN-L polypeptides may play a role in the control of bone
formation and maintenance based on the homology of IFN-polypeptides
to known interferons. Accordingly, IFN-L nucleic acid molecules,
polypeptides, and agonists and antagonists may be useful for the
diagnosis and/or treatment of bone disorders. Examples of such
diseases include, but are not limited to, osteoporosis,
osteopetrosis, osteogenesis imperfecta, Paget's disease,
periodontal disease, and hypercalcemia. Other bone disorders are
encompassed within the scope of the invention.
[0327] IFN-L polypeptides may play a role in the inappropriate
proliferation of cells based on the homology of IFN-polypeptides to
known interferons. Accordingly, IFN-L nucleic acid molecules,
polypeptides, and agonists and antagonists may be useful for the
diagnosis and/or treatment of diseases where there is abnormal cell
proliferation. Examples of such diseases include, but are not
limited to, arteriosclerosis and vascular restenosis. Other
diseases influenced by the inappropriate proliferation of cells are
encompassed within the scope of the invention.
[0328] In a specific embodiment, the present invention is directed
to the use of an IFN-L polypeptide in combination (pretreatment,
post-treatment, or concurrent treatment) with secreted or soluble
human fas antigen or recombinant versions thereof (PCT Pub. No. WO
96/20206; Mountz et al., 1995, J. Immunol., 155:4829-37; and
European Patent No. 510691). PCT Pub. No. WO 96/20206 discloses
secreted human fas antigen (native and recombinant, including an Ig
fusion protein), methods for isolating the genes responsible for
coding the soluble recombinant human fas antigen, methods for
cloning the gene in suitable vectors and cell types, and methods
for expressing the gene to produce the inhibitors. European Patent
No. 510691 teaches nucleic acids coding for human fas antigen,
including soluble fas antigen, vectors expressing for said nucleic
acids, and transformants transfected with the vector. When
administered parenterally, doses of a secreted or soluble fas
antigen fusion protein each are generally from about 1 .mu.g/kg to
about 100 .mu.g/kg.
[0329] Treatment of the diseases and disorders recited herein can
include the use of first line drugs for control of pain and
inflammation; these drugs are classified as non-steroidal,
anti-inflammatory drugs (NSAIDs). Secondary treatments include
corticosteroids, slow acting antirheumatic drugs (SAARDs), or
disease modifying (DM) drugs. Information regarding the following
compounds can be found in The Merck Manual of Diagnosis and Therapy
(16th ed. 1992) and in Pharmaprojects (PJB Publications Ltd).
[0330] In a specific embodiment, the present invention is directed
to the use of an IFN-L polypeptide and any of one or more NSAIDs
for the treatment of the diseases and disorders recited herein,
including acute and chronic inflammation such as rheumatic
diseases, and graft versus host disease. NSAIDs owe their
anti-inflammatory action, at least in part, to the inhibition of
prostaglandin synthesis (Goodman and Gilman, The Pharmacological
Basis of Therapeutics (7th ed. 1985)). NSAIDs can be characterized
into at least nine groups: (1) salicylic acid derivatives, (2)
propionic acid derivatives, (3) acetic acid derivatives, (4)
fenamic acid derivatives, (5) carboxylic acid derivatives, (6)
butyric acid derivatives, (7) oxicams, (8) pyrazoles, and (9)
pyrazolones.
[0331] In another specific embodiment, the present invention is
directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more salicylic acid derivatives, prodrug esters, or
pharmaceutically acceptable salts thereof. Such salicylic acid
derivatives, prodrug esters, and pharmaceutically acceptable salts
thereof comprise: acetaminosalol, aloxiprin, aspirin, benorylate,
bromosaligenin, calcium acetylsalicylate, choline magnesium
trisalicylate, magnesium salicylate, choline salicylate,
diflusinal, etersalate, fendosal, gentisic acid, glycol salicylate,
imidazole salicylate, lysine acetylsalicylate, mesalamine,
morpholine salicylate, 1-naphthyl salicylate, olsalazine,
parsalmide, phenyl acetylsalicylate, phenyl salicylate,
salacetamide, salicylamide O-acetic acid, salsalate, sodium
salicylate and sulfasalazine. Structurally related salicylic acid
derivatives having similar analgesic and anti-inflammatory
properties are also intended to be encompassed by this group.
[0332] In an additional specific embodiment, the present invention
is directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more propionic acid derivatives; prodrug esters, or
pharmaceutically acceptable salts thereof. The propionic acid
derivatives, prodrug esters, and pharmaceutically acceptable salts
thereof comprise: alminoprofen, benoxaprofen, bucloxic acid,
carprofen, dexindoprofen, fenoprofen, flunoxaprofen, fluprofen,
flurbiprofen, furcloprofen, ibuprofen, ibuprofen aluminum,
ibuproxam, indoprofen, isoprofen, ketoprofen, loxoprofen,
miroprofen, naproxen, naproxen sodium, oxaprozin, piketoprofen,
pimeprofen, pirprofen, pranoprofen, protizinic acid,
pyridoxiprofen, suprofen, tiaprofenic acid and tioxaprofen.
Structurally related propionic acid derivatives having similar
analgesic and anti-inflammatory properties are also intended to be
encompassed by this group.
[0333] In yet another specific embodiment, the present invention is
directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more acetic acid derivatives, prodrug esters, or
pharmaceutically acceptable salts thereof. The acetic acid
derivatives, prodrug esters, and pharmaceutically acceptable salts
thereof comprise: acemetacin, alclofenac, amfenac, bufexamac,
cinmetacin, clopirac, delmetacin, diclofenac potassium, diclofenac
sodium, etodolac, felbinac, fenclofenac, fenclorac, fenclozic acid,
fentiazac, furofenac, glucametacin, ibufenac, indomethacin,
isofezolac, isoxepac, lonazolac, metiazinic acid, oxametacin,
oxpinac, pimetacin, proglumetacin, sulindac, talmetacin, tiaramide,
tiopinac, tolmetin, tolmetin sodium, zidometacin and zomepirac.
Structurally related acetic acid derivatives having similar
analgesic and anti-inflammatory properties are also intended to be
encompassed by this group.
[0334] In another specific embodiment, the present invention is
directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more fenamic acid derivatives, prodrug esters, or
pharmaceutically acceptable salts thereof. The fenamic acid
derivatives, prodrug esters, and pharmaceutically acceptable salts
thereof comprise: enfenamic acid, etofenamate, flufenamic acid,
isonixin, meclofenamic acid, meclofenamate sodium, medofenamic
acid, mefenamic acid, niflumic acid, talniflumate, terofenamate,
tolfenamic acid and ufenamate. Structurally related fenamic acid
derivatives having similar analgesic and anti-inflammatory
properties are also intended to be encompassed by this group.
[0335] In an additional specific embodiment, the present invention
is directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more carboxylic acid derivatives, prodrug esters, or
pharmaceutically acceptable salts thereof. The carboxylic acid
derivatives, prodrug esters, and pharmaceutically acceptable salts
thereof which can be used comprise: clidanac, diflunisal,
flufenisal, inoridine, ketorolac and tinoridine. Structurally
related carboxylic acid derivatives having similar analgesic and
anti-inflammatory properties are also intended to be encompassed by
this group.
[0336] In yet another specific embodiment, the present invention is
directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more butyric acid derivatives, prodrug esters, or
pharmaceutically acceptable salts thereof The butyric acid
derivatives, prodrug esters, and pharmaceutically acceptable salts
thereof comprise:
[0337] bumadizon, butibufen, fenbufen and xenbucin. Structurally
related butyric acid derivatives having similar analgesic and
anti-inflammatory properties are also intended to be encompassed by
this group.
[0338] In another specific embodiment, the present invention is
directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more oxicams, prodrug esters, or pharmaceutically acceptable
salts thereof The oxicams, prodrug esters, and pharmaceutically
acceptable salts thereof comprise: droxicam, enolicam, isoxicam,
piroxicam, sudoxicam, tenoxicam and 4-hydroxyl-1,2-benzothiazine
1,1-dioxide 4-(N-phenyl)-carboxamide. Structurally related oxicams
having similar analgesic and anti-inflammatory properties are also
intended to be encompassed by this group.
[0339] In still another specific embodiment, the present invention
is directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more pyrazoles, prodrug esters, or pharmaceutically
acceptable salts thereof. The pyrazoles, prodrug esters, and
pharmaceutically acceptable salts thereof which may be used
comprise: difenamizole and epirizole. Structurally related
pyrazoles having similar analgesic and anti-inflammatory properties
are also intended to be encompassed by this group.
[0340] In an additional specific embodiment, the present invention
is directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment or, concurrent treatment) with any of
one or more pyrazolones, prodrug esters, or pharmaceutically
acceptable salts thereof. The pyrazolones, prodrug esters, and
pharmaceutically acceptable salts thereof which may be used
comprise: apazone, azapropazone, benzpiperylon, feprazone,
mofebutazone, morazone, oxyphenbutazone, phenylbutazone,
pipebuzone, propylphenazone, ramifenazone, suxibuzone and
thiazolinobutazone. Structurally related pyrazalones having similar
analgesic and anti-inflammatory properties are also intended to be
encompassed by this group.
[0341] In another specific embodiment, the present invention is
directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more of the following: NSAIDs: .epsilon.-acetamidocaproic
acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid,
amixetrine, anitrazafen, antrafenine, bendazac, bendazac lysinate,
benzydamine, beprozin, broperamole, bucolome, bufezolac,
ciproquazone, cloximate, dazidamine, deboxamet, detomidine,
difenpiramide, difenpyramide, difisalamine, ditazol, emorfazone,
fanetizole mesylate, fenflumizole, floctafenine, flumizole,
flunixin, fluproquazone, fopirtoline, fosfosal, guaimesal,
guaiazolene, isonixim, lefetamine HCl, leflunomide, lofemizole,
lotifazole, lysin clonixinate, meseclazone, nabumetone, nictindole,
nimesulide, orgotein, orpanoxin, oxaceprol, oxapadol, paranyline,
perisoxal, perisoxal citrate, pifoxime, piproxen, pirazolac,
pirfenidone, proquazone, proxazole, thielavin B, tiflamizole,
timegadine, tolectin, tolpadol, tryptamid and those designated by
company code number such as 480156S, AA861, AD1590, AFP802, AFP860,
AI77B, AP504, AU8001, BPPC, BW540C, CHINOIN 127, CN100, EB382,
EL508, F1044, FK-506, GV3658, ITF182, KCNTEI6090, KME4, LA2851,
MR714, MR897, MY309, ONO3144, PR823, PV102, PV108, R830, RS2131,
SCR152, SH440, SIR133, SPAS510, SQ27239, ST281, SY6001, TA60,
TAI-901 (4-benzoyl-1-indancarboxylic acid), TVX2706, U60257, UR2301
and WY41770. Structurally related NSAIDs having similar analgesic
and anti-inflammatory properties to the NSAIDs are also intended to
be encompassed by this group.
[0342] In still another specific embodiment, the present invention
is directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment or concurrent treatment) with any of
one or more corticosteroids, prodrug esters, or pharmaceutically
acceptable salts thereof for the treatment of the diseases and
disorders recited herein, including acute and chronic inflammation
such as rheumatic diseases, graft versus host disease, and multiple
sclerosis. Corticosteroids, prodrug esters, and pharmaceutically
acceptable salts thereof include hydrocortisone and compounds which
are derived from hydrocortisone, such as 21-acetoxypregnenolone,
alclomerasone, algestone, amcinonide, beclomethasone,
betamethasone, betamethasone valerate, budesonide,
chloroprednisone, clobetasol, clobetasol propionate, clobetasone,
clobetasone butyrate, clocortolone, cloprednol, corticosterone,
cortisone, cortivazol, deflazacon, desonide, desoximerasone,
dexamethasone, diflorasone, diflucortolone, difluprednate,
enoxolone, fluazacort, flucloronide, flumethasone, flumethasone
pivalate, flucinolone acetonide, flunisolide, fluocinonide,
fluorocinolone acetonide, fluocortin butyl, fluocortolone,
fluocortolone hexanoate, diflucortolone valerate, fluorometholone,
fluperolone acetate, fluprednidene acetate, fluprednisolone,
flurandenolide, formocortal, halcinonide, halometasone, halopredone
acetate, hydrocortamate, hydrocortisone, hydrocortisone acetate,
hydrocortisone butyrate, hydrocortisone phosphate, hydrocortisone
21-sodium succinate, hydrocortisone tebutate, mazipredone,
medrysone, meprednisone, methylprednisolone, mometasone furoate,
paramethasone, prednicarbate, prednisolone, prednisolone
21-diedryaminoacetate, prednisolone sodium phosphate, prednisolone
sodium succinate, prednisolone sodium 21-m-sulfobenzoate,
prednisolone sodium 21-stearoglycolate, prednisolone tebutate,
prednisolone 21-trimethylacetate, prednisone, prednival,
prednylidene, prednylidene 21-diethylaminoacetate, tixocortol,
triamcinolone, triamcinolone acetonide, triamcinolone benetonide
and triamcinolone hexacetonide. Structurally related
corticosteroids having similar analgesic and anti-inflammatory
properties are also intended to be encompassed by this group.
[0343] In another specific embodiment, the present invention is
directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more slow-acting antirheumatic drugs (SAARDs) or disease
modifying antirheumatic drugs (DMARDS), prodrug esters, or
pharmaceutically acceptable salts thereof for the treatment of the
diseases and disorders recited herein, including acute and chronic
inflammation such as rheumatic diseases, graft versus host disease,
and multiple sclerosis. SAARDs or DMARDS, prodrug esters, and
pharmaceutically acceptable salts thereof comprise: allocupreide
sodium, auranofin, aurothioglucose, aurothioglycanide,
azathioprine, brequinar sodium, bucillamine, calcium
3-aurothio-2-propanol-1-sulfonate, chlorambucil, chloroquine,
clobuzarit, cuproxoline, cyclophosphamide, cyclosporin, dapsone,
15-deoxyspergualin, diacerein, glucosamine, gold salts (e.g.,
cycloquine gold salt, gold sodium thiomalate, gold sodium
thiosulfate), hydroxychloroquine, hydroxychloroquine sulfate,
hydroxyurea, kebuzone, levamisole, lobenzarit, melittin,
6-mercaptopurine, methotrexate, mizoribine, mycophenolate mofetil,
myoral, nitrogen mustard, D-penicillamine, pyridinol imidazoles
such as SKNF86002 and SB203580, rapamycin, thiols, thymopoietin and
vincristine. Structurally related SAARDs or DMARDs having similar
analgesic and anti-inflammatory properties are also intended to be
encompassed by this group.
[0344] In another specific embodiment, the present invention is
directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more COX2 inhibitors, prodrug esters, or pharmaceutically
acceptable salts thereof for the treatment of the diseases and
disorders recited herein, including acute and chronic inflammation.
Examples of COX2 inhibitors, prodrug esters, or pharmaceutically
acceptable salts thereof include, for example, celecoxib.
Structurally related COX2 inhibitors having similar analgesic and
anti-inflammatory properties are also intended to be encompassed by
this group.
[0345] In still another specific embodiment, the present invention
is directed to the use of an IFN-L polypeptide in combination
(pretreatment, post-treatment, or concurrent treatment) with any of
one or more antimicrobials, prodrug esters, or pharmaceutically
acceptable salts thereof for the treatment of the diseases and
disorders recited herein, including acute and chronic inflammation.
Antimicrobials include, for example, the broad classes of
penicillins, cephalosporins and other beta-lactams,
aminoglycosides, azoles, quinolones, macrolides, rifamycins,
tetracyclines, sulfonamides, lincosamides and polymyxins. The
penicillins include, but are not limited to, penicillin G,
penicillin V, methicillin, nafcillin, oxacillin, cloxacillin,
dicloxacillin, floxacillin, ampicillin, ampicillin/sulbactam,
amoxicillin, amoxicillin/clavulanate, hetacillin, cyclacillin,
bacampicillin, carbenicillin, carbenicillin indanyl, ticarcillin,
ticarcillin/clavulanate, azlocillin, mezlocillin, peperacillin, and
mecillinam. The cephalosporins and other beta-lactams include, but
are not limited to, cephalothin, cephapirin, cephalexin,
cephradine, cefazolin, cefadroxil, cefaclor, cefamandole,
cefotetan, cefoxitin, ceruroxime, cefonicid, ceforadine, cefixime,
cefotaxime, moxalactam, ceftizoxime, cetriaxone, cephoperazone,
ceftazidime, imipenem and aztreonam. The aminoglycosides include,
but are not limited to, streptomycin, gentamicin, tobramycin,
amikacin, netilmicin, kanamycin and neomycin. The azoles include,
but are not limited to, fluconazole. The quinolones include, but
are not limited to, nalidixic acid, norfloxacin, enoxacin,
ciprofloxacin, ofioxacin, sparfloxacin and temafloxacin. The
macrolides include, but are not limited to, erythomycin, spiramycin
and azithromycin. The rifamycins include, but are not limited to,
rifampin. The tetracyclines include, but are not limited to,
spicycline, chlortetracycline, clomocycline, demeclocycline,
deoxycycline, guamecycline, lymecycline, meclocycline,
methacycline, minocycline, oxytetracycline, penimepicycline,
pipacycline, rolitetracycline, sancycline, senociclin and
tetracycline. The sulfonamides include, but are not limited to,
sulfanilamide, sulfamethoxazole, sulfacetamide, sulfadiazine,
sulfisoxazole and co-trimoxazole (trimethoprim/sulfamethoxa- zole).
The lincosamides include, but are not limited to, clindamycin and
lincomycin. The polymyxins (polypeptides) include, but are not
limited to, polymyxin B and colistin.
[0346] Agonists or antagonists of IFN-L polypeptide function may be
used (simultaneously or sequentially) in combination with one or
more cytokines, growth factors, antibiotics, anti-inflammatories,
and/or chemotherapeutic agents as is appropriate for the condition
being treated.
[0347] Other diseases caused by or mediated by undesirable levels
of IFN-L polypeptides are encompassed within the scope of the
invention. Undesirable levels include excessive levels of IFN-L
polypeptides and sub-normal levels of IFN-L polypeptides.
[0348] Uses of IFN-L Nucleic Acids and Polypeptides
[0349] Nucleic acid molecules of the invention (including those
that do not themselves encode biologically active polypeptides) may
be used to map the locations of the IFN-L gene and related genes on
chromosomes. Mapping may be done by techniques known in the art,
such as PCR amplification and in situ hybridization.
[0350] IFN-L nucleic acid molecules (including those that do not
themselves encode biologically active polypeptides), may be useful
as hybridization probes in diagnostic assays to test, either
qualitatively or quantitatively, for the presence of an IFN-L
nucleic acid molecule in mammalian tissue or bodily fluid
samples.
[0351] Other methods may also be employed where it is desirable to
inhibit the activity of one or more IFN-L polypeptides. Such
inhibition may be effected by nucleic acid molecules that are
complementary to and hybridize to expression control sequences
(triple helix formation) or to IFN-L mRNA. For example, antisense
DNA or RNA molecules, which have a sequence that is complementary
to at least a portion of an IFN-L gene can be introduced into the
cell. Anti-sense probes may be designed by available techniques
using the sequence of the IFN-L gene disclosed herein. Typically,
each such antisense molecule will be complementary to the start
site (5' end) of each selected IFN-L gene. When the antisense
molecule then hybridizes to the corresponding IFN-L mRNA,
translation of this mRNA is prevented or reduced. Anti-sense
inhibitors provide information relating to the decrease or absence
of an IFN-L polypeptide in a cell or organism.
[0352] Alternatively, gene therapy may be employed to create a
dominant-negative inhibitor of one or more IFN-L polypeptides. In
this situation, the DNA encoding a mutant polypeptide of each
selected IFN-L polypeptide can be prepared and introduced into the
cells of a patient using either viral or non-viral methods as
described herein. Each such mutant is typically designed to compete
with endogenous polypeptide in its biological role.
[0353] In addition, an IFN-L polypeptide, whether biologically
active or not, may be used as an immunogen, that is, the
polypeptide contains at least one epitope to which antibodies may
be raised. Selective binding agents that bind to an IFN-L
polypeptide (as described herein) may be used for in vivo and in
vitro diagnostic purposes, including, but not limited to, use in
labeled form to detect the presence of IFN-L polypeptide in a body
fluid or cell sample. The antibodies may also be used to prevent,
treat, or diagnose a number of diseases and disorders, including
those recited herein. The antibodies may bind to an IFN-L
polypeptide so as to diminish or block at least one activity
characteristic of an IFN-L polypeptide, or may bind to a
polypeptide to increase at least one activity characteristic of an
IFN-L polypeptide (including by increasing the pharmacokinetics of
the IFN-L polypeptide).
[0354] The IFN-L polypeptides of the present invention can be used
to clone IFN-L polypeptide receptors, using an expression cloning
strategy. Radiolabeled (.sup.125Iodine) IFN-L polypeptide or
affinity/activity-tagged IFN-L polypeptide (such as an Fc fusion or
an alkaline phosphatase fusion) can be used in binding assays to
identify a cell type or cell line or tissue that expresses IFN-L
polypeptide receptors. RNA isolated from such cells or tissues can
be converted to cDNA, cloned into a mammalian expression vector,
and transfected into mammalian cells (such as COS or 293 cells) to
create an expression library. A radiolabeled or tagged IFN-L
polypeptide can then be used as an affinity ligand to identify and
isolate from this library the subset of cells that express the
IFN-L polypeptide receptors on their surface. DNA can then be
isolated from these cells and transfected into mammalian cells to
create a secondary expression library in which the fraction of
cells expressing IFN-L polypeptide receptors is many-fold higher
than in the original library. This enrichment process can be
repeated iteratively until a single recombinant clone containing an
IFN-L polypeptide receptor is isolated. Isolation of the IFN-L
polypeptide receptors is useful for identifying or developing novel
agonists and antagonists of the IFN-L polypeptide signaling
pathway. Such agonists and antagonists include soluble IFN-L
polypeptide receptors, anti-IFN-L polypeptide receptor antibodies,
small molecules, or antisense oligonucleotides, and they may be
used for treating, preventing, or diagnosing one or more of the
diseases or disorders described herein.
[0355] A deposit of cDNA encoding human IFN-L polypeptide,
subcloned into pSPORT1 (Gibco BRL) and transfected into E. coli
strain DH10B, having Accession No. PTA-976, were made with the
American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209 on Nov. 23, 1999.
[0356] The following examples are intended for illustration
purposes only, and should not be construed as limiting the scope of
the invention in any way.
EXAMPLE 1
Cloning of the Rat IFN-L Polypeptide Gene
[0357] Generally, materials and methods as described in Sambrook et
al. supra were used to clone and analyze the gene encoding rat
IFN-L polypeptide.
[0358] Sequences encoding the rat IFN-L polypeptide were isolated
from a rat placenta cDNA library by large scale random cDNA
sequencing in combination with computer-assisted analysis. To
construct the rat placenta cDNA library, rat embryo day 17 [E17]
placenta mRNA was prepared by standard methods (Chomczynski and
Sacchi, 1987, Anal. Biochem. 162:156). Following synthesis using
the Superscript Plasmid cDNA kit (Gibco BRL), rat cDNA was
subcloned into the Sal I and Not I sites of the pSPORT1 vector
(Gibco BRL).
[0359] Sequence analysis of the full-length cDNA for rat IFN-L
polypeptide indicated that the gene comprises a 573 bp open reading
frame encoding a protein of 191 amino acids (FIG. 1A-1B). The rat
IFN-L polypeptide sequence is predicted to contain a signal peptide
(FIG. 1A, predicted signal peptide indicated by underline). The rat
IFN-L polypeptide sequence was identified as being a novel member
of the interferon family of proteins following comparisons of the
rat IFN-L polypeptide sequence with protein sequences in the
GenBank database.
EXAMPLE 2
Cloning of the Human IFN-L Polypeptide Gene
[0360] Generally, materials and methods as described in Sambrook et
al. supra were used to clone and analyze the gene encoding human
IFN-L polypeptide.
[0361] An examination of the genomic structure of known members of
the Interferon gene family revealed that members of this family
share a unique intronless structure. Sequences encoding the human
IFN-L polypeptide were, therefore, isolated by screening a human
genomic DNA library with a probe derived from the rat IFN-L
polypeptide gene.
[0362] A radioactive rat IFN-L probe was generated by polymerase
chain reaction (PCR) amplification of rat IFN-L polypeptide cDNA.
Polymerase chain reactions (PCR) were performed using a
Perkin-Elmer 9600 thermocycler (PE Biosystems, Foster City, Calif.)
and the following reaction conditions: 20 ng of rat IFN-L
polypeptide cDNA, 20 pmol each of primers 1795-01
(5'-A-T-G-A-C-A-C-T-G-A-A-G-T-A-T-T-T-A-T-G-G-3'; SEQ ID NO: 20)
and 1795-02 (5'-A-T-T-C-A-T-G-T-T-G-A-G-T-A-G-T-T-T-G-T-A-3'; SEQ
ID NO: 21), 1 mmol each of dATP, dTTP, dGTP, 0.01 mmol dCTP, 100
.mu.Ci .sup.32P-dCTP, 4 mM MgCl.sub.2, 1X PCR buffer, and 5U Taq
polymerase (PE Biosystems). A "cold" PCR reaction (i.e., one not
performed in the presence of radioactively labeled dCTP, and
utilizing a balanced dNTP mix) was prepared simultaneously with the
labeled reaction. Amplification reactions were carried out at
94.degree. C. for 30 seconds, 60.degree. C. for 30 seconds, and
72.degree. C. for 1 minute for 45 cycles. Pooled labeled and
unlabeled probe was purified using a Quick Spin G-50 column
(Qiagen), boiled at 100.degree. C. for 10 minutes, and chilled on
ice for 20 minutes prior to addition to the hybridization solution.
Probes with a specific activity of at least 5.times.10.sup.5
cpm/.mu.L were generated using this method.
[0363] Sequences encoding the human IFN-L polypeptide were isolated
by screening a human lambda genomic DNA library (Stratagene, Cat.
No. 946206). For the primary screen, 1.times.10.sup.6 clones were
plated at a density of 50,000 colonies/plate and transferred to
nitrocellulose filters using standard techniques. Positive clones
were re-screened prior to analysis.
[0364] The rat IFN-L probe was hybridized to the filters overnight
at 42.degree. C. in 30% formamide, 5X SSC, 2X Denhart's, 10
.mu.g/mL salmon sperm DNA, 0.2% SDS, 2 mM EDTA, and 0.1%
pyrophosphate. Following hybridization, filters were washed for
30-60 minutes at room temperature in 1X SSC and 0.1% SDS and then
for 15 minutes at 55.degree. C. in 0.2X SSC and 0.1% SDS.
[0365] Three positive clones were recovered following primary and
secondary screening, and lambda phage DNA was prepared by a solid
plate culture method. The Not I insert was excised from the clones
and ligated into pSPORT1 (Gibco BRL), and these ligations were
subsequently used to transform E. coli strain DH10. Following
transformation, plasmids were recovered using a Spin Column plasmid
prep kit (Qiagen).
[0366] Plasmids derived from the three positive genomic DNA clones
were analyzed by Southern blot analysis using the rat IFN-L probe
utilized in the genomic DNA library screening. After digesting the
recovered plasmid DNA with Hind III, the digested fragments were
resolved on an agarose gel, and then transferred to a nylon
membrane. Hybridization conditions were identical to those utilized
in the genomic DNA library screen. Southern blot analysis indicated
that the three positive genomic clones were likely to contain
identical genomic inserts. The fragments hybridizing with the rat
IFN-L probe were subsequently subcloned into pSPORT1 for sequencing
analysis. This analysis confirmed that the three positive genomic
DNA clones contained identical genomic inserts.
[0367] Sequence analysis of the three genomic clones containing
sequences encoding human IFN-L polypeptide indicated that the gene
comprises a 621 bp open reading frame encoding a protein of 207
amino acids (FIGS. 2A-2B). The human IFN-L polypeptide sequence is
predicted to contain a signal peptide (FIG. 2A, predicted signal
peptide indicated by underline). Sequence analysis of IFN-L
polypeptide strongly suggests that the protein is a secreted
cytokine molecule.
[0368] A similarity of 64% was observed between the open reading
frame of the human IFN-L gene and that of the rat IFN-L cDNA. FIG.
3 illustrates the amino acid sequence alignment of human IFN-L
polypeptide (SEQ ID NO: 2), human IFN-p (SEQ ID NO: 7), and rat
IFN-L polypeptide (SEQ ID NO: 4). Human IFN-L polypeptide is 30%
identical to human IFN-p. Human IFN-L polypeptide is 40.5%
identical to and 50% similar to rat IFN-L polypeptide. All five
predicted cysteine residues in human IFN-L polypeptide are
perfectly aligned with those in rat IFN-L polypeptide.
EXAMPLE 3
IFN-L mRNA Expression
[0369] Developmental expression patterns of IFN-L mRNA were
determined by Northern blot analysis using a .sup.32P-labeled
full-length rat cDNA probe to detect the presence of the IFN-L
polypeptide transcript in several different stages of mouse and rat
embryos. RNA was isolated from the rat and mouse embryos using the
same techniques employed for the construction of the rat placenta
cDNA library. Northern blots were prehybridized in 40% formamide,
5X SSC, 1 mM EDTA, and 0.1% for 4 hours at 42.degree. C. The blots
were hybridized overnight at 42.degree. C. in the same solution,
except for the addition of the rat IFN-L probe. Following
hybridization, blots were washed for 30 minutes at 60.degree. C. in
1X SSC and 0.1% SDS.
[0370] Expression of IFN-L mRNA was examined in various human
tissues by RT-PCR using standard techniques. Human IFN-L mRNA was
detected in pancreas, small intestine, prostrate, uterus, thyroid,
and placenta. The expression of IFN-L mRNA is localized by in situ
hybridization. A panel of normal embryonic and adult mouse tissues
is fixed in 4% paraformaldehyde, embedded in paraffin, and
sectioned at 5 .mu.m. Sectioned tissues are permeabilized in 0.2 M
HCl, digested with Proteinase K, and acetylated with
triethanolamine and acetic anhydride. Sections are prehybridized
for 1 hour at 60.degree. C. in hybridization solution (300 mM NaCl,
20 mM Tris-HCl, pH 8.0, 5 mM EDTA, 1X Denhardt's solution, 0.2%
SDS, 10 mM DTT, 0.25 mg/ml tRNA, 25 .mu.g/ml polyA, 25 .mu.g/ml
polyc and 50% formamide) and then hybridized overnight at
60.degree. C. in the same solution containing 10% dextran and
2.times.10 .sup.4cpm/.mu.l of a .sup.33P-labeled antisense
riboprobe complementary to the human IFN-L gene. The riboprobe is
obtained by in vitro transcription of a clone containing human
IFN-L cDNA sequences using standard techniques.
[0371] Following hybridization, sections are rinsed in
hybridization solution, treated with RNaseA to digest unhybridized
probe, and then washed in 0.1X SSC at 55.degree. C. for 30 minutes.
Sections are then immersed in NTB-2 emulsion (Kodak, Rochester,
N.Y.), exposed for 3 weeks at 4.degree. C., developed, and
counterstained with hematoxylin and eosin. Tissue morphology and
hybridization signal are simultaneously analyzed by darkfield and
standard illumination for brain (one sagittal and two coronal
sections), gastrointestinal tract (esophagus, stomach, duodenum,
jejunum, ileum, proximal colon, and distal colon), pituitary,
liver, lung, heart, spleen, thymus, lymph nodes, kidney, adrenal,
bladder, pancreas, salivary gland, male and female reproductive
organs (ovary, oviduct, and uterus in the female; and testis,
epididymus, prostate, seminal vesicle, and vas deferens in the
male), BAT and WAT (subcutaneous, peri-renal), bone (femur), skin,
breast, and skeletal muscle.
EXAMPLE 4
Production of IFN-L Polypeptides
[0372] A. Expression of IFN-L Polypeptides in Bacteria
[0373] PCR was used to amplify template DNA sequences encoding
either human or rat IFN-L polypeptide using primers that
corresponded to the 5' and 3' ends of the sequence (Table I) and
which incorporated restriction enzyme sites to permit insertion of
the amplified product into an expression vector. Following
amplification, PCR products were gel purified, digested with the
appropriate restriction enzymes, and ligated into the expression
vector pAMG21 (ATCC No. 98113) using standard recombinant DNA
techniques. After the ligation of PCR insert and vector sequences,
the ligation reaction mixtures were used to transform an E. coli
host strain (e.g., Amgen strain #2596) by electroporation and
transformants were selected for kanamycin drug resistance. Plasmid
DNA from selected colonies was isolated and subjected to DNA
sequencing to confirm the presence of an appropriate insert.
[0374] To construct a rat IFN-L polypeptide bacterial expression
vector, IFN-L nucleic acid sequences were amplified from a cDNA
template using the primers 1825-22 and 1825-21. The PCR product
that was obtained following amplification with these primers was
inserted into the Nde I and Bam HI sites of pAMG21, and the
ligation reaction was then used in bacterial transformation.
[0375] The resulting bacterial clone was designated Amgen strain
#3729. FIG. 4 illustrates the nucleotide sequence of the pAMG21
insert of Amgen strain #3729 and the predicted amino acid sequence
encoded by this insert.
[0376] A rat IFN-L polypeptide bacterial expression vector, in
which the cysteine at position 180 was substituted with a serine
residue, was constructed using the primers 1825-22 and 1909-56. The
PCR product that was obtained following amplification with these
primers was inserted into the Nde I and Bam HI sites of pAMG21, and
the ligation reaction was then used in bacterial
transformation.
3TABLE I SEQ ID Oligonucleotide ID Sequence 22 1825-22
5'-GAATAACATATGTGTGTATATCTCGATCATACTATCTTGGAGAA- TATG-3' 23 1825-21
5'-CCGCGGATCCATTAATTCATGTTCAGCAGTTTGTA-
AAAAATACTGAAACAACGACGAATTTCC-3' 24 1909-56
5'-CCGCGGATCCATTAATTCATGTTCAGCAGTTTGTAAAAAATACTGAAAGAACGACGAATTTCC-3'
25 1967-32 5'-TTGATCTAGAAAGGAGGAATAACATATGTGTAACCTGCTGAACGTTC-
ACCTGCGTCGTGTTACCTGG-3' 26 1982-14 5'-CCGCGGATCCATTATTTACG-
ACGGAACAGAGCGGTAAATTTGTAAAAGTAGTACAGGCAACGACGATTTCC-3' 27 1967-33
5'-CCGCGGATCCATTATTTACGACGGAACAGAGCGGTAAATTTGTAAAAGTAGTACAGAGAACG-
ACGGATTTCC-3' 28 2103-87 5'-AAGGAGCATATGCTGGACTGTAACCTGCTG-
AACGTTCAC-3' 29 1200-54 5'-GTTATTGCTCAGCGGTGGCA-3'
[0377] The resulting bacterial clone was designated Amgen strain
#3858. FIG. 5 illustrates the nucleotide sequence of the pAMG21
insert of Amgen strain #3858 and the predicted amino acid sequence
encoded by this insert.
[0378] To construct a human IFN-L polypeptide bacterial expression
vector, IFN-L nucleic acid sequences were amplified from a cDNA
template using the primers 1967-32 and 1982-14. The PCR product
that was obtained following amplification with these primers was
inserted into the Xba I and Bam HI sites of pAMG21, and the
ligation reaction was then used in bacterial transformation. The
resulting bacterial clone was designated Amgen strain #4047. FIG. 6
illustrates the nucleotide sequence of the pAMG21 insert of Amgen
strain #4047 and the predicted amino acid sequence encoded by this
insert.
[0379] A human IFN-L polypeptide bacterial expression vector, in
which the cysteine at position 193 was substituted with a serine
residue, was constructed using the primers 1967-32 and 1967-33. The
PCR product that was obtained following amplification with these
primers was inserted into the Xba I and Bam HI sites of pAMG21, and
the ligation reaction was then used in bacterial transformation.
The resulting bacterial clone was designated Amgen strain #3969.
FIG. 7 illustrates the nucleotide sequence of the pAMG21 insert of
Amgen strain #3969 and the predicted amino acid sequence encoded by
this insert.
[0380] A human IFN-L polypeptide bacterial expression vector,
expressing an N-terminal variant of human IFN-L polypeptide, was
constructed by amplifying plasmid from strain #4047 with the
primers 1967-32 and 1967-33. The PCR product that was obtained
following amplification with these primers was inserted into the
Nde I and Bam HI sites of pAMG21, and the ligation reaction was
then used in bacterial transformation. The resulting bacterial
clone was designated Amgen strain #4182. FIG. 8 illustrates the
nucleotide sequence of the pAMG21 insert of Amgen strain #4182 and
the predicted amino acid sequence encoded by this insert.
[0381] To generate IFN-L polypeptides, transformed host cells were
first incubated in Terrific Broth medium containing 50 .mu.g/mL
kanamycin at 30.degree. C. prior to induction of IFN-L polypeptide.
Expression of IFN-L polypeptide was induced by the addition of 30
ng/mL N-(3-oxohexanoyl)-dl-homoserine lactone followed by a six
hour incubation at either 30.degree. C. or 37.degree. C. Expression
of IFN-L polypeptide was evaluated by centrifugation of the
culture, resuspension and lysis of the bacterial pellets, and
analysis of host cell proteins by SDS-polyacrylamide gel
electrophoresis.
[0382] A single band on an SDS polyacrylamide gel corresponding to
E. coli produced IFN-L polypeptide was excised from the gel and
N-terminal amino acid sequence was determined essentially as
described by Matsudaira et al., 1987, J. Biol. Chem.
262:10-35).
[0383] IFN-L polypeptides were purified as follows. Cells were
first lysed in water by high pressure homogenization and inclusion
bodies were harvested by centrifugation. Solubilized inclusion
bodies were then subjected to a variety of refold conditions.
[0384] B. Construction of IFN-L Polypeptide Mammalian Expression
Vectors
[0385] Native protein and native protein-Fc fusion versions of both
human and rat IFN-L polypeptides were produced in either a CHO or
293 mammalian expression system. Template DNA sequences encoding
IFN-L polypeptide were amplified by PCR using primers corresponding
to the 5' and 3' ends (Table II).
[0386] To construct IFN-L polypeptide expression vectors, IFN-L
nucleic acid sequences were amplified as described below. Rat IFN-L
nucleic acid sequences were obtained using one of three primer
pairs (the forward primer 1847-77 and either 1847-88, 1896-56, or
1896-57). A rat IFN-L polypeptide-Fc fusion construct was generated
by cloning PCR products prepared with the first set of primers,
which incorporated Hind III and Not I cloning sites and no stop
codon. Rat IFN-L soluble polypeptides were generated by cloning PCR
products prepared with the second set of primers, which
incorporated Hind III and Sal I cloning sites and two stop codons,
into pDSR.alpha., or the third set of primers, which incorporated
Hind III and Not I cloning sites and two stop codons, into
pCEP4.
4TABLE II SEQ ID Oligonucleotide ID Sequence 30 1847-77
5'-CCCAAGCTTACCATGACACTGAAGTATTTATG-3' 31 1847-78
5'-AAGGAAAAAAGCGGCCGCATTCATGTTGAGTAG-3' 32 1896-56
5'-ACGCGTCGACTCATCAATTCATGTTGAGTAGTTTG-3' 33 1896-57
5'-AAGGAAAAAAGCGGCCGCTCATCAATTCATGTTGAGTAG-3' 34 1954-45
5'-ACGCGTCGACTTATTATTTCCTCCTGAATAG-3' 35 1954-46
5'-AAGGAAAAAAGCGGCCGCTTATTATTTCCTCCTGAATAGAGC-3' 36 1955-44
5'-CCCAAGCTTACCATGAGCACCAAACCTGATATG-3' 37 1954-47
5'-CCCAAGCTTACCATGATTCAAAAGTGTTTGTGGC-3' 38 1954-48
5'-AAGGAAAAAAGCGGCCGCGCGGCCCTCGATTTTCCTCCTGAATAGAGCTGTAA-3' 39
1954-49 5'-AAGGAAAAAAGCGGCCGCTTTCCTCCTGAATAGAGCTGTAA-3'
[0387] Human IFN-L nucleic acid sequences were obtained using one
of three primer pairs (the forward primer 1954-48 and 1954-49 and
the forward primer 1955-44 and either 1854-45 or 1854-46). A human
IFN-L polypeptide-Fc fusion construct was generated by cloning PCR
products prepared with the first set of primers, which incorporated
Not I cloning sites, no stop codon, and a Factor Xa cleavage site.
Human IFN-L soluble polypeptides were generated by cloning PCR
products prepared with the second set of primers, which
incorporated Hind III and Sal I cloning sites and two stop codons,
into pDSR.alpha., or the third set of primers, which incorporated
Hind III and Not I cloning sites and two stop codons, into pCEP4. A
second forward primer (1954-47) was also utilized in place of
1955-44 to generate constructs possessing two initiation
codons.
[0388] PCR amplifications were performed using a Perkin-Elmer 9600
thermocycler and the following reaction conditions: 20 ng of rat or
human IFN-L polypeptide cDNA, 20 pmol each of the appropriate
primers, 1 mmol of dNTPs, 4 mM MgCl.sub.2, 1X PCR buffer, and 5U
Taq polymerase (PE Biosystems). Amplification reactions were
carried out at 94.degree. C. for 30 seconds, 50.degree. C. for 30
seconds, and 72.degree. C. for 1 minute for 4 cycles followed by
94.degree. C. for 30 seconds, 55.degree. C. for 30 seconds, and
72.degree. C. for 1 minute for 26 cycles.
[0389] PCR products were purified using Qiagen PCR purification
spin columns and then subjected to digestion with the appropriate
restriction endonucleases. Following digestion, fragments were
separated on agarose gels, purified using Qiagen gel purification
spin columns, and ligated into the appropriate vectors. Ligations
were transformed into the E. coli strain DH10. Following sequence
analysis of selected transformants, large-scale plasmid stocks were
prepared for tissue culture transfection.
[0390] C. Expression and Purification of IFN-L Polypeptide in
Mammalian Cells
[0391] IFN-L polypeptide expression constructs were introduced into
293 EBNA or CHO cells using either a lipofection or calcium
phosphate protocol.
[0392] To conduct functional studies on the IFN-L polypeptides that
were produced, large quantities of conditioned media were generated
from a pool of hygromycin selected 293 EBNA clones. The cells were
cultured in 500 cm Nunc Triple Flasks to 80% confluence before
switching to serum free media a week prior to harvesting the media.
Conditioned media was harvested and frozen at -20.degree. C. until
purification.
[0393] Conditioned media was purified by affinity chromatography as
described below. The media was thawed and then passed through a 0.2
.mu.m filter. A Protein G column was equilibrated with PBS at pH
7.0, and then loaded with the filtered media. The column was washed
with PBS until the absorbance at A.sub.280 reached a baseline.
IFN-L polypeptide was eluted from the column with 0.1 M Glycine-HCl
at pH 2.7 and immediately neutralized with 1 M Tris-HCl at pH 8.5.
Fractions containing IFN-L polypeptide were pooled, dialyzed in
PBS, and stored at -70.degree. C.
[0394] For Factor Xa cleavage of the human IFN-L polypeptide-Fc
fusion polypeptide, affinity chromatography-purified protein was
dialyzed in 50 mM Tris-HCl, 100 mM NaCl, 2 mM CaCl.sub.2 at pH 8.0.
The restriction protease Factor Xa was added to the dialyzed
protein at 1/100 (w/w) and the sample digested overnight at room
temperature.
EXAMPLE 5
Biological Activity of IFN-L Polypeptides
[0395] The phosphorylation of IFN-L polypeptide was assayed as
follows. Cell lines were exposed to 1 .mu.g/mL of the rat IFN-L Fc
fusion polypeptide generated in Example 4C or to a control solution
at 37.degree. C. for 15 minutes. Following IFN-L polypeptide
exposure, the cells were lysed and cellular proteins were recovered
and separated by SDS-PAGE. The separated proteins were then
analyzed by Western blot using an anti-pTyr antibody. Several cell
lines showed an increase in cellular protein phosphorylation
following exposure to IFN-L Fc fusion polypeptide.
EXAMPLE 6
Production of Anti-IFN-L Polypeptide Antibodies
[0396] Antibodies to IFN-L polypeptides may be obtained by
immunization with purified protein or with IFN-L peptides produced
by biological or chemical synthesis. Suitable procedures for
generating antibodies include those described in Hudson and Bay,
Practical Immunology (2nd ed., Blackwell Scientific
Publications).
[0397] In one procedure for the production of antibodies, animals
(typically mice or rabbits) are injected with an IFN-L antigen
(such as an IFN-L polypeptide), and those with sufficient serum
titer levels as determined by ELISA are selected for hybridoma
production. Spleens of immunized animals are collected and prepared
as single cell suspensions from which splenocytes are recovered.
The splenocytes are fused to mouse myeloma cells (such as
Sp2/0-Agl4 cells), are first incubated in DMEM with 200 U/mL
penicillin, 200 .mu.g/mL streptomycin sulfate, and 4 mM glutamine,
and are then incubated in HAT selection medium (hypoxanthine,
aminopterin, and thymidine). After selection, the tissue culture
supernatants are taken from each fusion well and tested for
anti-IFN-L antibody production by ELISA.
[0398] Alternative procedures for obtaining anti-IFN-L antibodies
may also be employed, such as the immunization of transgenic mice
harboring human Ig loci for production of human antibodies, and the
screening of synthetic antibody libraries, such as those generated
by mutagenesis of an antibody variable domain.
EXAMPLE 7
Expression of IFN-L Polypeptide in Transgenic Mice
[0399] To assess the biological activity of IFN-L polypeptide, a
construct encoding an IFN-L polypeptide/Fc fusion protein under the
control of a liver specific ApoE promoter is prepared. The delivery
of this construct is expected to cause pathological changes that
are informative as to the function of IFN-L polypeptide. Similarly,
a construct containing the full-length IFN-L polypeptide under the
control of the beta actin promoter is prepared. The delivery of
this construct is expected to result in ubiquitous expression.
[0400] To generate these constructs, PCR is used to amplify
template DNA sequences encoding an IFN-L polypeptide using primers
that correspond to the 5' and 3' ends of the desired sequence and
which incorporate restriction enzyme sites to permit insertion of
the amplified product into an expression vector.
[0401] Following amplification, PCR products are gel purified,
digested with the appropriate restriction enzymes, and ligated into
an expression vector using standard recombinant DNA techniques. For
example, amplified IFN-L polypeptide sequences can be cloned into
an expression vector under the control of the human .beta.-actin
promoter as described by Graham et al., 1997, Nature Genetics,
17:272-74 and Ray et al., 1991, Genes Dev. 5:2265-73.
[0402] Following ligation, reaction mixtures are used to transform
an E. coli host strain by electroporation and transformants are
selected for drug resistance. Plasmid DNA from selected colonies is
isolated and subjected to DNA sequencing to confirm the presence of
an appropriate insert and absence of mutation. The IFN-L
polypeptide expression vector is purified through two rounds of
CsCl density gradient centrifugation, cleaved with a suitable
restriction enzyme, and the linearized fragment containing the
IFN-L polypeptide transgene is purified by gel electrophoresis. The
purified fragment is resuspended in 5 mM Tris, pH 7.4, and 0.2 mM
EDTA at a concentration of 2 mg/mL.
[0403] Single-cell embryos from BDF1X BDF1 bred mice are injected
as described (PCT Pub. No. WO 97/23614). Embryos are cultured
overnight in a CO.sub.2 incubator and 15-20 two-cell embryos are
transferred to the oviducts of a pseudopregnant CD1 female mice.
Offspring obtained from the implantation of microinjected embryos
are screened by PCR amplification of the integrated transgene in
genomic DNA samples as follows. Ear pieces are digested in 20 mL
ear buffer (20 mM Tris, pH 8.0, 10 mM EDTA, 0.5% SDS, and 500 mg/mL
proteinase K) at 55.degree. C. overnight. The sample is then
diluted with 200 mL of TE, and 2 mL of the ear sample is used in a
PCR reaction using appropriate primers.
[0404] At 8 weeks of age, transgenic founder animals and control
animals are sacrificed for necropsy and pathological analysis.
Portions of spleen are removed and total cellular RNA isolated from
the spleens using the Total RNA Extraction Kit (Qiagen) and
transgene expression determined by RT-PCR. RNA recovered from
spleens is converted to cDNA using the SuperScript.TM.
Preamplification System (Gibco-BRL) as follows. A suitable primer,
located in the expression vector sequence and 3' to the IFN-L
polypeptide transgene, is used to prime cDNA synthesis from the
transgene transcripts. Ten mg of total spleen RNA from transgenic
founders and controls is incubated with 1 mM of primer for 10
minutes at 70.degree. C. and placed on ice. The reaction is then
supplemented with 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM
MgCl.sub.2, 10 mM of each dNTP, 0.1 mM DTT, and 200 U of
SuperScript II reverse transcriptase. Following incubation for 50
minutes at 42.degree. C., the reaction is stopped by heating for 15
minutes at 72.degree. C. and digested with 2 U of RNase H for 20
minutes at 37.degree. C. Samples are then amplified by PCR using
primers specific for IFN-L polypeptide.
EXAMPLE 8
Biological Activity of IFN-L Polypeptide in Transgenic Mice
[0405] Prior to euthanasia, transgenic animals are weighed,
anesthetized by isofluorane and blood drawn by cardiac puncture.
The samples are subjected to hematology and serum chemistry
analysis. Radiography is performed after terminal exsanguination.
Upon gross dissection, major visceral organs are subject to weight
analysis.
[0406] Following gross dissection, tissues (i.e., liver, spleen,
pancreas, stomach, the entire gastrointestinal tract, kidney,
reproductive organs, skin and mammary glands, bone, brain, heart,
lung, thymus, trachea, esophagus, thyroid, adrenals, urinary
bladder, lymph nodes and skeletal muscle) are removed and fixed in
10% buffered Zn-Formalin for histological examination. After
fixation, the tissues are processed into paraffin blocks, and 3 mm
sections are obtained. All sections are stained with hematoxylin
and exosin, and are then subjected to histological analysis.
[0407] The spleen, lymph node, and Peyer's patches of both the
transgenic and the control mice are subjected to immunohistology
analysis with B cell and T cell specific antibodies as follows. The
formalin fixed paraffin embedded sections are deparaffinized and
hydrated in deionized water. The sections are quenched with 3%
hydrogen peroxide, blocked with Protein Block (Lipshaw, Pittsburgh,
Pa.), and incubated in rat monoclonal anti-mouse B220 and CD3
(Harlan, Indianapolis, Ind.). Antibody binding is detected by
biotinylated rabbit anti-rat immunoglobulins and peroxidase
conjugated streptavidin (BioGenex, San Ramon, Calif.) with DAB as a
chromagen (BioTek, Santa Barbara, Calif.). Sections are
counterstained with hematoxylin.
[0408] After necropsy, MLN and sections of spleen and thymus from
transgenic animals and control littermates are removed. Single cell
suspensions are prepared by gently grinding the tissues with the
flat end of a syringe against the bottom of a 100 mm nylon cell
strainer (Becton Dickinson, Franklin Lakes, N.J.). Cells are washed
twice, counted, and approximately 1.times.10.sup.6 cells from each
tissue are then incubated for 10 minutes with 0.5 .mu.g
CD16/32(Fc.gamma.III/II) Fc block in a 20 .mu.L volume. Samples are
then stained for 30 minutes at 2-8.degree. C. in a 100 .mu.L volume
of PBS (lacking Ca.sup.+ and Mg.sup.+), 0.1% bovine serum albumin,
and 0.01% sodium azide with 0.5 .mu.g antibody of FITC or
PE-conjugated monoclonal antibodies against CD90.2 (Thy-1.2), CD45R
(B220), CD11b(Mac-1), Gr-1, CD4, or CD8 (PharMingen, San Diego,
Calif.). Following antibody binding, the cells are washed and then
analyzed by flow cytometry on a FACScan (Becton Dickinson).
[0409] While the present invention has been described in terms of
the preferred embodiments, it is understood that variations and
modifications will occur to those skilled in the art. Therefore, it
is intended that the appended claims cover all such equivalent
variations that come within the scope of the invention as claimed.
Sequence CWU 0
0
* * * * *