U.S. patent application number 09/885188 was filed with the patent office on 2002-08-01 for production of hydroxylated fatty acids in genetically modified plants.
Invention is credited to Broun, Pierre, Somerville, Chris, van de Loo, Frank.
Application Number | 20020104125 09/885188 |
Document ID | / |
Family ID | 27405733 |
Filed Date | 2002-08-01 |
United States Patent
Application |
20020104125 |
Kind Code |
A1 |
Somerville, Chris ; et
al. |
August 1, 2002 |
Production of hydroxylated fatty acids in genetically modified
plants
Abstract
This invention relates to plant fatty acyl hydroxylases. Methods
to use conserved amino acid or nucleotide sequences to obtain plant
fatty acyl hydroxylases are described. Also described is the use of
cDNA clones encoding a plant hydroxylase to produce a family of
hydroxylated fatty acids in transgenic plants.
Inventors: |
Somerville, Chris; (Portola
Valley, CA) ; Broun, Pierre; (Burlingame, CA)
; van de Loo, Frank; (Lexington, KY) |
Correspondence
Address: |
Pillsbury Winthrop LLP
Intellectual Property Group
1600 Tysons Boulevard
McLean
VA
22102
US
|
Family ID: |
27405733 |
Appl. No.: |
09/885188 |
Filed: |
June 21, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09885188 |
Jun 21, 2001 |
|
|
|
08530862 |
Sep 20, 1995 |
|
|
|
08530862 |
Sep 20, 1995 |
|
|
|
08320982 |
Oct 11, 1994 |
|
|
|
08320982 |
Oct 11, 1994 |
|
|
|
08314596 |
Sep 26, 1994 |
|
|
|
Current U.S.
Class: |
800/281 ;
435/189; 536/23.2 |
Current CPC
Class: |
C12N 15/8247 20130101;
C12N 9/0073 20130101; C12N 9/0071 20130101; C12N 15/8222
20130101 |
Class at
Publication: |
800/281 ;
536/23.2; 435/189 |
International
Class: |
A01H 005/00; C12N
009/02; C07H 021/04 |
Goverment Interests
[0002] The invention described herein was made in the course of
work under grant number DE-FG02-94ER20133 from the U.S. Department
of Energy and grant No. MCB9305269 from the National Science
Foundation. Therefore, the U.S. Government has certain rights under
this invention.
Claims
What is claimed is:
1. An isolated nucleic acid fragment comprising a nucleic acid
sequence encoding a fatty acid hydroxylase with an amino acid
identity of 60% or greater to the polypeptide encoded by SEQ ID NO:
4.
2. The isolated nucleic acid fragment of claim 1, wherein the amino
acid identity is 90% or greater to the polypeptide encoded by SEQ
ID NO: 4.
3. The isolated nucleic acid fragment of claim 1, wherein the amino
acid identity is 100% of the polypeptide encoded by SEQ ID NO:
4.
4. An isolated nucleic acid fragment having a nucleic acid identity
of 90% or greater of a nucleotide sequence of SEQ ID NO: 1, 2, or
3.
5. An isolated nucleic acid having a nucleotide sequence of SEQ ID
NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
6. The isolated nucleic acid fragment of claim 1, wherein said
fragment is isolated from an oil-producing plant species.
7. A chimeric gene capable of causing altered levels of ricinoleic
acid in a transformed plant cell, said chimeric gene comprising a
nucleic acid fragment of claim 1, said fragment operably linked to
suitable regulatory sequences.
8. A chimeric gene capable of causing altered levels of lesquerolic
acid in a transformed plant cell, said chimeric gene comprising a
nucleic acid fragment of claim 1, said fragment operably linked to
suitable regulatory sequences.
9. A chimeric gene capable of causing altered levels of fatty acids
in a transformed plant cell, said chimeric gene comprising a
nucleic acid fragment of claim 1, said fragment operably linked to
suitable regulatory sequences.
10. A chimeric gene capable of causing altered levels of fatty
acids in a transformed plant cell, said chimeric gene comprising a
nucleic acid fragment of claim 2, said fragment operably linked to
suitable regulatory sequences.
11. A chimeric gene capable of causing altered levels of fatty
acids in a transformed plant cell, said chimeric gene comprising a
nucleic acid fragment of claim 4, said fragment operably linked to
suitable regulatory sequences.
12. Plants containing the chimeric gene of any one of claims 7, 8,
9, 10 or 11.
13. Oil obtained from seeds of the plants of claim 12.
14. The isolated nucleic acid fragment of claim 1, wherein said
fragment is obtainable from Ricinus communes (L.) (Castor).
15. The isolated nucleic acid fragment of claim 1, wherein said
fragment is obtainable from Lesquerella fendleri.
16. A method of producing seed oil containing altered levels of
hydroxylated fatty acids comprising: (a) transforming a plant cell
of an oil-producing species with a chimeric gene containing an
isolated nucleic acid of claim 1; (b) growing fertile plants from
the transformed plant cells of step (a); (c) screening progeny
seeds from the fertile plants of step (b) for the desired levels of
hydroxylated fatty acids; and (d) processing the progeny seed of
step (c) to obtain seed oil containing altered levels of
unsaturated fatty acids.
17. The method of claim 16, wherein said crop plant is selected
from the group consisting of rapeseed, Crambe, Brassica juncea,
Canola, flax, sunflower, safflower, cotton, cuphea, soybean,
peanut, coconut, oil palm and corn.
18. A method of producing seed oil containing altered levels of
hydroxylated fatty acids comprising: (a) transforming a plant cell
of an oil-producing species with a chimeric gene containing the
nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3;
(b) growing fertile plants from the transformed plant cells of step
(a); (c) screening progeny seeds from the fertile plants of step
(b) for the desired levels of hydroxylated fatty acids; and (d)
processing the progeny seed of step (c) to obtain seed oil
containing altered levels of unsaturated fatty acids.
19. The method of claim 18, wherein said crop plant is selected
from the group consisting of rapeseed, Crambe, Brassica juncea,
Canola, flax, sunflower, safflower, cotton, cuphea, soybean,
peanut, coconut, oil palm and corn.
20. A triglyceride oil from a plant selected from the group
consisting of rapeseed, Crambe, Brassica juncea, Canola, flax,
sunflower, cotton, cuphea, soybean, peanut, coconut, oil palm and
corn, wherein the fatty acid composition of the oil has been
modified to contain hydroxylated fatty acids by a method comprising
growing a plant cell having integrated in its genome a DNA
construct containing a plant hydroxylase encoding sequence of claim
1, under conditions which will permit the transcription and
translation of said plant hydroxylase in the plant cells.
21. A method to isolate nucleic acid fragments encoding fatty acid
hydroxylases comprising: (a) comparing SEQ ID NO: 4 and other fatty
acid hydroxylase sequences and fatty acid desaturases; (b)
identifying conserved sequences of 4 or more amino acids obtained
in step (a); (c) designing degenerate oligomers based on the
conserved sequences identified in step (b); (d) using the
degenerate oligomers of step (c) to isolate sequences encoding
fatty acid hydroxylases by sequence dependent protocols; (e)
obtaining the deduced amino acid sequence of the encoded gene
product from the nucleotide sequence of the gene and; (f)
distinguishing hydroxylase genes from desaturase genes by analyzing
amino acid sequence differences between fatty acid desaturases and
fatty acid hydroxylases.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No. 08/320,982, filed Oct. 11, 1994, which itself
is a continuation-in-part of U.S. patent application Ser. No.
08/314,596, filed Sep. 26, 1994, now abandoned. The entire contents
of U.S. patent application Ser. No. 08/320,982 and U.S. patent
application Ser. No. 08/314,596 are hereby incorporated by
reference and relied upon.
TECHNICAL FIELD
[0003] The present invention concerns the identification of nucleic
acid sequences and constructs, and methods related thereto, and the
use of these sequences and constructs to produce genetically
modified plants for the purpose of altering the fatty acid
composition of plant oils, waxes and related compounds.
DEFINITIONS
[0004] The subject of this invention is a class of enzymes that
introduce a hydroxyl group into several different fatty acids
resulting in the production of several different kinds of
hydroxylated fatty acids. In particular, these enzymes catalyze
hydroxylation of oleic acid to 12-hydroxy oleic acid and icosenoic
acid to 14-hydroxy icosenoic acid. Other fatty acids such as
palmitoleic and erucic acids may also be substrates. Since it is
not possible to refer to the enzyme by reference to a unique
substrate or product, we refer to the enzyme throughout as kappa
hydroxylase to indicate that the enzyme introduces the hydroxyl
three carbons distal (i.e., away from the carboxyl carbon of the
acyl chain) from a double bond located near the center of the acyl
chain.
[0005] The following fatty acids are also the subject of this
invention: ricinoleic acid, 12-hydroxyoctadec-cis-9-enoic acid
(12OH-18:1.sup.cis.DELTA.9); lesquerolic acid,
14-hydroxy-cis-11-icosenoi- c acid (14OH-20:1.sup.cis.DELTA.11);
densipolic acid, 12-hydroxyoctadec-cis-9,15-dienoic acid
(12OH-18:2.sup.cis.DELTA.9,15); auricolic acid,
14-hydroxy-cis-11,17-icosadienoic acid
(14OH-20:2.sup.cis.DELTA.11,17); hydroxyerucic,
16-hydroxydocos-cis-13-en- oic acid (16OH-22:1.sup.cis.DELTA.13);
hydroxypalmitoleic, 12-hydroxyhexadec-cis-9-enoic
(12OH-16:1.sup.cis.DELTA.9); icosenoic acid
(20:1.sup.cis.DELTA.11). It will be noted that icosenoic acid is
spelled eicosenoic acid in some countries.
BACKGROUND
[0006] Extensive surveys of the fatty acid composition of seed oils
from different species of higher plants have resulted in the
identification of at least 33 structurally distinct
monohydroxylated plant fatty acids, and 12 different
polyhydroxylated fatty acids that are accumulated by one or more
plant species (reviewed by van de Loo et al. 1993). Ricinoleic
acid, the principal constituent of the seed oil from the castor
plant Ricinus communes (L.), is of commercial importance. We have
previously described the cloning of a gene from this species that
encodes a fatty acid hydroxylase, and the use of this gene to
produce ricinoleic acid in transgenic plants of other species (see
U.S. patent application Ser. No. 08/320,982, filed Oct. 11, 1994).
The scientific evidence supporting the claims in that patent
application were subsequently published (van de Loo et al., 1995).
The use of the castor hydroxylase gene to also produce other
hydroxylated fatty acids such as lesquerolic acid, densipolic acid,
hydroxypalmitoleic, hydroxyerucic and auricolic acid in transgenic
plants is the subject of this invention. In addition, the
identification of a gene encoding a homologous hydroxylase from
Lesquerella fendleri, and the use of this gene to produce these
hydroxylated fatty acids in transgenic plants is the subject of
this invention.
[0007] Castor is a minor oilseed crop. Approximately 50% of the
seed weight is oil (triacylglycerol) in which 85-90% of total fatty
acids are the hydroxylated fatty acid, ricinoleic acid. Oil pressed
or extracted from castor seeds has many industrial uses based upon
the properties endowed by the hydroxylated fatty acid. The most
important uses are production of paints and varnishes, nylon-type
synthetic polymers, resins, lubricants, and cosmetics (Atsmon
1989). In addition to oil, the castor seed contains the extremely
toxic protein ricin, allergenic proteins, and the alkaloid
ricinine. These constituents preclude the use of the untreated seed
meal (following oil extraction) as a livestock feed, normally an
important economic aspect of oilseed utilization. Furthermore, with
the variable nature of castor plants and a lack of investment in
breeding, castor has few favorable agronomic characteristics. For a
combination of these reasons, castor is no longer grown in the
United States and the development of an alternative domestic source
of hydroxylated fatty acids would be attractive. The production of
ricinoleic acid, the important constituent of castor oil, in an
established oilseed crop through genetic engineering would be a
particularly effective means of creating a domestic source.
[0008] Because there is no practical source of lesquerolic,
densipolic and auricolic acids from plants that are adapted to
modern agricultural practices, there is currently no large-scale
use of these fatty acids by industry. However, the fatty acids
would have uses similar to those of ricinoleic acid if they could
be produced in large quantities at comparable cost to other
plant-derived fatty acids (Smith 1985). Plant species, such as
certain species in the genus Lesquerella, that accumulate a high
proportion of these fatty acids, have not been domesticated and are
not currently considered a practical source of fatty acids
(Hirsinger, 1989). This invention represents a useful step toward
the eventual production of these and other hydroxylated fatty acids
in transgenic plants of agricultural importance.
[0009] The taxonomic relationships between plants having similar or
identical kinds of unusual fatty acids have been examined (van de
Loo et al., 1993). In some cases, particular fatty acids occur
mostly or solely in related taxa. In other cases there does not
appear to be a direct link between taxonomic relationships and the
occurrence of unusual fatty acids. In this respect, ricinoleic acid
has now been identified in 12 genera from 10 families (reviewed in
van de Loo et al., 1993). Thus, it appears that the ability to
synthesize hydroxylated fatty acids has evolved several times
independently during the radiation of the angiosperms. This
suggested to us that the enzymes which introduce hydroxyl groups
into fatty acids arose by minor modifications of a related enzyme.
Indeed, as shown herein, the sequence similarity between .DELTA.12
fatty acid desaturases and the kappa hydroxylase from castor is so
high that it is not possible to unambiguously determine whether a
particular enzyme is a desaturase or a hydroxylase on the basis of
evidence in the scientific literature. Similarly, a patent
application (PCT/US93/09987) that purports to teach the isolation
and use of .DELTA.12 fatty acid desaturases does not teach how to
distinguish a hydroxylase from a desaturase. In view of the
importance of being able to distinguish between these activities
for the purpose of genetic engineering of plant oils, the utility
of that application is limited to the several instances where
direct experimental evidence (e.g., altered fatty acid composition
in transgenic plants) was presented to support the assignment of
function. A method for distinguishing between fatty acid
desaturases and fatty acid hydroxylases on the basis of amino acid
sequence of the enzyme is also a subject of this invention.
[0010] A feature of hydroxylated or other unusual fatty acids is
that they are generally confined to seed triacylglycerols, being
largely excluded from the polar lipids by unknown mechanisms
(Battey and Ohlrogge 1989; Prasad et al., 1987). This is
particularly intriguing since diacylglycerol is a precursor of both
triacylglycerol and polar lipid. With castor microsomes, there is
some evidence that the pool of ricinoleoyl-containing polar lipid
is minimized by a preference of diacylglycerol acyltransferase for
ricinoleate-containing diacylglycerols (Bafor et al. 1991).
Analyses of vegetative tissues have generated few reports of
unusual fatty acids, other than those occurring in the cuticle. The
cuticle contains various hydroxylated fatty acids which are
interesterified to produce a high molecular weight polyester which
serves a structural role. A small number of other exceptions exist
in which unusual fatty acids are found in tissues other than the
seed.
[0011] The biosynthesis of ricinoleic acid from oleic acid in the
developing endosperm of castor (Ricinus communis) has been studied
by a variety of methods. Morris (1967) established in
double-labeling studies that hydroxylation occurs directly by
hydroxyl substitution rather than via an unsaturated-, keto- or
epoxy-intermediate. Hydroxylation using oleoyl-CoA as precursor can
be demonstrated in crude preparations or microsomes, but activity
in microsomes is unstable and variable, and isolation of the
microsomes involved a considerable, or sometimes complete loss of
activity (Galliard and Stumpf, 1966; Moreau and Stumpf, 1981).
Oleic acid can replace oleoyl-CoA as a precursor, but only in the
presence of CoA, Mg.sup.2+ and ATP (Galliard and Stumpf, 1966)
indicating that activation to the acyl-CoA is necessary. However,
no radioactivity could be detected in ricinoleoyl-CoA (Moreau and
Stumpf, 1981). These and more recent observations (Bafor et al.,
1991) have been interpreted as evidence that the substrate for the
castor oleate hydroxylase is oleic acid esterified to
phosphatidylcholine or another phospholipid.
[0012] The hydroxylase is sensitive to cyanide and azide, and
dialysis against metal chelators reduces activity, which could be
restored by addition of FeSO.sub.4, suggesting iron involvement in
enzyme activity (Galliard and Stumpf, 1966). Ricinoleic acid
synthesis requires molecular oxygen (Galliard and Stumpf, 1966;
Moreau and Stumpf 1981) and requires NAD(P)H to reduce cytochrome
b5 which is thought to be the intermediate electron donor for the
hydroxylase reaction (Smith et al., 1992). Carbon monoxide does not
inhibit hydroxylation, indicating that a cytochrome P450 is not
involved (Galliard and Stumpf, 1966; Moreau and Stumpf 1981). Data
from a study of the substrate specificity of the hydroxylase show
that all substrate parameters (i.e., chain length and double bond
position with respect to both ends) are important; deviations in
these parameters caused reduced activity relative to oleic acid
(Howling et al., 1972). The position at which the hydroxyl was
introduced, however, was determined by the position of the double
bond, always being three carbons distal. Thus, the castor acyl
hydroxylase enzyme can produce a family of different hydroxylated
fatty acids depending on the availability of substrates. Thus, as a
matter of convenience, we refer to the enzyme throughout as a kappa
hydroxylase (rather than an oleate hydroxylase) to indicate the
broad substrate specificity.
[0013] The castor kappa hydroxylase has many superficial
similarities to the microsomal fatty acyl desaturases (Browse and
Somerville, 1991). In particular, plants have a microsomal oleate
desaturase active at the .DELTA.12 position. The substrate of this
enzyme (Schmidt et al., 1993) and of the hydroxylase (Bafor et al.,
1991) appears to be a fatty acid esterified to the sn-2 position of
phosphatidylcholine. When oleate is the substrate, the modification
occurs at the same position (.DELTA.12) in the carbon chain, and
requires the same cofactors, namely electrons from NADH via
cytochrome b.sub.5 and molecular oxygen. Neither enzyme is
inhibited by carbon monoxide (Moreau and Stumpf, 1981), the
characteristic inhibitor of cytochrome P450 enzymes.
[0014] There do not appear to have been any published biochemical
studies of the properties of the hydroxylase enzyme(s) in
Lesquerella.
Conceptual Basis of the Invention
[0015] In U.S. patent application Ser. No. 08/320,982, we described
the use of a cDNA clone from castor for the production of
ricinoleic acid in transgenic plants. As noted above, biochemical
studies by others had suggested that the castor hydroxylase may not
have strict specificity for oleic acid but would also catalyze
hydroxylation of other fatty acids such as icosenoic acid
(20:1.sup.cis.DELTA.11) (Howling et al., 1972). Based on these
studies, our previous application Ser. No. 08/320,982 noted in
Example 2 that the expression of the castor hydroxylase in
transgenic plants of species such as Brassica napus and Arabidopsis
thaliana that accumulate fatty acids such as icosenoic acid
(20:1.sup.cis.DELTA.13) and erucic acid (13-docosenoic acid;
22:1.sup.cis.DELTA.13) would be expected to accumulate some of the
hydroxylated derivatives of these fatty acids due to the activity
of the hydroxylase on these fatty acids. We have now obtained
additional direct evidence for such a claim based on the production
of ricinoleic, lesquerolic, densipolic and auricolic fatty acids in
transgenic Arabidopsis plants and have included such evidence
herein as Example 1.
[0016] In example three of the previous application, we taught the
various methods by which the castor hydroxylase clone and sequences
derived thereof could be used to identify other hydroxylase clones
from plant species such as Lesquerella fendleri that are known to
accumulate hydroxylated fatty acids in seed oils. In this
continuation we have provided an example of the use of that aspect
of the invention for the isolation of a novel hydroxylase gene from
Lesquerella fendleri.
[0017] In view of the high degree of sequence similarity between
.DELTA.12 fatty acid desaturases and the castor hydroxylase (van de
Loo et al., 1995), the validity of claims for the use of desaturase
or hydroxylase genes or sequences derived therefrom for the
identification of genes of identical function from other species
must be viewed with skepticism. In this application, we teach a
method by which hydroxylase genes can be distinguished from
desaturases and describe methods by which .DELTA.12 desaturases can
be converted to hydroxylases by the modification of the gene
encoding the desaturases. A mechanistic basis for the similar
reaction mechanisms of desaturases and hydroxylases was presented
in the earlier patent application (No. 08/320,982). Briefly, the
available evidence suggests that fatty acid desaturases have a
similar reaction mechanism to the bacterial enzyme methane
monooxygenase which catalyses a reaction involving oxygen-atom
transfer (CH.sub.4.fwdarw.CH.sub.3OH) (van de Loo et al., 1993).
The cofactor in the hydroxylase component of methane monooxygenase
is termed a .mu.-oxo bridged diiron cluster (FeOFe). The two iron
atoms of the FeOFe cluster are liganded by protein-derived nitrogen
or oxygen atoms, and are tightly redox-coupled by the
covalently-bridging oxygen atom. The FeOFe cluster accepts two
electrons, reducing it to the diferrous state, before oxygen
binding. Upon oxygen binding, it is likely that heterolytic
cleavage also occurs, leading to a high valent oxoiron reactive
species that is stabilized by resonance rearrangements possible
within the tightly coupled FeOFe cluster. The stabilized
high-valent oxoiron state of methane monooxygenase is capable of
proton extraction from methane, followed by oxygen transfer, giving
methanol. The FeOFe cofactor has been shown to be directly relevant
to plant fatty acid modifications by the demonstration that castor
stearoyl-ACP desaturase contains this type of cofactor (Fox et al.,
1993).
[0018] On the basis of the foregoing considerations, we
hypothesized that the castor oleate hydroxylase is a structurally
modified fatty acyl desaturase, based upon three arguments. The
first argument involves the taxonomic distribution of plants
containing ricinoleic acid. Ricinoleic acid has been found in 12
genera of 10 families of higher plants (reviewed in van de Loo et
al., 1993). Thus, plants in which ricinoleic acid occurs are found
throughout the plant kingdom, yet close relatives of these plants
do not contain the unusual fatty acid. This pattern suggests that
the ability to synthesize ricinoleic acid has arisen (and been
lost) several times independently, and is therefore a quite recent
divergence. In other words, the ability to synthesize ricinoleic
acid has evolved rapidly, suggesting that a relatively minor
genetic change in the structure of the ancestral enzyme was
necessary to accomplish it.
[0019] The second argument is that many biochemical properties of
castor kappa hydroxylase are similar to those of the microsomal
desaturases, as discussed above (e.g., both preferentially act on
fatty acids esterified to the sn-2 position of phosphatidylcholine,
both use cytochrome b5 as an intermediate electron donor, both are
inhibited by cyanide, both require molecular oxygen as a substrate,
both are thought to be located in the endoplasmic reticulum).
[0020] The third argument stems from the discussion of oxygenase
cofactors above, in which it is suggested that the plant membrane
bound fatty acid desaturases may have a .mu.-oxo bridged diiron
cluster-type cofactor, and that such cofactors are capable of
catalyzing both fatty acid desaturations and hydroxylations,
depending upon the electronic and structural properties of the
protein active site.
[0021] Taking these three arguments together, it was hypothesized
that kappa hydroxylase of castor endosperm is homologous to the
microsomal oleate .DELTA.12 desaturase found in all plants. The
evidence supporting this hypothesis was disclosed in the previous
patent application (No. 08/320,982). A number of genes encoding
microsomal .DELTA.12 desaturases from various species have recently
been cloned (Okuley et al., 1994) and substantial information about
the structure of these enzymes is now known. Hence, in the
following invention we teach how to use structural information
about fatty acyl desaturases to isolate kappa hydroxylase genes of
this invention. This example teaches the method by which any
carbon-monoxide insensitive plant fatty acyl hydroxylase gene can
be identified by one skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIGS. 1A-D show the mass spectra of hydroxy fatty acids
standards (FIG. 1A, O-TMS-methylricinoleate; FIG. 1B, O-TMS-methyl
densipoleate; FIG. 11C, O-TMS-methyl-lesqueroleate; and FIG. 1D,
O-TMS-methylauricoleate).
[0023] FIG. 2 shows the fragmentation pattern of trimethylsilylated
methyl esters of hydroxy fatty acids.
[0024] FIG. 3A shows the gas chromatogram of fatty acids extracted
from seeds of wild type Arabidopsis plants. FIG. 3B shows the gas
chromatogram of fatty acids extracted from seeds of transgenic
Arabidopsis plants containing the fah12 hydroxylase gene. The
numbers indicate the following fatty acids: [1] 16:0; [2] 18:0; [3]
18:1cis.DELTA.9; [4] 18:2.sup.cis.DELTA.9,12; [5] 20:0; [6]
20:1.sup.cis.DELTA.11; [7]18:3.sup.cis.DELTA.9,12,15;
[8]22:1.sup.cis.DELTA.13; [9] 24:1.sup.cis.DELTA.13; [10]ricinoleic
acid; [11] densipolic acid; [12] lesquerolic acid; [13] auricolic
acid.
[0025] FIGS. 4A-D show the mass spectra of novel fatty acids found
in seeds of transgenic plants. FIG. 4A shows the mass spectrum of
peak 10 from FIG. 3B. FIG. 4B shows the mass spectrum of peak 11
from FIG. 3B. FIG. 4C shows the mass spectrum of peak 12 from FIG.
3B. FIG. 4D shows the mass spectrum of peak 13 from FIG. 3B.
[0026] FIG. 5 shows the nucleotide sequence of pLesq2 (SEQ ID NO:
1).
[0027] FIG. 6 shows the nucleotide sequence of pLesq3 (SEQ ID NO:
2).
[0028] FIG. 7 shows a Northern blot of total RNA from seeds of L.
fendleri probed with pLesq2 or pLesq3. S, indicates RNA is from
seeds; L, indicates RNA is from leaves.
[0029] FIGS. 8A-B show the nucleotide sequence of genomic clone
encoding pLesq-HYD (SEQ ID NO: 3), and the deduced amino acid
sequence of hydroxylase enzyme encoded by the gene (SEQ ID NO:
4).
[0030] FIGS. 9A-B show multiple sequence alignment of deduced amino
acid sequences for kappa hydroxylases and microsomal .DELTA.12
desaturases. Abbreviations are: Rcfah12, fah12 hydroxylase gene
from R. communis (van de Loo et al., 1995); Lffah12, kappa
hydroxylase gene from L. fendleri; Atfad2, fad2 desaturase from
Arabidopsis thaliana (Okuley et al., 1994); Gmfad2-1, fad2
desaturase from Glycine max (GenBank accession number L43920);
Gmfad2-2, fad2 desaturase from Glycine max (Genbank accession
number L43921); Zmfad2, fad2 desaturase from Zea mays
(PCT/US93/09987); Rcfad2, fragment of fad2 desaturase from R.
communis (PCT/US93/09987); Bnfad2, fad2 desaturase from Brassica
napus (PCT/US93/09987); LFFAH12.AMI, SEQ ID NO: 4; FAH12.AMI, SEQ
ID NO: 5; ATFAD2.AMI, SEQ ID NO: 6; BNFAD2.AMI, SEQ ID NO: 7;
GMFAD2-1.AMI, SEQ ID NO: 8; GMFAD2-2.AMI, SEQ ID NO: 9; ZMFAD2.AMI,
SEQ ID NO: 10; and RCFAD2.AMI, SEQ ID NO: 11.
[0031] FIG. 10 shows a Southern blot of genomic DNA from L.
fendleri probed with pLesq-HYD. E=EcoRI, H=HindIII, X=XbaI.
[0032] FIG. 11 shows a map of binary Ti plasmid pSLJ44024.
SUMMARY OF THE INVENTION
[0033] This invention relates to plant fatty acyl hydroxylases.
Methods to use conserved amino acid or nucleotide sequences to
obtain plant fatty acyl hydroxylases are described. Also described
is the use of cDNA clones encoding a plant hydroxylase to produce a
family of hydroxylated fatty acids in transgenic plants.
[0034] In a first embodiment, this invention is directed to
recombinant DNA constructs which can provide for the transcription
or transcription and translation (expression) of the plant kappa
hydroxylase sequence. In particular, constructs which are capable
of transcription or transcription and translation in plant host
cells are preferred. Such constructs may contain a variety of
regulatory regions including transcriptional initiation regions
obtained from genes preferentially expressed in plant seed tissue.
In a second aspect, this invention relates to the presence of such
constructs in host cells, especially plant host cells which have an
expressed plant kappa hydroxylase therein.
[0035] In yet another aspect, this invention relates to a method
for producing a plant kappa hydroxylase in a host cell or progeny
thereof via the expression of a construct in the cell. Cells
containing a plant kappa hydroxylase as a result of the production
of the plant kappa hydroxylase encoding sequence are also
contemplated herein.
[0036] In another embodiment, this invention relates to methods of
using a DNA sequence encoding a plant kappa hydroxylase for the
modification of the proportion of hydroxylated fatty acids produced
within a cell, especially plant cells. Plant cells having such a
modified hydroxylated fatty acid composition are also contemplated
herein.
[0037] In a further aspect of this invention, plant kappa
hydroxylase proteins and sequences which are related thereto,
including amino acid and nucleic acid sequences, are contemplated.
Plant kappa hydroxylase exemplified herein includes a Lesquerella
fendleri fatty acid hydroxylase. This exemplified fatty acid
hydroxylase may be used to obtain other plant fatty acid
hydroxylases of this invention.
[0038] In a further aspect of this invention, a nucleic acid
sequence which directs the seed specific expression of an
associated polypeptide coding sequence is described. The use of
this nucleic acid sequence or fragments derived thereof, to obtain
seed-specific expression in higher plants of any coding sequence is
contemplated herein.
DETAILED DESCRIPTION OF THE INVENTION
[0039] A genetically transformed plant of the present invention
which accumulates hydroxylated fatty acids can be obtained by
expressing the double-stranded DNA molecules described in this
application.
[0040] A plant fatty acid hydroxylase of this invention includes
any sequence of amino acids, such as a protein, polypeptide or
peptide fragment, or nucleic acid sequences encoding such
polypeptides, obtainable from a plant source which demonstrates the
ability to catalyze the production of ricinoleic, lesquerolic,
hydroxyerucic (16-hydroxydocos-cis-13-enoic acid) or
hydroxypalmitoleic (12-hydroxyhexadec-cis-9-enoic) from CoA, ACP or
lipid-linked monoenoic fatty acid substrates under plant enzyme
reactive conditions. By "enzyme reactive conditions" is meant that
any necessary conditions are available in an environment (i.e.,
such factors as temperature, pH, lack of inhibiting substances)
which will permit the enzyme to function.
[0041] Preferential activity of a plant fatty acid hydroxylase
toward a particular fatty acyl substrate is determined upon
comparison of hydroxylated fatty acid product amounts obtained per
different fatty acyl substrates. For example, by "oleate
preferring" is meant that the hydroxylase activity of the enzyme
preparation demonstrates a preference for oleate-containing
substrates over other substrates. Although the precise substrate of
the castor fatty acid hydroxylase is not known, it is thought to be
a monounsaturated fatty acid moiety which is esterified to a
phospholipid such as phosphatidylcholine. However, it is also
possible that monounsaturated fatty acids esterified to
phosphatidylethanolamine, phosphatidic acid or a neutral lipid such
as diacylglycerol or a Coenzyme-A thioester may also be substrates.
As noted above, significant activity has been observed in
radioactive labelling studies using fatty acyl substrates other
than oleate (Howling et al., 1972) indicating that the substrate
specificity is for a family of related fatty acyl compounds.
Because the castor hydroxylase introduces hydroxy groups three
carbons from a double bond, proximal to the methyl carbon of the
fatty acid we term the enzyme a kappa hydroxylase for convenience.
of particular interest, we envision that the castor kappa
hydroxylase may be used for production of 12-hydroxy-9-octadecenoic
acid (ricinoleate), 12-hydroxy-9-hexadecenoic acid,
14-hydroxy-11-eicosenoic acid, 16-hydroxy-13-docosanoic acid,
9-hydroxy-6-octadecenoic acid by expression in plants species which
produce the non-hydroxylated precursors. We also envision
production of additionally modified fatty acids such as
12-hydroxy-9,15-octadecadienoic acid that result from desaturation
of hydroxylated fatty acids (e.g., 12-hydroxy-9-octadecenoic acid
in this example).
[0042] We also envision that future advances in the genetic
engineering of plants will lead to production of substrate fatty
acids, such as icosenoic acid esters, and palmitoleic acid esters
in plants that do not normally accumulate such fatty acids. We
envision that the invention described herein may be used in
conjunction with such future improvements to produce hydroxylated
fatty acids of this invention in any plant species that is amenable
to directed genetic modification. Thus, the applicability of this
invention is not limited in our conception only to those species
that currently accumulate suitable substrates.
[0043] As noted above, a plant kappa hydroxylase of this invention
will display activity towards various fatty acyl substrates. During
biosynthesis of lipids in a plant cell, fatty acids are typically
covalently bound to acyl carrier protein (ACP), coenzyme A (CoA) or
various cellular lipids. Plant kappa hydroxylases which display
preferential activity toward lipid-linked acyl substrate are
especially preferred because they are likely to be closely
associated with normal pathway of storage lipid synthesis in
immature embryos. However, activity toward acyl-CoA substrates or
other synthetic substrates, for example, is also contemplated
herein.
[0044] Other plant kappa hydroxylases are obtainable from the
specific exemplified sequences provided herein. Furthermore, it
will be apparent that one can obtain natural and synthetic plant
kappa hydroxylases including modified amino acid sequences and
starting materials for synthetic-protein modeling from the
exemplified plant kappa hydroxylase and from plant kappa
hydroxylases which are obtained through the use of such exemplified
sequences. Modified amino acid sequences include sequences which
have been mutated, truncated, increased and the like, whether such
sequences were partially or wholly synthesized. Sequences which are
actually purified from plant preparations or are identical or
encode identical proteins thereto, regardless of the method used to
obtain the protein or sequence, are equally considered naturally
derived.
[0045] Thus, one skilled in the art will readily recognize that
antibody preparations, nucleic acid probes (DNA and RNA) and the
like may be prepared and used to screen and recover "homologous" or
"related" kappa hydroxylases from a variety of plant sources.
Typically, nucleic acid probes are labeled to allow detection,
preferably with radioactivity although enzymes or other methods may
also be used. For immunological screening methods, antibody
preparations either monoclonal or polyclonal are utilized.
Polyclonal antibodies, although less specific, typically are more
useful in gene isolation. For detection, the antibody is labeled
using radioactivity or any one of a variety of second
antibody/enzyme conjugate systems that are commercially
available.
[0046] Homologous sequences are found when there is an identity of
sequence and may be determined upon comparison of sequence
information, nucleic acid or amino acid, or through hybridization
reactions between a known kappa hydroxylase and a candidate source.
Conservative changes, such as Glu/Asp, Val/Ile, Ser/Thr, Arg/Lys
and Gln/Asn may also be considered in determining sequence
homology. Typically, a lengthy nucleic acid sequence may show as
little as 50-60% sequence identity, and more preferably at least
about 70% sequence identity, between the target sequence and the
given plant kappa hydroxylase of interest excluding any deletions
which may be present, and still be considered related. Amino acid
sequences are considered homologous by as little as 25% sequence
identity between the two complete mature proteins. (See generally,
Doolittle, R. F., OF URFS and ORFS, University Science Books, CA,
1986.)
[0047] A genomic or other appropriate library prepared from the
candidate plant source of interest may be probed with conserved
sequences from the plant kappa hydroxylase to identify homologously
related sequences. Use of an entire cDNA or other sequence may be
employed if shorter probe sequences are not identified. Positive
clones are then analyzed by restriction enzyme digestion and/or
sequencing. When a genomic library is used, one or more sequences
may be identified providing both the coding region, as well as the
transcriptional regulatory elements of the kappa hydroxylase gene
from such plant source. Probes can also be considerably shorter
than the entire sequence. Oligonucleotides may be used, for
example, but should be at least about 10, preferably at least about
15, more preferably at least 20 nucleotides in length. When shorter
length regions are used for comparison, a higher degree of sequence
identity is required than for longer sequences. Shorter probes are
often particularly useful for polymerase chain reactions (PCR),
especially when highly conserved sequences can be identified (See
Gould, et al., 1989 for examples of the use of PCR to isolate
homologous genes from taxonomically diverse species).
[0048] When longer nucleic acid fragments are employed (>100 bp)
as probes, especially when using complete or large cDNA sequences,
one would screen with low stringencies (for example, 40-50.degree.
C. below the melting temperature of the probe) in order to obtain
signal from the target sample with 20-50% deviation, i.e.,
homologous sequences. (Beltz, et al. 1983).
[0049] In a preferred embodiment, a plant kappa hydroxylase of this
invention will have at least 60% overall amino acid sequence
similarity with the exemplified plant kappa hydroxylase. In
particular, kappa hydroxylases which are obtainable from an amino
acid or nucleic acid sequence of a castor or lesquerella kappa
hydroxylase are especially preferred. The plant kappa hydroxylases
may have preferential activity toward longer or shorter chain fatty
acyl substrates. Plant fatty acyl hydroxylases having
oleate-12-hydroxylase activity and eicosenoate-14-hydroxylase
activity are both considered homologously related proteins because
of in vitro evidence (Howling et al., 1972), and evidence disclosed
herein, that the castor kappa hydroxylase will act on both
substrates. Hydroxylated fatty acids may be subject to further
enzymatic modification by other enzymes which are normally present
or are introduced by genetic engineering methods. For example,
14-hydroxy-11,17-eicosadienoic acid, which is present in some
Lesquerella species (Smith 1985), is thought to be produced by
desaturation of 14-hydroxy-11-eicosenoic acid.
[0050] Again, not only can gene clones and materials derived
thereof be used to identify homologous plant fatty acyl
hydroxylases, but the resulting sequences obtained therefrom may
also provide a further method to obtain plant fatty acyl
hydroxylases from other plant sources. In particular, PCR may be a
useful technique to obtain related plant fatty acyl hydroxylases
from sequence data provided herein. One skilled in the art will be
able to design oligonucleotide probes based upon sequence
comparisons or regions of typically highly conserved sequence. Of
special interest are polymerase chain reaction primers based on the
conserved regions of amino acid sequence between the castor kappa
hydroxylase and the L. fendleri hydroxylase (SED ID NO: 4). Details
relating to the design and methods for a PCR reaction using these
probes are described more fully in the examples.
[0051] It should also be noted that the fatty acyl hydroxylases of
a variety of sources can be used to investigate fatty acid
hydroxylation events in a wide variety of plant and in vivo
applications. Because all plants synthesize fatty acids via a
common metabolic pathway, the study and/or application of one plant
fatty acid hydroxylase to a heterologous plant host may be readily
achieved in a variety of species.
[0052] Once the nucleic acid sequence is obtained, the
transcription, or transcription and translation (expression), of
the plant fatty acyl hydroxylases in a host cell is desired to
produce a ready source of the enzyme and/or modify the composition
of fatty acids found therein in the form of free fatty acids,
esters (particularly esterified to glycerolipids or as components
of wax esters), estolides, or ethers. Other useful applications may
be found when the host cell is a plant host cell, in vitro and in
vivo.
[0053] For example, by increasing the amount of an kappa
hydroxylase available to the plant, an increased percentage of
ricinoleate or lesqueroleate (14-hydroxy-11-eicosenoic acid) may be
provided.
[0054] Kappa hydroxylase
[0055] By this invention, a mechanism for the biosynthesis of
ricinoleic acid in plants is demonstrated. Namely, that a specific
plant kappa hydroxylase having preferential activity toward fatty
acyl substrates is involved in the accumulation of hydroxylated
fatty acids in at least some plant species. The use of the terms
ricinoleate or ricinoleic acid (or lesqueroleate or lesquerolic
acid, densipoleate etc.) is intended to include the free acids, the
ACP and CoA esters, the salts of these acids, the glycerolipid
esters (particularly the triacylglycerol esters), the wax esters,
the estolides and the ether derivatives of these acids.
[0056] The determination that plant fatty acyl hydroxylases are
active in the in vivo production of hydroxylated fatty acids
suggests several possibilities for plant enzyme sources. And in
fact, hydroxylated fatty acids are found in some natural plant
species in abundance. For example, three hydroxy fatty acids
related to ricinoleate occur in major amounts in seed oils from
various Lesquerella species. Of particular interest, lesquerolic
acid is a 20 carbon homolog of ricinoleate with two additional
carbons at the carboxyl end of the chain (Smith 1985). Other
natural plant sources of hydroxylated fatty acids include but are
not limited to seeds of the Linum genus, seeds of Wrightia species,
Lycopodium species, Strophanthus species, Convolvulaces species,
Calendula species and many others (van de Loo et al., 1993).
[0057] Plants having significant presence of ricinoleate or
lesqueroleate or desaturated other or modified derivatives of these
fatty acids are preferred candidates to obtain naturally-derived
kappa hydroxylases. For example, Lesquerella densipila contains a
diunsaturated 18 carbon fatty acid with a hydroxyl group (van de
Loo et al., 1993) that is thought to be produced by an enzyme that
is closely related to the castor kappa hydroxylase, according to
the theory on which this invention is based. In addition, a
comparison between kappa hydroxylases and between plant fatty acyl
hydroxylases which introduce hydroxyl groups at positions other
than the 12-carbon of oleate or the 14-carbon of lesqueroleate or
on substrates other than oleic acid and icosenoic acid may yield
insights for protein modeling or other modifications to create
synthetic hydroxylases as discussed above. For example, on the
basis of information gained from structural comparisons of the
.DELTA.12 desaturases and the kappa hydroxylase, we envision making
genetic modifications in the structural genes for .DELTA.12
desaturases that convert these desaturases to kappa-hydroxylases.
We also envision making changes in .DELTA.15 hydroxylases that
convert these to hydroxylases with comparable substrate specificity
to the desaturases (e.g., conversion of 18:2.sup..DELTA.9,12 to
15OH-18:2.sup..DELTA.9,12. Since the difference between a
hydroxylase and a desaturases concerns the disposition of one
proton, we envision that by systematically changing the charged
groups in the region of the enzyme near the active site, we can
effect this change.
[0058] Especially of interest are fatty acyl hydroxylases which
demonstrate activity toward fatty acyl substrates other than
oleate, or which introduce the hydroxyl group at a location other
than the C12 carbon. As described above, other plant sources may
also provide sources for these enzymes through the use of protein
purification, nucleic acid probes, antibody preparations, protein
modeling, or sequence comparisons, for example, and of special
interest are the respective amino acid and nucleic acid sequences
corresponding to such plant fatty acyl hydroxylases. Also as
previously described, once a nucleic acid sequence is obtained for
the given plant hydroxylase, further plant sequences may be
compared and/or probed to obtain homologously related DNA sequences
thereto and so on.
[0059] Genetic Engineering Applications
[0060] As is well known in the art, once a cDNA clone encoding a
plant kappa hydroxylase is obtained, it may be used to obtain its
corresponding genomic nucleic acid sequences thereto.
[0061] The nucleic acid sequences which encode plant kappa
hydroxylases may be used in various constructs, for example, as
probes to obtain further sequences from the same or other species.
Alternatively, these sequences may be used in conjunction with
appropriate regulatory sequences to increase levels of the
respective hydroxylase of interest in a host cell for the
production of hydroxylated fatty acids or study of the enzyme in
vitro or in vivo or to decrease or increase levels of the
respective hydroxylase of interest for some applications when the
host cell is a plant entity, including plant cells, plant parts
(including but not limited to seeds, cuttings or tissues) and
plants.
[0062] A nucleic acid sequence encoding a plant kappa hydroxylase
of this invention may include genomic, cDNA or mRNA sequence. By
"encoding" is meant that the sequence corresponds to a particular
amino acid sequence either in a sense or anti-sense orientation. By
"recombinant" is meant that the sequence contains a genetically
engineered modification through manipulation via mutagenesis,
restriction enzymes, and the like. A cDNA sequence may or may not
encode pre-processing sequences, such as transit or signal peptide
sequences. Transit or signal peptide sequences facilitate the
delivery of the protein to a given organelle and are frequently
cleaved from the polypeptide upon entry into the organelle,
releasing the "mature" sequence. The use of the precursor DNA
sequence is preferred in plant cell expression cassettes.
[0063] Furthermore, as discussed above the complete genomic
sequence of the plant kappa hydroxylase may be obtained by the
screening of a genomic library with a probe, such as a cDNA probe,
and isolating those sequences which regulate expression in seed
tissue. In this manner, the transcription and translation
initiation regions, introns, and/or transcript termination regions
of the plant kappa hydroxylase may be obtained for use in a variety
of DNA constructs, with or without the kappa hydroxylase structural
gene. Thus, nucleic acid sequences corresponding to the plant kappa
hydroxylase of this invention may also provide signal sequences
useful to direct transport into an organelle 5' upstream non-coding
regulatory regions (promoters) having useful tissue and timing
profiles, 3' downstream non-coding regulatory region useful as
transcriptional and translational regulatory regions and may lend
insight into other features of the gene.
[0064] Once the desired plant kappa hydroxylase nucleic acid
sequence is obtained, it may be manipulated in a variety of ways.
Where the sequence involves non-coding flanking regions, the
flanking regions may be subjected to resection, mutagenesis, etc.
Thus, transitions, transversions, deletions, and insertions may be
performed on the naturally occurring sequence. In addition, all or
part of the sequence may be synthesized. In the structural gene,
one or more codons may be modified to provide for a modified amino
acid sequence, or one or more codon mutations may be introduced to
provide for a convenient restriction site or other purpose involved
with construction or expression. The structural gene may be further
modified by employing synthetic adapters, linkers to introduce one
or more convenient restriction sites, or the like.
[0065] The nucleic acid or amino acid sequences encoding a plant
kappa hydroxylase of this invention may be combined with other
non-native, or "heterologous", sequences in a variety of ways. By
"heterologous" sequences is meant any sequence which is not
naturally found joined to the plant kappa hydroxylase, including,
for example, combination of nucleic acid sequences from the same
plant which are not naturally found joined together.
[0066] The DNA sequence encoding a plant kappa hydroxylase of this
invention may be employed in conjunction with all or part of the
gene sequences normally associated with the kappa hydroxylase. In
its component parts, a DNA sequence encoding kappa hydroxylase is
combined in a DNA construct having, in the 5' to 3' direction of
transcription, a transcription initiation control region capable of
promoting transcription and translation in a host cell, the DNA
sequence encoding plant kappa hydroxylase and a transcription and
translation termination region.
[0067] Potential host cells include both prokaryotic and eukaryotic
cells. A host cell may be unicellular or found in a multicellular
differentiated or undifferentiated organism depending upon the
intended use. Cells of this invention may be distinguished by
having a plant kappa hydroxylase foreign to the wild-type cell
present therein, for example, by having a recombinant nucleic acid
construct encoding a plant kappa hydroxylase therein.
[0068] Depending upon the host, the regulatory regions will vary,
including regions from viral, plasmid or chromosomal genes, or the
like. For expression in prokaryotic or eukaryotic microorganisms,
particularly unicellular hosts, a wide variety of constitutive or
regulatable promoters may be employed. Expression in a
microorganism can provide a ready source of the plant enzyme. Among
transcriptional initiation regions which have been described are
regions from bacterial and yeast hosts, such as E. coli, B.
subtilis, Saccharomyces cerevisiae, including genes such as
beta-galactosidase, T7 polymerase, tryptophan E and the like.
[0069] For the most part, the constructs will involve regulatory
regions functional in plants which provide for modified production
of plant kappa hydroxylase with resulting modification of the fatty
acid composition. The open reading frame, coding for the plant
kappa hydroxylase or functional fragment thereof will be joined at
its 5' end to a transcription initiation regulatory region such as
the wild-type sequence naturally found 5' upstream to the kappa
hydroxylase structural gene. Numerous other transcription
initiation regions are available which provide for a wide variety
of constitutive or regulatable, e.g., inducible, transcription of
the structural gene functions. Among transcriptional initiation
regions used for plants are such regions associated with the
structural genes such as for nopaline and mannopine synthases, or
with napin, soybean .beta.-conglycinin, oleosin, 12S storage
protein, the cauliflower mosaic virus 35S promoters and the like.
The transcription/translation initiation regions corresponding to
such structural genes are found immediately 5' upstream to the
respective start codons. In embodiments wherein the expression of
the kappa hydroxylase protein is desired in a plant host, the use
of all or part of the complete plant kappa hydroxylase gene is
desired; namely all or part of the 5' upstream non-coding regions
(promoter) together with the structural gene sequence and 3'
downstream non-coding regions may be employed. If a different
promoter is desired, such as a promoter native to the plant host of
interest or a modified promoter, i.e., having transcription
initiation regions derived from one gene source and translation
initiation regions derived from a different gene source, including
the sequence encoding the plant kappa hydroxylase of interest, or
enhanced promoters, such as double 35S CaMV promoters, the
sequences may be joined together using standard techniques.
[0070] For such applications when 5' upstream non-coding regions
are obtained from other genes regulated during seed maturation,
those preferentially expressed in plant embryo tissue, such as
transcription initiation control regions from the B. napus napin
gene, or the Arabidopsis 12S storage protein, or soybean
.beta.-conglycinin (Bray et al., 1987), or the L. fendleri kappa
hydroxylase promoter described herein are desired. Transcription
initiation regions which are preferentially expressed in seed
tissue, i.e., which are undetectable in other plant parts, are
considered desirable for fatty acid modifications in order to
minimize any disruptive or adverse effects of the gene product.
[0071] Regulatory transcript termination regions may be provided in
DNA constructs of this invention as well. Transcript termination
regions may be provided by the DNA sequence encoding the plant
kappa hydroxylase or a convenient transcription termination region
derived from a different gene source, for example, the transcript
termination region which is naturally associated with the
transcript initiation region. Where the transcript termination
region is from a different gene source, it will contain at least
about 0.5 kb, preferably about 1-3 kb of sequence 3' to the
structural gene from which the termination region is derived.
[0072] Plant expression or transcription constructs having a plant
kappa hydroxylase as the DNA sequence of interest for increased or
decreased expression thereof may be employed with a wide variety of
plant life, particularly, plant life involved in the production of
vegetable oils for edible and industrial uses. Most especially
preferred are temperate oilseed crops. Plants of interest include,
but are not limited to rapeseed (Canola and high erucic acid
varieties), Crambe, Brassica juncea, Brassica nigra, meadowfoam,
flax, sunflower, safflower, cotton, Cuphea, soybean, peanut,
coconut and oil palms and corn. An important criterion in the
selection of suitable plants for the introduction on the kappa
hydroxylase is the presence in the host plant of a suitable
substrate for the hydroxylase. Thus, for example, production of
ricinoleic acid will be best accomplished in plants that normally
have high levels of oleic acid in seed lipids. Similarly,
production of lesquerolic acid will best be accomplished in plants
that have high levels of icosenoic acid in seed lipids.
[0073] Depending on the method for introducing the recombinant
constructs into the host cell, other DNA sequences may be required.
Importantly, this invention is applicable to dicotyledons and
monocotyledons species alike and will be readily applicable to new
and/or improved transformation and regulation techniques. The
method of transformation is not critical to the current invention;
various methods of plant transformation are currently available. As
newer methods are available to transform crops, they may be
directly applied hereunder. For example, many plant species
naturally susceptible to Agrobacterium infection may be
successfully transformed via tripartite or binary vector methods of
Agrobacterium mediated transformation. In addition, techniques of
microinjection, DNA particle bombardment, electroporation have been
developed which allow for the transformation of various monocot and
dicot plant species.
[0074] In developing the DNA construct, the various components of
the construct or fragments thereof will normally be inserted into a
convenient cloning vector which is capable of replication in a
bacterial host, e.g., E. Coli. Numerous vectors exist that have
been described in the literature. After each cloning, the plasmid
may be isolated and subjected to further manipulation, such as
restriction, insertion of new fragments, ligation, deletion,
insertion, resection, etc., so as to tailor the components of the
desired sequence. Once the construct has been completed, it may
then be transferred to an appropriate vector for further
manipulation in accordance with the manner of transformation of the
host cell.
[0075] Normally, included with the DNA construct will be a
structural gene having the necessary regulatory regions for
expression in a host and providing for selection of transformant
cells. The gene may provide for resistance to a cytotoxic agent,
e.g., antibiotic, heavy metal, toxin, etc., complementation
providing prototropy to an auxotrophic host, viral immunity or the
like. Depending upon the number of different host species the
expression construct or components thereof are introduced, one or
more markers may be employed, where different conditions for
selection are used for the different hosts.
[0076] It is noted that the degeneracy of the DNA code provides
that some codon substitutions are permissible of DNA sequences
without any corresponding modification of the amino acid
sequence.
[0077] As mentioned above, the manner in which the DNA construct is
introduced into the plant host is not critical to this invention.
Any method which provides for efficient transformation may be
employed. Various methods for plant cell transformation include the
use of Ti- or Ri-plasmids, microinjection, electroporation,
infiltration, imbibition, DNA particle bombardment, liposome
fusion, DNA bombardment or the like. In many instances, it will be
desirable to have the construct bordered on one or both sides of
the T-DNA, particularly having the left and right borders, more
particularly the right border. This is particularly useful when the
construct uses A. tumefaciens or A. rhizogenes as a mode for
transformation, although the T-DNA borders may find use with other
modes of transformation.
[0078] Where Agrobacterium is used for plant cell transformation, a
vector may be used which may be introduced into the Agrobacterium
host for homologous recombination with T-DNA or the Ti- or
Ri-plasmid present in the Agrobacterium host. The Ti- or Ri-plasmid
containing the T-DNA for recombination may be armed (capable of
causing gall formation) or disarmed (incapable of causing gall),
the latter being permissible, so long as the vir genes are present
in the transformed Agrobacterium host. The armed plasmid can give a
mixture of normal plant cells and gall.
[0079] In some instances where Agrobacterium is used as the vehicle
for transforming plant cells, the expression construct bordered by
the T-DNA border(s) will be inserted into a broad host spectrum
vector, there being broad host spectrum vectors described in the
literature. Commonly used is pRK2 or derivatives thereof. See, for
example, Ditta et al., (1980), which is incorporated herein by
reference. Included with the expression construct and the T-DNA
will be one or more markers, which allow for selection of
transformed Agrobacterium and transformed plant cells. A number of
markers have been developed for use with plant cells, such as
resistance to kanamycin, the aminoglycoside G418, hygromycin, or
the like. The particular marker employed is not essential to this
invention, one or another marker being preferred depending on the
particular host and the manner of construction.
[0080] For transformation of plant cells using Agrobacterium,
explants may be combined and incubated with the transformed
Agrobacterium for sufficient time for transformation, the bacteria
killed, and the plant cells cultured in an appropriate selective
medium. Once callus forms, shoot formation can be encouraged by
employing the appropriate plant hormones in accordance with known
methods and the shoots transferred to rooting medium for
regeneration of plants. The plants may then be grown to seed and
the seed used to establish repetitive generations and for isolation
of vegetable oils.
[0081] The invention now being generally described, it will be more
readily understood by reference to the following examples which are
included for purposes of illustration only and are not intended to
limit the present invention.
EXAMPLES
[0082] In the experimental disclosure which follows, all
temperatures are given in degrees centigrade (.degree.), weights
are given in grams (g), milligram (mg) or micrograms (.mu.g),
concentrations are given as molar (M), millimolar (mM) or
micromolar (.mu.M) and all volumes are given in liters (l),
microliters (.mu.l) or milliliters (ml), unless otherwise
indicated.
Example 1
Production of Novel Hydroxylated Fatty Acids in Arabidopsis
Thaliana
[0083] Overview
[0084] The kappa hydroxylase encoded by the previously described
fah12 gene from Castor (U.S. patent application Ser. No.
08/320,982) was used to produce ricinoleic acid, lesquerolic acid,
densipolic acid and auricolic acid in transgenic Arabidopsis
plants. This example reduces to practice the method taught in
Example 2 of the foregoing application.
[0085] Production of transgenic plants
[0086] A variety of methods have been developed to insert a DNA
sequence of interest into the genome of a plant host to obtain the
transcription and translation of the sequence to effect phenotypic
changes. The following methods represent only one of many
equivalent means of producing transgenic plants and causing
expression of the hydroxylase gene.
[0087] Arabidopsis plants were transformed, by
Agrobacterium-mediated transformation, with the kappa hydroxylase
encoded by the Castor fah12 gene on binary Ti plasmid pB6. This
plasmid was previously used to transform Nicotiana tabacum for the
production of ricinoleic acid (U.S. patent application Ser. No.
08/320,982).
[0088] Inoculums of Agrobacterium tumefaciens strain GV3101
containing binary Ti plasmid pB6 were plated on L-broth plates
containing 50 .mu.g/ml kanamycin and incubated for 2 days at
30.degree. C. Single colonies were used to inoculate large liquid
cultures (L-broth medium with 50 mg/l rifampicin, 110 mg/l
gentamycin and 200 mg/l kanamycin) to be used for the
transformation of Arabidopsis plants.
[0089] Arabidopsis plants were transformed by the in planta
transformation procedure essentially as described by Bechtold et
al., (1993). Cells of A. tumefaciens GV3101(pB6) were harvested
from liquid cultures by centrifugation, then resuspended in
infiltration medium at OD.sub.600=0.8 (Infiltration medium was
Murashige and Skoog macro and micronutrient medium (Sigma Chemical
Co., St. Louis, Mo.) containing 10 mg/l 6-benzylaminopurine and 5%
glucose). Batches of 12-15 plants were grown for 3 to 4 weeks in
natural light at a mean daily temperature of approximately
25.degree. C. in 3.5 inch pots containing soil. The intact plants
were immersed in the bacterial suspension then transferred to a
vacuum chamber and placed under 600 mm of vacuum produced by a
laboratory vacuum pump until tissues appeared uniformly
water-soaked (approximately 10 min). The plants were grown at
25.degree. C. under continuous light (100 .mu.mol m.sup.-2 s.sup.-1
irradiation in the 400 to 700 nm range) for four weeks. The seeds
obtained from all the plants in a pot were harvested as one batch.
The seeds were sterilized by sequential treatment for 2 min with
ethanol followed by 10 min in a mixture of household bleach
(Chlorox), water and Tween-80 (50%, 50%, 0.05%) then rinsed
thoroughly with sterile water. The seeds were plated at high
density (2000 to 4000 per plate) onto agar-solidified medium in 100
mm petri plates containing 1/2.times.Murashige and Skoog salts
medium enriched with B5 vitamins (Sigma Chemical Co., St. Louis,
Mo.) and containing kanamycin at 50 mg/l. After incubation for 48 h
at 4.degree. C. to stimulate germination, seedlings were grown for
a period of seven days until transformants were clearly
identifiable as healthy green seedlings against a background of
chlorotic kanamycin-sensitive seedlings. The transformants were
transferred to soil for two weeks before leaf tissue could be used
for DNA and lipid analysis. More than 20 transformants were
obtained.
[0090] DNA was extracted from young leaves from transformants to
verify the presence of an intact fah12 gene. The presence of the
transgene in a number of the putative transgenic lines was verified
by using the polymerase chain reaction to amplify the insert from
pB6. The primers used were HF2=GCTCTTTTGTGCGCTCATTC (SEQ ID NO: 12)
and HR1=CGGTACCAGAAAACGCCTTG (SEQ ID NO: 13), which were designed
to allow the amplification of a 700 bp fragment. Approximately 100
ng of genomic DNA was added to a solution containing 25 pmol of
each primer, 1.5 U Taq polymerase (Boehringer Manheim), 200 uM of
dNTPs, 50 mM KCl, 10 mM Tris.Cl (pH 9), 0.1% (v/v) Triton X-100,
1.5 mM MgCl.sub.2, 3% (v/v) formamide, to a final volume of 50
.mu.l. Amplifications conditions were: 4 min denaturation step at
94.degree. C., followed by 30 cycles of 92.degree. C. for 1 min,
55.degree. C. for 1 min, 72.degree. C. for 2 min. A final extension
step closed the program at 72.degree. C. for 5 min. Transformants
could be positively identified after visualization of a
characteristic 1 kb amplified fragment on an ethidium bromide
stained agarose gel. All transgenic lines tested gave a PCR product
of a size consistent with the expected genotype, confirming that
the lines were, indeed, transgenic. All further experiments were
done with three representative transgenic lines of the wild type
designated as 1-3, 4D, 7-4 and one transgenic line of the fad2
mutant line JB12. The transgenic JB12 line was included in order to
test whether the increased accumulation of oleic acid in this
mutant would have an effect on the amount of ricinoleic acid that
accumulated in the transgenic plants.
[0091] Analysis of transgenic plants
[0092] Leaves and seeds from fah12 transgenic Arabidopsis plants
were analyzed for the presence of hydroxylated fatty acids using
gas chromatography. Lipids were extracted from 100-200 mg leaf
tissue or 50 seeds. Fatty acid methyl esters (FAMES) were prepared
by placing tissue in 1.5 ml of 1.0M methanolic HCl (Supelco Co.) in
a 13.times.100 mm glass screw-cap tube capped with a teflon-lined
cap and heated to 80.degree. C. for 2 hours. Upon cooling, 1 ml
petroleum ether was added and the FAMES removed by aspirating off
the ether phase which was then dried under a nitrogen stream in a
glass tube. One hundred .mu.l of N,O-bis(Trimethylsilyl)
trifluoroacetamide (BSTFA; Pierce Chemical Co) and 200 .mu.l
acetonitrile was added to derivatize the hydroxyl groups. The
reaction was carried out at 70.degree. C. for 15 min. The products
were dried under nitrogen, redissolved in 100 .mu.l chloroform and
transferred to a gas chromatograph vial. Two .mu.l of each sample
were analyzed on a SP2340 fused silica capillary column (30 m, 0.75
mm ID, 0.20 mm film, Supelco), using a Hewlett-Packard 5890 II
series Gas Chromatograph. The samples were not split, the
temperature program was 195.degree. C. for 18 min, increased to
230.degree. C. at 25.degree. C./min, held at 230.degree. C. for 5
min then down to 195.degree. C. at 25.degree. C./min., and flame
ionization detectors were used.
[0093] The chromatographic elution time of methyl esters and O-TMS
derivatives of ricinoleic acid, lesquerolic acid and auricolic acid
was established by GC-MS of lipid samples from seeds of L. fendleri
and comparison to published chromatograms of fatty acids from this
species (Carlson et al., 1990). A O-TMS-methyl-ricinoleate standard
was prepared from ricinoleic acid obtained from Sigma Chemical Co
(St, Louis, Mo.). O-TMS-methyl-lesqueroleate and
O-TMS-methyl-auricoleate standards were prepared from
triacylglycerols purified from seeds of L. fendleri. The mass
spectrum of O-TMS-methyl-ricinoleate, O-TMS-methyl-densipoleate,
O-TMS-methyl-lesqueroleate, and O-TMS-methyl-auricoleate are shown
in FIGS. 1A-D, respectively. The structures of the characteristic
ions produced during mass spectrometry of these derivatives are
shown in FIG. 2.
[0094] Lipid extracted from transgenic tissues were analyzed by gas
chromatography and mass spectrometry for the presence of
hydroxylated fatty acids. As a matter of reference, the average
fatty acid composition of leaves in Arabidopsis wild type and fad2
mutant lines was reported by Miquel and Browse (1992). Gas
chromatograms of methylated and silylated fatty acids from seeds of
wild type and a fah12 transgenic wild type plant are shown in FIGS.
3A and 3B, respectively. The profiles are very similar except for
the presence of three small but distinct peaks at 14.3, 15.9 and
18.9 minutes. A very small peak at 20.15 min was also evident. The
elution time of the peaks at 14.3 and 18.9 min corresponded
precisely to that of comparably prepared ricinoleic and lesquerolic
standards, respectively. No significant differences were observed
in lipid extracts from leaves or roots of the wild type and the
fah12 transgenic wild type lines (Table 1). Thus, in spite of the
fact that the fah12 gene is expressed throughout the plant, we
observed effects on fatty acid composition only in seed tissue. A
similar observation was described previously for transgenic fah12
tobacco in patent application Ser. No. 08/320,982.
1TABLE 1 Fatty acid composition of lipids from transgenic and wild
type Arabidopsis. The values are the means obtained from analysis
of samples from three independent transgenic lines, or three
independent samples of wild type and fad2 lines. Fatty Seed Leaf
Root acid WT FAH12/WT FAH12/fad2 JB12 WT FAH12/WT WT FAH12/WT 16:0
8.5 8.2 6.4 6.1 16.5 17.5 23.9 24.9 16:3 0 0 0 0 10.1 9.8 0 0 18:0
3.2 3.5 2.9 3.5 1.3 1.2 2.0 1.9 18:1 15.4 26.3 43.4 47.8 2.4 3.4
5.4 3.2 18:2 27.0 21.4 10.2 7.2 15.1 14.0 32.2 29.4 18:3 22.0 16.6
-- 9.7 36.7 36.0 26.7 30.6 20:1 14.0 14.3 -- 13.1 0 0 0 0 22:1 2.0
1.0 0.5 0.5 0 0 0 0 24:1 2.5 1.7 2.0 1.6 0 0 0 0 18:1- 0 0.4 0.3 0
0 0 0 0 OH 18:2- 0 0.4 0.3 0 0 0 0 0 OH 20:1- 0 0.2 0.1 0 0 0 0 0
OH 20:2- 0 0.1 0.1 0 0 0 0 0 OH
[0095] In order to confirm that the observed new peaks in the
transgenic lines corresponded to derivatives of ricinoleic,
lesquerolic, densipolic and auricolic acids, mass spectrometry was
used. The fatty acid derivatives were resolved by gas
chromatography as described above except that a Hewlett-Packard
5971 series mass selective detector was used in place of the flame
ionization detector used in the previous experiment. The spectra of
the four new peaks in FIG. 3B (peak numbers 10, 11, 12 and 13) are
shown in FIGS. 4A-D, respectively. Comparison of the spectrum
obtained for the standards with that obtained for the four peaks
from the transgenic lines confirms the identity of the four new
peaks. On the basis of the three characteristic peaks at M/Z 187,
270 and 299, peak 10 is unambiguously identified as
O-TMS-methylricinoleate. On the basis of the three characteristic
peaks at M/Z 185, 270 and 299, peak 11 is unambiguously identified
as O-TMS-methyldensipoleate. On the basis of the three
characteristic peaks at M/Z 187, 298 and 327, peak 12 is
unambiguously identified as O-TMS-methyllesqueroleate. On the basis
of the three characteristic peaks at M/Z 185, 298 and 327, peak 13
is unambiguously identified as O-TMS-methylauricoleate. These
results unequivocally demonstrate the identity of the fah12 cDNA as
encoding a hydroxylase that hydroxylates both oleic acid to produce
ricinoleic acid and also hydroxylate icosenoic acid to produce
lesquerolic acid. These results also provide additional evidence
that the hydroxylase can be functionally expressed in a
heterologous plant species in such a way that the enzyme is
catalytically functional. These results also demonstrate that
expression of this hydroxylase gene leads to accumulation of
ricinoleic, lesquerolic, densipolic and auricolic acids in a plant
species that does not normally accumulate hydroxylated fatty acids
in extractable lipids.
[0096] The presence of lesquerolic acid in the transgenic plants
was anticipated in the previous patent application (No. 08/320,982)
based on the biochemical evidence suggesting broad substrate
specificity of the kappa hydroxylase. By contrast, the accumulation
of densipolic and auricolic acids was less predictable. Since
Arabidopsis does not normally contain significant quantities of the
non-hydroxylated precursors of these fatty acids which could serve
as substrates for the hydroxylase, it appears that one or more of
the three n-3 fatty acid desaturases known in Arabidopsis (e.g.,
fad3, fad7, fad8; reviewed in Gibson et al., 1995) are capable of
desaturating the hydroxylated compounds at the n-3 position. That
is, densipolic acid is produced by the action of an n-3 desaturase
on ricinoleic acid. Auricolic acid is produced by the action of an
n-3 desaturase on lesquerolic acid. Because it is located in the
endoplasmic reticulum, the fad3 desaturase is almost certainly
responsible. This can be tested in the future by producing
fah12-containing transgenic plants of the fad3-deficient mutant of
Arabidopsis (similar experiments can be done with fad7 and fad8).
It is also formally possible that the enzymes that normally
elongate 18:1.sup.cis.DELTA.9 to 20:1.sup.cis.DELTA.11 may elongate
12OH-18:1.sup.cis.DELTA.9 to 14OH-20:1.sup.cis.DELTA.11, and
12OH-18:2.sup.cis.DELTA.9,15 to 14OH-20:2.sup.cis.DELTA.11,17.
[0097] The amount of the various fatty acids in seed, leaf and root
lipids of the control and transgenic plants is presented in Table
1. Although the amount of hydroxylated fatty acids produced in this
example is less than desired for commercial production of
ricinoleate and other hydroxylated fatty acids from plants, we
envision numerous improvements of this invention that will increase
the level of accumulation of hydroxylated fatty acids in plants
that express the fah12 or related hydroxylase genes. Improvements
in the level and tissue specificity of expression of the
hydroxylase gene is envisioned. Methods to accomplish this by the
use of strong, seed-specific promoters such as the B. napus napin
promoter or the native promoters of the castor fah12 gene or the
corresponding hydroxylase gene from L. fendleri will be obvious to
one skilled in the art. Additional improvements are envisioned to
involve modification of the enzymes which cleave hydroxylated fatty
acids from phosphatidylcholine, reduction in the activities of
enzymes which degrade hydroxylated fatty acids and replacement of
acyltransferases which transfer hydroxylated fatty acids to the
sn-1, sn-2 and sn-3 positions of glycerolipids. Although genes for
these enzymes have not been described in the scientific literature,
their utility in improving the level of production of hydroxylated
fatty acids can be readily envisioned based on the results of
biochemical investigations of ricinoleate synthesis.
[0098] Although Arabidopsis is not an economically important plant
species, it is widely accepted by plant biologists as a model for
higher plants. Therefore, the inclusion of this example is intended
to demonstrate the general utility of the invention described here
and in the previous application (No. 08/320,982) to the
modification of oil composition in higher plants. One advantage of
studying the expression of this novel gene in Arabidopsis is the
existence in this system of a large body of knowledge on lipid
metabolism, as well as the availability of a collection of mutants
which can be used to provide useful information on the biochemistry
of fatty acid hydroxylation in plant species. Another advantage is
the ease of transposing any of the information obtained on
metabolism of ricinoleate in Arabidopsis to closely related species
such as the crop plants Brassica napus, Brassica juncea or Crambe
Abyssinica in order to mass produce ricinoleate, lesqueroleate or
other hydroxylated fatty acids for industrial use. The kappa
hydroxylase is useful for the production of ricinoleate or
lesqueroleate in any plant species that accumulates significant
levels of the precursors, oleic acid and icosenoic acid. Of
particular interest are genetically modified varieties that
accumulate high levels of oleic acid. Such varieties are currently
available for sunflower and Canola. Production of lesquerolic acid
and related hydroxy fatty acids can be achieved in species that
accumulate high levels of icosenoic acid or other long chain
monoenoic acids. Such plants may in the future be produced by
genetic engineering of plants that do not normally make such
precursors. Thus, we envision that the use of the kappa hydroxylase
is of general utility.
Example 2
Isolation of Lesquerella Kappa Hydroxylase Genomic Clone
[0099] Overview
[0100] Regions of nucleotide sequence that were conserved in both
the Castor kappa hydroxylase and the Arabidopsis fad2 .DELTA.12
fatty acid desaturase were used to design oligonucleotide primers.
These were used with genomic DNA from Lesquerella fendleri to
amplify fragments of several homologous genes. These amplified
fragments were then used as hybridization probes to identify full
length genomic clones from a genomic library of L. fendleri.
Hydroxylated fatty acids are specific to the seed tissue of
Lesquerella sp., and are not found to any appreciable extent in
vegetative tissues. One of the two genes identified by this method
was expressed in both leaves and developing seeds and is therefore
thought to correspond to the .DELTA.12 fatty acid desaturase. The
other gene was expressed at high levels in developing seeds but was
not expressed or was expressed at very low levels in leaves and is
the kappa hydroxylase from this species. The identity of this gene
will be established by introducing the gene into transgenic
Arabidopsis plants and showing that it causes the accumulation of
ricinoleic acid, lesquerolic acid, densipolic acid and auricolic
acid in seed lipids. The promoter of this gene is also of utility
because it is able to direct expression of a gene specifically in
developing seeds at a time when storage lipids are accumulating.
This promoter is, therefore, of great utility for many applications
in the genetic engineering of seeds, particularly in members of the
Brassicacea.
[0101] The various steps involved in this process are described in
detail below. Unless otherwise indicated, routine methods for
manipulating nucleic acids, bacteria and phage were as described by
Sambrook et al. (1989).
[0102] Isolation of a fraament of the Lesquerella kappa hydroxylase
gene
[0103] Oligonucleotide primers for the amplification of the L.
fendleri kappa hydroxylase were designed by choosing regions of
high deduced amino acid sequence homology between the Castor kappa
hydroxylase and the Arabidopsis .DELTA.12 desaturase (fad2).
Because most amino acids are encoded several different codons,
these oligonucleotides were designed to encode all possible codons
that could encode the corresponding amino acids. The sequence of
these mixed oligonucleotides was:
Oligo 1: TAYWSNCAYMGNMGNCAYCA (SEQ ID NO: 14)
Oligo 2: RTGRTGNGCNACRTGNGTRTC (SEQ ID NO: 15)
[0104] (Where: Y=C+T; W=A+T; S=G+C; N=A+G+C+T; M=A+C; R=A+G)
[0105] These oligonucleotides were used to amplify a fragment of
DNA from L. fendleri genomic DNA by the polymerase chain reaction
(PCR) using the following conditions: Approximately 100 ng of
genomic DNA was added to a solution containing 25 pmol of each
primer, 1.5 U Taq polymerase (Boehringer Manheim), 200 uM of dNTPs,
50 mM KCl, 10 mM Tris.Cl (pH 9), 0.1% (v/v) Triton X-100, 1.5 mM
MgCl.sub.2, 3% (v/v) formamide, to a final volume of 50 .mu.l.
Amplifications conditions were: 4 min denaturation step at
94.degree. C., followed by 30 cycles of 92.degree. C. for 1 min,
55.degree. C. for 1 min, 72.degree. C. for 2 min. A final extension
step closed the program at 72.degree. C. for 5 min.
[0106] PCR products of approximately 540 bp were observed following
electrophoretic separation of the products of the PCR reaction in
agarose gels. Two of these fragments were cloned into pBluescript
(Stratagene) to give rise to plasmids pLesq2 and pLesq3. The
sequence of the inserts in these two plasmids was determined by the
chain termination method. The sequence of the insert in pLesq2 is
presented as FIG. 5 (SEQ ID NO: 1) and the sequence of the insert
in pLesq3 is presented as FIG. 6 (SEQ ID NO: 2). The high degree of
sequence identity between the two clones indicated that they were
both potential candidates to be either a .DELTA.12 desaturase or a
gama hydroxylase.
[0107] Northern analysis
[0108] In L. fendleri, hydroxylated fatty acids are found in large
amounts in seed oils but are not found in appreciable amounts in
leaves. Therefore, an important criterion in discriminating between
a fatty acyl desaturase and kappa hydroxylase is that the kappa
hydroxylase gene is expected to be expressed more highly in tissues
which have high level of hydroxylated fatty acids than in other
tissues whereas all plant tissues should contain mRNA for an
.omega.6 fatty acyl desaturase since diunsaturated fatty acids are
found in the lipids of all tissues in most or all plants.
Therefore, it was of great interest to determine whether the gene
corresponding to pLesq2 was also expressed only in seeds, or is
also expressed in other tissues. This question was addressed by
testing for hybridization of pLesq2 to RNA purified from developing
seeds and from leaves.
[0109] Total RNA was purified from developing seeds and young
leaves of L. fendleri using an Rneasy RNA extraction kit (Qiagen),
according to the manufacturer's instructions. RNA concentrations
were quantified by UV spectrophotometry at .lambda.=260 and 280 nm.
In order to ensure even loading of the gel to be used for Northern
blotting, RNA concentrations were further adjusted after recording
fluorescence under UV light of RNA samples stained with ethidium
bromide and run on a test denaturing gel.
[0110] Total RNA prepared as described above from leaves and
developing seeds was electrophoresed through an agarose gel
containing formaldehyde (Iba et al., 1993). An equal quantity (10
.mu.g) of RNA was loaded in both lanes, and RNA standards
(0.16-1.77 kb ladder, Gibco-BRL) were loaded in a third lane.
Following electrophoresis, RNA was transferred from the gel to a
nylon membrane (Hybond N+, Amersham) and fixed to the filter by
exposure to UV light. A .sup.32P-labelled probe was prepared from
insert DNA of clone pLesq2 by random priming and hybridized to the
membrane overnight at 52.degree. C., after it had been
prehybridized for 2 h. The prehybridization solution contained
5.times.SSC, 10.times. Denhardt's solution, 0.1% SDS, 0.1M
KPO.sub.4 pH 6.8, 100 .mu.g/ml salmon sperm DNA. The hybridization
solution had the same basic composition, but no SDS, and it
contained 10% dextran sulfate and 30% formamide. The blot was
washed once in 2.times.SSC, 0.5% SDS at 65.degree. C. then in
1.times.SSC at the same temperature.
[0111] Brief (30 min) exposure of the blot to X-ray film revealed
that the probe pLesq2 hybridized to a single band only in the seed
RNA lane (FIG. 7). The blot was re-probed with the insert from
pLesq3 gene, which gave bands of similar intensity in the seed and
leaf lanes (FIG. 7).
[0112] These results show that the gene corresponding to the clone
pLesq2 is highly and specifically expressed in seed of L. fendleri.
In conjunction with knowledge of the nucleotide and deduced amino
acid sequence, strong seed-specific expression of the gene
corresponding to the insert in pLesq2 is a convincing indicator of
the role of the enzyme in synthesis of hydroxylated fatty acids in
the seed oil.
[0113] Characterization of a genomic clone of the gamma
hydroxylase
[0114] Genomic DNA was prepared from young leaves of L. fendleri as
described by Murray and Thompson (1980). A Sau3AI-partial digest
genomic library constructed in the vector .lambda.DashII
(Stratagene, 11011 North Torrey Pines Road, La Jolla, Calif. 92037)
was prepared by partially digesting 500 .mu.g of DNA,
size-selecting the DNA on a sucrose gradient (Sambrook et al.,
1989), and ligating the DNA (12 kb average size) to the
BamHI-digested arms of .lambda.DashII. The entire ligation was
packaged according to the manufacturer's conditions and plated on
E. coli strain XL1-Blue MRA-P2 (Stratagene). This yielded
5.times.10.sup.5 primary recombinant clones. The library was then
amplified according to the manufacturer's conditions. A fraction of
the genomic library was plated on E. coli XL1-Blue and resulting
plaques (150,000) were lifted to charged nylon membranes (Hybond
N+, Amersham), according to the manufacturer's conditions. DNA was
crosslinked to the filters under UV in a Stratalinker
(Stratagene).
[0115] Several clones carrying genomic sequences corresponding to
the L. fendleri hydroxylase were isolated by probing the membranes
with the insert from pLesq2 that was PCR-amplified with internal
primers and labelled with .sup.32P by random priming. The filters
were prehybridized for 2 hours at 65.degree. C. in 7% SDS, 1 mM
EDTA, 0.25M Na.sub.2HPO.sub.4 (pH 7.2), 1% BSA and hybridized to
the probe for 16 hours in the same solution. The filters were
sequentially washed at 65.degree. C. in solutions containing
2.times.SSC, 1.times.SSC, 0.5.times.SSC in addition to 0.1% SDS. A
2.6 kb Xba I fragment containing the complete coding sequence for
the gamma-hydroxylase and approximately 1 kb of the 5' upstream
region was subcloned into the corresponding site of pBluescript KS
to produce plasmid pLesq-Hyd and the sequence determined completely
using an automatic sequencer by the dideoxy chain termination
method. Sequence data was analyzed using the program DNASIS
(Hitachi company).
[0116] The sequence of the insert in clone pLesq-Hyd is shown in
FIGS. 8A-B. The sequence entails 1855 bp of contiguous DNA sequence
(SEQ ID NO: 3). The clone encodes a 401 bp 5' untranslated region
(i.e., nucleotides preceding the first ATG codon), an 1152 bp open
reading frame, and a 302 bp 3' untranslated region. The open
reading frame encodes a 384 amino acid protein with a predicted
molecular weight of 44,370 (SEQ ID NO: 4). The amino terminus lacks
features of a typical signal peptide (von Heijne, 1985).
[0117] The exact translation-initiation methionine has not been
experimentally determined, but on the basis of deduced amino acid
sequence homology to the Castor kappa hydroxylase (noted below) is
thought to be the methionine encoded by the first ATG codon at
nucleotide 402.
[0118] Comparison of the pLesq-Hyd deduced amino acid sequence with
sequences of membrane-bound desaturases and the castor hydroxylase
(FIGS. 9A-B) indicates that pLesq-Hyd is homologous to these genes.
This figure shows an alignment of the L. fendleri hydroxylase (SEQ
ID NO: 4) with the castor hydroxylase (van de Loo et al. 1995), the
Arabidopsis fad2 cDNA which encodes an endoplasmic
reticulum-localized .DELTA.12 desaturase (called fad2) (okuley et
al., 1994), two soybean fad2 desaturase clones, a Brassica napus
fad2 clone, a Zea mays fad2 clone and partial sequence of a R.
communis fad2 clone. The high degree of sequence homology indicates
that the gene products are of similar function. For instance, the
overall homology between the Lesquerella hydroxylase and the
Arabidopsis fad2 desaturase was 92.2% similarity and 84.8% identity
and the two sequences differed in length by only one amino
acid.
[0119] Southern hybridization
[0120] Southern analysis was used to examine the copy number of the
genes in the L. fendleri genome corresponding to the clone
pLesq-Hyd. Genomic DNA (5 .mu.g) was digested with EcoR I, Hind III
and Xba I and separated on a 0.9% agarose gel. DNA was
alkali-blotted to a charged nylon membrane (Hybond N+, Amersham),
according to the manufacturer's protocol. The blot was
prehybridized for 2 hours at 65.degree. C. in 7% SDS, 1 mM EDTA,
0.25M Na.sub.2HO.sub.4 (pH 7.2), 1% BSA and hybridized to the probe
for 16 hours in the same solution with pLesq-Hyd insert
PCR-amplified with internal primers and labelled with .sup.32P by
random priming. The filters were sequentially washed at 65.degree.
C. in solutions containing 2.times.SSC, 1.times.SSC, 0.5.times.SSC
in addition to 0.1% SDS, then exposed to X-ray film.
[0121] The probe hybridized with a single band in each digest of L.
fendleri DNA (FIG. 10), indicating that the gene from which
pLesq-Hyd was transcribed is present in a single copy in the L.
fendleri genome.
[0122] Expression of pLesq-Hyd in Transgenic Plants
[0123] There are a wide variety of plant promoter sequences which
may be used to cause tissue-specific expression of cloned genes in
transgenic plants. For instance, the napin promoter and the acyl
carrier protein promoters have previously been used in the
modification of seed oil composition by expression of an antisense
form of a desaturase (Knutson et al. 1992). Similarly, the promoter
for the .beta.-subunit of soybean .beta.-conglycinin has been shown
to be highly active and to result in tissue-specific expression in
transgenic plants of species other than soybean (Bray et al.,
1987). Thus, although we describe the use of the L. fendleri kappa
hydroxylase promoter in the examples described here, other
promoters which lead to seed-specific expression may also be
employed for the production of modified seed oil composition. Such
modifications of the invention described here will be obvious to
one skilled in the art.
[0124] Constructs for expression of L. tendieri kappa hydroxylase
in plant cells are prepared as follows: A 13 kb SalI fragment
containing the pLesq-Hyg gene was ligated into the XhoI site of
binary Ti plasmid vector pSLJ44026 (Jones et al., 1992) (FIG. 11)
to produce plasmid pTi-Hyd and transformed into Agrobacterium
tumefaciens strains GV3101 by electroporation. Strain GV3101 (Koncz
and Schell, 1986) contains a disarmed Ti plasmid. Cells for
electroporation were prepared as follows. GV3101 was grown in LB
medium with reduced NaCl (5 g/l). A 250 ml culture was grown to
OD.sub.600=0.6, then centrifuged at 4000 rpm (Sorvall GS-A rotor)
for 15 min. The supernatant was aspirated immediately from the
loose pellet, which was gently resuspended in 500 ml ice-cold
water. The cells were centrifuged as before, resuspended in 30 ml
ice-cold water, transferred to a 30 ml tube and centrifuged at 5000
rpm (Sorvall SS-34 rotor) for 5 min. This was repeated three times,
resuspending the cells consecutively in 30 ml ice-cold water, 30 ml
ice-cold 10% glycerol, and finally in 0.75 ml ice-cold 10%
glycerol. These cells were aliquoted, frozen in liquid nitrogen,
and stored at -80C. Electroporations employed a Biorad Gene pulsar
instrument using cold 2 mm-gap cuvettes containing 40 .mu.l cells
and 1 .mu.l of DNA in water, at a voltage of 2.5 KV, and 200 Ohms
resistance. The electroporated cells were diluted with 1 ml SOC
medium (Sambrook et al., 1989, page A2) and incubated at 28.degree.
C. for 2-4 h before plating on medium containing kanamycin (50
mg/l).
[0125] Arabidopsis thaliana can be transformed with the
Agrobacterium cells containing pTi-Hyd as described in Example 1
above. Similarly, the presence of hydroxylated fatty acids in the
transgeneic Arabidopsis plants can be demonstrated by the methods
described in Example 1 above.
[0126] Constitutive expression of the L. fendleri hydroxylase in
transgenic plants
[0127] A 1.5 kb EcoR I fragment from pLesq-Hyg comprising the
entire coding region of the hydroxylase was gel purified, then
cloned into the corresponding site of pBluescript KS (Stratagene).
Plasmid DNA from a number of recombinant clones was then restricted
with Pst I, which should cut only once in the insert and once in
the vector polylinker sequence. Release of a 920 bp fragment with
Pst I indicated the right orientation of the insert for further
manipulations. DNA from one such clone was further restricted with
SalI, the 5' overhangs filled-in with the Klenow fragment of DNA
polymerase I, then cut with Sac I. The insert fragment was gel
purified, and cloned between the Sma I and Sac I sites of pBI121
(Clontech) behind the Cauliflower Mosaic Virus 35S promoter. After
checking that the sequence of the junction between insert and
vector DNA was appropriate, plasmid DNA from a recombinant clone
was used to transform A. tumefaciens (GV3101). Kanamycin resistant
colonies were then used for in planta transformation of A. thaliana
as previously described.
[0128] DNA was extracted from kanamycin resistant seedlings and
used to PCR-amplify selected fragments from the hydroxylase using
nested primers. When fragments of the expected size could be
amplified, corresponding plants were grown in the greenhouse or on
agar plates, and fatty acids extracted from fully expanded leaves,
roots and dry seeds. GC-MS analysis was then performed as
previously described to characterize the different fatty acid
species and detect accumulation of hydroxy fatty acids in
transgenic tissues.
Example 3
Obtaining Other Plant Fatty Acyl Hydroxylases
[0129] In a previous patent application, we described the ways in
which the castor fah12 sequence could be used to identify other
kappa hydroxylases by methods such as PCR and heterologous
hybridization. However, because of the high degree of sequence
similarity between .DELTA.12 desaturases and kappa hydroxylases,
prior art does not teach how to distinguish between the two kinds
of enzymes without a functional test such as demonstrating activity
in transgenic plants or another suitable host (e.g., transgenic
microbial or animal cells). The identification of the L. fendleri
hydroxylase provided for the development of criteria by which a
hydroxylase and a desaturase may be distinguished solely on the
basis of deduced amino acid sequence information.
[0130] FIGS. 9A-B show a sequence alignment of the castor and L.
fendleri hydroxylase sequences with the castor hydroxylase sequence
and all publically available sequences for all plant microsomal
.DELTA.12 fatty acid desaturases. Of the 384 amino acid residues in
the castor hydroxylase sequence, more than 95% are identical to the
corresponding residue in at least one of the desaturase sequences.
Therefore, none of these residues are responsible for the catalytic
differences between the hydroxylase and the desaturases. Of the
remaining 16 residues in the castor hydroxylase and 14 residues in
the Lesquerella hydroxylase, all but six represent instances where
the hydroxylase sequence has a conservative substitution compared
with one or more of the desaturase sequences, or there is wide
variability in the amino acid at that position in the various
desaturases. By conservative, we mean that the following amino
acids are functionally equivalent: Ser/Thr, Ile/Leu/Val/Met,
Asp/Glu. Thus, these structural differences also cannot account for
the catalytic differences between the desaturases and hydroxylases.
This leaves just six amino acid residues where both the castor
hydroxylase and the Lesquerella hydroxylase differ from all of the
known desaturases and where all of the known microsomal .DELTA.12
desaturases have the identical amino acid residue. These residues
occur at positions 69, 111, 155, 226, 304 and 331 of the alignment
in FIG. 9. Therefore, these six sites distinguish hydroxylases from
desaturases. Based on this analysis, we claim that any enzyme with
greater than 60% sequence identity to one of the enzymes listed in
FIG. 9 can be classified as a hydroxylase if it differs from the
sequence of the desaturases at these six positions. Because of
slight differences in the number of residues in a particular
protein, the numbering may vary from protein to protein but the
intent of the number system will be evident if the protein in
question is aligned with the castor hydroxylase using the numbering
system shown herein. Thus, in conjunction with the methods for
using the lesquerella hydroxylase gene to isolate homologous genes,
the structural criterion disclosed here teaches how to isolate and
identify plant kappa hydroxylase genes for the purpose of
genetically modifying fatty acid composition as disclosed herein
and in the previous application (No. 08/320,982).
[0131] In considering which of the six substitutions are solely or
primarily responsible for the difference in catalytic activity of
the hydroxylases of this invention and the desaturases, we consider
it likely that the substitution of a Phe for a Tyr at position 226
may be solely responsible for this difference in catalytic activity
because of the known participation of tyrosine radicals in enzyme
catalysis. Other substitutions, such as the Ala for Ser at position
331 may have effects at modulating the overall rate of the
reaction. On this basis we envision creating novel kappa
hydroxylases by site directed mutagenesis of .DELTA.12 desaturases.
We also envision converting .DELTA.15 desaturases and .DELTA.9
desaturases to hydroxylases by similar use of site-directed
mutagenesis.
CONCLUDING REMARKS
[0132] By the above examples, demonstration of critical factors in
the production of novel hydroxylated fatty acids by expression of a
kappa hydroxylase gene from Castor in transgenic plants is
described. In addition, a complete cDNA sequence of the Lesquerella
fendleri kappa hydroxylase is also provided. A full sequence of the
castor hydroxylase is also given with various constructs for use in
host cells. Through this invention, one can obtain the amino acid
and nucleic acid sequences which encode plant fatty acyl
hydroxylases from a variety of sources and for a variety of
applications.
[0133] All publications mentioned in this specification are
indicative of the level of skill of those skilled in the art to
which this invention pertains. All publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
[0134] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
REFERENCES
[0135] Atsmon, D. (1989) Castor, in Oil Crops of the World,
Robbelen, G., Downey, K. R., and Ashri, A., Eds., McGraw-Hill, New
York, pp. 438-447.
[0136] Bechtold, N., Ellis, J. and Pelletier, G. (1993) In Planta
Agrobacterium mediated gene transfer by infiltration of adult
Arabidopsis thaliana plants. C.R. Acad. Sci. Paris 316,
1194-1199.
[0137] Beltz, G. A., Jacobs, K. A., Eickbuch, T. H., Cherbas, P.
T., Kafatos, F. C. (1983) Isolation of multigene families and
determination of homologies by filter hybridization methods.
Methods in Enzymology 100, 266-285.
[0138] Bray, E. A., Naito, S., Pan, N. S., Anderson, E., Dube, P.,
Beachy, R. N. (1987) Expression of the .beta.-subunit of
.beta.-conglycinin in seeds of transgenic plants. Planta
172:364-370.
[0139] Carlson, K. D., Chaudhry, A., Bagby, M. O (1990) Analysis of
oil and meal from lesquerella fendleri seed. J. Am. Oil Chem. Soc.
67, 438-442.
[0140] Ditta, G., Stanfield, S., Corbin, D., Helinski, D. R. (1980)
Broad host range DNA cloning system for gram-negative bacteria:
Construction of a gene bank of Rhizobium meliloti. Proc. Natl.
Acad. Sci. USA 77,7347-7351.
[0141] Gould, S. J., Subramani, S., Scheffler, I. E. (1989) Use of
the DNA polymerase chain reaction for homology probing. Proc. Natl.
Acad. Sci. USA 86, 1934-1938.
[0142] Hirsinger, F. (1989) New oil crops, in Oil Crops of the
World, Robbelen, G., Downey, K. R., and Ashri, A., Eds.,
McGraw-Hill, New York, pp. 518-533.
[0143] Howling, D., Morris, L. J., Gurr, M. I., James, A. T. (1972)
The specificity of fatty acid desaturases and hydroxylases. The
dehydrogenation and hydroxylation of monoenoic acids, Biochim.
Biophys. Acta 260, 10.
[0144] Huyuh, T. V., Young, R. A., Davis, R. W. (1985) Constructing
and screening cDNA libraries in .lambda.gt10 and .lambda.gt11. In
DNA Cloning, Vol. 1: A Practical Approach, (ed) D. M. Glover. IRL
Press, Washington DC pp 49-77.
[0145] Iba, K., Gibson, S., Nishiuchi, T., Fuse, T., Nishimura, M.,
Arondel, V., Hugly, S., and Somerville, C. (1993) A gene encoding a
chloroplast omega-3 fatty acid desaturase complements alterations
in fatty acid desaturation and chloroplast copy number of the fad7
mutant of Arabidopsis thaliana. J. Biol. Chem. 268,
24099-24105.
[0146] Jones, J. D. G., Shlumukov, L., Carland, F., English, J.,
Scofield, S., Bishop, G. J., Harrison, K. (1992) Effective vectors
for transformation, expression of heterologous genes, and assaying
transposon excision in transgenic plants. Transgenic Res.
1,285-297.
[0147] Knutson, D. S., Thompson, G. A., Radke, S. E., Johnson, W.
B., Knauf, V. C., Kridl, J. C. (1992) Proc. Natl. Acad. Sci. USA
89, 2624-2628.
[0148] Koncz, C., Schell, J. (1986) The promoter of T.sub.L-DNA
gene 5 controls the tissue-specific expression of chimeric genes
carried by a novel type of Agrobacterium binary vector. Mol. Gen.
Genet. 204, 383-396.
[0149] Miquel, M. Browse, J. (1992) Arabidopsis mutants deficient
in polyunsaturated fatty acid synthesis. J. Biol. Chem. 267,
1502-1509.
[0150] Murray, M. G., Thompson, W. F. (1980) Rapid isolation of
high molecular weight plant DNA. Nucl. Acid Res. 8,4321-4325.
[0151] Okuley, J., Lightner, J., Feldman, R., Yadav, N., Lark, E.,
Browse, J. (1994) Arabidopsis FAD2 gene encodes the enzyme that is
essential for polyunsaturated lipid
[0152] Sambrook, J., Fritsch, E. F., and Maniatis, T., Molecular
Cloning: a Laboratory Manual, 2nd ed., Cold Spring Harbor
Laboratory Press, 1989.
[0153] Smith C. R., Jr. (1985) Unusual seed oils and their fatty
acids, in Fatty Acids, Pryde E. H., Ed., American Oil Chemists'
Society, Champaign, Second edition, pp 29-47.
[0154] van de Loo, F. J., Fox, B. G., Somerville, C. (1993) Unusual
fatty acids, in Lipid Metabolism in Plants, T. S. Moore Jr., Ed.,
CRC Press, Boca Raton, pp91-126.
[0155] van de Loo, F. N., Turner, S., Somerville, C. R. (1995) An
oleate 12-hydroxylase from castor (Ricinus communis L.) is a fatty
acyl desaturase homolog. Proc. Natl. Acad. Sci. USA
92,6743-6747
[0156] von Heijne, G. (1985) signal sequences. J. Mol. Biol.
184,99-105
Sequence CWU 1
1
* * * * *