U.S. patent application number 10/002528 was filed with the patent office on 2002-08-29 for methods and compositions for producing full length cdna libraries.
Invention is credited to Guegler, Karl, Rose, Michael J., Tan, Ruoying.
Application Number | 20020119477 10/002528 |
Document ID | / |
Family ID | 26997568 |
Filed Date | 2002-08-29 |
United States Patent
Application |
20020119477 |
Kind Code |
A1 |
Guegler, Karl ; et
al. |
August 29, 2002 |
Methods and compositions for producing full length cDNA
libraries
Abstract
Methods and compositions are provided for producing full-length
CDNA libraries. In the subject methods, full length first strand
cDNAs are isolated using a fusion protein of an eIF-4E domain and
an eIF-4G domain separated by a flexible linker. Also provided is
the novel fusion protein employed in the subject methods, as well
as nucleic acids encoding, and host cells capable of expressing,
the same. Finally, kits for use in practicing the subject methods
are provided. The subject invention finds use in a variety of
applications in which full-length cDNA libraries are employed.
Inventors: |
Guegler, Karl; (Menlo Park,
CA) ; Tan, Ruoying; (Foster City, CA) ; Rose,
Michael J.; (Palo Alto, CA) |
Correspondence
Address: |
Carol L. Francis
Bozicevic, Field and Francis LLP
Suite 200
200 Middlefield Road
Menlo Park
CA
94025
US
|
Family ID: |
26997568 |
Appl. No.: |
10/002528 |
Filed: |
November 1, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10002528 |
Nov 1, 2001 |
|
|
|
09799645 |
Mar 5, 2001 |
|
|
|
09799645 |
Mar 5, 2001 |
|
|
|
09352540 |
Jul 13, 1999 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/7.1; 530/395; 536/25.4 |
Current CPC
Class: |
C12N 15/1096
20130101 |
Class at
Publication: |
435/6 ; 435/7.1;
536/25.4; 530/395 |
International
Class: |
C12Q 001/68; G01N
033/53; C07H 021/04; C07K 014/00 |
Claims
What is claimed is:
1. A method of isolating a nucleic acid having a 5' end cap
structure, said method comprising: contacting said nucleic acid
with a Fusion Protein comprising an eIF-4E domain and an eIF-4G
domain joined by a linker domain, whereby a complex of said Fusion
Protein and nucleic acid is produced; and isolating said
complex.
2. The method according to claim 1, wherein said nucleic acid is
mRNA.
3. The method according to claim 2, wherein said mRNA lacks a
polyA.sup..div. tail.
4. The method according to claim 1, wherein said nucleic acid is an
mRNA/cDNA duplex.
5. The method according to claim 1, wherein said Fusion Protein is
stably associated with a solid support.
6. A method for generating a cDNA library, said method comprising:
(a) generating a population of blunt-ended mRNA/cDNA duplexes; (b)
contacting said population of blunt-ended mRNA/cDNA duplexes with a
fusion protein comprising an eIF-4E domain and an eIF-4G domain
joined by a linker domain, to produce a reaction mixture including
complexes of said Fusion Protein and blunt-ended mRNA/cDNA
duplexes; and (c) separating said complexes from the remainder of
said reaction mixture.
7. The method according to claim 6, wherein said population of
blunt-ended mRNA/cDNA duplexes are generated by: (a) contacting a
population of mRNAs with a reverse transcriptase under conditions
sufficient to produce a population of mRNA/cDNA duplexes; and
contacting said population of mRNA/cDNA duplexes with an RNAse
under conditions sufficient to degrade single stranded RNA to
produce a population of blunt-ended mRNA/cDNA duplexes.
8. The method according to claim 6, wherein said Fusion Protein is
stably associated with a solid support during said separating
step.
9. A method for generating a cDNA library, said method comprising:
(a) contacting a population of mRNAs with a reverse transcriptase
under conditions sufficient to produce a population of mRNA/cDNA
duplexes; (b) contacting said population of mRNA/cDNA duplexes with
an RNAse under conditions sufficient to degrade single stranded RNA
to produce a population of blunt-ended mRNA/cDNA duplexes; (c)
contacting said population of blunt-ended mRNA/cDNA duplexes with a
fusion protein comprising an eIF-4E domain and an eIF-4G domain
joined by a linker domain, to produce complexes of said Fusion
Protein and blunt-ended mRNA/cDNA duplexes in an aqueous mixture;
(d) separating said complexes from the remainder of said aqueous
mixture; and (e) disrupting said complexes to produce free
blunt-ended mRNA/cDNA duplexes.
10. The method according to claim 9, wherein said Fusion Protein of
said complexes is stably associated with a solid support at least
during said separating step.
11. A Fusion Protein comprising an eIF-4E domain and a eIF-4G
domain separated by a flexible linking domain.
12. The Fusion Protein according to claim 11, wherein said protein
has a binding affinity greater than eIF-4E for a 5' cap structure
of a nucleic acid.
13. The Fusion Protein according to claim 11, wherein said protein
further comprises a ligand domain.
14. The Fusion Protein according to claim 11, wherein said protein
is stably associated with a solid support.
15. A nucleic acid encoding the Fusion Protein according to claim
11.
16. A host cell comprising a nucleic acid according to claim
15.
17. A kit for use in the preparation of a cDNA library, said kit
comprising: a Fusion Protein comprising an eIF-4E domain and a
eIF-4G domain separated by a flexible linking domain.
18. The kit according to claim 17, wherein said Fusion Protein is
stably associated with a surface of a solid support.
19. The kit according to claim 17, wherein said kit further
comprises a reverse transcriptase.
20. The kit according to claim 17, wherein said kit further
comprises an RNAse.
Description
TECHNICAL FIELD
[0001] The field of this invention is cDNA libraries.
BACKGROUND OF THE INVENTION
[0002] A complementary DNA or cDNA is a deoxyribonucleic acid that
contains the information coding for the synthesis of proteins, but
lacks the intervening introns present in genomic DNA. The synthesis
of cDNA, the use of cDNA and libraries of cDNA play a critical role
in a variety of different application in biotechnology and related
fields. Applications in which cDNAs and/or libraries thereof are
employed include gene discovery, differential gene expression
analysis, and the like. A variety of protocols have been developed
to prepare cDNA and libraries thereof, where such methods are
continually being modified.
[0003] In standard methods currently used for the preparation of
cDNA libraries, the mRNA in the cell is isolated by virtue of the
presence of a polyadenylated tail present at its 3' end which binds
to a resin specific for this structure (oligo dT-chromatography).
The purified mRNA is then copied into cDNA using a reverse
transcriptase, which starts at the 3' end of the mRNA and proceeds
towards the 5' end. Second strand synthesis is then performed.
Linkers are added to the ends of the double stranded cDNA to allow
for its packaging into virus or cloning into plasmids. At this
stage, the cDNA is in a form that can be propagated.
[0004] One disadvantage observed with current cDNA library
synthesis protocols is that current methods tend to produce
libraries having a significant proportion of incomplete cDNAs,
which results from inefficiencies in the reverse transcriptase
employed to generate the library. To compensate for the incomplete
cDNA constituents of the library, investigators must perform many
rounds of isolation (screenings) and construct a "full-length" cDNA
from the accumulated pieces. Such processes are resource intensive
and do not ensure that each initial mRNA is represented in the cDNA
library.
[0005] In addition, there is significant under-representation of
sequences close to the 5' end of mRNAs since in cDNA libraries
produced by convention methods. This under-representation results
from the fact that the reverse transcriptase will usually "fall
off" before reaching these sequences.
[0006] Another problem concerning cDNA synthesis is the source and
quality of the mRNA used. Using present day technology, the MRNA
that is used as a source for cDNA synthesis is purified by its 3'
end polyadenylated tail. However, some mRNAs do not possess a 3'
end but all mRNAs have a 5' cap structure. Consequently, a cDNA
library constructed from this source of mRNA would be more
representative of the total genetic information present in the
cell. In recent years, unsuccessful attempts have been made to
develop antibodies directed against the cap structure of mRNA. The
problems usually encountered were related to the insufficient
affinity of the antibodies for the cap. This major drawback made it
impossible to develop isolation protocols for capped mRNAs.
[0007] Therefore, there is continued interest in the development of
new methods of cDNA synthesis.
Relevant Literature
[0008] U.S. Patents of interest include U.S. Pat. No.
5,219,989.
[0009] Strategies for producing full length cDNAs are described in:
Edery, et al., "An efficient strategy to isolate full-length cDNAs
based on an mRNA cap retention procedure (CAPture)," Mol Cell Biol
(June, 1995)15(6):3363-71; Suzuki et al.,"Construction and
characterization of a full length-enriched and a 5'-end-enriched
cDNA library," Gene (Oct. 24, 1997) 200(1-2):149-56;
Alphey,"PCR-based method for isolation of full-length clones and
splice variants from cDNA libraries," Biotechniques (March
1997)22(3):481-4,486; Caminci et al.,"High efficiency selection of
fill-length cDNA by improved biotinylated cap trapper," DNA Res
(Feb. 28, 1997) 4(1):61-6; Caminci et al., "High-efficiency
full-length cDNA cloning by biotinylated CAP trapper," Genomics
(Nov. 1, 1996)37(3):327-36; Schmid et al.,"A procedure for
selective fall length cDNA cloning of specific RNA species,"
Nucleic Acids Res (May 26, 1987)15(10):3987-96; Seki et al.,
"High-efficiency cloning of Arabidopsis full-length cDNA by
biotinylated CAP trapper," Plant J (September 1998) 15(5):707-20;
Okayama et al., "High-efficiency cloning of full-length cDNA," Mol
Cell Biol (February 1982) 2(2): 161-70; Sekine et al., "Synthesis
of full-length cDNA using DNA-capped mRNA," Nucleic Acids Symp Ser
(1993) (29): 143-4.
[0010] eIF-4E is described in Altmann et al., "mRNA cap-binding
protein: cloning of the gene encoding protein synthesis initiation
factor eIF-4E from Saccharomyces cerevisiae," Mol Cell Biol (March
1987) 7(3):998-1003. eIF-4G is described in Hentze, Science (Jan.
24, 1997) 275: 500 and Haghighat et al., J. Biol. Chem. (Aug. 29,
1997) 272:21677.
SUMMARY OF THE INVENTION
[0011] Methods and compositions are provided for producing
full-length cDNA libraries. In the subject methods, full length
first strand cDNAs are isolated using a fusion protein of an eIF-4E
domain and an eIF-4G domain separated by a flexible linker. Also
provided is the novel fusion protein employed in the subject
methods, as well as nucleic acids encoding, and host cells capable
of expressing, the same. Finally, kits for use in practicing the
subject methods are provided. The subject invention finds use in a
variety of applications in which full-length cDNA libraries are
employed.
BRIEF DESCRIPTION OF THE FIGURES
[0012] FIG. 1 provides schematic of the expression construct
encoding a fusion protein according to the subject invention.
[0013] FIG. 2 provides a representation a complex of the subject
fusion protein with mRNA bound to a solid support.
[0014] FIG. 3 provides a schematic of the preparation cDNA library
according to the subject invention.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
[0015] Methods and compositions are provided for producing
full-length cDNA libraries. In the subject methods, full length
first strand cDNAs are isolated using a fusion protein of an eIF-4E
domain and an eIF-4G domain separated by a flexible linker. Also
provided is the novel fusion protein employed in the subject
methods, as well as nucleic acids encoding, and host cells capable
of expressing, the same. Finally, kits for use in practicing the
subject methods are provided. The subject invention finds use in a
variety of applications in which full-length cDNA libraries are
employed. In further describing the subject invention, the subject
methods will be discussed first, followed by a description of the
kits of the invention.
[0016] Before the subject invention is further described, it is to
be understood that the invention is not limited to the particular
embodiments of the invention described below, as variations of the
particular embodiments may be made and still fall within the scope
of the appended claims. It is also to be understood that the
terminology employed is for the purpose of describing particular
embodiments, and is not intended to be limiting. Instead, the scope
of the present invention will be established by the appended
claims.
[0017] In this specification and the appended claims, the singular
forms "a,""an," and "the" include plural reference unless the
context clearly dictates otherwise. Unless defined otherwise, all
technical and scientific terms used herein have the same meaning as
commonly understood to one of ordinary skill in the art to which
this invention belongs.
[0018] In the broadest sense, the subject invention is a method of
isolating a nucleic acid having a 5' cap structure. Any nucleic
acid may be isolated through use of the subject methods, as long as
the nucleic acid has a 5' cap structure. By 5' cap structure is
meant the 5' structure found on eukaryotic mRNAs, i.e. 5' terminal
m7GpppN (where N is any nucleotide). See Baneijee, Microbiol. Rev.
(1980) 44: 175-205 and Shatkin, Cell (1985) 40:223-224 for further
description of the 5' cap structure. The nucleic acids may be
naturally produced or synthetic nucleic acids, and may be single
stranded or double stranded. The subject methods are particularly
suited for use in the isolation of single-stranded MRNA or
double-stranded mRNA:cDNA duplexes or hybrid complexes.
[0019] A critical aspect of the subject invention is the use of an
eIF-4E/eIF-4G fusion protein. The subject eIF-4E/eIF-4G fusion
protein has at least the following features: an eIF-4E domain, and
eIF-4G domain; and a linker domain that joins the eIF-4E and eIF-4G
domains with a flexible linkage. The eIF-4E domain may be derived
from any convenient eukaryotic source, e.g. animal, plant, yeast,
etc., and may include the amino acid sequence of an entire eIF-4E
protein or a fragment thereof, e.g. an eIF-4E fragment that
exhibits the requisite 5' cap structure binding activity. A number
of eIF-4E proteins from different eucaryotes are known, including
rabbit, mouse, human, yeast etc., where the eIF-4E domain in the
subject fusion protein may be one of these or a derivative
(including mutant) thereof, as long as the requisite 5' cap
structure binding activity is retained. Generally, the length of
this domain ranges from about 100 to 200, usually from about 125 to
175 and more usually from about 150 to 175 aa.
[0020] As with the eIF-4E domain, the eIF-4G domain may be derived
from any convenient eukaryotic source, such as animal, plant,
yeast, insect and the like, such as human, mouse, rabbit, fruit
fly, wheat germ etc. The eIF-4G domain may include the amino acid
sequence of an entire eIF-4G protein or a fragment thereof, e.g. an
eIF-4G fragment that exhibits the requisite ability to enhance the
5' cap structure binding activity of eIF-4E, as well as a
derivative or mutant thereof. The length of this domain typically
ranges from about 100 to 500, usually from about 100 to 300 and
more usually from about 150 to 200 aa long, where a domain that
incorporates residues 318 to 478 of the wild type eIF-4G or the
equivalent thereof is of particular interest in many
embodiments.
[0021] Joining the eIF-4E and eIF-4G domains is the linker domain.
The linker domain is a flexible linker that is of sufficient length
to provide for substantially free movement of the two eIF domains
relative to each other. Because of the manner in which the fusion
protein is produced, the linker domain is generally, though not
necessarily, a stretch of amino acids, where the stretch of amino
acids is generally at least about 5 aa in length, usually at least
about 10 aa in length and more usually at least about 20 aa in
length, where the linker may be 100 aa in length or longer, but
generally will not exceed about 100 aa in length and usually will
not exceed about 50 aa in length. The amino acid sequence of the
linking domain may be any convenient sequence, as long as the
sequence does not give rise to some stable secondary structure that
may diminish the flexibility of the domain, e.g. an .alpha.-helical
structure. Of interest in many embodiments are linking sequences
derived from RNA binding proteins, e.g. hnRNAPA.
[0022] In addition to the above domains, the eIF-4E/eIF-4G fusion
protein also generally includes an additional domain for stably
associating the fusion protein to a solid support. In the broadest
sense, this additional domain may provide for any type of stable
association with a solid support, including covalent or
non-covalent association. However, in many preferred embodiments,
this additional domain provides for non-covalent, stable
association with a solid support. By stable association is meant
that the domain, and therefore the fusion protein of which the
domain is part, remains bound to the solid support under a given
set of conditions, e.g. a pH ranging from about 6.0 to 8.0, usually
from about 7.0 to 7.5; a salt concentration ranging from about 0 to
1.0 M, usually from about 0.1 to 0.2 M; and a temperature ranging
from about 0 to 22.degree. C., usually from about 0 to 4.degree. C.
Typically, this domain of the subject fusion proteins is a member
of a specific binding pair, where specific binding pairs of
interest include: ligands/receptors; antigens/antibodies or binding
fragments thereof; and the like. Specific solid support binding
domains of interest include: protein A, the FLAG epitope, biotin,
His tag, and the like.
[0023] The subject fusion proteins are further characterized in
that they have a significantly enhanced 5' cap recognition activity
as compared to eIF-4E by itself. By significantly enhanced is meant
that cap recognition activity is at least 5 fold, usually at least
about 20 fold and more usually at least about 200 fold greater than
that observed in eIF-4E by itself, as measure by electrophoretic
mobility shift (see Experimental Section).
[0024] The molecular weight of the subject fusion proteins may vary
somewhat depending on the nature of the linker domain and the solid
phase binding domain, if present. However, the molecular weight of
the subject proteins ranges from about 20 kD to 60 kD, usually from
about 40 kD to 55 kD and more usually from about 40 to 50 kD, where
in many embodiments the molecular weight is about 45 kD.
[0025] The subject fusion protein may be made using any convenient
protocol, where protocols for preparing fusion proteins are well
known to those of skill in the art. In general, a vector is
constructed using restriction endonucleases, ligase etc., which
comprises an expression construct having a nucleic acid that
encodes the subject fusion protein, e.g. a nucleic acid that
includes coding sequence for the fusion protein, e.g. the solid
support binding domain, the eIF-4E domain, the eIF-4G domain, the
flexible linker, etc. A representative expression construct is
depicted in FIG. 1. The vector is then used to transform as
suitable expression host, e.g. E.coli, which host is then cultured
to produce the fusion protein, which is ultimately harvested and
isolated. A representative protocol which may be modified (e.g. by
introducing a gene encoding the eIF-4G domain) to produce the
fusion proteins of the present invention can be found U.S. Pat. No.
5,219,989, the disclosure of which is herein incorporated by
reference.
[0026] Turning now to the subject methods, common features to all
of the embodiments of the subject invention are: (1) contacting a
nucleic acid having a 5' cap structure with a fusion protein
according to the subject invention under conditions sufficient to
form a complex between said nucleic acid and said fusion protein;
and (2) isolating the resultant complex.
[0027] As summarized above, the first common step in all of the
embodiments of the subject invention is to contact the fusion
protein with the nucleic acid. The nucleic acid is typically an
mRNA or an mRNA derivative, e.g. a cDNA/mRNA duplex. The initial
mRNA may be present in a variety of different samples, where the
sample will typically be derived from a physiological source. The
physiological source may be derived from a variety of eukaryotic
sources, with physiological sources of interest including sources
derived from single celled organisms such as yeast and
multicellular organisms, including plants and animals, particularly
mammals, where the physiological sources from multicellular
organisms may be derived from particular organs or tissues of the
multicellular organism, or from isolated cells derived therefrom.
In obtaining the sample of RNAs to be analyzed from the
physiological source from which it is derived, the physiological
source may be subjected to a number of different processing steps,
where such processing steps might include tissue homogenation, cell
isolation and cytoplasmic extraction, nucleic acid extraction and
the like, where such processing steps are known to the those of
skill in the art. Methods of isolating RNA from cells, tissues,
organs or whole organisms are known to those of skill in the art
and are described in Maniatis et al., Molecular Cloning: A
Laboratory Manual (Cold Spring Harbor Press)(1989).
[0028] Contact is brought about using any convenient protocol, such
as introducing a quantity of fusion protein into an aqueous medium
comprising the nucleic acids of interest or vice versa. Contact
occurs under conditions sufficient for the fusion protein to stably
bind to the 5' cap structure of the nucleic acid. Generally,
contact occurs in an aqueous media ranging in pH from about 6.5 to
8.5, usually from about 7.0 to 8.0. In addition to the fusion
protein and the nucleic acid, the aqueous media may include one or
more buffering agents, ions, chelators, antioxidants, glycerol,
tRNA and the like. In contacting the fusion protein with the
nucleic acid, the fusion protein is generally incubated with the
nucleic acid for a sufficient period time and at a sufficient
temperature for substantially all potential complexes between the
fusion proteins and nucleic acids present in the aqueous mixture to
occur. Incubation generally lasts for a period of time ranging from
about 5 to 30 min, usually from about 10 to 25 min and more usually
from about 15 to 20 min. The temperature at which incubation is
carried out typically ranges from about 0 to 22.degree. C., usually
from about 0 to 4.degree. C.
[0029] Depending on the particular embodiment being performed, the
fusion protein may or may not be stably associated with a solid
support prior to contact with the nucleic acids. Thus, in one
embodiment, the fusion protein is pre-bound to a solid support
prior to contact with the nucleic acids. In another embodiment, the
fusion protein is not bound to a solid support prior to contact
with the nucleic acids. In this latter embodiment, following
complex formation, a solid support may be introduced into the
aqueous mixture under conditions sufficient for the solid support
to bind to the fusion protein moiety of the complex. The solid
support may be any convenient solid support. Generally the solid
support or solid phase has a member of a specific binding pair on
its surface which is capable of specifically binding to a moiety
present on the fusion protein/nucleic acid complexes of the subject
invention. A variety of different solid-phases are suitable for use
in the subject methods, such phases being known in the art and
commercially available. Specific solid phases of interest include
polymeric, e.g. polystyrene, pegs, sheets, beads, magnetic beads,
and the like. The surfaces of such solid phases have been modified
to comprise the specific binding pair member, e.g. for biotinylated
primer extension products, streptavidin coated magnetic bead may be
employed as the solid phase. In yet other embodiments, e.g. where a
solid support is not critical to the isolation of the fusion
protein nucleic acid complex, the fusion protein is not pre-bound
to a solid support and is not bound to a solid support at any time
in the process.
[0030] Following formation of the fusion protein and nucleic acid
complexes, as well as stable association of the complexes to solid
supports (when desired), the resultant complexes are isolated. By
isolated is meant that the complexes are at least separated from at
least some of the remaining components of the reaction mixture in
which they are present following complex formation. For example,
"separating" as used herein includes removing a portion of the
water from the reaction mixture that includes the complexes, such
that the complexes are concentrated. Separating also includes
retrieving the complexes from the remainder of the reaction mixture
constituents. Any convenient isolation protocol may be employed,
where the particular protocol chosen generally depends on the
nature of the complexes that are being isolated. For example, in
those preferred embodiments in which the complexes are stably
associated via the fusion protein to a solid support, separation or
isolation typically involves concentration of the solid supports,
e.g. by centrifugation, etc.
[0031] In certain embodiments of the subject invention, e.g. in the
preparation of a cDNA library, the above methods are modified
through the addition of the following steps: (1) a first strand
cDNA synthesis step; and (b) an RNAse treatment step; which two
steps are performed prior to the complex isolation step.
[0032] First strand cDNA synthesis is performed using any
convenient protocol. In preparing the first strand cDNA, a primer
is contacted with the mRNA with a reverse transcriptase and other
reagents necessary for primer extension under conditions sufficient
for first strand cDNA synthesis to occur. Although both random and
specific primers may be employed, in many embodiments the primer is
an oligo dT primer that provides for hybridization to a polyA tail
of an niRNA. The oligo dT primer will be sufficiently long to
provide for efficient hybridization to the polyA tail, where the
primer will typically range in length from 10 to 25 nt in length,
usually 10 to 20 nt in length, and more usually from 12 to 18 nt
length. Additional reagents that may be present include: dNTPs;
buffering agents, e.g. TrisCl; cationic sources, both monovalent
and divalent, e.g. KCl, MgCl.sub.2; sulfhydril reagents, e.g.
dithiothreitol; and the like. A variety of enzymes, usually DNA
polymerases, possessing reverse transcriptase activity can be used
for the first strand cDNA synthesis step. Examples of suitable DNA
polymerases include the DNA polymerases derived from organisms
selected from the group consisting of a thermophilic bacteria and
archaebacteria, retroviruses, yeasts, Neurosporas, Drosophilas,
primates and rodents. Preferably, the DNA polymerase will be
selected from the group consisting of Moloney murine leukemia virus
(M-MLV) as described in U.S. Pat. No. 4,943,531 and M-MLV reverse
transcriptase lacking RNaseH activity as described in U.S. Pat. No.
5,405,776 (the disclosures of which patents are herein incorporated
by reference), human T-cell leukemia virus type I (HTLV-I), bovine
leukemia virus (BLV), Rous sarcoma virus (RSV), human
immunodeficiency virus (HIV) and Thermus aquaticus (Taq) or Thermus
thermophilus (Tth) as described in U.S. Pat. No. 5,322,770, the
disclosure of which is herein incorporated by reference, avian
reverse transcriptase, and the like. Suitable DNA polymerases
possessing reverse transcriptase activity may be isolated from an
organism, obtained commercially or obtained from cells which
express high levels of cloned genes encoding the polymerases by
methods known to those of skill in the art, where the particular
manner of obtaining the polymerase will be chosen based primarily
on factors such as convenience, cost, availability and the like. Of
particular interest because of their commercial availability and
well characterized properties are avian reverse transcriptase and
M-MLV.
[0033] The order in which the reagents are combined may be modified
as desired. One protocol that may be used involves the combination
of all reagents except for the reverse transcriptase on ice, then
adding the reverse transcriptase and mixing at around 4.degree. C.
Following mixing, the temperature of the reaction mixture is raised
to 37.degree. C. followed by incubation for a period of time
sufficient for first strand cDNA primer extension product to form,
usually about 1 hour.
[0034] Following first strand cDNA synthesis, the resultant duplex
mRNA/cDNA (i.e. hybrid) is then contacted with an RNAse capable of
degrading single stranded RNA but not RNA complexed to DNA under
conditions sufficient for any single stranded RNA to be degraded. A
variety of different RNAses may be employed, where known suitable
RNAses include: RNAse T1 from Aspergillus orzyae, RNase I, RNase A
and the like. The exact conditions and duration of incubation
during this step will vary depending on the specific nuclease
employed. However, the temperature is generally between about 20 to
37.degree. C., and usually between about 25 to 37.degree. C.
Incubation usually lasts for a period of time ranging from about 10
to 60 min, usually from about 15 to 60 min.
[0035] Nuclease treatment results in the production of blunt-ended
mRNA/cDNA duplexes or hybrids. In the resultant mixture, those
mRNA/cDNA hybrids that include a full length cDNA will have the 5'
cap structure of the template mRNA, while those in which a full
length cDNA was not produced in the reverse transcription step will
not. Following production of the blunt-ended mRNA/cDNA hybrids, the
resultant hybrids are then contacted with the fusion protein and
isolated as described above.
[0036] Following isolation, the nucleic acids may be further
processed as desired, where further processing includes: release
from the solid phase support (if present), e.g. by cleavage
reaction, disruption of the specific bond, and the like; production
of double stranded cDNA, etc., where protocols for performing such
operations are well known to those of skill in the art.
[0037] The subject methods find use in a variety of applications in
which isolation of full length mRNA and/or cDNAs is desired. Such
applications include: mRNA isolation, cDNA library construction,
and the like. For example, where one desires to construct a cDNA
library, mRNA/cDNA hybrids comprising full length cDNAs from the
initial sample can be prepared as described above. The resultant
hybrids are then converted to double stranded cDNAs which are then
inserted to a vector, e.g. plasmid, phage, etc., for subsequent
propagation and use.
[0038] Also provided by the subject invention are kits for carrying
out the subject methods. The kits of the subject invention include
at least the fusion protein of the subject invention, i.e. a fusion
protein that includes at least an eIF-4E domain, a linker domain
and an eIF-4G domain. The kit may further include a solid phase,
such as those described above, and one or more reagents for
carrying the claimed methods, including, for example, buffers, the
appropriate nucleotide triphosphates (e.g., dATP, dCTP, dGTP and
dTTP; or rATP, rCTP, rGTP and UTP), reverse transcriptase, DNA
polymerase, RNA polymerase, T1 RNAse, primers (e.g., appropriate
length poly(T) or random primers), and the like. A set of
instructions will also typically be included, where the
instructions may be associated with a package insert and/or the
packaging of the kit or the components thereof.
[0039] The following examples are offered by way of illustration
and not by way of limitation.
EXPERIMENTAL
I. Methods and Compositions for Producing Full Length cDNA
Libraries
[0040] A. Construction of Expressible eIF-4E/eIF-4G Fusion
Protein
[0041] Amplification of DNA sequences from cDNA Library
[0042] (1) Prepare PCR reaction cocktail:
[0043] 1.5 mM MgCl.sub.2
[0044] 16.6 mM NH.sub.4SO.sub.4
[0045] 2.8 mM .beta.-mercaptoethanol
[0046] 0.68 .mu.M EDTA, pH 8.0
[0047] 67 mM Tris-HCl (pH 8.8)
[0048] 0.1% Tween.TM.-20
[0049] 0.2mM dNTP (each)
[0050] 0.03 units/.mu.L Taq Polymerase (5units/.mu.L)
[0051] 0.00178 units/.mu.L Pfu 2.5 units/.mu.L
[0052] (2) Dilute 5' & 3' primer pairs to 50 .mu.M each in 1.5
mL tube for eIF-4E and eIF-4G individually.
[0053] (3) Transfer 100 .mu.L of PCR cocktail to 2 reaction tubes
on ice.
[0054] (4) Add 1 .mu.L of eIF-4E and eIF-4G primer pairs to
individual reaction tubes. The final concentration of each primer
is 0.5 .mu.M.
[0055] (5) Add 1 .mu.L of CDNA Human Liver Library to each
reaction.
[0056] (6) Cycle: 1)
[0057] 94.degree. C. for 3 minutes
[0058] 2) 94.degree. C. for 15 seconds
[0059] 3) 0.5.degree. C./sec to 50.degree. C.
[0060] 4) 50.degree. C. for 1 minute
[0061] 5) 72.degree. C. for 4 minutes
[0062] 6) Go to step 2, 34.times.
[0063] 7) 72.degree. C. for 8 minutes
[0064] 8) 4.degree. C. Forever
[0065] 9) End
[0066] (7) Prepare 0.8% SeaKem GTG Agarose [FMC Cat. No. 50074]
gel+EtBr and load 50 .mu.L of PCR reactions. Run gel 360 v-hr.
[0067] (8) Remove gel slices and extract PCR products using
QIAquick Gel Extraction Kit [QIAGEN Cat. No. 28704]. Resuspend
purified products in 30 .mu.L EB buffer.
[0068] Restriction Digest of PCR Products & pET-15b Expression
Vector
[0069] (1) eIF-4E Digestion
[0070] 25 .mu.L Purified PCR Product
[0071] 5 .mu.L 10X NE Buffer 4
[0072] 18 .mu.L RNase free H.sub.2O
[0073] 1 .mu.L Nco I (10 units/.mu.L)
[0074] 1 .mu.L Ban I (20 units/.mu.L)
[0075] Incubate@37.degree. C., 4.25 hours
[0076] (2) eIF-4G Digestion
[0077] 25 .mu.L Purified PCR Product
[0078] 5 .mu.L 10.times.NE Buffer 2
[0079] 0.5 .mu.L 100.times.BSA
[0080] 17.5 .mu.L RNase free H2O
[0081] 1 .mu.L Ban I (20 units/.mu.L)
[0082] 1 .mu.L Xho I (20 units/.mu.L)
[0083] Incubate@37.degree. C., 4.25 hours
[0084] (3) pET-15b Vector
[0085] 8.1 .mu.L 0.37 .mu.g/.mu.L pET-15b Vector
[0086] [Novagen Cat. 5 .mu.L 10.times.NE Buffer 2
[0087] No. 69661-3] 5 .mu.L 10.times.BSA
[0088] 29.9 .mu.L RNase Free H2O
[0089] 1 .mu.L Nco I (10 units/.mu.L)
[0090] 1 .mu.L Xho I (20 units/.mu.L)
[0091] Incubate@37.degree. C., 2.0 hours
[0092] (4) Prepare 0.8% SeaKem GTG Agarose gel+EtBr and load
50.mu.L of RE digestion reactions. Run gel 200 v-hr.
[0093] (5) Remove gel slices and extract using QLAquick Gel
Extraction Kit. Resuspend purified products in 30 .mu.L EB
buffer.
[0094] (6) Prepare 0.8% SeaKem LE Agarose [FMC Cat. No. 50004]
gel+EtBr and load 5 .mu.L of RE digested PCR products to estimate
concentration.
[0095] eIF-4E/eIF-4G Construct Ligation
[0096] Prepare ligation reaction at
[0097] 1:1:1 (Vector:eIF-4E:eIF-4G)
[0098] X .mu.L pET-15b NcoI/XhoI
[0099] X .mu.L eIF-4E NcoI/BanI
[0100] X .mu.L eIF-4G BanI/XhoI
[0101] 2 .mu.L 10 X T4 DNA Ligase Buffer
[0102] X .mu.L DI H.sub.2O
[0103] 1 .mu.L T4 DNA Ligase (400 units/.mu.L)
[0104] 20 .mu.L, Incubate @16.degree. C. overnight (16 hours).
[0105] B. Expression & Purification of eIF-4E/eIF-4G Fusion
Protein
[0106] Transformation to DH10B Cells
[0107] Transfer 1 .mu.L of ligation to 1.5 mL .mu.fuge tube on
ice.
[0108] Add 50 .mu.L ElectroMAX DH10B Cells [Gibco-BRL Cat. No.
18290-015]. Mix gently.
[0109] Transfer DNA/Cells to 0.1 cm gap cuvette on ice.
[0110] Electroporate @2.5 kv .
[0111] Recover cells in 1 mL SOC (pH 7.0, 22.degree. C.). Incubate
@37.degree. C., 60 minutes, 250 rpm.
[0112] Plate 10 .mu.L & 100 .mu.L of transformation on
LB+2.times.Carbenicillin (100 .mu.g/mL).
[0113] Incubate 37.degree. C. overnight (16 hours).
[0114] Plasmid Preparation
[0115] Inoculate 25 mL LB+2.times.Carbenicillin (100 .mu.g/mL) with
individual colony.
[0116] Incubate@37.degree. C., 250 rpm, overnight (16 hours).
[0117] Purify plasmid using QIAgen Plasmid Midi Kit [QIAGEN Cat.
No. 12143].
[0118] Resuspend DNA in 100 .mu.L 10 mM Tris-HCL pH 7.5.
[0119] Sequencing of the construct is recommended to confirm the
sequence of the construct.
[0120] Transformation of eIF-4E/eIF-4G Fusion Protein Construct to
BL21(DE3)pLysS Cells
[0121] (1) Dilute purified plasmid to 1ng/.mu.L.
[0122] Transfer 1 .mu.L of plasmid to 1.5 mL .mu.fuge tube on
ice.
[0123] Add 20 .mu.L BL21(DE3)pLysS cells [Novagen Cat. No. 69451-4]
to tube and mix gently.
[0124] Incubate on ice 30 minutes.
[0125] Heat shock DNA/Cells@42.degree. C. for 40 seconds. Transfer
to ice for 2 minutes.
[0126] Add 180 .mu.L SOC (pH 7.0, 22.degree. C.) and transfer
entire volume to Falcon 2059 tube.
[0127] Incubate 37.degree. C., 200-250 rpm, 60 minutes.
[0128] Plate 10 .mu.L & 100 .mu.L of transformation on
LB+2.times.Carbenicillin (100 .mu.g/mL)+Chloramphenicol (34
.mu.g/mL).
[0129] Incubate 37.degree. C. overnight (16 hours).
[0130] C. Purification of Expressed eIF-4E/eIF-4G Fusion
Protein
[0131] Day 1
[0132] Inoculate 100 mL of LB+2.times.Carbenicillin (100
.mu.g/mL)+Chioramphenicol (34 .mu.g/mL) with single colony from
transformation plates.
[0133] Incubate 37.degree. C., 250 rpm, overnight (16 hours).
[0134] Day 2
[0135] Inoculate 8.times.500 mL LB+2.times.Carbenicillin (100
.mu.g/mL)+Chloramphenicol (34 .mu.g/mL) with 1 mL of overnight
culture.
[0136] Incubate 37.degree. C., 225 rpm, OD.sub.600=0.6.
[0137] Add 5 mL 100 mM ITPG (C.sub.f32 1 mM). Incubate 37.degree.
C., 225 rpm, 2 hours.
[0138] All following steps performed at 4.degree. C.
[0139] Split each 500 mL culture into 2.times.250 mL volumes and
pellet cells@2000.times.g, 15 min, 4.degree. C.
[0140] Carefully remove supernatants. Resuspend both pellets in
single 20 mL volume of Sonication Buffer [20 mM HEPES (pH 7.5), 0.5
M KCL, 0.2 mM EDTA, 0.5% NP-40].
[0141] Transfer 20 mL volume (per 500 mL culture) to Falcon
35-2070, 50 mL polypropylene tubes on ice.
[0142] Prepare Sonicator Ultrasonic Processor XL, Misonix Inc. by
filling cup horn with 4.degree. C. H.sub.2O.
[0143] Sonicate cells for 2.times.60 seconds pulses @ power level
7.
[0144] Transfer sonicated cell suspensions to 40 mL Oakridge tubes
and centrifuge @10,000.times. g for 15 minutes.
[0145] Pool all supernatants into 1 liter polypropylene flask and
dilute 5 fold with Dilution Buffer [20 mM HEPES (pH 7.5), 0.2 mM
EDTA, 1 mM Dithiothreitol, 10% Glycerol] to decrease [KCl] to 0.1
M. Store on ice @4.degree. C.
[0146] Column Chromatography Preparation
[0147] Pool 4.times.1 mL 7-methylguanosine 5'-triphosphate (m7-GTP)
immobilized on Sepharose 4B [Sigma cat. no. M-4648] to Falcon 2059
tube. Rinse vials with Wash Buffer [20 mM HEPES (pH 7.5), 100 mM
KCl, 0.2 mM EDTA, 1 mM Dithiothreitol, 10% Glycerol] to collect all
sepharose beads.
[0148] Rinse 10 mL Column (BioRad) with 20 mL DI H.sub.2O. Add 3 mL
Wash Buffer to the column and cap.
[0149] Load the m7-GTP sepharose beads into the column under the
control of a peristaltic pump.
[0150] Wash beads with 20 mL Wash Buffer (5 volumes) and 80 mL
Sonication Buffer (20 volumes).
[0151] Equilibrate column with 40 mL Wash Buffer (10 volumes).
[0152] Column Loading/Purification
[0153] Load protein suspension to column @75 mL/hour using
peristaltic pump. Wash column with 200 mL Wash Buffer @75 mL/hour
using peristaltic pump. Prepare 500 .mu.M 7-methylguanosine
5'-triphosphate (m7-GTP) [Sigma Cat. No. M-6133] in 10 mL Wash
Buffer.
[0154] Drain column until the meniscus is just above the column
bead. Carefully add 4 mL of 500 .mu.M m7-GTP and allow column to
flow until the elution buffer has completely entered the beads.
Stop flow and let stand 20 minutes.
[0155] Add 4 mL of Wash Buffer and collect 4 mL of eluted protein
in 14 mL Falcon 2059 tubes.
[0156] SDS-PAGE Analysis of Purified eIF-4E/eIF-4G Fusion
Protein
[0157] Prepare SDS-PAGE gel:
1 Reagent 5% Stacking Gel 12% Resolving Gel 40% Acrylamide 2.5 mL
15 mL 1M Tris-HCl 2.5 mL (pH 6.8) 12.5 mL (pH 8.8) 20% SDS 0.1 mL
0.25 mL 10% Ammonium Persulfate 0.1 mL 0.5 mL TEMED 0.02 mL 0.05 mL
DI H2O to 20 mL to 50 mL
[0158] Pour gel and let polymerize.
[0159] (1) Prerun gel for 20 minutes @200 volts in 1 X
Tris/Glycine/SDS Buffer [Prepared from 10.times.Tris/Glycine/SDS
Buffer, BioRad Cat. No. 161-0732].
[0160] (2) Protein sample preparation: Dilute 100 .mu.L of purified
4E/4G Fusion protein 1:1 with SDS Reducing Sample Buffer [Laemmli
Sample Buffer BioRad Cat. No. 161-0737]. Heat sample 70.degree. C.
for 5 minutes.
[0161] (3) Prepare SDS-Broad Range Standards [BioRad Cat. No.
161-0317]. Heat 70.degree. C. for 5 minutes.
[0162] (4) Load 10 .mu.L SDS-Broad Range Standard and 200 .mu.L
protein sample to gel.
[0163] Run gel 450 volt-hours.
[0164] Stain gel using 1.times.Coomassie Stain Solution [BioRad
Cat. No. 161-0436].
[0165] Destain gel using 1.times.Destain Solution, Coomassie R-250
[BioRad Cat. No. 161-0438].
[0166] Expected protein size is approx. 46 kDa.
[0167] Load protein to Pierce Slide-A-Lyzer 2,000 MWCO dialysis
cassette [Pierce Cat. No. 66210]. Dialyze against 2.times.1500 mL
Wash Buffer and 2.times.1500 mL 2.times.Storage Buffer [40 mM
HEPES-KOH (pH 7.5), 0.2 mM EDTA, 2 mM DTT, 200 mM KCl].
[0168] Remove protein sample from cassette and store at 4.degree.
C.
[0169] Quantitate protein using Coomassie Plus-200 Protein Assay
Reagent [Pierce 23238].
[0170] D. Mobility Shift Assay
[0171] Produce .sup.32P-labelled capped and uncapped run off RNA
using TransProbe T [Pharmacia Biotech 27-9276-01] to test the
binding affinity of the fusion protein. Purify capped run off RNA
from Native-PAGE gel. Store @-80.degree. C. in RNase free H.sub.2O.
Gel preparation: 6% polyacrylamide native gel
2 Reagent Volume 40% Acrylamide 7.5 mL 10x TBE 5.0 mL 10% Ammonium
Persulfate 0.5 mL TEMED 1.0 mL DI H2O to 50 mL
[0172] Pour gel using 20 well comb. Allow to polymerize and chill
to @4.degree. C.
[0173] Prepare 4.times.Binding Buffer:
[0174] 40 mM HEPES-KOH, pH 7.5
[0175] 400 MM KCl
[0176] 4 mM MgCl.sub.2
[0177] 2.0 mM EDTA
[0178] 4 mM DTT
[0179] 40% Glycerol
[0180] Dilute 4E/4G fusion protein to 16 .mu.L/sample in Wash
Buffer. Create protein range from 5ng-250ng in 1.5 mL .mu.fuge
tubes on ice.
[0181] Prepare RNA (capped & uncapped) cocktails at 16
.mu.L/sample in 2.times.Binding Buffer.
[0182] Mix protein with capped and uncapped RNA samples and
incubate 15 minutes [Binding Buffer becomes 1.times.on ice.
[0183] Run gel 600 v-hr in 1.times.TBE @4.degree. C. Dry gel for 30
minutes at 80.degree. C.
[0184] Autoradiograph with an intensifying screen at -80.degree.
C.
[0185] Compare binding affinity between capped and uncapped RNA.
The 4E/4G fusion protein binds the capped RNA at the 5-10 nM range.
Non-specific binding at the 70-140 nM range occurs with the
uncapped RNA.
[0186] E. Biotinylation of eIF-4E/eIF-4G Fusion Protein
[0187] Concentrate protein to 1.5-2.0 mg/mL using Millipore
Microcon 10,000 MWCO microconcentrator [Millipore Cat. No.
42422]
[0188] Follow protocol supplied with EZ-Link NHS-LC-LC-Biotin
[Pierce Cat. No. 21343].
[0189] Quantitate biotinylation using ImmunoPure HABA [Pierce Cat.
No. 28050].
[0190] Quantitate protein concentration post-biotinylation using
Coomassie Plus-200 Protein Assay Reagent [Pierce 23238].
[0191] Verify the binding affinity post-biotinylation using
Mobility Shift assay explained above. The 4E/4G fusion protein
binds the capped RNA at a range of 3.5-7.0 nM after
biotinylation.
[0192] F. Coupling of 4E/4G Fusion Protein to StreptAvidin
Beads
[0193] Remove 100 .mu.L Dynabeads M-280 StreptAvidin [Dynal Cat.
No. 112.06] per .mu.g protein and transfer to 1.5 mL .mu.fuge
tube.
[0194] Remove supernatant by magnetic separation and wash beads
3.times.w/ 100 .mu.L of 2X Storage Buffer.
[0195] Dilute 4E/4G Fusion protein (1 .mu.g/50 .mu.L) in
2.times.Storage Buffer.
[0196] Resuspend beads in 50 .mu.L diluted protein after final wash
with 2.times.Storage Buffer.
[0197] Incubate @4.degree. C. for 30 minutes. Mix by gentle
pipeting every 5 minutes. Remove supernatant by magnetic separation
and wash 3.times.w/50 .mu.L 1.times.Binding Buffer [10 mM HEPES-KOH
(pH 7.5), 100 mM KCl, 1 mM MgCl.sub.2, 0.5 mM EDTA, 1 mM
Dithiothreitol, 10% Glycerol]. Store @4.degree. C.
[0198] G. Synthesis of mRNA/DNA Hybrid
[0199] [Reagents used from SUPERSCRIPT Plasmid System for cDNA
Synthesis and Plasmid Cloning]
[0200] (1) Annealing, add a mixture of 2.5 .mu.L mRNA polyA.sup.+(1
.mu.g/.mu.L), 2 .mu.L oligo dT Not I primer adapter, and 5.5 .mu.L
of RNase free H.sub.2O.
[0201] (2) 70.degree. C., 10 minutes, chill on ice for 5 minutes,
spin to collect and suspend.
[0202] (3) First Strand reaction with oligo-dT
3 Add iced cocktail containing 4 .mu.L 5x 1st Strand Buffer 2 .mu.L
0.1M DTT 1 .mu.L 10 mM dNTPs 1 .mu.L [.alpha.-32P]dCTP (1O
.mu.ci/.mu.l)
[0203] 37.degree. C. for 2 minutes to equilibrate the temperature.
Add 2 .mu.L SuperScript II RT. Total 20 .mu.L, mix, incubate at
37.degree. C. for 60 minutes.
[0204] Add equal volume of Phenol:Choloroform:Isoamyl alcohol
(25:24:1). Vortex thoroughly and centrifuge 14,000.times.g at room
temperature for 5 minutes. Carefully remove the upper aqueous layer
and transfer to a new tube.
[0205] Add 1/2 volume (10 .mu.L) 7.5M NH4OAC, 3 volumes
(-20.degree. C.) 100% ethanol (90 .mu.L), mix, centrifuge at
20,000.times.g, 4.degree. C., 20 minutes. Carefully remove the
supernatant.
[0206] The pellet is washed with 200 .mu.L of 70% ethanol
(-20.degree. C.) and centrifuged at 20,000.times.g for 5 minutes.
Remove supernatant carefully and dry.
[0207] H. RNase One Treatment of mRNA/DNA Hybrid
[0208] Resuspend mRNA/DNA hybrid in 40 .mu.L RNase free
H.sub.2O.
[0209] Add 5 .mu.L 10.times.RNase One Buffer and 5 .mu.L RNase One
(10 units/.mu.L) [Promega Cat. No. M4261].
[0210] Incubate @37.degree. C., 15 minutes.
[0211] Add equal volume of Phenol:Choloroform:Isoamyl alcohol
(25:24:1). Vortex thoroughly and centrifuge 14,000.times. g at room
temperature for 5 minutes. Carefully remove the upper aqueous layer
and transfer to a new tube.
[0212] Add 1/2 volume (25 .mu.L) 7.5 M NH.sub.4OAC, 3 volumes
(-20.degree. C.) 100% ethanol (225 .mu.L), mix, centrifuge at
20,000.times. g, 4.degree. C., 20 minutes. Carefully remove the
supernatant.
[0213] The pellet is washed with 500 .mu.L of 70% ethanol
(-20.degree. C.) and centrifuged at 20,000.times. g for 5 minutes.
Remove supernatant carefully and dry.
[0214] I. Capture of mRNA/DNA Hybrid using eIF-4E/eIF-4G Fusion
Protein
[0215] (1) Resuspend RNase One treated mRNA/DNA hybrid in 50 .mu.L
of 1.times.Binding Buffer.
[0216] (2) After final wash with 1.times.Binding Buffer, resuspend
protein beads in 50 .mu.L of diluted mRNA.
[0217] (3) Incubate on ice (4.degree. C. BioCold) for 15 minutes.
Mix by gentle pipeting every 5 minutes.
[0218] (4) Remove the supernatant by magnetic separation and wash
5.times.w/50 .mu.L 1.times.Binding Buffer +0.3M KCl +0.1% NP-40.
Collect all wash volumes in 1.5 mL .mu.fuge tube for counting.
[0219] Elute MRNA from protein beads by resuspending in 50 .mu.L
1.times.Binding Buffer +0.3M KCl+0.1% NP-40+1 mM M7-GTP.
[0220] Incubate @4.degree. C. for 5-15 minutes. Mix by gentle pipet
every 5 minutes if incubating for periods greater than 5 minutes.
Remove the supernatant by magnetic separation and repeat elution
step.Pool elution volumes (100 .mu.L). Add 1/2 volume (50 .mu.L)
7.5 M NH.sub.4OAC, 3 volumes (-20.degree. C.) 100% ethanol (450
.mu.L), mix, centrifuge at 20,000.times.g, 4.degree. C., 20
minutes. Carefully remove the supernatant.
[0221] The pellet is washed with 500 .mu.L of 70% ethanol
(-20.degree. C.) and centrifuged at 20,000.times.g for 5 minutes.
Remove supernatant carefully and dry.
[0222] J. Completion of FL-cDNA Library [2nd Strand Synthesis]
[0223] Resuspend captured RNA/DNA hybrid in 13 .mu.L RNase free
H.sub.2O.
[0224] On ice add cocktail containing
[0225] Recreate 1.sup.st Strand conditions by adding
[0226] 4 .mu.L 5.times.1.sup.st Strand Buffer
[0227] 2 .mu.L 0.1 M DTT
[0228] 1 .mu.L 10 mM dNTP Mix
[0229] Create 2.sup.nd Strand conditions by adding
[0230] 93 .mu.L RNase free H.sub.2O
[0231] 30 .mu.L 5.times.2.sup.nd Strand Buffer
[0232] 3 .mu.L 10 mM dNTP Mix
[0233] 1 .mu.L E.coli DNA Ligase (10units/.mu.L)
[0234] 4 .mu.L E.coli DNA Polymerase I (10units/.mu.L)
[0235] 1 =82 L E.coli RNase H (2 units/.mu.L)
[0236] Total 150 .mu.L. Incubate 16.degree. C. for 2 hours.
[0237] Add 2 .mu.L T4 DNA Polymerase (10 units), 16.degree. C., 5
minutes.
[0238] Add 10 .mu.L 0.5M EDTA, place on ice.
[0239] Add 150 .mu.L of Phenol:Choloroform:Isoamyl alcohol
(25:24:1). Vortex thoroughly and centrifuge 14,000.times. g at room
temperature for 5 minutes. Carefully remove the upper aqueous layer
and transfer to a new tube.
[0240] Add 70 .mu.L 7.5 M NH.sub.4OAC, 0.5 mL 100% ethanol
(-20.degree. C.), mix, centrifuge at 20,000.times.g, 4.degree. C.,
20 minutes. Carefully remove the supernatant.
[0241] The pellet is washed with 500 .mu.L of 70% ethanol
(-20.degree. C.) and centrifuged at 20,000.times. g for 5 minutes.
Remove supernatant carefully and dry.
[0242] Sal I Adapter Ligation
4 (1) Pellet is resuspended in 25 .mu.L RNase Free H.sub.2O 10
.mu.L 5x T4 DNA Ligase Buffer 10 .mu.L Sal I Adapters 5 .mu.L T4
DNA Ligase Total 50 .mu.L, 16.degree. C., 16 hours.
[0243] Add 50 .mu.L of Phenol:Choloroform:Isoamyl alcohol
(25:24:1). Vortex thoroughly and centrifuge 14,000.times.g at room
temperature for 5 minutes. Carefully remove the upper aqueous layer
and transfer to a new tube.
[0244] Add 25 .mu.L 7.5M NH.sub.4OAC, 150 .mu.L 100% ethanol
(-20.degree. C.), mix, centrifuge at 20,000.times.g, 4.degree. C.,
20 minutes. Carefully remove the supernatant.
[0245] The pellet is washed with 500 .mu.L of 70% ethanol
(-20.degree. C.) and centrifuged at 20,000.times.g for 5 minutes.
Remove supernatant carefully and dry.
[0246]
[0247] Not I Digestion
[0248] To adapted cDNA add the following reagents:
[0249] 41 .mu.L RNase Free H.sub.2O
[0250] 5 .mu.L React 3 Buffer
[0251] 4 .mu.L Not I
[0252] Total 50 .mu.L, incubate 37.degree. C. for 2-3 hours.
[0253]
[0254] Add 50 .mu.L of Phenol:Choloroform:Isoamyl alcohol
(25:24:1). Vortex thoroughly and centrifuge 14,000.times.g at room
temperature for 5 minutes. Carefully remove the upper aqueous layer
and transfer to a new tube.
[0255] Add 25 .mu.L 7.5M NH.sub.4OAC, 150 .mu.L 100% ethanol
(-20.degree. C.), mix, centrifuge at 20,000.times.g, 4.degree. C.,
20 minutes. Carefully remove the supernatant.
[0256] The pellet is washed with 500 .mu.L of 70% ethanol
(-20.degree. C.) and centrifuged at 20,000.times.g for 5 minutes.
Remove supernatant carefully and dry.
[0257] Separate cDNA from adapter by size fraction column
[0258] Place one of the cDNA size fractionation columns in a
support. Remove the top cap first and then the bottom cap. Allow
the excess liquid (20% ethanol) to drain.
[0259] Pipet 0.8 ml of TEN buffer [10 mM Tris-HCl (pH 7.5), 0.1 mM
EDTA, 20 mM NaCl. Autoclaved] onto the upper frit and let drain
completely. Repeat this step three more times for a total 3.2
ml.
[0260] Label 20 sterile microcentrifuge tubes from 1 to 20, and
place them in a rack with tube 1 under the outlet of the
column.
[0261] Add 97 .mu.l of TEN buffer to the cDNA pellets and mix
gently.
[0262] Add the entire sample to the center of the top fritz and let
it drain into the bed. Collect the effluent into tube 1.
[0263] Add 100 .mu.l of TEN buffer to the column and collect the
effluent into tube 2.
[0264] Beginning with the next 100 .mu.l aliquot of TEN buffer,
collect single-drop (.about.35 .mu.l) fraction into individual
tubes. Continue adding 100 .mu.l aliquots of TEN buffer until you
have collected a total of 18 drops into tubes 3 through 20, one
drop per tube.
[0265] Using an automatic pipet, measure the volume in each tube,
use a fresh tip for each fraction to avoid cross-contamination.
Record each value in column A. Identify the fraction for which the
value in column is closest to, but not exceeding 550 .mu.l.
[0266] Place the tubes in a scintillation counter and obtain
Cerenkov counts for each fraction.
[0267] Based on cpm of each fraction, and total volume in column B
(<550 .mu.l), decide the fraction to be combined. Add 1/2 volume
7.5M NH.sub.4OAC, 5 .mu.l 1 mg/ml yeast tRNA, followed by 3 volumes
100% ethanol, Vortex the mixture thoroughly, and centrifuge at
20,000.times.g, 4.degree. C., 20 minutes. Carefully remove the
supernatant.
[0268] Rinse the pellet gently with 200 .mu.l 70% cold ethanol.
Centrifuge for 2 min at 20,000.times.g and remove the
supernatant.
[0269] Lyophilize the pellet for 5 min to evaporate residual
ethanol.
[0270] Count the dry pellet to determine amount of cDNA yield.
[0271] Ligation and Transformation
[0272] Re-suspend CDNA pellet to a concentration of 5 ng/.mu.l.
[0273] For each sample prepare a tube with
5 31 .mu.l ddw 4 .mu.l 5 ng/ul cDNA (20 ng) 1 .mu.l pSPORT1 vector
(Sal I-Not I) (50 ng) 5 .mu.l 10 .times. NEB T4 DNA ligase buffer 5
.mu.l T4 DNA ligase Total 50 .mu.l, incubate at 16.degree. C. for
overnight.
[0274] Dilute 1 .mu.l of ligation into 9 .mu.l ddw.
[0275] Transform 1 .mu.l of 1:10 dilution with 20 .mu.l of DH-10B
electrocompetent cells.
[0276] Electroporate at 2.5 KV.
[0277] Recover cells in 1 mL SOC (pH 7.0, 22.degree. C.). Incubate
@37.degree. C., 60 minutes, 250 rpm.
[0278] Plate 10 and 100 .mu.l of transformation onto LB
+2.times.Carbenicillin agar plates.
[0279] Grow overnight at 37.degree. C. and determine titer of
ligation, titer per ng and titer per total amount of CDNA
(titer/library).
[0280] Solutions and Reagents Needed
6 Name Company Part No. Taq DNA Polymerase Amersham T03031 Cloned
Pfu Polymerase Stratagene 600159-81 Primers for eIF4E/eIF4G fusion
protein construct
[0281] (1) 5'-primer of 4E domain
[0282] (2) 3'-Primer of 4E domain
7 [0087] (2) 3'-Primer of 4E domain
5'-AGTTAAGTGGGCACCTGGTCTTTGAGAATCTTCTCTGGAGACAGCAACAACAAAC (SEQ ID
NO:02) CTATTTTTAG-3' [0088] (3) 5'-Primer of 4G domain
5'-GCTGTCTCCAGAGAAGATTCTCAAAGACCAGGTGCCCACTTAACTGTGAAAAGGA (SEQ ID
NO:03) GACGGAAAATTAAGGAG-3' [0089] (4) 3'-Primer of 4G domain
5'-GCCGGATCCTCGAGTCATTACTTATCGTCATCGTC- CTTGTAATCGCCAAGGTTGG (SEQ
ID NO:04) CAAAGGATGG-3'
[0283]
8 SeaKem GTG Agarose FMC 50074 SeaKem LE Agarose FMC 50004 QIAquick
Gel Extraction Kit QIAGEN 28704 Nco I NEB 193L Ban I NEB 118L Xho I
NEB 146L pET15b Expression Kit Novagen 69668-3 T4 DNA Ligase NEB
202L ElectroMAX DH10B cells Gibco-BRL 18290-015 QIAGEN Plasmid Midi
Kit QIAGEN 12143 7-methylguanosine 5 = triphosphate Sigma M-4648
immobilized on Sepharose 4B 7-methylguanosine 5 = triphosphate,
Sigma M-6133 Sodium Salt Tris/Glycine/SDS Buffer BioRad 161-0732
Laemmli Sample Buffer BioRad 161-0737 SDS-Broad Range Standard
BioRad 161-0317 Coomassie Stain Solution BioRad 161-0436 Destain
Solution, Coomassie R-250 BioRad 161-0438 Slide-A-Lyzer 2,000 MWCO
Dialysis Pierce 66210 Cassette Coomassie Plus-200 Protein Assay
Reagent Pierce 23238 TransProbe T Kit Pharmacia 27-9276-01 biotech
Millipore Microcon 10,000 MWCO Millipore 42422 Microconcentrator
EZ-LINK NHS-LC-LC-Biotin Pierce 21343 ImmunoPure HABA Pierce 28050
Dynabeads M280 StreptAvidin Dynal 112.06 SUPERSCRIPT Plasmid System
for Gibco-BRL 18248-013 cDNA Synthesis and Plasmid Cloning RNase
ONE Ribonuclease Promega M4261
[0284] It is evident from the above results and discussion that
improved methods for isolating full length mRNAs are provided. With
the subject methods, one can obtain a population of full length
mRNAs from an initial sample, where shorter mRNA fragments are
removed. In addition, one can employ the subject methods to obtain
a library of substantially full length cDNAs. Finally, the subject
Fusion Proteins provide for greater binding specificity to the 5'
cap structure than is achieved with other protocols, thereby
improving the obtainable results. As such, the subject invention
represents a significant contribution to the art.
[0285] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference. The
citation of any publication is for its disclosure prior to the
filing date and should not be construed as an admission that the
present invention is not entitled to antedate such publication by
virtue of prior invention.
[0286] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it is readily apparent to those of ordinary skill
in the art in light of the teachings of this invention that certain
changes and modifications may be made thereto without departing
from the spirit or scope of the appended claims.
* * * * *