U.S. patent application number 09/194842 was filed with the patent office on 2002-08-15 for methods for detection of rearranged dna.
Invention is credited to BELCH, ANDREW R., PILARSKI, LINDA M., SZCZEPEK, AGNIESZKA J..
Application Number | 20020110807 09/194842 |
Document ID | / |
Family ID | 21791477 |
Filed Date | 2002-08-15 |
United States Patent
Application |
20020110807 |
Kind Code |
A1 |
PILARSKI, LINDA M. ; et
al. |
August 15, 2002 |
METHODS FOR DETECTION OF REARRANGED DNA
Abstract
The invention provides methods for the identification of members
of a malignant lymphocyte clone by analysis of clonotypic DNA
rearrangements of T cell or B cell receptor genes. The DNA or RNA
from isolated single tumor cells is amplified by PCR using
consensus primers to the VDJ region of the receptor genes, and the
sequence of the VDJ region is obtained from each. The clonotypic
sequence of the malignant clone is identified as the most frequent
VDJ sequence amplified. Individual-specific PCR primers for the VDJ
region are then designed based upon the clonotypic sequence. These
specific PCR primers are used to detect and quantitate clonotypic
cells in subsequent patient samples using in situ PCR or in situ
RT-PCR. Fractionated or unfractionated samples of blood or bone
marrow, as well as tissue sections can be analyzed. The methods
provide a highly sensitive and quantitative means to monitor the
progress of disease and the efficacy of treatment protocols, as
well as to detect members of the malignant clone in autologous bone
marrow cells destined for transplant.
Inventors: |
PILARSKI, LINDA M.;
(ALBERTA, CA) ; BELCH, ANDREW R.; (ALBERTA,
CA) ; SZCZEPEK, AGNIESZKA J.; (ALBERTA, CA) |
Correspondence
Address: |
LAHIVE & COCKFIELD, LLP
28 State Street
Boston
MA
02109
US
|
Family ID: |
21791477 |
Appl. No.: |
09/194842 |
Filed: |
April 1, 1999 |
PCT Filed: |
June 3, 1997 |
PCT NO: |
PCT/US97/09534 |
Current U.S.
Class: |
435/6.16 ;
435/91.2; 536/24.31; 536/24.33 |
Current CPC
Class: |
C12Q 2600/156 20130101;
C12Q 2600/106 20130101; C07K 2317/565 20130101; C12Q 1/6886
20130101; C12Q 2600/158 20130101 |
Class at
Publication: |
435/6 ; 435/91.2;
536/24.31; 536/24.33 |
International
Class: |
C12Q 001/68; C07H
021/04; C12P 019/34 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 3, 1996 |
US |
60/019106 |
Claims
We claim:
1. A method for detecting a target clonotypic nucleic acid
rearrangement in hematopoietic cells from a subject having, or at
risk of having, a hematopoietic neoplastic disorder comprising: a)
isolating a hematopoietic neoplastic cell containing the target
clonotypic nucleic acid rearrangement; b) amplifying a specific
segment of the target nucleic acid containing the clonotypic
rearrangement; c) determining the sequence of the amplified
segment; and d) detecting the presence of the specific clonotypic
nucleic acid sequence in hematopoietic cells derived from a subject
having, or at risk of having, a neoplastic hematopoietic
disorder.
2. The method of claim 1 wherein the hematapoeitic cells are
malignant cells.
3. The method of claim 2 wherein the hematapoietic cells are B
cells or T cells.
4. The method of claim 1 wherein the hematapoietic cells are
multiple myeloma cells.
5. The method of claim 1 wherein the clonotypic rearrangement is in
an Ig gene locus.
6. The method of claim 1 wherein the clonotypic rearrangement is in
a TCR gene locus.
7. The method of claim 1 wherein the clonotypic rearrangement is a
chromosomal translocation.
8. The method of claim 1, wherein the amplifying is by PCR.
9. The method of claim 8 wherein cells bearing a clonotypic
rearrangement are detected by direct labeling of a PCR product.
10. The method of claim 1 wherein cells bearing a clonotypic
rearrangement are detected by nucleic acid hybridization to a PCR
product.
11. The method of claim 8 wherein PCR primers for PCR specifically
amplify the unique hypervariable regions of the IgH, k or 1 Ig
gene, or of the TCR a, b, g or d chain.
12. The method of claim 8 wherein PCR primers for PCR are specific
for the CDR1, CDR2 and/or the CDR3 region.
13. The method of claim 12 wherein the specific primers for the
CDR1, CDR2 or CDR3 region are used in conjunction with a
framework-specific consensus primer.
14. The use of the method of claim 1 to examine patient blood or
bone marrow samples to monitor the response to treatment in a
hematological malignancy.
15. The use of the method of claim 1 for the purpose of testing
bone marrow cells containing stem cells destined for autologous
transplantation.
16. A kit useful for the detection of a target clonotypic nucleic
acid rearrangement from a subject having, or at risk of having, a
hematopoietic neoplastic disorder wherein the target clonotypic
nucleic acid rearrangement is indicative of a neoplastic disorder,
the kit comprising carrier means being compartmentalized to receive
in close confinement therein one or more containers comprising: a)
a first container containing nucleic acid primers specific for a
CDR1, CDR2 and/or CDR3 region; and b) a second container containing
framework-specific nucleic acid primers.
17. The kit of claim 16 further comprising an amplification
polymerase and deoxyribonucleotide(s).
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of Invention
[0002] The invention relates generally to a method for the
detection of malignant cells, and the use of the method to monitor
disease progression and response to treatment in cancer patients.
In particular, the invention relates to the identification of
malignant lympho-cytes by PCR amplification of immunoglobulin or T
cell receptor genes which are uniquely rearranged in the malignant
clone.
[0003] 2. Description of the Related Art
[0004] Lymphoid malignancies are characterized by the proliferation
of cells which carry a unique genetic marker by virtue of their
rearranged receptor genes, the immunoglobulin (Ig) genes in B
cells, and the T cell receptor (TCR) genes in T cells. It is well
known in the art that germ line genes for both Ig and TCR exist as
pools of gene segments which become assembled during the normal
differentiation of B and T lymphocytes by a process of site
specific recombination (Alberts et. al., 1995). Diversity of Ig and
TCR are generated by the combinatorial association of these gene
segments from the different pools, so that the total repertoire of
antigen receptors is log-folds greater than the actual number of
receptor gene segments.
[0005] The Ig genes comprise 3 clusters of genes, on three
different chromosomes: (1) the heavy chain (IgH) genes, which
include the immunoglobulin heavy chains, (2) k light chain genes
and (3)1 light chain genes, which encode the immunoglobulin light
chains. The IgH cluster consists of four pools of gene segments,
known as C (constant), J (joining), D (diversity) and V (variable).
There are nine C gene segments, arranged in an ordered cluster,
which determine the class of the heavy chain. The variable region
of the IgH is encoded by pools comprising 6 J segments, 10 or more
D segments and at least 50 V segments. The arrangement of these
gene segments on the chromosome is depicted in
[0006] FIG. 1. The Ig light chain genes consist of C, J, and V, but
no D segment. Similarly, the genes for the a and b and the g and d
chains of the TCR exist on separate chromosomes as pools of C, J,
D, and V gene segments.
[0007] During differentiation of a T or B cell, the germ line genes
are rearranged so that one member of each pool of variable region
gene segments (J, D, and V) is randomly selected and the selected
segments are joined together. The process of site specific
recombination that takes place during lymphocyte differentiation is
distinctive, in that during the joining of the Ig and TCR gene
segments J, D and V, a variable number of nucleotides may be lost
from the ends of the recombining gene segments. In the case of IgH
recombination only, one or more nucleotides may also be randomly
inserted at the joining site. This loss and gain of nucleotides at
the joining sites Ig or TCR is a source of further diversity. It
yields rearranged Ig or TCR genes which may be different in length.
If short regions spanning the junctions of gene segments (VD, DJ,
and JC) are examined, they may be substantially different in
length.
[0008] The variable regions of both Ig and TCR comprise three
regions with little sequence homology between different clones,
which are known as "hypervariable" or "complementarity-determining
regions" (known as CDR1, CDR2. and CDR3, shown in FIG. 1). The
intervening portions of the variable region are more consistent
between different clones, and are known as "framework" (FR1, FR2.
FR3, and FR4). The CDR3 region, which is encoded by the VJ
junctional region of the light chain, and the D region plus the VD
and DJ junctional regions of the heavy chain, is the most highly
variable, due to the somatic mutations introduced during
recombination, as described above. Each B lymphocyte expresses only
a single rearranged IgH gene, and a single rearranged k or 1 gene.
Each mature T lymphocyte expresses a single TCR a chain and a
single TCR b chain. In a lymphoid malignancy, if clonal expansion
of a tumor progenitor cell took place after rearrangement of the Ig
or TCR gene, it is possible to identify a signature or clonotypic
rearrangement which is characteristic of the malignant clone. With
the appropriate molecular probes, cells related to the malignant
clone can be distinguished from cells with unrearranged Ig or TCR
genes, or cells which carry different rearrangements. The
rearrangement of Ig or TCR genes in a clone is called its
"clonotypic rearrangement".
[0009] It is clinically important to be able to detect and
characterize tumor cells, not only at diagnosis, but during and
after treatment. It is also important to be able to detect any
malignant cells that might contaminate a population of stem cells
destined for autologous transplantation after ablative
chemotherapy. The following methods which are currently available
to detect malignant cells carrying a monoclonal or clonotypic
rearrangement in patient samples differ in their accuracy and their
sensitivity. None are quantitative.
[0010] Morphological examination of cells in patient blood samples
or biopsies is currently used, but is relatively insensitive in
detecting minimal residual disease. Also, cells which might be
related to the malignant clone, but are at a different stage of
maturation, and thus have a different morphology from the bulk of
the tumor cells, are probably missed.
[0011] Southern blot hybridization analysis of isolated DNA, a
technique which is well known in the art, requires that between 1
and 5 percent of the cells in the patient sample carry a clonotypic
rearrangement for it to be detected. Although this technique has
been used to detect a monoclonal population of cells which are
present in high frequency, it is not useful for the detection of
minimal residual disease, because it is not sensitive enough. Also,
it cannot provide sequence information that definitively
characterizes a malignant clone.
[0012] Recently, techniques have been developed which rely upon the
use of the polymerase chain reaction (PCR) to amplify clonotypic
DNA rearrangements in malignant cells. PCR, which is well known in
the art (U.S. Pat. No. 4.683 202 to Mullis, 1987), is a process of
repeated cycles of DNA denaturation, followed by DNA synthesis
which is used to amplify segments of DNA between two fixed anchor
points on a DNA molecule.
[0013] Single stranded oligonucleotide primers, called PCR primers,
are constructed (based on previously obtained nucleic acid sequence
information) which will hybridize to the anchor points, one primer,
the upstream primer, on the sense strand, and the other primer, the
downstream primer, on the antisense strand. The DNA segment is heat
denatured, and then cooled to a temperature at which the PCR
primers will anneal to their complementary sequences on the DNA
segment. A heat-stable DNA polymerase enzyme then copies the DNA
between the two anchor points. In 20-40 or more successive cycles
of denaturation and DNA synthesis, the DNA segment of interest
(between the two anchor points) can be amplified a million-fold or
more. The two anchor points must be within a few thousand
nucleotides of each other for efficient amplification to occur. In
RT-PCR (reverse transcriptase PCR), the RNA in cells is used as the
template. It is first copied into cDNA using the enzyme reverse
transcriptase, and the resultant cDNA is subjected to the PCR
reaction.
[0014] In the context of clonotypic rearrangements, "consensus" or
"framework" PCR primers which hybridize to DNA in the constant or
framework regions of rearranged Ig or TCR are used to amplify DNA
prepared from patient blood or bone marrow samples containing a
high proportion of tumor cells. For example, the upstream primer
might be chosen from the 5' end of the V segment, and the
downstream primer from the J segment. Germ line (unrearranged) DNA
will not be amplified to detectable levels because the distance
between the primers is too great for efficient synthesis. A
monoclonal rearrangement can often (but not always) be detected as
a single band if the amplified DNA is electrophoresed on an
appropriate gel. This amplified DNA represents the putative
hypervariable region containing the clonotypic V(D)J rearrangement.
More specific PCR primers, referred to as patient-specific PCR
primers can be designed once the clonotypic sequence has been
determined. The following prior art utilizes PCR technology.
[0015] U.S. Pat. No. 5, 418,132 to Morley (1995) teaches a method
for the diagnosis of leukemia and lymphoma by PCR amplification of
Ig or TCR gene segments using consensus framework primers, followed
by separation of the PCR products on the basis of size. Because
rearranged Ig or TCR genes vary somewhat in their size, as noted
above, a clonotypic rearrangement that has been amplified can often
be detectable as a discrete band on a gel. If the patient sample
does not contain a monoclonal population of cells, size separation
will yield a smear, with no detectable discrete band. However, the
inventors disclose that this method fails to produce a discrete
band with every patient sample, even when multiple pairs of primers
are employed. This method could be useful during initial diagnosis
when the tumor burden is high, but is not proposed as a means of
following minimal residual disease after treatment, because it does
not involve detection of a specific clonotypic rearrangement.
[0016] Flow cytometry-based fluorescent in situ hybridization
(FISH) using immunoglobulin heavy chain variable region probes (Cao
et al., 1995a; 1995b) has been suggested as a method to detect
clonotypic rearrangements in individual cells in myeloma. The FISH
technique involves hybridization of a biotin-labeled anti-sense RNA
probe to the unamplified RNA in fixed cells in suspension. Cells
which contain RNA complementary to the clonotypic sequence are then
detected by means of flow cytometry. The sequence of the anti-sense
RNA probes are derived by amplifying the mRNA expressed in myeloma
patients' bone marrow mononuclear cells using RT-PCR from
homogenized total RNA with consensus framework PCR primers for the
IgH variable region. Because the RNA in the cells to be assayed is
not amplified, this method is only sensitive enough to detect cells
in which the clonotypic RNA is highly abundant, but it cannot
detect cells with a low level of the RNA, or cells in which the DNA
is rearranged, but is not being transcribed. For example, FISH
might work well with myeloma plasma cells, which are virtual
"immunoglobulin factories", and contain extremely high
concentrations of mRNA encoding the Ig being produced by the cell.
However, FISH would not be sensitive enough to detect pre-B cells
or B cells which share the clonotypic rearrangement of a myeloma
malignant clone, but do not transcribe or have a low level
transcription of the gene.
[0017] RT-PCR or PCR using patient-specific PCR probes have been
used to amplify bulk RNA or DNA preparations made from myeloma
patient samples in an attempt to follow minimal residual disease
(Billadeau et. al 1991; Billadeau et al, 1992; Billadeau et al.,
1993; Chen and Epstein 1996; Cao et al. 1995). In all of these
reports, the sequences of the PCR primers were originally derived
from amplification of bulk RNA or DNA isolated from
tumor-containing material, which the present inventors find may
amplify a sequence which is unrelated to the malignant clone.
Another major problem with this approach is that the use of bulk
nucleic acid to detect clonotypic sequence does not give
quantitative results, and may grossly underestimate the frequency
of clonotypic sequences.
[0018] A reliable method to quantitate malignant cells during
assessment of minimal residual disease does not currently exist. A
reference by Yameda et al., 1990 proposed a method based on cloning
the products of a PCR amplification into bacteriophage and
attempting an analysis of the ratio of phage carrying the
clonotypic sequence to phage carrying any other rearrangement.
Billadeau et al. (1991) proposed to quantitate a PCR amplification
of bulk nucleic acid by preparing a standard curve by seeding known
numbers of clonotypic cells into a population of non-rearranged
cells. Both proposed methods are very indirect. The FISH method of
Cao, cited above, while it provides an analysis on a single cell
level, is too insensitive to be quantitative, measuring only the
cells which express very high levels of mRNA.
[0019] In situ PCR and in situ RT-PCR are known in the art as means
to detect nucleic acid sequences in single cells (U.S. Pat. No.
5,436,144 to Stewart and Timm, 1995 ; Nuovo, 1994).
[0020] It is clinically important to be able to monitor the members
of a malignant T or B lymphocyte clone, over time in order to
determine the effect of treatment on cells of malignant lymphocyte
clones. Since most of these malignancies are heterogeneous in
differentiation state and/or morphology, the only marker that
unequivocally confirms a relationship with the malignancy is the
immunoglobulin rearrangement of the IgH, light chain (k or 1) or
the T cell receptor a, b, g or d. Assays using bulk nucleic acid
from lymphocyte populations are not quantitative and do not
identify the clonotypic cell types present in blood, lymphoid
tissue or bone marrow. Often the malignant lymphocyte comprising
the major cellular mass of primary tumor divide slowly or not at
all, and may be terminally differentiated with little generative
capacity. Hematopoietic malignancies appear to be hierarchical with
components at sequential states of differentiation not easily
detected with conventional clinical assays, especially if they are
present at low frequency. Thus at present, the effects of treatment
on the full hierarchy of malignant cells in diseases much as
myeloma, lymphoma and chronic and acute lymphocytic leukemias,
cannot be assessed.
DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 is a schematic drawing of the immunoglobulin heavy
chain locus in germ line and rearranged DNA.
[0022] FIG. 2 is a photograph illustrating the detection of
amplified IgH rearrangements using consensus primers in single
plasma cells and single B cells from a multiple myeloma patient 6
months after chemotherapy. PBMC from patient JOD-5 were taken one
month after completing 6 cycles of chemotherapy. PBMC were stained
with CD19-FITC and individual CD19+ cells were deposited into lysis
buffer in PCR tubes using the ELITE Autoclone cell deposition unit.
DNA was amplified using hemi-nested consensus primers designed to
detect IgH rearrangements. BMC were stained with CD38-PE and
anti-human Ig-FITC and CD38+ cells with high forward and side
scatter were sorted into PCR tubes. Lane 19 contained molecular
weight standards. Lane 1 contained a "water control" for the first
step of the consensus PCR. Lanes 2-9: bands amplified from single
CD19+ PBMC. Lanes 11-18: bands amplified from single BM plasma
cells.
[0023] FIG. 3 is a sequence alignment of CDR2 and CDR3 sequences
obtained from sorted blood B cells and autologous BM plasma cells.
IgH bands amplified in hemi-nested PCR, shown in FIG. 2, were cut
out, ligated into a sequencing vector, and sequenced using dideoxy
chain termination. (A) shows the CDR3 sequence obtained for 2 of
the 10 sorted BM plasma cells (from FIG. 2 and 3 others from the
JOD-5 BM sample: in total, the product from 11 individual BM plasma
cells was sequenced). Sequences were compared to known sequences
using BLAST and the VBASE database, and aligned using GCG software.
All 10 sequences were most closely related to the DP-31 VH3 gene
family. The DP-3 1 sequence (line 1) aligned with 2 representative
JOD B cells (lines 2 and 3) and 2 representative BM plasma cells
(lines 4 and 5), as well as the consensus JOD sequence from the 10
plasma cell sequences (line 6). Although the JOD sequence varies
from the P-3 I sequence in several places, the same variation
occurred in all JOD B and plasma cells, with few exceptions (e.g.
BM plasma cell 4.4, line 5, positions 213, 214, 215). CDR2 and CDR3
sequences used for primers in PSA are underlined. (B) shows the JOD
consensus sequence (line 1) aligned with the unrelated BM plasma
cell 5.3 (line 2) and with the unrelated B cell (line 3), as well
as a related BM plasma cell for comparison (line 4). The unrelated
B cell sequence aligned with VH4a, and the unrelated plasma cell
sequence aligned best, although at only moderate homology, with the
DP-3 1 sequence. The absence of bands from water controls (FIG. 2)
and the amplification of an unrelated IgH sequence from plasma cell
#11, shows that the presence of a common sequence for 10/11 cells
amplifying a band, does not reflect contamination by JOD DNA, and
that amplification requires the presence of a cell in the tube. The
consensus rearrangement identified in 10/11 plasma cells was
designated as clonotypic for JOD.
[0024] FIG. 4 depicts patient-specific amplification (PSA) using
CDR2 and CDR3 primers specific for the JOD clonotypic VDJ
rearrangement. Blood was taken at 12 months post-diagnosis from
patient JOD (JOD-6). DNA from 27 single sorted B cells were
amplified in a two step PCR. The initial amplification was carried
out with consensus primers, followed by 40 cycles of PSA PCR using
primers homologous to the CDR2 and
[0025] CDR3 sequences (Table 1) of the JOD clonotypic sequence
identified in FIG. 3. The PSA step of PCR was at high stringency
(60 1/2C). (A) shows that a product of the expected size was
amplified from 9/27 individual B cells. (B) gives the sequence of
the product amplified by the CDR2 and CDR3 primers from 6 of the 9
B cells from which a patient-specific band was amplified.
[0026] FIG. 5 shows the use of consensus primers in single cell
RT-PCR to amplify IgH rearrangements from patient LAR BM plasma
cells, the sequences obtained from the resulting PCR products, and
the use of patient-specific primers derived from the sequence to
amplify clonotypic sequences in single cells. (A) BMC from LAR,
taken at diagnosis, were stained and individual plasma cells were
sorted into PCR tubes. mRNA was amplified at relatively low
stringency using hemi-nested consensus RT-PCR. (B) The CDR2 to CDR3
sequence of LAR. Bands from (A) were cut out and sequenced. For 3/3
BM plasma cells the same VDJ sequence was obtained. (C) To confirm
the number of single plasma cells expressing the sequence
identified in (B), primers homologous to the patient-specific CDR2
and CDR3 regions were designed (Table 1) and used at high
stringency to amplify mRNA from 48 individual BM plasma cells.
42/48 amplified a product of the expected size, confirming the
sequence of (B) as clonotypic for LAR.
[0027] FIG. 6 demonstrates the specificity of LAR patient-specific
primers. Clonotypic LAR sequences are amplified in bulk RT-PCR from
unsorted LAR BMC and from sorted LAR blood B cells but not from LAR
blood T cells, or from BMC of unrelated patients. RNA was amplified
from unsorted BMC, from sorted PBMC B cells and from sorted PBMC T
cells using patient-specific CDR2/CDR3 primers (Table 1) at high
stringency.
SUMMARY OF THE INVENTION
[0028] Recognizing the need for a clinically feasible test for
assessing minimal residual disease in lymphoid malignancies which
would require a more accurate, sensitive and quantitative method to
detect clonotypic rearrangements in patient samples than was
currently available, the object of the invention was to develop a
method with the following features: consistently accurate PCR
primer specificity, a quantitative readout, and high sensitivity.
Ideally, the method should also be compatible with allowing
qualitative identification of the cell types which express a given
clonotypic rearrangement.
[0029] The invention is based upon the discovery that the most
accurate and quantitative information regarding the identity of a
clonotypic sequence and frequency of clonotypic cells in patient
samples is obtained from RT-PCR or PCR analysis of nucleic acid in
whole cell lysates, rather than from purified bulk preparations of
nucleic acid. The inventors made the following observations:
[0030] PCR amplification of bulk nucleic acid preparations from MM
plasma tumour cells using consensus primers for the VDJ region
frequently yields a sequence which turns out not to be the
clonotypic sequence of the malignancy.
[0031] Quantitative measurements of the frequency of a clonotypic
sequence made on bulk nucleic acid preparations tend to grossly
underestimate the frequency of such cells.
[0032] The inventors have circumvented these problems, which hinder
the development of a clinical test for minimal residual
disease:
[0033] (1) by performing RT-PCR or PCR directly in cell lysates
made within a few hours of being harvested from the patient. In the
case of MM patient samples, PBMC or BMC are diluted in a small
volume (several microliters) of an appropriate lyses buffer. RT-PCR
or PCR is performed directly in the cell lysate; and
[0034] (2) by performing RT-PCR in situ in intact cells. In situ
RT-PCR amplification is carried out using patient specific VDJ
region primers in cells affixed to slides, which allows for the
direct visualization and counting of clonotypic cells.
[0035] In accordance with the invention a method for the detection
of clonotypic gene rearrangements in patient cell samples comprises
two phases. In the first phase, the nucleotide sequence of the
clonotypic rearrangement is determined, and the patient-specific
PCR probes are designed, using the following steps:
[0036] (a) isolating single cells or pools of up to 1000 cells by
means of cell sorting, limiting dilution, or other means from a
tumor cell-rich sample of patient cells,
[0037] (b) amplifying a region of DNA comprising at least a portion
of VDJ in several of the isolated single cells or pools of up to
1000 cells by PCR or RT-PCR, using pairs of consensus framework
primers which are known to amplify DNA in the variable region of Ig
or TCR, or alternatively, amplifying DNA known to contain another
type of DNA rearrangement, such as a chromosomal translocation
using appropriate conservative primers;
[0038] (c) determining the nucleotide sequence of the amplified DNA
segments;
[0039] (d) constructing patient-specific PCR primers, which bracket
the amplified nucleotide sequence, specific for the CDR, CDR2, and/
or the CDR3 regions, or the CDR1, CDR2, or CDR3 region, or any set
of primers that specifically amplify the unique hypervariable
regions of the IgH, k or 1 immunoglobulin gene, or the TCR a, b, g
or d chain, or any set of primers that specifically amplify a
clonotypic rearrangement in lymphoid malignancies.
[0040] (e) confirming that the patient-specific primers amplify the
sequence obtained in (c) above, and no other sequences.
[0041] The second phase of the method of patient specific
amplification comprises the use of in situ RT-PCR or PCR to amplify
a nucleotide sequence comprising a clonotypic rearrangement in
intact cells, without removing the DNA or RNA from the cell, as
follows:
[0042] (a) performing in situ PCR or in situ RT-PCR, using the said
patient-specific probes on patient tissue samples comprising
fractionated or unfractionated white blood cells, peripheral blood
mononuclear cells, or bone marrow cells, or any other patient
samples such as tissue biopsies, which are either fixed to slides,
or fixed in solution.
[0043] (b) directly detecting the resultant amplified DNA in cells,
or, for an additional confirmation of specificity, hybridizing the
amplified DNA in situ to labeled nucleic acid probes comprising an
internal portion (which excludes any primer sequence) of the
clonotypic region.
[0044] An alternative or complement to the second phase of the
method described above comprises determining the frequency of
clonotypic cells by means of a limiting dilution RT-PCR or PCR
assay as follows:
[0045] (a) diluting cells in series to give from approximately 1000
cells to 1 cell per tube,
[0046] (b) lysing the cells in the tubes,
[0047] (c) performing RT-PCR or PCR on the resulting material,
[0048] (d) counting the number of tubes containing the clonotypic
sequence for each dilution, and
[0049] (e) estimating the frequency of clonotypic cells.
[0050] The advantage of the limiting dilution methodology is that a
clonotypic sequence can be detected from a single cell as in the in
situ assay, but the limiting dilution method is simpler and more
cost effective. Cells destined for this method can be processed
quickly and stored at -80.degree. C. for later analysis. Cells
destined for in situ RT-PCR must be fixed, washed and applied to
slides within 1 8-24h.
[0051] The invention extends to a patient-specific kit designed for
the analysis of clonotypic cells in patient samples comprising at
least one but preferably two patient-specific PCR primers, and a
nucleic acid probe comprising at least a portion of the clonotypic
V(D)J region which is amplified by the patient-specific PCR primers
or the patient-specific primer and an appropriate consensus
primer.
[0052] The method is used to detect malignant lymphocytes in
patient samples in a wide variety of applications, which include,
but are not limited to the following:
[0053] to monitor clonotypic cells before during and after
treatment in any lymphoid malignancy in which any Ig or any TCR
genes are rearranged, including, but not limited to multiple
myeloma, Hodgkin's lymphoma, and ALL;
[0054] to monitor clonotypic cells before, during or after
treatment in lymphoid malignancies in which the clonotypic
rearrangement comprises a chromosomal translocation;
[0055] to monitor the presence of clonotypic cells in a population
of cells to be transplanted, for example bone marrow cells or
isolated stem cells;
[0056] to monitor the presence of clonotypic cells in pre-malignant
conditions such as monoclonal gammopathy of undetermined
significance, indolent myeloma, or smoldering myeloma;
[0057] to monitor the presence of clonotypic cells in autoimmune
diseases characterized by autoimmune clonal expansion;
[0058] for use in the identification of the variety of cell types
representing the various differentiation stages which comprise a
malignant clone; and
[0059] for use in the development of treatment protocols which
require sensitive tests for malignant cells in blood, bone marrow
and other tissues.
[0060] Broadly speaking, one aspect of the invention is a method
for determining the correct patient-specific clonotypic nucleic
acid sequence for a tumour comprising:
[0061] performing RT-PCR or PCR with consensus primers using the
unpurified nucleic acid released from small numbers of lysed tumour
cells. and preferably a single tumour cell, as a template, to
generate a product, and
[0062] obtaining the nucleotide sequence of the product.
[0063] Another aspect of the invention is a method for analyzing
the number of cells in a population of cells which contain a
clonotypic sequence, comprising:
[0064] performing RT-PCR or PCR with at least one correct patient
specific clonotypic primer to amplify the clonotypic nucleotide
sequence in intact cells, and
[0065] detecting the amplified clonotypic sequence in the intact
cells.
[0066] A further aspect of the invention is a method for analyzing
the number of cells in a population of cells which contain a
clonotypic sequence comprising:
[0067] performing RT-PCR or PCR with at least one correct patient
specific clonotypic primer to amplify the clonotypic nucleotide
sequence using the unpurified nucleic acid released from cells
which have been subjected to limiting dilution and lysed. and
[0068] detecting the amplified clonotypic sequence.
DETAILED DESCRIPTION OF THE INVENTION
[0069] The invention comprises methods for the detection of
clonotypic DNA rearrangements in lymphoid tissues. The inventors
encountered two problems during their investigation of the role of
blood-borne clonotypic B cells in myeloma. The first was that no
existing method of screening for clonotypic rearrangements was both
sensitive enough and quantitative enough to provide a reliable
count all of the clonotypic cells in all states of differentiation.
The second was that in attempting to generate patient-specific PCR
primers using bulk RNA or DNA isolated from myeloma bone marrow
cells, it became evident that consensus primers to the IgH variable
region sometimes amplify a VDJ sequence which is not the clonotypic
rearrangement present in the myeloma cells. The reason for this was
not clear. However, use of the wrong PCR primers is fatal to any
attempt to assay for clonotypic cells in patient samples.
Identification of Clonotypic Sequence. Design and Testing of
Patient-specific Primers
[0070] One aspect of the invention provides for a reliable method
to generate PCR primers for use in screening. This aspect of the
invention is based on the premise that in order to unequivocally
determine the rearranged Ig or TCR sequence of a malignant clone,
it is necessary to amplify this rearrangement from a small number
of cells, preferably individual cells, sequence the amplified
product, and then confirm that the majority of cells thought to be
malignant actually express the identified sequence. This aspect of
the invention comprises the following steps:
[0071] (a) performing PCR using consensus framework primers on a
number of single tumor cells or groups of 1000 or fewer tumor cells
to amplify the clonotypic rearrangement,
[0072] (b) obtaining the amplified PCR products by gel
electrophoresis,
[0073] (c) obtaining the nucleotide sequence of the amplified PCR
products from several tumor cells before assigning a sequence to
the malignant clonotypic rearrangement,
[0074] (d) preparing patient specific DNA primers based on the
clonotypic sequence,
[0075] (e) testing the patient-specific primers, once constructed,
for their ability to amplify the clonotypic sequence and only the
clonotypic sequence in patient samples.
[0076] This aspect of the invention is directed toward overcoming
the problem that use of homogenized nucleic acid as the initial
source of the sequence can amplify an infrequent and thus
inaccurate sequence. It therefore provides for the identification
of the clonotypic rearrangement, using single tumor cells, or very
few tumor cells, rather than bulk homogenized DNA. For this
procedure, it is desirable to obtain a tumor-rich sample of cells,
or to enrich the cell sample for tumor cells, if possible. For
multiple myeloma, bone marrow plasma cells are an ideal source of
tumor material. Single cells can be sorted using a cell sorter such
as the ELITE Autoclone (Coulter Electronics), using surface markers
(which are detectable by fluorescently labeled antibodies), and/or
size gating to distinguish tumor cells from non-tumor cells in the
patient samples. For example, a large size, and a high
concentration of both the CD38 marker (detectable by an antibody to
CD38) and immunoglobulin (detectable by an antibody to
immunoglobulin) are diagnostic for myeloma plasma cells, as
detailed in the Materials and Methods section below. If the patient
cell sample contains primarily tumor cells, the single cells can be
plated by limiting dilution, without the need for cell sorting.
[0077] The single cells, prepared as indicated above, are placed
into a small volume consisting of a few microliters of an
appropriate lysis buffer, depending on whether RNA (RT-CR) or DNA
(PCR) will be used as the starting material for amplification (see
Materials and Methods). In all cases control samples which do not
contain a cell are included. At this point it is possible to
amplify DNA (which is present in only one copy) in the single cell,
or to copy RNA (which may be present in hundreds of copies, or none
at all, depending on the cell type) into cDNA which is then
amplified. In cells such as myeloma plasma cells, RNA is relatively
abundant, making RT-PCR practical. However, RNA is much more labile
than DNA, so cell samples which are not optimally fresh, in which
RNA may be degraded, could still be used for PCR, rather than
RT-PCR. If RT-PCR is done, then RNA is copied into cDNA by means of
the enzyme known as reverse transcriptase, using methodology well
known in the art. The methodology used by the inventors for this
step is outlined in the Materials and Methods.
[0078] PCR is then carried out in order to amplify all sequences
with VDJ rearrangements. The appropriate consensus framework
primers are chosen based upon known sequences in the constant or
framework regions of the Ig or TCR gene which bracket the VDJ
recombination sites, or a chosen hypervariable sequence. For Ig,
the rearranged heavy chain has more diversity than the rearranged
light chain, so that it is a better choice as a probe for
clonotypic sequence. However, if the heavy chain is not rearranged
in the tumor being assayed, primers to the light chains can be
used.
[0079] In order to minimize spurious amplification products, the
inventors in a preferred embodiment carried out two rounds of PCR
using hemi-nested consensus framework primers specific for IgH, the
sequences of which are given in Table 1. The first round of
amplification was done with an upstream primer which hybridizes in
the FR2 region (FR2), and a downstream primer which hybridizes in
the J region (JH1). An aliquot of the material from the first round
of amplification was used for a second round of amplification using
the same upstream primer, and a downstream primer (JH2) which
hybridizes in the J region, just upstream (on the 5' side) of the
JH 1 primer.
[0080] The products of the second round of amplification are
subjected to electrophoresis in an agarose or polyacrylanide gel,
using methodology which is well known in the art, including the use
of appropriate size markers. The PCR products are variable in
length, depending on the choice of primers and length of the DNA
segment which is bracketed by the primers. However, most products
will be within the range of 150-200 nucleotides. The bands are cut
out of the gel, separated from the gel material using methodology
well known in the art, ligated into a sequencing vector and
sequenced using standard methodology (see Materials and Methods).
The sequences obtained for the panel of single cells can be
conveniently compared to known Ig, TCR or other sequences using
information contained in data bases such as BLAST and the VBASE
database, and can be aligned using appropriate software. Generally,
the sequence obtained aligns with one of the VH families if IgH PCR
primers have been used. Once the sequences of a number of cells are
obtained and aligned, it is then possible to assign a consensus
sequence to the clonotypic rearrangement. FIG. 3A exemplifies the
alignment of sequences, and the consensus sequence assigned in a
preferred embodiment. The experience of the inventors in using
single purified myeloma plasma cells as starting material is that
many of the sequences obtained are identical or nearly identical.
However, the number of sequences obtained which are clearly
unrelated to the malignant clone will vary with the purity of the
tumor cell starting material.
[0081] Once the clonotypic sequence is known, it is possible to
design patient-specific PCR primers specific for one or more of the
most variable regions in the sequence. In a preferred embodiment,
the inventors chose the upstream primer in the CDR2 region and the
downstream primer in the CDR3 region of the rearranged IgH.
[0082] The next step is to confirm that the primers are truly
specific, in that they amplify the clonotypic sequence that they
bracket, and only that sequence . Single cells from the tumor
cell-rich source are again used as starting material for PCR or
RT-PCR. Appropriate controls, such as unrelated single B cells or T
cells are also included in the experiment. The first round of
amplification is carried out using the consensus primers (in the
preferred embodiment, the FR2 and the JH1 primers). However, the
second round of amplification is performed using the
patient-specific primers. Products are run on a gel and sequenced
as above. If the primers amplify the correct product--the
clonotypic sequence in tumor cells, but do not amplify any product
in irrelevant cells, then they have been vetted as patient-specific
primers suitable for use in analytical patient-specific
amplification (PSA), to be described below. If the primers do not
amplify a product, or if they amplify a spurious product, other
primers based on the clonotypic sequence can be selected.
Analysis of Clonotypic Cells Using PSA in Single Cells
[0083] In order for a screening test to be useful clinically for
the purpose of following the progress of disease and treatment, and
in order for clinical decisions to be based upon the results of the
test, it must have both a quantitative readout (the assay must be
done at the level of single cells, rather than bulk preparations of
nucleic acid made from a whole population of cells), and
sensitivity (the RNA or DNA reflecting the clonotypic rearrangement
in the single cells must be amplified to detectable levels, so that
clonotypic cells expressing low levels of RNA or no RNA can be
detected).
[0084] A further aspect of the invention therefore provides for the
use of in situ PCR or RT-PCR with patient-specific PCR primers,
which may be produced as indicated above, to detect clonotypic
rearrangements in single cells. In a preferred embodiment, a novel
use for in situ RT-PCR is described for amplifying the
CDR1-CDR2-CDR3 regions of individual cells placed on a slide, or
suspended in a solution. A cell with at least one gene copy of the
patient-specific rearrangement is amplified and is visualized using
an appropriate means, which may be colorimetry or autoradiography
if the process is carried out on slides, or fluorescence if the
assay is carried out in suspension.
[0085] The patient samples to be analyzed can include unpurified
white cells from blood after red cell lysis (WBC), isolated
peripheral blood mononuclear cells (PBMC) , or bone marrow
mononuclear cells (BMMC). Any of these cell populations can be
subjected to further fractionation, selection or depletion using
standard methods such as FACS sorting. For example, to quantitate
the proportion of T cells with a specific clonotypic rearrangement,
one approach would be to positively select for T cells using an
antibody to a T cell marker such as CD3 using a cell sorter, and to
examine the selected T cells for the presence of the clonotypic
rearrangement. Cells are generally formalin fixed before sorting
and purification in order to preserve RNA. If sorted cells are to
be used, approximately 10,000 cells (using an ELITE Autoclone
(Coulter) or comparable equipment) sorted into microtitre wells are
sufficient. The method is also amenable to using tissue biopsies or
sections from solid organs such as spleen and lymph node.
[0086] For analysis on slides, the cells can be placed onto
appropriately treated siliconized glass slides (for example, In
situ PCR glass slides from Perkin Elmer) in three spots each, to
accommodate processing of positive and negative controls on the
same slide. RT-PCR is carried out essentially according to
published methods (Nuovo, 1994), after fine-tuning the system for
the particular cell types and PCR primers being used. The
conditions for PCR and RT-PCR which gave optimal results for the
primers used in the Examples are detailed in the Materials and
Methods.
[0087] Another aspect of the invention encompasses, as an
alternative to amplification of clonotypic rearrangements in cells
affixed to slides, performing the in situ PCR or in situ RT-PCR in
cells in suspension, using methods generally disclosed in U.S. Pat.
No. 5,436,144 to Stewart and Timm (1995). Detection of clonotypic
cells is accomplished by means of flow cytometry. For example, the
PCR amplification step can be carried out in the presence of a
biotinylated dNTP, which can be detected in flow cytometry using
fluoresceinated (FITC-labeled) or phycoerytherin-labeled avidin.
Using this methodology, it is feasible to use two-color flow
cytometry to detect both the clonotypic DNA marker and a cell
surface marker. It is therefore possible to positively and
sensitively identify malignant cells which exist at a particular
differentiation state, as defined by expression of cell surface
markers, such as CD10, CD34, or CD38.
[0088] In a further aspect of the invention, the clonotypic
specificity of the product of in situ amplification is confirmed by
a step comprising hybridization of this product to a nucleic acid
probe comprising an internal portion (excluding any primer
sequence) of the clonotypic region (for example the IgH V(D)J
region). The amplification step is carried out in the absence of
labeled dNTPs, so that the PCR product is unlabeled, and detection
of cells positive for the clonotypic sequence is done by means of a
labeled nucleic acid probe. Alternatively, PCR products could be
labeled with a label which will not interfere with detection of the
hybridization probe. The process of in situ hybridization, both on
cells fixed to slides and in cells in suspension, is well known in
the art. The nucleic acid probes consist of a labeled single
stranded RNA.
[0089] In a further aspect of the Invention, rather than amplifying
the clonotypic sequence in situ in intact cells, the cells are
subjected to limiting dilution, down to 1 cell per tube, lysed, and
RT-PCR or PCR is carried out on the unpurified nucleic acid which
has been released from the cells. This method differs from methods
used in the prior art in that the released nucleic acid is used
without further purification or even ethanol precipitation. The
inventors have found that by performing RT-PCR on unmanipulated
cell lysates, it is possible to detect clonotypic sequence which is
the product of a single cell. The inventors believe that when
nucleic acid, especially RNA. is purified, material is lost or
degraded. This can lead to a gross underestimation of the number of
cells within a population which contain clonotypic sequence. The
inventors avoid loss and degradation of RNA in cell samples by
firstly, placing cells in a buffered solution which inhibits
degradation of RNA, and secondly, by not performing any
manipulations on the RNA before it is subjected to reverse
transcription and PCR.
[0090] This aspect of the invention, which is capable of detecting
single cells containing clonotypic sequence, provides an
alternative to the use of in situ RT-PCR and in situ PCR. It is
therefore possible to use this method to determine the frequency of
clonotypic cells in a population of MM PBMC, MM BM or other cells.
A limiting dilution of cells, followed by patient specific
amplification is performed. Defined numbers of PBMC or other cells
are placed in PCR tubes in a dilution series to give from
approximately 1000 cells to 1 cell per tube as soon as possible
after isolation. Controls containing no cells are included. The
products of amplification are detected on ethidium bromide stained
gels.
[0091] Generally, with MM PBMC, all wells containing 1000, 300, 100
and 30 cells contain the clonotypic nucleotide sequence, indicating
that at least 3 out of 30 or 10% of cells are clonotypic. If 2
wells containing 1 cell per well are positive, that would indicate
that approximately 66% of PBMC are clonotypic. More than 3
replicates can be used to obtain more precise numbers.
[0092] The details of this aspect of the invention are outlined in
Example 3 below.
[0093] The inventors anticipate that this aspect of the invention
will allow for testing of patient samples which are obtained in
centers which are not equipped to handle in situ RT-PCR or even
cell sorting. The inventors envision that a clinical lab would
obtain a "sample collection kit" comprising tested reagents and
tubes. For example:
[0094] PCR microtubes containing 8 ml of lysis buffer
(1.2.times.transcription buffer, a non-ionic detergent and RNASE
inhibitor),
[0095] PBS,
[0096] tubes for diluting cells, and
[0097] instructions.
[0098] The instructions would direct the technician to:
[0099] process blood or bone marrow on Ficoll to obtain mononuclear
cells, which is a standard laboratory procedure;
[0100] re-suspend the washed cells to a concentration of one
million (10.sup.6) cells per ml of PBS;
[0101] make dilutions (3 or 10 fold) by diluting the appropriate
volume of cell suspension into PBS to generate dilutions down to
10.sup.3 cells/ml (at that dilution 1 microliter contains 1 cell)
(for example, 100 ml of 10.sup.6 cells/ml into 900 microliters of
PBS generates a dilution containing 10.sup.5 cells/ml, etc.);
[0102] transfer 1 microliter from each cell suspension into ice
cold PCR tubes containing the lysis buffer in triplicate; and
[0103] freeze at -80.degree. C., and ship on dry ice to a core
lab.
[0104] In the core lab, bone marrow cells samples treated as above
would be subjected to RT-PCR using consensus primers to determine
the clonotypic sequence for the patient according to the method of
the invention. Blood, bone marrow or other types of cell samples
treated as above would be subjected to RT-PCR using patient
specific primers to determine the frequency of clonotypic cells in
the samples.
Applications
[0105] The methods of the invention can be used for the analysis of
any malignancy which carries a clonotypic rearrangement for which
it is possible to generate patient-specific PCR primers. These
include:
[0106] (1) malignancies of the T cell lineage, which carry
rearrangements of the genes for the a, b, g or d chains;
[0107] (2) malignancies of the B cell lineage, which carry
rearrangements of the genes for the immunoglobulin heavy chain, or
the k or 1 light chains;
[0108] (3) hematological malignancies in which a chromosomal
translocation provides a clonotypic marker, many of such
translocations involve an Ig or TCR locus (exemplified by, but not
limited to, translocations involving chromosome 11 band q23, which
occurs frequently in both myeloid and lymphoblastic leukemias
(Rowley, 1990) , and the translocation of the c-myc protooncogene
with the IgH locus (Taub et. al. 1982) . Translocations, involving
Ig or TCR loci have been identified in stem cell leukemia, T
cell-ALL, T cell CLL, Adult T cell Leukemia, T-prolymphocytic
leukemia, high and low grade lymphoma, diffuse lymphoma, B cell
CLL, multiple myeloma, follicular lymphoma, B-CLL, as well as
Burkitt's lymphoma.
[0109] The methods of the invention can be used to detect malignant
lymphocytes in patient samples for a wide variety of
applications:
[0110] to monitor clonotypic cells before during and after
treatment in any lymphoid malignancy;
[0111] to monitor the presence of clonotypic cells in a population
of cells to be transplanted, for example bone marrow cells or
isolated stem cells; (The failure of treating malignancies such as
multiple myeloma with ablative chemotherapy and radiotherapy
followed by autologous bone marrow or stem cell transplantation has
been attributed in part to contamination of the transplant with
cryptic tumor cells.)
[0112] to monitor the presence of clonotypic cells in pre-malignant
conditions such as monoclonal gammopathy of undetermined
significance, indolent myeloma, or smoldering myeloma;
[0113] to monitor the presence of clonotypic cells in autoimmune
diseases characterized by autoimmune clonal expansion;
[0114] for use in the identification and quantitation of the
variety of cell types representing the various differentiation
stages which comprise a malignant clone; and
[0115] for use in the development of treatment protocols which
require sensitive tests for malignant cells in blood, bone marrow
and other tissues.
[0116] The invention can be better understood by reference to the
following non-limiting examples, which illustrate the use of the
methods of the invention to quantitate the number of clonotypic B
cells in the blood of multiple myeloma (MM) patients over time,
before, during and after chemotherapy.
[0117] MM is characterized by the presence of monoclonal
immunoglobulin in the blood, lytic bone lesions, and often large
numbers of monoclonal plasma cells in the bone marrow. Although
many patients respond to treatment, nearly all relapse and become
refractory to treatment (Barlogie et al,. 1989; Greipp, 1992).
While it is clear that monoclonal plasma cells located in the bone
marrow directly or indirectly mediate most symptoms of myeloma,
these cells do not appear to have the qualities of growth and
spread required of a malignant progenitor cell. Consistent with
this, the degree of reduction of plasma cell burden (Bergsagel,
1979) or of monoclonal immunoglobulin (Palmer et al., 1989) does
not correlate with enhanced survival, and the extent to which bone
marrow used for transplantation is contaminated with plasma cells
has little impact on patient survival (Barlogie et al., 1989). A
number of observations have led to the view that the generative
compartment in myeloma includes B lineage cells found in the bone
marrow, the blood or both, at a stage of differentiation preceding
that of plasma cells (Pilarski and Jensen, 1992; Bergsagel et al.
1995; Pilarski et al, 1996; Jensen et al., 1991; Boccadoro et al,
1983; Hulin et al, 1978; Omede et al, 1993; Caligaris-Cappio et al,
1985; Berenson et al, 1987; Billadau et al., 1993; Takashita et al,
1994). Normal plasma cells are terminally differentiated B cells
which do not divide, but which are active in immuno-globulin
synthesis. There is no direct evidence that the malignant
clonotypic plasma cells in multiple myeloma divide either. However,
because there has been no way to detect the generative precursors
of multiple myeloma plasma cells, clinical analysis as well as
treatment has focussed on the plasma cell. Precursors have thus far
been overlooked, although their presence or absence may be crucial
to designing successful treatment protocols.
[0118] A number of studies have demonstrated cells in blood of
myeloma patients with an IgH rearrangement identical to that of
autologous bone marrow plasma cells (Bergsagel et al, 1995;
Bersenson et al, 1987; Takashita et al, 1994; Bakkus et al, 1994;
Billadeau et al, 1992; Corradini et al, 1993; Gazitt et al., 1994;
Owen et al., 1994; Sassel et al., 1990; Dreyfus et al., 1993;
Mariette et al., 1994; Cirradini et al., 1995; Chen and Epstein,
1996). The differentiation stage of these blood cells and their
number has been controversial. A first step towards evaluating the
extent to which peripheral blood lymphocytes include malignant
myeloma relatives is to quantitate the number of clonotypic B cells
in the circulation. Previous work showing the presence in
circulating cells of clonotypic rearrangements have provided a wide
range of estimates (Billadeau et al., 1992; Dreyfus et al., 1993;
Chen and Epstein, 1996; Vescio et al., 1995; Billadeau et al.,
1995). All of these estimates are based on the apparent frequency
of a given sequence within homogenized DNA or RNA from a
heterogeneous population of cells. The inventors have previously
identified a large subset of cells bearing CD19+ (a diagnostic
marker for B cells) in the blood of myeloma patients, some of which
have clonotypic sequences (Bersagel et al., 1995), with the
phenotype of late stage B cells and properties consistent with
malignant status (Pilarski et al,. 1996). In the examples below,
the inventors used the methods of the invention to unequivocally
determine the clonotypic sequence, and to quantitate the number of
clonotypic CD19+ B cells in the blood of multiple patients.
Materials and Methods
[0119] Patients: Blood and bone marrow were obtained after informed
consent from 20 patients with multiple myeloma, at diagnosis,
during intermittent chemotherapy and after treatment. Samples are
numbered sequentially, e.g. JOD-1, JOD-6, etc. Peripheral blood was
drawn into heparinized tubes and purified over Ficoll Paque
(Pharmacia, Dorval QB) as previously described (Bergsagel et al.,
1995) to give peripheral blood mononuclear cells (PBMC). Bone
marrow cells (BMC) were also purified using Ficoll Paque. All
samples were purified immediately after being drawn, and were
stained for cell sorting (as outlined below) and fixed within 4
hours after collection, to preserve mRNA. Samples for in situ
RT-PCR were stored for up to 24 hours in fixative prior to sorting.
For single cell PCR and RT-PCR, all samples remained unfixed, were
stained, sorted and processed within 4 hours post-collection of the
sample.
[0120] Antibodies and reagents: FMC 63 (CD19; a diagnostic marker
for B cells; Pietersz et al, 1995; Zola et al., 1991) was
conjugated to FITC. Leu4PE (CD3; a diagnostic marker for T cells)
and Leul 7-FITC (CD38; a diagnostic marker for plasma cells) were
from Becton Dickinson (San Jose, CA). Ig2a-PE, IgG1 and goat
anti-mouse Ig-PE were from Southern Biotech (Birmingham, Ala.).
Anti-human Ig F(ab)2 fragments coupled to PE and F(ab)2 fragments
of goat-anti-mouse PE were from Southern Biotech.
[0121] Immunoflourescence (IF) and cell sorting: Staining for
surface phenotype utilized 1 or 2 color IF with CD19-FITC and
CD3-PE, as described in Pilarski and Belch, 1994 and Bergsagel et
al., 1995. All experiments included controls with isotype matched
monoclonal antibodies. CD19+ and CD3+ subsets of PBMC were sorted
using the ELITE (Coulter, Hialieh, Fla.). BMC were stained with
CD38-FITC and anti-human Ig-PE followed by sorting of the cells
with high forward and side scatter that were stained by both CD38
and Ig reagents. Sort gates were set to include only those cells
with staining brighter than the relevant isotype controls, as
previously described (Bersagel et al., 1995). For single cell
experiments, individual CD19+ PBMC or CD38.sup.hi large BMC were
sorted into individual wells of a microtitre plate, or directly
into 0.2 ml thin walled PCR tubes. On reanalysis, sorted CD19+
populations had a purity of 95% or greater for the defining
phenotype. PBMC had no detectable contamination with any peripheral
plasma cells as defined by their relatively low cytoplasmic Ig
content (Bergsagel et al., 1995), and the absence of
morphologically identifiable plasma cells in cytospins of sorted
subsets, in cytospins of PBMC or in smears of patient blood. To
avoid any contamination between samples, and in particular to avoid
contamination of blood cells with BM cells, blood samples were
always sorted prior to bone marrow samples, and tubing in the flow
cytometer was always washed with bleach between sorts.
[0122] After Ficoll partial purification of BMC, the BMC can be
further separated into B or T cells or plasma cells using antibody
coated columns and these cells. Any of these populations of cells
could be diluted using limiting dilutions to yield one cell per
well and this procedure could be used in place of flow
cytometry.
[0123] Morphology of sorted CD19+ MM PBMC: Sorted CD19+ PBMC were
place on slides, and were stained with Wright's stain. Slides were
examined microscopically for morphological characteristics.
[0124] Patient-specific amplification (PSA): For amplification of
patient-specific sequences, primers to CDR2 and CDR3 regions of the
rearranged IgH VDJ from individual BM plasma cells were designed
and used for in situ RT-PCR. This was found to be more specific
than was the use of a CDR3 primer paired with a consensus FR2
primer. PSA utilized a primer from the 5' terminus of the CDR2
region paired with a primer to the entire CDR3 region. The
sequences for patients JOD and LAR PSA primers are given in Table
1. Primer sequences were designed based on the IgH VDJ sequence
present in the majority of individual BM plasma cells. For all
patients, the CDR2/CDR3 amplification was done using autologous T
cells as a negative control, and the specificity of the
amplification was confirmed by testing the primers on B cells from
an unrelated patient. For JOD, the sequences used in PSA were
detected in DNA from 10/11 single BM plasma cells. For LAR, the
presence of the clonotypic sequence was confirmed in the MRNA from
42/48 individual sorted LAR BM plasma cells using single cell
RT-PCR with patient-specific CDR2/CDR3 PSA giving a product of the
expected size, 162 base pairs.
[0125] Single cell PCR: Single cells were sorted into 0.2 ml PCR
tubes assembled on a Micro Amp base (Perkin Elmer, Mississauga,
ON). Each of the tubes contained 5 ml of lysis solution (200 mM
KOH, 50 mM DTT). After sorting, tubes were incubated in a thermal
cycler (Perkin Elmer) for 10 minutes at 65.degree. C. followed by
addition of 5 ml of neutralizing solution (900 mM Tris-HCl pH 9.0,
300 mM KCl , 200 mM HCl). Next, 40 ml of a PCR mix (0.1 mM dNTPs
[Boehringer Mannheim, Laval QB], 10 mM Tris-HCl pH9.0, 0. 1%
Triton-X-100, 2 mM MgC12, and 5 units of TAQ polymerase [Gibco/BRL,
Burlington ON]) containing 0.01 mM of both FR2 and JH1 primers [see
Table 1],was added to each sample. Samples were cycled as follows:
180 seconds at 95.degree. C. (initial denaturation step), followed
by 40 cycles of 30 seconds at 94.degree. C., 30 seconds at
52.degree. C., and 60 seconds at 72.degree. C., followed by a 10
minute terminal incubation at 72.degree. C. For consensus
amplification, two ml of each sample was then transferred into a
second PCR tube containing 48 ml of a PCR mix as above containing
0.01 mM of both FR2 and JH2 primers, and cycled as above. For
patient-specific amplification (PSA) with single cells, the second
round of amplification was performed as above, except with PCR mix
containing 0.01 mM of both CDR2 and CDR3 primers instead of the
consensus FR2 and JH2 primers, and a higher stringency annealing
temperature of 60.degree. C., instead of 52.degree. C. The final
products were analyzed by electrophoresis through 6% polyacrylamide
gels or on 2% agarose gels in 0.5.times. Tris/Boric Acid/EDTA (TBE)
buffer (Sambrook et al., 1989), followed by ethidium bromide
staining of the gels. and visualization of bands under UV
light.
[0126] Single cell RT-PCR: Single cells were sorted into 0.2 ml PCR
tubes as for single cell PCR, above. Each tube contained 4 ml of
RT-Lysis solution (SuperScript first strand buffer from Gibco/BRL
[0.25 M Tris-HCl (pH 8.3), 0.37 M KCl and 15 mM MgCl.sub.2], 0.5%
NP-40, 0.01M DTT, 0.25 mM dNTPs, 200 units of RNAse inhibitor, and
0.006 mMdT16 (a universal poly dT primer) . After sorting, the
samples were heated to 70.degree. C. for 10 minutes, placed on ice,
and 1 ml (10 units) of reverse transcriptase (SuperScript,
Gibco/BRL) was added to each tube. The tubes were incubated at
42.degree. C. for 30 minutes, and the reactions were stopped by
heating at 991/4C for 3 minutes. Two ml of synthesized cDNA were
transferred into fresh PCR tubes containing 48 ml of PCR mix (0.1
mM dNTPs, 10 mM Tris-HCl pH 8.3, 2 mM MgCl2, 2 units of TAQ
polymerase) containing 0.01 mM each of FR2 and JH1 primers. Samples
were heated for 3 minutes at 95.degree. C., followed by 25 cycles
of 30 seconds at 94.degree. C., 30 seconds at 52.degree. C. and 1
at 72.degree. C. For consensus PCR, 2 ml of this PCR-amplified
mixture were transferred into a third tube containing 48 ml of the
PCR mix containing 0.01 mM of both FR2 and JH2 primers, and cycled
as above for 25 cycles. For PSA, this final amplification was
performed as above, except with patient-specific CDR2 and CDR3
primers and an annealing temperature of 60.degree. C. The final
products were analyzed by electrophoresis through 2% agarose gels
in 0.5.times. TBE buffer, followed by ethidium bromide staining of
the gels, and visualization of bands under UV light.
[0127] In situ RT-PCR: In situ reverse transcriptase polymerase
chain reaction (RT-PCR) (Nuovo, 1994) was used to quantitate the
proportion of sorted PBMC expressing IgH mRNA, CD19 mRNA and
clonotypic VDJ rearrangements. PBMC from MM patients were stained
in double direct immunofluorescence with monoclonal antibody to
CD19 (CD19-FITC) and to T cells (CD3-PE), and fixed in 10%
formalin/PBS overnight. Using the ELITE Autoclone (Coulter), each
PBMC sample was sorted at 10,000 cells per well of a flat bottom 96
well microtitre tray into T (CD3+19-) and B (CD3-19+) fractions.
For some samples. the whole blood lysis method (Becton Dickinson)
was used to prepare cells for the in situ RT-PCR, as well as
unfractionated PBMC. Rapid processing prior to the fixation step
was essential to preserve mRNA. Samples were placed in 3 spots, at
10,000 cells per spot, on In situ PCR glass slides (Perkin Elmer)
and air dried. Cells were permeabilized using 2 mg pepsin
(Boehringer Mannheim) per ml of 0.01N HCl. The time of pepsin
digestion was carefully optimized. Pepsin was inactivated to a 1
minute wash in DEPC (diethylpyrocarbonate)-- treated water.
followed by a 1 minute wash in 100% ethanol. Digestion with 1000
U/ml of DNAseI (RNAse-free, Boehringer Mannheim) removed genomic
DNA prior to reverse transcription. Incubation of the sample with
DNAseI was performed in the In situ PCR System (Perkin Elmer)
thermal cycler at 37.degree. C. overnight. DNAseI was removed by a
1 minute wash in DEPC-treated water followed by a 1 minute wash in
100% ethanol. In situ reverse transcription was performed to 60
minutes at 37.degree. C. only for the test samples under standard
conditions recommended by the manufacturer using SuperScript
(Gibco/BRL) and the universal primer, dT16. After washing with
water and ethanol, an In situ Core Kit (Perkin Elmer) was used to
amplify a target sequence during 25-30 cycles (94.degree. C. for
1', 56.degree. C. for 1' and 72.degree. C. for 1.5') with a direct
incorporation of DIG-11-dUTP (Boehringer Mannheim) during PCR to
label the product. Amplified DNA was detected using anti-DIG Fab
conjugated with alkaline phosphatase (Boehringer Mannheim),
followed by incubation with NBT/BCIP substrate solution (Nitro blue
tetrazolium chloride/5-Bromo-4-chloro-3indolyl-phosphate,
4-toluidine salt, Boehringer Mannheim). Color development was
monitored under the microscope. Negative controls for every sample
included omitting the RT step to confirm digestion of genomic DNA
which would otherwise lead to amplification of non-specific PCR
products. As a positive control, mRNA for a housekeeping gene,
histone, was amplified to quantitate the number of cells on the
slide with intact mRNA. As a control for the specificity of the
primers used to amplify IgH mRNA and CD19, autologous T cells were
tested and were negative for both IgH and CD19 mRNA, as expected.
Primer pairs are given in Table 1. IgH mRNA was detected using
consensus primers to FR2 and JH.
[0128] RT-PCR using bulk RNA: RNA was prepared from 0.
1-10.times.10.sup.6 unfractionated BMC, PBMC or sorted populations
of B and T cells of the same patient using Trizol (Gibco/BRL)
according to manufacturer's directions. (The T cells, collected at
the same time as B cells in a double immunofluorescence sort, serve
as a negative control.) After purification, 1 microgram of RNA was
reverse transcribed using SuperScript reverse transcriptase
(Gibco/BRL) and the universal primer oligo dT.sub.15 using
manufacturers instructions. Briefly, RNA was incubated with the
primer for 10' at 70.degree. C., chilled on ice and 5.times. First
Strand Buffer (Gibco/BRL), 0.1M DTT, 0.25 mM dNTPs and 200 U
SuperScript reverse transcriptase were added. The reaction tube was
placed at 42.degree. C. for 30', followed by heating for 3' at
100.degree. C. PCR was performed under standard conditions.
Briefly, 2 ml cDNA from the reverse transcriptase reaction was
added to 48 ml of PCR Buffer (Gibco/BRL), containing 2 mM
MgCl.sub.2, FR2 and JH1 primers as described above for single cell
RT-PCR, and 1 U TAQ polymerase. Samples were cycled on the Perkin
Elmer Thermal Cycler 9600 for 25 cycles of 30 seconds at 94.degree.
C., 30 seconds at 50.degree. C. and 45 seconds at 72.degree. C. For
consensus RT-PCR, a second round of amplification was carried out
using FR2 and JH2 primers, and cycling as above. For PSA, the
second round of amplification utilized patient specific primers
CDR2 and CDR3 for 25 cycles at an annealing temperature of
60.degree. C. The PCR products were analyzed by electrophoresis on
2% agarose gels in TBE buffer. The gels were stained with ethidium
bromide, and bands were visualized with UV light.
[0129] DNA Sequencing: Sequencing was performed using techniques
well known in the art, with a.sup.32P-dCTP (Amersham, Oakville ON)
using either the Sequenase 2.0 system (Amersham) or the cycle
sequencing kit (Perkin Elmer) following the manufacturer's
instructions. For patient JOD, the FR2/JH2 PCR product was
subcloned into a Bluescript vector expressed in the DH5 strain of
Escherichia coli, purified, and sequenced using universal
sequencing primers. For LAR, the FR2/JH2 product was digested from
the low melting point gel using b-Agarase (New England Biolabs,
Mississauga ON) according to the manufacturers directions, and
sequenced directly using the FR2 and JH2 primers. The products of
sequencing were analyzed and aligned using GCG and NCBI BLAST
programs.
EXAMPLE 1
PATIENT JOD
Amplification of Rearranged IgH Sequences in MM PBMC CD19+ Cells
and Bone Marrow Plasma Cells using IgH Consensus Primers
[0130] Substantial numbers (mean=28-33% (Bergsagel et al, 1995)) of
CD19+ PBMC are detectable in PBMC of multiple myeloma patients
(Pilarski and Jensen, 1992; Bersagel et al., 1995; Pilarski et al.,
1996). A B cell is definitively identified by its rearranged
imunoglobulin genes and usually by the expression of Ig mRNA. To
confirm that the CD19+ PBMC obtained by cell sorting are in fact B
cells, single CD19+ PBMC from MM patient JOD were examined for
rearranged Ig genes. Single CD19+ cells were sorted into PCR tubes
and the DNA encoding the Ig heavy chain was amplified using PCR
with hemi-nested consensus framework primers to FR2, JH1 and JH2
(Table 1). A product of the expected size, about 160 base pairs,
was amplified from patient JOD
[0131] (FIG. 2), whose PBMC comprised 30% CD19+cells. Sequencing
followed by BLAST search indicated that all bands had an IgH V
region sequence. Single bone marrow plasma cells from the same
patient were also amplified using the same consensus primers. All
plasma cells examined, 11/11, gave bands that comigrated with those
produced upon amplification of the CD19+ cells (FIG. 2). Thus, all
CD19+ PBMC and all BM plasma cells analyzed had a rearranged IgH
CDR3.
Identification of the Clonotypic Rearrangement
[0132] To confirm that the product amplified in single cell PCR was
in fact IgH, and to determine whether or not the rearranged IgH
CDR3 sequence of BM plasma cells was shared by CD19+ PBMC, the
bands shown in FIG. 2 as well as additional bands from another gel,
were excised and sequenced from both the FR2 and JH directions. The
BM plasma cell clonotypic rearrangement for patient JOD was
identified as that sequence shared by the majority of plasma cells
examined. Ten out of eleven of the individual BM plasma cells had
an identical IgH rearrangement, providing proof that this was the
monoclonal JOD myeloma rearrangement (FIG. 3A). This rearrangement
aligned with the DP31 VH3 gene family (FIG. 3A). Of the CD19+ PBMC
B cells from JOD-5 (taken at month 7 after diagnosis), 9/10 had an
IgH CDR3 sequence identical to that of the autologous BM plasma
cells with little or no intraclonal variation. Representative PBMC
B and BM plasma cell sequences are presented in FIG. 3A aligned
with the DP-3 1 sequence. One B cell had an unrelated sequence that
was of a different V gene family (VH4a) (FIG. 3B). The unrelated BM
plasma cell aligned with the DP-31 VH3 sequence, but had low
homology to the JOD consensus sequence (FIG. 3B). Thus, for patient
JOD, who had just completed 6 cycles of VAD chemotherapy, 9/10, or
90%, of blood B cells were clonotypic. The absolute number of B
cells in blood for sample JOD-5 was 0.58.times.10.sup.9/L of blood,
and of these 0.52.times.10.sub.9/L were clonotypic. Thus clonotypic
cells in blood represented 8.6% of total white blood cells.
[0133] The clonotypic PCR primers for JOD were prepared based upon
the sequence information obtained from the single cell PCR, and are
shown in Table 1.
[0134] To confirm that the sequences identified as clonotypic for
JOD were actually expressed as mRNA, sorted B cells (CD19+) were
analyzed using in situ RT-PCR to amplify the clonotypic sequence
using patient specific primers (hereinafter referred to as
patient-specific amplification, PSA). Sorted B and T cells were
analyzed from patient JOD-6, at 11 months post diagnosis (5 months
after cessation of chemotherapy). To confirm specificity of the JOD
PSA, B and T cells from an unrelated MM patient were also tested.
All circulating B cells expressed CD19 mRNA. For two separate
aliquots of JOD-6 B cells, a mean of 71% expressed clonotypic mRNA
(Table 2). T cells from JOD-6 had 1% of clonotypic cells,
indicating a low level of contamination by B cells. However, T
cells from two different unrelated patients had less than 0.1%
clonotypic cells, and B cells from unrelated patients had 4% or
less positive cells, perhaps reflecting limited diversity in the
few normal B cells circulating in MM (Pilarski et al., 1984;
Pilarski et al., 1985), and confirming the specificity of the
patient-specific primers for JOD. Thus, clonotypic B cells, as
defined by patient-specific IgH rearrangement and MRNA synthesis,
are not eradicated by chemotherapy and persist for prolonged
periods after cessation of therapy. For JOD-6, B cells numbered
0.22.times.10.sup.9/L of blood , and 0.15.times.10.sup.9/L were
clonotypic (3.3% of total WBC). As further confirmation that
patient sample JOD-6 had circulating clonotypic B cells at 5 months
post-chemotherapy, DNA from single sorted B cells was amplified by
PSA using CDR2/CDR3 primers. Nine out of 27 individual B cells had
a DNA rearrangement that was amplified by the JOD PSA to give
products of the expected size, 160 base pairs, as shown in FIG.
4A.
[0135] The bands amplified in FIG. 4A were sequenced to confirm
that they indeed represented the JOD clonotypic sequence, thus
validating the use of PSA in quantitating clonotypic cells in blood
After amplification with primers to CDR3 and the 5' terminus of
CDR2 from JOD, the amplified products from 5/5 individual JOD-6 B
cells had nearly identical sequences in the intervening FR2 region,
and identical sequences from the 25 base pairs of CDR2 not part of
the primer sequence (FIG. 4B). Thus PSA is specific. Using PSA, a
product of the expected size was amplified from bulk DNA isolated
from BMC taken at diagnosis (JOD-4), from the staging BMC (JOD-5)
and from a stable phase BMC (JOD-7), as well as from PBMC B cells
but not from PBMC T cells from JOD-7, indicated persistence of the
clonotypic sequence for over a year post-diagnosis (data not
shown).
EXAMPLE 2
PATIENT LAR
Identification of the Clonotypic Sequence for LAR
[0136] Individual BM plasma cells from newly diagnosed MM patient
LAR were sorted into PCR tubes and the expressed IgH allele was
amplified in RT-PCR using the consensus framework IgH primers shown
in Table 1. A product of the expected size was amplified in 36/36
individual BM plasma cells (FIG. 5A). Sequencing of the amplified
bands from 3 of these plasma cells indicated that they had an
identical VDJ sequence, shown in FIG. 5B, that aligned with DP-79
of the VH4 family. CDR2/CDR3 LAR-specific primers, designed based
on the plasma cell sequence, were used to amplify the mRNA from 48
additional BM plasma cells; 42/48 amplified a product of the
expected size, shown in FIG. 5C, confirming the identity of the
clonotypic sequence in the majority (48/51 or 88%) of individual
plasma cells.
Quantitation of the Proportion of Clonotypic Cells Using PCR and in
Situ RT-PCR
[0137] To quantitate the proportion of blood B cells with
clonotypic DNA rearrangements, single cell PSA PCR was used to
amplify DNA from LAR-1CD19+ B cells using LAR-specific primers. A
clonotypic product was amplified from 4/12 (33%) individual LAR B
cells. This sample was taken at diagnosis prior to initiation of
treatment. To quantitate the number of LAR peripheral blood B cells
expressing clonotypic mRNA sequences, in situ LAR PSA was used to
amplify clonotypic mRNA from LAR B cells and, as a control, LAR T
cells. The results are shown in Table 3. All aliquots of B and T
cells expressed histone mRNA, a housekeeping gene product which was
used to provide a measure of the number of cells which had intact
and detectable mRNA. For the B cell aliquots, all B cells expressed
CD19 mRNA, as well as IgH mRNA (detected by consensus primers). For
LAR-1, in situ RT-PCR with LAR CDR2/CDR3 primers amplified a
product in 522/1183 (44%) of sorted CD19+ blood B cells. This
confirms at the mRNA level the finding that 4/12 LAR-1 B cells had
clonotypic DNA rearrangements. T cells from LAR, not expected to
express rearranged IgH, had less than 0.1% positive cells. For
LAR-3, 46% of blood B cells were clonotypic (Table 3). LAR-1 was
taken 2 months before initiation of therapy; LAR-3 was taken one
month after initiation of therapy. Thus, for this patient,
chemotherapy did not eradicate clonotypic blood B cells. Overall,
the number of clonotypic B cells was reduced approximately 2 fold
by one cycle of chemotherapy (from 0.12.times.10.sup.9/L to
0.06.times.10.sup.9/L).
Quantitation of Clonotypic Cells Using Unfractionated WBC
[0138] In order to accurately determine the total number of
circulating clonotypic B cells in MM, as well as to design a PSA
assay which would be easily adaptable for clinical use, in situ
RT-PCR using consensus IgH primers, as well as PSA with CDR2/CDR3
primers was performed on white blood cells prepared by the whole
blood lysis method. The results are shown in Table 4. As predicted
by previous work (Bersagel et al., 1995), approximately 3-10% of
total WBC express CD19 and IgH mRNA. In situ RT-PCR amplification
with IgH VDJ consensus primers of mRNA in WBC gave a mean of 5% for
5 different patients, with a range of 3.3% to 7.4%. Use of CD19
primers to amplify mRNA from WBC gave a mean value of 6.8% for 5
different patients, with a range of 2.5% to 10.4% of WBC. To
determine the frequency of clonotypic cells among unfractionated
WBC, PSA in situ RT-PCR with LAR primers was used. For LAR-3, in
situ RT-PCR using unfractionated WBC prepared by the red cell lysis
method for WBC demonstrated that 145/2116 WBC, or 6.8% of total WBC
were CD19+. To determine the number of circulating clonotypic
cells, LAR WBC were amplified using PSA with CDR2 and CDR3 primers.
By this measure, 24/1987 WBC, or 1.2% of LAR-3 WBC were clonotypic,
confirming calculations from Table 3. The infrequent presence of
either LAR or JOD sequences among WBC from unrelated MM patients
confirms the specificity of the assay. The simplicity and
quantitative nature of PSA using in situ RT-PCR on total WBC makes
this approach feasible in a clinical laboratory, for monitoring
circulating relatives of the malignant myeloma clone during
treatment. It is also a validation of more complex methods for
determining the frequency of clonotypic B cells that rely on
purified B cell populations. Calculated values from purified
populations appear to reasonably estimate the absolute numbers
obtained by analysis of unmanipulated WBC.
Specificity of JOD and LAR PSA
[0139] Total RNA from sorted LAR B cells, T cells and BM plasma
cells, as well as BM plasma cells from 2 unrelated MM patients, was
amplified in conventional bulk RT-PCR. An amplified product of the
expected size was detected in B and plasma cells from LAR, but was
absent from LAR T cells and from BM plasma cells of two unrelated
MM patients (FIG. 6), confirming the specificity of the LAR
primers, and the presence of clonotypic mRNA within the B cell
population. The identity of the PSA RT-PCR product for LAR B and
plasma cells was confirmed by analysis of the products using
restriction fragment length polymorphism (not shown). Control
experiments also demonstrated that JOD primers did not amplify a
product from LAR blood subsets of BMC in bulk RT-PCR, and LAR
primers did not amplify a band from JOD-5, JOD-6 or JOD-7 PBMC,
PBMC subsets or BMC (not shown). Results identical to those for
LAR- 1 showing the presence of clonotypic sequences in BMC and PBMC
B cells, but not PBMC T cells, were obtained for LAR-3 using bulk
PSA of mRNA (not shown).
Discussion of Results
[0140] The above examples demonstrate that in MM patients, 44-90%
of total circulating blood B cells, or 1-9% of total WBC. have an
IgH rearrangement identical to that of autologous BM plasma cells,
the tumor cells. The absolute number ranges from
0.06-0.5.times.10.sup.9 clonotypic cells/L of blood. An important
aspect of this work is the identification of the clonotypic IgH
sequence as that expressed by the majority of individual BM plasma
cells in a patient. This type of quantitation is possible only at
the single cell level, either by single cell PCR or RT-PCR, or by
in situ RT-PCR. Although previous studies analyzed homogenized
preparations of nucleic acid derived from unfractionated bone
marrow, the assumption was made that most plasma cells express the
IgH sequence identified as predominant in bulk PCR or RT-PCR.
Confirmation of this was essential, since only an IgH CDR3 sequence
that identifies most BM plasma cells would be expected in the
blood. Using single cell PCR or RT-PCR, for patient JOD and LAR,
10/11 and 45/51 respectively of BM plasma cells expressed the
sequence identified as clonotypic. A second refinement in this work
was the use of two patient specific primers, CDR2 and CDR3, for
amplification of clonotypic sequences. The inventors found that use
of a primer specific for patient-specific CDR3 together with a
consensus FR2 primer, as commonly used in other studies
(allele-specific oligomer (ASO)-PCR), was less specific than was
the use of PSA with CDR2/CDR3 primers to drive high stringency
amplification of IgH variable regions. The patient-specific
amplification (PSA) methods were validated by the inventors
demonstration that the sequences of CDR2/CDR3 amplified products
from 6 individual B cells were clonotypic. For patient JOD, the
presence of the clonotypic sequence was confirmed in 3 different
samples of BM plasma cells taken over a 1.3 year period including
at diagnosis (JOD-4), for staging after chemotherapy (JOD-5), and
during the stable phase of disease (JOD-7). The clonotypic JOD
sequence was detectable in PBMC or in purified B cells from 4
sequential JOD samples.
[0141] For all patients tested, all CD19+ (by cell sorting) blood B
cells expressed both CD19 mRNA and IgH mRNA. Based on mean values
from phenotypic analysis of nearly 500 patients done previously,
the absolute numbers of circulating blood B cells represent about
3-10% of total WBC, or about 0.4.times.10.sup.9 B cells/L of blood
(unpublished results and Bergsagel et al., 1995). For patient JOD
at 1 month post-chemotherapy (JOD-5), 90% of individual circulating
B cells hare an IgH VDJ rearrangement identical to that of
autologous BM plasma cells. However, for JOD-6, taken 5 months
after cessation of therapy, the absolute number and proportion of
clonotypic B cells decreased, suggesting recovery of polyclonal B
cells post-chemotherapy, and by extrapolation that chemotherapy may
actually enrich for clonotypic B cells, although absolute numbers
may decrease. This may reflect a greater chemosensitivity for
normal B cells as compared to the clonotypic set. For patient
LAR-1, at diagnosis, 44% of circulating B cells were clonotypic.
After one cycle of chemotherapy, the proportion of clonotypic B
cells remained constant, although absolute numbers decreased
suggesting depletion after the initial exposure to
chemotherapy.
[0142] For patient LAR, newly diagnosed, about 44% of total CD19+ B
cells are clonotypic. For JOD, after 6 cycles of chemotherapy,
nearly all B cells (90%) were clonotypic. At 5 months (JOD-6)
post-chemotherapy, 71% of blood B cells were clonotypic, indicating
their persistence after chemotherapy. Calculations of the absolute
number of clonotypic B cells circulating the blood of these two
patients give values of 1-9% of white blood cells or
0.06-0.52.times.10.sup.9 clonotypic B cells/L of blood. comparison
with normal values indicates expanded numbers of overall B cells,
and enriched proportions of clonotypic B cells. Sequential samples
for both JOD and LAR indicate that chemotherapy does not
effectively target circulating clonotypic B cells.
[0143] The long term goal of this work is to evaluate the link
between clonotypic B cells, disease progression and spread, and
clinical outcome. The frequent relapse rate for myeloma indicates
that current modes of treatment are not accompanied by elimination
of the generative compartment of MM. PSA for monitoring clonotypic
cells in whole blood using in situ RT-PCR or limiting dilution PCR
with patient-specific primers proves a clinically feasible
monitoring strategy for determining the extent to which clonal
cells infiltrate the blood of MM patients before, during and after
therapy, as well as their persistence after cytoreduction and
transplantation. Measurement of circulating clonotypic B cell
numbers using in situ PSA provides a marker of blood involvement
that complements measure of plasma cell kill, to evaluate the
efficacy of present and future therapies which target the malignant
clone in MM. This assay allows the use of blood tests rather than
the more invasive and expensive bone marrow tests for routine
clinical monitoring. When bone marrow or tissue samples are
necessary, this assay is quantitative, more specific and more
sensitive than any currently available test.
EXAMPLE 3
Analysis of Additional Myeloma Patients
[0144] The aforementioned methods for determining the frequency of
clonotypic B cells in blood was applied to a group of 18 multiple
myeloma patients. This example clearly demonstrates how the methods
of the invention are used to monitor the number of clonotypic B
cells before, during and after treatment by chemotherapy or
hematopoietic transplantation.
[0145] The characteristics of the clonotypic sequences derived from
BM plasma cells of the patients are presented in Tables 4 and 5.
The patients have the Ig isotype distribution characteristic of
myeloma. The pattern of Vh family usage included frequent use of
the Vh3 gene family and infrequent use of the Vh1 family (Table 4).
The most frequent J segment was Jh4 (65% of the patients). Overall,
the CDR3 length was 12-54 nucleotides (NT) (mean+/-SE=28+/-2 NT).
The sequences of the CDR3 portion of IgH are presented in Table
5.
9-90% of Myeloma PBMC B Cells are Clonotypic as Detected by in Situ
RT-PCR
[0146] For 17 myeloma patients (one patient from Table 4 died prior
to this analysis) and 35 blood samples analyzed in this study, the
percentage of circulating B cells expressing clonotypic mRNA was on
average 66%. Table 6 records the frequency of clonotypic B cells
for each myeloma patient for one or more blood samples taken at
regular clinical visits. In all cases the sequences identified as
clonotypic were confirmed to be expressed by >80% of autologous
BM plasma cells. In blood, the proportion of B cells expressing
clonotypic IgH mRNA ranged from 9-90% with a mean of 66% +/-4%
(SE). These values were used to calculate that 14+/-2% of PBMC were
clonotypic cells (range=0.9-50% of PBMC)
[0147] The proportion of clonotypic cells among total white blood
cells was calculated as 3.5 +/-1% (range=1-9%) (data not shown).
The absolute number of circulating clonotypic B cells was
0.1+/-0.02.times.10.sup.9/L of blood
(range=0.01-0.61.times.10.sup.9/L).
Abbreviations
[0148]
1 BMC bone marrow cells dNTP deoxynucleotide triphosphates PBMC
peripheral blood mononuclear cells MGUS monoclonal gammopathy of
undeter- mined significance MM multiple myeloma IgH immunoglobulin
heavy chain VDJ variable, diversity, joining WBC white blood cells
PSA patient-specific amplification TCR T cell receptor FITC
Fluorescene isothiocyanate PB phycoerytherin MW molecular weight BM
bone marrow ALL Acute Lymphocytic Leukemia JOD, LAR, JES, BTA
Nomenclature for individual patients CLL Chronic Lymphocytic
Leukemia VAD Vincristine, Adriamycin, Dexametha- sone M Melphalan
Dex Dexamethasone UV Ultraviolet
[0149]
2TABLE 1 Primers used for in situ RT-PCR, for PCR and for RT-PCR
Histone 5' CCACTGAACTTCTGATTCGC Histone 3' GCGTGCTAGCTGGATGTCTT
CD19 5' GACCTCACCATGGCCCCTGG CD19 3' CAGCCAGTGCCATAGTAC Consensus
IgH primers IgH FR2 5' TATGAATTCGGAAAGGGCCTGGAGTGG IgH JH1 3'
ACGGGATCCACCTGAGGAGACGGTGACC IgH JH2 3' ACGGATCCGTGACCAGGGTNGCTTGG-
CCCCAG Patient-specific CDR2/CDR3 primers for PSA: JOD5 CDR2 5'
CGTGGAATAGGGGCAGTC JOD5 CDR3 3' AAGTTGTAGCCATCTCGG LAR1 CDR2 5'
ACTTCTACGACAATGGCGAAAC LAR1 CDR3 3' CCCTCCGAGGACGTGGTG Note: the
above sequences represent SEQ ID NOS: 1-11, respectively.
[0150]
3TABLE 2 PBMC B cells, but not T cells, express clonotypic
sequences for patient JOD, after chemotherapy Clonotypic B Cells %
Clonotypic # .times. 10.sup.9/L % of WBC Patient Tissue Subset (#
counted) of Blood Calculated JOD-5 BMC CD38.sup.+Ig.sup.+ 91
(10/11) JOD-5 PBMC CD19.sup.+ 90 (9/10) 0.52 9 JOD-6 PBMC
CD19.sup.+ 71 (1111/1555) 0.15 3 1.3 (6/463) NKI-7 PBMC CD19.sup.+
3.7 (12/305) 0.007 0.06 CD3.sup.+ <0.1 (0/1000) RAM-9 PBMC
CD19.sup.+ <0.1 (0/1000) <0.0006 <0.01 CD3.sup.+ <0.1
(0/1000)
[0151] PBMC or BMC were sorted as indicated and analyzed using PSA
with in situ RT-PCR with primers specific for CDR2 and CDR3 of JOD
(lines 3-1 1), or sequencing (lines 1 and 2). For sorted CD19+ PBMC
from unrelated patients, the presence of B cells was confirmed
using in situ RT-PCR for CD19, and viability of mRNA was
established using histone primers.
4TABLE 3 PBMC B cells, but not T cells, have clonotypic IgH VDJ
sequences for patient LAR, at diagnosis and after initiation of
treatment Clonotypic B Cells Subset # .times. 10.sup.9/L % of WBC
Patient Tissue (Sorted) % Clonotypic of Blood Calculated LAR-1 BMC
CD38.sup.+Ig.sup.+ 88 (45/51) LAR-1 PBMC CD19.sup.+ 44 (522/1183)
0.12 .times. 10.sup.9 2.2 CD3.sup.+ 1 (5/452) LAR-3 PBMC CD19.sup.+
46 (190/409) 0.06 .times. 10.sup.9 1.1 CD3.sup.+ <0.1
(0/1000)
[0152] PBMC and BMC were analyzed using PSA with CDR2 and CDR3
primers from patient LAR in in situ RT-PCR. In all cases, viability
of mRNA was confirmed by amplification with primers to histone.
5TABLE 4 Characteristics of Clonotypic IgH VDJ sequences Patient Jh
CDR3 (status*) IgH Lt % PC.sup.a Vh Family Family Length (NT) 1.
(Unt) IgG K 23 Vh2(S12-12) Jh4(b) 27 2. (Unt) IgG K 31 Vh5(DP73)
Jh3(a) 18 3. (Tr) IgA K 33 Vh3(DP77) Jh2 6 4. (Unt) IgA K 30
Vh4(DP65) nd 21 5. (Unt) IgG L 23 Vh3(DP49) Jh6(b) 30 6. (Unt) IgG
K 30 Vh4(DP71) Jh4(a) 36 7. (Unt) IgG K 25 VH3(DP77) Jh2 30 8.
(Off) IgA L 57 Vh3(DP46) Jh3(b) 21 9. (Off) Nd.sup.a L 80
Vh3-21(DP77) Jh6(c) 24 10. (Unt) IgG K 90 Vh2(S12-12) 3h4(a) 33 11.
(Sm) IgA K 51 Vh3-30(DP49) Jh4(a) 18 12. (Tr)** IgG L 11
Vh3-15(DP38) Jh4(a) 21 13. (Unt) IgA K 70 Vh3-8(DP58) Jh4(a) 27 14.
IgG K 67 Vh3-30(DP49) 3h4(b) 24 (Off)*** 15. (Unt) IgG K 75
Vh4-31(DP78) Jh4(b) 12 16. (Unt) IgG K 22 Vh1(DP88) Jh4(b) 36 17.
(Unt) IgG K 50 Vh3-49(DP57) Jh4(c) 54 18. (Tr) IgG K 41
Vh5-51(DP73) Jh4(b) 15 *These patients were all diagnosed with
myeloma; patients #8 and 14 were in relapse at the time their BM
was obtained. Patient #10 died one month post-diagnosis. Their
treatment status at the time the bone marrow sample was obtained is
indicated. Patient 11 has smoldering myeloma, and remains
untreated, for the samples analyzed here. Selection criteria for
this study were that the patient was diagnosed with myeloma and
that a fresh BM # sample was available; no selection was applied
for stage of disease or treatment status. **This patient was in
stable phase immediately prior to hematopoietic transplantation.
***This patient was first diagnosed in 1988 and is thus a long term
survivor. In 1993/94, she had clonotypic DNA sequences detectable
in her blood (6, Patient #3 in that study). The sequence of IgH VDJ
transcripts in her plasma cells was determined at relapse for this
study (in 1997) using single sorted BM plasma cells. The CDR3
sequence obtained was identical to that determined previously (6).
All of her relapse plasma cells express this sequence.
[0153]
6 a % PC = percent of plasma cells in the bone marrow sample used
to derive the clonotypic sequence; ND = not detectable by routine
clinical methods; Lt = light chain; K = kappa; L = lambda; Unt =
untreated; Tr = treated; and Off = off therapy.
[0154]
7TABLE 5 Clonotypic IgH CDR3 sequences and primers used for PSA
(SEQ ID NOS: 12-29) (SEQ ID NOS: 30-47) codon 92 FR3 CDR3 01
TGTGCTCAC AAACTTATCACTGGTTGGGACGGTAGTAGT 02 TGTGCGACA
CAACACTACTATGATAGT 03 TGTGCGAGA GATACCTATTATTATGGTTCAGGGAGTTATTCA
04 TGTGCGGGT GGCACCACGTCCTCCCAGGGT 05 TGTGCGAAG
CTCGTGGTTGTGGCGGTGGAAGCTCTAACCC- AT 06 TGTGCGAGG
GTCCCCATGAACTATGCTATAAGGGGAAACTTAGGT 07 TGTGCGAGA
GAATGGTCGTACTTCTATGAAAGTTATTGGTTA 08 TGTGCGAGA
GACGGAAGCAGAGATGGCTACAACTCG 09 TGTGCGAGA GGGGATGGTTCGGGAGAGATCTTT
10 TGTTCACAC ACGCGTTTCATGCGTGCGGATGTGAACAACTTC 11 TGTGCGCCA
GTTCTTGCCAACTGGTTT 12 TGTACCACA GCGTTCAGTGAGCCCTCGAGC 13 TGTGCGACA
GATCAAGATGACTACGGTGACTACGGGACC 14 TGTACGAGA
GTAAATCCTTTCTATGAAGGTAGTCGTTATCCCATA 15 TGCGCCACA GATCCCTCTGAC 16
TGTGCGACA GTAAATCCTTTCTATGAAGGTAGTCGTTATCCCATA 17 TGTACTAGA
GATAGGGAGGATACTGTAGTAGGAACAGTTACTATGGGCCGAATACCCACGGTT 18 TGTGCGAGA
CATTATCACGGTTAC (SEQ ID NOS: 48-65) codon 92 JH 01
TACTTTGACCAG.TGGGGC 02 TATAGTTGACTTC.TGGGGC 03
TACTGGTACTTCGATCTC.TGGGGC 04 CAGAGGTTGGAACTC.TGGGGC 05
GATAATCTTGATATTTG.TGGGGC 06 TCCATTGACTAC.TGGGGC 07
TTACCCTTTGACTTC.TGGGGC 08 GGTGTTTTTGATATC.TGGGGC 09
CCTTACTACTACTATCACATGGACGTC.TGGGGC 10 TTTGACTAC.TGGGGC 11
CGCCCCTTTGACCAC.TGGGGC 12 GACTACTACACGATGGACTTC.TGGGGC 13
TTTAACTCC.TGGGGC 14 TACTACTTTGGCTAC.TGGGGC 15 TACTTTGACCTC.TGGGGC
16 TACTACTTTGGCTAC.TGGGGC 17 AAATACTACTACTACCACCACATGGACGTC.TGGGGC
18 CGATCGGACGTC.TGGGGGC
[0155] Regions used as patient-specific CDR3 primers are
highlighted in bold italics.
8TABLE 6 Clonotypic B cells are frequent in the blood of myeloma
patients Patient Status- # of sequential Absolute # .times.
10.sup.9/L Apr. 97 time points of B cells of PBMC Blood.sup.- 1. Tr
5 69, 99, 91 24, 3, 14 0.1, 0.35, 0.09 95, 62 10, 18 0.05, 0.11 2.
Deceased 2 74, 74 19, 31 0.17, 0.15 3. Tr 2 71, 54 14, 9 0.22, 0.12
4. Allo Tsp 4 45, 46, 46, 62 9, 9, 10, 19 0.12, 0.08, 0.06, 0.11 5.
Off 3 91, 40, 73 18, 8, 16 0.24, 0.1, 0.21 6. Tr 3 60, 77, 90 10,
10, 50 0.08, 0.03, 0.1 7. Deceased 1 93 12 0.06 8. Deceased 1 9 0.9
0.01 9. Tr 1 52 7 0.09 11. Unt 2 65, 64 10, 6 0.08, 0.06 12. Auto
Tsp 2 46, 64 15, 7 0.16, 0.13 13. Tr 1 73 12 0.18 14. Tr 2 28, 90
8, 21 0.03, 0.08 15. Tr 2 66, 90 11, 13 0.17, 0.13 16. Tr 1 56 13
0.17 17. Tr 1 53 20 0.42 18. Tr 2 68, 49 20, 18 0.61, 0.39 Mean 66
.+-. 4 14 .+-. 2 0.15 .+-. .02
Normal PBMC (15 donors)
[0156] CD19.sup.+ PBMC (60 slides) <0.3%
Normal Plasma cells (BM, 4 donors)
[0157] CD38.sup.hiIg.sup.+ BMC (19 slides) <0.3%
[0158] Individual time points are listed sequentially in the table.
#1 was slowly responding to melphalan (M) and dexamethasone (Dex),
#2 had M/Dex, #3 is relapsing after treatment with M/prednisone
(P), #4 was treated with M/P and then received an allogeneic
transplant, #5 is being treated with M/P, #6 was treated with
M/Decadron but did not respond, #7 received M/Dex, #8 was at a
terminal stage of disease, #9 was newly diagnosed untreated, #11
has smoldering myeloma and remains untreated, #12 responded to VAD
and was in plateau, and #13 was newly diagnosed untreated. Patient
#14 was in relapse. Patients #15-18 were studied at diagnosis
and/or during the first 1-2 cycles of first line therapy. Mean
values are .+-.SE. For all samples, a minimum of 300 cells and
frequently 500-1 000 cells were viewed. In all cases, for in situ
RT-PCR assays being performed on a given day, the patient-specific
primers being tested each day on sorted myeloma B cells were also
tested on B cells from normal donors to confirm their specificity.
Every set of patient-specific primers has been tested on sorted B
cells from at least 2 normal donors and on sorted CD19.sup.+ BMC
from at least one normal donor. No amplification was detected in
these normal donor controls.
References
[0159] Alberts B, Bray D, Lewis J, Raff M, Roberts K, Watson J:
Molecular Biology of the Cell, third edition, Garland Publishing,
Inc. , New York, N.Y., 1995, Chapter 23.
[0160] Bakkus MHC, van Riet I, Van Camp B, Thielemann K: Evidence
that the clonogenic cell in multiple myeloma originates from a
pre-switched but somatically mutated B cell. Brit. J. Henatol.
87:68, 1994.
[0161] Barlogie B. Epstein J., Selvanayagam P., Alexanian R.:
Plasma cell myeloma--new biological insights and advances in
therapy. Blood 73: 865, 1989.
[0162] Berenson J, Wong R, Kim K, Brown N, Lichtenstein A: Evidence
of peripheral blood B lymphocyte but not T lymphocyte involvement
in multiple myeloma. Blood 70:1550, 1987.
[0163] Bergsagel D E: Treatment of plasma cell myeloma. Ann. Rev.
Med. 30:431, 1979
[0164] Bergsagel P L, Masellis Smith A, Szczepek A, Mant M J Belch
A R, Pilarski L M: In multiple myeloma, clonotypic B lymphocytes
are detectable among CD19+ peripheral blood cells expressing CD38,
CD56 and monotypic immunoglobulin light chain. Blood 85:436,
1995.
[0165] Billadeau D, Blackstadt M, Greipp P, Kyle R A, Oken M M, Kay
N, Van Ness B: Analysis of B-lymphoid malignancies using
allele-specific polymerase chain reaction: A technique for
sequential quantitation of residual disease. Blood 78:3021,
1991.
[0166] Billadeau D, Quam L, Thomas W, Kay M, Greipp P, Kyle R, Oken
MM, Van Ness B: Detection and quantitation of malignant cells in
the peripheral blood of multiple myeloma patients. Blood 80:1818,
1992.
[0167] Billadeau D, Ahmann G, Greipp P, van Ness B: The bone marrow
of multiple myeloma patients contains B cell populations at
different stages of differentiation that are clonally related to
the malignant plasma cell. J. Exp. Med. 178:1023, 1993.
[0168] Billadeau D, van Ness B, Kimlinger T, Kyle R A, O'Fallon W
M, Greipp P R, Witzig T E: Clonal circulating cells are a common
occurrence in plasma cell disorders: a comparison of MGUS, SMM and
MM Blood 86:58a, 1995.
[0169] Boccadoro M, Gavarotti P, Fossati G, Massaia M, Pilieri A,
Durie BGM: Kinetics of circulating B lymphocytes in human myeloma.
Blood 61:812, 1983.
[0170] Caligaris-Cappio F, Bergui L, Tesio L, Pizzolo G, Malavasi
F, Chilosi M, Campana D, van Camp B, Janossy G: Identification of
malignant plasma cell precursors in the bone marrow of multiple
myeloma. J. Clin. Ivest. 76:1243, 1985.
[0171] Cao J., Vescio R A, Hong C H, Kim A., Lichenstein A K,
Berenson J R: Identification of malignant cells in multiple myeloma
bone marrow with immunoglobulin Vh gene probes by fluorescent in
situ hybridization and flow cytometry. J Clin. Invest. 95:964,
1995.
[0172] Cao J, Vescio R A, Rettig M B, Hong C H, Kim A, Lee J C,
Lichtenstein A K, Bersenson J R: A CD10-positive subset of
malignant cells is identified in multiple myeloma using PCR with
patient-specific immunoglobulin gene primers. Leukemia 9:1948,
1995.
[0173] Cassel A, Leibovitz N, Hornstein L, Quitt M, Aghai E:
Evidence for the existence of circulating monoclonal B-lymphocytes
in multiple myeloma patients. Exp. Hematol. 18:1171,1990.
[0174] Chen B J, Epstein J: Circulating clonal lymphocytes in
myeloma constitute a minor population of B cells. Blood 87:1972,
1996.
[0175] Corradini P, Voena C, Astolfi M, Ladetto M, Tarella C,
Boccadoro M, Pileri A: High dose sequential chemotherapy in
multiple myeloma: residual tumor cells are detectable in bone
marrow and peripheral blood cell harvests and after autografting.
Blood 85:1596, 1995.
[0176] Corradini P, Voena C, Omede P, Astolfi M, Boccadoro M,
Dalla-Favera R, Pilieri A: Detection of circulating tumor cells in
multiple myeloma by a PCR based method. Leukemia 7:1879, 1993.
[0177] Chen and Epstein 1996.
[0178] Dreyfus F, Melle J, Quarre C, Pillier C: Contamination of
peripheral blood by monoclonal B cells following treatment of
multiple myeloma by high dose chemotherapy. Brit. J. Hematol.
85:411, 1993.
[0179] Mariette X, Fermand J-P, Brouet J-C: Myeloma cell
contamination of peripheral blood stem cell grafts in patients with
multiple myeloma treated by high dose therapy. Bone Marrow Transp.
14:47, 1994.
[0180] Gazitt U, Reading C, Lee J-H, Barlogie B, Vesole D, Jaganath
S, Simonetti D, DiGuisto R, Schnell J, Rosen NR, Tricot G:
Differential peripheral blood mobilization of tumor and normal
hematopoietic progenitor cells (HPC) in multiple myeloma (MM).
Blood 84:354a, 1994.
[0181] Greipp PR: Advances in the diagnosis and management of
myeloma. Sem. Hematol. 29:24, 1992.
[0182] Hulin N, Conte P F, Pileri A: Biology of the human myeloma
population. La Ricerca in Clinica e in Laboratorio 8:49, 1978.
[0183] Jensen G S, Mant M J, Belch A R, Berenson J R, Ruether B A,
Pilarski L M: Selective expression of CD45 isoforms defines CALLA+
monoclonal B lineage cells in peripheral blood from myeloma
patients as late stage B cells. Blood 78:711, 1991.
[0184] Mariette X, Fermand J-P, Brouet J-C: Myeloma cell
contamination of peripheral blood stem cell grafts in patients with
multiple myeloma treated by high dose therapy. Bone Marrow Transp.
14:47, 1994.
[0185] Nuovo G: PCR in situ Hybridization. New York, N.Y.: Raven
Press, 1994.
[0186] Omede P, Boccadoro M, Fusaro A, Gallone G, Pileri A:
Multiple myeloma: "early" plasma cell phenotype identifies patients
with aggressive biological and clinical characteristics. Brit. J.
Henatol. 85:504, 1993.
[0187] Owen R G, Child J A, Rawson A, Smith G M, Johnson R, Wood
hear V, Elsworth A, Morgan G J: Detection of contaminating cells in
PBMC harvests and the efficacy of CD34 selection in patients with
multiple myeloma. Blood: 84:352a, 1994.
[0188] Palmer M., Belch A., Hanson J., Brox L.: Reassessment of the
relationship between M-protein decrement and survival in multiple
myeloma. Br. J. Cancer 59:110, 1989.
[0189] Pietersz G A, Li W J, Sutton V R, Burgess J, McKenzie IFC,
Zola H, Trapani J A: In vitro and in vivo antitumor-activity of a
chimeric anti-CD19 antibody. Cancer Immunol. Immunother. 41:53,
1995.
[0190] Pilarski L M, Mant M J, Ruether B A, Belch A: Severe
deficiency of B lymphocytes in peripheral blood from multiple
myeloma patients. J. Clin. Invest. 74:1301, 1984.
[0191] Pilarski L M, Ruether B A, Mant M J: Abnormal function of B
lymphocytes from peripheral blood of multiple myeloma patients. I.
Lack of correlation between the number of cells potentially able to
secrete IgM and serum IgM levels. J. Clin. Invest. 75:2024,
1985.
[0192] Pilarski L M., Jensen G S.: Monoclonal circulating B cells
in multiple myeloma: A continuously differentiating possibly
invasive population as defined by expression of CD45 isoforms and
adhesion molecules. Hematology/Oncology Clinics of North America
6:297, 1992.
[0193] Pilarski L M, Belch, A J: Circulating monoclonal B cells
expressing p-glycoprotein may be a reservoir of multidrug resistant
disease in multiple myeloma. Blood 83:724, 1994.
[0194] Pilarski L M., Masellis Smith A, Szczepek A., Mant M J,
Belch A R: Circulating clonotypic B cells in the biology of myeloma
Speculations on the origin of multiple myeloma. Leuk. Lymphoma
18:179, 1996.
[0195] Sambrook J. Fritsch E F, Maniatis T. Molecular Cloning: A
Laboratory Manual (2nd Ed.), Cold Spring Harbor Press, Cold Spring
Harbor, N.Y., 1989, Volume 3.
[0196] Takashita M, Kosaka M, Goto T, Saito S: Cellular origin and
extent of clonal involvement in multiple myeloma: genetic and
phenotypic studies. Brit. J. Haematol. 87:735, 1994.
[0197] Taub R., Kirsch J. Morton C., Lenoir G., Swan D., Tronick S.
Aaronson S., and Leder P. Translocation of the c-myc gene into the
immunoglobulin heavy chain locus in human
[0198] Burkitt lymphoma and murine plasmacytoma cells. Proc. Natl.
Acad. Sci. U.S.A. 79:7837 (1982)
[0199] Rowley J D: Molecular cytogenetics: Rosetta Stone for
understanding cancer--twenty-ninth G. H. A. Clowes Memorial Award
Lecture. Cancer Res 50: 3816-25 (1990).
[0200] Vescio R A, Han E J, Lee J C, Wu, C H, Cao J, Shin J,
Schiller G J, Rettig M B, Lichtenstein A K, Berenson J R:
Quantitative comparison of multiple myeloma contamination in bone
marrow harvest and leukaphereses autografts. Blood 86:234a,
1995.
[0201] Yameda M, Wasserman R, Lange B, Reichard B, Womer R, Rovera
G: Minimal residual disease in childhood B-lineage lymphoblastic
leukemia. N. Engl. J. Med. 323:448, 1990.
[0202] Zola H, Mcardle PJ, Bradford T, Weedon H, Yasui H, Kurosawa
Y: Preparation and characterization of a chimeric CD19 monoclonal
antibody. Innunol. Cell Biol. 69:411, 1991.
[0203] U.S. Pat. No. 5, 418,132 to Morley (1995).
[0204] U.S. Pat. No. 4,683,202 to Mullis (1987).
[0205] U.S. Pat. No. 5,436,144 to Stewart and Timm (1995).
* * * * *