U.S. patent application number 09/761042 was filed with the patent office on 2002-08-01 for vectors comprising sar elements.
Invention is credited to Agarwal, Manju, Plavec, Ivan, Veres, Gabor.
Application Number | 20020103148 09/761042 |
Document ID | / |
Family ID | 21792123 |
Filed Date | 2002-08-01 |
United States Patent
Application |
20020103148 |
Kind Code |
A1 |
Agarwal, Manju ; et
al. |
August 1, 2002 |
Vectors comprising SAR elements
Abstract
This invention relates to a method of using scaffolding
attachment regions (SARs) to increase expression in retrovirally
transduced resting cells. This includes gene therapy by introducing
into a patient a cellular composition comprising non-immortal human
cells transduced with a retroviral vector comprising a DNA SAR
element and a heterologous gene operatively linked to an expression
control sequence. A particularly preferred SAR is the 5' SAR of the
human interferon .beta. gene or a fragment thereof.
Inventors: |
Agarwal, Manju; (Sunnyvale,
CA) ; Plavec, Ivan; (Sunnyvale, CA) ; Veres,
Gabor; (Palo Alto, CA) |
Correspondence
Address: |
THOMAS HOXIE
NOVARTIS CORPORATION
PATENT AND TRADEMARK DEPT
564 MORRIS AVENUE
SUMMIT
NJ
079011027
|
Family ID: |
21792123 |
Appl. No.: |
09/761042 |
Filed: |
January 16, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09761042 |
Jan 16, 2001 |
|
|
|
09194301 |
Nov 23, 1998 |
|
|
|
60019231 |
Jun 6, 1996 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/320.1; 435/366; 435/456 |
Current CPC
Class: |
C07K 14/005 20130101;
C12N 2830/85 20130101; C12N 2740/16322 20130101; C12N 15/68
20130101; C12N 2830/15 20130101; C12N 15/85 20130101; A61K 48/00
20130101; C07K 14/47 20130101; A61P 31/18 20180101; C12N 15/86
20130101; C12N 2740/13043 20130101; C12N 2830/00 20130101; A61P
43/00 20180101; C12N 2840/203 20130101 |
Class at
Publication: |
514/44 ; 435/456;
435/320.1; 435/366 |
International
Class: |
A61K 048/00; C12N
015/867; C12N 005/08 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 6, 1997 |
EP |
PCT/EP97/02972 |
Claims
1. Use of a DNA scaffold or matrix attachment region (SAR) to
increase gene expression in retrovirally transduced eukaryotic
non-immortal resting cells.
2. A method of modifying expression of a heterologous gene in a
retrovirally transduced eukaryotic cell comprising transducing a
non-immortal cell with a retrovirus comprising (i) at least one
heterologous gene operatively linked to an expression control
sequence and (ii) at least one SAR.
3. A method of increasing expression of a heterologous gene in a
retrovirally transduced eukaryotic resting cell comprising
transducing a non-immortal eukaryotic resting cell with a
retrovirus comprising (i) at least one heterologous gene
operatively linked to an expression control sequence and (ii) at
least one SAR, the SAR being in the reverse direction.
4. A method of down regulating expression of a heterologous gene in
a retrovirally transduced eukaryotic resting cell comprising
transducing a non-immortal cell with a retrovirus comprising (i) at
least one heterologous gene operatively linked to an expression
control sequence and (ii) at least one SAR, the SAR being in the
forward direction.
5. A retroviral vector comprising genetic material corresponding to
(a) at least one SAR, and (b) at least one heterologous gene
operatively linked to an expression control sequence, the
heterologous gene (or at least one of the heterologous genes if
there is more than one heterologous gene) being rev-M10 and the SAR
or at least one SAR is derived from, obtainable from or corresponds
to the 5' SAR of the human interferon-.beta. gene.
6. A cellular composition comprising non-immortal human cells
transduced with a retroviral vector as claimed in claim 5.
7. A cellular composition according to claim 6 wherein the cells
are hematopoietic cells.
8. A cellular composition according to claim 7 wherein the cells
are T cells.
9. A method of gene therapy for a patient in need thereof,
comprising introducing into said patient, a cellular composition
according to any one of claims 6, 7 or 8.
10. The method according to claim 9 comprising the steps of
removing hematopoietic cells from said patient, transducing said
cells with a vector according to claim 5, and reintroducing the
transduced cells into the patient.
11. A method of treating a patient suffering from HIV infection,
e.g., HIV-1 infection, comprising removing and isolating
hematopoietic cells (e.g., hematopoietic stem cells, peripheral
blood lymphocytes, CD4+ cells or T cells derived from hematopoietic
stem cells) from said patient; transducing the cells with a gene
for an anti-retroviral protein (e.g., rev-M10) and a SAR (e.g., a
SAR derived or obtainable from the 5' SAR of human IFN-.beta.), and
reintroducing the cells into the patient.
12. All novel products, processes, and utilities substantially as
described herein, especially with reference to the examples.
Description
[0001] This invention relates to the use of scaffold attachment
regions (SARs) to increase gene expression in primary
non-proliferating cells i.e. in resting cells.
[0002] Eukaryotic chromosomes are organised into discrete chromatin
domains which are thought to define independent units encompassing
all required cis-regulatory elements for co-ordinated expression of
the genes within the domain. These chromatin domains are bordered
by sequences which specifically associate with the nuclear
scaffold, or nuclear matrix, defining the boundaries of the
chromatin domains. Such sequences are referred to as scaffold
attachment region (SAR) or matrix attachment region (MAR). SAR
elements are several hundred basepairs long and A/T rich
(.gtoreq.70%). Although cloned SAR and MAR elements share common
structural features, no consensus sequence has been identified.
SARs have been located upstream, downstream or within genes
(introns) suggesting that they may represent functionally distinct
classes (Bode J et al. . 1995 Scaffold/Matrix-attachment regions
(S/MAR): Structural properties creating transcriptionally active
loci Academic Press, Orlando). SAR elements can enhance expression
of heterologous genes in transfection experiments in vitro and in
transgenic mice. In some instances, it has been reported that SAR
elements can confer position-independent expression to a linked
transgene.
[0003] While transfected DNA integrates randomly into chromosomes,
there is growing evidence that retroviral integration is not
completely random (Shih, C. C 1988 Cell 53, 531-537, Rohdewohld, H
et al 1987 J. Virol. 61, 336-343 and Mielke, C et al 1996
Biochemistry 35, 2239-2252). Notably, proviruses preferentially
integrate into host SAR sequences (Mielke, C et al 1996) and into
"open" chromatin characterised by sensitivity to DNaseI digestion
(Rohdewohld, H et al 1987).
[0004] Our experience has shown that the regulation of gene
expression is different for resting cells as opposed to
proliferating cells. We have found that gene expression of
transduced genes is significantly decreased in resting (i.e. not
mitotically active) cells as compared to active cells. Low
expression in resting cells is a problem when expression is desired
in vivo, e.g., in gene therapy, because at any given time, most
cells in the body (unlike most cells in cell cultures) are in a
quiescent state. Thus, although methods are now available to permit
and enhance integration of heterologous genetic material into
normal resting cells, there are at present no established ways to
enhance expression of the heterologous genetic material in such
cells.
[0005] One might suppose that the difference in expression is due
to limiting quantities of necessary transcription factors or to
control by specific promoter/enhancer elements. Our research
suggests, however, that this difference in expression between
resting and proliferating cells is largely due to changes in
chromatin structure mediated by the DNA SARs. Hereinafter, use of
the term SAR will be understood to encompass scaffold and matrix
attachment regions.
[0006] We have now discovered that SARs increase expression of
heterologous genes in transduced eukaryotic resting primary cells,
particularly in retrovirally transduced cells. The SAR sequence has
no detectable influence on retroviral vector expression in
transduced cell lines. In contrast, the SAR-containing vectors
express at significantly higher levels compared to controls in
resting primary T cells. For example, we have shown that in
retrovirally transduced resting primary T cells, a SAR
significantly increases expression of the heterologous gene, both
in terms of percentage of cells expressing that gene and in terms
of levels of expression per cell. This is the first demonstration
that retroviral mediated transduction of a SAR and a heterologous
gene in cis improves expression of that gene, and the first
demonstration that co-transduction with a SAR and a heterologous
gene improves expression of the gene in resting primary cells.
[0007] Vectors suitable for use in the present invention are chosen
on the basis of their ability of causing integration with the host
genetic material. Accordingly, retroviruses which include
oncoviruses such as Moloney C type and lentiviruses are suitable
for purposes of the present invention. The invention may also be
practised by introducing the DNA by homologous recombination or by
using artificial human chromosomes.
[0008] The invention thus provides, in a first embodiment
[0009] (i) Use of a SAR to increase gene expression in transduced
cells for example resting cells, including resting progeny of
transduced cells;
[0010] (ii) A method of increasing expression of a heterologous
gene in a resting cell comprising transducing a cell, e.g., a
non-immortal cell, with (i) the heterologous gene and (ii) one or
more SARs.
[0011] A SAR for use in the present invention is not itself
transcribed and translated to express a protein, nor is it a
promoter or enhancer element for a gene; its effect on gene
expression is mostly position-independent. By position-independent
is understood that the SAR is placed within the vector and is not
placed so as to destroy other functions required for gene transfer
and expression for example the SAR should not be inserted in a
position which blocks an essential LTR function. Preferably the SAR
is at least 450 base pairs (bp) in length, preferably from 600-1000
bp, e.g., about 800 bp. The SAR is preferably AT-rich (i.e., more
than 50%, preferably more than 70% of the bases are adenine or
thymine), and will generally comprise repeated 4-6 bp motifs, e.g.,
ATTA, ATTTA, ATTTTA, TAAT, TAAAT, TAAAAT, TAATA, and/or ATATTT,
separated by spacer sequences, e.g., 3-20 bp, usually 8-12 bp in
length. The SAR may be from any eukaryote, preferably a mammal,
most preferably a human. Suitably the SAR is the SAR for human
IFN-.beta. gene or fragment thereof, e.g., preferably derived from
or corresponding to the 5' SAR of human interpheron beta
(IFN-.beta.), Klehr, D et al. Scaffold-Attached Regions from the
Human Interferon .beta. domain Can Be Used To Enhance the Stable
Expression of Genes under the Control of Various Promoters.
Biochemistry 1991, 30, 1264-1270), e.g., a fragment of at least 450
base pairs (bp) in length, preferably from 600-1000 bp, e.g., about
800 bp, and being substantially homologous to a corresponding
portion of the 5' SAR of human IFN-.beta. gene, e.g., having at
least 80%, preferably at least 90%, most preferably at least 95%
homology therewith. Especially preferred for use as a SAR in
accordance with the present invention is the 800 bp Eco-RI-HindIII
(blunt end) fragment of the 5'SAR element of IFN-.beta. as
described by Mielke, C et al. Biochemistry 1990 29: 7475-7485.
[0012] In a further embodiment, the invention provides:
[0013] (i) a retroviral vector comprising genetic material
corresponding to (a) at least one SAR, and (b) at least one
heterologous gene operatively linked to an expression control
sequence, the heterologous gene (or at least one of the
heterologous genes if there is more than one heterologous gene)
being rev-M10 and the SAR or at least one SAR is derived from,
obtainable from or corresponds to the 5' SAR of the human
interferon-.beta. gene;
[0014] (ii) a packaging cell line transduced with a retroviral
vector according to (i); and
[0015] (iii) a cellular composition comprising non-immortal
eukaryotic cells (preferably a mammalian, e.g., human cell)
transduced with a retroviral vector according to (i). Hereinafter
(i), (ii) and (iii) above will be referred to as a retroviral
vector of the invention, a packaging cell line of the invention and
a cellular composition of the invention respectively.
[0016] Preferably, the retroviral vector is an amphotropic
retroviral vector, preferably a vector characterized in that it has
a long terminal repeat sequence (LTR), e.g., a retroviral vector
derived from the Moloney murine leukemia virus (MoMLV),
myeloproliferative sarcoma virus (MPSV), murine embryonic stem cell
virus (MESV), murine stem cell virus (MSCV) or spleen focus forming
virus (SFFV). Preferably, in the case of a vector according to
(ii), the gene to be expressed replaces the retroviral gag, pol
and/or env sequences.
[0017] Selection of an appropriate control expression sequences is
dependent on the host cell used and the choice is within the skill
of one of ordinary skill in the art. Examples of regulatory
elements include a transcriptional promoter or enhancer or RNA
polymerase binding sequence, sequences conferring inducibility of
transcription, and selectable markers may be incorporated into the
expression vector. The promoter controlling expression of the gene
is, for example viral LTR, e.g., MoMLV LTR, tissue specific
promoters, or inducible promotors. Preferably, the construct lacks
the retroviral gag, pol and/or env sequences, so that the gag, pol
and env functions must be provided in trans by a packaging cell
line. Thus, when the vector construct is introduced into the
packaging cell, the gag-pol and env proteins produced by the cell
assemble with the vector RNA to produce replication-defective,
transducing virions that are secreted into the culture medium. The
virus thus produced can infect and integrate into the DNA of the
target cell, but generally will not produce infectious viral
particles since it is lacking essential viral sequences.
[0018] Particularly preferred vector structures comprise the
general structure Type 1, Type 2 or Type 3:
1 Type 1: 5' LTR-X-SAR-m-LTR 3'; Type 2: 5' LTR-X-m-SAR-LTR 3';
Type 3: 5' LTR-X-m-LTR/SAR 3';
[0019] wherein LTR is a long terminal repeat, X is the gene for the
desired protein, preferably the revM10 gene, m is a marker, SAR is
a scaffold/matrix attachment region, preferably the hIFN.beta. SAR
described below, and LTR/SAR is a long terminal repeat with SAR
incorporated into it, for example the LMSILy (LMSiLy) or LMILy2S
(LMiLy2S) vectors further described herein. Alternatively, the
vector contains only the gene of interest and one or more SAR
elements. In the type 3 vector structure, the SAR element is
incorporated into the vector 3' LTR and thereby duplicated into the
5'LTR, resulting in a vector having two copies of the SAR element.
Alternatively, two copies of the SAR are arranged to form a vector
of structure (5') LTR-X-SAR-m-SAR-LTR (3'). The SAR in a single SAR
system, is placed upstream of the 3' LTR. A particularly preferred
system is one in which the SAR is in a single copy, in the 3'
position (upstream of the 3' LTR) and in reverse orientation. The
orientation of the SAR i.e. either forward or reverse is important.
In order to increase expression of the heterologous gene, the SAR
should be placed (in the vector) in the reverse direction. A SAR in
the foreward direction, down-regulates expression. This
down-regulation effect is of use in a single SAR-two promoter
system for example where lower expression of one gene in a
multi-gene system is desired.
[0020] The packaging cell line is preferably transfected with
separate plasmids encoding gag-pol and env, so that multiple
recombination events are necessary before a replication-competent
retrovirus (RCR) can be produced. Suitable retroviral vector
packaging cell lines include those based on the murine NIH/3T3 cell
line and include PA317 (Miller et al. 1986 Mol. Cell Biol. 6:2895;
Miller et al. 1989 BioTechniques 7:980), CRIP (Danos et al. 1988
Proc. Natl Acad Sci USA 85:6460), and gp+am12 (Markowitz et al.
1988 Virology 167:400); and also cell lines based on human 293
cells or monkey COS cells, for example ProPak A packaging cells,
e.g., as described in Pear et al. 1993 Proc. Natl. Acad. Sci. USA
90: 8392-8396; Rigg et al., 1996 Virology 218; Finer et al. 1994
Blood 83: 43-50; Landau, et al. 1992 J. Virol. 66: 5110-5113).
Retroviral vector DNA can be introduced into packaging cells either
by stable or transient transfection to produce retroviral vector
particles.
[0021] The range of host cells that may be infected by a retrovirus
or retroviral vector is generally determined by the viral env
protein. The recombinant virus generated from a packaging cell can
be used to infect virtually any cell type recognized by the env
protein provided by the packaging cell. Infection results in the
integration of the viral genome into the transduced cell and the
consequent stable expression of the foreign gene product. The
efficiency of infection is also related to the level of expression
of the receptor on the target cell. In general, murine ecotropic
env of MoMLV allows infection of rodent cells, whereas amphotropic
env allows infection of rodent, avian and some primate cells,
including human cells. Xenotropic vector systems utilize murine
xenotropic env, and also allow infection of human cells. The host
range of retroviral vectors may be altered by substituting the env
protein of the base virus with that of a second virus. The
resulting, "pseudotyped" virus has the host range of the virus
donating the envelope protein and expressed by the packaging cell
line. For example, the G-glycoprotein from vesicular stomatitis
virus (VSV-G) may be substituted for the MMLV env protein, thereby
broadening the host range. Preferably the vector and packaging cell
line of the present invention are adapted to be suitable for
transduction of human cells.
[0022] By heterologous gene is meant a gene which is not a native
retroviral gene and which is suitably inserted into the vector
under control of a promoter to permit expression in the cell to be
transduced. The heterologous gene may be any gene for which
expression is desired, e.g., a gene encoding for a protein which
interferes with viral or retroviral (e.g., HIV) replication, for
example the Rev-M10 gene, e.g., as described in WO 90/14427 and
Escaich et al. Hum. Gene Ther. (1995) 6: 625-634.
[0023] The eukaryotic cells with which the method of the present
invention is employed are non-immortal human cells. By
"non-immortal human cell" is meant a human cell which in cell
culture will grow through only a finite number of divisions, or
which in vivo may undergo maturation or differentiation, e.g., a
non-cancerous primary cell. Suitable cell types include cell types
which undergo differentiation or activation and which become
arrested in vivo, e.g., hematopoietic cells, endothelial cells,
fibroblasts, keratinocytes, etc. Accordingly, the present invention
encompasses the use of a SAR to increase gene expression in resting
(non-proliferating) eukaryotic primary cells, the term resting
including cells which were previously active and are now resting.
Preferably the cells are non-cancerous hematopoietic cells, e.g.,
hematopoietic stem cells (for example, CD34+/Thy-1+ cells) or
mature hematopoietic cells (e.g., peripheral blood lymphocytes or
thymocytes, for example CD4+ cells).
[0024] Gene therapy is a method of therapy comprising the use of
cells which express heterologous genetic material in vivo. In the
case of treatment of an inborn genetic disease characterized by a
deficiency in expression of a critical protein (e.g.,
ADA-deficiency (SCID), hemophilia A and B, Gaucher's disease, and
the like), the genetic material is suitably a gene for the normal
protein. Alternatively, the gene may be for a protective protein,
e.g., a gene for a protein that protects against high dose
chemotherapy, e.g., MDR-1, or a gene for a protein protecting
against viral or retroviral infection, e.g., rev-M10, or may encode
a protective RNA, e.g. a ribozyme or antisense sequence capable of
protecting against viral or retroviral infection. Gene therapy may
be in vivo, e.g., administering the vector to the patient, so that
the target cells are transduced in situ, or ex vivo, e.g.,
transducing the desired cells in vitro and introducing the
transduced cells into the patient, for example a procedure wherein
the desired cells are removed and isolated from the individual to
be treated, transduced with the desired gene, then reintroduced
into the patient.
[0025] Peripheral blood lymphocytes (PBLs) have been used as
cellular targets for gene therapy applications of immune disorders
including SCID-ADA deficiency and HIV disease. At present,
retroviral vectors are the gene transfer modality of choice mainly
because integration of retrovirally-transduced genes into the
chromosome of the target cells supports persistent transgene
expression reviewed in. Protocols for efficient gene marking of
PBLs have been developed, but little is known about regulation of
transgene expression in primary T cells. In vivo, the majority of
circulating PBLs are in a resting state and genes encoded by
standard retroviral vectors based on the Moloney murine leukemia
virus or the Murine embryonic stem cells virus are not efficiently
expressed in these cells. The factors that control transgene
expression in primary T cells are not known, but may render
retroviral-based gene therapy approaches inefficient in certain
disease applications including HIV disease.
[0026] In a yet further embodiment, the invention provides
[0027] (i) a method of gene therapy in a patient in need thereof,
comprising introducing into said patient a) a cellular composition
of the present invention or b) a retroviral vector of the present
invention;
[0028] (ii) a cellular composition as described above for
therapeutic or prophylactic use, e.g., in a method of gene therapy
as described above;
[0029] (iii) the use of a SAR or vector as described above in the
manufacture of a cellular composition as described above, or in a
method of gene therapy as described above.
[0030] A preferred embodiment of the present invention is a method
of treating a patient suffering from HIV infection, e.g., HIV-1
infection, comprising removing and isolating hematopoietic cells
(e.g., hematopoietic stem cells, peripheral blood lymphocytes, CD4+
cells or T cells derived from hematopoietic stem cells) from said
patient; transducing the cells with a gene for an anti-retroviral
protein (e.g., rev-M10) and a SAR (e.g., a SAR derived or
obtainable from the 5' SAR of human IFN-.beta.), and reintroducing
the cells into the patient. Optionally, the patient may receive
co-therapy with cytokines or growth factors such as IL-2, and/or
with anti-HIV drugs such as AZT, HIV protease inhibitors, or the
like.
[0031] Mature T-cells isolated from PBL ot thymus (thymocytes) are
normally in a resting state (i.e. mitotically inactive). Upon in
vitro exposure to various stimuli such as phytomegaglutinin (PHA)
and allogenic feeder cells or anti-CD3 and anti-CD28 antibodies the
cells become activated and start to proliferate. The activation
status of T-cells can be determined measuring expression of the
CD25 antigen (IL-2 receptor alpha chain). CD25 expression is low on
resting cells and is upregulated on activated cells. After initial
activation T-cells will undergo several rounds of division and then
return to non-activated state and concomitantly downregulate
expression of CD25 antigen.
[0032] FIG. 1 depicts schematic representations of the specific
retroviral vectors described in the examples. The names of the
retroviral vectors are indicated on the left. Vectors are not drawn
to scale. LTR is Moloney murine leukemia virus long terminal
repeat; MPSV is myeloproliferative sarcoma virus LTR; MESV is
murine embryonal stem cell virus LTR; SAR is scaffold or matrix
attachment region; IRES is internal ribosomal entry site; NGFr is
nerve growth factor receptor.
[0033] FIG. 2 depicts expression of retroviral vectors in
CD25.sup.- cell populations on day 11 post stimulation.
[0034] FIG. 3A is a schematic representation of the integrated
LMILy2S proviral DNA and the position of primers which are used to
amplify SAR sequence present in the 5' and the 3' LTR.
[0035] FIG. 3B shows the PCR analysis of the two sorted
sub-populations of resting LMiLy2S-transduced T cells, Lyt-2.sup.+
and Lyt-2.sup.- cells. The two populations are separated using FACS
and analysed by semiquantitative PCR for the presence of the SAR
sequence in the proviral DNA.
[0036] FIG. 4 depicts the HIV-1 infection experiment. (A) Primary T
cells are harvested on day five post-stimulation with PHA, IL-2 and
feeder cells and inoculated with the HIV-1 JR-CSF virus. Viral
replication is monitored over a period of 9 days by measuring p24
antigen concentration in cell supernatants. (B) "Day 5
re-stimulated" samples are re-stimulated with fresh PHA, IL-2 and
feeder cells on day 3 post inoculation with HIV-1. All values are
average from triplicate samples, bars indicate standard error.
Where not visible, the error value is below the resolution of the
graphics program.
[0037] FIG. 5 depicts a comparison of the effect of SAR
transduction on the steady state level of retroviral RNA in primary
resting T cells and in cultured cells.
[0038] FIG. 6 depicts RevM10 and Lyt-2 protein expression in
LMiLy-transduced CEMSS cells. (A) RevM10 and Lyt-2 protein
expression correlate. Northern blot analysis of transduced CEMSS
cells. RNA from transduced, Lyt-2-enriched CEMSS cell populations
is analyzed using a Rev-specific oligonucleotide probe as described
(Plavec, I., et al 1997 Gene Therapy 7, 128-139). The transducing
vectors are indicated on top. L.DELTA.MiLy is a control vector
which does not encode the RevM10 protein (Plavec, I., et al 1997
Gene Therapy 7, 128-139). The genomic size transcripts are
indicated by arrow. (B) CEMSS cells transduced with the indicated
vectors and mock transduced control cells are stained with the
anti-Lyt-2-PE antibody, fixed in 4% paraformaldehyde and then
stained with the anti-Rev-FITC antibody as described (Rigg, R. J.,
et al 1995 J. Immunol. Methods 188, 187-195). The cells used for
this analysis are not pre-enriched for Lyt-2 expression. The
fraction of transduced cells in these populations determined by
Lyt-2 staining is 30% and 26% for LMiLy and L.DELTA.MiLy vectors,
respectively.
[0039] FIG. 7 shows the comparison between LMiLy and LMiLy2S vector
expression in transduced cell lines. CEMSS (human CD4+ T cell line)
and PA317 (mouse fibroblast line) cells are transduced with the
LMiLy and LMiLy2S vectors and Lyt-2-enriched using immunomagnetic
beads. The cells are stained with anti-Lyt-2-PE antibody and
analyzed by FACscan. The numbers in parenthesis display percentages
of Lyt-2-positive cells.
[0040] FIG. 8 shows that the LMiLy2S vector is efficiently
expressed in resting T cells. Lyt-2-enriched LMiLy and
LMiLy2S-transduced CD4+ primary T cells are activated with PHA,
IL-2 and irradiated allogenic feeder cells. On days 3 and 11
post-stimulation, cell aliquots are stained with
anti-CD25.sup.-FITC and anti-Lyt-2-PE antibodies and analyzed by
FACscan. Numbers indicate the percentage of Lyt-2-positive cells in
the respective quadrants. Gates for background fluorescence are set
based on control isotype antibodies. Mock are untransduced control
cells.
[0041] FIG. 6 shows that the SAR effect is orientation dependent.
(A) Lyt-2-enriched CD4+ primary T cells transduced with the
MESV-MiLy, MESV-MiLy2S, MESV-MiLy2S-F, LMiLy and LMiLy2S vectors
are stimulated with PHA, IL-2 and feeder cells. Transgene
expression is analyzed on days 3, 5, 7, 10 and 12 post-stimulation
as described in legend to FIG. 2. On day 12, cells are
re-stimulated (indicated by arrow) and analyzed three days later
(day 15 on the graph). (B) Percentage of Lyt-2.sup.+ cells in the
CD25.sup.+ and CD25.sup.- fractions of resting T cells was
determined on day 10 post-stimulation.
EXAMPLE 1
Vector Constructions and Retrovirus-producing Cells
Example 1A
[0042] The structures of the recombinant retrovirus vectors are
shown in FIG. 1. LMILy, MESV-MILy, MPSV-MILy, L587-MILy and LMSILy
are derived from their MoMLV, MESV, MPSV, MoMLV/587 and MoMLV/SAR
counterparts. The XhoI(blunt)-ClaI fragment spanning the tkNeo drug
selection marker is exchanged for the BamHI(blunt)-ClaI IRES-Lyt-2
fragment. IRES-Lyt-2 consists of the internal ribosomal entry site
(IRES) of the human encephalomyocarditis virus (EMCV) (Jang, S. K.
et al. 1989 J. Virol. 63:1651-1660) linked to the Lyt-2 .alpha.'
surface marker gene. Tagawa, M. et al. 1986 Proc. Natl. Acad. Sci.
USA 83:3422-3426). The LMILy-2S is constructed by inserting the 800
bp EcoRI-HindIII (blunt end) IFN-.beta. SAR fragment (Klehr, D. et
al. 1991 Biochemistry 30:1264-1270) into the NheI site in 3' LTR of
the LXSN vector, and then the 3' LTR of LMILy is replaced by
SAR-containing 3'LTR from the LXSN. L.DELTA.MILY and
L.DELTA.MILY-2S contain a mutated RevM10 gene (.DELTA.M10) lacking
the methionine initiation codon. Escaich, S. et al. 1995 Hum. Gene
Ther. 6: 625-634. In addition, a 50 bp linker
5'-GATCTGCTACGTGCATCGCTACCTGACTAGCTG- ACAGGCCATTCTGGCCT-3' (SEQ.ID.
NO.1) is inserted into the BglII site of the .DELTA.M10 gene
(hatched box, FIG. 1). Vector LLyCD4N is constructed by inserting
HindIII-ClaI Lyt-2 gene fragment into the EcoRI site of the LXSN
(Miller, A. D. et al. 1989 BioTechniques 7: 980-990) and then the
SV40-Neo fragment of LXSN is replaced by the human nerve growth
factor receptor (NGFr) cDNA (1.5 kb BamHI-SacI fragment, Johnson,
D. et al. 1986 Cell 47:545-554) under control of the human CD4
promoter (1.1 kb fragment, Salmon, P. et al. 1993 Proc. Natl. Acad.
Sci. USA 90: 7739-7743.). Retroviral vector plasmid DNAs are
transfected into BOSC-23 cells as described (Pear, W. S. et al.
1993 Proc. Natl. Acad. Sci. USA 90: 8392-8396.). Forty-eight hours
post-transfection, BOSC-23 supernatants containing ecotropic
retrovirus are used to inoculate PA317 cells (Miller, A. D. et al.
1986 Molecular and Cellular Biology 6: 2895-2902). Following
transduction, Lyt-2-expressing PA317 cells are enriched using
fluorescence activated cell sorter (FACS) to generate pools of
producer cells. Retroviral vector supernatants are prepared as
described in Forestell, S. P. et al. 1995 Gene Therapy 2: 723-730.
Transduction efficiency of retroviral vector supernatants is
determined on NIH3T3 cells. All producer cells are tested for the
presence of replication competent retrovirus by S+L-assay on PG4
cells (Haapala, D. K. et al. 1985 J. Virol. 53:827-833.).
Example 1B
[0043] The MoMLV-based retroviral vector LMiLy (FIG. 1) encodes two
genes from one bicistronic mRNA transcript (FIG. 6A).: the RevM10
gene and the Lyt-2 surface marker (mouse CD8 a' chain). Translation
of the Lyt-2 protein is mediated by the IRES of the human EMCV and
hence, linked to RevM10 protein expression. Double-staining of
transduced CEMSS cells for RevM10 and Lyt-2 showed that expression
of the two proteins is co-linear (FIG. 6B). Flow cytometric
analysis of the easier detectable Lyt-2 surface antigen is
subsequently used to estimate overall transgene expression. The 800
bp IFN.beta.-SAR fragment (as above) is inserted into the NheI site
of the 3'LTR of the LMiLy generating the LMiLy2S vector. We have
also generated MESV-based vectors because of their advantage over
MoMLV for expression in hematopoietic cells. The MESV-MiLy2S and
MESV-MiLy2S-F vectors are derived from the MESV-MiLy construct
(Plavec I et al, 1997 Gene Therapy 7, 128-139.) (FIG. 1). In
LMiLy2S and MESV-MiLy2S, the SAR sequence is in the reverse, and in
the MESV-MiLy2S-F in the forward orientation, as indicated by the
arrows in FIG. 1. Forward and reverse refers to the orientation of
the SAR element in its natural human IFN.beta. gene locus (Junker,
U. et al 1995 Gene Therapy 2, 639-646). Following transduction, the
3'LTR SAR sequence is duplicated in the 5'LTR generating a
double-copy type vector (Hantzopoulos, P. A. et al 1989 Proc. Natl.
Acad. Sci. USA 86, 3519-3523.). Such double-copy vectors can be
unstable (Junker, U., et al 1995 Gene Therapy 2, 639-646). Clonal
analyses of the LMiLy2S transduced CEMSS cells revealed instability
of the vector. In about 30% of individual clonal CEMSS lines
integrated proviruses did not contain SAR sequence (data not
shown). Amphotropic producer cell lines were generated using
ProPak-A packaging cells (Rigg, J. R. et al. 1996 Virology 218,
290-295.) Since the vectors do not encode a drug resistance gene it
is not possible to determine viral end-point titers. Instead, the
ability of viral supernatants to transfer genes into NIH-3T3 cells
is measured. Transduction efficiencies (Forestell, S. P., et al
(1995) Gene Therapy 2, 723-730) of the retroviral stocks used were:
LMiLy, 53%; MESV-MiLy, 81%; LMiLy2S, 21%; MESV-MiLy2S, 14%; and
MESV-MiLy2S-F, 7%. All retroviral stocks were free of RCR.
EXAMPLE 2
PCR Analysis
[0044] For PCR analysis, cell lysates are prepared from 100,000
viable unfractionated or sorted cells. Cells are lysed in 200 .mu.l
of a buffer containing 50 mM KCl, 10 mM Tris pH: 8.3, 2.5
MgCl.sub.2, 1% Tween 20, 1% NP40 and 100 mg/ml proteinase K at
56.degree. C. for 2 hours. After lysis, samples are incubated 30
minutes at 95.degree. C. to inactivate proteinase K. Primer used
for amplification are:
2 5 ' LTR pecific primers:- Sar up2+:
5'-TCAATGGGTCTGTTTCTGAGCTCTA-3' (SEQ. ID. NO.2) and SDdn-:
5'-GGCGCATAAAATCAGTCATAGACAC-3' (SEQ. ID. NO.3); 3' LTR specific
primers:- Lyt up+: 5'-ACTTCGCCTGTGATATTTACATCTG-3' (SEQ. ID. NO.4)
and LTR dnl-: 5'-TCTATCTGTTCCTGACCTTGATCTG-3' (SEQ. ID. NO.5) and
endogenous .beta.-globin gene specific primers:- LA1: 5'
ACACAACTGTGTTCACTAGC 3' (SEQ. ID. NO.6) and LA2: 5'
CAACTTCATCCACGTTCACC 3' (SEQ. ID. NO.7).
[0045] Cells lysates are mixed with the PCR buffer (Perkin Elmer),
dNTPs (Pharmacia) 200 .mu.M, 100 pmol of each primer and unit of
Taq polymerase (Perkin Elmer). After denaturation (3 minutes at
95.degree. C.), the samples are submitted to 40 cycles of
amplification: 1 minute 95.degree. C., 2 minutes 59.degree. C., 2
minutes 72.degree. C., and 10 minutes elongation at 72.degree. C.
in thermocycler (Perkin Elmer 4800). PCR products are analyzed by
ethidium-bromide staining in 1.4% agarose gels.
EXAMPLE 3
Transduction of Primary T-cells
[0046] Primary T-cells are isolated either from peripheral blood of
healthy donors (PBL) or from thymus grafts of SCID-hu thymus/liver
mice (thymocytes) (Plavec, I. et al. 1996 Gene Therapy 3, 717-724)
and enriched for CD4+ cells by depleting CD8+ cells using anti-CD8
biotinylated Ab (Becton Dickinson) and streptavidin magnetic
dynabeads (Dynal). This procedure yields a 90-95% pure CD4+
population. Cells are stimulated to divide in a TOC medium (RPMI
supplemented with 1xMBM vitamin solution (GIBCO-BRL),
insulin-transferrin-sodium selenite supplement (SIGMA) and 10%
fetal bovine serum (Hyclone) with PHA (2 .mu.g/ml), IL-2 (40 U/ml)
and allogeneic JY feeder cells (James, S. P. 1994 In Current
Protocols in Immunology, vol. 1. R. Coico, editor. John Wiley &
Sons, Inc., New York. and Plavec, I., 1997 Gene Therapy 7, 128-139)
for 3-4 days. Retroviral vector transduction is performed by
centrifugation of 5.times.10.sup.5 cells with 1 ml of supernatant
from retroviral producer cells supplemented with 8 .mu.g/ml
polybrene for 3 hours at 2000 xg and 34.degree. C. This procedure
is performed on two consecutive days. The transduced cells are
generally enriched by two rounds of positive selection using
anti-Lyt-2 biotinylated Ab (PharMingen) and streptavidin magnetic
dynabeads (Dynal) or using fluorescence activated cell sorter
(FACS). For analysis of retroviral vector gene expression, cells
are stimulated with PHA and feeders as described above and at
various time points post-stimulation aliquots of cells are double
stained with anti-Lyt-2 R-PE (PharMingen) and anti-CD25 FITC
(Beckton Dickinson) antibodies and analyzed on a FACScan (Beckton
Dickinson). Expression of NGFr is analyzed using FITC-conjugated
anti-NGFr antibody (MoAb 20.4, ATCC#HB8737).
EXAMPLE 3A
[0047] The effect of the SAR sequence on transgene expression is
most pronounced in the CD25.sup.- compartment of resting T
cells.
[0048] Cellular Lyt-2 expression levels (mean fluorescence
intensity) of LMiLy- and LMiLy2S-transduced populations are
analysed (Table 2). The CD25.sup.- gate is defined using control
isotype antibodies (data not shown). On average, there are
5.7.+-.3.4 fold more Lyt-2.sup.+ cells in the CD25.sup.- fraction
of the LMiLy2S than of the LMiLy-transduced populations (Table 2).
In contrast, there are only 1.7.+-.0.5 fold more Lyt-2.sup.+
LMiLy2S- than the LMiLy-transduced cells in the CD25.sup.+ fraction
(Table 2). The mean fluorescence intensity of the Lyt-2 staining,
which is taken as an indirect measure for transgene expression
level, is only slightly increased (1.6 fold) in the LMiLy2S
compared to the LMiLy-transduced cells and there was no detectable
difference between the CD25.sup.- and CD25.sup.+ cell fractions
(Table 2).
[0049] Two populations of resting LMiLy2S-transduced T cells are
observed: 30-40% of the cells are Lyt-2.sup.+ and the rest are
Lyt-2.sup.- (FIG. 8F.). To further characterise those populations,
the Lyt-2.sup.+ and the Lyt-2.sup.- cells are separated using FACS
and analysed by semiquantitative PCR for the presence of the SAR
sequence in the proviral DNA (FIG. 3B). The Lyt-2.sup.+ cells show
strong SAR-specific PCR signals indicating SAR sequence copies
present both in the 5' and the 3' LTR. In contrast, the Lyt-2.sup.-
cells yield faint SAR-specific signals implying that a significant
portion of integrated retroviral proviruses has lost the SAR
sequence, in agreement with our observations about the instability
of the LMily2S vector. Lyt-2.sup.- cells contain however,
transcriptionally competent proviruses as demonstrated by
expression of the Lyt-2 marker upon re-stimulation of these cells
(data not shown).
3TABLE 2 Expression of the Lyt-2 surface marker in the CD25.sup.-
and CD25.sup.+ subpopulations of resting primary T cells transduced
with the LMiLy and LMiLy2S vectors. Relative transgene expression
Percent Lyt-2.sup.+ cells (Lyt-2 mean fluorescence intensity)
CD25.sup.- fraction CD25.sup.+ fraction CD25.sup.- Lyt-2.sup.+
fraction CD25.sup.+ Lyt-2.sup.+ fraction Ratio Ratio Ratio Ratio
LMiLy2S LMiLy2S LMiLy2S LMiLy2S Tissue* LMiLy LMiLy2S LMiLy LMiLy
LMiLy2S LMiLy LMiLy LMiLy2S LMiLy LMiLy LMiLy2S LMiLy 1 3 19 6.3 12
20 1.7 25 41 1.6 32 48 1.5 2 1 11 11 6 15 2.5 23 35 1.5 26 39 1.5 3
7 20 2.9 26 28 1.1 27 46 1.7 44 76 1.7 4 9 22 2.4 26 33 1.3 23 41
1.8 32 54 1.7 Average 5.7 .+-. 3.4 1.7 .+-. 0.5 1.65 .+-. 0.1 1.6
.+-. 0.1 Samples are analysed 10-12 days post-stimulation with PHA,
IL-2 and allogenic feeder cells. Gates for the CD25.sup.- fractions
are set using control isotype antibodies. Quantitative analysis of
the Lyt-2 staining was performed when approximately 50% of the
total cells fell into the CD25.sup.- gate (see FIG. 8, panel D).
*Tissues 1 and 4 are thymocytes, and 2 and 3 are PBLs.
EXAMPLE 3B
[0050] The SAR sequence enhances transgene expression in an
orientation-dependent manner.
[0051] The SAR sequence is able to rescue expression of the
MESV-based retroviral vector MESV-MiLy (FIG. 1) which is also
down-regulated in resting primary T cells (Rigg, J. R. 1996
Virology 218, 290-295). Kinetic analysis of Lyt-2 expression in
transduced T cell cultures demonstrates that the MESV-MiLy2S vector
behaves similarly to the LMiLy2S vector (FIG. 9A). Compared to
MESV-LMiLy, the Lyt-2 transgene is better expressed in the
MESV-MiLy2S transduced CD25.sup.- resting T cell fraction.
Furthermore, the cell number in the Lyt-2.sup.+CD25.sup.- fraction
is comparable to the LMiLy2S vector (FIG. 9B). The positive effect
is observed only when the SAR sequence is present in the reverse
orientation (compare MESV-MiLy2S and MESV-MiLy2S-F vectors, FIG.
9). Interestingly, when the SAR element is in the forward
orientation (vector MESV-MiLy2S-F) transgene expression is lower
than even with the parental MESV-MiLy vector. Similarly, lower
transgene expression is also seen with the LMiLy2S-F vector which
carries the SAR sequence in the forward orientation (data not
shown).
EXAMPLE 4
HIV Infection of Primary T-cells
[0052] On day 4-5 following stimulation, cells are washed and
resuspended in TOC medium containing IL-2 alone. 2-3.times.10.sup.4
cells in 75 .mu.l volume are mixed with 75 .mu.l of an undiluted
JR-CSF HIV-1 virus stock (10.sup.4-10.sup.5 TCID.sub.50/ml) and
then plated in triplicate in the wells of round-bottom 96-well
plates. Cells are cultured overnight and on the following day 125
.mu.l of medium is removed and replaced with 135 .mu.l of fresh
TOC+IL-2. In this way cell supernatants are harvested on days 3, 5,
7, and 9 post inoculation. Where indicated, on day three, 135 .mu.l
TOC/IL-2 containing 2.5.times.10.sup.5 feeder cells/ml is added to
the cells. HIV-1 p24 antigen concentration in the culture
supernatants is determined using an ELISA kit (Dupont-NEN).
EXAMPLE 5
Expression of Standard Retroviral Vectors in Non-stimulated
T-cells.
[0053] We have previously observed that the expression of the
MoMLV-based retroviral vectors is down regulated in non-stimulated
primary human T-cells. We were interested in identifying retroviral
vectors which would allow expression in non-stimulated cells. We
tested vectors based on myeloproliferative sarcoma virus (MPSV),
murine embryonic stem cell virus (MESV), and a MoMLV-based vector
which contains a primer binding site from the dl587-rev virus (FIG.
1, vectors MESV-MILy, MPSV-MILy and L/587-MILy). All these vectors
encode Lyt-2 surface marker which allows easy and quantitative
analysis of expression (FIG. 1). Primary CD4+ T-cells are
stimulated in vitro with PHA, IL-2 and allogeneic feeder cells for
3-4 days and then transduced with retroviral vectors by
centrifugation (Bahnson, A. B., et al. (1995) J. Virol. Methods
54:131-143). Following this protocol, we detect 4-8% Lyt-2 positive
cells and after expansion in vitro, the Lyt-2 positive cells are
further enriched to 80-90% purity using immunomagnetic beads. These
cells are then stimulated in a medium containing PHA and feeders.
The CD25 surface protein (low affinity IL2 receptor) is used as a
marker for the T cell activation status. Three to five days post
stimulation, CD25 expression is at a maximum with greater than 95%
CD25.sup.+ cells (FIG. 8A). By days 11-14, cells ceased to
proliferate and the CD25 marker was down-regulated (>50%
CD25.sup.- cells) reflecting the mitotically resting state of these
primary T cells (FIG. 8D). Expression of retroviral vectors in
stimulated and non-stimulated cultures is determined by staining
cells for Lyt2 expression with the anti-Lyt2 antibodies. Results
are shown in Table 1A. Expression of Lyt-2 in LMILy, MESV-MILy,
MPSV-MILy and L/587-MILy transduced cells is down-regulated as the
cells become non-stimulated. On day 11 post stimulation,
approximately 50% of cells are CD25.sup.- and 50% are CD25.sup.+.
The majority of the Lyt-2+ cells are present in CD25.sup.+
population and very few in the CD25.sup.- population. We reasoned
that CD25.sup.- cells lack transcription factors required for
retroviral vector LTR expression. To test this hypothesis a vector
is prepared in which expression of a marker gene (in this case it
is the human NGF receptor, supra) is driven by the 1.1 kb human CD4
promoter (supra) (FIG. 1, vector LLyCD4N). CD4 molecule is
expressed normally at high levels in non-stimulated T-cells.
Expression of NGFr from the CD4 promoter in the retrovirally
transduced cells, however, is down-regulated in CD25.sup.- cells
and this down-regulation appears to go in parallel with the
down-regulation of the expression of the MoMLV LTR promoter,
indicating that the down-regulation is characteristic of the
retroviral vector, not the specific promoter used.
4TABLE 1A Expression of retroviral vectors in CD4 + T-cells on day
11 post stimulation. Vector % expressing cells Mean fluorescence
LMILy 6 16 L.DELTA.MILy 8 16 MESV-MILy 7 18 MPSV-MILy 2 16
L/587-MILy 7 16 LLyCD4N 9 19 LMSILy 17 19 LMILy2S 23 27
L.DELTA.MILy2S 30 22
[0054]
5TABLE 1B Expression of the Lyt-2 surface marker in activated and
resting primary T cells transduced with the LMiLy and LMiLy2S
vectors. Activated Resting Percent Lyt-2.sup.+ cells Percent
Lyt-2.sup.+ cells Ratio Ratio Tis- LMiLy2S LMiLy2S sue* LMiLy
LMiLy2S LMiLy LMiLy LMiLy2S LMiLy 1 91 96 1.05 15 39 2.6 2 65 64
0.98 7 26 3.7 3 73 86 1.18 33 48 1.5 4 95 96 1.01 35 55 1.6 Aver-
1.06 .+-. 2.4 .+-. 0.9 age 0.08 Samples are analyzed on day 3
(Activated) and day 10-12 (Resting) post-stimulation with PHA, IL-2
and allogeneic feeder cells. Gates for the Lyt-2.sup.+ cells are
set using untransduced T cells as control (see FIG. 8, panels A and
D). *Tissues 1 and 4 are thymocytes, and 2 and 3 are PBLs.
EXAMPLE 6
Vectors Containing Scaffold Attachment Region (SAR) Maintain
Expression in Non-stimulated T-cells.
[0055] We analysed Lyt-2 transgene expression in activated (day 3
post stimulation) and resting cells (day 11 post stimulation).
[0056] Results obtained with one representative tissue are shown in
FIG. 8. There is no marked difference in the percentage of the
Lyt-2.sup.+ cells between the LMiLy (91%) and the LMiLy2S (96%)
vectors in activated T cells (FIG. 8, panels B and C). In resting
cells. overall Lyt-2 expression was lower (FIG. 8, compare panels B
and C to E and F), and the loss of transgene expression correlates
with the decrease of the CD25 marker. However, we observe a
significant difference in Lyt-2 expression between the LMiLy and
the LMiLy2S vectors. Fifteen percent of the LMiLy transduced cells
are Lyt-2 positive compared to 39% for the LMiLy2S vector (FIG. 8,
panels E and F). Upon re-stimulation, both LMiLy- and
LMiLy2S-transduced cells express comparable high levels of the
Lyt-2 marker (87% and 95%, respectively) demonstrating that the
observed loss of expression is not caused by loss of integrated
vector (data not shown and FIG. 9A). Similar expression patterns
are observed irrespective of the source of primary T cells. The
data obtained with four independent tissues (two PBLs and two
thymocytes) is summarized in Table 1B. Although the absolute
percentage of Lyt-2.sup.+ resting T cells varies considerably from
tissue to tissue, the LMiLy2S vector consistently yields higher
values (on average 2.4.+-.0.9 fold more Lyt-2.sup.+ cells) than the
LMiLy vector (Table 1B).
EXAMPLE 7
Inhibition of HIV Replication
[0057] To test whether improved expression would result in more
effective RevM10-mediated inhibition of HIV-1 replication, primary
CD4+ T cells transduced with the LMiLy, LMSiLy LMiLy2S vectors are
inoculated with the HIV-1 JR-CSF strain and viral replication is
monitored over a period of 9 days (FIG. 4). Cells transduced with
the L.DELTA.MILy vector which does not produce RevM10 protein
(supra) are used as a negative control. Cells are inoculated with
HIV-1 JR-CSF on day 5 post stimulation with PHA, IL-2 and feeder
cells ("Day 5" samples). To make a comparison between stimulated
(activated) and non-stimulated (non-activated) cells, on day three
post inoculation with HIV, half of the cultures are fed fresh PHA
and feeder cells to maintain stimulated phenotype of T-cells. As
shown in FIG. 4B. the LMiLy2S vector is not only more potent in
inhibiting HIV replication in activated cells but it maintains its
efficacy even in resting cells whereas the LMiLy vector lost its
anti-viral effect (FIG. 4A). The anti-viral effect of the LMiLy2S
vector was solely due to RevM10 protein expression since a control
SAR vector (L.DELTA.MiLy2S) which does not encode RevM10 protein
had no effect on HIV-1 replication (data not shown). As expected,
there was no difference in anti-viral efficacy between the two
vectors in HIV-1 HXB-3 infected CEMSS cell populations (data not
shown).
EXAMPLE 8
Differential Expression in SAR-transduced Primary and Cultured
Cells
[0058] RNA Analysis: Total Cellular RNA extracted from CEM SS cells
(human CD4+ T cells) and thymocytes using Rnazol B (Ambion, Austin
Tex.) is analyzed by RNase protection using the Ambion RPA II kit.
RNA probes are synthesized using plasmids derived from
pBluescriptKS+ (Stratagene) by in vitro transcription with either
T3 or T7 polymerase using .sup.32P-UTP according to the Bluescript
Instruction Manual. The RNA probes corresponding to 188 bp
HindIII-BamHI fragment internal to the Rev gene and 100 bp
PstI-Sall PCR fragment spanning the third exon of the human
.beta.-actin gene from positions 1450 to 1550 (GenBank file
HUMACTB-CYT-A). The assay is performed by hybridizing.apprxeq.1
.mu.g total cellular RNA and 9 .mu.g yeast carrier RNA with
1-2.times.10.sup.5 cpm of each probe. Protected fragments are
separated on a 5% polyacrylamide-7M urea denaturing gel and
visualized by autoradiography. Radioactivity in protected fragments
is quantitated using a Phosphorimager (Molecular Dynamics).
Relative expression of RevM10 is estimated by using the
actin-specific signals as an internal reference to correct for
differences in the amount of RNA loaded in different lanes.
[0059] We have found that SAR enhances expression of retroviral
vectors in primary T-cells but not in cultured cells (specifically,
the CEM SS T-cell line or PA317-mouse fibroblast cell line). CEM SS
cells transduced with the LMILy, LMSILy and LMILy2S vectors show
patterns of Lyt-2 staining similar to that observed in stimulated
or active thymocytes (data not shown. As is shown in FIG. 6 the
presence of the SAR element has no effect on transgene expression
levels in the established human T cell line nor in the murine
cells.
[0060] To further analyze the expression of SAR-containing vectors
at the molecular level we have isolated total cellular RNA from
transduced CEM SS cells and both stimulated and non-stimulated
thymocytes. Steady-state level of vector-specific RNA was
determined by semiquantitive RNase protection assay. Values
obtained in the assay are shown in FIG. 5. Values obtained in CEM
SS cells and thymocytes are separately normalized relative to the
appropriate LMILy vector RNA. RNA analysis corroborates the results
obtained by Lyt-2 staining in primary thymocytes. SAR stimulates
the expression of retroviral vectors up to three-fold in both
stimulated and non-stimulated thymocytes and again the double SAR
configuration is more effective than the single SAR. Interestingly,
SAR has no effect on vector RNA expression in transduced CEM SS
cells (FIG. 5) underscoring the difference between primary and
immortalized T-cells.
Sequence CWU 1
1
7 1 50 DNA Artificial Sequence linker sequence 1 gatctgctac
gtgcatcgct acctgactag ctgacaggcc attctggcct 50 2 25 DNA Artificial
Sequence PCR primer sequence 2 tcaatgggtc tgtttctgag ctcta 25 3 25
DNA Artificial Sequence PCR primer sequence 3 ggcgcataaa atcagtcata
gacac 25 4 25 DNA Artificial Sequence PCR primer sequence 4
acttcgcctg tgatatttac atctg 25 5 25 DNA Artificial Sequence PCR
primer sequence 5 tctatctgtt cctgaccttg atctg 25 6 20 DNA
Artificial Sequence PCR primer sequence 6 acacaactgt gttcactagc 20
7 20 DNA Artificial Sequence PCR primer sequence 7 caacttcatc
cacgttcacc 20
* * * * *