U.S. patent application number 09/796599 was filed with the patent office on 2002-09-12 for thermal cycler including a temperature gradient block.
This patent application is currently assigned to Stratagene. Invention is credited to Danssaert, John Lewis, Shoemaker, Daniel Davis, Shopes, Robert James.
Application Number | 20020127660 09/796599 |
Document ID | / |
Family ID | 22487166 |
Filed Date | 2002-09-12 |
United States Patent
Application |
20020127660 |
Kind Code |
A1 |
Danssaert, John Lewis ; et
al. |
September 12, 2002 |
Thermal cycler including a temperature gradient block
Abstract
A method in which a temperature gradient is generated across a
"gradient" block, and an apparatus comprising a block across which
a temperature gradient can be generated. By setting up such a
gradient, multiple reaction mixtures held in wells on the gradient
block can be simultaneously run at temperatures which differ only
slightly, thereby permitting an optimum temperature for the
reaction to be quickly identified. In a preferred embodiment the
gradient block is integrated into a thermal cycler used for nucleic
acid amplification reactions.
Inventors: |
Danssaert, John Lewis; (San
Diego, CA) ; Shopes, Robert James; (San Diego,
CA) ; Shoemaker, Daniel Davis; (Stanford,
CA) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT &
DUNNER LLP
1300 I STREET, NW
WASHINGTON
DC
20005
US
|
Assignee: |
Stratagene
|
Family ID: |
22487166 |
Appl. No.: |
09/796599 |
Filed: |
March 2, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09796599 |
Mar 2, 2001 |
|
|
|
09364801 |
Jul 30, 1999 |
|
|
|
09364801 |
Jul 30, 1999 |
|
|
|
09115175 |
Jul 14, 1998 |
|
|
|
6054263 |
|
|
|
|
09115175 |
Jul 14, 1998 |
|
|
|
08634826 |
Apr 19, 1996 |
|
|
|
5779981 |
|
|
|
|
08634826 |
Apr 19, 1996 |
|
|
|
08139540 |
Oct 20, 1993 |
|
|
|
5525300 |
|
|
|
|
Current U.S.
Class: |
435/91.3 ;
422/400; 435/286.1; 435/303.1; 435/6.16; 436/174 |
Current CPC
Class: |
B01L 2300/1838 20130101;
G01N 35/0099 20130101; B01L 2200/147 20130101; B01L 2300/1844
20130101; G01N 35/028 20130101; B01L 2300/0829 20130101; B01L
7/5255 20130101; B01L 7/52 20130101; B01L 2300/1822 20130101; B01L
7/525 20130101; Y10S 435/809 20130101; B01L 7/54 20130101; B01L
2300/1827 20130101; G01N 2035/042 20130101; Y10T 436/25
20150115 |
Class at
Publication: |
435/91.3 ; 435/6;
435/286.1; 435/303.1; 422/99; 436/174 |
International
Class: |
C12M 001/38; C12P
019/34 |
Claims
What is claimed is:
1. A method for simultaneously reacting a plurality of reaction
mixtures in an apparatus including a temperature gradient block
comprising the steps of: placing reaction mixtures in a plurality
of reaction wells in said gradient block, said gradient block
having a top portion, first and second oppposing portions, and a
bottom portion, said plurality of reaction mixture wells being
formed in said block between said opposing portions, and generating
a temperature gradient across said gradient block and between said
opposing portions.
2. A method according to claim 1 Wherein said step of generating a
temperature gradient comprises the steps of heating said first
opposing portion of said gradient block, and cooling said second
opposing portion of said gradient block.
3. A method according to claim 1 including the further step of
controlling said temperature gradient using controlling means.
4. A method according to claim 3,wherein said controlling step
comprises the steps of collecting and storing temperature set point
and actual temperature data from said wells, and transmitting said
information to a microprocessor.
5. A method according to claim 1 wherein said apparatus further
comprises at least one additional heat conducting block having a
top portion, first and second opposing portions, and a bottom
portion, and a plurality of reaction mixture wells formed in said
additional block between said opposing portions, the method further
comprising the step of moving said reaction mixtures between said
gradient block and said additional block or blocks.
6. A method for automated temperature cycling of a reaction mixture
using a thermal cycling apparatus comprising at least one heat
conducting block, said block having a plurality of sample wells
spaced between first and second opposing portions and in an upper
surface thereof, the method comprising placing reaction mixtures in
said wells, and generating a temperature gradient across said block
and between said opposing portions by heating said first opposing
portion and cooling said second opposing portion.
7. An apparatus for generating a temperature gradient across a heat
conducting block comprising: a reaction mixture holder, said
reaction mixture holder comprising a heat conducting block having a
top portion, first and second opposing portions, and a bottom
portion, a plurality of reaction mixture wells formed in said top
portion, and between said first and second opposing portions, a
block heater positioned adjacent to said first opposing portion,
and a block cooler positioned adjacent to said second opposing
portion.
8. An apparatus for generating a temperature gradient across a heat
conducting block according to claim 7 wherein said apparatus
further comprises controller means for controlling said block
heater and block cooler.
9. An apparatus for generating a temperature gradient across a heat
conducting block according to claim 7 wherein said heat conducting
block comprises brass.
10. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 8 wherein said controller
means comprises a microprocessor for collecting and storing
temperature set point and actual temperature data.
11. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 7 wherein said plurality
of wells in said heat conducting block are spaced across said top
portion.
12. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 11 wherein said plurality
of wells in said heat conducting block are spaced across said top
portion in parallel, aligned rows.
13. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 7 wherein said holder
further comprises a heater positioned adjacent to said bottom
portion.
14. An apparatus for generating a temperature gradient across a
heat conducting block comprising holding means for holding a
reaction mixture, said holding means comprising: (i) a heat
conducting block having a top portion, first and second opposing
portions, and a bottom portion, and a plurality of reaction mixture
wells formed in said top portion and between said first and second
opposing portions; and (ii) means for generating a temperature
gradient across said heat conducting block and between said first
and second opposing portions.
15. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 14 wherein said means for
generating a temperature gradient comprises means for heating said
first opposing portion of said block, and means for cooling said
second opposing portion of said block.
16. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 14 wherein said apparatus
further comprises at least one additional holding means for holding
a reaction mixture, said additional holding means comprising: (i)
at least one additional heat conducting block including a plurality
of reaction mixture wells; and (ii) means for heating said
additional heat conducting block.
17. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 14 wherein said heat
conducting block comprises brass.
18. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 14 wherein said plurality
of wells in said heat conducting block are spaced across said block
in parallel, aligned rows.
19. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 14 wherein said apparatus
further comprises controller means for generating said temperature
gradient.
20. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 19 wherein said controller
means comprises a microprocessor for collecting and storing
temperature is set point and actual temperature data.
21. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 14 wherein said holder
means further comprises a heating means for heating said bottom
portion.
22. An apparatus for generating a temperature gradient across a
heat conducting block according to claim 16 wherein said apparatus
further comprises robot arm means, controlled by robot arm control
means, for moving said reaction mixture between said holding
means.
23. An automated apparatus for performing molecular biological
reactions comprising at least one temperature controlled block,
said block having a plurality of reaction mixture wells spaced
between first and second opposing portions and in an upper portion
thereof, and a block heater positioned adjacent to said first
opposing portion and capable of generating a temperature gradient
between said first and second opposing portions.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a temperature cycling
apparatus useful for performing nucleic acid amplification, DNA
sequencing and the like which apparatus can include single or
multiple heating and/or cooling blocks containing sample wells
wherein a temperature gradient can be generated across a given
block.
BACKGROUND OF THE INVENTION
[0002] Systems which require multiple or cyclic chemical reactions
to produce a desired product often require careful temperature
control to produce optimal results. Such reactions include nucleic
acid amplification reactions such as the polymerase chain reaction
(PCR) and the ligase chain reaction (LCR). For this reason,
apparatus have been developed which permit the accurate control of
the temperature of reaction vessels in which such amplification
reactions are performed.
[0003] For example, there are a number of thermal "cyclers" used
for DNA amplification and sequencing in the prior art in which one
or more temperature controlled elements or "blocks" hold the
reaction mixture, and the temperature of a block is varied over
time.
[0004] Another prior art system is represented by a temperature
cycler in which multiple temperature controlled blocks are kept at
different desired temperatures and a robotic arm is utilized to
move reaction mixtures from block to block.
[0005] All of these systems include features which allow the user
to program temperatures or temperature profiles over time for a
block on the instrument so that various processes (e.g. denaturing,
annealing and extension) can be efficiently accomplished once the
optimum temperatures for these steps are determined. Importantly,
however, the determination of the optimum temperature for each of
the various steps in any reaction system, and in particular for any
nucleic amplification or incubation reaction involving an annealing
step, is not a simple task.
[0006] PCR is a technique involving multiple cycles that results in
the geometric amplification of certain polynucleotide sequence each
time a cycle is completed. The technique of PCR is well known to
the person of average skill in the art of molecular biology. The
technique of PCR is described in many books, including, PCR: A
Practical Approach, M. J. McPherson, et al., IRL Press (1991), PCR
Protocols: A Guide to Methods and Applications, by Innis, et al.,
Academic Press (1990), and PCR Technology: Principals and
Applications for DNA Amplification, H. A. Erlich, Stockton Press
(1989). PCR is also described in many U.S. Pat. Nos., including
U.S. Pat. Nos., 4,683,195; 4,683,202; 4,800,159; 4,965,188;
4,889,818; 5,075,216; 5,079,352; 5,104,792; 5,023,171; 5,091,310;
and 5,066,584, which are hereby incorporated by reference.
[0007] The PCR technique typically involves the step of denaturing
a polynucleotide, followed by the step of annealing at least a pair
of primer oligonucleotides to the denatured polynucleotide, i.e.,
hybridizing the primer to the denatured polynucleotide template.
After the annealing step, an enzyme with polymerase activity
catalyzes synthesis of a new polynucleotide strand that
incorporates the primer oligonucleotide and uses the original
denatured polynucleotide as a synthesis template. This series of
steps (denaturation, primer annealing, and primer extension)
constitutes a PCR cycle. As cycles are repeated, the amount of
newly synthesized polynucleotide increases geometrically because
the newly synthesized polynucleotides from an earlier cycle can
serve as templates for synthesis in subsequent cycles. Primer
oligonucleotides are typically selected in pairs that can anneal to
opposite strands of a given double-stranded polynucleotide sequence
so that the region between the two annealing sites is
amplified.
[0008] The temperature of the reaction mixture must be varied
during a PCR cycle, and consequently varied many times during a
multicycle PCR experiment. For example, denaturation of DNA
typically takes place at around 90-95.degree. C., annealing a
primer to the denatured DNA is typically performed at around
40-60.degree. C., and the step of extending the annealed primers
with a polymerase is typically performed at around 70-75.degree. C.
Each of these steps has an optimal temperature for obtaining the
desired result. Many experiments are required to determine the
optimal temperature for each step.
[0009] For example, while the temperature at which DNA denatures is
generally between 90-95.degree. C., slight variations in the
particular temperature necessary are observed depending on the
length of the DNA and the percentage of each of the four
deoxynucleotides present (guanine-cytosine pairs and
adenine-thymine pairs). Insufficient heating during the
denaturation step is a common reason for a PCR reaction to fail.
However, overheating during the denaturation step can result in
excessive denaturation of the polymerase.
[0010] Achieving the optimal temperature for the PCR annealing step
is even more critical. An annealing temperature which is too low
will result in non-specific DNA fragments being amplified. At too
high of an annealing temperature, the primers will anneal less
efficiently resulting in decreased yield of the desired product and
possibly reduced purity. In the annealing step, the optimal
temperature will depend on many factors including the length of the
primer and the percentage of each of the four deoxynucleotides
present (guanine-cytosine pairs and adenine-thymine pairs). For a
typical 20-base oligonucleotide primer comprised of roughly 50%
guanine-cytosine, a temperature of 55.degree. C. is a good estimate
for the lower end of the temperature range. However, as one
increases the primer length in order to attain greater primer
specificity, differing annealing temperatures may be required.
Thus, the number of subtle influences on the optimal annealing
temperature makes difficult the task of quickly identifying the
optimum for a given system,
[0011] Achieving the optimal temperature for the extension reaction
is also important for obtaining the desired PCR result. Temperature
may affect both the rate and the accuracy of the extension
reaction. If the rate of the polymerase reaction is too low, then
the newly synthesized polynucleotide may not contain a site for
primer annealing. Additionally, the denatured polynucleotide
sequence for amplification may contain one or more regions of
secondary structure that may form or disappear according to the
temperature selected. Furthermore, several different enzymes with
polymerase activity may be used for PCR. Each enzyme will have its
own optimum temperature for activity, stability and accuracy.
[0012] Determination of the optimal denaturing, annealing, and
extension temperatures for a particular PCR is complicated by the
fact that the optimum will be different for each of the reactions.
Thus, in order to determine the three optimal temperature ranges,
multiple separate experiments must be run where two temperature
variables are held constant while a third temperature variable is
changed. As a result, determination of the optimal temperature for
running a PCR system can be a time consuming task.
[0013] It is therefore an object of the present invention to
provide an efficient means by which optimal reaction temperatures
can be more efficiently identified for PCR and other reactions.
SUMMARY OF THE INVENTION
[0014] To achieve this object, the invention is a method in which a
temperature gradient is generated across a "gradient" block. The
invention also includes an apparatus comprising a block across
which a temperature gradient can be generated. By setting up such a
gradient, multiple reaction mixtures can be simultaneously run at
temperatures which differ only slightly, thereby permitting an
optimum temperature for a given reaction to be quickly identified.
In the most preferred embodiment of the invention the gradient
block is integrated into a thermal cycler. By doing so, it is
possible to run a series of desired reactions using the thermal
cycler immediately upon identification of the optimum reaction
temperature.
[0015] In a first embodiment, the invention is a method for
simultaneously reacting a plurality of reaction mixtures in an
apparatus including a temperature gradient block comprising the
steps of:
[0016] placing reaction mixtures in a plurality of reaction wells
in the gradient block, the gradient block having a top portion,
first and second oppposing portions, and a bottom portion, the
plurality of reaction mixture wells being formed in the block
between the opposing portions, and
[0017] generating a temperature gradient across said gradient block
and between the opposing portions.
[0018] In this embodiment, the step of generating a temperature
gradient may comprise the steps of heating the first opposing
portion of the gradient block, and cooling the second opposing
portion of the gradient block. The method may also include the step
of controlling the temperature gradient using a controlling means.
By using a controlling means, the method may further include the
steps of collecting and storing temperature set point and actual
temperature data from the wells, and transmitting that information
to a microprocessor.
[0019] In another form of the method of the invention, where the
apparatus further comprises at least one additional heat conducting
block having a top portion, first and second opposing portions, and
a bottom portion, and a plurality of reaction mixture wells formed
in the additional block between the opposing portions, the method
may further comprise the step of moving the reaction mixtures
between the gradient block and one or more of the additional block
or blocks.
[0020] In another form, the method employs an apparatus comprising
at least one heat conducting block, the block having a plurality of
sample wells spaced between first and second opposing portions and
in an upper surface thereof, and the method comprises
[0021] placing reaction mixtures in the wells, and
[0022] generating a temperature gradient across the block and
between the opposing portions by heating the first opposing portion
and cooling the second opposing portion.
[0023] The invention also includes an apparatus comprising:
[0024] a reaction mixture holder, the reaction mixture holder
comprising a heat conducting block having a top portion, first and
second opposing portions, and a bottom portion, a plurality of
reaction mixture wells formed in the top portion, and between the
first and second opposing portions,
[0025] a block heater positioned adjacent to the first opposing
portion, and
[0026] a block cooler positioned adjacent to the second opposing
portion.
[0027] In another form, the apparatus of the invention comprises
holding means for holding a reaction mixture, the holding means
including a heat conducting block having a top portion, first and
second opposing portions, and a bottom portion, and a plurality of
reaction mixture wells formed in the top portion and between the
first and second opposing portions; and means for generating a
temperature gradient across the heat conducting block and between
the first and second opposing portions.
[0028] In yet another form, the invention includes an apparatus for
performing molecular biological reactions comprising at least one
temperature controlled block, the block having a plurality of
reaction mixture wells spaced between first and second opposing
portions and in an upper portion thereof, and a block heater
positioned adjacent to the first opposing portion and capable of
generating a temperature gradient between the first and second
opposing portions.
[0029] In a preferred embodiment, the heat conducting block or
"gradient" block is made substantially of, or comprises, brass.
[0030] The apparatus of the invention can include additional
elements. Thus, in an especially preferred embodiment, the
apparatus includes more than one heat conducting block along with
the gradient block. The apparatus may also include a controller for
controlling the temperature gradient across the gradient block, and
in a multi-block apparatus, the controller may also control the
temperature of blocks which are heated or cooled to a uniform
temperature. Preferably, the controller will include a
microprocessor for collecting and storing temperature set point and
actual temperature data, and multiple temperature sensors for
collecting the actual temperature data from the wells and for
transmitting the information to the microprocessor.
[0031] In another embodiment, the plurality of wells in the
gradient block are formed in parallel, aligned rows. Further, where
more than one block is included, the apparatus may include a robot
arm for moving samples between blocks in a programmably
controllable manner.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] The invention will be better understood by reference to the
appended figures of which:
[0033] FIG. 1 is a perspective view of a thermal cycler
incorporating the thermal gradient block of the invention;
[0034] FIG. 2 is a perspective, exploded view, of the thermal
gradient block, surrounding heaters and cooler according to the
invention; and
[0035] FIG. 3 is a block diagram depicting the elements of a
thermal cycler in which the thermal gradient apparatus and method
of the invention may be used.
DETAILED DESCRIPTION OF THE INVENTION
[0036] The present invention relates to a device and method for
creating a thermal gradient across a block, such as a block in
known thermal cyclers for PCR reactions, which enables one to
simultaneously conduct a series of experiments at very close to the
same temperatures. As used herein, the term "block" refers to a
structure, usually metal, which can be temperature controlled and
in which wells have been arranged to accept vessels containing
reaction mixtures or "samples." The phrase "gradient block" as used
herein is intended to describe such a block, except that a gradient
block is a block across which a temperature gradient can be
established. Examples of the specific manner in which such a
temperature gradient can be established are discussed herein,
though those skilled in the art will understand that once the
advantage of having a gradient block is known, many other
variations of the apparatus shown herein can be easily
identified.
[0037] One particular area of utility for the present invention is
in multiple block thermal cyclers. By incorporating the gradient
block of the invention into a multiple block thermal cycler, it is
possible to simultaneously conduct a series of reactions where the
temperature at which the reactions are proceeding is varied across
the gradient block. This permits the rapid determination of the
optimal temperature for that particular reaction.
[0038] FIG. 1 depicts the prior art Stratagene device in which a
thermal gradient block 2 according to the invention has been
incorporated.
[0039] Various components of the cycler depicted in greater detail
in FIGS. 2 and 3 can be seen in FIG. 1, i.e. display 15, keypad 16,
additional blocks 17, 18 and 19 and robot arm 20 (shown in cut-away
view).
[0040] It will be understood that a microprocessor can is be
incorporated into the control electronics of the apparatus, as is
well known. The microprocessor can be used to control the range of
the temperature gradient and also to program the movement of
samples into and out of the thermal gradient block. The
microprocessor executes commands written in software that collect
user input via the keyboard, compare the input to actual
temperatures, and turn off or on the heating or cooling units as
appropriate. The electronics also includes a timer, readable by the
microprocessor. This allows the microprocessor to compare the
elapsed time that the reaction mixture has been in a given block
and compare it to a desired time input by the user.
[0041] The microprocessor will also control the robot arm, which
arm is operated using two stepper motors. One motor raises and
lowers the arm. The other rotates the arm from block to block.
[0042] Thus, those skilled in the art can readily understand how
the thermal gradient block of the invention can be incorporated
into known thermal cyclers.
[0043] Of course, the thermal gradient block of the invention need
not necessarily be incorporated into a known cycler to be
advantageously used. For example, a stand alone unit incorporating
the thermal gradient block could be used in conjunction with known
cyclers so that optimum reaction temperatures could be identified
and then used in those cyclers.
[0044] FIG. 2 provides an exploded view of the components of the
gradient block assembly. Thus, in FIG. 2, the gradient block
apparatus is generally designated by reference number 1. The
apparatus comprises a heat conducting block 2 which incorporates a
number of wells 3 for holding reaction mixtures or the vessels in
which the mixtures can be held. In a portion of block 2, heater 5
fits into opening 4. Heater 5 is a commonly available cylindrically
shaped cartridge type resistive heater (RAMA brand, San Jacinto,
Calif.).
[0045] Depending on the temperature range desired, the opposing
portion of block 2 may simultaneously be cooled using a heat sink
made up of a ribbed aluminum block 7 and a fan 9. Naturally,
whether the heat sink is operated or not, a temperature gradient
will be created between the opposing portions of the block.
However, where the temperature gradient is to be made larger, the
heat sink can be operated. To enhance the ability to create and
maintain a gradient, block 2 is preferably composed of a material
with a relatively low coefficient of thermal conductivity to reduce
the amount of heat flux necessary to create the temperature
gradient across the block. Brass is preferred.
[0046] Where a multiblock system is used (FIG. 1) blocks other than
the gradient block will be constructed of a material with a
relatively high coefficient of thermal conductivity. By doing so,
the blocks can be heated or cooled to a uniform temperature but
will not be thermally conductive enough to require excess heating
or cooling to maintain a temperature. Aluminum is known for such
uses in the prior art.
[0047] Depending on the size of the gradient block and the heating
and cooling capacities of the heater and heat sink, temperature
gradients in excess of 1 to 14.degree. C. across block 2 can be
achieved. Holes 6 may be drilled in block 2 to limit thermal
conductivity, such that parallel aligned rows of wells in the block
tend to be at one temperature. The use of holes also permits the
temperature profile across the gradient block, and from one row of
wells to the next, to be linear.
[0048] Heaters and coolers known in the art may be used. For
example, Peltier thermoelectric devices may be used, though other
passive or active heaters would also be useful (e.g. chilled or
heated liquids or gases).
[0049] As shown in both FIGS. 1 and 2, gradient block 2 preferably
has eight rows of sample wells 3 equally spaced across the block.
Each row can contain five sample wells. 0.5 ml tubes can be used.
The particular number and design of the sample wells can be varied
to modify capacity if desired. If a temperature gradient of
8.degree. C. is formed between the hot and cold portions of the
block, each row of sample wells will differ in temperature by
approximately 1.degree. C.
[0050] Returning to FIG. 2, additional heaters 8 and 10 may also be
employed so that the system can be operated in the same manner as
blocks known in the art, i.e. with uniform heating across the
entire length and width of block 2. Heaters 8 and 10 are
preferrably thin foil type (MINCO brand Minneapolis, Minn.).
Heaters 8 and 10 can also be in conjunction with heater 5 to bring
block 2 to at least the cool portion temperature as quickly as
possible when the system is started or the temperature range over
which block 2 is to be operated is raised.
[0051] Wire connectors 11, 12 and 13 connect the heaters to a power
source. Apparatus 1 may also include a thermostat 14 which can be
used as a high temperature cut-off, which is a desirable safety
feature.
[0052] The block diagram of FIG. 3 depicts a gradient block
(labelled "second block") of the type shown in FIG. 2 as block 2
integrated into a thermal cycler having multiple heating and
cooling blocks. The labels in FIG. 3 are self-explanatory, and the
apparatus described by FIG. 2 differs from a known thermal cycler
only with respect to the substitution of the gradient block for a
non-gradient block. For PCR, the first, second and third blocks in
FIG. 3 may be programmed to be maintained at a temperature range of
between about 25 to 99.degree. C., and are used for denaturing,
annealing and extension respectively. The fourth block is generally
maintained at between 4 and 25.degree. C. and is used for sample
storage after the PCR reaction has completed. The second block,
made of brass, will be used for the annealing step.
[0053] As can be seen in FIG. 3, more than one thermocouple can be
used along the length of the gradient block so that temperatures
along the block can be carefully monitored and used to feed
information back to the control electronics and display.
[0054] The following examples are offered for the purpose of
illustrating, not limiting, the subject invention.
EXAMPLE 1
Use of the Gradient Thermal Cycler for the Polymerease Chain
Reaction
[0055] High temperature primer extension testing of the thermal
gradient system of the invention was carried out using two model
primer/template systems. These two systems exhibit significantly
variable extension product yields depending upon the annealing
temperature used during the extension process. Primer/template set
#1 amplifies a 105 bp region of the human Gaucher gene, while set
#2 amplifies a 540 bp region of the human fucosidase gene. The
thermal gradient system of the invention contains a gradient block
that allowed primer extension using an optimal annealing
temperature range of 42 to 56.degree. C.
[0056] Methods and Materials
[0057] Primer extension reactions were carried out using the
gradient block of the invention. Primer/template test set #1
consisted of a genomic human DNA template and two 22mer oligomers
yielding a 105 bp extension product. The sequence of primer A was
5' CCTGAGGGCTCCCAGAGAGTGG 3'9 (SEQ ID NO:1). The sequence of primer
B was 5' GGTTTAGCACGACCACAACAGC 3' (SEQ ID NO:2). Primer/template
test set #2 consisted of a genomic human DNA template and two
oligomers of 20 and 30 bases respectively yielding a 540 bp
extension product. The sequence of primer A was 5'
AGTCAGGTATCTTTGACAGT 3' (SEQ ID NO:3). The sequence of primer B was
5' AAGCTTCAGGAAAACAGTGAGCAGCGCCTC 3' (SEQ ID NO:4).
[0058] The primer extension reaction mixture consisted of
1.times.Taq DNA polymerase buffer (10 mM tris-HCl pH 8.8, 50 mM
KCl, 1.5 mM MgCl2, .001% (w/v) gelatin), 250 uM each dNTP, 250 ng
each primer and template and 2.5 units Taq DNA polymerase in a 100
.mu.l reaction volume. The reaction mixture was overlayed with 50
.mu.l of nuclease free sterile mineral oil.
[0059] The temperature cycling parameters used were as follows:
1 1 min 94.degree. C. 1 min 42-56.degree. C. (gradient block)
.vertline. .vertline. 1 min 72.degree. C. .vertline. 1 min
94.degree. C. .vertline. 30 cycles 1 min 42-56.degree. C. (gradient
block) .vertline. .vertline. 8 min 72.degree. C. Storage 4.degree.
C.
[0060] Eight reaction mixes were tested per primer/template
set--one per gradient temperature block slot. Annealing
temperatures used were 42, 44, 46, 48, 50, 52, 54 and 56.degree. C.
(two degree C increments across the gradient block). Reactions were
carried out in 500 .mu.l eppendorf tubes.
[0061] Results
[0062] Both primer/template sets 1 and 2 yielded obviously varying
results depending upon the annealing temperature used in the
gradient temperature block. Primer extension products from set #1
varied from the desired single DNA band of size 105 bp (derived
from the extension reaction using a 56.degree. C. annealing
temperature) to a reaction mix yielding multiply sized extraneous
DNA extension products (of approximate size 180, 280 and 800 bp)
from a reaction using a 48.degree. C. annealing temperature. Primer
extension products from set #2 varied from the desired single DNA
band of size 540 bp (derived from the extension reaction using a
42.degree. C. annealing temperature) to a reaction mix yielding an
extraneous DNA extension product of approximately 2000 bp from a
reaction using a 56.degree. C. annealing temperature.
EXAMPLE 2
Use of the Gradient Thermal Cycler for the Ligase Chain
Reaction
[0063] Ligase chain reaction (LCR) is a recently described DNA
amplification technique that can be used to detect trace levels of
known nucleic acid sequences. LCR involves a cyclic two step
reaction which is performed in a DNA thermal cycler machine. The
first step is a high temperature melting step in which double
stranded DNA unwinds to become single stranded. The second step is
a cooling step in which two sets of adjacent, complementary
oligonucleotides anneal to the single stranded target DNA molecules
and are ligated together by a DNA ligase enzyme. The products of
ligation from one cycle serve as templates for the ligation
reaction of the next cycle. Thus, LCR results in the exponential
amplification of ligation products.
[0064] Materials and Methods
[0065] The materials used in this experiment were obtained from
Stratagene, La Jolla, Calif. The optimal temperature for the second
step of the LCR cycle, in which the oligonucleotides are annealed
to the DNA target molecules, was determined empirically by the use
of the gradient thermal cycler of the invention. Two sets of
reactions were set up, one with a wild type template to which the
oligonucleotides were complementary, and one with a mutant template
that differed from the wild type template DNA sequence by one base
transition. The DNA templates used in this experiment were plasmid
constructs containing the pBluescriptII vector and the lac I gene.
The wild-type template contained a normal lac I sequence, and the
mutant template contained a C to T transition mutation at site 191
within the insert. The four oligonucleotide probes consisted of two
pairs of two oligonucleotides each. The first set, A and B, were
adjacent to each other and complementary to one strand of the
target DNA. The second set, C and D, were complementary to the
first set, and therefore occupied adjacent sites on the second
strand of the target DNA. The oligonucleotide probe sequences (5'
to 3') were as follows:
2 A: TTGTGCCACG CGGTTGGGAA TGTA (SEQ ID NO:5) B: AGCAACGACT
GTTTGCCCGC CAGTTC (SEQ ID NO:6) C: TACATTCCCA ACCGCGTGGC ACAAC (SEQ
ID NO:7) D: AACTGGCGGG CAAACAGTCG TTGT (SEQ ID NO:8)
[0066] Oligonucleotide probes A and D were 5'-phosphorylated during
synthesis.
[0067] The sequence of the wild type lac I insert, starting at site
161 of the insert, was as follows: 5' CTGAATTACA TTCCCAACCG
CGTGGCACAA CAACTGGCGG GCAAACAGTC GTTGCTGATT 3' (SEQ ID NO:9)
[0068] The mutant sequence differed from the wild type by a C to T
transition at site 191.
[0069] The LCR experiment was performed as follows: The following
ingredients were combined in a sterile 500-.mu.l of 10.times.Z Pfu
LCR buffer, 15 .mu.l of sterile dH.sub.2O, 1 .mu.l (10 ng of each)
of oligonucleotide mixture, 1 .mu.l (100 pg) of either the
wild-type or mutant plasmid templates or no template, and 1 .mu.l
(4U) of Pfu DNA ligase enzyme. A 25 -.mu.l overlay of sterile
mineral oil was added to the tube. This procedure was repeated so
that there were a total of 5 tubes each of either the wild type
template reaction mixture or the mutant template reaction mixture.
The tubes were placed in the gradient thermal cycler of the
invention in positions 1, 3, 5, 7 and 8, so that at each isothermal
column in the machine, there would be a wild type and a mutant
template reaction. The machine was programmed to cycle between a
high temperature of 92.degree. C. and the gradient block, which was
varied in temperature between 56.degree. C. and 70.degree. C. The
machine was programmed to move to the high temperature block for 4
minutes, then the gradient block for 3 minutes, then to move
between the high temperature block and the gradient block 25 times,
stopping for 1 minute at each block. The ligation chain reaction
products were visualized by electrophoresis on a 6% polyacrylamide
get buffered with TBE, followed by staining with ethidium bromide
and photography under UV light.
[0070] Results
[0071] The wild type template reaction produced the most intense
positive signal in position 8, which corresponds to the coldest
(56.degree. C.) section of the gradient block. The use of the
gradient thermal cycler of the invention allowed the empirical
determination of the best annealing temperature for this reaction
in one experiment.
[0072] There are many modifications and variations of the thermal
gradient block which can advantageously be incorporated into it or
related structures. Further, multiple thermal gradient blocks could
be employed as more than one block of a multi-block thermal cycler
where samples are automatically moved between the various blocks,
thereby allowing for multiple reactions to be operated at multiple
temperatures.
[0073] The invention has been described in detail with respect to
its use with PCR. However, in addition to being exceptionally
useful for the determination of the optimal temperature for
individual steps in a PCR procedure, the invention is also useful
for determining the optimal temperature for numerous other chemical
reactions. These other chemical reactions include any non-PCR
nucleic acid amplification that employs an annealing step analogous
to a PCR annealing step, such as ligase chain reaction (LCR) and
DNA cycle sequencing. Other types of reactions for which the
invention will be useful include DNA sequencing, cDNA synthesis
using a cycling reaction, coupled amplification sequencing (CAS),
rapid amplification of cDNA ends (RACE) and any other incubation
reaction in which incubations must be accomplished at multiple
temperatures.
Sequence CWU 1
1
* * * * *