U.S. patent application number 09/934207 was filed with the patent office on 2002-08-15 for adenovector pharmaceutical composition.
This patent application is currently assigned to GenVec, Inc.. Invention is credited to Brough, Douglas E., Bruder, Joseph T., Kovesdi, Imre, Lizonova, Alena, McVey, Duncan L..
Application Number | 20020110545 09/934207 |
Document ID | / |
Family ID | 22980456 |
Filed Date | 2002-08-15 |
United States Patent
Application |
20020110545 |
Kind Code |
A1 |
Kovesdi, Imre ; et
al. |
August 15, 2002 |
Adenovector pharmaceutical composition
Abstract
The present invention provides multiply deficient adenoviral
vectors and complementing cell lines. Also provided are
recombinants of the multiply deficient adenoviral vectors and a
therapeutic method, particularly relating to gene therapy,
vaccination, and the like, involving the use of such
recombinants.
Inventors: |
Kovesdi, Imre; (Rockville,
MD) ; Brough, Douglas E.; (Gaithersburg, MD) ;
McVey, Duncan L.; (Derwood, MD) ; Bruder, Joseph
T.; (Ijamsville, MD) ; Lizonova, Alena;
(Gaithersburg, MD) |
Correspondence
Address: |
LEYDIG VOIT & MAYER, LTD
TWO PRUDENTIAL PLAZA, SUITE 4900
180 NORTH STETSON AVENUE
CHICAGO
IL
60601-6780
US
|
Assignee: |
GenVec, Inc.
65 West Watkins Mill Road
Gaithersburg
MD
20878
|
Family ID: |
22980456 |
Appl. No.: |
09/934207 |
Filed: |
August 21, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09934207 |
Aug 21, 2001 |
|
|
|
08258416 |
Jun 10, 1994 |
|
|
|
Current U.S.
Class: |
424/93.21 ;
435/235.1; 435/320.1; 435/456 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 14/005 20130101; A61K 2039/5256 20130101; C12N 2810/6081
20130101; A61K 48/00 20130101; C12N 2810/60 20130101; Y10S 977/799
20130101; C07K 14/4712 20130101; C12N 2840/203 20130101; C12N
2710/10352 20130101; C12N 2710/10322 20130101; C12N 2830/85
20130101; C12N 2840/20 20130101; C12N 15/86 20130101; C12N 7/00
20130101; A61P 43/00 20180101; C12N 2710/10343 20130101; C12N
2830/002 20130101; C12N 2840/44 20130101 |
Class at
Publication: |
424/93.21 ;
435/456; 435/320.1; 435/235.1 |
International
Class: |
A61K 048/00; C12N
007/00; C12N 015/861 |
Claims
What is claimed is:
1. An adenoviral vector that is deficient in two or more adenoviral
gene functions.
2. The adenoviral vector of claim 1, wherein at least one of the
said two or more gene functions is selected from the group of gene
functions comprising the E1, E2, E3 and E4 regions of the
adenoviral genome.
3. The adenoviral vector of claim 1, wherein at least one of the
said two or more gene functions is selected from the group of gene
functions comprising the late regions of the adenoviral genome.
4. The adenoviral vector of claim 2, wherein at least one of the
said two or more gene functions is selected from the group of gene
functions comprising the late regions of the adenoviral genome.
5. The adenoviral vector of claim 1, wherein the said two or more
adenoviral gene functions is all the adenoviral gene functions.
6. The adenoviral vector of claim 5, wherein said adenoviral vector
comprises adenoviral inverted terminal repeats and one or more
adenoviral promoters.
7. The adenoviral vector of claim 5, wherein said adenoviral vector
comprises adenoviral inverted terminal repeats and a packaging
signal.
8. The adenoviral vector of claim 1, wherein said adenoviral vector
only functions in a complementing cell line.
9. The adenoviral vector of claim 8, wherein said adenoviral vector
only functions in a complementing cell line as a result of the
modification of adnoviral inverted terminal repeats or packaging
signal.
10. A cell line that complements an adenoviral vector of claim
1.
11. A cell line that complements an adenoviral vector of claim
2.
12. A cell line that complements an adenoviral vector of claim
3.
13. A cell line that complements an adenoviral vector of claim
4.
14. A cell line that complements an adenoviral vector of claim
5.
15. A cell line that complements an adenoviral vector of claim
6.
16. A cell line that complements an adenoviral vector of claim
7.
17. A cell line that complements an adenoviral vector of claim
8.
18. A cell line that complements an adenoviral vector of claim
9.
19. A cell line selected from the group consisting of those cell
lines designated as 293/E4, 293/ORF-6, and 293/E4/E2A.
20. A recombinant multiply deficient adenoviral vector of claim 1
comprising a foreign gene.
21. The recombinant vector of claim 20, wherein said foreign gene
is the cystic fibrosis transmembrane regulator gene.
22. The recombinant vector of claim 20, wherein said recombinant
vector is selected from the group consisting of Ad.sub.GV.10,
Ad.sub.GV.11, Ad.sub.GV.12, and Ad.sub.GV.13.
23. The recombinant vector of claim 22, wherein said recombinant
vector is selected from the group consisting of Ad.sub.GVCFTR.10,
Ad.sub.GVCFTR.11, Ad.sub.GVCFTR.12, and Ad.sub.GVCFTR.13.
24. A recombinant multiply deficient adenoviral vector of claim 1
comprising a DNA sequence capable of expressing in a mammal a
therapeutic agent.
25. The recombinant multiply deficient adenoviral vector of claim
24, wherein said therapeutic agent is an antisense molecule
selected from the group consisting of mRNA and a synthetic
oligonucleotide.
26. A recombinant multiply deficient adenoviral vector of claim 1
comprising a DNA sequence capable of expressing in a mammal a
polypeptide capable of eliciting an immune response to said
polypeptide.
27. A method of gene therapy comprising the administration to a
patient in need of gene therapy a therapeutically effective amount
of a recombinant multiply deficient adenoviral vector of claim
20.
28. A method of gene therapy comprising the administration to a
patient in need of gene therapy a therapeutically effective amount
of a recombinant multiply deficient adenoviral vector of claim
21.
29. A method of gene therapy comprising the administration to a
patient in need of gene therapy a therapeutically effective amount
of a recombinant multiply deficient adenoviral vector of claim
22.
30. A method of gene therapy comprising the administration to a
patient in need of gene therapy a therapeutically effective amount
of a recombinant multiply deficient adenoviral vector of claim
23.
31. The method of claim 28, wherein the recombinant multiply
deficient adenoviral vector is administered to the lungs of said
patient.
32. The method of claim 30, wherein the recombinant multiply
deficient adenoviral vector is administered to the lungs of said
patient.
33. A method of therapy comprising the administration to a patient
in need of therapy a therapeutically effective amount of a
recombinant multiply deficient adenoviral vector of claim 1
comprising a DNA sequence capable of expressing a therapeutic
agent.
34. The method of claim 33, wherein said therapeutic agent is an
antisense molecule selected from the group consisting of mRNA and a
synthetic oligonucleotide.
35. A method of vaccination comprising the administration to a
patient in need of vaccination an immunity-inducing effective
amount of a recombinant multiply deficient adenoviral vector of
claim 1 comprising a DNA sequence capable of expressing a
polypeptide capable of eliciting an immune response to said
polypeptide.
Description
TECHNICAL FIELD OF THE INVENTION
[0001] The present invention relates to recombinant, multiply
deficient adenoviral vectors and complementing cell lines and to
the therapeutic use of such vectors.
BACKGROUND OF THE INVENTION
[0002] During the winter and spring of 1952-1953, Rowe and his
colleagues at the National Institutes of Health (NIH) obtained and
placed in tissue culture adenoids that had been surgically removed
from young children in the Washington, D.C. area (Rowe et al.,
Proc. Soc. Exp. Biol. Med., 84, 570-573 (1953)). After periods of
several weeks, many of the cultures began to show progressive
degeneration characterized by destruction of epithelial cells. This
cytopathic effect could be serially transmitted by filtered culture
fluids to established tissue cultures of human cell lines. The
cytopathic agent was called the "adenoid degenerating" (Ad) agent.
The name "adenovirus" eventually became common for these agents.
The discovery of many prototype strains of adenovirus, some of
which caused respiratory illnesses, followed these initial
discoveries (Rowe et al., supra; Dingle et al., Am. Rev. Respir.
Dis., 97, 1-65 (1968); reviewed in Horwitz, "Adenoviridae and their
replication," In Virology, Fields et al., eds., 2nd ed., Raven
Press Ltd., New York, N.Y., pp. 1679-1721 (1990)).
[0003] Over 40 adenoviral subtypes have been isolated from humans
and over 50 additional subtypes have been isolated from other
mammals and birds (reviewed in Ishibashi et al., "Adenoviruses of
animals," In The Adenoviruses, Ginsberg, ed., Plenum Press, New
York, N.Y., pp. 497-562 (1984); Strauss, "Adenovirus infections in
humans," In The Adenoviruses, Ginsberg, ed., Plenum Press, New
York, N.Y., pp. 451-596 (1984)). All these subtypes belong to the
family Adenoviridae, which is currently divided into two genera,
namely Mastadenovirus and Aviadenovirus. All adenoviruses are
morphologically and structurally similar. In humans, however,
adenoviruses show diverging immunological properties and are,
therefore, divided into serotypes. Two human serotypes of
adenovirus, namely Ad2 and Ad5, have been studied intensively and
have provided the majority of information about adenoviruses in
general.
[0004] Adenoviruses are nonenveloped, regular icosahedrons, 65-80
nm in diameter, consisting of an external capsid and an internal
core. The capsid is composed of 20 triangular surfaces or facets
and 12 vertices (Horne et al., J. Mol. Biol., 1, 84-86 (1959)). The
facets are comprised of hexons and the vertices are comprised of
pentons. A fiber projects from each of the vertices. In addition to
the hexons, pentons, and fibers, there are eight minor structural
polypeptides, the exact positions of the majority of which are
unclear. One minor polypeptide component, namely polypeptide IX,
binds at positions where it can stabilize hexon-hexon contacts at
what is referred to as the group-of-nine center of each facet
(Furcinitti et al., EMBO, 8, 3563-3570 (1989)). The minor
polypeptides VI and VIII are believed to stabilize hexon-hexon
contacts between adjacent facets, and the minor polypeptide IIIA,
which is known to be located in the regions of the vertices, is
suggested to link the capsid and the core (Stewart et al., Cell,
67, 145-154 (1991)).
[0005] The viral core contains a linear, double-stranded DNA
molecule with inverted terminal repeats (ITRs), which vary in
length from 103 bp to 163 bp (Garon et al., PNAS USA 69, 2391-2394
(1972); Wolfson et al., PNAS USA, 69, 3054-3057 (1972); Arrand et
al., J. Mol. Biol., 128, 577-594 (1973); Steenberg et al., Nucleic
Acids Res., 4, 4371-4389 (1977); and Tooze, DNA Tumor Viruses, 2nd
ed., Cold Spring Harbor, New York: Cold Spring Harbor Laboratory.
pp. 943-1054 (1981)). The ITRs harbor origins of DNA replication
(Garon et al., supra; Wolfson et al., supra; Arrand et al., supra;
Steenberg et al., supra). The viral DNA is associated with four
polypeptides, namely V, VII, .mu., and terminal polypeptide (TP).
The 55 kd TP is covalently linked to the 5' ends of the DNA via a
dCMP (Rekosh et al., Cell, 11, 283-295 (1977); Robinson et al.,
Virology, 56, 54-69 (1973)). The other three polypeptides are
noncovalently bound to the DNA and fold it in such a way as to fit
it into the small volume of the capsid. The DNA appears to be
packaged into a structure similar to cellular nucleosomes as seen
from nuclease digestion patterns (Corden et al., PNAS USA, 73,
401-404 (1976); Tate et al., Nucleic Acids Res., 6, 2769-2785
(1979); Mirza et al., Biochim. Biophys. Acta, 696, 76-86
(1982)).
[0006] The overall organization of the adenoviral genome is
conserved among serotypes, such that specific functions are
similarly positioned. The Ad2 and Ad5 genomes have been completely
sequenced and sequences of selected regions of genomes from other
serotypes are available.
[0007] Adenovirus begins to infect a cell by attachment of the
fiber to a specific receptor on the cell membrane (Londberg-Holm et
al., J. Virol., 4, 323-338 (1969); Morgan et al., J. Virol., 4,
777-796 (1969); Pastan et al., "Adenovirus entry into cells: some
new observations on an old problem," In Concepts in Viral
Pathogenesis, Notkins et al., eds., Springer-Verlag, New York,
N.Y., pp. 141-146 (1987)). Then, the penton base binds to an
adenoviral integrin receptor. The receptor-bound virus then
migrates from the plasma membrane to clathrin-coated pits that form
endocytic vesicles or receptosomes, where the pH drops to 5.5
(Pastan et al., Concepts in Viral Pathogenesis, Notkins and
Oldstone, eds. Springer-Verlag, New York. pp. 141-146 (1987)). The
drop in pH is believed to alter the surface configuration of the
virus, resulting in receptosome rupture and release of virus into
the cytoplasm of the cell. The viral DNA is partially uncoated,
i.e., partially freed of associated proteins, in the cytoplasm
while being transported to the nucleus.
[0008] When the virus reaches the nuclear pores, the viral DNA
enters the nucleus, leaving most of the remaining protein behind in
the cytoplasm (Philipson et al., J. Virol., 2, 1064-1075 (1968)).
However, the viral DNA is not completely protein-free--at least a
portion of the viral DNA is associated with at least four viral
polypeptides, namely V, VII, TP and .mu., and is converted into a
viral DNA-cell histone complex (Tate et al., Nucleic Acids Res., 6,
2769-2785 (1979)).
[0009] The cycle from cell infection to production of viral
particles lasts 1-2 days and results in the production of up to
10,000 infectious particles per cell (Green et al., Virology 13,
169-176 (1961)). The infection process of adenovirus is divided
into early (E) and late (L) phases, which are separated by viral
DNA replication, although some events which take place during the
early phase also take place during the late phase and vice versa.
Further subdivisions have been made to fully describe the temporal
expression of viral genes.
[0010] During the early phase, viral mRNA, which constitutes a
minor proportion of the total RNA present in the cell, is
synthesized from both strands of the adenoviral DNA present in the
cell nucleus. At least five regions, designated E1-4 and MLP-L1,
are transcribed (Lewis et al., Cell, 7, 141-151 (1976); Sharp et
al., Virology, 75, 442-456 (1976); Sharp, "Adenovirus
transcription," In The Adenoviruses, Ginsberg, ed., Plenum Press,
New York, N.Y., pp. 173-204 (1984)). Each region has a distinct
promoter(s) and is processed to generate multiple mRNA species,
and, therefore, each region may be thought of as a gene family.
[0011] The products of the early (E) regions serve regulatory roles
for the expression of other viral components, are involved in the
general shut-off of cellular DNA replication and protein synthesis,
and are required for viral DNA replication. The intricate series of
events regulating early mRNA transcription begins with expression
of immediate early regions E1A, L1 and the 13.5 kd gene (reviewed
in Sharp (1984), supra; Horwitz (1990), supra). Expression of the
delayed early regions E1B, E2A, E2B, E3 and E4 is dependent on the
E1A gene products. Three promoters, the E2 promoter at 72 map units
(mu), the protein IX promoter, and the IVa promoter are enhanced by
the onset of DNA replication but are not dependent on it (Wilson et
al., Virology, 94, 175-184 (1979)). Their expression characterizes
an intermediate phase of viral gene expression. The result of the
cascade of early gene expression is the start of viral DNA
replication.
[0012] Adenoviral DNA replication displaces one parental
single-strand by continuous synthesis in the 5' to 3' direction
from replication origins at either end of the genome (reviewed in
Kelly et al., "Initiation of viral DNA replication," In Advances in
Virus Research, Maramorosch et al., eds., Academic Press, Inc., San
Diego, Calif., 34: 1-42 (1988); Horwitz (1990), supra; van der
Vliet, "Adenovirus DNA replication in vitro," In The Eukaryotic
Nucleus, Strauss et al., eds., Telford Press, Caldwell, N.J. 1:
1-29 (1990)). Three viral proteins encoded from E2 are essential
for adenoviral DNA synthesis: the single-stranded DNA binding
protein (DBP), the adenoviral DNA polymerase (Ad pol), and the
pre-terminal protein (pTP). In addition to these, in vitro
experiments have identified many host cell factors necessary for
DNA synthesis.
[0013] DNA synthesis is initiated by the covalent attachment of a
dCMP molecule to a serine residue of pTP. The pTP-dCMP complex then
functions as the primer for Ad pol to elongate. The displaced
parental single-strand can form a panhandle structure by
base-pairing of the inverted terminal repeats. This terminal duplex
structure is identical to the ends of the parental genome and can
serve as an origin for the initiation of complementary strand
synthesis.
[0014] Initiation of viral DNA replication appears to be essential
for entry into the late phase. The late phase of viral infection is
characterized by the production of large amounts of the viral
structural polypeptides and the nonstructural proteins involved in
capsid assembly. The major late promoter (MLP) becomes fully active
and produces transcripts that originate at 16.5 mu and terminate
near the end of the genome. Post-transcriptional processing of this
long transcript gives rise to five families of late mRNA,
designated L1-5 (Shaw et al., Cell, 22, 905-916 (1980)). The
mechanisms which control the shift from the early to late phase and
result in such a dramatic shift in transcriptional utilization are
unclear. The requirement for DNA replication may be a cis-property
of the DNA template, since late transcription does not occur from a
superinfecting virus at a time when late transcription of the
primary infecting virus is active (Thomas et al., Cell, 22, 523-533
(1980)).
[0015] Assembly of the virion is an intricate process from the
first step of assembling major structural units from individual
polypeptide chains (reviewed in Philipson, "Adenovirus Assembly,"
In The Adenoviruses, Ginsberg, ed., Plenum Press, New York, N.Y.
(1984), pp. 309-337; Horwitz (1990), supra). Hexon, penton base,
and fiber assemble into trimeric homopolymer forms after synthesis
in the cytoplasm. The 100 kd protein appears to function as a
scaffolding protein for hexon trimerization and the resulting hexon
trimer is called a hexon capsomer. The hexon capsomeres can
self-assemble to form shell of an empty capsid, and the penton base
and fiber trimers can combine to form the penton when the
components are inside the nucleus. The facet of the icosahedron is
made up of three hexon capsomeres, which can be seen by
dissociation of the capsid, but the intermediate step of formation
of a group-of-nine hexons has not been observed. Several assembly
intermediates have been shown from experiments with
temperature-sensitive mutants. The progression of capsid assembly
appears dependent on scaffolding proteins, 50 kd and 30 kd, and the
naked DNA most probably enters the near-completed capsid through an
opening at one of the vertices. The last step of the process
involves the proteolytic trimming of the precursor polypeptides
pVI, pVII, pVIII and pTP, which stabilizes the capsid structure,
renders the DNA insensitive to nuclease treatment, and yields a
mature virion.
[0016] Recombinant adenoviral vectors have been used in gene
therapy. The use of a recombinant adenoviral vector to transfer one
or more recombinant genes enables targeted delivery of the gene or
genes to an organ, tissue, or cells in need of treatment, thereby
overcoming the delivery problem encountered in most forms of
somatic gene therapy. Furthermore, recombinant adenoviral vectors
do not require host cell proliferation for expression of adenoviral
proteins (Horwitz et al., In Virology, Raven Press, New York, 2,
1679-1721 (1990); and Berkner, BioTechniques, 6, 616 (1988)) and,
if the diseased organ in need of treatment is the lung, has the
added advantage of being normally trophic for the respiratory
epithelium (Straus, In Adenoviruses, Plenum Press, New York, pp.
451-496 (1984)).
[0017] Other advantages of adenoviruses as potential vectors for
human gene therapy are as follows: (i) recombination is rare; (ii)
there are no known associations of human malignancies with
adenoviral infections despite common human infection with
adenoviruses; (iii) the adenoviral genome (which is linear,
double-stranded DNA) currently can be manipulated to accommodate
foreign genes ranging in size from small peptides up to 7.0-7.5 kb
in length; (iv) an adenoviral vector does not insert its DNA into
the chromosome of a cell, so its effect is impermanent and unlikely
to interfere with the cell's normal function; (v) the adenovirus
can infect non-dividing or terminally differentiated cells, such as
cells in the brain and lungs; and (vi) live adenovirus, having as
an essential characteristic the ability to replicate, has been
safely used as a human vaccine (Horwitz, M. S. et al.; Berkner et
al.; Straus et al.; Chanock et al., JAMA, 195, 151 (1966);
Haj-Ahmad et al., J. Virol., 57, 267 (1986); and Ballay et al.,
EMBO, 4, 3861 (1985)).
[0018] Until now, adenoviral vectors used to express a foreign gene
have been deficient in only a single early region (E1) that is
essential for viral growth, i.e., singly functionally deficient.
Only the essential region E1 or, alternatively, the nonessential
region E3 has been removed for insertion of a foreign gene into the
adenoviral genome. If the region removed from the adenovirus is
essential for the virus to grow, a complementing system, such as a
complementing cell line is necessary to compensate for the missing
viral function. In other words, the complementing cell line will
express the missing viral function so that the singly deficient
adenovirus can grow inside the complementing cell. Currently, there
are only a few cell lines that exist that will complement for
essential functions missing from a singly deficient adenovirus.
Examples of such cell lines include HEK-293 (Graham et al., Cold
Spring Harbor Symp. Ouant. Biol., 39, 637-650 (1975)), W162
(Weinberg et al., PNAS USA, 80, 5383-5386 (1983)), and gMDBP
(Klessig et al., Mol. Cell. Biol., 4, 1354-1362 (1984); Brough et
al., Virology, 190, 624-634 (1992)).
[0019] Foreign genes have been inserted into two major regions of
the adenoviral genome for use as expression vectors. Insertion into
the E1 region results in defective progeny that require either
growth in complementary cells or the presence of an intact helper
virus (Berkner et al., J. Virol., 61, 1213-1220 (1987); Davidson et
al., J. Virol., 61, 1226-1239 (1987); and Mansour et al., Mol. Cell
Biol., 6, 2684-2694 (1986)). This region of the genome has been
used most frequently for expression of foreign genes. Such
E1-defective expression vector viruses usually have been grown in
the HEK-293 cell line, which contains and expresses the
complementing adenoviral E1 region. The inserted genes have been
placed under the control of various promoters and most produce
large amounts of the foreign gene product, dependent on the
expression cassette. These adenoviral vectors, however, are
defective in noncomplementing cell lines. In contrast, the E3
region is nonessential for virus growth in tissue culture, and
replacement of this region with a foreign gene expression cassette
leads to a virus that can productively grow in a noncomplementing
cell line. The insertion and expression of the hepatitis B surface
antigen in the E3 region with subsequent inoculation and formation
of antibodies in the hamster has been reported (Morin et al., PNAS
USA, 84, 4626-4630 (1987)).
[0020] The problem with singly deficient adenoviral vectors is that
they limit the amount of usable space within the adenoviral genome
for insertion and expression of a foreign gene. Due to
similarities, or overlap, in the viral sequences contained within
the singly deficient adenoviral vectors and the complementing cell
lines that currently exist, recombination events can take place and
create replication competent viruses within a vector stock. This
event can render a stock of vector unusable for gene therapy
purposes as a practical matter.
[0021] Accordingly, it is an object of the present invention to
provide multiply deficient adenoviral vectors that can accommodate
insertion and expression of larger pieces of foreign DNA. It is
another object of the present invention to provide cell lines that
complement the present inventive multiply deficient adenoviral
vectors. It is also an object of the present invention to provide
recombinants of multiply deficient adenoviral vectors and
therapeutic methods, particularly relating to gene therapy,
vaccination, and the like, involving the use of such recombinants.
These and other objects and advantages of the present invention, as
well as additional inventive features, will be apparent from the
following detailed description.
BRIEF SUMMARY OF THE INVENTION
[0022] The present invention provides multiply deficient adenoviral
vectors and complementing cell lines. The multiply deficient
adenoviral vectors can accommodate insertion and expression of
larger fragments of foreign DNA than is possible with currently
available singly deficient adenoviral vectors. The multiply
deficient adenoviral vectors are also replication deficient, which
is particularly desirable for gene therapy and other therapeutic
purposes. Accordingly, the present invention also provides
recombinant multiply deficient adenoviral vectors and therapeutic
methods, for example, relating to gene therapy, vaccination, and
the like, involving the use of such recombinants.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 is a set of schematic diagrams of the
Ad.sub.GVCFTR.10L and Ad.sub.GVCFTR.10R viral vectors.
[0024] FIG. 2 is a set of schematic diagrams of the
Ad.sub.GVCFTR.11 viral vectors.
[0025] FIG. 3 is a schematic diagram of the Ad.sub.GVCFTR.12 viral
vector.
[0026] FIG. 4 is a schematic diagram of the Ad.sub.GVCFTR.13 viral
vector.
DETAILED DESCRIPTION OF THE INVENTION
[0027] The present invention provides, among other things, multiply
deficient adenoviral vectors for gene cloning and expression. The
multiply deficient adenoviral vectors of the present invention
differ from currently available singly deficient adenoviral vectors
in being deficient in at least two essential gene functions and in
being able to accept and express larger pieces of foreign DNA.
[0028] Any subtype, mixture of subtypes, or chimeric adenovirus may
be used as the source of DNA for generation of the multiply
deficient adenoviral vectors. However, given that the Ad5 genome
has been completely sequenced, the present invention will be
described with respect to the Ad5 serotype.
[0029] Preferably, the adenoviral vector of the present invention
is at least deficient in a function provided by early region 1 (E1)
and/or one or more functions encoded by early region 2 (E2), such
as early region 2A (E2A) and early region 2B (E2B), and/or early
region 3 (E3), and/or early region 4 (E4) of the adenoviral genome.
Any one of the deleted functional regions then may be replaced with
a promoter-variable expression cassette to produce a novel gene
product. The insertion of a novel gene into the E2A region, for
example, may be facilitated by the introduction of a unique
restriction site, such that the novel gene product may be expressed
from the E2A promoter.
[0030] The present invention, however, is not limited to adenoviral
vectors that are deficient in gene functions only in the early
region of the genome. Also included are adenoviral vectors that are
deficient in the late region of the genome, adenoviral vectors that
are deficient in the early and late regions of the genome, as well
as vectors in which essentially the entire genome has been removed,
in which case it is preferred that at least either the viral
inverted terminal repeats and some of the promoters or the viral
inverted terminal repeats and a packaging signal are left intact.
One of ordinary skill in the art will appreciate that the larger
the region of the adenoviral genome that is removed, the larger the
piece of exogenous DNA that can be inserted into the genome. For
example, given that the adenoviral genome is 36 kb, by leaving the
viral inverted terminal repeats and some of the promoters intact,
the theoretical capacity of the adenovirus is approximately 35 kb.
Alternatively, one could generate a multiply deficient adenoviral
vector that contains only the ITR and a packaging signal. This
could then effectively allow for expression of 37-38 kb of foreign
DNA from this vector.
[0031] In general, virus vector construction relies on the high
level of recombination between fragments of adenoviral DNA in the
cell. Two or three fragments of adenoviral DNA, containing regions
of similarity (or overlap) between fragments and constituting the
entire length of the genome, are transfected into a cell. The host
cell's recombination machinery constructs a full-length viral
vector genome. Similar procedures for constructing viruses
containing alterations in various single regions have been
previously described (Berkner et al., Nucleic Acids Res., 12,
925-941 (1984); Berkner et al., Nucleic Acids Res., 11, 6003-6020
(1983); Brough et al., Virol., 190, 624-634 (1992)) and can be used
to construct multiply deficient viruses as can in vitro
recombination and ligation, for example.
[0032] The first step in virus vector construction is to construct
a deletion or modification of a particular region of the adenoviral
genome in a plasmid cassette using standard molecular biological
techniques. After extensive analysis, this altered DNA (containing
the deletion or modification) is then moved into a much larger
plasmid that contains up to one half of the adenovirus genome. The
next step is to transfect the plasmid DNA (containing the deletion
or modification) and a large piece of the adenovirus genome into a
recipient cell. Together these two pieces of DNA encompass all of
the adenovirus genome plus a region of similarity. Within this
region of similarity a recombination event will take place to
generate a complete intact viral genome with the deletion or
modification. In the case of multiply deficient vectors, the
recipient cell will provide not only the recombination functions
but also all missing viral functions not contained within the
transfected viral genome. The multiply deficient vector can be
further modified by alteration of the ITR and/or packaging signal,
for example, such that the multiply deficient vector only functions
in a complementing cell line.
[0033] In addition, the present invention also provides
complementing cell lines for propagation of the present inventive
multiply deficient adenoviral vectors. The preferred cell lines of
the present invention are characterized in complementing for at
least one gene function of the gene functions comprising the E1,
E2, E3 and E4 regions of the adenoviral genome. Other cell lines
include those that complement adenoviral vectors that are deficient
in at least one gene function from the gene functions comprising
the late regions, those that complement for a combination of early
and late gene functions, and those that complement for all
adenoviral functions. One of ordinary skill in the art will
appreciate that the cell line of choice would be one that
specifically complements for those functions that are missing from
the recombinant multiply deficient adenoviral vector of interest
and that can be generated using standard molecular biological
techniques. The cell lines are further characterized in containing
the complementing genes in a nonoverlapping fashion, which
eliminates the possibility of the vector genome recombining with
the cellular DNA. Accordingly, replication-competent adenoviruses
are eliminated from the vector stocks, which are, therefore,
suitable for certain therapeutic purposes, especially gene therapy
purposes. This also eliminates the replication of the adenoviruses
in noncomplementing cells.
[0034] The complementing cell line must be one that is capable of
expressing the products of the two or more deficient adenoviral
gene functions at the appropriate level for those products in order
to generate a high titer stock of recombinant adenoviral vector.
For example, it is necessary to express the E2A product, DBP, at
stoichiometric levels, i.e., relatively high levels, for adenoviral
DNA replication, but the E2B product, Ad pol, is necessary at only
catalytic levels, i.e., relatively low levels, for adenoviral DNA
replication. Not only must the level of the product be appropriate,
the temporal expression of the product must be consistent with that
seen in normal viral infection of a cell to assure a high titer
stock of recombinant adenoviral vector. For example, the components
necessary for viral DNA replication must be expressed before those
necessary for virion assembly. In order to avoid cellular toxicity,
which often accompanies high levels of expression of the viral
products, and to regulate the temporal expression of the products,
inducible promoter systems are used. For example, the sheep
metallothionine inducible promoter system can be used to express
the complete E4 region, the open reading frame 6 of the E4 region,
and the E2A region. Other examples of suitable inducible promoter
systems include, but are not limited to, the bacterial lac operon,
the tetracycline operon, the T7 polymerase system, and combinations
and chimeric constructs of eukaryotic and prokaryotic transcription
factors, repressors and other components. Where the viral product
to be expressed is highly toxic, it is desirable to use a bipartite
inducible system, wherein the inducer is carried in a viral vector
and the inducible product is carried within the chromatin of the
complementing cell line. Repressible/inducible expression systems,
such as the tetracycline expression system and lac expression
system also may be used.
[0035] DNA that enters a small proportion of transfected cells can
become stably maintained in an even smaller fraction. Isolation of
a cell line that expresses one or more transfected genes is
achieved by introduction into the same cell of a second gene
(marker gene) that, for example, confers resistance to an
antibiotic, drug or other compound. This selection is based on the
fact that, in the presence of the antibiotic, drug, or other
compound, the cell without the transferred gene will die, while the
cell containing the transferred gene will survive. The surviving
cells are then clonally isolated and expanded as individual cell
lines. Within these cell lines are those that will express both the
marker gene and the genes of interest. Propagation of the cells is
dependent on the parental cell line and the method of selection.
Transfection of the cell is also dependent on cell type. The most
common techniques used for transfection are calcium phosphate
precipitation, liposome, or DEAE dextran mediated DNA transfer.
[0036] Many modifications and variations of the present
illustrative DNA sequences and plasmids are possible. For example,
the degeneracy of the genetic code allows for the substitution of
nucleotides throughout polypeptide coding regions, as well as in
the translational stop signal, without alteration of the encoded
polypeptide coding sequence. Such substitutable sequences can be
deduced from the known amino acid or DNA sequence of a given gene
and can be constructed by conventional synthetic or site-specific
mutagenesis procedures. Synthetic DNA methods can be carried out in
substantial accordance with the procedures of Itakura et al.,
Science, 198, 1056 (1977) and Crea et al., PNAS USA, 75, 5765
(1978). Site-specific mutagenesis procedures are described in
Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor, N.Y. (2d ed. 1989). Therefore, the present invention
is in no way limited to the DNA sequences and plasmids specifically
exemplified. Exemplified vectors are for gene therapy of cystic
fibrosis and, therefore, contain and express the CFTR gene but the
vectors described are easily convertible to treat other potential
diseases including, but not limited to, other chronic lung
diseases, such as emphysema, asthma, adult respiratory distress
syndrome, and chronic bronchitis, as well as cancer, coronary heart
disease, etc. Accordingly, any gene or DNA sequence can be inserted
into a multiply deficient adenoviral vector. The choice of gene or
DNA sequence should be one that will achieve a therapeutic effect,
for example, in the context of gene therapy, vaccination, and the
like.
[0037] One skilled in the art will appreciate that suitable methods
of administering a multiply deficient adenoviral vector of the
present invention to an animal for therapeutic purposes, e.g., gene
therapy, vaccination, and the like (see, for example, Rosenfeld et
al., Science, 252, 431-434 (1991), Jaffe et al., Clin. Res., 39(2),
302A (1991), Rosenfeld et al., Clin. Res., 39(2), 311A (1991),
Berkner, BioTechniques, 6, 616-629 (1988)), are available, and,
although more than one route can be used to administer the vector,
a particular route can provide a more immediate and more effective
reaction than another route. Pharmaceutically acceptable excipients
are also well-known to those who are skilled in the art, and are
readily available. The choice of excipient will be determined in
part by the particular method used to administer the composition.
Accordingly, there is a wide variety of suitable formulations of
the pharmaceutical composition of the present invention. The
following formulations and methods are merely exemplary and are in
no way limiting. However, oral, injectable and aerosol formulations
are preferred.
[0038] Formulations suitable for oral administration can consist of
(a) liquid solutions, such as an effective amount of the compound
dissolved in diluents, such as water, saline, or orange juice; (b)
capsules, sachets or tablets, each containing a predetermined
amount of the active ingredient, as solids or granules; (c)
suspensions in an appropriate liquid; and (d) suitable emulsions.
Tablet forms can include one or more of lactose, mannitol, corn
starch, potato starch, microcrystalline cellulose, acacia, gelatin,
colloidal silicon dioxide, croscarmellose sodium, talc, magnesium
stearate, stearic acid, and other excipients, colorants, diluents,
buffering agents, moistening agents, preservatives, flavoring
agents, and pharmacologically compatible excipients. Lozenge forms
can comprise the active ingredient in a flavor, usually sucrose and
acacia or tragacanth, as well as pastilles comprising the active
ingredient in an inert base, such as gelatin and glycerin, or
sucrose and acacia, emulsions, gels, and the like containing, in
addition to the active ingredient, such excipients as are known in
the art.
[0039] The vectors of the present invention, alone or in
combination with other suitable components, can be made into
aerosol formulations to be administered via inhalation. These
aerosol formulations can be placed into pressurized acceptable
propellants, such as dichlorodifluoromethane, propane, nitrogen,
and the like. They also may be formulated as pharmaceuticals for
non-pressured preparations such as in a nebulizer or an
atomizer.
[0040] Formulations suitable for parenteral administration include
aqueous and non-aqueous, isotonic sterile injection solutions,
which can contain anti-oxidants, buffers, bacteriostats, and
solutes that render the formulation isotonic with the blood of the
intended recipient, and aqueous and non-aqueous sterile suspensions
that can include suspending agents, solubilizers, thickening
agents, stabilizers, and preservatives. The formulations can be
presented in unit-dose or multi-dose sealed containers, such as
ampules and vials, and can be stored in a freeze-dried
(lyophilized) condition requiring only the addition of the sterile
liquid excipient, for example, water, for injections, immediately
prior to use. Extemporaneous injection solutions and suspensions
can be prepared from sterile powders, granules, and tablets of the
kind previously described.
[0041] Additionally, the vectors employed in the present invention
may be made into suppositories by mixing with a variety of bases
such as emulsifying bases or water-soluble bases.
[0042] Formulations suitable for vaginal administration may be
presented as pessaries, tampons, creams, gels, pastes, foams, or
spray formulas containing, in addition to the active ingredient,
such carriers as are known in the art to be appropriate.
[0043] The dose administered to an animal, particularly a human, in
the context of the present invention will vary with the gene or
other sequence of interest, the composition employed, the method of
administration, and the particular site and organism being treated.
The dose should be sufficient to effect a desirable response, e.g.,
therapeutic or immune response, within a desirable time frame.
[0044] The multiply deficient adenoviral vectors and complementing
cell lines of the present invention also have utility in vitro. For
example, they can be used to study adenoviral gene function and
assembly.
[0045] The following examples further illustrate the present
invention and, of course, should not be construed as in any way
limiting its scope. Enzymes referred to in the examples are
available, unless otherwise indicated, from Bethesda Research
Laboratories (BRL), Gaithersburg, Md. 20877, New England Biolabs
Inc. (NEB), Beverly, Mass. 01915, or Boehringer Mannheim
Biochemicals (BMB), 7941 Castleway Drive, Indianapolis, Ind. 46250,
and are used in substantial accordance with the manufacturer's
recommendations. Many of the techniques employed herein are well
known to those in the art. Molecular biology techniques are
described in detail in laboratory manuals, such as Maniatis et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.
(2d ed. 1989) and Current Protocols in Molecular Biology (Ausubel
et al., eds. (1987)). One of ordinary skill in the art will
recognize that alternate procedures can be substituted for various
procedures presented below. Although the examples and figures
relate to Ad.sub.GV.10, Ad.sub.GV.11, Ad.sub.GV.12, and
Ad.sub.GV.13 which contain the cystic fibrosis transmembrane
regulator gene (CFTR), namely Ad.sub.GVCFTR.10, Ad.sub.GVCFTR.11,
Ad.sub.GVCFTR.12, and Ad.sub.GVCFTR.13, these vectors are not
limited to expression of the CFTR gene and can be used to express
other genes and DNA sequences. For example, therefore, the present
invention encompasses such vectors comprising any foreign gene
(e.g., for use in gene therapy), any DNA sequence capable of
expressing in a mammal a polypeptide capable of eliciting an immune
response to the polypeptide (e.g., for use in vaccination), and any
DNA sequence capable of expressing in a mammal any other
therapeutic agent (e.g., an antisense molecule, particularly an
antisense molecule selected from the group consisting of mRNA and a
synthetic oligonucleotide).
EXAMPLE 1
[0046] This example describes the generation of one embodiment
involving AD.sub.GV.10, namely Ad.sub.GVCFTR.10.
[0047] Ad.sub.GVCFTR.10 expresses the CFTR gene from the
cytomegalovirus (CMV) early promoter. Two generations of this
vector have been constructed and are designated Ad.sub.GVCFTR.10L
and Ad.sub.GVCFTR.10R, dependent on the direction in which the CFTR
expression cassette is placed in the E1 region in relation to the
vector genome as shown in FIG. 1, which is a set of schematic
diagrams of Ad.sub.GVCFTR.10L and Ad.sub.GVCFTR.10R.
[0048] The CFTR expression cassette was constructed as follows.
pRK5 (Genentech Inc., South San Francisco, Calif.) was digested
with Kpn I (New England Biolabs (NEB), Beverly, Mass.), blunt-ended
with Mung Bean nuclease (NEB), and an Xho I linker (NEB) was
ligated in place of the Kpn I site. The resulting vector was named
pRK5-Xho I. pRK5-Xho I was then digested with Sma I (NEB) and Hin
dIII (NEB) and blunt-ended with Mung bean nuclease. A plasmid
containing the CFTR gene, pBQ4.7 (Dr. Lap-Chee Tsui, Hospital for
Sick Children, Toronto, Canada), was digested with Ava I (NEB) and
Sac I (NEB) and blunt-ended with Mung bean nuclease. These two
fragments were isolated and ligated together to produce pRK5-CFTR1,
the CFTR expression cassette.
[0049] pRK5-CFTR1 was digested with Spe I (NEB) and Xho I and
blunt-ended with Klenow (NEB). pAd60.454 (Dr. L. E. Babiss, The
Rockefeller University, New York, N.Y.), which contains Ad5
sequences from 1-454/3325-5788, was digested with Bql II (NEB) and
blunt-ended with Klenow. These two fragments were purified from
vector sequences by low-melt agarose technique (Maniatis et al.,
Molecular Cloning: a laboratory manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 2nd ed. (1989)) and ligated
together to produce the left arm plasmids pGVCFTR.10L and
pGVCFTR.10R.
[0050] The left arm plasmid from pGVCFTR.10L or pGVCFTR.10R was
digested with Nhe I (NEB). The right arm of the virus was produced
by digesting Ad5d1324 (Dr. Thomas E. Shenk, Princeton University,
Princeton, N.J.) with Cla I (NEB). The two fragments, a small 918
bp fragment and a large approximately 32,800 bp fragment, were
separated by sucrose gradient centrifugation (Maniatis et al.,
supra). The large fragment was mixed with the left arm plasmid
fragments and transfected into 293 cells by standard calcium
phosphate protocol (Graham et al., Virology, 52, 456 (1973)). The
resulting recombinant viruses were plaque-purified on 293 cells,
and viral stocks were established using standard virology
techniques (e.g., Berkner et al., (1983) and (1984), supra).
EXAMPLE 2
[0051] This example describes the generation of
Ad.sub.GVCFTR.11.
[0052] Ad.sub.GVCFTR.11 was constructed by means of a single in
vivo recombination between 1-27082, i.e., the left arm, of
Ad.sub.GVCFTR.10 and a plasmid (pGV11A, pGV11B, pGV11C, or pGV11D;
described in detail below) containing 21562-35935, i.e., the right
arm, of Ad5 linearized with Bam HI (NEB) and Sal I (NEB) and into
which the various E3 and E4 alterations as described below were
introduced.
[0053] The left arm from Ad.sub.GV CFTR.10 was isolated on a
concave 10-40% sucrose gradient, wherein 1/4 th of the total
solution was 40%, after intact Ad.sub.GVCFTR.10 was digested with
Spe I (NEB) and Srf I (Stratagene, La Jolla, Calif.) to yield the
1-27082 bp fragment.
[0054] The right arm was obtained by Bam HI-Sal I digestion of a
modified pGEM vector (pGBS). pGBS was generated as follows. pGemI
(Promega, Madison, Wis.) was digested with Eco RI and blunt-ended
with Klenow, and a Sal I linker was ligated into the vector. The
resulting DNA was then digested with Sal I and religated, thereby
replacing the Eco RI site with a Sal I site and deleting the
sequence between the two Sal I sites, to generate pGEMH/P/S, which
was digested with Hin dIII and blunt-ended with Klenow, and a Bam
HI linker was ligated into the vector to generate pGEMS/B. pGEMS/B
was digested with Bam HI and Sal I and ligated with an.about.14 kb
Bam HI-Sal I fragment (21562-35935 from Ad5) from a pBR plasmid
called p50-100 (Dr. Paul Freimuth, Columbia University, NY) to
generate pGBS.
[0055] Three different versions of the right arm plasmid have been
constructed in order to introduce into the adenoviral vector two Ad
E3 gene products having anti-immunity and anti-inflammatory
properties. The large E3 deletion in pGBS.DELTA.E30RF6, designated
pGV11(O) (Example 7), was essentially replaced with three different
versions of an expression cassette containing the Rous sarcoma
virus-long terminal repeat (RSV-LTR) promoter driving expression of
a bicistronic mRNA containing at the 5' end the Ad2 E3 19 kDa
anti-immunity gene product and at the 3' end the Ad5 E3 14.7 kDa
anti-inflammatory gene product. One additional virus was
constructed by deleting the 19 kDa cDNA fragment by Bst BI (NEB)
fragment deletion. This virus, designated Ad.sub.GVCFTR.11(D),
contains the RSV-LTR promoter driving expression of a monocistronic
mRNA containing only the E3 14.7 kDa anti-inflammatory gene
product.
[0056] The Spe I (27082)--Nde I (31089) fragment from pGBSAE3
(Example 5) was subcloned into pUC 19 by first cloning the Eco RI
(27331)--Nde I (31089) fragment into identical sites in the pUC 19
polylinker. A Hin dIII (26328)--Eco RI (27331) fragment generated
from pGBS was then cloned into the Eco RI site of this clone to
generate pHN.DELTA.E3. Using appropriate primers, a PCR fragment
with flanking Xba I sites was generated containing the RSV-LTR
promoter, the Ad2 E3 19 kDa gene product, and the Ad5 E3 14.7 kDa
gene product. The amplified fragment was digested with Xba I and
subcloned into pUC 19 to generate pXA. After analysis of the Xba I
fragment, the fragment was ligated into pHN.DELTA.E3 to generate
pHNRA.
[0057] Using appropriate primers, two PCR fragments with flanking
Bst BI sites were generated that encode internal ribosomal entry
sites (IRES), which are known to enhance the translation of mRNAs
that contain them (Jobling et al., Nature, 325, 622-625 (1987);
Jang et al., Genes and Development, 4, 1560-1572 (1990)). One
fragment (version B) contains a 34 bp IRES from the untranslated
leader of the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4
leader) (Jobling et al., supra). The other fragment (version C)
contains a 570 bp IRES from the 5' nontranslated region of
encephalomyocarditis virus (EMCV) mRNA (Jang et al., supra). Each
Bst BI fragment from version B or C was cloned in place of the Bst
BI fragment in pXA. The resulting plasmids, named pXB and pXC,
respectively, were moved into pHN.DELTA.E3 to generate pHNRB and
pHNRC, respectively, after sequence analysis of the Xba I
fragments.
[0058] The Spe I (27082)--Nde I (31089) fragment from
pGBS.DELTA.E30RF6 was replaced with the Spe I--Nde I fragments from
pHNRA, pHNRB, pHNRC and pHNRD to generate pGV11A, pGV11B, pGV11C
and pGV11D, respectively.
[0059] The pGBV plasmid DNA was linearized with Bam HI and Sal I
and mixed with the purified left arm DNA fragment in varying
concentrations to give about 20 .mu.g total DNA, using salmon sperm
or calf thymus DNA (Life Technologies, Gaithersburg, Mass.) to
bring the amount of DNA to about 20 .mu.g as needed. The mixed
fragments were then transfected into 293 cells using standard
calcium phosphate techniques (Graham et al., supra).
[0060] Five days after transfection, the cell monolayer was
harvested by freeze-thawing three times. The resulting hybrid virus
was titered onto 293 cells and isolated plaques were picked. The
process of plaque isolation was repeated twice more to ensure a
single recombinant virus existed in the initial plaque stock. The
plaque isolate stock was then amplified to a large viral stock
according to standard virology techniques as described in Burlseson
et al., Virology: a Laboratory Manual, Academic Press Inc.
(1992).
[0061] FIG. 2 is a set of schematic diagrams of the various
AD.sub.GVCFTR.11 viral vectors. The diagrams are aligned with that
of AD.sub.GVCFTR.10L for comparison.
EXAMPLE 3
[0062] This example describes the generation of
Ad.sub.GVCFTR.12.
[0063] Ad.sub.GV.12 is characterized by complete elimination of the
E4 region. This large deletion allows for insertion of up to about
10 kb of exogenous DNA. More importantly, another region of the
genome has become accessible for introduction of foreign gene
expression cassettes. This deletion now enables the incorporation
of larger expression cassettes for other products. For example,
soluble receptors, i.e., TNF or IL-6 without a transmembrane domain
so that they are now not attached to the membrane, and antisense
molecules, e.g., those directed against cell cycle regulating
products, such as cdc2, cdk kinases, cyclins, i.e., cyclin E or
cyclin D, and transcription factors, i.e., E2F or c-myc, to
eliminate inflammation and immune responses.
[0064] pGV11(O) is altered to produce a right arm plasmid in which
the entire E4 region is deleted. The resulting plasmid in which the
entire E3 and E4 regions are deleted is named pGV12(O). This is
done by introducing a Pac I restriction site at the Afl III site at
32811 and the Bsq I site at 35640. Deletion of the Pac I fragment
between these two sites effectively eliminates all of the E4
sequences including the E4 TATA element within the E4 promoter and
the E4 poly A site.
[0065] Virus construction is performed as previously described
except that the 293/E4 cell line or the 293/ORF6 cell line is used.
The left arm from Ad.sub.GVCFTR.10L, the right arm pGV12(O)
plasmid, and all other general techniques are as described in
Example 2. Since E4 contains essential gene products necessary for
viral growth, the resulting E4 deletion mutant virus cannot grow in
the absence of exogenously expressed E4. Therefore, all
manipulations for viral construction are carried out in the new
293/E4 cell line or 293/ORF6 cell line (described in Examples 8 and
9, respectively). The resulting virus is Ad.sub.GVCFTR.12.
EXAMPLE 4
[0066] This example describes the generation of
Ad.sub.GVCFTR.13.
[0067] Ad.sub.GV.13 is characterized by not only complete
elimination of E1, and E4 (as in (AD.sub.GV.12) but also complete
elimination of E2A. The complete coding region of E2A is deleted by
fusing together the DNA from two E2A mutant viruses, namely H5in800
and H5in804, containing insertions of Cla I restriction sites at
both ends of the open reading frame (Vos et al., Virology, 172,
634-642 (1989); Brough et al., Virology, 190, 624-634 (1992)). The
Cla I site of H5in800 is between codons 2 and 3 of the gene, and
the Cla I site of H5in804 is within the stop codon of the E2A gene.
The resultant virus contains an open reading frame consisting of 23
amino acids that have no similarity to the E2A reading frame. More
importantly, this cassette offers yet another region of the virus
genome into which a unique gene can be introduced. This can be done
by inserting the gene of interest into the proper reading frame of
the existing mini-ORF or by introducing yet another expression
cassette containing its own promoter sequences, polyadenylation
signals, and stop sequences in addition to the gene of
interest.
[0068] Adenovirus DNA is prepared from H5in800 and H5in804. After
digestion with the restriction enzyme Hin dIII (NEB), the Hin dIII
A fragments from both H5in800 and H5in804 are cloned into pKS+
(Stratagene). The resulting plasmids are named pKS+H5in800Hin dIIIA
and pKS+H5in804Hin dIIIA, respectively. The Cla I (NEB) fragment
from pKS+H5in800Hin dIIIA is then isolated and cloned in place of
the identical Cla I fragment from PKS+H5in804Hin dIIIA. This
chimeric plasmid, pHin dIIIA.DELTA.E2A effectively removes all of
the E2A reading frame as described above. At this point, the E2A
deletion is moved at Bam HI (NEB) and Spe I (NEB) restriction sites
to replace the wild-type sequences in pGV12(O) to construct
pGV13(O).
[0069] Ad.sub.GVCFTR.13 virus is constructed as previously
described by using Ad.sub.GVCFTR.10 left arm DNA and pGV13(O) right
arm plasmid DNA. However, the recipient cell line for this virus
construction is the triple complementing cell line 293/E4/E2A.
EXAMPLE 5
[0070] This example describes the generation of pGBS.DELTA.E3.
[0071] This plasmid was generated to remove the majority of the E3
region within PGBS, including the E3 promoter and existing E3
genes, to make room for other constructs and to facilitate
introduction of E3 expression cassettes. This plasmid contains a
deletion from 28331 to 30469.
[0072] A PCR fragment was generated with Ad5s(27324) and
A5a(28330)X as primers and pGBS as template. The resulting fragment
was digested with Eco RI (27331) and Xba I (28330) and
gel-purified. This fragment was then introduced into PGBS at the
Eco RI (27331) and Xba I (30470) sites.
EXAMPLE 6
[0073] This example describes the generation of
pGBS.DELTA.E3.DELTA.E4.
[0074] A large deletion of the Ad5 E4 region was introduced into
pGBS.DELTA.E3 to facilitate moving additional exogenous sequences
into the adenoviral genome. The 32830-35566 E4 coding sequence was
deleted.
[0075] A Pac I site was generated in place of the Mun I site at
32830 by treating PGBS Mun I-digested DNA with Klenow to blunt-end
the fragment and by ligating a Pac I linker to this. The modified
DNA was then digested with Nde I and the resulting 1736 bp fragment
(Nde I 31089-Pac I 32830) was gel-purified. A PCR fragment was
prepared using A5 (35564)P (IDT, Coralville, Iowa) and T7 primers
(IDT, Coralville, Iowa) and pGBS as template. The resulting
fragment was digested with Pac I and Sal I to generate Pac I
35566-Sal I 35935. A Sma I site within the polylinker region of pUC
19 was modified to a Pac I site by ligating in a Pac I linker. The
Pac I 35566 -Sal I 35935 fragment was moved into the modified pUC
19 vector at Pac I and Sal I sites, respectively, in the polylinker
region. The modified Nde I 31089-Pac I 32830 fragment was moved
into the pUC 19 plasmid, into which the Pac I 35566-Sal I 35935
fragment already had been inserted, at Nde I and Pac I sites,
respectively. The Nde I 31089-Sal I 35935 fragment from the pUC 19
plasmid was purified by gel purification and cloned in place of the
respective Nde I and Sal I sites in pGBS.DELTA.E3 to yield
pGBS.DELTA.E3.DELTA.E4.
EXAMPLE 7
[0076] This example describes the generation of
pGBS.DELTA.E30RF6.
[0077] The Ad5 894 bp E4 ORF-6 gene was placed 3' of the E4
promoter in pGBS.DELTA.E3.DELTA.E4. ORF-6 is the only absolutely
essential E4 product necessary for virus growth in a non-E4
complementing cell line. Therefore, this product was re-introduced
into the right arm plasmid (Example 2) under its own promoter
control so that Ad.sub.GVCFTR.11 virus can be propagated in 293
cells.
[0078] A PCR fragment was generated using A5s(33190)P (32 bp;
5'CACTTAATTAAACGCCTACATGGGGGTAGAGT3') (SEQ ID NO:1) and A5a(34084)P
(34 bp; 5'CACTTAATTAAGGAAATATGACTACGTCCGGCGT3') (SEQ ID NO:2) as
primers (IDT, Coralville, Iowa) and pGBS as template. This fragment
was digested with Pac I and gel-purified. The product was
introduced into the single Pac I site in pGBS.DELTA.E3.DELTA.E4 to
generate pGV11(O), which was the plasmid that was E3-modified for
expression of the 19 kDa and 14.7 kDa Ad E3 products.
EXAMPLE 8
[0079] This example describes the generation of the 293/E4 cell
line.
[0080] The vector pSMT/E4 was generated as follows. A 2752 bp Mun I
(site 32825 of Ad2)-Sph I (polylinker) fragment was isolated from
pE4(89-99), which is a pUC19 plasmid into which was subcloned
region 32264-35577 from Ad2, blunt-ended with Klenow, and treated
with phosphatase (NEB). The 2752 bp Mun I-Sph I fragment was then
ligated into pMT010/A.sup.+ (McNeall et al., Gene, 76, 81-89
(1989)), which had been linearized with Bam HI, blunt-ended with
Klenow and treated with phosphatase, to generate the expression
cassette plasmid, pSMT/E4.
[0081] The cell line 293 (ATCC CRL 1573; American Type Culture
Collection, Rockville, Md.) was cultured in 10% fetal bovine serum
Dulbecco's modified Eagle's medium (Life Technologies,
Gaithersburg, Mass.). The 293 cells were then transfected with
pSMT/E4 linearized with Eco RI by the calcium phosphate method
(Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold
Spring Harbor Laboratory Press (1989)). Approximately 24-48 hours
post-transfection, medium (as above) containing 100 .mu.M
methotrexate and amethopterin (Sigma Chemical Co., St. Louis, Mo.)
was added. The presence of methotrexate in the medium selects for
expression of the dihydrofolate reductase (DHFR) gene, which is the
selectable marker on the pSMT/E4 plasmid.
[0082] The normal cell DHFR gene is inhibited by a given
concentration of methotrexate (cell type-specific), causing cell
death. The expression of the additional DHFR gene in transfected
cells containing pSMT/E4 provides resistance to methotrexate.
Therefore, transfected cells containing the new genes are the only
ones that grow under these conditions (for review, see Sambrook et
al., supra).
[0083] When small colonies of cells formed from the initial single
cell having the selectable marker, they were clonally isolated and
propagated (for review, see Sambrook et al., supra). These clones
were expanded to produce cell lines that were screened for
expression of the product--in this case, E4--and screened for
functionality in complementing defective viruses--in this case,
both E1 and E4 defective viruses.
[0084] The result of this process produced the first 293/E4 cell
lines capable of complementing adenoviral vectors defective in both
E1 and E4 functions, such as Ad.sub.GVCFTR.12.
EXAMPLE 9
[0085] This example describes the generation of the 293/ORF-6 cell
line.
[0086] The primers A5s(33190)P and A5a(34084)P were used in a
polymerase chain reaction (PCR) (PCR Protocols, A guide to Methods
and Applications, Innis et al., eds., Academic Press, Inc. (1990))
to amplify the ORF-6 gene of Ad5 E4 and generate Pac I sites at the
ends for cloning. The amplified fragment was blunt-ended with
Klenow and cloned into pCR-Script SK(+) (Stratagene, La Jolla,
Calif.). The resulting plasmid, pCR/ORF-6, was sequenced and then
the ORF-6 insert was transferred into the pSMT/puro expression
vector, which was generated by ligation of a blunt-ended Eco
RI--Hin dIII fragment containing the SMT promoter into the
blunt-ended Mlu I-Hin dIII site in pRCpuro, to generate
pSMT/ORF-6.
[0087] The 293 cell line was cultured and transfected with
pSMT/ORF-6 as described in Example 8, except that the transfected
cells were placed under selection for the puromycin resistance
gene, which allows cells that express it to grow in the presence of
puromycin. Colonies of transformed cells were subcloned and
propagated and were screened as described in Example 8.
[0088] This cell line is suitable for complementing vectors that
are deficient in the E1 and E4 region, such as the Ad.sub.GVCFTR.12
series of vectors.
EXAMPLE 10
[0089] This example describes the generation of the 293/E4/E2A cell
line. The 293/E4/E2A cell line allows E1, E4 and E2A defective
viral vectors to grow.
[0090] The E2A expression cassette for introduction into 293/E4
cells is produced as follows. The first step is to alter
surrounding bases of the ATG of E2A to make a perfect Kozak
consensus (Kozak, J. Molec. Biol., 196, 947-950 (1987)) to optimize
expression of E2A. Two primers are designed to alter the 5' region
of the E2A gene. Ad5s(23884), an 18 bp oligonucleotide
(5'gCCgCCTCATCCgCTTTT3') (SEQ ID NO:3), is designed to prime the
internal region flanking the Sma I site of the E2A gene.
DBP(ATG)R1, a 32 bp oligonucleotide
(5'CCggAATTCCACCATggCgAgtcgggAAgAgg3'- ) (SEQ ID NO:4), is designed
to introduce the translational consensus sequence around the ATG of
the E2A gene modifying it into a perfect Kozak extended consensus
sequence and to introduce an Eco RI site just 5' to facilitate
cloning. The resulting PCR product using the above primers is
digested with Eco RI and Sma I (NEB) and cloned into the identical
polylinker sites of pBluescript IIKS+ (Stratgene, La Jolla,
Calif.). The resulting plasmid is named pKS/ESDBP.
[0091] A Sma I-Xba I fragment is isolated from pHRKauffman (Morin
et al., Mol. Cell. Biol., 9, 4372-4380 (1989)) and cloned into the
corresponding Sma I and Xba I sites of pKS/ESDBP to complete the
E2A reading frame. The resulting plasmid is named pKSDBP. In order
to eliminate all homologous sequences from vector contained within
the expression cassette, the Kpn I to Dra I fragment from pKSDBP is
moved into corresponding Kpn I and Pme I sites in PNEB193 (NEB) in
which the Eco RI sites in the polylinker have been destroyed
(GenVec). The resulting clone, pE2A, contains all of the E2A
reading frame without any extra sequences homologous to the E2A
deleted vector in Example 4.
[0092] A 5' splice cassette is then moved into pE2A to allow proper
nuclear processing of the mRNA and to further enhance expression of
E2A. To do this, pRK5, described in Example 1, is digested with Sac
II (NEB), blunt-ended with Mung Bean nuclease (NEB), and digested
with Eco RI (NEB). The resulting approx. 240 bp fragment of
interest containing the splicing signals is cloned into the Cla I
(blunt-ended with Klenow) to Eco RI sites of pE2A to generate
p5'E2A. The blunt-ended (Klenow) Sal I to Hin dIII fragment from
p5'E2A containing the E2A sequences is moved into the blunt-ended
(Klenow) Xba I site of pSMT/puro and pSMT/neo. The resulting E2A is
named pKSE2A.
[0093] The Xba I fragment from pKSE2A that contained all the E2A
gene is moved into the Xba I site of pSMT/puro and pSMT/neo. The
resulting E2A expression plasmids, pSMT/E2A/puro and pSMT/E2A/neo,
are transfected into 293/E4 and 203/ORF-6 cells, respectively.
Cells transfected with pSMT/E2A/puro are selected for growth in
standard media plus puromycin and cells transfected with
pSMT/E2A/neo are selected for growth in standard media plus G418.
Clonal expansion of isolated colonies is as described in Example 8.
The resulting cell lines are screened for their ability to
complement E1, E4 and E2A defective viral vectors.
[0094] These cell lines are suitable for complementing vectors that
are deficient in the E1, E4 and E2A regions of the virus, such as
those described in the Ad.sub.GVCFTR.13 series of viral
vectors.
EXAMPLE 11
[0095] This example describes the generation of complementing cell
lines using the cell line A549 (ATCC) as the parental line.
[0096] Ad2 virus DNA is prepared by techniques previously
described. The genomic DNA is digested with Ssp I and Xho I and the
5438 bp fragment is purified and cloned into Eco RV/Xho I sites of
pKS+ (Stratagene) to produce pKS341-5778. After diagnostic
determination of the clone, an Xho I (blunt-ended with Klenow) to
Eco RI fragment is moved into Nru I (blunt) to Eco RI sites in
pRC/CMVneo to produce pE1neo. Transformation of A549 cells with
this clone yields a complementing cell line (similar to 293),
wherein additional expression cassettes can be introduced, in a
manner similar to that described for the 293 cell, to produce
multicomplementing cell lines with excellent plaqueing
potential.
[0097] All references, including publications and patents, cited
herein are hereby incorporated by reference to the same extent as
if each reference were individually and specifically indicated to
be incorporated by reference and were set forth in its entirety
herein.
[0098] While this invention has been described with emphasis upon
preferred embodiments, it will be obvious to those of ordinary
skill in the art that the preferred embodiments may be varied. It
is intended that the invention may be practiced otherwise than as
specifically described herein. Accordingly, this invention includes
all modifications encompassed within the spirit and scope of the
appended claims.
Sequence CWU 1
1
4 1 32 DNA Artificial Sequence Synthetic DNA 1 cacttaatta
aacgcctaca tgggggtaga gt 32 2 34 DNA Artificial Sequence Synthetic
DNA 2 cacttaatta aggaaatatg actacgtccg gcgt 34 3 18 DNA Artificial
Sequence Synthetic DNA 3 gccgcctcat ccgctttt 18 4 32 DNA Artificial
Sequence Synthetic DNA 4 ccggaattcc accatggcga gtcgggaaga gg 32
* * * * *