U.S. patent application number 10/141132 was filed with the patent office on 2002-09-19 for human dna ligase iv.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Haseltine, William A., Wei, Ying-Fei.
Application Number | 20020132331 10/141132 |
Document ID | / |
Family ID | 34798330 |
Filed Date | 2002-09-19 |
United States Patent
Application |
20020132331 |
Kind Code |
A1 |
Wei, Ying-Fei ; et
al. |
September 19, 2002 |
Human DNA Ligase IV
Abstract
A human DNA Ligase IV polypeptide and DNA (RNA) encoding such
polypeptide and a procedure for producing such polypeptide by
recombinant techniques is disclosed. Also disclosed are methods for
utilizing such polypeptide via gene therapy for the treatment of
disorders associated with a defect in DNA Ligase IV. Antagonists
against such polypeptides and their use as a therapeutic to destroy
unwanted cells are also disclosed. Diagnostic assays to detect
mutant DNA Ligase IV genes are also disclosed.
Inventors: |
Wei, Ying-Fei; (Berkeley,
CA) ; Haseltine, William A.; (Washington,
DC) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
9410 KEY WEST AVENUE
ROCKVILLE
MD
20850
|
Assignee: |
Human Genome Sciences, Inc.
9410 Key West Avenue
Rockville
MD
20850
|
Family ID: |
34798330 |
Appl. No.: |
10/141132 |
Filed: |
May 9, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10141132 |
May 9, 2002 |
|
|
|
08461562 |
Jun 5, 1995 |
|
|
|
08461562 |
Jun 5, 1995 |
|
|
|
PCT/US94/12922 |
Nov 8, 1994 |
|
|
|
Current U.S.
Class: |
435/199 ;
435/320.1; 435/325; 435/6.11; 435/69.1; 536/23.2 |
Current CPC
Class: |
C12N 9/93 20130101 |
Class at
Publication: |
435/199 ;
435/69.1; 435/6; 435/320.1; 435/325; 536/23.2 |
International
Class: |
C12N 009/22; C12Q
001/68; C07H 021/04; C12P 021/02; C12N 005/06 |
Claims
What is claimed is:
1. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide encoding the polypeptide
as set forth in SEQ ID NO:2; (b) a polynucleotide capable of
hybridizing to and which is at least 70% identical to the
polynucleotide of (a); and (c) a polynucleotide fragment of the
polynucleotide of (a) or (b).
2. The polynucleotide of claim 1 wherein the polynucleotide is
DNA.
3. The polynucleotide of claim 2 which encodes the polypeptide as
set forth in SEQ ID NO:2.
4. The polynucleotide of claim 2 comprising the nucleotide sequence
of SEQ ID NO:1 from nucleotide 1 to 3325.
5. The polynucleotide of claim 2 comprising the nucleotide sequence
of SEQ ID NO:1 from nucleotide 232 to 3325.
6. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide which encodes a mature
polypeptide encoded by the DNA contained in ATCC Deposit No. 75880;
(b) a polynucleotide which encodes a polypeptide expressed by the
DNA contained in ATCC Deposit No. 75880; (c) a polynucleotide
capable of hybridizing to and which is at least 70% identical to
the polynucleotide of (a) or (b); and (d) a polynucleotide fragment
of the polynucleotide of (a), (b) or (c).
7. A vector containing the DNA of claim 2.
8. A host cell genetically engineered with the vector of claim
7.
9. A process for producing a polypeptide comprising: expressing
from the host cell of claim 8 the polypeptide encoded by said
DNA.
10. A process for producing cells capable of expressing a
polypeptide comprising transforming or transfecting the cells with
the vector of claim 7.
11. A polypeptide selected from the group consisting of (i) a
polypeptide having the deduced amino acid sequence of SEQ ID NO:2
and fragments, analogs and derivatives thereof; (ii) a polypeptide
encoded by the cDNA of ATCC Deposit No. 75880 and fragments,
analogs and derivatives of said polypeptide.
12. A compound effective as an agonist for the polypeptide of claim
11.
13. A compound effective as an antagonist against the polypeptide
of claim 11.
14. A method for the treatment of a patient having need of hABH
comprising: administering to the patient a therapeutically
effective amount of the polypeptide of claim 11.
15. The method of claim 14 wherein said therapeutically effective
amount of the polypeptide is administered by providing to the
patient DNA encoding said polypeptide and expressing said
polypeptide in vivo.
16. A method for the treatment of a patient having need of hABH
comprising: administering to the patient a therapeutically
effective amount of the compound of claim 12.
17. A method for the treatment of a patient having need to inhibit
DNA Ligase IV comprising: administering to the patient a
therapeutically effective amount of the antagonist of claim 13.
18. A process for diagnosing a disease or a susceptibility to a
disease related to expression of the polypeptide of claim 11
comprising: determining a mutation in the nucleic acid sequence
encoding said polypeptide.
19. A diagnostic process comprising: analyzing for the presence of
the polypeptide of claim 11 in a sample derived from a host.
20. A method for identifying antagonists and agonists comprising:
combining DNA Ligase IV, DNA having single-strand breaks and a
compound to be screened under conditions where the single-strand
break would be repaired by the DNA Ligase IV; and determining if
the compound enhances or blocks the repair.
Description
[0001] This application is a divisional of and claims priority
under 35 U.S.C. .sctn. 120 to copending U.S. patent application
Ser. No. 08/461,562, filed Jun. 5, 1995, which is a
continuation-in-part of and claims priority under 35 U.S.C. .sctn.
120 to International Application No. PCT/US94/12922, filed Nov. 8,
1994, each of which is hereby incorporated by reference.
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is Human DNA Ligase IV. The
invention also relates to inhibiting the action of such
polypeptides.
[0003] DNA strand interruptions and gaps are generated during
replication, repair and recombination. In mammalian cell nuclei,
rejoining of such breaks depends on several different DNA
polymerases and DNA ligases. The occurrence of three different DNA
ligases was established previously by biochemical and immunological
characterization of purified enzymes (Tomkinson, A. E., et al., J.
Biol. Chem., 266:21728-21735 (1991)). DNA ligases are enzymes that
catalyze DNA replication, excision repair and recombinational
repair in mammalian cells (Li, J. J. and Kelly, T. J., PNAS, USA,
81:6973-77 (1984) and Wook, R. O. et aL, Cell, 53:97-106 (1988)).
In bacteria, three DNA ligases, namely DNA Ligase I, DNA Ligase II
and DNA Ligase III have been discovered, while in humans all three
have been found but only DNA Ligase I has been cloned.
[0004] A full-length human cDNA encoding DNA Ligase I has been
obtained by functional complementation of a S. cereviasiae cdc9
temperature-sensitive DNA ligase mutant (Barker, D. G., Eur. J.
Biochem., 162:659-67 (1987)). The full-length cDNA encodes a
102-kDa protein of 919 amino acid residues. There is no marked
sequence homology to other known proteins except for microbial DNA
ligases. The active site lysine residue is located at position 568.
DNA Ligase I requires magnesium and ATP for activity. The main
function of DNA Ligase I is the joining of Okazaki fragments during
lagging-strand DNA replication. It also effectively seals
single-strand breaks in DNA and joins restriction enzyme DNA
fragments with staggered ends. The enzyme is also able to catalyze
blunt-end joining of DNA. DNA Ligase I can join oligo (dT)
molecules hydrogen-bonded to poly (dA), but the enzyme differs from
T4 DNA Ligase in being unable to ligate oligo (dT) with a poly (rA)
complementary strand.
[0005] Human DNA Ligase II is more firmly associated with the cell
nuclei. This enzyme is a labile protein, which is rapidly
inactivated at 42.degree. C. DNA Ligase II resembles other
eukaryotic DNA Ligases in requiring ATP as cofactor, but the enzyme
differs from DNA Ligase I in having a much higher association for
ATP. DNA Ligase II catalyzes the formation of phosphodiester bonds
with an oligo (dT).multidot.poly (rA) substrate, but not with an
oligo (rA).multidot.poly (dT) substrate, so it differs completely
from DNA Ligase I in this regard (Arrand, J. E. et aL, J. Biol.
Chem., 261:9079-82 (1986)).
[0006] A recently detected enzyme, which is larger than DNA Ligase
II and apparently unrelated to that protein, has been named DNA
Ligase III (Tomkinson, A. E. et al., J. Biol. Chem., 266:21728-35
(1991)). DNA Ligase III resembles DNA Ligase I, and differs from
DNA Ligase II, in binding only weakly to hydroxylapatite in having
a low affinity, for ATP. DNA Ligase I and III however are not
closely related. DNA Ligase III repairs single strand breaks in DNA
efficiently, but it is unable to perform either blunt-end joining
or AMP-dependent relaxation of supercoiled DNA (Elder, R. H. et
al., Eur. J. Biochem., 203:53-58 (1992)).
[0007] The mechanism for joining of DNA strand interruptions by DNA
ligases has been widely described. The reaction is initiated by the
formation of a covalent enzyme-adenylate complex. Mammalian and
viral DNA ligases employ ATP as cofactor, whereas bacterial DNA
ligases use NAD to generate the adenylyl group. The ATP is cleaved
to AMP and pyrophosphate with the adenylyl residue linked by a
phosphoramidate bond to the e-amino group of a specific lysine
residue at the active site of the protein (Gumport, R. I., et al.,
PNAS, 68:2559-63 (1971)). Reactivated AMP residue of the DNA
ligase-adenylate intermediate is transferred to the 5' phosphate
terminus of a single strand break in double stranded DNA to
generate a covalent DNA-AMP complex with a 5'-5' phosphoanhydride
bond. This reaction intermediate has also been isolated for
microbial and mammalian DNA ligases, but is more short lived than
the adenylylated enzyme. In the final step of DNA ligation,
unadenylylated DNA ligases required for the generation of a
phosphodiester bond catalyzes displacement of the AMP residue
through attack by the adjacent 3'-hydroxyl group on the
adenylylated site.
[0008] The polypeptide of the present invention has been putatively
identified as a human DNA Ligase IV as a result of amino acid
sequence homology.
[0009] In accordance with one aspect of the present invention,
there are provided novel mature polypeptides which are human DNA
Ligase IV, as well as biologically active and diagnostically or
therapeutically useful fragments, analogs and derivatives
thereof.
[0010] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding human
DNA Ligase IV, including mRNAs, DNAs, cDNAs, genomic DNAs as well
as analogs and biologically active and diagnostically or
therapeutically useful fragments thereof.
[0011] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptides by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
human DNA Ligase IV nucleic acid sequence, under conditions
promoting expression of said protein and subsequent recovery of
said protein.
[0012] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, synthesis of DNA and
manufacture of DNA vectors.
[0013] In accordance with another aspect of the present invention
there is provided a method of treating conditions which are related
to insufficient human DNA Ligase IV activity via gene therapy
comprising inserting the DNA Ligase IV gene into a patient's cells
either in vivo or ex vivo. The gene is expressed in transduced
cells and as a result, the protein encoded by the gene may be used
therapeutically, for example, to prevent disorders associated with
defects in DNA, for example, abnormal cellular proliferation, for
example tumors, to treat severe immunosuppression, stunted growth
and lymphoma, as well as cellular hypersensitivity to DNA-damaging
agents.
[0014] In accordance with yet a further aspect of the present
invention, there is also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to human sequences which may be used diagnostically to
detect a mutation in the gene encoding DNA Ligase IV.
[0015] In accordance with yet another aspect of the present
invention, there are provided antagonists to such polypeptides,
which may be manufactured intracellularly or administered through
gene therapy to inhibit the action of such polypeptides, for
example, to target and destroy undesired cells, e.g., cancer
cells.
[0016] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
[0017] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0018] FIG. 1 shows the cDNA sequence (SEQ ID NO:1) and the
corresponding deduced amino sequence (residues 2-623 of SEQ ID
NO:2) of the DNA Ligase IV polypeptide. The standard one letter
abbreviation for amino acids is used.
[0019] FIG. 2 illustrates the amino acid homology between human DNA
Ligase I (upper line As HLIG1 (SEQ ID NO:9)) and human DNA Ligase
IV (lower line HLIG4 (SEQ ID NO:2)).
[0020] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIG. 1 or for the mature polypeptide encoded by the cDNA of the
clone deposited as with the American Type Tissue Culture Collection
("ATCC") on Aug. 31, 1994, and designated ATCC Deposit No. 75880.
The ATCC is located at 10801 University Boulevard, Manassas, Va.
20110-2209, USA, The ATCC deposit was made pursuant to the terms of
the Budapest Treaty on the international recognition of the deposit
of microorganisms for purposes of patent procedure.
[0021] A polynucleotide encoding a polypeptide of the present
invention may be obtained from testis, thymus and heart. The
polynucleotide of this invention was discovered in a cDNA library
derived from human activated T-cells. It is structurally related to
the DNA ligase family. It contains an open reading frame encoding a
protein of 911 amino acid residues. The protein exhibits the
highest degree of homology to rabbit DNA ligase with 29% identity
and 51% similarity over a the entire protein. It is also important
that there is a conserved active lysine residue which is bordered
on either side by a hydrophobic amino acid residue, and the
sequence E-KYDG-R is common to enzymes from different sources such
as mammalian cells, yeasts, vaccinia virus and bacteriophage
T7.
[0022] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIG. 1 or that of the deposited clone or may be a
different coding sequence which coding sequence, as a result of the
redundancy or degeneracy of the genetic code, encodes the same
mature polypeptide as the DNA of FIG. 1 or the deposited cDNA.
[0023] The polynucleotide which encodes for the mature polypeptide
of FIG. 1 or for the mature polypeptide encoded by the deposited
cDNA may include: only the coding sequence for the mature
polypeptide; the coding sequence for the mature polypeptide (and
optionally additional coding sequence) and non-coding sequence,
such as introns or non-coding sequence 5' and/or 3' of the coding
sequence for the mature polypeptide.
[0024] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0025] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 or the polypeptide encoded by the cDNA of
the deposited clone. The variant of the polynucleotide may be a
naturally occurring allelic variant of the polynucleotide or a
non-naturally occurring variant of the polynucleotide.
[0026] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIG. 1 or the same
mature polypeptide encoded by the cDNA of the deposited clone as
well as variants of such polynucleotides which variants encode for
a fragment, derivative or analog of the polypeptide of FIG. 1 or
the polypeptide encoded by the cDNA of the deposited clone. Such
nucleotide variants include deletion variants, substitution
variants and addition or insertion variants.
[0027] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIG. 1 or of the coding sequence of
the deposited clone. As known in the art, an allelic variant is an
alternate form of a polynucleotide sequence which may have a
substitution, deletion or addition of one or more nucleotides,
which does not substantially alter the function of the encoded
polypeptide.
[0028] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0029] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0030] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0031] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIG. 1 (SEQ ID NO:1) or
the deposited cDNA(s).
[0032] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0033] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0034] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0035] The present invention further relates to a DNA Ligase IV
polypeptide which has the deduced amino acid sequence of FIG. 1 or
which has the amino acid sequence encoded by the deposited cDNA, as
well as fragments, analogs and derivatives of such polypeptide.
[0036] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIG. 1 or that encoded by the
deposited cDNA, means a polypeptide which retains essentially the
same biological function or activity as such polypeptide.
[0037] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0038] The fragment, derivative or analog of the polypeptide of
FIG. 1 or that encoded by the deposited cDNA may be (i) one in
which one or more of the amino acid residues are substituted with a
conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes a
substituent group, or (iii) one in which the mature polypeptide is
fused with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene glycol), or
(iv) one in which the additional amino acids are fused to the
mature polypeptide, which is employed for purification of the
mature polypeptide. Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the
teachings herein.
[0039] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0040] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0041] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0042] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0043] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0044] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0045] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the DNA
Ligase IV genes. The culture conditions, such as temperature, pH
and the like, are those previously used with the host cell selected
for expression, and will be apparent to the ordinarily skilled
artisan.
[0046] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0047] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0048] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct MRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0049] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0050] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0051] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0052] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0053] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0054] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0055] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0056] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0057] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0058] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), a-factor, acid phosphatase, or heat shock proteins,
among others. The heterologous structural sequence is assembled in
appropriate phase with translation initiation and termination
sequences, and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
[0059] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0060] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0061] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0062] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0063] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0064] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0065] The DNA Ligase IV polypeptide can be recovered and purified
from recombinant cell cultures by methods including ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0066] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0067] The DNA Ligase IV polypeptides and agonists and antagonists
which are polypeptides, described below, may be employed in
accordance with the present invention by expression of such
polypeptides in vivo, which is often referred to as "gene
therapy."
[0068] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0069] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0070] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0071] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol m, and b-actin
promoters). Other viral promoters which may be employed include,
but are not limited to, adenovirus promoters, thymidine kinase (TK)
promoters, and B19 parvovirus promoters. The selection of a
suitable promoter will be apparent to those skilled in the art from
the teachings contained herein.
[0072] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or hetorologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMI promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the b-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0073] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, y-2, y-AM, PA12, T19-14X,
VT-19-17-H2, yCRE, yCRIP, GP+E-86, GP+envAm12, and DAN cell lines
as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0074] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0075] Once the DNA Ligase IV polypeptide is being expressed
intra-cellularly via gene therapy, it may be used to repair
single-strand breaks in DNA which result from DNA-damaging agents,
e.g., UV radiation. Several human syndromes result from autosomal
recessive inheritance for the DNA ligase gene. These syndromes
cause severe immunodeficiency and greatly increases the
susceptibility of abnormal cellular differentiation due to the
disrepair of DNA while at the cellular level they are characterized
by chromosome instability and hypersensitivity to DNA-damaging
agents. These syndromes include Fanconi's anemia and
Blackfan-diamond anemia.
[0076] The polypeptide of the present invention may also be
employed to treat severe immunosuppression which is the result of a
defect in the DNA ligase III gene and stunted growth and lymphoma
which results from defective rejoining of DNA.
[0077] Similarly, the polynucleotide of the present invention is
also useful for identifying other molecules which have similar
biological activity. An example of a screen for this is isolating
the coding region of the DNA Ligase IV gene by using the known DNA
sequence to synthesize an oligonucleotide probe. Labeled
oligonucleotides having a sequence complementary to that of the
gene of the present invention are used to screen a library of human
cDNA, genomic DNA or mRNA to determine which members of the library
the probe hybridizes to.
[0078] The polypeptide and/or polynucleotide of the present
invention may also be employed in relation to scientific research,
synthesis of DNA and for the manufacture of DNA vectors. The
polypeptide and/or polynucleotide of the present invention may be
sold into the research market. Thus, for example DNA Ligase IV may
be used for ligation of DNA sequences in vitroin a manner similar
to other DNA ligases of the art.
[0079] This invention also provides a method of screening compounds
to identify those which enhance (agonists) or block (antagonists)
the DNA-joining reaction catalyzed by human DNA Ligase IV. An
example of such method comprises combining ATP and DNA Ligase IV
and DNA having single-strand breaks with the compound under
conditions where the DNA ligase would normally cleave ATP to AMP
and the AMP is transferred to the 5' phosphate terminus of a single
strand break in double-stranded DNA to generate a covalent DNA-AMP
complex with the single strand break being subsequently repaired.
The DNA having the single-strand breaks may be supplied in the
above example by mutant cells which are deficient in proteins that
are responsible for strand break repair, for example mutant rodent
cells deficient in XRCC1 and the cdc9 S. Cerevisiae DNA ligase
mutant. The ability of the compound to enhance or block the
catalysis of this reaction could then be measured to determine if
the compound is an effective agonist or antagonist.
[0080] Human DNA Ligase IV is produced and functions
intra-cellulary, therefore, any antagonists must be intra-cellular.
Potential antagonists to human DNA Ligase IV include antibodies
which are produced intra-cellularly. For example, an antibody
identified as antagonizing DNA Ligase IV may be produced
intra-cellularly as a single chain antibody by procedures known in
the art, such as transforming the appropriate cells with DNA
encoding the sigle chain antibody to prevent the function of human
DNA Ligase IV.
[0081] Another potential antagonist is an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix --see
Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of DNA Ligase
IV. The antisense RNA oligonucleotide hybridizes to the mRNA in
vivo and blocks translation of the mRNA molecule into the DNA
Ligase IV (antisense --Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of DNA Ligase
IV.
[0082] Yet another potential antagonist includes a mutated form, or
mutein, of DNA Ligase IV which recognizes DNA but does not repair
single-strand breaks and, therefore, acts to prevent human DNA
Ligase IV from functioning.
[0083] The antagonists may be employed to target undesired cells,
e.g., cancer cells, since the prevention of DNA Ligase IV prevents
repair of single-strand breaks in DNA and will eventually result in
death of the cell.
[0084] The small molecule agonists and antagonists of the present
invention may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the molecule and a
pharmaceutically acceptable carrier or excipient. Such a carrier
includes but is not limited to saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The formulation
should suit the mode of administration.
[0085] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the pharmaceutical compositions
of the present invention may be employed in conjunction with other
therapeutic compounds.
[0086] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc.
[0087] Fragments of the full length Human DNA Ligase IV gene may be
used as a hybridization probe for a cDNA library to isolate the
full length DNA Ligase IV gene and to isolate other genes which
have a high sequence similarity to the DNA Ligase IV gene. Probes
of this type can be, for example, 30, 40, 50 75, 90, 100 or 150
bases. Preferably, however, the probes have between 30 and 50 base
pairs. The probe may also be used to identify a cDNA clone
corresponding to a full length transcript and a genomic clone or
clones that contain the complete gene including regulatory and
promotor regions, exons, and introns. The probe may be labelled,
for example, by radioactivity to facilitate identification of
hypbridization.
[0088] This invention also provides the use of the human DNA Ligase
IV gene as a diagnostic. For example, some diseases result from
inherited defective genes. These genes can be detected by comparing
the sequence of the defective gene with that of a normal one. That
is, a mutant gene would be associated with hypersensitivity to
DNA-damaging agents and an elevated susceptibility to abnormal cell
growth, for example tumors and cancer.
[0089] Individuals carrying mutations in the human DNA Ligase IV
gene may be detected at the DNA level by a variety of techniques.
Nucleic acids used for diagnosis may be obtained from a patient's
cells, such as from blood, urine, saliva, tissue biopsy and autopsy
material. The genomic DNA may be used directly for detection or may
be amplified enzymatically by using PCR (Saiki et al., Nature,
324:163-166 (1986) prior to analysis. RNA or cDNA may also be used
for the same purpose. Deletions or insertions can be detected by a
change in size of the amplified product in comparison to the normal
genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled DNA Ligase IV RNA or alternatively,
radiolabeled DNA Ligase IV antisense DNA sequences. Perfectly
matched sequences can be distinguished from mismatched duplexes by
PNase A digestion or by differences in melting temperatures.
[0090] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing fornamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0091] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase protection and S1
protection or the chemical cleavage method (e.g., Cotton et al.,
PNAS, USA, 85:4397-4401 (1985)).
[0092] Thus, the detection of a specific DNA sequence may be
achieved by method such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing, or the use of restriction
enzymes, e.g., restriction fragment length polymorphisms, and
Southern blotting of genomic DNA. Also, mutations may be detected
by in situ analysis.
[0093] In addition, some diseases are a result of, or are
characterized by, changes in gene expression which can be detected
by changes in the mRNA. Alternatively, the DNA Ligase IV gene can
be used as a reference to identify individuals expressing a
decreased level of DNA Ligase IV protein, e.g., by Northern
blotting.
[0094] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0095] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the cDNA is used to rapidly select primers that do not span more
than one exon in the genomic DNA, thus complicating the
amplification process. These primers are then used for PCR
screening of somatic cell hybrids containing individual human
chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0096] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0097] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0098] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes). The gene of
the present invention has been mapped to chromosome 13q33-34.
[0099] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0100] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0101] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0102] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0103] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0104] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention.
[0105] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0106] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0107] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0108] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 mg of plasmid
or DNA fragment is used with about 2 units of enzyme in about 20 ml
of buffer solution. For the purpose of isolating DNA fragments for
plasmid construction, typically 5 to 50 mg of DNA are digested with
20 to 250 units of enzyme in a larger volume. Appropriate buffers
and substrate amounts for particular restriction enzymes are
specified by the manufacturer. Incubation times of about 1 hour at
37.degree. C. are ordinarily used, but may vary in accordance with
the supplier's instructions. After digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate the
desired fragment.
[0109] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0110] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0111] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 mg of approximately equimolar
amounts of the DNA fragments to be ligated.
[0112] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456457 (1973)
EXAMPLE 1
Bacterial Expression and Purification of DNA Ligase IV
[0113] The DNA sequence encoding DNA Ligase IV, ATCC # 75880 is
initially amplified using PCR oligonucleotide primers corresponding
to the 5' sequences of the processed DNA Ligase IV protein. The 5'
oligonucleotide primer has the sequence 5'
GCGGGATCCATGAGACTAATTCTTCCTCAG 3' (SEQ ID NO:3) contains a Bam HI
restriction enzyme site (underlined) followed by 21 nucleotides of
DNA Ligase IV coding sequence starting from the presumed terminal
amino acid of the processed protein codon. The 3' sequence 5'
GCGCTGCAGTTAAATCAAATACTGGTTllG 3' (SEQ ID NO:4) contains
complementary sequences to a Pst I site (underlined) and is
followed by 21 nucleotides of DNA Ligase IV at C-terminal of DNA
Ligase IV. The restriction enzyme sites correspond to the
restriction enzyme sites on the bacterial expression vector pQE-9
(Qiagen, Inc. 9259 Eton Avenue, Chatsworth, Calif., 91311). pQE-9
encodes antibiotic resistance (Amp.sup.r), a bacterial origin of
replication (ori), an IPTG-regulatable promoter operator (P/O), a
ribosome binding site (RBS), a 6-His tag and restriction enzyme
sites. pQE-9 is then digested with Bam HI and Pst I. The amplified
sequences are ligated into pQE-9 and inserted in frame with the
sequence encoding for the histidine tag and the RBS. The ligation
mixture is then used to transform E. coli strain M15/rep 4
available from Qiagen under the trademark M15/rep 4 by the
procedure described in Sambrook, J. et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4
contains multiple copies of the plasmid pREP4, which expresses the
lacI repressor and also confers kanamycin resistance (Kan.sup.r).
Transformants are identified by their ability to grow on LB plates
and ampicillin/kanamycin resistant colonies are selected. Plasmid
DNA is isolated and confirmed by restriction analysis. Clones
containing the desired constructs are grown overnight (O/N) in
liquid culture in LB media supplemented with both Amp (100 ug/ml)
and Kan (25 ug/ml). The O/N culture is used to inoculate a large
culture at a ratio of 1:100 to 1:250. The cells are grown to an
optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells are grown an extra 3 to 4 hours. Cells are then harvested by
centrifugation. The cell pellet is solubilized in the chaotropic
agent 6 Molar Guanidine HCl. After clarification, solubilized
protein extract is purified from this solution by chromatography on
a Nickel-Chelate column under conditions that allow for tight
binding by proteins containing the 6-His tag (Hochuli, E. et al.,
J. Chromatography 411:177-184 (1984)) and eluted from the column in
6 molar guanidine HCl pH 5.0 and for the purpose of renaturation
adjusted to 3 molar guanidine HCl, 100 mM sodium phosphate, 10
mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized).
After incubation in this solution for 12 hours the protein is
dialyzed to 10 mmolar sodium phosphate.
EXAMPLE 2
Cloning and Expression of DNA Ligase IV Using the Baculovirus
Expression System
[0114] A DNA sequence encoding full length DNA Ligase IV protein,
ATCC # 75880, is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0115] The 5' primer has the sequence 5' GCGCCCGGGATGAGACTAATT
[0116] CTTCTCCAG 3' (SEQ ID NO:5) and contains a Sma I restriction
enzyme site (in bold) followed first by 21 nucleotides resembling
an efficient signal for the initiation of translation in eukaryotic
cells (Kozak, M., J. Mol. Biol., 196:947-950, (1987)) (the
initiation codon for translation "ATG" is underlined).
[0117] The 3' primer has the sequence 5'
GCGGGTACCTTAAATCAAATACTGGTTTTC 3' (SEQ ID NO:6) and contains the
cleavage site for the restriction endonuclease Asp 718 (in bold)
and 21 nucleotides complementary to the C-terminal sequence of the
DNA Ligase IV gene. The amplified sequences were isolated from a 1%
agarose gel using a commercially available kit ("Geneclean," BIO
101 Inc., La Jolla, Calif.). The fragment was then digested with
the endonucleases Sma I and Asp 718 and then purified again on a 1%
agarose gel. This fragment is designated F2.
[0118] The vector pRG1 (modification of pVL941 vector, discussed
below) is used for the expression of the DNA Ligase IV protein
using the baculovirus expression system (for review see: Summers,
M. D. and Smith, G. E. 1987, A manual of methods for baculovirus
vectors and insect cell culture procedures, Texas Agricultural
Experimental Station Bulletin No. 1555). This expression vector
contains the strong polyhedrin promoter of the Autographa
californica nuclear polyhedrosis virus (AcMNPV) followed by the
recognition sites for the restriction endonucleases Sma I and Asp
718. The polyadenylation site of the simian virus (SV)40 is used
for efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E.coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of cotransfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V. A. and Summers,
M. D., Virology, 170:31-39).
[0119] The plasmid is digested with the restriction enzymes Sma I
and Asp 718 and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA is then
isolated from a 1% agarose gel using the commercially available kit
("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA is
designated V2.
[0120] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E.coli HB101 cells are then transformed and
bacteria identified that contained the plasmid (pBac DNA Ligase IV)
with the DNA Ligase IV gene using the enzymes Sma I and Asp 718.
The sequence of the cloned fragment is confirmed by DNA
sequencing.
[0121] 5 mg of the plasmid pBac DNA Ligase IV was cotransfected
with 1.0 mg of a commercially available linearized baculovirus
("BaculoGold baculovirus DNA", Pharmingen, San Diego, Calif.) using
the lipofection method (Felgner et al. Proc. Natl. Acad. Sci. USA,
84:7413-7417 (1987)).
[0122] 1 mg of BaculoGold virus DNA and 5 mg of the plasmid pBac
DNA Ligase IV are mixed in a sterile well of a microtiter plate
containing 50 ml of serum free Grace's medium (Life Technologies
Inc., Gaithersburg, Md.). Afterwards 10 ml Lipofectin plus 90 ml
Grace's medium are added, mixed and incubated for 15 minutes at
room temperature. Then the transfection mixture is added dropwise
to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue
culture plate with 1 ml Grace' medium without serum. The plate is
rocked back and forth to mix the newly added solution. The plate is
then incubated for 5 hours at 27.degree. C. After 5 hours the
transfection solution is removed from the plate and 1 ml of Grace's
insect medium supplemented with 10% fetal calf serum is added. The
plate is put back into an incubator and cultivation continued at
27.degree. C. for four days.
[0123] After four days the supernatant is collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) is used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0124] Four days after the serial dilution of the viruses is added
to the cells, blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses is
then resuspended in an Eppendorf tube containing 200 ml of Grace's
medium. The agar is removed by a brief centrifugation and the
supernatant containing the recombinant baculoviruses is used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes are harvested and then stored
at 4.degree. C.
[0125] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-DNA Ligase IV at a multiplicity of infection (MOI) of
2. Six hours later the medium is removed and replaced with SF900 II
medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 mCi of .sup.35S-methionine and 5
mCi .sup.35S cysteine (Amersham) are added. The cells are further
incubated for 16 hours before they are harvested by centrifugation
and the labelled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
Expression of Recombinant DNA Ligase IV in COS Cells
[0126] The expression of plasmid, DNA Ligase IV HA is derived from
a vector pcDNAI/Amp (Invitrogen) containing:1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E.coli replication
origin, 4) CMV promoter followed by a polylinker region, a SV40
intron and polyadenylation site. A DNA fragment encoding the entire
DNA Ligase IV precursor and a HA tag fused in frame to its 3' end
was cloned into the polylinker region of the vector, therefore, the
recombinant protein expression is directed under the CMV promoter.
The HA tag correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H. Niman,
R. Heighten, A Cherenson, M. Connolly, and R. Lemer, Cell 37:767
(1984)). The infusion of HA tag to our target protein allows easy
detection of the recombinant protein with an antibody that
recognizes the HA epitope.
[0127] The plasmid construction strategy is described as
follows:
[0128] The DNA sequence encoding DNA Ligase IV, ATCC # 75880, is
constructed by PCR on the original EST cloned using two primers:
the 5' primer 5' GCGGAATTCATGAGACTAATTCTTCCTCAG 3' (SEQ ID NO:7)
contains an Eco RI site (underlined) followed by 21 nucleotides of
DNA Ligase IV coding sequence starting from the initiation codon;
the 3' sequence 5' GCGCTCGAGTCAA
[0129] GCGTAGTCTGGGACGTCGTATGGGTAAATCAAATACTGGTTTTGTTC 3' (SEQ ID
NO:8) contains complementary sequences to an Xho I site
(underlined), translation stop codon, HA tag and the last 21
nucleotides of the DNA Ligase IV coding sequence (not including the
stop codon). Therefore, the PCR product contains an Eco RI site,
DNA Ligase IV coding sequence followed by HA tag fused in frame, a
translation termination stop codon next to the HA tag, and an Xho I
site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with Eco RI and Xho I restriction enzyme and ligated.
The ligation mixture is transformed into E. coli strain SURE
(available from Stratagene Cloning Systems, 11099 North Torrey
Pines Road, La Jolla, Calif. 92037) the transformed culture is
plated on ampicillin media plates and resistant colonies are
selected. Plasmid DNA is isolated from transformants and examined
by restriction analysis for the presence of the correct fragment.
For expression of the recombinant DNA Ligase IV, COS cells are
transfected with the expression vector by DEAE-DEXTRAN method (J.
Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory
Manual, Cold Spring Laboratory Press, (1989)). The expression of
the DNA Ligase IV HA protein is detected by radiolabelling and
immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)).
Cells are labelled for 8 hours with .sup.35S-cysteine two days post
transfection. Culture media are then collected and cells are lysed
with detergent (RIPA buffer (150 mM NaCl, 0.1% SDS, 1% NP-40, 0.5%
DOC, 50 mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media are precipitated with a HA
specific monoclonal antibody. Proteins precipitated are analyzed on
15% SDS-PAGE gels.
EXAMPLE 4
Expression Pattern of DNA Ligase IV in Human Tissue
[0130] Northern blot analysis may be performed to examine the
levels of expression of DNA Ligase IV in human tissues. Total
cellular RNA samples are isolated with RNAzol B system (Biotecx
Laboratories, Inc. 6023 South Loop East, Houston, Tex. 77033).
About 15 .mu.g of total RNA isolated from each human tissue
specified is separated on 1% agarose gel and blotted onto a nylon
filter (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold
Spring Harbor Press, (1989)). The labeling reaction is done
according to the Stratagene Prime-It kit with 50 ng DNA fragment.
The labeled DNA is purified with a Select-G-50 column (5 Prime-3
Prime, Inc. 5603 Arapahoe Road, Boulder, Colo. 80303). The filter
containing the particular RNA blot is then hybridized with
radioactive labeled full length DNA Ligase IV gene at 1,000,000
cpm/ml in 0.5 M NaPO.sub.4, pH 7.4 and 7% SDS overnight at
65.degree. C. After wash twice at room temperature and twice at
60.degree. C. with 0.5.times.SSC, 0.1% SDS, the filter is then
exposed at -70.degree. C. overnight with an intensifying screen.
3).
EXAMPLE 5
Expression Via Gene Therapy
[0131] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0132] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0133] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer $further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
$EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0134] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0135] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0136] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0137] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
9 1 3325 DNA human CDS (274)..(3006) 1 ccacagcgct gtagactgcg
ccgcattaga agcctggcct cctgatgctg tgctcttcat 60 ctagacccaa
gccccaggtc gtgggacgat ttctcccgtt tttgactccc tggaactgta 120
ttgcctgctt tacctgcgta catgttgatt ctttctcatg gcaaccccgc aggaaaccat
180 caagatctca ttttacagct gggattctct ggttcacaga ggtaacggag
cttgcccgag 240 gccagttaaa cgagaagatt catcaccgct ttg atg gct gcc tca
caa act tca 294 Met Ala Ala Ser Gln Thr Ser 1 5 caa act gtt gca tct
cac gtt cct ttt gca gat ttg tgt tca act tta 342 Gln Thr Val Ala Ser
His Val Pro Phe Ala Asp Leu Cys Ser Thr Leu 10 15 20 gaa cga ata
cag aaa agt aaa gga cgt gca gaa aaa atc aga cac ttc 390 Glu Arg Ile
Gln Lys Ser Lys Gly Arg Ala Glu Lys Ile Arg His Phe 25 30 35 agg
gaa ttt tta gat tct tgg aga aaa ttt cat gat gct ctt cat aag 438 Arg
Glu Phe Leu Asp Ser Trp Arg Lys Phe His Asp Ala Leu His Lys 40 45
50 55 aac cac aaa gat gtc aca gac tct ttt tat cca gca atg aga cta
att 486 Asn His Lys Asp Val Thr Asp Ser Phe Tyr Pro Ala Met Arg Leu
Ile 60 65 70 ctt cct cag cta gaa aga gag aga atg gcc tat gga att
aaa gaa act 534 Leu Pro Gln Leu Glu Arg Glu Arg Met Ala Tyr Gly Ile
Lys Glu Thr 75 80 85 atg ctt gct aag ctt tat att gag ttg ctt aat
tta cct aga gat gga 582 Met Leu Ala Lys Leu Tyr Ile Glu Leu Leu Asn
Leu Pro Arg Asp Gly 90 95 100 aaa gat gcc ctc aaa ctt tta aac tac
aga aca ccc act gga act cat 630 Lys Asp Ala Leu Lys Leu Leu Asn Tyr
Arg Thr Pro Thr Gly Thr His 105 110 115 gga gat gct gga gac ttt gca
atg att gca tat ttt gtg ttg aag cca 678 Gly Asp Ala Gly Asp Phe Ala
Met Ile Ala Tyr Phe Val Leu Lys Pro 120 125 130 135 aga tgt tta cag
aaa gga agt tta acc ata cag caa gta aac gac ctt 726 Arg Cys Leu Gln
Lys Gly Ser Leu Thr Ile Gln Gln Val Asn Asp Leu 140 145 150 tta gac
tca att gcc agc aat aat tct gct aaa aga aaa gac cta ata 774 Leu Asp
Ser Ile Ala Ser Asn Asn Ser Ala Lys Arg Lys Asp Leu Ile 155 160 165
aaa aag agc ctt ctt caa ctt ata act cag agt tca gca ctt gag caa 822
Lys Lys Ser Leu Leu Gln Leu Ile Thr Gln Ser Ser Ala Leu Glu Gln 170
175 180 aag tgg ctt ata cgg atg atc ata aag gat tta aag ctt ggt gtt
agt 870 Lys Trp Leu Ile Arg Met Ile Ile Lys Asp Leu Lys Leu Gly Val
Ser 185 190 195 cag caa act atc ttt tct gtt ttt cat aat gat gct gct
gag ttg cat 918 Gln Gln Thr Ile Phe Ser Val Phe His Asn Asp Ala Ala
Glu Leu His 200 205 210 215 aat gtc act aca gat ctg gaa aaa gtc tgt
agg caa ctg cat gat cct 966 Asn Val Thr Thr Asp Leu Glu Lys Val Cys
Arg Gln Leu His Asp Pro 220 225 230 tct gta gga ctc agt gat att tct
atc act tta ttt tct gca tca aaa 1014 Ser Val Gly Leu Ser Asp Ile
Ser Ile Thr Leu Phe Ser Ala Ser Lys 235 240 245 cca atg cta gct gct
att gca gat att gag cac att gag aag gat atg 1062 Pro Met Leu Ala
Ala Ile Ala Asp Ile Glu His Ile Glu Lys Asp Met 250 255 260 aaa cat
cag agt ttc tac ata gaa acc aag cta gat ggt gaa cgt atg 1110 Lys
His Gln Ser Phe Tyr Ile Glu Thr Lys Leu Asp Gly Glu Arg Met 265 270
275 caa atg cac aaa gat gga gat gta tat aaa tac ttc tct cga aat gga
1158 Gln Met His Lys Asp Gly Asp Val Tyr Lys Tyr Phe Ser Arg Asn
Gly 280 285 290 295 tat aac tac act gat cag ttt ggt gct tct cct act
gaa ggt tct ctt 1206 Tyr Asn Tyr Thr Asp Gln Phe Gly Ala Ser Pro
Thr Glu Gly Ser Leu 300 305 310 acc cca ttc att cat aat gca ttc aaa
gca gat ata caa atc tgt att 1254 Thr Pro Phe Ile His Asn Ala Phe
Lys Ala Asp Ile Gln Ile Cys Ile 315 320 325 ctt gat ggt gag atg atg
gcc tat aat cct aat aca caa act ttc atg 1302 Leu Asp Gly Glu Met
Met Ala Tyr Asn Pro Asn Thr Gln Thr Phe Met 330 335 340 caa aag gga
act aag ttt gat att aaa aga atg gta gag gat tct gat 1350 Gln Lys
Gly Thr Lys Phe Asp Ile Lys Arg Met Val Glu Asp Ser Asp 345 350 355
ctg caa act tgt tat tgt gtt ttt gat gta ttg atg gtt aat aat aaa
1398 Leu Gln Thr Cys Tyr Cys Val Phe Asp Val Leu Met Val Asn Asn
Lys 360 365 370 375 aag cta ggg cat gag act ctg aga aag agg tat gag
att ctt agt agt 1446 Lys Leu Gly His Glu Thr Leu Arg Lys Arg Tyr
Glu Ile Leu Ser Ser 380 385 390 att ttt aca cca att cca ggt aga ata
gaa ata gtg cag aaa aca caa 1494 Ile Phe Thr Pro Ile Pro Gly Arg
Ile Glu Ile Val Gln Lys Thr Gln 395 400 405 gct cat act aag aat gaa
gta att gat gca ttg aat gaa gca ata gat 1542 Ala His Thr Lys Asn
Glu Val Ile Asp Ala Leu Asn Glu Ala Ile Asp 410 415 420 aaa aga gaa
gag gga att atg gta aaa caa cct cta tcc atc tac aag 1590 Lys Arg
Glu Glu Gly Ile Met Val Lys Gln Pro Leu Ser Ile Tyr Lys 425 430 435
cca gac aaa aga ggt gaa ggg tgg tta aaa att aaa cca gag tat gtc
1638 Pro Asp Lys Arg Gly Glu Gly Trp Leu Lys Ile Lys Pro Glu Tyr
Val 440 445 450 455 agt gga cta atg gat gaa ttg gac att tta att gtt
gga gga tat tgg 1686 Ser Gly Leu Met Asp Glu Leu Asp Ile Leu Ile
Val Gly Gly Tyr Trp 460 465 470 ggt aaa gga tca cgg ggt gga atg atg
tct cat ttt ctg tgt gca gta 1734 Gly Lys Gly Ser Arg Gly Gly Met
Met Ser His Phe Leu Cys Ala Val 475 480 485 gca gag aag ccc cct cct
ggt gag aag cca tct gtg ttt cat act ctc 1782 Ala Glu Lys Pro Pro
Pro Gly Glu Lys Pro Ser Val Phe His Thr Leu 490 495 500 tct cgt gtt
ggg tct ggc tgc acc atg aaa gaa ctg tat gat ctg ggt 1830 Ser Arg
Val Gly Ser Gly Cys Thr Met Lys Glu Leu Tyr Asp Leu Gly 505 510 515
ttg aaa ttg gcc aag tat tgg aag cct ttt cat aga aaa gct cca cca
1878 Leu Lys Leu Ala Lys Tyr Trp Lys Pro Phe His Arg Lys Ala Pro
Pro 520 525 530 535 agc agc att tta tgt gga aca gag aag cca gaa gta
tac att gaa cct 1926 Ser Ser Ile Leu Cys Gly Thr Glu Lys Pro Glu
Val Tyr Ile Glu Pro 540 545 550 tgt aat tct gtc att gtt cag att aaa
gca gca gag atc gta ccc agt 1974 Cys Asn Ser Val Ile Val Gln Ile
Lys Ala Ala Glu Ile Val Pro Ser 555 560 565 gat atg tat aaa act ggc
tgc acc ttg cgt ttt cca cga att gaa aag 2022 Asp Met Tyr Lys Thr
Gly Cys Thr Leu Arg Phe Pro Arg Ile Glu Lys 570 575 580 ata aga gat
gac aag gag tgg cat gag tgc atg acc ctg gac gac cta 2070 Ile Arg
Asp Asp Lys Glu Trp His Glu Cys Met Thr Leu Asp Asp Leu 585 590 595
gaa caa ctt agg ggg aag gca tct ggt aag ctc gca tct aaa cac ctt
2118 Glu Gln Leu Arg Gly Lys Ala Ser Gly Lys Leu Ala Ser Lys His
Leu 600 605 610 615 tat ata ggt ggt gat gat gaa cca caa gaa aaa aag
cgg aaa gct gcc 2166 Tyr Ile Gly Gly Asp Asp Glu Pro Gln Glu Lys
Lys Arg Lys Ala Ala 620 625 630 cca aag atg aag aaa gtt att gga att
att gag cac tta aaa gca cct 2214 Pro Lys Met Lys Lys Val Ile Gly
Ile Ile Glu His Leu Lys Ala Pro 635 640 645 aac ctt act aac gtt aac
aaa att tct aat ata ttt gaa gat gta gag 2262 Asn Leu Thr Asn Val
Asn Lys Ile Ser Asn Ile Phe Glu Asp Val Glu 650 655 660 ttt tgt gtt
atg agt gga aca gat agc cag cca aag cct gac ctg gag 2310 Phe Cys
Val Met Ser Gly Thr Asp Ser Gln Pro Lys Pro Asp Leu Glu 665 670 675
aac aga att gca gaa ttt ggt ggt tat ata gta caa aat cca ggc cca
2358 Asn Arg Ile Ala Glu Phe Gly Gly Tyr Ile Val Gln Asn Pro Gly
Pro 680 685 690 695 gac acg tac tgt gta att gca ggg tct gag aac atc
aga gtg aaa aac 2406 Asp Thr Tyr Cys Val Ile Ala Gly Ser Glu Asn
Ile Arg Val Lys Asn 700 705 710 ata att ttg tca aat aaa cat gat gtt
gtc aag cct gca tgg ctt tta 2454 Ile Ile Leu Ser Asn Lys His Asp
Val Val Lys Pro Ala Trp Leu Leu 715 720 725 gaa tgt ttt aag acc aaa
agc ttt gta cca tgg cag cct cgc ttt atg 2502 Glu Cys Phe Lys Thr
Lys Ser Phe Val Pro Trp Gln Pro Arg Phe Met 730 735 740 att cat atg
tgc cca tca acc aaa gaa cat ttt gcc cgt gaa tat gat 2550 Ile His
Met Cys Pro Ser Thr Lys Glu His Phe Ala Arg Glu Tyr Asp 745 750 755
tgc tat ggt gat agt tat ttc att gat aca gac ttg aac caa ctg aag
2598 Cys Tyr Gly Asp Ser Tyr Phe Ile Asp Thr Asp Leu Asn Gln Leu
Lys 760 765 770 775 gaa gta ttc tca gga att aaa aat tct aac gag cag
act cct gaa gaa 2646 Glu Val Phe Ser Gly Ile Lys Asn Ser Asn Glu
Gln Thr Pro Glu Glu 780 785 790 atg gct tct ctg att gct gat tta gaa
tat cgg tat tcc tgg gat tgc 2694 Met Ala Ser Leu Ile Ala Asp Leu
Glu Tyr Arg Tyr Ser Trp Asp Cys 795 800 805 tct cct ctc agt atg ttt
cga cgc cac acc gtt tat ttg gac tcg tat 2742 Ser Pro Leu Ser Met
Phe Arg Arg His Thr Val Tyr Leu Asp Ser Tyr 810 815 820 gct gtt att
aat gac ctg agt acc aaa aat gag ggg aca agg tta gct 2790 Ala Val
Ile Asn Asp Leu Ser Thr Lys Asn Glu Gly Thr Arg Leu Ala 825 830 835
att aaa gcc ttg gag ctt cgg ttt cat gga gca aaa gta gtt tct tgt
2838 Ile Lys Ala Leu Glu Leu Arg Phe His Gly Ala Lys Val Val Ser
Cys 840 845 850 855 tta gct gag gga gtg tct cat gta ata att ggg gaa
gat cat agt cgt 2886 Leu Ala Glu Gly Val Ser His Val Ile Ile Gly
Glu Asp His Ser Arg 860 865 870 gtt gca gat ttt aaa gct ttt aga aga
act ttt aag aga aag ttt aaa 2934 Val Ala Asp Phe Lys Ala Phe Arg
Arg Thr Phe Lys Arg Lys Phe Lys 875 880 885 atc cta aaa gaa agt tgg
gta act gat tca ata gac aag tgt gaa tta 2982 Ile Leu Lys Glu Ser
Trp Val Thr Asp Ser Ile Asp Lys Cys Glu Leu 890 895 900 caa gaa gaa
aac cag tat ttg att taaagctagg tttcctagtg aggaaagcct 3036 Gln Glu
Glu Asn Gln Tyr Leu Ile 905 910 ctgatctggc agactcattg cagcaggtgg
taatgataaa atactaaact acattttatt 3096 tttgtatctt aaaaatctat
gcctaaaaag tatcattaca tataggaaaa caataatttt 3156 aacttttaag
gttgaaaaga caatagccca aagccaagaa agaaaaatta tcttgaatgt 3216
agtattcaat gattttttat gatcaaggtg aaataaacag tctaaagaag aggtgttttt
3276 ataatatcca tatagaaatc tagaattttt acttagatac taataaaat 3325 2
911 PRT human 2 Met Ala Ala Ser Gln Thr Ser Gln Thr Val Ala Ser His
Val Pro Phe 1 5 10 15 Ala Asp Leu Cys Ser Thr Leu Glu Arg Ile Gln
Lys Ser Lys Gly Arg 20 25 30 Ala Glu Lys Ile Arg His Phe Arg Glu
Phe Leu Asp Ser Trp Arg Lys 35 40 45 Phe His Asp Ala Leu His Lys
Asn His Lys Asp Val Thr Asp Ser Phe 50 55 60 Tyr Pro Ala Met Arg
Leu Ile Leu Pro Gln Leu Glu Arg Glu Arg Met 65 70 75 80 Ala Tyr Gly
Ile Lys Glu Thr Met Leu Ala Lys Leu Tyr Ile Glu Leu 85 90 95 Leu
Asn Leu Pro Arg Asp Gly Lys Asp Ala Leu Lys Leu Leu Asn Tyr 100 105
110 Arg Thr Pro Thr Gly Thr His Gly Asp Ala Gly Asp Phe Ala Met Ile
115 120 125 Ala Tyr Phe Val Leu Lys Pro Arg Cys Leu Gln Lys Gly Ser
Leu Thr 130 135 140 Ile Gln Gln Val Asn Asp Leu Leu Asp Ser Ile Ala
Ser Asn Asn Ser 145 150 155 160 Ala Lys Arg Lys Asp Leu Ile Lys Lys
Ser Leu Leu Gln Leu Ile Thr 165 170 175 Gln Ser Ser Ala Leu Glu Gln
Lys Trp Leu Ile Arg Met Ile Ile Lys 180 185 190 Asp Leu Lys Leu Gly
Val Ser Gln Gln Thr Ile Phe Ser Val Phe His 195 200 205 Asn Asp Ala
Ala Glu Leu His Asn Val Thr Thr Asp Leu Glu Lys Val 210 215 220 Cys
Arg Gln Leu His Asp Pro Ser Val Gly Leu Ser Asp Ile Ser Ile 225 230
235 240 Thr Leu Phe Ser Ala Ser Lys Pro Met Leu Ala Ala Ile Ala Asp
Ile 245 250 255 Glu His Ile Glu Lys Asp Met Lys His Gln Ser Phe Tyr
Ile Glu Thr 260 265 270 Lys Leu Asp Gly Glu Arg Met Gln Met His Lys
Asp Gly Asp Val Tyr 275 280 285 Lys Tyr Phe Ser Arg Asn Gly Tyr Asn
Tyr Thr Asp Gln Phe Gly Ala 290 295 300 Ser Pro Thr Glu Gly Ser Leu
Thr Pro Phe Ile His Asn Ala Phe Lys 305 310 315 320 Ala Asp Ile Gln
Ile Cys Ile Leu Asp Gly Glu Met Met Ala Tyr Asn 325 330 335 Pro Asn
Thr Gln Thr Phe Met Gln Lys Gly Thr Lys Phe Asp Ile Lys 340 345 350
Arg Met Val Glu Asp Ser Asp Leu Gln Thr Cys Tyr Cys Val Phe Asp 355
360 365 Val Leu Met Val Asn Asn Lys Lys Leu Gly His Glu Thr Leu Arg
Lys 370 375 380 Arg Tyr Glu Ile Leu Ser Ser Ile Phe Thr Pro Ile Pro
Gly Arg Ile 385 390 395 400 Glu Ile Val Gln Lys Thr Gln Ala His Thr
Lys Asn Glu Val Ile Asp 405 410 415 Ala Leu Asn Glu Ala Ile Asp Lys
Arg Glu Glu Gly Ile Met Val Lys 420 425 430 Gln Pro Leu Ser Ile Tyr
Lys Pro Asp Lys Arg Gly Glu Gly Trp Leu 435 440 445 Lys Ile Lys Pro
Glu Tyr Val Ser Gly Leu Met Asp Glu Leu Asp Ile 450 455 460 Leu Ile
Val Gly Gly Tyr Trp Gly Lys Gly Ser Arg Gly Gly Met Met 465 470 475
480 Ser His Phe Leu Cys Ala Val Ala Glu Lys Pro Pro Pro Gly Glu Lys
485 490 495 Pro Ser Val Phe His Thr Leu Ser Arg Val Gly Ser Gly Cys
Thr Met 500 505 510 Lys Glu Leu Tyr Asp Leu Gly Leu Lys Leu Ala Lys
Tyr Trp Lys Pro 515 520 525 Phe His Arg Lys Ala Pro Pro Ser Ser Ile
Leu Cys Gly Thr Glu Lys 530 535 540 Pro Glu Val Tyr Ile Glu Pro Cys
Asn Ser Val Ile Val Gln Ile Lys 545 550 555 560 Ala Ala Glu Ile Val
Pro Ser Asp Met Tyr Lys Thr Gly Cys Thr Leu 565 570 575 Arg Phe Pro
Arg Ile Glu Lys Ile Arg Asp Asp Lys Glu Trp His Glu 580 585 590 Cys
Met Thr Leu Asp Asp Leu Glu Gln Leu Arg Gly Lys Ala Ser Gly 595 600
605 Lys Leu Ala Ser Lys His Leu Tyr Ile Gly Gly Asp Asp Glu Pro Gln
610 615 620 Glu Lys Lys Arg Lys Ala Ala Pro Lys Met Lys Lys Val Ile
Gly Ile 625 630 635 640 Ile Glu His Leu Lys Ala Pro Asn Leu Thr Asn
Val Asn Lys Ile Ser 645 650 655 Asn Ile Phe Glu Asp Val Glu Phe Cys
Val Met Ser Gly Thr Asp Ser 660 665 670 Gln Pro Lys Pro Asp Leu Glu
Asn Arg Ile Ala Glu Phe Gly Gly Tyr 675 680 685 Ile Val Gln Asn Pro
Gly Pro Asp Thr Tyr Cys Val Ile Ala Gly Ser 690 695 700 Glu Asn Ile
Arg Val Lys Asn Ile Ile Leu Ser Asn Lys His Asp Val 705 710 715 720
Val Lys Pro Ala Trp Leu Leu Glu Cys Phe Lys Thr Lys Ser Phe Val 725
730 735 Pro Trp Gln Pro Arg Phe Met Ile His Met Cys Pro Ser Thr Lys
Glu 740 745 750 His Phe Ala Arg Glu Tyr Asp Cys Tyr Gly Asp Ser Tyr
Phe Ile Asp 755 760 765 Thr Asp Leu Asn Gln Leu Lys Glu Val Phe Ser
Gly Ile Lys Asn Ser 770 775 780 Asn Glu Gln Thr Pro Glu Glu Met Ala
Ser Leu Ile Ala Asp Leu Glu 785 790 795 800 Tyr Arg Tyr Ser Trp Asp
Cys Ser Pro Leu Ser Met Phe Arg Arg His 805 810 815 Thr Val Tyr Leu
Asp Ser Tyr Ala Val Ile Asn Asp Leu Ser Thr Lys 820 825 830 Asn Glu
Gly Thr Arg Leu Ala Ile Lys Ala Leu Glu Leu Arg Phe His 835 840 845
Gly Ala Lys Val Val Ser Cys Leu Ala Glu Gly Val Ser His Val Ile 850
855 860 Ile Gly Glu Asp His Ser Arg Val Ala
Asp Phe Lys Ala Phe Arg Arg 865 870 875 880 Thr Phe Lys Arg Lys Phe
Lys Ile Leu Lys Glu Ser Trp Val Thr Asp 885 890 895 Ser Ile Asp Lys
Cys Glu Leu Gln Glu Glu Asn Gln Tyr Leu Ile 900 905 910 3 30 DNA
Artificial sequence Contains a Bam HI restriction enzyme site 3
gcgggatcca tgagactaat tcttcctcag 30 4 30 DNA Artificial sequence
Contains complementary sequence to a Pst I site 4 gcgctgcagt
taaatcaaat actggttttg 30 5 30 DNA Artificial sequence Contains a
Sma I restriction enzyme site 5 gcgcccggga tgagactaat tcttctccag 30
6 30 DNA Artificial sequence Contains the cleavage site for the
restriction endonuclease Asp718 6 gcgggtacct taaatcaaat actggttttc
30 7 30 DNA Artificial sequence Contains an Eco RI site 7
gcggaattca tgagactaat tcttcctcag 30 8 60 DNA Artificial sequence
Contains complementary sequences to an Xho I site 8 gcgctcgagt
caagcgtagt ctgggacgtc gtatgggtaa atcaaatact ggttttgttc 60 9 642 PRT
human 9 Pro Val Glu Asp Ala Cys Trp Lys Pro Gly Gln Lys Val Pro Tyr
Leu 1 5 10 15 Ala Val Ala Arg Thr Phe Glu Lys Ile Glu Glu Val Ser
Ala Arg Leu 20 25 30 Arg Met Val Glu Thr Leu Ser Asn Leu Leu Arg
Ser Val Val Ala Leu 35 40 45 Ser Pro Pro Asp Leu Leu Pro Val Leu
Tyr Ser Leu Asn His Leu Gly 50 55 60 Pro Pro Gln Gln Gly Leu Glu
Leu Gly Val Gly Asp Gly Val Leu Leu 65 70 75 80 Lys Ala Val Ala Gln
Ala Thr Gly Arg Gln Leu Glu Ser Val Arg Ala 85 90 95 Glu Ala Ala
Glu Lys Gly Asp Val Gly Leu Val Ala Glu Asn Ser Arg 100 105 110 Ser
Thr Gln Arg Leu Met Leu Pro Pro Pro Pro Leu Thr Ala Ser Gly 115 120
125 Val Phe Ser Lys Phe Arg Asp Ile Ala Arg Leu Thr Gly Ser Ala Ser
130 135 140 Thr Ala Lys Lys Ile Asp Ile Ile Lys Gly Leu Phe Val Ala
Cys Arg 145 150 155 160 His Ser Glu Ala Arg Phe Ile Ala Arg Ser Leu
Ser Gly Arg Leu Arg 165 170 175 Leu Gly Leu Ala Glu Gln Ser Val Leu
Ala Ala Leu Ser Gln Ala Val 180 185 190 Ser Leu Thr Pro Pro Gly Gln
Glu Phe Pro Pro Ala Met Val Asp Ala 195 200 205 Gly Lys Gly Lys Thr
Ala Glu Ala Arg Lys Thr Trp Leu Glu Glu Gln 210 215 220 Gly Met Ile
Leu Lys Gln Thr Phe Cys Glu Val Pro Asp Leu Asp Arg 225 230 235 240
Ile Ile Pro Val Leu Leu Glu His Gly Leu Glu Arg Leu Pro Glu His 245
250 255 Cys Lys Leu Ser Pro Gly Ile Pro Leu Lys Pro Met Leu Ala His
Pro 260 265 270 Thr Arg Gly Ile Ser Glu Val Leu Lys Arg Phe Glu Glu
Ala Ala Phe 275 280 285 Thr Cys Glu Tyr Lys Tyr Asp Gly Gln Arg Ala
Gln Ile His Ala Leu 290 295 300 Glu Gly Gly Glu Val Lys Ile Phe Ser
Arg Asn Gln Glu Asp Asn Thr 305 310 315 320 Gly Lys Tyr Pro Asp Ile
Ile Ser Arg Ile Pro Lys Ile Lys Leu Pro 325 330 335 Ser Val Thr Ser
Phe Ile Leu Asp Thr Glu Ala Val Ala Trp Asp Arg 340 345 350 Glu Lys
Lys Gln Ile Gln Pro Phe Gln Val Leu Thr Thr Arg Lys Arg 355 360 365
Lys Glu Val Asp Ala Ser Glu Ile Gln Val Gln Val Cys Leu Tyr Ala 370
375 380 Phe Asp Leu Ile Tyr Leu Asn Gly Glu Ser Leu Val Arg Glu Pro
Leu 385 390 395 400 Ser Arg Arg Arg Gln Leu Leu Arg Glu Asn Phe Val
Glu Thr Glu Gly 405 410 415 Glu Phe Val Phe Ala Thr Ser Leu Asp Thr
Lys Asp Ile Glu Gln Ile 420 425 430 Ala Glu Phe Leu Glu Gln Ser Val
Lys Asp Ser Cys Glu Gly Leu Met 435 440 445 Val Lys Thr Leu Asp Val
Asp Ala Thr Tyr Glu Ile Ala Lys Arg Ser 450 455 460 His Asn Trp Leu
Lys Leu Lys Lys Asp Tyr Leu Asp Gly Val Gly Asp 465 470 475 480 Thr
Leu Asp Leu Val Val Ile Gly Ala Tyr Leu Gly Arg Gly Lys Arg 485 490
495 Ala Gly Arg Tyr Gly Gly Phe Leu Leu Ala Ser Tyr Asp Glu Asp Ser
500 505 510 Glu Glu Leu Gln Ala Ile Cys Lys Leu Gly Thr Gly Phe Ser
Asp Glu 515 520 525 Glu Leu Glu Glu His His Gln Ser Leu Lys Ala Leu
Val Leu Pro Ser 530 535 540 Pro Arg Pro Tyr Val Arg Ile Asp Gly Ala
Val Ile Pro Asp His Trp 545 550 555 560 Leu Asp Pro Ser Ala Val Trp
Glu Val Lys Cys Ala Asp Leu Ser Leu 565 570 575 Ser Pro Ile Tyr Pro
Ala Ala Arg Gly Leu Val Asp Ser Asp Lys Gly 580 585 590 Ile Ser Leu
Arg Phe Pro Arg Phe Ile Arg Val Arg Glu Asp Lys Gln 595 600 605 Pro
Glu Gln Ala Thr Thr Ser Ala Gln Val Ala Cys Leu Tyr Arg Lys 610 615
620 Gln Ser Gln Ile Gln Asn Gln Gln Gly Glu Asp Ser Gly Ser Asp Pro
625 630 635 640 Glu Asp
* * * * *