U.S. patent application number 09/911346 was filed with the patent office on 2002-08-08 for natural killer cell enhancing factor c.
Invention is credited to Gentz, Reiner, Ni, Jian, Rosen, Craig A., Yu, Guo-Liang.
Application Number | 20020106323 09/911346 |
Document ID | / |
Family ID | 23855033 |
Filed Date | 2002-08-08 |
United States Patent
Application |
20020106323 |
Kind Code |
A1 |
Ni, Jian ; et al. |
August 8, 2002 |
Natural killer cell enhancing factor C
Abstract
A human natural killer cell enhancing factor C and fragments
thereof and DNA (RNA) encoding such polypeptides and a procedure
for producing such polypeptidees by recombinant techniques is
disclosed. Further disclosed are antibodies directed against such
polypeptides and fragments or portions thereof and methods for
producing such antibodies and utilizing such antibodies for
therapeutic or diagnostic purposes. Also disclosed are methods for
utilizing such polypeptides and/or antibodies for preventing and/or
treating viral infections, inflammation, neoplasia and damge from
superoxide radicals. Diagnostic assays for identifying mutations in
nucleic acid sequence encoding a polypeptide of the present
invention and for detecting altered levels of the polypeptide of
the present invention for detecting diseases, for example, cancer,
are also disclosed.
Inventors: |
Ni, Jian; (Gaithersburg,
MD) ; Yu, Guo-Liang; (Darnestown, MD) ; Gentz,
Reiner; (Silver Spring, MD) ; Rosen, Craig A.;
(Laytonsville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
9410 KEY WEST AVENUE
ROCKVILLE
MD
20850
|
Family ID: |
23855033 |
Appl. No.: |
09/911346 |
Filed: |
July 24, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09911346 |
Jul 24, 2001 |
|
|
|
09407891 |
Sep 29, 1999 |
|
|
|
09407891 |
Sep 29, 1999 |
|
|
|
08467265 |
Jun 6, 1995 |
|
|
|
Current U.S.
Class: |
424/1.49 ;
435/7.1; 530/389.1 |
Current CPC
Class: |
C07K 14/52 20130101;
A61K 38/00 20130101; Y10S 514/885 20130101 |
Class at
Publication: |
424/1.49 ;
435/7.1; 530/389.1 |
International
Class: |
A61K 051/00; G01N
033/53; C07K 016/46 |
Claims
What is claimed is:
1. An isolated antibody or portion thereof that specifically binds
to a protein whose sequence consists of amino acid residues +31 to
+271 of SEQ ID NO:2.
2. The antibody or portion thereof of claim 1 wherein said protein
specifically bound by said antibody or portion thereof is
glycosylated.
3. The antibody or portion thereof of claim 1 which is a monoclonal
antibody.
4. The antibody or portion thereof of claim 1 which is a polyclonal
antibody.
5. The antibody or portion thereof of claim 1 which is a chimeric
antibody.
6. The antibody or portion thereof of claim 1 which is a single
chain antibody.
7. The antibody or portion thereof of claim 1 which is a Fab
fragment.
8. The antibody or portion thereof of claim 1 which is labeled.
9. The antibody of claim 8 wherein the label is selected from the
group consisting of: (a) an enzyme label; (b) a radioisotope; and
(c) a fluorescent label.
10. A composition comprising the antibody or portion thereof of
claim 1 and a carrier.
11. The composition of claim 10, wherein the antibody or portion
thereof is a monoclonal antibody.
12. The composition of claim 10, wherein the antibody or portion
thereof is a polyclonal antibody.
13. The composition of claim 10, wherein the antibody or portion
thereof is a chimeric antibody.
14. The composition of claim 10, wherein the antibody or portion
thereof is a single chain antibody.
15. The composition of claim 10, wherein the antibody or portion
thereof is a Fab fragment.
16. The composition of claim 10, wherein the antibody or portion
thereof is labeled.
17. The composition of claim 16 wherein the label is selected from
the group consisting of: (a) an enzyme label; (b) a radioisotope;
and (c) a fluorescent label.
18. An isolated cell that produces the antibody or portion thereof
of claim 1.
19. A hybridoma that produces the antibody of claim 1.
20. A hybridoma that produces the antibody of claim 3.
21. A method of detecting NKEF C protein in a biological sample
comprising: (a) contacting the biological sample with the antibody
or portion thereof of claim 1; and (b) detecting the NKEF C protein
in the biological sample.
22. The method of claim 21 wherein the antibody is a monoclonal
antibody.
23. The method of claim 21 wherein the antibody is a polyclonal
antibody.
24. The method of claim 21 wherein the antibody is a chimeric
antibody.
25. The method of claim 21 wherein the antibody is a single chain
antibody.
26. The method of claim 21 wherein the antibody is a Fab
fragment.
27. The method of claim 21 wherein the antibody is a labeled
antibody.
28. The method of claim 27 wherein the label is selected from the
group consisting of: (a) an enzyme label; (b) a radioisotope; and
(c) a fluorescent label.
29. An isolated antibody or portion thereof produced by immunizing
an animal with a protein whose sequence comprises amino acid
residues +31 to +271 of SEQ ID NO:2; wherein said antibody or
portion thereof specifically binds to the amino acid sequence of
SEQ ID NO:2.
30. An isolated antibody or portion thereof that specifically binds
to a protein selected from the group consisting of: (a) a protein
whose sequence consists of amino acid residues +1 to +271 of SEQ ID
NO:2; (b) a protein whose sequence consists of at least 30
contiguous amino acid residues of SEQ ID NO:2; and (c) a protein
whose sequence consists of at least 50 contiguous amino acid
residues of SEQ ID NO:2.
31. The isolated antibody or portion thereof of claim 30, that
specifically binds protein (a).
32. The isolated antibody or portion thereof of claim 30, that
specifically binds protein (b).
33. The isolated antibody or portion thereof of claim 30, that
specifically binds protein (c).
34. The isolated antibody or portion thereof of claim 30, wherein
said protein specifically bound by said isolated antibody or
portion thereof is glycosylated.
35. The isolated antibody or portion thereof of claim 30 which is a
monoclonal antibody.
36. The isolated antibody or portion thereof of claim 30 which is a
polyclonal antibody.
37. The isolated antibody or portion thereof of claim 30, which is
a chimeric antibody.
38. The isolated antibody or portion thereof of claim 30 which is a
single chain antibody.
39. The isolated antibody or portion thereof of claim 30 which is a
Fab fragment.
40. The antibody or portion thereof of claim 30 which is
labeled.
41. The antibody of claim 40 wherein the label is selected from the
group consisting of: (a) an enzyme label; (b) a radioisotope; and
(c) a fluorescent label.
42. A composition comprising the isolated antibody or portion
thereof of claim 30 and a carrier.
43. The composition of claim 42, wherein the isolated antibody or
portion thereof is a monoclonal antibody.
44. The composition of claim 42, wherein the isolated antibody or
portion thereof is a polyclonal antibody.
45. The composition of claim 42, wherein the isolated antibody or
portion thereof is a chimeric antibody.
46. The composition of claim 42, wherein the isolated antibody or
portion thereof is a single chain antibody.
47. The composition of claim 42, wherein the isolated antibody or
portion thereof is a Fab fragment.
48. The composition of claim 42, wherein the antibody or portion
thereof is labeled.
49. The composition of claim 48 wherein the label is selected from
the group consisting of: (a) an enzyme label; (b) a radioisotope;
and (c) a fluorescent label.
50. An isolated cell that produces the antibody of claim 30.
51. A hybridoma that produces the antibody of claim 30.
52. A hybridoma that produces the antibody of claim 35.
53. A method of assaying NKEF C protein in a biological sample
comprising: (a) contacting the biological sample with the isolated
antibody or portion thereof of claim 30; and (b) detecting NKEF C
protein in the biological sample.
54. The method of claim 53 wherein the isolated antibody or portion
thereof is a monoclonal antibody.
55. The method of claim 53 wherein the isolated antibody or portion
thereof is a polyclonal antibody.
56. The method of claim 53 wherein the isolated antibody or portion
thereof is a chimeric antibody.
57. The method of claim 53 wherein the isolated antibody or portion
thereof is a single chain antibody.
58. The method of claim 53 wherein the antibody is a Fab
fragment.
59. The method of claim 53 wherein the antibody is a labeled
antibody.
60. The method of claim 59 wherein the label is selected from the
group consisting of: (a) an enzyme label; (b) a radioisotope; and
(c) a fluorescent label.
61. An antibody or portion thereof produced by immunizing an animal
with a protein selected from the group consisting of: (a) a protein
whose sequence comprises amino acid residues +1 to +271 of SEQ ID
NO:2; (b) a protein whose sequence comprises 30 contiguous amino
acid residues of SEQ ID NO:2; and (c) a protein whose sequence
comprises 50 contiguous amino acid residues of SEQ ID NO:2; wherein
said antibody or portion thereof specifically binds to the amino
acid sequence of SEQ ID NO:2.
62. The antibody or portion thereof of claim 61 produced by
immunizing an animal with protein (a).
63. The antibody or portion thereof of claim 61 produced by
immunizing an animal with protein (b).
64. The antibody or portion thereof of claim 61 produced by
immunizing an animal with protein (c).
65. An isolated antibody or portion thereof that specifically binds
to a protein whose sequence consists of the amino acid sequence of
the mature form of the polypeptide encoded by the cDNA contained in
ATCC.RTM. Deposit No. 97157.
66. The antibody or portion thereof of claim 65 wherein said
protein specifically bound by said antibody or portion thereof is
glycosylated.
67. The antibody or portion thereof of claim 65 which is a
monoclonal antibody.
68. The antibody or portion thereof of claim 65 which is a
polyclonal antibody.
69. The antibody or portion thereof of claim 65 which is a chimeric
antibody.
70. The antibody or portion thereof of claim 65 which is a single
chain antibody.
71. The antibody or portion thereof of claim 65 which is a Fab
fragment.
72. The antibody or portion thereof of claim 65 which is
labeled.
73. The antibody of claim 72 wherein the label is selected from the
group consisting of: (a) an enzyme label; (b) a radioisotope; and
(c) a fluorescent label.
74. A composition comprising the antibody or portion thereof of
claim 65 and a carrier.
75. The composition of claim 74, wherein the antibody or portion
thereof is a monoclonal antibody.
76. The composition of claim 74, wherein the antibody or portion
thereof is a chimeric antibody.
77. The composition of claim 74, wherein the antibody or portion
thereof is a single chain antibody.
78. The composition of claim 74, wherein the antibody or portion
thereof is a Fab fragment.
79. The composition of claim 74, wherein the antibody or portion
thereof is labeled.
80. The composition of claim 79 wherein the label is selected from
the group consisting of: (a) an enzyme label; (b) a radioisotope;
and (c) a fluorescent label.
81. An isolated cell that produces the antibody of claim 65.
82. A hybridoma that produces the antibody of claim 65.
83. A hybridoma that produces the antibody of claim 67.
84. A method of detecting NKEF C protein in a biological sample
comprising: (a) contacting the biological sample with the antibody
or portion thereof of claim 65; and (b) detecting the NKEF C
protein in the biological sample.
85. The method of claim 84 wherein the antibody is a monoclonal
antibody.
86. The method of claim 84 wherein the antibody is a polyclonal
antibody.
87. The method of claim 84 wherein the antibody is a chimeric
antibody.
88. The method of claim 84 wherein the antibody is a single chain
antibody.
89. The method of claim 84 wherein the antibody is a Fab
fragment.
90. The method of claim 84 wherein the antibody is a labeled
antibody.
91. The method of claim 90 wherein the label is selected from the
group consisting of: (a) an enzyme label; (b) a radioisotope; and
(c) a fluorescent label.
92. An isolated antibody or portion thereof produced by immunizing
an animal with a protein whose sequence comprises the amino acid
sequence of the mature form of the polypeptide encoded by the cDNA
contained in ATCC.RTM. Deposit No. 97157; wherein said antibody or
portion thereof specifically binds to the amino acid sequence of
the polypeptide encoded by the cDNA contained in ATCC.RTM. Deposit
No. 97103.
93. An isolated antibody or portion thereof that specifically binds
to a protein selected from the group consisting of: (a) a protein
whose sequence consists of the amino acid sequence of the
polypeptide encoded by the cDNA contained in ATCC.RTM. Deposit No.
97157; (b) a protein whose sequence consists of 30 contiguous amino
acid residues of a polypeptide encoded by the cDNA contained in
ATCC.RTM. Deposit No. 97157; and (c) a protein whose sequence
consists of 50 contiguous amino acid residues of a polypeptide
encoded by the cDNA contained in ATCC.RTM. Deposit No. 97157.
94. The isolated antibody or portion thereof of claim 93 that
specifically binds protein (a).
95. The isolated antibody or portion thereof of claim 93 that
specifically binds protein (b).
96. The isolated antibody or portion thereof of claim 93 that
specifically binds protein (c).
97. The isolated antibody or portion thereof of claim 93, wherein
said protein specifically bound by said antibody or portion thereof
is glycosylated.
98. The isolated antibody or portion thereof of claim 93, which is
a monoclonal antibody.
99. The isolated antibody or portion thereof of claim 93, which is
a polyclonal antibody.
100. The isolated antibody or portion thereof of claim 93, which is
a chimeric antibody.
101. The isolated antibody or portion thereof of claim 93 which is
a single chain antibody.
102. The isolated antibody or portion thereof of claim 93 which is
a Fab fragment.
103. The isolated antibody or portion thereof of claim 93 which is
labeled.
104. The isolated antibody or portion thereof of claim 103 wherein
the label is selected from the group consisting of: (a) an enzyme
label; (b) a radioisotope; and (c) a fluorescent label.
105. A composition comprising the isolated antibody or portion
thereof of claim 93 and a carrier.
106. The composition of claim 105, wherein the antibody or portion
thereof is a monoclonal antibody.
107. The composition of claim 105, wherein the antibody or portion
thereof is a polyclonal antibody.
108. The composition of claim 105, wherein the antibody or portion
thereof is a chimeric antibody.
109. The composition of claim 105, wherein the antibody or portion
thereof is a single chain antibody.
110. The composition of claim 105, wherein the antibody or portion
thereof is a Fab fragment.
111. The composition of claim 105, wherein the antibody or portion
thereof is labeled.
112. The composition of claim 111, wherein the label is selected
from the group consisting of: (a) an enzyme label; (b) a
radioisotope; and (c) a fluorescent label.
113. An isolated cell that produces the isolated antibody or
portion thereof of claim 93.
114. A hybridoma that produces the antibody of claim 93.
115. A hybridoma that produces the antibody of claim 98.
116. A method of assaying NKEF C protein in a biological sample
comprising: (a) contacting the biological sample from a test
subject with the isolated antibody or portion thereof of claim 93;
and (b) detecting NKEF C protein in the biological sample.
117. The method of claim 116, wherein the antibody or portion
thereof is a monoclonal antibody.
118. The method of claim 116, wherein the antibody or portion
thereof is a polyclonal antibody.
119. The method of claim 116, wherein the antibody or portion
thereof is a chimeric antibody.
120. The method of claim 116, wherein the antibody or portion
thereof is a single chain antibody.
121. The method of claim 116, wherein the antibody or portion
thereof is a Fab fragment.
122. The method of claim 116, wherein the antibody or portion
thereof is labeled.
123. The method of claim 122, wherein the label is selected from
the group consisting of: (a) an enzyme label; (b) a radioisotope;
and (c) a fluorescent label.
124. An antibody or portion thereof produced by immunizing an
animal with a protein selected from the group consisting of: (a) a
protein whose sequence comprises the amino acid sequence of the
polypeptide encoded by the cDNA contained in ATCC.RTM. Deposit No.
97157; (b) a protein whose sequence comprises at least 30
contiguous amino acid residues of a polypeptide encoded by the cDNA
contained in ATCC.RTM. Deposit No. 97157; and (c) a protein whose
sequence comprises at least 50 contiguous amino acid residues of a
polypeptide encoded by the cDNA contained in ATCC.RTM. Deposit No.
97157; wherein said antibody or portion thereof specifically binds
to the polypeptide encoded by the cDNA contained in ATCC.RTM.
Deposit No. 97157.
125. (New) The antibody or portion thereof of claim 124 produced by
immunizing an animal with protein (a).
126. (New) The antibody or portion thereof of claim 124 produced by
immunizing an animal with protein (b).
127. (New) The antibody or portion thereof of claim 124 produced by
immunizing an animal with protein (c).
128. A method of treating a patient having need of a reduced level
of NKEF C protein, comprising administering to said patient the
antibody or portion thereof of claim 1.
129. The method of claim 128, wherein the antibody is a monoclonal
antibody.
130. A method of treating a patient having need of a reduced level
of NKEF C protein, comprising administering to said patient the
antibody or portion thereof of claim 30.
131. A method of treating a patient having need of a reduced level
of NKEF C protein, comprising administering to said patient the
antibody or portion thereof of claim 65.
132. A method of treating a patient having need of a reduced level
of NKEF C protein, comprising administering to said patient the
antibody or portion thereof of claim 93.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 09/407,891, filed Sep. 29, 1999, which is a divisional of U.S.
application Ser. No. 08/467,265, filed Jun. 6, 1995, now U.S. Pat.
No. 6,255,079, issued Jul. 3, 2001, each of which is incorporated
by reference in its entirety
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention has been putatively identified
as a natural killer cell enhancing factor C, sometimes hereinafter
referred to as "NKEF C." The invention also relates to inhibiting
the action of such polypeptides.
[0003] Natural killer (NK) cells are a subset of lymphocytes
capable of lysing a variety of tumor cells without prior activation
Lymphokine-activated killer (LAK) cells are mainly NK cells
activated by interleukin-2, and are capable of lysing wider ranges
of tumor cells with higher cytotoxic activity. NK cells are
proposed to function as natural surveillance to deter cancer
development in the body (Whiteside, T. and Herberman, R. B., Clin.
Immunol. Immunopathol., 58:1-23 (1989) and Trinchieri, G., Adv.
Immunol., 47:187-376 (1989)). LAK cells, in combination with IL-2,
have been used in experimental models and in clinical studies to
successfully treat some metastatic tumors (Rosenberg, S. A., et
al., N. Engl. J. Med., 316:889-897 (1987)). NK cells are also
important controlling viral infection and the regulation of
hematopoiesis (Trinchieri (1989), Kiessling, R., et al., Eur. J.
Immunol., 7:655-663 (1977), Kiessling, R. and Wigzell, H., Curr.
Top. Microbiol. Immunol., 92:107-123 (1981)). Given the important
roles of NK/LAK cells in maintaining the host well-being, it is not
surprising that their activities are stringently controlled in
vivo.
[0004] NK/LAK activity is influenced by various cellular and
humoral components in the blood (Golub, S. H., et al., R. E.
Schmidt (ed.): Natural Killer Cells: Biology and Clinical
Application, pp. 203-207, S. Karger, AG Basel (1990)), for
instance, the regulation by red blood cells (RBC), which enhance NK
cytotoxicity against different target cells (Shau, H., et al., E.
Lotzova (ed.): Natural Killer Cells: Their Definition, Functions,
Lineage and Regulation: pp. 235-349, S. Karger, AG Basel (1993))
and which also upregulate LAK development (Yannelli, J. R., et al.,
Cancer Res., 48:5696-5700 (1988)).
[0005] Oxdidative stress is an important yet incompletely
understood phenomenon, cells use reactive oxygen species (ROS) to
carry out essential functions. Under proper control, ROS initiates
conception, cell differentiation and proliferation. If not properly
controlled, ROS causes serious damage to cellular components which
may lead to apoptotic cell death. ROS are known to cause
large-scale cell death, senile changes, inflammation and tissue
injuries in the body.
[0006] Two NKEF genes (NKEF-A and B) from a K562 erythroleukemia
cell cDNA library have recently been cloned (Shau, H., et al.,
Immunogenetics, 40:129-134 (1994)). They have been identified as
members of a new class of highly conserved antioxidant proteins.
They share extensive homology with each other (88% identical at the
amino acid level, 71% identical in nucleotide sequence). It is not
clear whether the dimeric NKEF is a homo- or hetero-dimer of the A
or B peptides in vivo. NKEF A and NKEF B are differentially
expressed in different tissues. NKEF A and NKEF B have similar
antioxidant activity, but NKEF A has higher NK enhancing activity
than NKEFB. Transfecting NKEF DNA into different cells resulted in
cell-type-dependent enhanced cell proliferation or growth
inhibition.
[0007] This large family of proposed antioxidant genes are highly
conserved from bacteria to mammals while mammals have been found to
carry more than one NKEF-related gene, bacteria and yeast have been
found to carry only one copy (Sauri, H., et al.). Members of this
family have been described as thiol-specific antioxidants. These
genes (NKEF-A and B) encode recombinant proteins which possess
antioxidant function in the protection of protein and DNA from
oxidative damage. NKEF is a 44 kD protein isolated from red blood
cell cytosol that increases NK cell cytotoxicity to tumor target
cells (Shau, H., et al., Cell. Immunol., 147, 1-11 (1993)). NKEF is
a dimer protein composed of two approximately 22 kD monomers linked
by disulphide bonds.
[0008] Two of the other NKEF-related proteins are human
thiol-specific antioxidant protein (HPRP) isolated from a
hippocampus cDNA library, and the proliferation-associated gene
(PAG), found to be hyperexpressed in transformed cells. HPRP is 95%
identical to NKEF B by nucleotide sequences, and 93% identical by
amino acid sequence. Alignment with NKEF-related proteins in other
species suggested that NKEF B and HPRP are the same. PAG shares 98%
identity with NKEF A by nucleotide sequence, and 97% at the amino
acid level, and may be identical to NKEFA.
[0009] In mice, the two homologous genes are MSP23 and MER5. MER5
is 61% identical to NKEF A in amino acid sequence and 64% identical
to NKEFB. Even more striking is MSP23, which is 93% identical to
NKEF A and 76% identical to NKEFB. MSP23 is induced by oxidative
stress in mouse macrophage. MER5 is hyperexpressed in murine
erythroleukemic cells, and is necessary for differentiation in
those cells. NKEF and NKEF-related proteins show no sequence
homology to other known antioxidants, such as catalase, superoxide
dismutase, or glutathione peroxidase, nor do they exhibit the
enzymatic activity of those antioxidants.
[0010] This family of antioxidant genes has been found to
selectively suppress activation of NF- B. Nuclear factor B (NF- B)
is a transcriptional activator important for the expression of
human immunodeficiency virus type I (HIV-I) upon T-cell activating
stimuli (Englund, G. et al., Virology, 181:150-157 (1991), Nabel,
G., and Baltimore, D., Nature (London), 326:711-713 (1987)). Most
of the target genes of NF- B in T-cells and other types encode
proteins involved in immune, inflammatory and acute phase
responses.
[0011] The polypeptide of the present invention has been putatively
identified as a natural killer enhancing factor C due to its amino
acid sequence homology with human natural killer enhancing factor.
This identification has been made as a result of amino acid
sequence homology.
[0012] In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide, as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof. The polypeptide of the
present invention is of human origin.
[0013] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding a
polypeptide of the present invention, including mRNAs, DNAs, cDNAs,
genomic DNAs as well as analogs and biologically active and
diagnostically or therapeutically useful fragments thereof.
[0014] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
nucleic acid sequence encoding a polypeptide of the present
invention, under conditions promoting expression of said protein
and subsequent recovery of said protein.
[0015] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptide, or polynucleotide encoding such polypeptide for
therapeutic purposes, for example, to inhibit the growth of
leukemia cells, to treat viral infection, to augment the effects of
natural killer protein to treat neoplasias such as tumors and
cancers, to prevent inflammation, and to prevent damage from
superoxide radicals in the body, for example, tissue injury and
aging.
[0016] In accordance with yet a further aspect of the present
invention, there are also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to a nucleic acid sequence of the present invention.
[0017] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0018] In accordance with another aspect of the present invention,
there are provided NKEF C agonist compounds which mimic NKEF C and
bind to NKEF C receptors to elicit the biological functions of
wild-type NKEF C.
[0019] In accordance with yet another aspect of the present
invention, there are provided antagonists to such polypeptides,
which may be used to inhibit the action of such polypeptides, for
example, in the treatment of bone marrow transplant rejection.
[0020] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to the expression of the polypeptides and for
detecting mutations in the nucleic acid sequences encoding such
polypeptides.
[0021] In accordance with yet another aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, as
research reagents for in vitro purposes related to scientific
research, synthesis of DNA and manufacture of DNA vectors, for the
purpose of developing therapeutics and diagnostics for the
treatment of human disease.
[0022] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0024] FIG. 1 depicts the cDNA and corresponding deduced amino acid
sequence of the polypeptide of the present invention. The standard
one-letter abbreviations for amino acids are used. Sequencing was
performed using a 373 automated DNA sequencer (Applied Biosystems,
Inc.).
[0025] FIGS. 2A-D show the amino acid sequence homology between the
polypeptide of the present invention (top comparative line of each
row, from SEQ ID NO:2), human NKEF A (second comparative line of
each row, SEQ ID NO:14), NKEF B (third comparative line of each
row, SEQ ID NO:15), MER5 (fourth comparative line of each row, SEQ
ID NO: 16), and MSP23 (fifth comparative line of each row, SEQ ID
NO: 17).
[0026] FIG. 3 illustrates the growth inhibitory activity of NKEF C
against HL60 human promyelocytic leukemia cells.
[0027] FIG. 4 illustrates the growth inhibitory activity of NKEF C
against Jurkat human T-cell leukemia cells.
[0028] FIG. 5 illustrates the effect of NKEF C on VSV lytic
infection.
[0029] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIG. 1 (SEQ ID NO:2) or for the mature polypeptide encoded by
the cDNA of the clone deposited as ATCC Deposit No. 97157 on May
22, 1995 at the American Type Culture Collection, ATCC, 10801
University Boulevard, Manassas, Va. 20110-2209.
[0030] The polynucleotide of the present invention is highly
expressed in heart, liver, skeletal muscle, pancrease, testis, and
ovary, moderately expressed in placenta, lung, prostate, small
intestine and colon, and lowly expressed in brain, spleen, thymus
and peripheral blood leukocite. The polynucleotide of this
invention was discovered in a cDNA library derived from
cyclohexamide treated CEM cells. It is structurally related to a
family of highly conserved oxidative stress genes. It contains an
open reading frame encoding a protein of 271 amino acid residues of
which approximately the first 30 amino acids residues are the
putative leader sequence such that the mature protein comprises 241
amino acids. The protein exhibits the highest degree of homology to
NKEF B expressed from NK-sensitive erythroleukemic cell line K 562,
as shown in Sauri, H., et al. with 68.182% identity and 83.333%
similarity over the entire amino acid stretch. These proteins are
significantly homologous to several other proteins (thiol-specific
antioxidants) from a wide variety of organisms ranging from
prokaryotes to mammals, especially with regard to several
well-conserved motifs in the amino acid sequences.
[0031] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIG. 1 (SEQ ID NO:1) or that of the deposited clone or may
be a different coding sequence which coding sequence, as a result
of the redundancy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of FIG. 1 (SEQ ID NO: 1) or the
deposited cDNA.
[0032] The polynucleotide which encodes for the mature polypeptide
of FIG. 1 (SEQ ID NO:2) or for the mature polypeptide encoded by
the deposited cDNA may include, but is not limited to: only the
coding sequence for the mature polypeptide; the coding sequence for
the mature polypeptide and additional coding sequence such as a
leader or secretory sequence or a proprotein sequence; the coding
sequence for the mature polypeptide (and optionally additional
coding sequence) and non-coding sequence, such as introns or
non-coding sequence 5' and/or 3' of the coding sequence for the
mature polypeptide.
[0033] Thus, the term "polynucleofide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0034] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 (SEQ ID NO:2) or the polypeptide encoded by
the cDNA of the deposited clone. The variant of the polynucleotide
may be a naturally occurring allelic variant of the polynucleotide
or a non-naturally occurring variant of the polynucleotide.
[0035] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIG. 1 (SEQ ID
NO:2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIG. 1 (SEQ ID NO:2) or the polypeptide encoded by
the cDNA of the deposited clone. Such nucleotide variants include
deletion variants, substitution variants and addition or insertion
variants.
[0036] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIG. 1 (SEQ ID NO: 1) or of the coding
sequence of the deposited clone. As known in the art, an allelic
variant is an alternate form of a polynucleotide sequence which may
have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0037] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains.
[0038] Thus, for example, the polynucleotide of the present
invention may encode for a mature protein, or for a protein having
a prosequence or for a protein having both a prosequence and a
presequence (leader sequence).
[0039] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0040] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0041] Fragments of the full length NKEF C gene may be used as a
hybridization probe for a cDNA library to isolate the full length
gene and to isolate other genes which have a high sequence
similarity to the NKEF C gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a CDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete NKEF C gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
NKEF C gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0042] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIG. 1 (SEQ ID NO: 1) or
the deposited cDNA(s).
[0043] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, And which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO: 1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0044] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0045] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0046] The present invention further relates to an NKEF C
polypeptide which has the deduced amino acid sequence of FIG. 1
(SEQ ID NO:2) or which has the amino acid sequence encoded by the
deposited cDNA, as well as fragments, analogs and derivatives of
such polypeptide.
[0047] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIG. 1 (SEQ ID NO:2) or that
encoded by the deposited cDNA, means a polypeptide which retains
essentially the same biological function or activity as such
polypeptide. Thus, an analog includes a proprotein which can be
activated by cleavage of the proprotein portion to produce an
active mature polypeptide.
[0048] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0049] The fragment, derivative or analog of the polypeptide of
FIG. 1 (SEQ ID NO:2) or that encoded by the deposited cDNA may be
(i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptide or a proprotein sequence. Such fragments,
derivatives and analogs are deemed to be within the scope of those
skilled in the art from the teachings herein.
[0050] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0051] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0052] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 85% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0053] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0054] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0055] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0056] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
genes of the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0057] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0058] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0059] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or P.sub.L, the phage lambda PL promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0060] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0061] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0062] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0063] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTI, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0064] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0065] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0066] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0067] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0068] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples include the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0069] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), A-factor, acid phosphatase, or heat shock proteins,
among others. The heterologous structural sequence is assembled in
appropriate phase with translation initiation and termination
sequences, and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
[0070] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0071] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEMI (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0072] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0073] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0074] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well known to those skilled in the art.
[0075] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0076] The polypeptide can be recovered and purified from
recombinant cell cultures by methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0077] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0078] The NKEF C polypeptide of the present invention has been
shown to significantly augment NK cell-mediated cytotoxicity when
added at the initiation of cytotoxicity assays and NKEF,
accordingly, may be employed to regulate NK function.
[0079] The NKEF C polypeptide may be employed to enhance NK
activity and therefore deter cancer development in the body. The
NKEF C polypeptide may also be employed for immunoregulation of NK
activity and may be important for cells in coping with oxidative
insults which leads to tissue injury and aging, for example.
[0080] The NKEF C polypeptide of the present invention may also be
employed to prevent inflammation.
[0081] The NKEF C polypeptide of the present invention may also be
employed to prevent NK- B activity and prevent viral transcription
and therefore the proliferation of viral infections. Oxidative
stress induces NF- B activation in T-cells by the transactivator
TAX from human T-cell leukemia type 1 (HDLV-1) and therefore induce
viral transcription. Accordingly, Human immunodeficiency virus type
1 (HIV-1) and HDLV-1 may also be treated with the NKEF C
polypeptide of the present invention.
[0082] The polypeptide of the present invention may also be
employed to inhibit the cytopathic effect of vesicular stromatitis
virus and to inhibit the growth of leukemia cells.
[0083] The polynucleotides and polypeptides of the present
invention may also be employed as research reagents and materials
for discovery of treatments and diagnostics to human disease.
[0084] This invention provides a method for identification of the
receptor for the NKEF C polypeptide. The gene encoding the receptor
can be identified by numerous methods known to those of skill in
the art, for example, ligand panning and FACS sorting (Coligan, et
al., Current Protocols in Immun., 1(2), Chapter 5, (1991)).
Preferably, expression cloning is employed wherein polyadenylated
RNA is prepared from a cell responsive to the NKEF C polypeptide,
and a cDNA library created from this RNA is divided into pools and
used to transfect COS cells or other cells that are not responsive
to the NKEF C polypeptide. Transfected cells which are grown on
glass slides are exposed to labeled NKEF C polypeptide. The NKEF C
polypeptide can be labeled by a variety of means including
iodination or inclusion of a recognition site for a site-specific
protein kinase. Following fixation and incubation, the slides are
subjected to auto-radiographic analysis. Positive pools are
identified and sub-pools are prepared and re-transfected using an
iterative sub-pooling and re-screening process, eventually yielding
a single clone that encodes the putative receptor. As an
alternative approach for receptor identification, labeled ligand
can be photoaffinity linked with cell membrane or extract
preparations that express the receptor molecule. Cross-linked
material is resolved by PAGE and exposed to X-ray film. The labeled
complex containing the ligand-receptor can be excised, resolved
into peptide fragments, and subjected to protein microsequencing.
The amino acid sequence obtained from microsequencing would be used
to design a set of degenerate oligonucleotide probes to screen a
cDNA library to identify the gene encoding the putative
receptor.
[0085] This invention provides a method of screening compounds to
identify those which bind to and activate and those which bind to
and inhibit the receptor for the NKEF C polypeptides. As an
example, a mammalian cell or membrane preparation expressing the
NKEF C receptor is incubated with a labeled compound to be tested.
The compound may be labeled by a variety of means known in the art,
for example, by radioactivity. The ability of the compound to bind
to and activate the NKEF C receptor could then be measured by the
response of a known second messenger system. Such second messenger
systems include, but are not limited to, cAMP guanylate cyclase,
ion channels or phosphoinositide hydrolysis. For instance, an
effective agonist binds to the NKEF C receptor and elicits a second
messenger response while an effective antagonist binds to the
receptor but does not elicit a second messenger response thereby
effectively blocking the receptor.
[0086] Potential antagonists include an antibody, or in some cases,
an oligopeptide, which binds to the polypeptide. Alternatively, a
potential antagonist may be a closely related protein which binds
to the NKEF C receptor, however, they are inactive forms of the
polypeptide and thereby prevent the action of NKEF C since receptor
sites are occupied.
[0087] Another potential antagonist is an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix -see Lee
et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of NKEF C. The
antisense RNA oligonucleotide hybridizes to the mRNA in vivo and
blocks translation of the mRNA molecule into NKEF C polypeptide
(Antisense-Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of NKEF C.
[0088] Potential antagonists include a small molecule which binds
to and occupies the catalytic site of the polypeptide thereby
making the catalytic site inaccessible to substrate such that
normal biological activity is prevented. Examples of small
molecules include but are not limited to small peptides or
peptide-like molecules.
[0089] The antagonists may be employed to prevent bone marrow
transplant rejection. The antagonists may be employed in a
composition with a pharmaceutically acceptable carrier, e.g., as
hereinafter described.
[0090] The polypeptides of the present invention and agonist and
antagonist compounds may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the polypeptide or agonist or
antagonist compound, and a pharmaceutically acceptable carrier or
excipient. Such a carrier includes but is not limited to saline,
buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The formulation should suit the mode of
administration.
[0091] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides of the present
invention or agonist or antagonist compounds may be employed in
conjunction with other therapeutic compounds.
[0092] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 g/kg body weight and
in most cases they will be administered in an amount not in excess
of about 8 mg/Kg body weight per day. In most cases, the dosage is
from about 10 g/kg to about 1 mg/kg body weight daily, taking into
account the routes of administration, symptoms, etc.
[0093] The NKEF C polypeptides and agonists and antagonists which
are polypeptides may also be employed in accordance with the
present invention by expression of such polypeptides in vivo, which
is often referred to as "gene therapy."
[0094] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art and are apparent from the teachings herein. For example, cells
may be engineered by the use of a retroviral plasmid vector
containing RNA encoding a polypeptide of the present invention.
[0095] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
For example, a packaging cell is transduced with a retroviral
plasmid vector containing RNA encoding a polypeptide of the present
invention such that the packaging cell now produces infectious
viral particles containing the gene of interest. These producer
cells may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention.
[0096] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0097] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol ml, and -actin
promoters). Other viral promoters which may be employed include,
but are not limited to, adenovirus promoters, thymidine kinase (TK)
promoters, and B19 parvovirus promoters. The selection of a
suitable promoter will be apparent to those skilled in the art from
the teachings contained herein.
[0098] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or hetorologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the -actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0099] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317,-2,-AM, PA12, T19-14X, VT-19-17-H2,
CRE, CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in
Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is
incorporated herein by reference in its entirety. The vector may
transduce the packaging cells through any means known in the art.
Such means include, but are not limited to, electroporation, the
use of liposomes, and CaPO.sub.4 precipitation. In one alternative,
the retroviral plasmid vector may be encapsulated into a liposome,
or coupled to a lipid, and then administered to a host.
[0100] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0101] This invention is also related to the use of the NKEF C gene
as a diagnostic. Detection of a mutated form of NKEF C will allow a
diagnosis of a disease or a susceptibility to a disease which
results from underexpression of NKEF C for example, tumors and
viral infections.
[0102] Individuals carrying mutations in the human NKEF C gene may
be detected at the DNA level by a variety of techniques. Nucleic
acids for diagnosis may be obtained from a patient's cells,
including, but not limited to blood, urine, saliva, tissue biopsy
and autopsy material. The genomic DNA may be used directly for
detection or may be amplified enzymatically by using PCR (Saiki et
al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may
also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid encoding NKEF C can be used to
identify and analyze NKEF C mutations. For example, deletions and
insertions can be detected by a change in size of the amplified
product in comparison to the normal genotype. Point mutations can
be identified by hybridizing amplified DNA to radiolabeled NKEF C
RNA or alternatively, radiolabeled NKEF C antisense DNA sequences.
Perfectly matched sequences can be distinguished from mismatched
duplexes by RNase A digestion or by differences in melting
temperatures.
[0103] Sequence differences between the reference gene and genes
having mutations may be revealed by the direct DNA sequencing
method. In addition, cloned DNA segments may be employed as probes
to detect specific DNA segments. The sensitivity of this method is
greatly enhanced when combined with PCR. For example, a sequencing
primer is used with double-stranded PCR product or a
single-stranded template molecule generated by a modified PCR. The
sequence determination is performed by conventional procedures with
radiolabeled nucleotide or by automatic sequencing procedures with
fluorescent-tags.
[0104] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0105] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and SI protection or
the chemical cleavage method (e.g., Cotton et al., PNAS, USA,
85:4397-4401 (1985)).
[0106] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0107] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0108] The present invention also relates to a diagnostic assay for
detecting altered levels of NKEF C protein in various tissues since
over-expression compared to normal control tissue samples can
detect the presence of a tumor or viral infection. Assays used to
detect levels of NKEF C protein in a sample derived from a host are
well-known to those of skill in the art and include
radioimmunoassays, competitive-binding assays, Western Blot
analysis and preferably an ELISA assay. An ELISA assay initially
comprises preparing an antibody specific to the NKEF C antigen,
preferably a monoclonal antibody. In addition a reporter antibody
is prepared against the monoclonal antibody. To the reporter
antibody is attached a detectable reagent such as radioactivity,
fluorescence or in this example a horseradish peroxidase enzyme. A
sample is now removed from a host and incubated on a solid support,
e.g. a polystyrene dish, that binds the proteins in the sample. Any
free protein binding sites on the dish are then covered by
incubating with a non-specific protein such as bovine serum
albumin. Next, the monoclonal antibody is incubated in the dish
during which time the monoclonal antibodies attach to any NKEF C
proteins attached to the polystyrene dish. All unbound monoclonal
antibody is washed out with buffer. The reporter antibody linked to
horseradish peroxidase is now placed in the dish resulting in
binding of the reporter antibody to any monoclonal antibody bound
to NKEF. Unattached reporter antibody is then washed out.
Peroxidase substrates are then added to the dish and the amount of
color developed in a given time period is a measurement of the
amount of NKEF C protein present in a given volume of patient
sample when compared against a standard curve.
[0109] A competition assay may be employed wherein antibodies
specific to NKEF C are attached to a solid support and labeled NKEF
C and a sample derived from the host are passed over the solid
support and the amount of label detected attached to the solid
support can be correlated to a quantity of NKEF C in the
sample.
[0110] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0111] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region of the gene is used to rapidly select
primers that do not span more than one exon in the genomic DNA,
thus complicating the amplification process. These primers are then
used for PCR screening of somatic cell hybrids containing
individual human chromosomes. Only those hybrids containing the
human gene corresponding to the primer will yield an amplified
fragment.
[0112] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0113] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA having at least 50 or 60 bases. For a review of this
technique, see Verma et al., Human Chromosomes: a Manual of Basic
Techniques, Pergamon Press, New York (1988).
[0114] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0115] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0116] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0117] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0118] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0119] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0120] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0121] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0122] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0123] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0124] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37 C are ordinarily used, but may vary in
accordance with the supplier's instructions. After digestion the
reaction is electrophoresed directly on a polyacrylamide gel to
isolate the desired fragment.
[0125] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0126] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0127] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 Ag of approximately equimolar
amounts of the DNA fragments to be ligated.
[0128] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
[0129] Bacterial Expression and Purification of soluble NKEF
[0130] The DNA sequence encoding NKEF, ATCC No. 97157, is initially
amplified using PCR oligonucleotide primers corresponding to the 5'
sequences of the NKEF C protein and the vector sequences 3' to NKEF
C. Additional nucleotides corresponding to NKEF C were added to the
5' and 3' sequences respectively. The 5' oligonucleotide primers
used for the full length sequence with His-tag has the sequence 5'
GCGCGGATCCATGGAGGCGCTGCCCTGCT 3' (SEQ ID NO:3) contains a BamHI
restriction enzyme site followed by NKEF C coding sequence starting
from the presumed terminal amino acid of the processed protein and
without the His-tag 5' CGCCCATGGAGGCGCTGCCCCTG 3' (SEQ ID NO:4) and
contains a NcoI site. The 5' primer used for the NKEF C sequence
without the leader sequence and without the His-tag is 5'
CGCCCATGGCTGGAGCTGTGCAGGG 3' (SEQ ID NO:7) and has a NcoI site and
the 5' primer for the sequence without the leader sequence and with
the His-tag is GCGCGGATCCGCTGGAGCTGTGCAGG 3' (SEQ ID NO:5) and
contains a BamHI site. The 3' primers used were as follows: 5'
CGCGTCTAGATCAATTCAGTTTATCGAAATACTTCAGC 3' (SEQ ID NO:6) which
contains complementary sequences to an XbaI site followed by NKEF C
coding sequence; and 5' CGCGTCTAGATCAATTCAGTTTATCGAAATACTTCAGC 3'
(SEQ ID NO:[7] 6. The restriction enzyme sites correspond to the
restriction enzyme sites on the bacterial expression vector pQE-9
(Qiagen, Inc. Chatsworth, Calif., 91311). pQE-9 encodes antibiotic
resistance (Amp.sup.r), a bacterial origin of replication (ori), an
IPTG-regulatable promoter operator (P/O), a ribosome binding site
(RBS), a 6-His tag and restriction enzyme sites. pQE-9 was then
digested with BamHI and XbaI. The amplified sequences were ligated
into pQE-9 and were inserted in frame with the sequence encoding
for the histidine tag and the RBS. The ligation mixture was then
used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the
procedure described in Sambrook, J. et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4
contains multiple copies of the plasmid pREP4, which expresses the
lacd repressor and also confers kanamycin resistance (Kan.sup.r).
Transformants are identified by their ability to grow on LB plates
and ampicillin/kanamycin resistant colonies were selected. Plasmid
DNA was isolated and confirmed by restriction analysis. Clones
containing the desired constructs were grown overnight (O/N) in
liquid culture in LB media supplemented with both Amp (100 ug/ml)
and Kan (25 ug/ml). The O/N culture is used to inoculate a large
culture at a ratio of 1:100 to 1:250. The cells were grown to an
optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells were grown an extra 3 to 4 hours. Cells were then harvested
by centrifugation. The cell pellet was solubilized in the
chaotropic agent 6 Molar Guanidine HCl. After clarification,
solubilized NKEF C was purified from this solution by
chromatography on a Nickel-Chelate column under conditions that
allow for tight binding by proteins containing the 6-His tag
(Hochuli, E. et al., J. Chromatography 411:177-184 (1984)). NKEF C
was eluted from the column in 6 molar guanidine HCl pH 5.0 and for
the purpose of renaturation adjusted to 3 molar guanidine HCl, 100
mM sodium phosphate. After incubation in this solution for 12 hours
the protein was dialyzed to 10 mmolar sodium phosphate.
EXAMPLE 2
[0131] Cloning and Expression of NKEF C Using the Baculovirus
Expression System
[0132] The DNA sequence encoding the full length NKEF C protein,
ATCC No. 97157, was amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0133] For the pA2-gP vector the primers have the sequence 5'
CGCGGATCCCGAGGCGCTGCCCCTGC 3' (SEQ ID NO:8) and contains a BamHi
restriction enzyme site (in bold) followed by an efficient signal
for the initiation of translation in eukaryotic cells (Kozak, M.,
J. Mol. Biol., 196:947-950 (1987) and nucleotides of the NKEF C
gene; and the 3' primer has the sequence 5'
CGCGGATCCTCAATTCAGTTTATCGAAATAC 3' (SEQ ID NO:9) and contains the
cleavage site for the restriction endonuclease BamHi and
nucleotides complementary to the 3' non-translated sequence of the
NKEF C gene.
[0134] For the pA2 vector the sequences were as follows: 5'
CGCGGATCCGCCATCATGGAGGCGCTGCCCCTG 3' (SEQ ID NO:10) and contains a
BamHi site and the 3' primer is 5' CGCGGATCCTCAATTCAGTTTATCGAAATCA
3' (SEQ ID NO: 11) and also contains a BamHI site.
[0135] The amplified sequences were isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment was then digested with the
endonuclease BamHI and purified again on a 1% agarose gel. This
fragment is designated F2.
[0136] The vectors pA2-GP and pA2 (modifications of pVL941 vector,
discussed below) are used for the expression of the NKEF C protein
using the baculovirus expression system (for review see: Summers,
M. D. and Smith, G. E. 1987, A manual of methods for baculovirus
vectors and insect cell culture procedures, Texas Agricultural
Experimental Station Bulletin No. 1555). These expression vector
contains the strong polyhedrin promoter of the Autographa
californica nuclear polyhedrosis virus (AcMNPV) followed by the
recognition sites for the restriction endonuclease BamHI. The
polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of recombinant
virus the beta-galactosidase gene from E.coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of co-transfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pRG1 such as pAc373, pVL941 and pAcIMI (Luckow, V. A. and Summers,
M. D., Virology, 170:31-39).
[0137] The respective plasmid was digested with the restriction
enzyme BamHI and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA was then
isolated from a 1% agarose gel using the commercially available kit
("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA is
designated V2.
[0138] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E.coli HB101 cells were then transformed and
bacteria identified that contained the plasmid (pBacNKEF) with the
NKEF C gene using the enzyme BamHI. The sequence of the cloned
fragment was confirmed by DNA sequencing.
[0139] 5 .mu.g of the plasmid pBacNKEF C was co-transfected with
1.0 .mu.g of a commercially available linearized baculovirus
("BaculoGold baculovirus DNA", Pharmingen, San Diego, Calif.) using
the lipofection method (Felgner et al. Proc. Natl. Acad. Sci. USA,
84:7413-7417 (1987)).
[0140] 1 .mu.g of BaculoGold virus DNA and 5 .mu.g of the plasmid
pBacNKEF C were mixed in a sterile well of a microtiter plate
containing 50 .mu.l of serum free Grace's medium (Life Technologies
Inc., Gaithersburg, MD). Afterwards 10 .mu.l Lipofectin plus 90
.mu.l Grace's medium were added, mixed and incubated for 15 minutes
at room temperature. Then the transfection mixture was added
drop-wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm
tissue culture plate with 1 ml Grace's medium without serum. The
plate was rocked back and forth to mix the newly added solution.
The plate was then incubated for 5 hours at 27.degree. C. After 5
hours the transfection solution was removed from the plate and 1 ml
of Grace's insect medium supplemented with 10% fetal calf serum was
added. The plate was put back into an incubator and cultivation
continued at 27.degree. C. for four days.
[0141] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) was used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0142] Four days after the serial dilution, the virus was added to
the cells and blue stained plaques were picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses was
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus was used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0143] Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-NKEF C at a multiplicity of infection (MOI) of 2. Six
hours later the medium was removed and replaced with SF900 II
medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) were added. The cells were
further incubated for 16 hours before they were harvested by
centrifugation and the labelled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
[0144] Expression of Recombinant NKEF C in COS cells
[0145] The expression of plasmid, NKEF C HA is derived from a
vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E.coli replication
origin, 4) CMV promoter followed by a polylinker region, an SV40
intron and polyadenylation site. A DNA fragment encoding the entire
NKEF C precursor and a HA tag fused in frame to its 3' end was
cloned into the polylinker region of the vector, therefore, the
recombinant protein expression is directed under the CMV promoter.
The HA tag corresponds to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H. Niman,
R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell
37:767, (1984)). The infusion of HA tag to the target protein
allows easy detection of the recombinant protein with an antibody
that recognizes the HA epitope.
[0146] The plasmid construction strategy is described as
follows:
[0147] The DNA sequence encoding NKEF, ATCC No. 97157, was
constructed by PCR on the original EST cloned using two primers:
the 5' primer 5' GCGCGGATCCACCATGGAGGCGCTG 3' (SEQ ID NO:12)
contains a BamHI site followed by 12 nucleotides of NKEF C coding
sequence starting from the initiation codon; the 3' sequence 5'
GCGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATG- GGTAATTCAGTTTATC 3' (SEQ ID
NO:13) contains complementary sequences to an XbaI site,
translation stop codon, HA tag and the last 12 nucleotides of the
NKEF C coding sequence (not including the stop codon). Therefore,
the PCR product contains a BamHi site, NKEF C coding sequence
followed by HA tag fused in frame, a translation termination stop
codon next to the HA tag, and an XbaI site. The PCR amplified DNA
fragment and the vector, pcDNAI/Amp, were digested with BamHi and
XbaI restriction enzyme and ligated. The ligation mixture was
transformed into E. coli strain SURE (available from Stratagene
Cloning Systems, 11099 North Torrey Pines Road, La Jolla, Calif.
92037) the transformed culture was plated on ampicillin media
plates and resistant colonies were selected. Plasmid DNA was
isolated from transformants and examined by restriction analysis
for the presence of the correct fragment. For expression of the
recombinant NKEF, COS cells were transfected with the expression
vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T.
Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989)). The expression of the NKEF C HA protein
was detected by radio-labelling and immunoprecipitation method (E.
Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours
with .sup.35S-cysteine two days post transfection. Culture media
was then collected and cells were lysed with detergent (RIPA buffer
(150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris,
pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate
and culture media were precipitated with an HA specific monoclonal
antibody. Proteins precipitated were analyzed on 15% SDS-PAGE
gels.
EXAMPLE 4
[0148] Expression via Gene Therapy
[0149] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0150] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0151] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer contains an EcoRI site and
the 3' primer contains a HindIII site. Equal quantities of the
Moloney murine sarcoma virus linear backbone and the EcoRI and
HimdIII fragment are added together, in the presence of T4 DNA
ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0152] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0153] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0154] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
EXAMPLE 5
[0155] Growth Inhibitory Activity of NKEF C Against Human Leukemia
Cells
[0156] Two-fold serial dilution of purified NKEF C starting from
100 ng/ml were made in RPMI 1640 medium with 0.5% FBS. HL60 or
Jurkat cells were harvested from stationary cultures and washed
once with medium. Target cells were suspended at 1.times.10.sup.5
cells/ml in medium containing 0.5% FBS, then 0.1 ml aliquots were
dispensed into 96-well flat-bottomed microtiter plates containing
0.1 ml serially diluted test samples. Incubation was continued for
70 hr. The activity was quantified using MTS
[3(4,5-dimethyl-thiazoyl-2-yl) 5
(3-carboxymethoxyphenyl)-2-(4-sulfopheny- l)-2H-tetrazolium)]
Assay. MTS assay is performed by the addition of 20 .mu.l of MTS
and phenazine methosulfate (PMS) solution to 96 well plates (Stock
solution was prepared as described by Promega Technical Bulletin
No. 169). During a 3 hr. incubation, living cells convert the MTS
into the aqueous soluble formazan product. Wells with medium only
(no cells) were processed in exactly the same manner as the rest of
the wells and were used for blank controls. Wells with medium and
cells were used as baseline controls. The absorbence at 490 nm was
recorded using an ELISA reader and is proportional to the number of
viable cells in the wells. Cell growth promotion (positive
percentage) or inhibition (negative percentage), as a percentage
compared to baseline control wells (variation between three
baseline control well is less than 5%), calculated for each sample
concentration, by the formula: OD.sub.experimental/OD.sub.baseline
control X 100-100. All determinations were made in triplicate. Mean
and SD were calculated by Microsoft Excel.
EXAMPLE 6
[0157] Antiviral Activity of NKEF C against Vesicular Stomatitis
Virus (VSV)
[0158] The cytopathic effect reduction (CPER) assay is employed to
measure the protective effect of NKEF C on the infection and
cytopathic process of vesicular stomatitis virus (VSV) to normal
human dermal fibroblasts (NHDF) from foreskin (Clonetics). In this
experiment we performed serial dilution of NKEF C at a 1:2 ratio
and extended the dilution starting from 3 .mu.g/ml to 6 ng/ml final
concentration. The positive control employed in this experiment was
a recombinant human IFN protein (expressed in E. Coli), which had a
previously determined specific activity equal to 4.times.10.sup.6
units per 100 .mu.l. In addition, we maintained a negative
(untreated) mock control. Semi-purified (70%) protein isolated from
E. Coli expressing the NKEF C protein was employed in this study.
The NHDF cells were seeded at 2.times.10.sup.4/well and incubated
overnight to reach confluence. These cells were incubated for 12
hours in the presence of each diluted supernatant and then
subsequently challenged with VSV at an MOI equal to
1.times.10.sup.5 pfu/well. The plates were further incubated for 15
hours and then fixed and stained with crystal violet. The plates
were scored for CPE by estimating the percentage of cells surviving
on the -microtiter plate. The figure demonstrates a mean effective
NKEF C concentration equal to 100 ng/ml.
[0159] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
* * * * *