U.S. patent application number 09/923726 was filed with the patent office on 2002-08-01 for methods using cre-lox for production of recombinant adeno-associated viruses.
Invention is credited to Phaneuf, Daniel, Wilson, James M..
Application Number | 20020102714 09/923726 |
Document ID | / |
Family ID | 21825356 |
Filed Date | 2002-08-01 |
United States Patent
Application |
20020102714 |
Kind Code |
A1 |
Wilson, James M. ; et
al. |
August 1, 2002 |
Methods using cre-lox for production of recombinant
adeno-associated viruses
Abstract
Methods for efficient production of recombinant AAV are
described. In one aspect, three vectors are introduced into a host
cell. A first vector directs expression of cre recombinase, a
second vector contains a promoter, a spacer sequence flanked by
loxP sites and rep/cap, and a third vector contains a minigene
containing a transgene and regulatory sequences flanked by AAV
ITRs. In another aspect, the host cell stably or inducibly
expresses cre recombinase and two vectors carrying the other
elements of the system are introduced into the host cell.
Inventors: |
Wilson, James M.; (Gladwyne,
PA) ; Phaneuf, Daniel; (Philadelphia, PA) |
Correspondence
Address: |
HOWSON AND HOWSON
ONE SPRING HOUSE CORPORATION CENTER
BOX 457
321 NORRISTOWN ROAD
SPRING HOUSE
PA
19477
US
|
Family ID: |
21825356 |
Appl. No.: |
09/923726 |
Filed: |
August 7, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09923726 |
Aug 7, 2001 |
|
|
|
09242743 |
Feb 22, 1999 |
|
|
|
6274354 |
|
|
|
|
09242743 |
Feb 22, 1999 |
|
|
|
PCT/US97/15691 |
Sep 4, 1997 |
|
|
|
60025323 |
Sep 6, 1996 |
|
|
|
Current U.S.
Class: |
435/235.1 ;
435/320.1; 435/456 |
Current CPC
Class: |
C12N 2710/10343
20130101; C12N 2800/108 20130101; C12N 2750/14122 20130101; C12N
15/86 20130101; C12N 2810/40 20130101; C12N 2750/14143 20130101;
C12N 2830/003 20130101; C12N 9/00 20130101; C12N 2830/42 20130101;
A61K 48/00 20130101; C12N 2800/30 20130101 |
Class at
Publication: |
435/235.1 ;
435/456; 435/320.1 |
International
Class: |
C12N 015/861; C12N
007/00 |
Claims
What is claimed is:
1. A method for production of recombinant adeno-associated virus
(AAV) comprising culturing a host cell comprising and capable of
expressing (a) a cre transgene, which permits splicing out of the
rep and cap gene inhibitory sequences that when removed lead to
activation of rep and cap; (b) AAV rep and cap genes having a
spacer 5' thereto, said spacer flanked by lox sites; (c) a minigene
comprising a therapeutic transgene flanked by AAV inverse terminal
repeats (ITRs); in the presence of sufficient helper virus
functions, wherein a recombinant AAV capable of expressing said
transgene is produced.
2. The method according to claim 1 further comprising: (a)
introducing into a selected host cell i. a first vector comprising
a cre gene under control of sequences which permit expression of
cre recombinase; ii. a second vector comprising from 5' to 3', a
selected promoter, a spacer sequence flanked by loxP sites, an AAV
rep gene and an AAV cap gene; iii. a third vector comprising a
minigene consisting essentially of, from 5' to 3', a 5' AAV inverse
terminal repeat (ITR), a selected promoter, a selected transgene
and 3' AAV ITR; (b) culturing the host cell under conditions which
permit expression of the cre recombinase; and (c) recovering
recombinant AAV capable of expressing the product of said
transgene.
3. The method according to claim 1 wherein at least one of said
vectors is a recombinant adenovirus and the host cell is a 293
cell.
4. The method according to claim 1 wherein the first vector is a
recombinant adenovirus and the sequences which permit expression
comprise a cytomegalovirus promoter, the vector further comprising
a nuclear localization signal operably linked to the cre gene.
5. The method according to claim 1 wherein the second vector is a
recombinant adenovirus and the selected promoter comprises AAV
P5.
6. The method according to claim 5 wherein the spacer sequence is
selected from the group consisting of: (a) a 1300 bp fragment
containing translational start and stop sequences; (b) a 1600 bp
fragment containing the GFP cDNA, an intron and a polyadenylation
signal; and (c) a 1000 bp fragment containing the neomycin coding
sequence and a polyadenylation signal.
7. A method for production of recombinant adeno-associated virus
(AAV) comprising: (a) providing a host cell expressing cre; (b)
introducing into said host cell a first vector comprising from 5'
to 3', a selected promoter, a spacer sequence flanked by loxP
sites, and AAV rep and cap genes; and a second vector comprising
from 5' to 3', a minigene consisting essentially of 5' AAV inverse
terminal repeat (ITR), a selected promoter, a selected transgene,
and a 3' AAV ITR; (c) culturing the host cell under conditions
which permit expression of the cre recombinase and replication and
packaging of a recombinant AAV; and (d) recovering the recombinant
AAV capable of expressing the product of the transgene.
8. The method according to claim 7 wherein the first and second
vectors are recombinant adenoviruses.
9. The method according to claim 8 wherein the spacer sequence is
selected from the group consisting of: (a) a 1300 bp fragment
containing translational start and stop sequences; (b) a 1600 bp
fragment containing the GFP cDNA, an intron and a polyadenylation
signal; and (c) a 1000 bp fragment containing the neomycin coding
sequence and a polyadenylation signal.
10. A recombinant AAV produced according to the method of any one
of claims 1-9.
Description
FIELD OF THE INVENTION
[0001] This invention relates generally to production methods for
recombinant viruses, and more specifically, to methods of producing
recombinant adeno-associated viruses.
BACKGROUND OF THE INVENTION
[0002] Adeno-associated virus (AAV) is a replication-deficient
parvovirus, the genome of which is about 4.6 kb in length,
including 145 nucleotide inverted terminal repeats (ITRs). Two open
reading frames encode a series of rep and cap polypeptides. Rep
polypeptides (rep78, rep68, rep62 and rep40) are involved in
replication, rescue and integration of the AAV genome. The cap
proteins (VP1, VP2 and VP3) form the virion capsid. Flanking the
rep and cap open reading frames at the 5' and 3' ends are 145 bp
inverted terminal repeats (ITRs), the first 125 bp of which are
capable of forming Y- or T-shaped duplex structures. Of importance
for the development of AAV vectors, the entire rep and cap domains
can be excised and replaced with a therapeutic or reporter
transgene [B. J. Carter, in "Handbook of Parvoviruses", ed., P.
Tijsser, CRC Press, pp. 155-168 (1990)]. It has been shown that the
ITRs represent the minimal sequence required for replication,
rescue, packaging, and integration of the AAV genome.
[0003] When this nonpathogenic human virus infects a human cell,
the viral genome integrates into chromosome 19 resulting in latent
infection of the cell. Production of infectious virus and
replication of the virus does not occur unless the cell is
coinfected with a lytic helper virus, such as adenovirus or
herpesvirus. Upon infection with a helper virus, the AAV provirus
is rescued and amplified, and both AAV and helper virus are
produced. The infecting parental ssDNA is expanded to duplex
replicating form (RF) DNAs in a rep dependent manner. The rescued
AAV genomes are packaged into preformed protein capsids
(icosahedral symmetry approximately 20 nm in diameter) and released
as infectious virions that have packaged either + or - ss DNA
genomes following cell lysis.
[0004] AAV possesses unique features that make it attractive as a
vector for delivering foreign DNA to cells. Various groups have
studied the potential use of AAV in the treatment of disease
states. Progress towards establishing AAV as a transducing vector
for gene therapy has been slow for a variety of reasons. While the
ability of AAV to integrate in quiescent cells is important in
terms of long term expression of a potential transducing gene, the
tendency of the integrated provirus to preferentially target only
specific sites in chromosome 19 reduces its usefulness.
[0005] However, an obstacle to the use of AAV for delivery of DNA
is lack of highly efficient schemes for encapsidation of
recombinant genomes and production of infectious virions. See, R.
Kotin, Hum. Gene Ther., 5:793-801 (1994)]. One such method involves
transfecting the rAAV genome into host cells followed by
co-infection with wild-type AAV and adenovirus. However, this
method leads to unacceptably high levels of wild-type AAV.
Incubation of cells with rAAV in the absence of contaminating
wild-type AAV or helper adenovirus is associated with little
recombinant gene expression. In the absence of rep, integration is
inefficient and not directed to chromosome 19.
[0006] A widely recognized means for manufacturing transducing AAV
virions entails co-transfection with two different, yet
complementing plasmids. One of these contains the therapeutic or
reporter transgene sandwiched between the two cis acting AAV ITRs.
The AAV components that are needed for rescue and subsequent
packaging of progeny recombinant genomes are provided in trans by a
second plasmid encoding the viral open reading frames for rep and
cap proteins. Overexpression of Rep proteins have some inhibitory
effects on adenovirus and cell growth [J. Li et al, J. Virol.,
71:5236-5243 (1997)]. This toxicity has been the major source of
difficulty in providing these genes in trans for the construction
of a useful rAAV gene therapy vector.
[0007] There remains a need in the art for the methods permitting
the efficient production of AAV and recombinant AAV viruses for use
as vectors for somatic gene therapy.
SUMMARY OF THE INVENTION
[0008] The present invention provides methods which permit
efficient production of rAAV, which overcome the difficulties faced
by the prior art. This method is particularly desirable for
production of recombinant AAV vectors useful in gene therapy. The
method involves providing a host cell with
[0009] (a) a cre transgene, which permits splicing out of the rep
and cap gene inhibitory sequences that when removed lead to
activation of rep and cap;
[0010] (b) the AAV rep and cap genes, 5' to these genes is a spacer
which is flanked by lox sites;
[0011] (c) a minigene comprising a therapeutic transgene flanked by
AAV inverse terminal repeats (ITRs); and
[0012] (d) adenovirus or herpesvirus helper functions.
[0013] Thus, in one aspect, the invention provides a method for
producing a rAAV which comprises introducing into a host cell a
first vector containing the cre transgene under regulatory control
of sequences which express the gene product thereof in vitro, a
second vector containing a spacer flanked by lox sites, which is 5'
to the rep and cap genes, and a third vector containing a
therapeutic transgene flanked by AAV ITRs. These vectors may be
plasmids or recombinant viruses. One of the vectors can be a
recombinant adenovirus or herpesvirus, which can provide to the
host cell the essential viral helper functions to produce a rAAV
particle. However, if all the vectors are plasmids, the cell must
also be infected with the desired helper virus. The cell is then
cultured under conditions permitting production of the cre
recombinase. The recombinase causes deletion of the spacer flanked
by lox sites upstream of the rep/cap genes. Removal of the spacer
allows the rep and cap genes to be expressed, which in turn allows
packaging of the therapeutic transgene flanked by AAV ITRs. The
rAAV is harvested thereafter.
[0014] In another aspect, the invention provides a method wherein a
host cell expressing cre recombinase is co-transfected with a
vector carrying a spacer flanked by lox sites 5' to the rep and cap
genes, and a vector containing the therapeutic minigene above. With
the provision of helper functions by a means described herein, the
cell is then cultured under appropriate conditions. When cultured,
the cre recombinase causes deletion of the spacer thus activating
expression of rep/cap, resulting in the rAAV as described
above.
[0015] In yet another aspect, the present invention provides rAAV
vectors produced by the methods of the invention.
[0016] Other aspects and advantages of the present invention are
described further in the following detailed description of the
preferred embodiments thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 is a schematic illustration of a 1600 bp DNA fragment
containing green fluorescent protein (GFP) cDNA, an intron and a
polyadenylation (pA or polyA) signal useful as a spacer in a vector
of the invention.
[0018] FIG. 2 is a schematic illustration of a 1000 bp DNA fragment
containing the gene encoding neomycin resistance (neo.sup.R) and a
polyA useful as a spacer.
[0019] FIG. 3 illustrates a plasmid pG.CMV.nls.CRE, useful for
transfection of human embryonic kidney 293 cells in the method of
the invention.
[0020] FIG. 4 illustrates a plasmid pAd.P5.Sp.Rep/Cap, useful in
the method of the invention.
[0021] FIG. 5 illustrates the construction of the recombinant
adenovirus, Ad.CMV.NLS-CRE, useful in the method of the
invention.
[0022] FIG. 6A illustrates the structure of the Ad.CAG.Sp.LacZ
virus.
[0023] FIG. 6B provides the Southern blot analysis of genomic DNA
isolated from 293 cells infected with the LacZ virus at a m.o.i. of
1 and cut with NotI. The 1000 bp .sup.32P-NEO spacer was used as a
probe. After the digestion with NotI a 6200 bp restriction fragment
(without cre-mediated recombination) and/or a 5200 bp restriction
fragment (with cre-mediated recombination) can be detected.
[0024] FIG. 6C provides the Southern blot analysis of genomic DNA
isolated from 293 cells infected with the LacZ virus at a m.o.i. of
10 and cut with NotI. The 1000 bp .sup.32P-NEO spacer was used as a
probe. After the digestion with NotI a 6200 bp restriction fragment
(without cre-mediated recombination) and/or a 5200 bp restriction
fragment (with cre-mediated recombination) can be detected.
[0025] FIG. 6D provides the Southern blot analysis genomic DNA
isolated from 293 cells infected with the LacZ virus at a m.o.i. of
100 and cut with NotI. The 1000 bp .sup.32P-NEO spacer was used as
a probe. After the digestion with NotI a 6200 bp restriction
fragment (without cre-mediated recombination) and/or a 5200 bp
restriction fragment (with cre-mediated recombination) can be
detected.
[0026] FIG. 7 illustrates the structure of the
Ad.Tre.CMV.GFP.Rep/Cap virus.
DETAILED DESCRIPTION OF THE INVENTION
[0027] The invention provides a method for rAAV production using
the cre-lox system, which overcomes the difficulties previously
experienced in providing efficient production systems for
recombinant AAV. The method of this invention produces rAAV
carrying therapeutic transgenes, which are particularly useful in
gene therapy applications.
[0028] In summary, the method involves culturing a selected host
cell which contains
[0029] (a) a cre transgene
[0030] (b) the AAV rep and cap genes, 5' to these genes is a spacer
flanked by lox sites;
[0031] (c) a minigene comprising a therapeutic transgene flanked by
AAV ITRs; and
[0032] (d) adenovirus or herpesvirus helper functions.
[0033] The use of the term "vector" throughout this specification
refers to either plasmid or viral vectors, which permit the desired
components to be transferred to the host cell via transfection or
infection. By the term "host cell" is meant any mammalian cell
which is capable of functioning as an adenovirus packaging cell,
i.e., expresses any adenovirus proteins essential to the production
of AAV, such as HEK 293 cells and other packaging cells. By the
term "minigene" is meant the sequences providing a therapeutic
transgene in operative association with regulatory sequences
directing expression thereof in the host cell and flanked by AAV
ITRS. The term "transgene" means a heterologous gene inserted into
a vector.
[0034] Desirably, components (a), (b) and (c) may be carried on
separate plasmid sequences, or carried as a transgene in a
recombinant virus. Alternatively, the cre protein may be expressed
by the selected host cell, therefor not requiring transfection by a
vector. For each of these components, recombinant adenoviruses are
currently preferred. However, using the information provided herein
and known techniques, one of skill in the art could readily
construct a different recombinant virus (i.e., non-adenovirus) or a
plasmid vector which is capable of driving expression of the
selected component in the host cell. For example, although less
preferred because of their inability to infect non-dividing cells,
vectors carrying the required elements of this system, e.g., the
cre recombinase, may be readily constructed using e.g.,
retroviruses or baculoviruses. Therefore, this invention is not
limited by the virus or plasmid selected for purposes of
introducing the cre recombinase, rep/cap, or minigene into the host
cell.
[0035] Desirably, however, at least one of the vectors is a
recombinant virus which also supplies the helper functions (d) to
the cell. Alternatively, the helper functions may be supplied by
co-infecting the cell with a helper virus, i.e., adenovirus or
herpesvirus, in a conventional manner. The resulting rAAV
containing the minigene may be isolated therefrom.
[0036] A. The Cre Transgene
[0037] The cre protein is a recombinase isolated from bacteriophage
P1 which recognizes a specific sequence of 34 bp (loxP).
Recombination between two loxP sites (catalyzed by the cre protein)
causes, in certain cases, the loss of sequences flanked by these
sites [for a review see N. Kilby et al, Trends Genet., 9:413-421
(1993)]. The sequences of cre are provided in N. Sternberg et al,
J. Mol. Biol., 187:197-212 (1986) and may alternatively be obtained
from other commercial and academic sources. The expression of the
cre protein in the cell is essential to the method of this
invention.
[0038] Without wishing to be bound by theory, the inventors believe
that the expression of cre recombinase in the host cell permits the
deletion of the "spacer" DNA sequence residing between the promoter
and rep/cap genes in the second vector. This deletion of rep and
cap gene inhibitory sequences, allows expression and activation of
the rep and cap proteins and resulting in the replication and
packaging of the AAV genome.
[0039] The cre protein may be provided in two alternative ways. The
gene encoding the protein may be a separate component transfected
into the desired host cell. Alternatively, the host cell selected
for expression of the rAAV may express the cre protein
constitutively or under an inducible promoter.
[0040] B. Triple Infection/Transfection Method
[0041] In one embodiment of the present invention, the method
employs three vectors, i.e., recombinant viruses or plasmids, to
infect/transfect a selected host cell for production of a rAAV. A
first vector comprises the cre transgene operatively linked to
expression control sequences. A second vector comprises the AAV rep
and cap genes downstream of a spacer sequence which is flanked by
lox sites and which itself is downstream of expression control
sequences. A third vector comprises the therapeutic minigene, i.e.,
a transgene flanked by AAV ITRs and regulatory sequences. Suitable
techniques for introducing these vectors into the host cell are
discussed below and are known to those of skill in the art. When
all vectors are present in a cell and the cell is provided with
helper functions, the rAAV is efficiently produced.
[0042] 1. First Vector
[0043] As stated above, in a preferred embodiment, a first vector
is a recombinant replication-defective adenovirus containing the
cre transgene operatively linked to expression control sequences in
the site of adenovirus El deletion, e.g., Ad.CMV.NLS-CRE. See FIG.
5. Preferably, as in the examples below, the cre gene is operably
linked to a suitable nuclear localization signal (NLS). A suitable
NLS is a short sequence, i.e., in the range of about 21 bp, and may
be readily synthesized using conventional techniques, or engineered
onto the vector by including the NLS sequences in a PCR primer. As
described in detail in Example 1 below, the cre gene and a nuclear
localization signal (NLS) are obtained from a previously described
plasmid.
[0044] Desirably, the cre gene is under the control of a
cytomegalovirus (CMV) immediate early promoter/enhancer [see, e.g.,
Boshart et al, Cell, 41:521-530 (1985)]. However, other suitable
promoters may be readily selected by one of skill in the art.
Useful promoters may be constitutive promoters or regulated
(inducible) promoters, which will enable control of the amount of
the cre gene product to be expressed. For example, another suitable
promoter includes, without limitation, the Rous sarcoma virus LTR
promoter/enhancer. Still other promoter/enhancer sequences may be
selected by one of skill in the art.
[0045] In addition, the recombinant virus also includes
conventional regulatory elements necessary to drive expression of
the cre recombinase in a cell transfected with the vector. Such
regulatory elements are known to those of skill in the art,
including without limitation, polyA sequences, origins of
replication, etc.
[0046] 2. Second Vector
[0047] Another, "second", vector useful in this embodiment of the
method is described in Example 2 as Ad.sp.Rep/Cap. It contains the
AAV rep and cap genes downstream of a spacer sequence which is
flanked by lox sites and which itself is downstream of expression
control sequences.
[0048] The AAV rep and cap sequences are obtained by conventional
means. Preferably, the promoter is the AAV P5 promoter. However,
one of skill in the art may readily substitute other suitable
promoters. Examples of such promoters are discussed above in
connection with the first vector.
[0049] The spacer is an intervening DNA sequence (STOP) between the
promoter and the gene. It is flanked by loxP sites and contains
multiple translational start and stop codons. The spacer is
designed to permit use of a "Recombination-Activated Gene
Expression (RAGE)" strategy [B. Sauer, Methods Enzymol.,
225:890-900 (1993)]. Such a strategy controls the expression of a
given gene (in this case, rep/cap). The spacer must be excised by
expression of the cre protein of the first vector and its
interaction with the lox sequences to express rep/cap.
[0050] Currently, there are two particularly preferred spacers.
These spacers include a 1600 bp DNA fragment containing the GFP
cDNA, an intron and a polyadenylation signal (FIG. 1) which was
derived from a commercial plasmid (Clontech) as described below. A
second preferred spacer is a 1300 bp fragment containing
translational start and stop sequences obtained as a 1.3 kbp
ScaI-SmaI fragment of pBS64 as described [M. Anton and F. Graham,
J. Virol., 69:4600-4606 (1995)]. Another desirable spacer is a 1000
bp fragment containing the neomycin resistance coding sequence and
a polyadenylation signal [Y. Kanegae et al, Nucl. Acids Res.,
23:3816-3821 (1995)] (see, FIG. 2).
[0051] Using the information provided herein, one of skill in the
art may select and design other suitable spacers, taking into
consideration such factors as length, the presence of at least one
set of translational start and stop signals, and optionally, the
presence of polyadenylation sites. These spacers may contain genes,
which typically incorporate the latter two elements (i.e., the
start/stop and polyA sites). Desirably, to reduce the possibility
of recombination, the spacer is less than 2 kbp in length. However,
the invention is not so limited.
[0052] As stated above, the spacer is flanked by loxP sites, which
are recognized by the cre protein and participate in the deletion
of the spacer. The sequences of loxP are publicly available from a
variety of sources [R. H. Hoess and K. Abremski, Proc. Natl. Acad.
Sci., 81: 1026-1029 (1984)]. Upon selection of a suitable spacer
and making use of known techniques, one can readily engineer loxP
sites onto the ends of the spacer sequence for use in the method of
the invention.
[0053] In addition, the recombinant virus which carries the rep/cap
genes and the spacer, also includes conventional regulatory
elements necessary to drive expression of rep and cap in a cell
transfected with the recombinant virus, following excision of the
loxP-flanked spacer by the cre recombinase. Such regulatory
elements are known to those of skill in the art.
[0054] 3. Third Vector
[0055] The third vector contains a minigene, which is defined as a
sequence which comprises a suitable transgene, a promoter, and
other regulatory elements necessary for expression of the
transgene, all flanked by AAV ITRs. In the examples below, where
the third vector carries the LacZ gene, the presence of rAAV is
detected by assays for beta-galactosidase activity. However,
desirably, the third vector carries a therapeutic gene which can be
delivered to an animal via the rAAV produced by this method.
[0056] The AAV sequences employed are preferably the cis-acting 5'
and 3' inverted terminal repeat (ITR) sequences [See, e.g., B. J.
Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press,
pp. 155-168 (1990)]. The ITR sequences are about 143 bp in length.
Preferably, substantially the entire sequences encoding the ITRs
are used in the vectors, although some degree of minor modification
of these sequences is expected to be permissible for this use. The
ability to modify these ITR sequences is within the skill of the
art. [See, e.g., texts such as Sambrook et al, "Molecular Cloning.
A Laboratory Manual.", 2d edit., Cold Spring Harbor Laboratory, New
York (1989); Carter et al, cited above; and K. Fisher et al., J.
Virol., 70:520-532 (1996)].
[0057] The AAV ITR sequences may be obtained from any known AAV,
including presently identified human AAV types. Similarly, AAVs
known to infect other animals may also be employed in the vector
constructs of this invention. The selection of the AAV is not
anticipated to limit the following invention. A variety of AAV
strains, types 1-4, are available from the American Type Culture
Collection or available by request from a variety of commercial and
institutional sources. In the following exemplary embodiment an
AAV-2 is used for convenience.
[0058] The 5' and 3' AAV ITR sequences flank the selected transgene
sequence and associated regulatory elements. The transgene sequence
of the vector is a nucleic acid sequence heterologous to the AAV
sequence, which encodes a polypeptide or protein of interest. The
composition of the transgene sequence will depend upon the use to
which the resulting vector will be put. For example, one type of
transgene sequence includes a reporter sequence, which upon
expression produces a detectable signal. Such reporter sequences
include without limitation an E. coli beta-galactosidase (LacZ)
cDNA, an alkaline phosphatase gene and a green fluorescent protein
gene. These sequences, when associated with regulatory elements
which drive their expression, provide signals detectable by
conventional means, e.g., ultraviolet wavelength absorbance,
visible color change, etc.
[0059] A more preferred type of transgene sequence is a therapeutic
gene which expresses a desired gene product in a host cell. These
therapeutic nucleic acid sequences typically encode products for
administration and expression in a patient in vivo or ex vivo to
replace or correct an inherited or non-inherited genetic defect or
treat an epigenetic disorder or disease. The selection of the
transgene sequence is not a limitation of this invention.
[0060] In addition to the major elements identified above, the
minigene also includes conventional regulatory elements necessary
to drive expression of the transgene in a cell transfected with
this vector. Thus, the minigene comprises a selected promoter which
is linked to the transgene and located within the transgene between
the AAV ITR sequences.
[0061] Selection of the promoter used to drive expression of the
transgene is a routine matter and is not a limitation of the
vector. Useful promoters include those which are discussed above in
connection with the first vector component.
[0062] The minigene also desirably contains heterologous nucleic
acid sequences including sequences providing signals required for
efficient polyadenylation of the transcript and introns with
functional splice donor and acceptor sites. A common poly-A
sequence which is employed in the exemplary vectors of this
invention is that derived from the papovavirus SV-40. The poly-A
sequence generally is inserted following the transgene sequences
and before the 3' AAV ITR sequence. A common intron sequence is
also derived from SV-40, and is referred to as the SV-40 T intron
sequence. A minigene of the present invention may also contain such
an intron, desirably located between the promoter/enhancer sequence
and the transgene. Selection of these and other common vector
elements are conventional and many such sequences are available
[see, e.g., Sambrook et al, and references cited therein].
[0063] The rAAV vector containing the minigene may be carried on a
plasmid backbone and used to transfect a selected host cell or may
be flanked by viral sequences (e.g., adenoviral sequences) which
permit it to infect the selected host cell. Suitable Ad/AAV
recombinant viruses may be produced in accordance with known
techniques. See, e.g., International patent applications
WO96/13598, published May 9, 1996; WO95/23867 published Sept. 8,
1995, and WO 95/06743 published March 9, 1995, which are
incorporated by reference herein.
[0064] C. Host Cell/Double Infection or Transfection System
[0065] In another embodiment of the method of this invention, a
packaging cell line is constructed which expresses the cre
recombinase. According to this aspect of the method, this cell line
expressing the cre recombinase can be substituted for the vector or
plasmid bearing the cre gene, as described above. Thus, only the
second and third vectors described above are subsequently
introduced into the cell.
[0066] An exemplary suitable cre expressing cell line has been
generated using the vector illustrated in FIG. 3. Generation of
this cell line is described in detail in Example 4 below. However,
the present invention is not limited to these constructs. Given the
information provided herein, one of skill in the art can readily
generate another plasmid containing a suitable selectable marker
(e.g., neo.sup.R). Such a plasmid may then be used for the
generation of a cre recombinase-expressing cell line according to
the invention.
[0067] Having obtained such a cre-expressing cell line, this cell
line can be infected (or transfected) with the vector containing
the rep/cap genes and the vector containing the minigene described
above.
[0068] D. Production of Vectors and rAAV
[0069] Assembly of the selected DNA sequences contained within each
of the vectors described above utilize conventional techniques.
Such techniques include cDNA cloning such as those described in
texts [Sambrook et al, cited above], use of overlapping
oligonucleotide sequences of the adenovirus, AAV genome combined
with polymerase chain reaction, and any other suitable methods
which provide the desired nucleotide sequence.
[0070] Whether using the three vector system, or the cre-expressing
host cell and two vectors, introduction of the vectors into the
host cell is accomplished using known techniques. Where
appropriate, standard transfection and co-transfection techniques
are employed, e.g., CaPO.sub.4 transfection techniques using the
complementation human embryonic kidney (HEK) 293 cell line (a human
kidney cell line containing a functional adenovirus Ela gene which
provides a transacting Ela protein). Other conventional methods
employed in this invention include homologous recombination of the
viral genomes, plaquing of viruses in agar overlay, methods of
measuring signal generation, and the like.
[0071] Following infection/transfection, the host cell is then
cultured under standard conditions, to enable production of the
rAAV. See, e.g., F. L. Graham and L. Prevec, Methods Mol. Biol.,
7:109-128 (1991). Desirably, once the rAAV is identified by
conventional means, it may be recovered using standard techniques
and purified.
[0072] The following examples illustrate the preferred methods of
the invention. These examples are illustrative only and are not
intended to limit the scope of the invention.
EXAMPLE 1
Construction of Ad.CMV.NLS-CRE
[0073] The construction of a recombinant adenovirus containing a
nuclear localization signal and the cre gene under control of a
cytomegalovirus promoter is described below, with reference to FIG.
5.
[0074] The nls-Cre cDNA was isolated from the plasmid pexCANCRE [Y.
Kanegae et al, Nucl. Acids Res., 23:3816-3821 (1995)] by digestion
with SfciI and PacI and then blunt ended with Klenow and T4 DNA
polymerase. The NLS-Cre fragment was then cloned into the EcoRV
site of the plasmid pAd.CMV.Link (a plasmid containing the human
Ad5 sequences, map units 0 to 16, which is deleted of Ela and Elb
as described in X. Ye et al, J. Biol. Chem., 271:3639-3646 (1996).
The orientation and presence of the nuclear localization signal in
the resulting plasmid pAd.CMV.NLS-CRE was verified by
sequencing.
[0075] To produce the recombinant adenovirus carrying the cre
transgene, the pAd.CMV.NLS-CRE recombinant vector was
co-transfected with the Ad dl327 backbone into 293 cells. Ten days
later, 15 plaques were picked up and 5 of them were expanded on 293
cells. Viruses were screened for their recombinase activity by
assessing their ability to remove a spacer positioned between the
CAG promoter (beta-actin) and the bacterial LacZ coding sequence
using an adenoviral construct described in Y. Kanegae et al, Nucl.
Acids Res., 23:3816-3821 (1995). Two viruses tested positive for
beta-galactosidase activity, indicating cre recombinase activity.
As desired, these recombinant viruses may be purified by two rounds
of plaque purification.
EXAMPLE 2
Construction of Ad.sp.Rep/Cap
[0076] An exemplary recombinant adenovirus containing the AAV rep
and cap genes may be produced as follows.
[0077] An AAV P5 promoter was obtained from the 121 bp XbaI-BamHI
fragment from plasmid psub201, which contains the entire AAV2
genome [R. J. Samulski et al, J. Virol., 61:3096-3101 (1987)] by
PCR using the following primer pairs:
[0078] XbaI ITR rightward: SEQ ID NO:2:
GGCCTCTAGATGGAGGGGTGGAGTCGTGAC;
[0079] BamP5 rightward: SEQ ID NO:3:
GGCCGGATCCAACGCGCAGCCGCCATGCCG;
[0080] Bam P5 leftward: SEQ ID NO:4:
GGCCGGATCCCAAACCTCCCGCTTCAAAAT;
[0081] SacI leftward: SEQ ID NO:5:
GGCCGAGCTCAGGCTGGGTTTTGGGGAGCA.
[0082] A 5' portion of the Rep/Cap gene was similarly excised via
PCR from a BamI-SacI fragment (504 bp) obtained from psub201. The
BamHI PCR primer creates a unique site between the rep mRNA and the
first rep ATG.
[0083] The P5 promoter and the Rep/Cap gene fragment were subcloned
into the XbaI-SacI sites of the pSP72 vector (Promega), resulting
in P5.Rep/Cap. The spacer DNA, a 1300 bp fragment flanked by loxP
sites, was obtained from the plasmid pMA19 [M. Anton and F. Graham,
J. Virol., 69:4600-4606 (1995)] following digestion with BamHI.
This spacer DNA was cloned into the unique BamHI site of the
P5.Rep/Cap construct, resulting in the P5.Spacer.Rep/Cap
construct.
[0084] The complete fragment containing the P5 promoter, the spacer
and the rep/cap genes was obtained by subcloning the 3' portion of
the Rep/Cap gene (SacI/blunt ended fragment, 3680 bp) into the
SacI-EcoRV sites of the P5.Spacer.Rep/Cap plasmid. The 3' portion
of the Rep/cap gene was isolated from the SSV9 plasmid (which
contains a complete wild-type AAV genome) as a SacI-blunt ended
fragment. This involved digesting SSV9 with XbaI, filling the XbaI
site with Klenow and liberating the fragment by digesting with
SacI.
[0085] The complete fragment containing the P5 promoter, the spacer
and the rep/cap sequence was subcloned into the BglII site of the
pAd.link vector. This was accomplished by adding a BglII linker at
the 5' end of the P5.Spacer.Rep/Cap plasmid construct and using the
BglII site located at the 3' end of the multiple cloning site of
pSP72.
[0086] The resulting plasmid (11250 bp) contains Ad5 map units (mu)
0-1, the P5 promoter, the spacer sequence flanked by loxP sites,
rep/cap, and Ad5 mu 9-16. This plasmid is termed
pAd.P5.spacer.Rep/Cap [FIG. 4].
[0087] To produce recombinant adenovirus capable of expressing rep
and cap, pAd.P5.spacer.Rep/Cap was first used to transform a
cre-expressing bacterial strain E. coli strain BNN132 (ATCC
Accession No. 47059) in order to determine whether the spacer could
be removed after recombination between the loxP sites (catalyzed by
the cre recombinase). Analysis on agarose gels of the plasmid DNA
isolated from several transformed colonies showed that, indeed,
most of the constructs analyzed lost the spacer following
transformation (data not shown).
[0088] The plasmid P5.spacer.Rep/Cap was also co-transfected with
the Ad dl327 backbone in HEK 293 cells. Ten days later, 20 plaques
were picked up and expanded. The structure of the viruses was
analyzed by Southern blot using the complete AAV genome and the
1300 bp DNA spacer as probes. One plaque (P3) showed the expected
band pattern after digestion with the restriction enzyme BamHI
(data not shown).
[0089] Similar constructs may be made using other suitable spacers.
For example, a 1600 bp spacer was derived from plasmid phGFP-S65T
plasmid (Clontech) which contains the humanized GFP gene.
phGFP-S65T was cut with the restriction enzymes HindIII and BamHI.
After adding a BglII linker at the 5' end (BglII is compatible with
BamHI), the 1.6 kb fragment was subcloned into the BamHI site of
the flox vector [H. Gu et al, Science, 265:103-106 (1994)] in order
to add a loxP site on each side of the fragment. The GFP DNA
fragment flanked by loxP sites was subsequently cut with PvuI and
SmaI and subcloned into the EcoRV site of the Bluescript II cloning
vector (Stratagene). The resulting GFP spacer can be used to
construct a P5.spacer.Rep/cap plasmid or adenovirus as described
above.
EXAMPLE 3
Production of rAAV
[0090] The supernatant from several plaques (containing viruses)
obtained from the study described in Example 2 was tested for the
ability to produce AAV in a functional assay involving the
adenovirus encoding the cre protein constructed as described in
Example 1 above and pAV.CMVLacZ.
[0091] The plasmid AV.CMVLacZ is a rAAV cassette in which rep and
cap genes are replaced with a minigene expressing B-galactosidase
from a CMV promoter. The linear arrangement of AV.CMVLacZ
includes:
[0092] (a) the 5' AAV ITR (bp 1-173) obtained by PCR using pAV2 [C.
A. Laughlin et al, Gene, 23: 65-73 (1983)]as template [nucleotide
numbers 365-538 of SEQ ID NO:1];
[0093] (b) a CMV immediate early enhancer/promoter [Boshart et al,
Cell, 41:521-530 (1985); nucleotide numbers 563-1157 of SEQ ID
NO:1],
[0094] (c) an SV40 intron (nucleotide numbers 1178-1179 of SEQ ID
NO:1),
[0095] (d) E. coli beta-galactosidase cDNA (nucleotide numbers
1356-4827 of SEQ ID NO:1),
[0096] (e) an SV40 polyadenylation signal (a 237 BamHI-BclI
restriction fragment containing the cleavage/poly-A signals from
both the early and late transcription units; nucleotide numbers
4839-5037 of SEQ ID NO:1) and
[0097] (f) 3'AAV ITR, obtained from pAV2 as a SnaBI-BglII fragment
(nucleotide numbers 5053-5221 of SEQ ID NO:1).
[0098] The functional assay was performed by infecting 293 cells
with the cre virus and the Rep/Cap virus (multiplicity of infection
(MOI) 10) followed by a transfection 2 hours later with 5 .mu.g
pAV.CMVLacZ. Forty-eight hours later, cells were harvested and
freeze-thawed. One-fifth of the supernatant (containing rAAV) was
used to infect 293 cells. Twenty-four hours later an X-gal assay
was performed.
[0099] Viruses from plaque #3 yielded positive for
beta-galactosidase transduction in this assay. Supernatant from
plaque #3 was used in a second round of purification (plaque
amplification). Twenty plaques were picked up and expanded.
EXAMPLE 4
Production of Cre Expressing Cell Line
[0100] A plasmid vector, pG.CMV.nls.cre was constructed as follows
for use in transfecting 293 cells. The nls-Cre cDNA was isolated
from the plasmid pexCANCRE (Kanegae, cited above) as described in
Example 1 above. The nls-Cre fragment was then subcloned into the
XbaI sites of vector pG downstream of a CMV promoter. This plasmid
vector is illustrated in FIG. 3 and contains a human growth hormone
(hGH) termination sequence, an SV40 ori signal, a neomycin
resistance marker, an SV40 polyadenylation site, an ampicillin
marker, on a backbone of pUC19.
[0101] This plasmid was transfected into 293 cells using
conventional techniques. Cells were selected in the presence of
G-418 for neomycin resistance. Cells were identified by infecting
them at different MOI (1 to 100) with Ad.CAG.Sp.LacZ, an adenovirus
containing the bacterial LacZ coding sequence separated from its
beta-actin (CAG) promoter by a neomycin spacer DNA flanked by two
loxP sites followed by the bacterial LacZ gene. Cells were selected
on the basis of their ability to remove the spacer fragment
inducing the expression of the LacZ gene. After X-gal staining, six
cell lines were found to be positive. DNA from these infected cells
was isolated and analyzed by Southern blot using the spacer DNA
(NEO) as a probe. Results shown in FIG. 6A, with reference to Table
1, and FIGS. 6B-6D indicate that cell line #2 can remove the DNA
spacer with much more efficacy than the other 293/cre cell lines
analyzed.
1TABLE 1 NEO Probe Without Recombination With Recombination 6200
6200 5200
EXAMPLE 5
Generation of the Ad.GFP Rep/Cap
[0102] As described in Example 2 for the construction of the
Ad.Sp.Rep/Cap virus, the link plasmid containing the P5 promoter,
the GFP spacer flanked by two loxP sites and the Rep and Cap coding
sequences was co-transfected with the Ad dl327 backbone into HEK
293 cells. Ten days later, 20 plaques were picked up and expanded.
During this expansion, the monolayer of HEK 293 cells were screened
for the expression of GFP by microscopic analysis using a mercury
lamp with a 470-490 nm band-pass excitation filter (Nikon). One of
the monolayers (from plaque #13) showed a region positive for the
expression of GFP. This region was further expanded and purified by
two other rounds of plaque purification. The presence of the
Ad.GFP.Rep/Cap virus was monitored by the expression of GFP, as
described, and/or by the expression of the Rep and Cap proteins by
Western blot analysis using specific monoclonal antibodies
(American Research Products, Inc.). One cell lysate (from one
purified plaque) containing the Ad.GFP rep/cap was used in order to
infect 293 cells (adenovirus preparation with 40.times.150 mm
dishes of HEK 293 cells). A total of 6.86.times.10.sup.13
particles/ml were obtained after purification. This virus is
currently being tested for the production of rAAV, as described in
Example 3.
EXAMPLE 6
Construction of the Ad.TRE.CMV.GFP.Rep/Cap
[0103] FIG. 7 shows the final structure of the Ad.TRE.CMV.Rep/Cap
virus. The AAV P5 promoter was replaced by the tetracycline (Tet)
inducible promoter (Clontech). This promoter contains the
tetracycline responsive elements (TRE) followed by the CMV minimal
promoter without the CMV enhancer. This promoter is inducible in
the presence of the antibiotic doxycycline (Sigma) in the
293/Tet-On cell line (Clontech) which contains a stable gene
expressing the rTetR (reverse Tet repressor) fused to the GP16
transcriptional activation domain. The objective here is to
construct a double inducible expression system in order to limit
the expression of the cytotoxic Rep gene products. In order to
fully induce the expression of the Rep and Cap genes, the virus
must be in the presence of 1--the cre recombinase (in order to
delete the GFP spacer as described previously) and 2--the Tet-On
inducible factor doxycycline (DOX).
[0104] The link plasmid containing the construct described above
was used to transfect HEK 293 cells in the presence or the absence
of DOX and/or the cre recombinase (from the adenovirus expressing
nls-cre). Proteins from cell homogenates were analyzed by Western
blot using the Rep antibodies. Rep proteins are fully induced only
in the presence of DOX and the cre recombinase.
[0105] In order to construct pAd.TRE.CMV.link.1, the pTRE plasmid
(Clontech) was cut with the restriction endonucleases Xho and EcoR1
to isolate the TRE and the minimal CMV promoter. The Xho and EcoR1
sites were filled with Klenow and the 448 bp fragment was inserted
into the EcoRV site of the pAdlink.1 plasmid. The GFP.Rep/Cap
fragment was subsequently cut with ClaI and BglIII and inserted
into the pAd.TRE.CMV.link.1 cut with ClaI and BamHI.
[0106] This link recombinant plasmid was co-transfected with the Ad
dl327 backbone in HEK 293 cells. Ten days later, 20 plaques were
picked up and expanded. These plaques are currently being analyzed
for the expression of GFP and the Rep and Cap proteins. Two
adenoviruses expressing large amounts of rep proteins were
identified. These viruses are currently being purified and
studied.
[0107] Numerous modifications and variations of the present
invention are included in the above-identified specification and
are expected to be obvious to one of skill in the art. Such
modifications and alterations to the processes of the present
invention are believed to be encompassed in the scope of the claims
appended hereto.
Sequence CWU 1
1
* * * * *