U.S. patent application number 09/921232 was filed with the patent office on 2002-08-01 for polypeptides controlling phytate metabolism in plants.
Invention is credited to Beach, Larry R., Martino-Catt, Susan J., Wang, Hongyu.
Application Number | 20020102681 09/921232 |
Document ID | / |
Family ID | 22378620 |
Filed Date | 2002-08-01 |
United States Patent
Application |
20020102681 |
Kind Code |
A1 |
Martino-Catt, Susan J. ; et
al. |
August 1, 2002 |
Polypeptides controlling phytate metabolism in plants
Abstract
This invention relates to newly identified polynucleotides and
polypeptides, variants and derivatives of same; methods for making
the polynucleotides, polypeptides, variants, derivatives and
antagonists. In particular the invention relates to polynucleotides
and polypeptides of the phytate metabolic pathway.
Inventors: |
Martino-Catt, Susan J.;
(Grimes, IA) ; Wang, Hongyu; (Urbandale, IA)
; Beach, Larry R.; (Des Moines, IA) |
Correspondence
Address: |
PIONEER HI-BRED INTERNATIONAL INC.
7100 N.W. 62ND AVENUE
P.O. BOX 1000
JOHNSTON
IA
50131
US
|
Family ID: |
22378620 |
Appl. No.: |
09/921232 |
Filed: |
August 2, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09921232 |
Aug 2, 2001 |
|
|
|
09677064 |
Sep 29, 2000 |
|
|
|
6291224 |
|
|
|
|
09677064 |
Sep 29, 2000 |
|
|
|
09118442 |
Jul 17, 1998 |
|
|
|
6197561 |
|
|
|
|
60085852 |
May 18, 1998 |
|
|
|
60055446 |
Aug 11, 1997 |
|
|
|
60055526 |
Aug 8, 1997 |
|
|
|
60053944 |
Jul 28, 1997 |
|
|
|
60053351 |
Jul 22, 1997 |
|
|
|
Current U.S.
Class: |
435/183 |
Current CPC
Class: |
C12N 15/8243 20130101;
C12N 9/90 20130101; C12N 9/1205 20130101 |
Class at
Publication: |
435/183 |
International
Class: |
C12N 009/00 |
Claims
What is claimed is:
1. An isolated polypeptide comprising an amino acid sequence which
has at least 80% sequence identity to SEQ ID NO: 17, wherein the %
sequence identity is based on the entire sequence and is determined
by the GAP program where the gap creation penalty=12 and the gap
extension penalty 4.
2. An isolated polypeptide comprising the sequence of SEQ ID NO:17.
Description
[0001] This application is a divisional of co-pending U.S.
application Ser. No. 09/677,064 filed Aug. 29, 2000, which is a
divisional of U.S. application Ser. No. 09/118,442 filed Jul. 17,
1998 now U.S. Pat. No. 6,197,561, the disclosure of which is herein
incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of animal
nutrition. Specifically, the present invention relates to the
identification and use of genes encoding various enzymes involved
in the metabolism of phytate in plants and the use of these genes
and mutants thereof to reduce the levels of phytate, and/or
increase the levels of non-phytate phosphorus in food or feed.
BACKGROUND OF THE INVENTION
[0003] The role of phosphorus in animal nutrition is well
recognized. Eighty percent of the phosphorus in the body of animals
is found in the skeleton, providing structure to the animal. Twenty
percent of the phosphorus in animals can be found in soft tissues,
where it is a constituent compound and therefore involved in a wide
series of biochemical reactions. For example, phosphorus is
required for the synthesis and activity of DNA, RNA, phospholipids,
and some B vitamins.
[0004] Though phosphorus is essential for healthy animals, it is
also recognized that not all phosphorus in feed is bioavailable.
Phytic acid salts (i.e., phytates) are the major storage form of
phosphorus in plants. See e.g., "Chemistry and Application of
Phytic Acid: an Overview," Phytic Acid: Chemistry and Application;
Graf, Ed.; Pilatus Press: Minneapolis, Minn., pp. 1-21; (1986).
Phytates are the major form of phosphorus in seeds, typically
representing from 50% to 80% of seed total phosphorus.
[0005] In corn and soybeans, for example, phytate represents about
60% to 80% of total phosphorus. When seed-based diets are consumed
by non-ruminants, the consumed phytic acid forms salts with several
nutritionally-important minerals in the intestinal tract. Excretion
of these salts reduces the retention and utilization, i.e.,
bioavailability of the diet's phosphorus and mineral contents.
Consequently, this can result in mineral deficiencies in both
humans and animals fed the above seed. See e.g., McCance et al.,
Biochem. J. 29:4269 (1935); Edman, Cereal Chem. 58:21 (1981).
[0006] Phytate, a large source of phosphorus, is not metabolized by
monogastric animals. Phytic acid, in fact, is considered to be an
anti-nutritional factor because it reduces the bioavailability of
proteins and minerals by chelation; see e.g., Cheryan, "Phytic Acid
Interactions in Food Systems," CRC Crit. Rev. Food Sci. Nutr.
13:297-335 (1980).
[0007] Phytate does not simply cause a reduction in nutrient
availability. The phytate-bound phosphorus in animal waste
contributes to surface and ground water pollution. See e.g.,
Jongbloed et al., Nether. J. Ag. Sci. 38:567 (1990).
[0008] Because the phytate content of seed has an impact on diet,
phosphorus and mineral retention, and the environment, several
approaches have been proposed to reduce this impact. Approaches
include removing dietary phytate by post-harvest intervention and
reducing seed phytate content genetically.
[0009] Post-harvest food processing methods that remove phytic acid
either physically or via fermentation, are disclosed for example by
Indumadhavi et al., Int. J. Food Sci. Tech. 27:221 (1992).
Hydrolyzing phytic acid is a useful approach to increase the
nutritional value of many plant foodstuffs. Phytases, as discussed
more fully below, catalyze the conversion of phytic acid to
inositol and inorganic phosphate. Phytase-producing microorganisms
include bacteria and yeasts. See e.g. Power et al., J. Bacteriol.
151:1102-1108 (1982); Segueilha et al., Biotechnol. Lett.
15(4):399404 (1993) and Nayini et al., Lebensm. Wiss. Technol.
17:24-26 (1984).
[0010] The use of phytases, phytic acid-specific phosphohydrolases,
typically of microbial origin, as dietary supplements, is disclosed
by Nelson et al., J. Nutr. 101:1289 (1971). All currently known
post-harvest technologies involve added procedures and expense in
order to circumvent problems associated with phytate.
[0011] The genetic approach involves developing crop germplasm
possessing heritable reductions in seed phytic acid. Heritable
quantitative variation in seed phytic acid has been observed among
lines of several crop species. See Raboy, In: Inositol Metabolism
in Plants, Moore D. J., et al., (eds.) Alan R. Liss, New York, pp.
52-73; (1990).
[0012] However, this variation has been found to be highly and
positively correlated with variation in less desirable
characteristics, therefore, breeding for reduced seed phytic acid
using traditional breeding methods, could result in germplasm with
undesirable correlated characteristics. To date, there have been no
reports of commercially acceptable low phytic acid corn germplasm
produced by such an approach.
[0013] In genetically altering phytate, natural variability for
phytate and free phosphorus has been examined. See Raboy, V. and D.
B. Dickinson, Crop Sci. 33:1300-1305 (1993),and Raboy, V. et al.,
Maydica 35:383-390(1990). While some variability for phytic acid
was observed, there was no corresponding change in non-phytate
phosphorus. In addition, varietal variability represented only two
percent of the variation observed, whereas ninety-eight percent of
the variation in phytate was attributed to environmental
factors.
[0014] As mentioned above, studies of soybean and other crops have
indicated that altering genetic expression of phytate through
recurrent selection breeding methods might have correlated
undesirable results. See Raboy, V., D. B. Dickinson, and F. E.
Below; Crop Sci. 24:431-434 (1984); Raboy, V., F. E. Below, and D.
B. Dickinson; J. Hered. 80:311-315 (1989); Raboy, V., M. M. Noaman,
G. A. Taylor, and S. G. Pickett; Crop Sci. 31:631-635; (1991).
[0015] While it has been proposed that a block in phytic acid
accumulation might be valuable in producing low phytic acid
germplasm without the introduction of undesirable correlated
responses, (See Raboy et al., Crop Sci. 33:1300 (1993)) employing
such a traditional mutant selection approach has, in certain cases,
revealed that homozygosity for mutants associated with substantial
reductions in phytic acid also proved to be lethal.
[0016] Myo-inositol is produced from glucose in three steps
involving the enzymes hexokinase (EC 2.7.1.1), L-myo-inositol
1-phosphate synthase (EC 5.5.1.4) and L-myo-inositol 1-phosphate
phosphatase (EC 3.1.3.25). The biosynthetic route leading to
phytate is complex and not completely understood. Without wishing
to be bound by any particular theory of the formation of phytate,
it is believed that the synthesis may be mediated by a series of
one or more ADP-phosphotransferases, ATP-dependent kinases and
isomerases. A number of intermediates have been isolated including
for example 2 and 3 monophosphates, 1,3 and 2,6 di-phosphates,
1,3,5 and 2,5,6 triphosphates, 1,3,5,6 and 2,3,5,6
tetra-phosphates, and 1,2,4,5,6 and 1,2,3,4,6 penta-phosphates.
Several futile cycles of dephosphorylation and rephosphorylation of
the P.sub.5 and P.sub.6 forms have been reported as well as a cycle
involving G6P.fwdarw.myoinositiol-1-
-phosphate.fwdarw.myo-inositol; the last step being completely
reversible, indicating that control of metabolic flux through this
pathway may be important. This invention differs from the foregoing
approaches in that it provides tools and reagents that allows the
skilled artisan, by the application of, inter alia, transgenic
methodologies to influence the metabolic flux in respect to the
phytic acid pathway. This influence may be either anabolic or
catabolic, by which is meant the influence may act to decrease the
flow resulting from the biosynthesis of phytic acid and/or increase
the degradation (i.e., catabolism of phytic acid). A combination of
both approaches is also contemplated by this invention.
[0017] As mentioned above, once formed phytate may be
dephosphorylated by phosphohydrolases, particularly 3-phytases
typically found in microorganisms and 6-phytases the dominant form
in plants. After the initial event, both enzymes are capable of
successive dephosphorylation of phytate to free inositol.
[0018] Accordingly, there have also been reports that plants can be
transformed with constructs comprising a gene encoding phytase. See
Pen et al., PCT Publication WO 91/14782, incorporated herein in its
entirety by reference. Transgenic seed or plant tissues expressing
phytases can then be used as dietary supplements. However, this
application has not been done to reduce seed phytic acid.
[0019] Based on the foregoing, there exists the need to improve the
nutritional content of plants, particularly corn and soybean by
increasing non-phytate phosphorus and reducing seed phytate with no
other obvious or substantial adverse effects.
SUMMARY OF THE INVENTION
[0020] It is therefore an object of the present invention to
provide plants, particularly transgenic corn, which has enhanced
levels of non-phytate phosphorus without corresponding detrimental
effects.
[0021] It is a further object of the present invention to provide
plants, particularly transgenic corn which have reduced levels of
phosphorus in the form of phytate without corresponding detrimental
effects.
[0022] It is a further object of the present invention to provide
transgenic plant lines with dominant, heritable phenotypes which
are useful in breeding programs designed to produce commercial
products with improved phosphorus availability and reduced
phytate.
[0023] It is a further object of the present invention to improve
animal performance by feeding animals plants and parts thereof
particularly seeds with enhanced nutritional value.
[0024] It is a further object of the present invention to provide
plant seeds, particularly corn seeds and resulting meal, that
result in less environmental contamination, when excreted, than do
currently used seeds.
[0025] These and other objects of the invention will become readily
apparent from the ensuing description.
[0026] An isolated polynucleotide is provided comprising a member
selected from the group consisting of:
[0027] (a) a polynucleotide encoding a polypeptide comprising SEQ
ID NOS: 2, 6, 11, 17 or complement thereof;
[0028] (b) a polynucleotide of at least 25 nucleotides in length
which selectively hybridizes under stringent conditions to a
polynucleotide of SEQ ID NOS: 1, 5, 7, 10, 14, 15, 16 or a
complement thereof, wherein the hybridization conditions include a
wash step in 0.1.times. SSC at 60.degree. C.;
[0029] (c) a polynucleotide having a sequence of a nucleic acid
amplified from a Zea mays nucleic acid library using the primers of
SEQ ID NOS: 3-4, 8-9, 12-13, or 18-19;
[0030] (d) a polynucleotide having at least 75% sequence identity
to SEQ ID NO: 1, at least 60% sequence identity to SEQ ID NO: 5, at
least 80% sequence identity to SEQ ID NO: 10, or at least 70%
sequence identity to SEQ ID NO: 16, wherein the % sequence identity
is based on the entire coding region and is determined by the GAP
program where the gap creation penalty=50 and the gap extension
penalty=3; and
[0031] (e) a polynucleotide comprising at least 20 contiguous bases
of the polynucleotide of (a) through (c), or complement
thereof.
[0032] According to the present invention, polypeptides that have
been identified as novel phytate biosynthetic enzymes are
provided.
[0033] An isolated polypeptide is provided comprising an amino acid
sequence which has at least 80% sequence identity to SEQ ID NO: 2,
at least 35% sequence identity to SEQ ID NO: 6, at least 90%
sequence identity to SEQ ID NO: 11 or at least 80% sequence
identity to SEQ ID NO: 17, wherein the % sequence identity is based
on the entire sequence and is determined by the GAP program where
the gap creation penalty=12 and the gap extension penalty=4.
[0034] It is a further object of the invention, moreover, to
provide polynucleotides that encode maize phytate biosynthetic
enzymes, particularly polynucleotides that encode
phosphatidylinositol 3-kinase, myo-inositol monophosphatase-3,
myo-inositol 1,3,4-triphosphate 5/6 kinase and myo-inositol
1-phosphate synthase.
[0035] In a particularly preferred embodiment of this aspect of the
invention the polynucleotide comprises the regions encoding
phosphatidylinositol 3-kinase, myo-inositol monophosphatase-3,
myo-inositol 1 ,3,4-triphosphate5/6 kinase and myo-inositol
1-phosphate synthase.
[0036] In another particularly preferred embodiment of the present
invention polypeptides are isolated from Zea mays.
[0037] In accordance with this aspect of the present invention
there is provided a polynucleotide of at least 25 nucleotides in
length which selectively hybridizes under stringent conditions to
the polynucleotides set out below, or a complement thereof. As used
herein, "stringent conditions" means the hybridization conditions
include a wash step in 0.1.times. SSC at 60.degree. C.
[0038] In accordance with this aspect of the present invention
there is provided a polynucleotide having a sequence of a nucleic
acid amplified from a Zea mays nucleic acid library using the
primers set out in the sequences below.
[0039] In accordance with this aspect of the invention there are
provided isolated nucleic acid molecules encoding phytate
biosynthetic enzymes, particularly those from Zea mays, mRNAs,
cDNAs, genomic DNAs and, in further embodiments of this aspect of
the invention, biologically, useful variants, analogs or
derivatives thereof, or fragments thereof, including fragments of
the variants, analogs and derivatives.
[0040] Other embodiments of the invention are naturally occurring
allelic variants of the nucleic acid molecules in the sequences
provided which encode phytate biosynthetic enzymes.
[0041] In accordance with another aspect of the invention there are
provided novel polypeptides which comprise phytate biosynthetic
enzymes of maize origin as well as biologically, or diagnostically
useful fragments thereof, as well as variants, derivatives and
analogs of the foregoing and fragments thereof.
[0042] It also is an object of the invention to provide phytate
biosynthetic polypeptides, particularly phosphatidylinositol
3-kinase, myo-inositol monophosphatase-3, myo-inositol
1,3,4-triphosphate5/6 kinase or myo-inositol 1-phosphate synthase
polypeptide, that may be employed for modulation of phytic acid
synthesis.
[0043] In accordance with yet a further aspect of the present
invention, there is provided the use of a polypeptide of the
invention, or particular fragments thereof.
[0044] It is another object of the invention to provide a process
for producing the polypeptides, polypeptide fragments, variants and
derivatives, fragments of the variants and derivatives, and analogs
of the foregoing.
[0045] In a preferred embodiment of this aspect of the invention
there are provided methods for producing the polypeptides
comprising culturing host cells having expressibly incorporated
therein a polynucleotide under conditions for expression of phytate
biosynthetic enzymes in the host and then recovering the expressed
polypeptide.
[0046] In accordance with another object of the invention there are
provided products, compositions, processes and methods that utilize
the aforementioned polypeptides and polynucleotides, for purposes
including research, biological, and agricultural.
[0047] In accordance with yet another aspect of the present
invention, there are provided inhibitors to such polypeptides,
useful for modulating the activity and/or expression of the
polypeptides. In particular, there are provided antibodies against
such polypeptides.
[0048] In accordance with certain embodiments of the invention
there are probes that hybridize to phytate biosynthetic enzyme
polynucleotide sequences useful as molecular markers in breeding
programs.
[0049] In certain additional preferred embodiments of this aspect
of the invention there are provided antibodies against the phytate
biosynthetic enzymes. In certain particularly preferred embodiments
in this regard, the antibodies are selective for the entire class
the phytate biosynthetic enzymes, irrespective of species of origin
as well as species-specificantibodies, such as antibodies capable
of specific immune reactivity with for example, Zea mays phytate
biosynthetic enzymes.
[0050] In accordance with yet another aspect of the present
invention, there are provided phytate enzyme antagonists. Among
preferred antagonists are those which bind to phytate biosynthetic
enzymes so as to inhibit the binding of binding molecules or to
stabilize the complex formed between the phytate biosynthetic
enzyme and the binding molecule to prevent further biological
activity arising from the phytate biosynthetic enzyme. Also among
preferred antagonists are molecules that bind to or interact with
phytate biosynthetic enzymes so as to inhibit one or more effects
of a particular phytate biosynthetic enzyme or which prevent
expression of the enzyme and which also preferably result in a
lowering of phytic acid accumulation.
[0051] Other objects, features, advantages and aspects of the
present invention will become apparent to those of skill from the
following description. It should be understood, however, that the
following description and the specific examples, while indicating
preferred embodiments of the invention, are given by way of
illustration only. Various changes and modifications within the
spirit and scope of the disclosed invention will become readily
apparent to those skilled in the art from reading the following
description and from reading the other parts of the present
disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0052] This invention relates, in part, to newly identified
polynucleotides and polypeptides; variants and derivatives of these
polynucleotides and polypeptides; processes for making these
polynucleotides and these polypeptides, and their variants and
derivatives and antagonists of the polypeptides; and uses of these
polynucleotides, polypeptides, variants, derivatives and
antagonists. In particular, in these and in other regards, the
invention relates to polynucleotides and polypeptides of the
phytate metabolic pathway, most particularly with the enzymes
phosphatidylinositol 3-kinase, myo-inositol monophosphatase-3,
myo-inositol 1 ,3,4-triphosphate 5/6 kinase and myo-inositol
1-phosphate synthase and genes encoding same.
[0053] Glossary
[0054] The following illustrative explanations are provided to
facilitate understanding of certain terms used frequently herein,
particularly in the Examples. The explanations are provided as a
convenience and are not limitative of the invention.
[0055] PHYTATE BIOSYNTHETIC ENZYME-BINDING MOLECULE, as used
herein, refers to molecules or ions which bind or interact
specifically with phytate biosynthetic enzyme polypeptides or
polynucleotides of the present invention, including, for example
enzyme substrates, cell membrane components and classical
receptors. Binding between polypeptides of the invention and such
molecules, including binding or interaction molecules may be
exclusive to polypeptides of the invention, which is preferred, or
it may be highly specific for polypeptides of the invention, which
is also preferred, or it may be highly specific to a group of
proteins that includes polypeptides of the invention, which is
preferred, or it may be specific to several groups of proteins at
least one of which includes a polypeptide of the invention. Binding
molecules also include antibodies and antibody-derived reagents
that bind specifically to polypeptides of the invention.
[0056] GENETIC ELEMENT, as used herein, generally means a
polynucleotide comprising a region that encodes a polypeptide or a
polynucleotide region that regulates replication, transcription or
translation or other processes important to expression of the
polypeptide in a host cell, or a polynucleotide comprising both a
region that encodes a polypeptide and a region operably linked
thereto that regulates expression. Genetic elements may be
comprised within a vector that replicates as an episomal element;
that is, as a molecule physically independent of the host cell
genome. They may be comprised within plasmids. Genetic elements
also may be comprised within a host cell genome; not in their
natural state but, rather, following manipulation such as
isolation, cloning and introduction into a host cell in the form of
purified DNA or in a vector, among others.
[0057] HOST CELL, as used herein, is a cell which has been
transformed or transfected, or is capable of transformation or
transfection by an exogenous polynucleotide sequence. Exogenous
polynucleotide sequence is defined to mean a sequence not naturally
in the cell. This includes transformation to incorporate additional
copies of an endogenous polynucleotide.
[0058] IDENTITY and SIMILARITY, as used herein, and as known in the
art, are relationships between two polypeptide sequences or two
polynucleotide sequences, as determined by comparing the sequences.
In the art, identity also means the degree of sequence relatedness
between two polypeptide or two polynucleotide sequences as
determined by the match between two strings of such sequences. Both
identity and similarity can be readily calculated (Computational
Molecular Biology, Lesk, A. M., ed., Oxford University Press, New
York, 1988; Biocomputing: Informatics and Genome Projects, Smith,
D. W., ed., Academic Press, New York, 1993; Computer Analysis of
Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds.,
Humana Press, New Jersey, 1994; Sequence Analysis in Molecular
Biology, von Heinje, G., Academic Press, 1987; and Sequence
Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton
Press, New York, 1991). Methods commonly employed to determine
identity or similarity between two sequences include, but are not
limited to those disclosed in Carillo, H., and Lipman, D., SIAM J.
Applied Math. 48:1073 (1988). Preferred methods to determine
identity are designed to give the largest match between the two
sequences tested. Methods to determine identity and similarity are
codified in computer programs. Typical computer program methods to
determine identity and similarity between two sequences include,
GCG program package (Devereux, J., et al., Nucleic Acids Research
12(1):387 (1984)), BLASTP, BLASTN, FASTA and TFASTA (Atschul, S. F.
et al., J. Mol. Biol. 215:403 (1990)).
[0059] For purposes of defining the present invention, the Gap
program is used. The algorithm used for the Gap program is that of
Needleman and Wunsch (J. Mol. Biol. 48:443-453 [1970]). The
parameters used are as follows: for nucleotide comparisons the gap
creation penalty=50, gap extension penalty=3; for amino acid
comparisons the gap creation penalty=12, the gap extension
penalty=4.
[0060] ISOLATED, as used herein, means altered "by the hand of man"
from its natural state; i.e., that, if it occurs in nature, it has
been changed or removed from its original environment, or both. For
example, a naturally occurring polynucleotide or a polypeptide
naturally present in a living organism in its natural state is not
"isolated," but the same polynucleotide or polypeptide separated
from the coexisting materials of its natural state is "isolated",
as the term is employed herein. For example, with respect to
polynucleotides, the term isolated means that it is separated from
the chromosome and cell in which it naturally occurs. As part of or
following isolation, such polynucleotides can be joined to other
polynucleotides, such as DNAs, for mutagenesis, to form fusion
proteins, and for propagation or expression in a host, for
instance. The isolated polynucleotides, alone or joined to other
polynucleotides such as vectors, can be introduced into host cells,
in culture or in whole organisms. Introduced into host cells in
culture or in whole organisms, such DNAs still would be isolated,
as the term is used herein, because they would not be in their
naturally occurring form or environment. Similarly, the
polynucleotides and polypeptides may occur in a composition, such
as media formulations, solutions for introduction of
polynucleotides or polypeptides, for example, into cells,
compositions or solutions for chemical or enzymatic reactions, for
instance, which are not naturally occurring compositions, and,
therein remain isolated polynucleotides or polypeptides within the
meaning of that term as it is employed herein.
[0061] LIGATION, as used herein, refers to the process of forming
phosphodiester bonds between two or more polynucleotides, which
most often are double stranded DNAs. Techniques for ligation are
well known to the art and protocols for ligation are described in
standard laboratory manuals and references, such as, for instance,
Sambrooket al., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York
(1989) and Maniatis et al., pg. 146, as cited below.
[0062] OLIGONUCLEOTIDE(S), as used herein, refers to short
polynucleotides. Often the term refers to single-stranded
deoxyribonucleotides, but it can refer as well to single- or
double-stranded ribonucleotides, RNA:DNA hybrids and
double-stranded DNAs, among others. Oligonucleotides, such as
single-stranded DNA probe oligonucleotides, often are synthesized
by chemical methods, such as those implemented on automated
oligonucleotide synthesizers. However, oligonucleotides can be made
by a variety of other methods, including in vitro recombinant
DNA-mediated techniques and by expression of DNAs in cells and
organisms. Initially, chemically synthesized DNAs typically are
obtained without a 5' phosphate. The 5' ends of such
oligonucleotides are not substrates for phosphodiester bond
formation by ligation reactions that employ DNA ligases typically
used to form recombinant DNA molecules. Where ligation of such
oligonucleotides is desired, a phosphate can be added by standard
techniques, such as those that employ a kinase and ATP. The 3' end
of a chemically synthesized oligonucleotide generally has a free
hydroxyl group and, in the presence of a ligase, such as T4 DNA
ligase, readily will form a phosphodiester bond with a 5' phosphate
of another polynucleotide, such as another oligonucleotide. As is
well known, this reaction can be prevented selectively, where
desired, by removing the 5' phosphates of the other
polynucleotide(s) prior to ligation.
[0063] PLANT, as used herein, includes, but is not limited to plant
cells, plant tissue and plant seeds.
[0064] PLASMIDS, as used herein, generally are designated herein by
a lower case p preceded and/or followed by capital letters and/or
numbers, in accordance with standard naming conventions that are
familiar to those of skill in the art. Starting plasmids disclosed
herein are either commercially available, publicly available, or
can be constructed from available plasmids by routine application
of well known, published procedures. Many plasmids and other
cloning and expression vectors that can be used in accordance with
the present invention are well known and readily available to those
of skill in the art. Moreover, those of skill readily may construct
any number of other plasmids suitable for use in the invention. The
properties, construction and use of such plasmids, as well as other
vectors, in the present invention will be readily apparent to those
of skill from the present disclosure.
[0065] POLYNUCLEOTIDE(S), as used herein, generally refers to any
polyribonucleotide or polydeoxribonucleotide, which may be
unmodified RNA or DNA or modified RNA or DNA. Thus, for instance,
polynucleotides as used herein refers to, among others, single-and
double-stranded DNA, DNA that is a mixture of single- and
double-stranded regions or single-, double- and triple-stranded
regions, single- and double-stranded RNA, and RNA that is mixture
of single- and double-stranded regions, hybrid molecules comprising
DNA and RNA that may be single-stranded or, more typically,
double-stranded, or triple-stranded, or a mixture of single- and
double-stranded regions. In addition, polynucleotide as used herein
refers to triple-stranded regions comprising RNA or DNA or both RNA
and DNA. The strands in such regions may be from the same molecule
or from different molecules. The regions may include all of one or
more of the molecules, but more typically involve only a region of
some of the molecules. One of the molecules of a triple-helical
region often is an oligonucleotide. As used herein, the term
polynucleotide includes DNAs or RNAs as described above that
contain one or more modified bases. Thus, DNAs or RNAs with
backbones modified for stability or for other reasons are
"polynucleotides" as that term is intended herein. Moreover, DNAs
or RNAs comprising unusual bases, such as inosine, or modified
bases, such as tritylated bases, to name just two examples, are
polynucleotides as the term is used herein. It will be appreciated
that a great variety of modifications have been made to DNA and RNA
that serve many useful purposes known to those of skill in the art.
The term polynucleotide as it is employed herein embraces such
chemically, enzymatically or metabolically modified forms of
polynucleotides, as well as the chemical forms of DNA and RNA
characteristic of viruses and cells, including interalia, simple
and complex cells.
[0066] POLYPEPTIDES, as used herein, includes all polypeptides as
described below. The basic structure of polypeptides is well known
and has been described in innumerable textbooks and other
publications in the art. In this context, the term is used herein
to refer to any peptide or protein comprising two or more amino
acids joined to each other in a linear chain by peptide bonds. As
used herein, the term refers to both short chains, which also
commonly are referred to in the art as peptides, oligopeptides and
oligomers, for example, and to longer chains, which generally are
referred to in the art as proteins, of which there are many types.
It will be appreciated that polypeptides often contain amino acids
other than the 20 amino acids commonly referred to as the 20
naturally occurring amino acids, and that many amino acids,
including the terminal amino acids, may be modified in a given
polypeptide, either by natural processes, such as processing and
other post-translational modifications, but also by chemical
modification techniques which are well known to the art. Even the
common modifications that occur naturally in polypeptides are too
numerous to list exhaustively here, but they are well described in
basic texts and in more detailed monographs, as well as in a
voluminous research literature, and they are well known to those of
skill in the art. Among the known modifications which may be
present in polypeptides of the present are, to name an illustrative
few, acetylation, acylation, ADP-ribosylation, amidation, covalent
attachment of flavin, covalent attachment of a heme moiety,
covalent attachment of a nucleotide or nucleotide derivative,
covalent attachment of a lipid or lipid derivative, covalent
attachment of phosphatidylinositol, cross-linking, cyclization,
disulfide bond formation, demethylation, formation of covalent
cross-links, formation of cystine, formation of pyroglutamate,
formylation, gamma-carboxylation, glycosylation, GPI anchor
formation, hydroxylation, iodination, methylation, myristoylation,
oxidation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination. Such modifications are well known to those of skill
and have been described in great detail in the scientific
literature. Several particularly common modifications,
glycosylation, lipid attachment, sulfation, gamma-carboxylation of
glutamic acid residues, hydroxylation and ADP-ribosylation, for
instance, are described in most basic texts, such as, for instance
PROTEINS--STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E.
Creighton, W. H. Freeman and Company, New York (1993). Many
detailed reviews are available on this subject, such as, for
example, those provided by Wold, F., Posttranslational Protein
Modifications: Perspectives and Prospects, pgs. 1-12 in
POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson,
Ed., Academic Press, New York (1983); Seifter et al., Meth.
Enzymol. 182:626-646 (1990) and Rattan et al., Protein Synthesis:
Posttranslational Modifications and Aging, Ann. N.Y. Acad. Sci.
663:48-62 (1992). It will be appreciated, as is well known and as
noted above, that polypeptides are not always entirely linear. For
instance, polypeptides may be branched as a result of
ubiquitination, and they may be circular, with or without
branching, generally as a result of posttranslation events,
including natural processing event and events brought about by
human manipulation which do not occur naturally. Circular, branched
and branched circular polypeptides may be synthesized by
non-translation natural process and by entirely synthetic methods,
as well. Modifications can occur anywhere in a polypeptide,
including the peptide backbone, the amino acid side-chains and the
amino or carboxyl termini. In fact, blockage of the amino or
carboxyl group in a polypeptide, or both, by a covalent
modification, is common in naturally occurring and synthetic
polypeptides and such modifications may be present in polypeptides
of the present invention, as well. For instance, the amino terminal
residue of polypeptides made in E. coli or other cells, prior to
proteolytic processing, almost invariably will be
N-formylmethionine. During posttranslational modification of the
peptide, a methionine residue at the NH.sub.2-terminus may be
deleted. Accordingly, this invention contemplates the use of both
the methionine-containing and the methionine-less amino terminal
variants of the protein of the invention. The modifications that
occur in a polypeptide often will be a function of how it is made.
For polypeptides made by expressing a cloned gene in a host, for
instance, the nature and extent of the modifications in large part
will be determined by the host cell post-translational modification
capacity and the modification signals present in the polypeptide
amino acid sequence. For instance, as is well known, glycosylation
often does not occur in bacterial hosts such as, for example, E.
coli. Accordingly, when glycosylation is desired, a polypeptide
should be expressed in a glycosylating host, generally a eukaryotic
cell. Similar considerations apply to other modifications. It will
be appreciated that the same type of modification may be present in
the same or varying degree at several sites in a given polypeptide.
Also, a given polypeptide may contain many types of modifications.
In general, as used herein, the term polypeptide encompasses all
such modifications, particularly those that are present in
polypeptides synthesized by expressing a polynucleotide in a host
cell.
[0067] TRANSFORMATION, as used herein, is the process by which a
cell is "transformed" by exogenous DNA when such exogenous DNA has
been introduced inside the cell membrane. Exogenous DNA may or may
not be integrated (covalently linked) into chromosomal DNA making
up the genome of the cell. In prokaryotes and yeasts, for example,
the exogenous DNA may be maintained on an episomal element, such as
a plasmid. With respect to higher eukaryotic cells, a stably
transformed or transfected cell is one in which the exogenous DNA
has become integrated into the chromosome so that it is inherited
by daughter cells through chromosome replication. This stability is
demonstrated by the ability of the eukaryotic cell to establish
cell lines or clones comprised of a population of daughter cells
containing the exogenous DNA.
[0068] VARIANT(S), as used herein, of polynucleotides or
polypeptides, as the term is used herein, are polynucleotides or
polypeptides that differ from a reference polynucleotide or
polypeptide, respectively. Variants in this sense are described
below and elsewhere in the present disclosure in greater detail.
With reference to polynucleotides, generally, differences are
limited such that the nucleotide sequences of the reference and the
variant are closely similar overall and, in many regions,
identical. As noted below, changes in the nucleotide sequence of
the variant may be silent. That is, they may not alter the amino
acids encoded by the polynucleotide. Where alterations are limited
to silent changes of this type, a variant will encode a polypeptide
with the same amino acid sequence as the reference. Also as noted
is below, changes in the nucleotide sequence of the variant may
alter the amino acid sequence of a polypeptide encoded by the
reference polynucleotide. Such nucleotide changes may result in
amino acid substitutions, additions, deletions, fusions and
truncations in the polypeptide encoded by the reference sequence,
as discussed below. With reference to polypeptides generally,
differences are limited so that the sequences of the reference and
the variant are closely similar overall and, in many regions,
identical. A variant and reference polypeptide may differ in amino
acid sequence by one or more substitutions, additions, deletions,
fusions and truncations, which may be present in any
combination.
[0069] GERMPLASM, as used herein, means a set of genetic entities
which may be used in a conventional breeding program to develop new
plant varieties.
[0070] HIGH PHOSPHOROUS TRANSGENIC, as used herein, means an entity
which, as a result of recombinant genetic manipulation, produces
seed with a heritable decrease in phytic acid percentage and/or
increase in non-phytate phosphorous percentage.
[0071] PHYTIC ACID, as used herein, means myo-inositol
tetraphosphoric acid, myo-inositol pentaphosphoric acid and
myo-inositol hexaphosphoric acid. As a salt with cations, phytic
acid is "phytate".
[0072] NON-PHYTATE PHOSPHOROUS, as used herein, means total
phosphorus minus phytate phosphorous.
[0073] NON-RUMINANT ANIMAL means an animal with a simple stomach
divided into the esophageal, cardia, fundus and pylorus regions. A
non-ruminant animal additionally implies a species of animal
without a functional rumen. A rumen is a section of the digestive
system where feedstuff/food is soaked and subjected to digestion by
micro-organisms before passing on through the digestive tract. This
phenomenon does not occur in a non-ruminant animal. The term
non-ruminant animal includes but is not limited to humans, swine,
poultry, cats and dogs.
[0074] As mentioned above, the present invention relates to novel
phytic acid metabolic polypeptides and polynucleotides encoding
same, among other things, as described in greater detail below.
Among the polypeptides particularly useful for the practice of this
invention include but are not limited to D-myo-inositol-3-phosphate
synthase, myo-inositol 1-phosphate synthase (otherwise referred to
as IN01), phosphatidylinositol-4-phosphate-5-kinase, signaling
inositol polyphosphate-5-phosphatase (SIP-110), myo-inositol
monophosphatase-3, myo-inositol 1,3,4 triphosphate 5/6 kinase, 1
D-myo-inositol trisphosphate 3-kinase B, myo-inositol
monophosphatase-1, inositol polyphosphate 5-phosphatase, 1
D-myo-inositol trisphosphate 3-kinase, phosphatidylinositol
3-kinase, phosphatidylinositol 4-kinase,
phosphatidylinositolsynthase, phosphatidylinositol transfer
protein, phosphatidylinositol 4,5-bisphosphate 5-phosphatase,
myo-inositol transporter, phosphatidylinositol-specific
phospholipase C and maize phytase.
[0075] The nucleic acids and fragments thereof encoding the
above-mentioned enzymes are useful to generate enzyme deficient
transgenics. For example, a single gene or gene fragment (or
combinations of several genes) may be incorporated into an
appropriate expression cassette (using for example the globulin-1
promoter for embryo-preferred expression or the native promoter
associated with the enzyme encoding gene) and transformed into corn
along with an appropriate selectable marker (such as the herbicide
PAT) in such a manner as to silence the expression of the
endogenous genes.
[0076] Relevant literature describing the application of
homology-dependent gene silencing include: Jorgensen, Trends
Biotechnol 8 (12):340-344 (1990); Flavell, Proc. Nat'l. Acad. Sci.
(USA) 91:3490-3496 (1994); Finnegan et al., Bio/Technology 12:
883-888 (1994); Neuhuberet al., Mol. Gen. Genet. 244:230-241
(1994). Alternatively, another approach to gene silencing can be
with the use of antisense technology (Rothstein et al. in Osf.
Surv. Plant Mol. Cell. Biol. 6:221-246 (1989).
[0077] In particular, the invention relates to polypeptides and
polynucleotides of novel phytate biosynthetic enzyme genes. The
invention relates especially to Zea mays phytate biosynthetic
enzymes having the nucleotide and amino acid sequences set out
below respectively.
[0078] Polynucleotides
[0079] In accordance with one aspect of the present invention,
there are provided isolated polynucleotides which encode the
phytate biosynthetic enzymes having the deduced amino acid sequence
below.
[0080] Using the information provided herein, such as the
polynucleotide sequences set out below, a polynucleotide of the
present invention encoding phytate biosynthetic enzyme polypeptides
may be obtained using standard cloning and screening procedures. To
obtain the polynucleotide encoding the protein using the DNA
sequences given below, oligonucleotide primers can be synthesized
that are complementary to the known polynucleotide sequence. These
primers can then be used in PCR to amplify the polynucleotide from
template derived from mRNA or genomic DNA isolated from plant
material. The resulting amplified products can then be cloned into
commercially available cloning vectors, such as the TA series of
vectors from InVitrogen. By sequencing the individual clones thus
identified with sequencing primers designed from the original
sequence, it is then possible to extend the sequence in both
directions to determine the full gene sequence. Such sequencing is
performed using denatured double stranded DNA prepared from a
plasmid clone. Suitable techniques are described by Maniatis, T.,
Fritsch, E. F. and Sambrook, J. in MOLECULAR CLONING, A Laboratory
Manual (2nd edition 1989 Cold Spring Harbor Laboratory. See
Sequencing Denatured Double-Stranded DNA Templates 13.70).
Illustrative of the invention, the polynucleotide set out below
were assembled from a cDNA library derived for example, from
germinating maize seeds.
[0081] Myo-inositol 1-phosphate synthase of the present invention
is structurally related to other proteins of the myo-inositol
1-phosphate synthase family, as shown by comparing the present
sequence encoding myo-inositol 1-phosphate synthase with sequences
reported in the literature. A preferred DNA sequence is set out
below. It contains an open reading frame encoding a protein of
about 510 amino acid residues with a deduced molecular weight of
about 59.7 (calculated as the number of amino acid residues X 117)
kDa. The protein exhibits greatest homology to
myo-inositol-1-phosphate synthase. The present myo-inositol
1-phosphate synthase has about 88% identity and about 92%
similarity with the amino acid sequence of myo-inositol-1-phosphate
synthase from Mesembryantherum crystallium and 78.7% identity at
the nucleic acid level. (These percentages are based on comparison
of full-length coding sequence only, i.e., ATG through stop
codon).
[0082] Myo-inositol monophosphatase-3 of the invention is
structurally related to other proteins of the myo-inositol
monophosphatase-3family, as shown by comparing the present sequence
encoding myo-inositol monophosphatase-3with that of sequence
reported in the literature. A preferred DNA sequence is set out
below. It contains an open reading frame encoding a protein of
about 267 amino acid residues with a deduced molecular weight of
about 31.2 kDa (calculated as the number of amino acid residues X
117). Novel myo-inositol monophosphatase-3identified by homology
between the amino acid sequence set out below and known amino acid
sequences of other proteins such as myo-inositol
monophosphatase-3from Lycopersicum esulentum with 76.1% identity/8
1.1% similarity at the amino acid level and 67.9% identity at the
nucleic acid level. (These percentages are based on comparison of
full-length coding sequence only, i.e., ATG through stop
codon).
[0083] Myo-inositol 1,3,4-trisphosphate5/6-kinase of the invention
is structurally related to other proteins of the myo-inositol
1,3,4-trisphosphate5/6-kinase family, as shown by comparing the
sequence encoding the present inositol 1,3,4-trisphosphate
5/6-kinase with that of sequence reported in the literature. A
preferred DNA sequence is set out below. It contains an open
reading frame encoding a protein of about 353 amino acid residues
with a deduced molecular weight of about 41.3 kDa (calculated as
the number of amino acid residues X 1 17). The protein exhibits
greatest homology to myo-inositol 1,3,4-trisphosphate5/6-kinase
from Homo sapiens. myo-inositol 1,3,4-trisphosphate 5/6-kinase
below has about 34% identity and about 43.4% similarity with the
amino acid sequence of myo-inositol 1,3,4-trisphosphate5/6-kinase
from Homo sapiens. (The percentages disclosed above are based on
comparison of full-length coding sequence only, i.e., ATG through
stop codon.)
[0084] A preferred phosphatidylinositol3-kinase sequence is set out
below. It contains an open reading frame encoding a protein of
about 803 amino acid residues with a deduced molecular weight of
about 94.1 kDa (calculated as the number of amino acid residues X
117). The protein exhibits greatest homology to
phosphatidylinositol 3-kinase from Glycine max. Homology between
amino acid sequences set out in the following sequences and known
amino acid sequences of other proteins such as phosphatidylinositol
3-kinase from Glycine max with 78% identity/84% similarity at the
amino acid level and 73% identity at the nucleic acid level (these
percentages are based on comparison of full-length coding sequence
only i.e., ATG through stop codon) based on the Gap program defined
below.
[0085] Polynucleotides of the present invention may be in the form
of RNA, such as mRNA, or in the form of DNA, including, for
instance, cDNA and genomic DNA obtained by cloning or produced by
chemical synthetic techniques or by a combination thereof. The DNA
may be double-stranded or single-stranded. Single-stranded DNA may
be the coding strand, also known as the sense strand, or it may be
the non-coding strand, also referred to as the antisense
strand.
[0086] The coding sequence which encodes the polypeptide may be
identical to the coding sequence of the polynucleotides shown
below. It also may be a polynucleotide with a different sequence,
which, as a result of the redundancy (degeneracy) of the genetic
code, encodes the polypeptides shown below. As discussed more fully
below, these alternative coding sequences are an important source
of sequences for codon optimization.
[0087] Polynucleotides of the present invention which encode the
polypeptides listed below may include, but are not limited to the
coding sequence for the mature polypeptide, by itself; the coding
sequence for the mature polypeptide and additional coding
sequences, such as those encoding a leader or secretory sequence,
such as a pre-, or pro- or prepro- protein sequence; the coding
sequence of the mature polypeptide, with or without the
aforementioned additional coding sequences, together with
additional, non-coding sequences, including for example, but not
limited to non-coding 5' and 3' sequences, such as the transcribed,
non-translated sequences that play a role in transcription
(including termination signals, for example), ribosome binding,
mRNA stability elements, and additional coding sequence which
encode additional amino acids, such as those which provide
additional functionalities.
[0088] The DNA may also comprise promoter regions which function to
direct the transcription of the mRNA encoding phytate biosynthetic
enzymes of this invention. Such promoters may be independently
useful to direct the transcription of heterologous genes in
recombinant expression systems. Heterologous is defined as a
sequence that is not naturally occurring with the promoter
sequence. While the nucleotide sequence is heterologous to the
promoter sequence, it may be homologous, or native, or
heterologous, or foreign to the plant host.
[0089] Furthermore, the polypeptide may be fused to a marker
sequence, such as a peptide, which facilitates purification of the
fused polypeptide. In certain embodiments of this aspect of the
invention, the marker sequence is a hexa-histidine peptide, such as
the tag provided in the pQE vector (Qiagen, Inc.) and the pET
series of vectors (Novagen), among others, many of which are
commercially available. As described in Gentz et al., Proc. Nat'l.
Acad. Sci., (USA) 86:821-824 (1989), for instance, hexa-histidine
provides for convenient purification of the fusion protein. The HA
tag may also be used to create fusion proteins and corresponds to
an epitope derived of influenza hemagglutinin protein, which has
been described by Wilson et al., Cell 37:767 (1984), for
instance.
[0090] In accordance with the foregoing, the term "polynucleotide
encoding a polypeptide" as used herein encompasses polynucleotides
which include a sequence encoding a polypeptide of the present
invention, particularly plant, and more particularly Zea mays
phytate biosynthetic enzymes having the amino acid sequence set out
below. The term encompasses polynucleotides that include a single
continuous region or discontinuous regions encoding the polypeptide
(for example, interrupted by integrated phage or insertion sequence
or editing) together with additional regions, that also may contain
coding and/or non-coding sequences.
[0091] The present invention further relates to variants of the
present polynucleotides which encode for fragments, analogs and
derivatives of the polypeptides having the deduced amino acid
sequence below. A variant of the polynucleotide may be a naturally
occurring variant such as a naturally occurring allelic variant, or
it may be a variant that is not known to occur naturally. Such
non-naturally occurring variants of the polynucleotide may be made
by mutagenesis techniques, including those applied to
polynucleotides, cells or organisms.
[0092] Among variants in this regard are variants that differ from
the aforementioned polynucleotides by nucleotide substitutions,
deletions or additions. The substitutions may involve one or more
nucleotides. The variants may be altered in coding or non-coding
regions or both. Alterations in the coding regions may produce
conservative or non-conservative amino acid substitutions,
deletions or additions.
[0093] Among the particularly preferred embodiments of the
invention in this regard are polynucleotides encoding polypeptides
having the amino acid sequences set out below; variants, analogs,
derivatives and fragments thereof.
[0094] Further particularly preferred in this regard are
polynucleotides encoding phytate biosynthetic enzyme variants,
analogs, derivatives and fragments, and variants, analogs and
derivatives of the fragments, which have the amino acid sequences
below in which several, a few, 1 to 10, 1 to 5, 1 to 3, 2, 1 or no
amino acid residues are substituted, deleted or added, in any
combination. Especially preferred among these are silent
substitutions, additions and deletions, which do not alter the
properties and activities of the phytate biosynthetic enzymes. Also
especially preferred in this regard are conservative substitutions.
Most highly preferred are polynucleotides encoding polypeptides
having the amino acid sequence below, without substitutions.
[0095] Further preferred embodiments of the invention are
polynucleotides that are greater than 79%, preferably at least 80%,
more preferably at least 85% identical to a polynucleotide encoding
myo-inositol 1-phosphate synthase polypeptide having the amino acid
sequence set out below, and polynucleotides which are complementary
to such polynucleotides. Among these particularly preferred
polynucleotides, those with at least 90%, 95%, 98% or at least 99%
are especially preferred.
[0096] Further preferred embodiments of the invention are
polynucleotides that are greater than 70%, preferably at least 75%,
more preferably at least 80% identical to a polynucleotide encoding
myo-inositol monophosphatase-3polypeptide having the amino acid
sequence set out below, and polynucleotides which are complementary
to such polynucleotides. Among these particularly preferred
polynucleotides, those with at least 85%, 90%, 95%, 98% or at least
99% are especially preferred.
[0097] Further preferred embodiments of the invention are
polynucleotides that are greater than 45%, preferably at least 50%,
more preferably at least 55%, still more preferably at least 60%
identical to a polynucleotide encoding myo-inositol
1,3,4-triphosphate 5/6-kinase polypeptide having the amino acid
sequence set out below, and polynucleotides which are complementary
to such polynucleotides. Among these particularly preferred
polynucleotides, those with at least 65%, 70%, 75%, 80%, 85%, 90%,
95%, 98% or at least 99% are especially preferred.
[0098] Further preferred embodiments of the invention are
polynucleotides that are greater than 73%, preferably at least 75%,
more preferably at least 80% identical to a polynucleotide encoding
phosphatidylinositol 3-kinase polypeptide having the amino acid
sequence set out below, and polynucleotides which are complementary
to such polynucleotides. Among these particularly preferred
polynucleotides, those with at least 85%, 90%, 95%, 98% or at least
99% are especially preferred.
[0099] Particularly preferred embodiments in this respect,
moreover, are polynucleotides which encode polypeptides which
retain substantially the same or even exhibit a reduction in the
biological function or activity as the mature polypeptide encoded
by the polynucleotides set out below.
[0100] The present invention further relates to polynucleotides
that hybridize to the herein above-described sequences. In this
regard, the present invention especially relates to polynucleotides
which hybridize under stringent conditions to the herein
above-described polynucleotides. As herein used, the term
"stringent conditions" means hybridization will occur only if there
is at least 95% and preferably at least 97% identity between the
sequences.
[0101] The terms "stringent conditions" or "stringent hybridization
conditions" includes reference to conditions under which a probe
will hybridize to its target sequence, to a detectably greater
degree than other sequences (e.g., at least 2-fold over
background). Stringent conditions are sequence-dependent and will
be different in different circumstances. By controlling the
stringency of the hybridization and/or washing conditions, target
sequences can be identified which are 100% complementary to the
probe (homologous probing). Alternatively, stringency conditions
can be adjusted to allow some mismatching in sequences so that
lower degrees of similarity are detected (heterologous probing).
Generally, a probe is less than about 1000 nucleotides in length,
preferably less than 500 nucleotides in length.
[0102] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 37.degree.
C., and a wash in 1.times. to 2.times. SSC (20.times. SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times. SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times. SSC at 60
to 65.degree. C.
[0103] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation of Meinkoth and Wahl,
Anal. Biochem., 138:267-284 (1984): T.sub.m=81.5.degree. C.+16.6
(log M)+0.41 (%GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, %GC is the percentage of guanosine and cytosine
nucleotides in the DNA, % form is the percentage of formamide in
the hybridization solution, and L is the length of the hybrid in
base pairs. The T.sub.m is the temperature (under defined ionic
strength and pH) at which 50% of a complementary target sequence
hybridizes to a perfectly matched probe. T.sub.m is reduced by
about 1.degree. C. for each 1% of mismatching; thus, T.sub.m,
hybridization and/or wash conditions can be adjusted to hybridize
to sequences of the desired identity. For example, if sequences
with .gtoreq.90% identity are sought, the Tm can be decreased
10.degree. C. Generally, stringent conditions are selected to be
about 5.degree. C. lower than the thermal melting point (T.sub.m)
for the specific sequence and its complement at a defined ionic
strength and pH. However, severely stringent conditions can utilize
a hybridization and/or wash at 1, 2, 3, or 4.degree. C. lower than
the thermal melting point (T.sub.m); moderately stringent
conditions can utilize a hybridization and/or wash at 6, 7, 8, 9,
or 10.degree. C. lower than the thermal melting point (T.sub.m);
low stringency conditions can utilize a hybridization and/or wash
at 11, 12, 13, 14, 15, or 20.degree. C. lower than the thermal
melting point (T.sub.m). Using the equation, hybridization and wash
compositions, and desired T.sub.m, those of ordinary skill will
understand that variations in the stringency of hybridization
and/or wash solutions are inherently described. If the desired
degree of mismatching results in a T.sub.m of less than 45.degree.
C. (aqueous solution) or 32.degree. C. (formamide solution) it is
preferred to increase the SSC concentration so that a higher
temperature can be used. An extensive guide to the hybridization of
nucleic acids is found in Tijssen, Laboratory Techniques in
Biochemistry and Molecular Biology--Hybridization with Nucleic Acid
Probes, Part I, Chapter 2 "Overview of principles of hybridization
and the strategy of nucleic acid probe assays", Elsevier, New York
(1993); and Current Protocols in Molecular Biology, Chapter 2,
Ausubel et al., Eds., Greene Publishing and Wiley-Interscience, New
York (1995).
[0104] As discussed additionally herein regarding polynucleotide
assays of the invention, for instance, polynucleotides of the
invention as discussed above, may be used as a hybridization probe
for RNA, cDNA and genomic DNA to isolate full-length cDNAs and
genomic clones encoding phytate biosynthetic enzymes and to isolate
cDNA and genomic clones of other genes that have a high sequence
similarity to the genes. Such probes generally will comprise at
least 15 bases. Preferably, such probes will have at least 30 bases
and may have at least 50 bases. Particularly preferred probes will
have at least 30 bases and will have 50 bases or less.
[0105] The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials for
discovery of high phosphorous transgenic corn plants. The
polynucleotides of the invention that are oligonucleotides, derived
from the sequences below may be used as PCR primers in the process
herein described to determine whether or not the genes identified
herein in whole or in part are transcribed in phytic acid
accumulating tissue.
[0106] The polynucleotides may encode a polypeptide which is the
mature protein plus additional amino or carboxyl-terminal amino
acids, or amino acids interior to the mature polypeptide (when the
mature form has more than one polypeptide chain, for instance).
Such sequences may play a role in processing of a protein from
precursor to a mature form, may allow protein transport, may
lengthen or shorten protein half-life or may facilitate
manipulation of a protein for assay or production, among other
things. As generally is the case in vivo, the additional amino
acids may be processed away from the mature protein by cellular
enzymes.
[0107] A precursor protein, having the mature form of the
polypeptide fused to one or more prosequences may be an inactive
form of the polypeptide. When prosequences are removed such
inactive precursors generally are activated. Some or all of the
prosequences may be removed before activation. Generally, such
precursors are called proproteins.
[0108] In sum, a polynucleotide of the present invention may encode
a mature protein, a mature protein plus a leader sequence (which
may be referred to as a preprotein), a precursor of a mature
protein having one or more prosequences which are not the leader
sequences of a preprotein, or a preproprotein, which is a precursor
to a proprotein, having a leader sequence and one or more
prosequences, which generally are removed during processing steps
that produce active and mature forms of the polypeptide.
[0109] Polypeptides
[0110] The present invention further relates to polypeptides that
have the deduced amino acid sequences below.
[0111] The invention also relates to fragments, analogs and
derivatives of these polypeptides. The terms "fragment,"
"derivative" and "analog" when referring to the polypeptides, means
a polypeptide which retains essentially the same biological
function or activity as such polypeptide. Fragments derivatives and
analogs that retain at least 90% of the activity of the native
phytate biosynthetic enzymes are preferred. Fragments, derivatives
and analogs that retain at least 95% of the activity of the native
polypeptides are preferred. Thus, an analog includes a proprotein
which can be activated by cleavage of the proprotein portion to
produce an active mature polypeptide.
[0112] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide. In certain preferred embodiments it is a recombinant
polypeptide.
[0113] The fragment, derivative or analog of the polypeptides below
may be (i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptide or a proprotein sequence. Such fragments,
derivatives and analogs are deemed to be obtained by those of
ordinary skill in the art, from the teachings herein.
[0114] Among the particularly preferred embodiments of the
invention in this regard are polypeptides having the amino acid
sequence of phytate biosynthetic enzymes set out below, variants,
analogs, derivatives and fragments thereof, and variants, analogs
and derivatives of the fragments.
[0115] Among preferred variants are those that vary from a
reference by conservative amino acid substitutions. Such
substitutions are those that substitute a given amino acid in a
polypeptide by another amino acid of like characteristics.
Typically seen as conservative substitutions are the replacements,
one for another, among the aliphatic amino acids Ala, Val, Leu and
lie; interchange of the hydroxyl residues Ser and Thr, exchange of
the acidic residues Asp and Glu, substitution between the amide
residues Asn and Gln, exchange of the basic residues Lys and Arg
and replacements among the aromatic residues Phe, Tyr.
[0116] Further particularly preferred in this regard are variants,
analogs, derivatives and fragments, and variants, analogs and
derivatives of the fragments, having the amino acid sequence below,
in which several, a few, 1 to 10, 1 to 5, 1 to 3, 2, 1 or no amino
acid residues are substituted, deleted or added, in any
combination. Especially preferred among these are silent
substitutions, additions and deletions, which do not alter the
properties and activities of the phytate biosynthetic enzymes. Also
especially preferred in this regard are conservative substitutions.
Most highly preferred are polypeptides having the amino acid
sequences below without substitutions.
[0117] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0118] The polypeptides of the present invention include the
myo-inositol 1-phosphate synthase polypeptide (in particular the
mature polypeptide) as well as polypeptides which have greater than
88% identity (92% similarity) to the polypeptide, as described
above in Needleman and Wunsch, and more preferably at least 90%
identity (95% similarity), still more preferably at least 95%
identity (98% similarity) and most preferably at least 98% identity
and also include portions of such polypeptides with such portion of
the polypeptide generally containing at least 30 amino acids and
more preferably at least 50 amino acids.
[0119] The polypeptides of the present invention include the
myo-inositol monophosphatase-3polypeptide (in particular the mature
polypeptide) as well as polypeptides which have greater than 77%
identity (82% similarity) to the polypeptide, as described above in
Needleman and Wunsch, more preferably at least 80% identity (85%
similarity), still more preferably at least 85% identity (90%
similarity), still more preferably at least 90% identity (95%
similarity), still more preferably at least 95% identity (98%
similarity) and most preferably at least 98% identity and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0120] The polypeptides of the present invention include the
myo-inositol 1,3,4-triphosphate 5/6-kinase polypeptide (in
particular the mature polypeptide) as well as polypeptides which
have greater than 35% identity (45% similarity) to the polypeptide,
as described above in Needleman and Wunsch, more preferably at
least 50% identity (60% similarity), still more preferably at least
60% identity (70% similarity), more preferably at least 80%
identity (85% similarity), still more preferably at least 70%
identity (80% similarity), more preferably at least 80% identity
(85% similarity), still more preferably at least 85% identity (90%
similarity), still more preferably at least 90% identity (95%
similarity), still more preferably at least 95% identity (98%
similarity) and most preferably at least 98% identity and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0121] The polypeptides of the present invention include the
phosphatidylinositol 3-kinase polypeptide (in particular the mature
polypeptide) as well as polypeptides which have greater than 78%
identity (84% similarity) to the polypeptide, as described above in
Needleman and Wunsch, more preferably at least 80% identity (85%
similarity), still more preferably at least 85% identity (90%
similarity), still more preferably at least 90% identity (95%
similarity), still more preferably at least 95% identity (98%
similarity) and most preferably at least 98% identity and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0122] Vectors, Host Cells, Expression
[0123] The present invention also relates to vectors comprising the
polynucleotides of the present invention, host cells that
incorporate the vectors of the invention and the production of
polypeptides of the invention by recombinant techniques.
[0124] Host cells can be genetically engineered to incorporate the
polynucleotides and express polypeptides of the present invention.
For instance, the polynucleotides may be introduced into host cells
using well known techniques of infection, transduction,
transfection, transvection and transformation. The polynucleotides
may be introduced alone or with other polynucleotides. Such other
polynucleotides may be introduced independently, co-introduced or
introduced joined to the polynucleotides of the invention.
[0125] Thus, for instance, polynucleotides of the invention may be
transfected into host cells with another, separate, polynucleotide
encoding a selectable marker, using standard techniques for
co-transfection and selection in, for instance, plant cells. In
this case the polynucleotides generally will be stably incorporated
into the host cell genome.
[0126] Alternatively, the polynucleotides may be joined to a vector
containing a selectable marker for propagation in a host. The
vector construct may also be introduced into host cells by the
aforementioned techniques. Generally, a plasmid vector is
introduced as DNA in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. Electroporation
also may be used to introduce polynucleotides into a host. If the
vector is a virus, it may be packaged in vitro or introduced into a
packaging cell and the packaged virus may be transduced into cells.
A wide variety of techniques suitable for making polynucleotides
and for introducing polynucleotides into cells in accordance with
this aspect of the invention are well known and routine to those of
skill in the art. Such techniques are reviewed at length in
Sambrook et al., cited above, which is illustrative of the many
laboratory manuals that detail these techniques.
[0127] Vectors
[0128] In accordance with this aspect of the invention the vector
may be, for example, a plasmid vector, a single or double-stranded
phage vector, a single or double-stranded RNA or DNA viral vector.
Such vectors may be introduced into cells as polynucleotides,
preferably DNA, by well known techniques for introducing DNA and
RNA into cells. The vectors, in the case of phage and viral vectors
also may be and preferably are introduced into cells as packaged or
encapsidated virus by well known techniques for infection and
transduction. Viral vectors may be replication competent or
replication defective. In the latter case viral propagation
generally will occur only in complementing host cells.
[0129] Preferred among vectors, in certain respects, are those for
expression of polynucleotides and polypeptides of the present
invention. Generally, such vectors comprise cis-acting control
regions effective for expression in a host operatively linked to
the polynucleotide to be expressed. Appropriate trans-acting
factors either are supplied by the host, supplied by a
complementing vector or supplied by the vector itself upon
introduction into the host.
[0130] In certain preferred embodiments in this regard, the vectors
provide for preferred expression. Such preferred expression may be
inducible expression or expression predominantly in certain types
of cells or both inducible and cell-preferred. Particularly
preferred among inducible vectors are vectors that can be induced
for expression by environmental factors that are easy to
manipulate, such as temperature and nutrient additives. A variety
of vectors suitable to this aspect of the invention, including
constitutive and inducible expression vectors for use in
prokaryotic and eukaryotic hosts, are well known and employed
routinely by those of skill in the art. Such vectors include, among
others, chromosomal, episomal and virus-derived vectors, e.g.,
vectors derived from bacterial plasmids, from bacteriophage, from
transposons, from yeast episomes, from insertion elements, from
yeast chromosomal elements, from viruses such as baculoviruses,
papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl
pox viruses, pseudorabies viruses and retroviruses, and vectors
derived from combinations thereof, such as those derived from
plasmid and bacteriophage genetic elements, such as cosmids and
phagemids and binaries used for Agrobacterium-mediated
transformations. All may be used for expression in accordance with
this aspect of the present invention. Generally, any vector
suitable to maintain, propagate or express polynucleotides to
express a polypeptide in a host may be used for expression in this
regard.
[0131] The following vectors, which are commercially available, are
provided by way of example. Among vectors preferred for use in
bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS
vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a,
pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3,
pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred
eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG
available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available
from Pharmacia. Useful plant binaries vectors include BIN19 and its
derivatives available from Clontech. These vectors are listed
solely by way of illustration of the many commercially available
and well known vectors that are available to those of skill in the
art for use in accordance with this aspect of the present
invention. It will be appreciated that any other plasmid or vector
suitable for, for example, introduction, maintenance, propagation
or expression of a polynucleotide or polypeptide of the invention
in a host may be used in this aspect of the invention.
[0132] In general, expression constructs will contain sites for
transcription initiation and termination, and, in the transcribed
region, a ribosome binding site for translation. The coding portion
of the mature transcripts expressed by the constructs will include
a translation initiating AUG at the beginning and a termination
codon appropriately positioned at the end of the polypeptide to be
translated.
[0133] In addition, the constructs may contain control regions that
regulate as well as engender expression. Generally, in accordance
with many commonly practiced procedures, such regions will operate
by controlling transcription, such as transcription factors,
repressor binding sites and termination, among others. For
secretion of the translated protein into the lumen of the
endoplasmic reticulum, into the periplasmic space or into the
extracellular environment, appropriate secretion signals may be
incorporated into the expressed polypeptide. These signals may be
endogenous to the polypeptide or they may be heterologous
signals.
[0134] Generally, recombinant expression vectors will include
origins of replication, a promoter derived from a highly-expressed
gene to direct transcription of a downstream structural sequence,
and a selectable marker to permit isolation of vector containing
cells after exposure to the vector.
[0135] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes may be increased by
inserting an enhancer sequence into the vector. Enhancers are
cis-acting elements of DNA, usually about from 10 to 300 bp that
act to increase transcriptional activity of a promoter in a given
host cell-type. Examples of enhancers include the SV40 enhancer,
which is located on the late side of the replication origin at bp
100 to 270, the cytomegalovirus early promoter enhancer, the
polyoma enhancer on the late side of the replication origin, and
adenovirus enhancers. Additional enhancers useful in the invention
to increase transcription of the introduced DNA segment, include,
inter alia, viral enhancers like those within the 35S promoter, as
shown by Odell et al., Plant Mol. Biol. 10:263-72 (1988), and an
enhancer from an opine gene as described by Fromm et al., Plant
Cell 1:977 (1989).
[0136] Among known eukaryotic promoters suitable in this regard are
the CMV immediate early promoter, the HSV thymidine kinase
promoter, the early and late SV40 promoters, the promoters of
retroviral LTRs, such as those of the Rous sarcoma virus ("RSV"),
metallothionein promoters, such as the mouse metallothionein-I
promoter and various plant promoters, such as globulin-1. When
available, the native promoters of the phytate biosynthetic enzyme
genes may be used.
[0137] As mentioned above, the DNA sequence in the expression
vector is operatively linked to appropriate expression control
sequence(s), including, for instance, a promoter to direct mRNA
transcription. Representatives of prokaryotic promoters include the
phage lambda PL promoter, the E. coli lac, trp and tac promoters to
name just a few of the well-known promoters.
[0138] With respect to plants, examples of seed-specific promoters
include promoters of seed storage proteins which express these
proteins in seeds in a highly regulated manner (Thompson et al.;
BioEssays. 10:108; (1989), incorporated herein in its entirety by
reference), such as, for dicotyledonous plants, a bean p-phaseolin
promoter, a napin promoter, a .beta.-conglycinin promoter, and a
soybean lectin promoter. For monocotyledonous plants, promoters
useful in the practice of the invention include, but are not
limited to, a maize 15 kD zein promoter, a 22 kD zein promoter, a
.gamma.-zein promoter, a waxy promoter, a shrunken 1 promoter, a
globulin 1 promoter, and the shrunken 2 promoter. However, other
promoters useful in the practice of the invention are known to
those of skill in the art.
[0139] Other examples of suitable promoters are the promoter for
the small subunit of ribulose-1,5-bis-phosphatecarboxylase,
promoters from tumor-inducing plasmids of Agrobacterium
tumefaciens, such as the nopaline synthase and octopine synthase
promoters, and viral promoters such as the cauliflower mosaic virus
(CaMV) 1 9S and 35S promoters or the figwort mosaic virus 35S
promoter.
[0140] It will be understood that numerous promoters not mentioned
are suitable for use in this aspect of the invention are well known
and readily may be employed by those of skill in the manner
illustrated by the discussion and the examples herein. For example
this invention contemplates using the native phytate biosynthetic
enzyme promoters to drive the expression of the enzyme in a
recombinant environment.
[0141] Vectors for propagation and expression generally will
include selectable markers. Such markers also may be suitable for
amplification or the vectors may contain additional markers for
this purpose. In this regard, the expression vectors preferably
contain one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells. Preferred markers
include dihydrofolate reductase or neomycin resistance for
eukaryotic cell culture, and tetracycline or ampicillin resistance
genes for culturing E. coli and other prokaryotes. Kanamycin and
herbicide resistance genes (PAT and BAR) are generally useful in
plant systems.
[0142] Selectable marker genes, in physical proximity to the
introduced DNA segment, are used to allow transformed cells to be
recovered by either positive genetic selection or screening. The
selectable marker genes also allow for maintaining selection
pressure on a transgenic plant population, to ensure that the
introduced DNA segment, and its controlling promoters and
enhancers, are retained by the transgenic plant.
[0143] Many of the commonly used positive selectable marker genes
for plant transformation have been isolated from bacteria and code
for enzymes that metabolically detoxify a selective chemical agent
which may be an antibiotic or a herbicide. Other positive selection
marker genes encode an altered target which is insensitive to the
inhibitor.
[0144] A preferred selection marker gene for plant transformation
is the BAR or PAT gene, which is used with the selecting agent
bialaphos. Spencer et al., T. Thero. Appl'd Genetics 79:625-631
(1990). Another useful selection marker gene is the neomycin
phosphotransferase II (nptII) gene, isolated from Tn5, which
confers resistance to kanamycin when placed under the control of
plant regulatory signals. Fraley et al., Proc. Nat'l Acad. Sci.
(USA) 80:4803 (1983). The hygromycin phosphotransferase gene, which
confers resistance to the antibiotic hygromycin, is a further
example of a useful selectable marker. Vanden Elzen et al., Plant
Mol. Biol. 5:299 (1985). Additional positive selectable markers
genes of bacterial origin that confer resistance to antibiotics
include gentamicin acetyl transferase, streptomycin
phosphotransferase, aminoglycoside-3'-adenyltransferase and the
bleomycin resistance determinant. Hayford et al., Plant Physiol.
86:1216 (1988); Jones et al., Mol. Gen. Genet. 210:86 (1987); Svab
et al., Plant Mol. Biol. 14:197 (1990); Hille et al., Plant Mol.
Biol. 7:171 (1986).
[0145] Other positive selectable marker genes for plant
transformation are not of bacterial origin. These genes include
mouse dihydrofolate reductase, plant
5-enolpyruvylshikimate-3-phosphatesynthase and plant acetolactate
synthase. Eichholtz et al., Somatic Cell Mol. Genet. 13:67 (1987);
Shah et al., Science 233:478 (1986); Charest et al., Plant Cell
Rep. 8:643 (1990).
[0146] Another class of useful marker genes for plant
transformation with the DNA sequence requires screening of
presumptively transformed plant cells rather than direct genetic
selection of transformed cells for resistance to a toxic substance
such as an antibiotic. These genes are particularly useful to
quantitate or visualize the spatial pattern of expression of the
DNA sequence in specific tissues and are frequently referred to as
reporter genes because they can be fused to a gene or gene
regulatory sequence for the investigation of gene expression.
Commonly used genes for screening presumptively transformed cells
include p-glucuronidase (GUS), .beta.-galactosidase, luciferase,
and chloramphenicol acetyltransferase. Jefferson, Plant Mol. Biol.
Rep. 5:387 (1987); Teeri et al., EMBO J. 8:343 (1989); Koncz et
al., Proc. Nat'l Acad. Sci. (USA) 84:131 (1987); De Block et al.,
EMBO J. 3:1681 (1984). Another approach to the identification of
relatively rare transformation events has been use of a gene that
encodes a dominant constitutive regulator of the Zea mays
anthocyanin pigmentation pathway (Ludwig et al., Science 247:449
(1990)).
[0147] The appropriate DNA sequence may be inserted into the vector
by any of a variety of well-known and routine techniques. In
general, a DNA sequence for expression is joined to an expression
vector by cleaving the DNA sequence and the expression vector with
one or more restriction endonucleases and then joining the
restriction fragments together using T4 DNA ligase. The sequence
may be inserted in a forward or reverse orientation. Procedures for
restriction and ligation that can be used to this end are well
known and routine to those of skill. Suitable procedures in this
regard, and for constructing expression vectors using alternative
techniques, which also are well known and routine to those skill,
are set forth in great detail in Sambrook et al., MOLECULAR
CLONING, A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York (1989).
[0148] Polynucleotides of the invention, encoding the heterologous
structural sequence of a polypeptide of the invention generally
will be inserted into the vector using standard techniques so that
it is operably linked to the promoter for expression. The
polynucleotide will be positioned so that the transcription start
site is located appropriately 5' to a ribosome binding site. The
ribosome binding site will be 5' to the AUG that initiates
translation of the polypeptide to be expressed. Generally, there
will be no other open reading frames that begin with an initiation
codon, usually AUG, and lie between the ribosome binding site and
the initiation codon. Also, generally, there will be a translation
stop codon at the end of the polypeptide and there will be a
polyadenylation signal in constructs for use in eukaryotic hosts.
Transcription termination signal appropriately disposed at the 3'
end of the transcribed region may also be included in the
polynucleotide construct.
[0149] The vector containing the appropriate DNA sequence as
described elsewhere herein, as well as an appropriate promoter, and
other appropriate control sequences, may be introduced into an
appropriate host using a variety of well known techniques suitable
to expression therein of a desired polypeptide. The present
invention also relates to host cells containing the above-described
constructs discussed. The host cell can be a higher eukaryotic
cell, such as a mammalian or plant cell, or a lower eukaryotic
cell, such as a yeast cell, or the host cell can be a prokaryotic
cell, such as a bacterial cell.
[0150] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, microinjection, cationic lipid-mediated transfection,
electroporation, transduction, scrape loading, ballistic
introduction, infection or other methods. Such methods are
described in many standard laboratory manuals, such as Davis et
al., BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook et
al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0151] Representative examples of appropriate hosts include
bacterial cells, such as streptococci, staphylococci, E. coli,
streptomyces and Salmonella typhimunum cells; fungal cells, such as
yeast cells and Aspergillus cells; insect cells such as Drosophila
S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and
Bowes melanoma cells; and plant cells. Hosts for a great variety of
expression constructs are well known, and those of skill will be
enabled by the present disclosure readily to select a host for
expressing a polypeptide in accordance with this aspect of the
present invention.
[0152] The engineered host cells can be cultured in conventional
nutrient media, which may be modified as appropriate for, inter
alia, activating promoters, selecting transformants or amplifying
genes. Culture conditions, such as temperature, pH and the like,
previously used with the host cell selected for expression
generally will be suitable for expression of polypeptides of the
present invention as will be apparent to those of skill in the
art.
[0153] Constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0154] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention.
[0155] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, where the
selected promoter is inducible it is induced by appropriate means
(e.g., temperature shift or exposure to chemical inducer) and cells
are cultured for an additional period.
[0156] Cells typically then are harvested by centrifugation,
disrupted by physical or chemical means, and the resulting crude
extract retained for further purification. Microbial cells employed
in expression of proteins can be disrupted by any convenient
method, including freeze-thaw cycling, sonication, mechanical
disruption, or use of cell lysing agents, such methods are well
know to those skilled in the art.
[0157] As noted above, the present invention provides vectors
capable of expressing phytate biosynthetic enzymes under the
control of suitable promoters. In general, the vectors should be
functional in plant cells. At times, it may be preferable to have
vectors that are functional in E. coli (e.g., production of protein
for raising antibodies, DNA sequence analysis, construction of
inserts, obtaining quantities of nucleic acids and proteins).
Vectors and procedures for cloning and expression in E. coli are
discussed above and, for example, in Sambrook et al. (supra) and in
Ausubel et al. (supra).
[0158] Vectors that are functional in plants are preferably binary
plasmids derived from Agrobacterium plasmids. Such vectors are
capable of transforming plant cells. These vectors contain left and
right border sequences that are required for integration into the
host (plant) chromosome. At minimum, between these border sequences
is the gene to be expressed under control of a promoter. In
preferred embodiments, a selectable marker and a reporter gene are
also included. For ease of obtaining sufficient quantities of
vector, a bacterial origin that allows replication in E. coli is
preferred.
[0159] In certain preferred embodiments, the vector contains a
reporter gene and the structural genes of this invention. The
reporter gene should allow ready determination of transformation
and expression. The GUS (.beta.-glucuronidase) gene is preferred
(U.S. Pat. No. 5,268,463). Other reporter genes, such as
.beta.-galactosidase, luciferase, GFP, and the like, are also
suitable in the context of this invention. Methods and substrates
for assaying expression of each of these genes are well known in
the art. The reporter gene should be under control of a promoter
that is functional in plants. Such promoters include CaMV 35S
promoter, mannopine synthase promoter, ubiquitin promoter and DNA J
promoter.
[0160] Preferably, the vector contains a selectable marker for
identifying transformants. The selectable marker may confer a
growth advantage under appropriate conditions. Generally,
selectable markers are drug resistance genes, such as neomycin
phosphotransferase. Other drug resistance genes are known to those
in the art and may be readily substituted. The selectable marker
has a linked constitutive or inducible promoter and a termination
sequence, including a polyadenylation signal sequence.
[0161] Additionally, a bacterial origin of replication and a
selectable marker for bacteria are preferably included in the
vector. Of the various origins (e.g., colEl, fd phage), a colEl
origin of replication is preferred. Most preferred is the origin
from the pUC plasmids, which allow high copy number.
[0162] A general vector suitable for use in the present invention
is based on pB 121 (U.S. Pat. No. 5,432,081) a derivative of
pBIN19. Other vectors have been described (U.S. Pat. No. 4,536,475)
or may be constructed based on the guidelines presented herein. The
plasmid pBI121 contains a left and right border sequence for
integration into a plant host chromosome. These border sequences
flank two genes. One is a kanamycin resistance gene (neomycin
phosphotransferase) driven by a nopaline synthase promoter and
using a nopaline synthase polyadenylation site. The second is the
E. coli GUS gene under control of the CaMV 35S promoter and
polyadenylated using a nopaline synthase polyadenylation site.
Plasmid pBI121 also contains a bacterial origin of replication and
selectable marker.
[0163] In certain embodiments, the vector may contain the
structural genes identified herein under control of a promoter. The
promoter may be the native promoters associated with the structural
genes themselves or a strong, constitutive promoter, such as CaMV
35S promoter. Other elements that are preferred for optimal
expression (e.g., transcription termination site, enhancer, splice
site) may also be included. The genes may alternatively be
expressed as fusion proteins with a reporter gene, for example.
[0164] Plant Transformation Methods
[0165] As discussed above the present invention also provides
methods for producing a plant which expresses a foreign gene,
comprising the steps of (a) introducing a vector as described above
into an embryogenic plant cell, wherein the vector contains a
foreign gene in an expressible form, and (b) producing a plant from
the embryogenic plant cell, wherein the plant expresses the foreign
gene.
[0166] Vectors may be introduced into plant cells by any of several
methods. For example, DNA may be introduced as a plasmid by
Agrobacterium in co-cultivation or bombardment. Other
transformation methods include electroporation, CaPO.sub.4-mediated
transfection, and the like. Preferably, DNA is first transfected
into Agrobacterium and subsequently introduced into plant cells.
Most preferably, the infection is achieved by co-cultivation. In
part, the choice of transformation methods depends upon the plant
to be transformed.
[0167] Phytate biosynthetic polypeptides can be recovered and
purified from recombinant cell cultures by well-known methods
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Most preferably, high
performance liquid chromatography ("HPLC") is employed for
purification. Well known techniques for refolding protein may be
employed to regenerate active conformation when the polypeptide is
denatured during isolation and or purification.
[0168] Polypeptides of the present invention include naturally
purified products, products of chemical synthetic procedures, and
products produced by recombinant techniques from a prokaryotic or
eukaryotic host, including, for example, bacterial, yeast, higher
plant, insect and mammalian cells. Depending upon the host employed
in a recombinant production procedure, the polypeptides of the
present invention may be glycosylated or may be non-glycosylated.
In addition, polypeptides of the invention may also include an
initial modified methionine residue, in some cases as a result of
host-mediated processes.
[0169] It is appreciated that the gene expressing the polypeptide
of interest may have to be "codon-optimized" to affect efficient
expression of a particular host. Thus, this invention contemplates
selecting from the sequences below, the particular codon optimized
sequence for the particular host cell of interest.
[0170] Other genes of interest may be "stacked" during the same
transformation events. For example, other genes of interest may
impart disease, pest or herbicide resistance, or improve the feed
and food quality of the plant or seed, such increased or altered
oil expression or altered protein or carbohydrate expression.
[0171] Regeneration of Transformed Plants
[0172] Following transformation, regeneration is involved to obtain
a whole plant from transformed cells. Techniques for regenerating
plants from tissue culture such as transformed protoplasts or
callus cell lines, are known in the art. For example, see Phillips
et al.; Plant Cell Tissue Organ Culture; Vol. 1: p 123; (1981);
Patterson et al.; Plant Sci.; Vol.42; p.125; (1985); Wright et al.;
Plant Cell Reports; Vol.6: p. 83; (1987); and Barwale et al.;
Planta; Vol. 167; p.473 (1986); each incorporated herein in its
entirety by reference. The selection of an appropriate method is
within the skill of the art.
[0173] It is expected that the transformed plants will be used in
traditional breeding programs, including TOPCROSS pollination
systems as disclosed in U.S. Pat. No. 5,706,603 and U.S. Pat. No.
5,704,160 the disclosure of each is incorporated herein by
reference.
[0174] Polynucleotide Assays
[0175] This invention is also related to the use of the phytate
biosynthetic enzyme polynucleotides in marker to assist in breeding
program, as described for example in PCT publication US89/00709.
The DNA may be used directly for detection or may be amplified
enzymatically by using PCR prior to analysis. PCR (Saiki et al.,
Nature 324:163-166 (1986)). RNA or cDNA may also be used in the
same ways. As an example, PCR primers complementary to the nucleic
acid encoding the phytate biosynthetic enzymes can be used to
identify and analyze phytate biosynthetic enzyme presence and
expression. Using PCR, characterization of the gene present in a
particular tissue or plant variety may be made by an analysis of
the genotype of the tissue or variety. For example, deletions and
insertions can be detected by a change in size of the amplified
product in comparison to the genotype of a reference sequence.
Point mutations can be identified by hybridizing amplified DNA to
radiolabeled phytate biosynthetic enzyme RNA or alternatively,
radiolabeled phytate biosynthetic enzyme antisense DNA sequences.
Perfectly matched sequences can be distinguished from mismatched
duplexes by RNase A digestion or by differences in melting
temperatures.
[0176] Sequence differences between a reference gene and genes
having mutations also may be revealed by direct DNA sequencing. In
addition, cloned DNA segments may be employed as probes to detect
specific DNA segments. The sensitivity of such methods can be
greatly enhanced by appropriate use of PCR or another amplification
method. For example, a sequencing primer is used with
double-stranded PCR product or a single-stranded template molecule
generated by a modified PCR. The sequence determination is
performed by conventional procedures with radiolabeled nucleotide
or by automatic sequencing procedures with fluorescent-tags.
[0177] Genetic typing of various varieties of plants based on DNA
sequence differences may be achieved by detection of alteration in
electrophoretic mobility of DNA fragments in gels, with or without
denaturing agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA fragments of
different sequences may be distinguished on denaturing formamide
gradient gels in which the mobilities of different DNA fragments
are retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0178] Sequence changes at specific locations also may be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., Proc. Nat'l.
Acad. Sci., (USA), 85:4397-4401 (1985)).
[0179] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., restriction fragment length polymorphisms ("RFLP")
and Southern blofting of genomic DNA.
[0180] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations also can be detected by in situ analysis.
[0181] A mutation may be ascertained for example, by a DNA
sequencing assay. Samples are processed by methods known in the art
to capture the RNA. First strand cDNA is synthesized from the RNA
samples by adding an oligonucleotide primer consisting of sequences
which hybridize to a region on the mRNA. Reverse transcriptase and
deoxynucleotides are added to allow synthesis of the first strand
cDNA. Primer sequences are synthesized based on the DNA sequences
of the phytate biosynthetic enzymes of the invention. The primer
sequence is generally comprised of at least 15 consecutive bases,
and may contain at least 30 or even 50 consecutive bases.
[0182] Cells carrying mutations or polymorphisms in the gene of the
present invention may also be detected at the DNA level by a
variety of techniques. The DNA may be used directly for detection
or may be amplified enzymatically by using PCR (Saiki et al.,
Nature, 324:163-166 (1986)) prior to analysis. RT-PCR can also be
used to detect mutations. It is particularly preferred to used
RT-PCR in conjunction with automated detection systems, such as,
for example, GeneScan. RNA or cDNA may also be used for the same
purpose, PCR or RT-PCR. As an example, PCR primers complementary to
the nucleic acid encoding phytate biosynthetic enzymes can be used
to identify and analyze mutations. Examples of representative
primers are shown below in Table 1. For example, deletions and
insertions can be detected by a change in size of the amplified
product in comparison to the normal genotype. Point mutations can
be identified by hybridizing amplified DNA to radiolabeled RNA or
alternatively, radiolabeled antisense DNA sequences. While
perfectly matched sequences can be distinguished from mismatched
duplexes by RNase A digestion or by differences in melting
temperatures, preferably point mutations are identified by sequence
analysis.
[0183] Primers used for detection of mutations or polymorphisms in
myo-inositol 1-phosphate synthase gene
1 5'CTCGCTACCTCGCTTCGCATTCCATT3' 5'ACGCCACTTGGCTCACTTGTACTCCA3'
[0184] Primers used for detection of mutations or polymorphisms in
myo-inositol monophosphatase-3 gene
2 5'ACGAGGTTGCGGGCGAACCGAAAAT3' 5'TAGGGACCGTTGCCTCAACCTAT3'
[0185] Primers used for detection of mutations or polymorphisms in
myo-inositol 1,3,4-trisphosphate 5/6-kinase gene
3 5'TTCTCTCGGTCGCCGCTACTGG3' 5'AGCATGAACAGTTAGCACCT3'
[0186] Primers used for detection of mutations or polymorphisms in
phosphatidylinositol3-kinase gene
4 5'CCGCTTCTCC TCACCTTCCT CT 3' 5'TGGCTTGTGA CAGTCAGCAT GT 3'
[0187] The above primers may be used for amplifying phytate
biosynthetic enzyme cDNA or genomic clones isolated from a sample
derived from an individual plant. The invention also provides the
primers above with 1, 2, 3 or 4 nucleotides removed from the 5'
and/or the 3' end. The primers may be used to amplify the gene
isolated from the individual such that the gene may then be subject
to various techniques for elucidation of the DNA sequence. In this
way, mutations in the DNA sequence may be identified.
[0188] Polypeptide Assays
[0189] The present invention also relates to diagnostic assays such
as quantitative and diagnostic assays for detecting levels of
phytate biosynthetic enzymes in cells and tissues, including
determination of normal and abnormal levels. Thus, for instance, a
diagnostic assay in accordance with the invention for detecting
expression of phytate biosynthetic enzymes compared to normal
control tissue samples may be used to detect unacceptable levels of
expression. Assay techniques that can be used to determine levels
of polypeptides of the present invention, in a sample derived from
a plant source are well-known to those of skill in the art. Such
assay methods include radioimmunoassays, competitive-binding
assays, Western Blot analysis and ELISA assays. Among these ELISAs
frequently are preferred. An ELISA assay initially comprises
preparing an antibody specific to the polypeptide, preferably a
monoclonal antibody. In addition a reporter antibody generally is
prepared which binds to the monoclonal antibody. The reporter
antibody is attached to a detectable reagent such as radioactive,
fluorescent or enzymatic reagent, in this example horseradish
peroxidase enzyme.
[0190] To carry out an ELISA a sample is removed from a host and
incubated on a solid support, e.g., a polystyrene dish, that binds
the proteins in the sample. Any free protein binding sites on the
dish are then covered by incubating with a non-specific protein
such as bovine serum albumin. Next, the monoclonal antibody is
incubated in the dish during which time the monoclonal antibodies
attach to any phytate biosynthetic enzymes attached to the
polystyrene dish. Unbound monoclonal antibody is washed out with
buffer. The reporter antibody linked to horseradish peroxidase is
placed in the dish resulting in binding of the reporter antibody to
any monoclonal antibody bound to phytate biosynthetic enzyme.
Unattached reporter antibody is then washed out. Reagents for
peroxidase activity, including a colorimetric substrate are then
added to the dish. Immobilized peroxidase, linked to phytate
biosynthetic enzyme through the primary and secondary antibodies,
produces a colored reaction product. The amount of color developed
in a given time period indicates the amount of phytate biosynthetic
enzyme present in the sample. Quantitative results typically are
obtained by reference to a standard curve.
[0191] A competition assay may be employed wherein antibodies
specific to phytate biosynthetic enzymes attached to a solid
support and labeled enzyme derived from the host are passed over
the solid support and the amount of label detected attached to the
solid support can be correlated to a quantity of phytate
biosynthetic enzyme in the sample.
[0192] Antibodies
[0193] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as immunogens
to produce antibodies thereto. These antibodies can be, for
example, polyclonal or monoclonal antibodies. The present invention
also includes chimeric, single chain, and humanized antibodies, as
well as Fab fragments, or the product of an Fab expression library.
Various procedures known in the art may be used for the production
of such antibodies and fragments.
[0194] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptide can be
used to generate antibodies binding the whole native polypeptide.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0195] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler, G.
and Milstein, C., Nature 256:495-497 (1975)), the trioma technique,
the human B-cell hybridoma technique (Kozbor et al., Immunology
Today 4:72 (1983)) and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole et al., pg. 77-96 in MONOCLONAL
ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc. (1985)).
[0196] Hybridoma cell lines secreting the monoclonal antibody are
another aspect of this invention.
[0197] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice, or other organisms such as other
mammals, may be used to express humanized antibodies to immunogenic
polypeptide products of this invention.
[0198] The above-described antibodies may be employed to isolate or
to identify clones expressing the polypeptide or purify the
polypeptide of the present invention by attachment of the antibody
to a solid support for isolation and/or purification by affinity
chromatography.
[0199] Polypeptide derivatives include antigenically or
immunologically equivalent derivatives which form a particular
aspect of this invention.
[0200] The term `antigenically equivalent derivative` as used
herein encompasses a polypeptide or its equivalent which will be
specifically recognized by certain antibodies which, when raised to
the protein or polypeptide according to the present invention,
interfere with the immediate physical interaction between the
antibody and its cognate antigen.
[0201] The term "immunologically equivalent derivative" as used
herein encompasses a peptide or its equivalent which when used in a
suitable formulation to raise antibodies in a vertebrate, the
antibodies act to interfere with the immediate physical interaction
between the antibody and its cognate antigen.
[0202] The polypeptide, such as an antigenically or immunologically
equivalent derivative or a fusion protein thereof is used as an
antigen to immunize a mouse or other animal such as a rat guinea
pig, goat, rabbit, sheep, cattle or chicken. The fusion protein may
provide stability to the polypeptide. The antigen may be
associated, for example by conjugation, with an immunogenic carrier
protein for example bovine serum albumin (BSA) or keyhole limpet
haemocyanin (KLH). Alternatively a multiple antigenic peptide
comprising multiple copies of the protein or polypeptide, or an
antigenically or immunologically equivalent polypeptide thereof may
be sufficiently antigenic to improve immunogenicity so as to
obviate the use of a carrier.
[0203] Alternatively phage display technology could be utilized to
select antibody genes with binding activities towards the
polypeptide either from repertoires of PCR amplified v-genes of
lymphocytes from humans screened for possessing anti-Fbp or from
naive libraries (McCafferty, J. et al., (1990), Nature 348:552-554;
Marks, J. et al., (1992) Biotechnology 10:779-783). The affinity of
these antibodies can also be improved by chain shuffling (Clackson,
T. et al., (1991) Nature 352:624-628).
[0204] The antibody should be screened again for high affinity to
the polypeptide and/or fusion protein.
[0205] As mentioned above, a fragment of the final antibody may be
prepared.
[0206] The antibody may be either intact antibody of M.sub.r
approximately 150,000 or a derivative of it, for example a Fab
fragment or a Fv fragment as described in Sierra, A and Pluckthun,
A., Science 240:1038-1040 (1988). If two antigen binding domains
are present each domain may be directed against a different epitope
- termed `bispecific` antibodies.
[0207] The antibody of the invention, as mentioned above, may be
prepared by conventional means for example by established
monoclonal antibody technology (Kohler, G. and Milstein, C.,
Nature, 256:495-497 (1975)) or using recombinant means e.g.
combinatorial libraries, for example as described in Huse, W. D. et
al., Science 246:1275-1281 (1989).
[0208] Preferably the antibody is prepared by expression of a DNA
polymer encoding said antibody in an appropriate expression system
such as described above for the expression of polypeptides of the
invention. The choice of vector for the expression system will be
determined in part by the host, which may be a prokaryotic cell,
such as E. coli (preferably strain B) or Streptomyces sp. or a
eukaryotic cell, such as a mouse C127, mouse myeloma, human HeLa,
Chinese hamster ovary, filamentous or unicellular fungi or insect
cell. The host may also be a transgenic animal or a transgenic
plant for example as described in Hiatt, A. et al., Nature
340:76-78 (1989). Suitable vectors include plasmids,
bacteriophages, cosmids and recombinant viruses, derived from, for
example, baculoviruses and vaccinia.
[0209] The Fab fragment may also be prepared from its parent
monoclonal antibody by enzyme treatment, for example using papain
to cleave the Fab portion from the Fc portion.
[0210] Phytate Biosynthetic Enzyme Binding Molecules and Assays
[0211] This invention also provides a method for identification of
molecules, such as binding molecules, that bind the phytate
biosynthetic enzymes. Genes encoding proteins that bind the
enzymes, such as binding proteins, can be identified by numerous
methods known to those of skill in the art, for example, ligand
panning and FACS sorting. Such methods are described in many
laboratory manuals such as, for instance, Coligan et al., Current
Protocols in Immunology 1(2): Chapter 5 (1991).
[0212] For instance, expression cloning may be employed for this
purposes. To this end polyadenylated RNA is prepared from a cell
expressing the phytate biosynthetic enzymes, a cDNA library is
created from this RNA, the library is divided into pools and the
pools are transfected individually into cells that are not
expressing the enzyme. The transfected cells then are exposed to
labeled enzyme. The enzyme can be labeled by a variety of
well-known techniques including standard methods of
radio-iodination or inclusion of a recognition site for a
site-specific protein kinase. Following exposure, the cells are
fixed and binding of enzyme is determined. These procedures
conveniently are carried out on glass slides.
[0213] Pools are identified of cDNA that produced phytate
biosynthetic enzyme-binding cells. Sub-pools are prepared from
these positives, transfected into host cells and screened as
described above. Using an iterative sub-pooling and re-screening
process, one or more single clones that encode the putative binding
molecule can be isolated.
[0214] Alternatively a labeled ligand can be photoaffinity linked
to a cell extract, such as a membrane or a membrane extract,
prepared from cells that express a molecule that it binds, such as
a binding molecule. Cross-linked material is resolved by
polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray
film. The labeled complex containing the ligand-binding can be
excised, resolved into peptide fragments, and subjected to protein
microsequencing. The amino acid sequence obtained from
microsequencing can be used to design unique or degenerate
oligonucleotide probes to screen cDNA libraries to identify genes
encoding the putative binding molecule.
[0215] Polypeptides of the invention also can be used to assess
phytate biosynthetic enzyme binding capacity of phytate
biosynthetic enzyme binding molecules, such as binding molecules,
in cells or in cell-free preparations.
[0216] Polypeptides of the invention may also be used to assess the
binding or small molecule substrates and ligands in, for example,
cells, cell-free preparations, chemical libraries, and natural
product mixtures. These substrates and ligands may be natural
substrates and ligands or may be structural or functional
mimetics.
[0217] Anti-phytate biosynthetic enzyme antibodies represent a
useful class of binding molecules contemplated by this
invention.
[0218] Antagonists--Assays and Molecules
[0219] The invention also provides a method of screening compounds
to identify those which enhance or block the action of phytate
biosynthetic enzymes on cells, such as its interaction with
substrate molecules. An antagonist is a compound which decreases
the natural biological functions of the enzymes.
[0220] Potential antagonists include small organic molecules,
peptides, polypeptides and antibodies that bind to a polypeptide of
the invention and thereby inhibit or extinguish its activity.
Potential antagonists also may be small organic molecules, a
peptide, a polypeptide such as a closely related protein or
antibody that binds the same sites on a binding molecule, such as a
binding molecule, without inducing phytate biosynthetic
enzyme-induced activities, thereby preventing the action of the
enzyme by excluding the enzyme from binding.
[0221] Potential antagonists include a small molecule which binds
to and occupies the binding site of the polypeptide thereby
preventing binding to cellular binding molecules, such as binding
molecules, such that normal biological activity is prevented.
Examples of small molecules include but are not limited to small
organic molecules, peptides or peptide-like molecules.
[0222] Other potential antagonists include molecules that affect
the expression of the gene encoding phytate biosynthetic enzymes
(e.g. transactivation inhibitors). Other potential antagonists
include antisense molecules. Antisense technology can be used to
control gene expression through antisense DNA or RNA or through
double- or triple-helix formation. Antisense techniques are
discussed, for example, in - Okano, J. Neurochem. 56. 560 (1991);
OLIGODEOXYNUCLEOTIDESAS ANTISENSE INHIBITORS OF GENE EXPRESSION,
CRC Press, Boca Raton, Fla. (1988). Triple helix formation is
discussed in, for instance Lee et al., Nucleic Acids Research
6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science 251:1360 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA. For example, the 5'
coding portion of a polynucleotide that encodes the mature
polypeptide of the present invention may be used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription thereby preventing
transcription and the production of phytate biosynthetic enzymes.
The antisense RNA oligonucleotide hybridizes to the mRNA in vivo
and blocks translation of the mRNA molecule into phytate
biosynthetic enzymes. The oligonucleotides described above can also
be delivered to cells such that the antisense RNA or DNA may be
expressed in vivo to inhibit production of phytate biosynthetic
enzymes.
[0223] The antagonists may be employed for instance to reduce the
levels of phytate and/or increase the available phosphorous in
plant cells.
EXAMPLES
[0224] The present invention is further described by the following
examples. The examples are provided solely to illustrate the
invention by reference to specific embodiments. These
exemplifications,while illustrating certain specific aspects of the
invention, do not portray the limitations or circumscribe the scope
of the disclosed invention.
[0225] Certain terms used herein are explained in the foregoing
glossary.
[0226] All examples were carried out using standard techniques,
which are well known and routine to those of skill in the art,
except where otherwise described in detail. Routine molecular
biology techniques of the following examples can be carried out as
described in standard laboratory manuals, such as Sambrook et al.,
MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0227] All parts or amounts set out in the following examples are
by weight, unless otherwise specified.
[0228] Unless otherwise stated size separation of fragments in the
examples below was carried out using standard techniques of agarose
and polyacrylamide gel electrophoresis ("PAGE") in Sambrook et al.,
MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989) and numerous
other references such as, for instance, by Goeddel et al., Nucleic
Acids Res. 8:4057 (1980).
[0229] Unless described otherwise, ligations were accomplished
using standard buffers, incubation temperatures and times,
approximately equimolar amounts of the DNA fragments to be ligated
and approximately 10 units of T4 DNA ligase ("ligase") per 0.5
microgram of DNA.
Example 1
Isolation of DNA Coding for Novel Proteins from Zea mays
[0230] The polynucleotide having the myo-inositol 1-phosphate
synthase DNA sequence was obtained from the sequencing of a library
of cDNA clones prepared from maize embryos isolated 15 days after
pollination. The polynucleotide having the myo-inositol
monophosphatase-3 DNA sequence was obtained from the sequencing of
a library of cDNA clones prepared from maize immature ears. The
polynucleotide having the myo-inositol 1,3,4-triphosphate
5.6-kinase DNA sequence was obtained from the sequencing of a
library of cDNA clones prepared from maize tassel shoots. The
polynucleotide having the phosphatidylinositol-3-kinase DNA
sequence was obtained from the sequencing of a library of cDNA
clones prepared from germinating maize seeds. Total RNA was
isolated from this tissue using standard protocols and enriched for
mRNA by selection with oligo dT, again by standard protocols. This
mRNA was then used as template to synthesize complementary DNA
(cDNA) using the enzyme reverse transcriptase by conventional
methods. The resulting strand of cDNA was then converted to
double-stranded pieces of cDNA and ligated into the cloning vector
pSPORT using conventional ligation/transformation methods.
Individual colonies were then selected and plasmid DNA prepared
from each. This plasmid DNA was then denatured and used as template
in dideoxynucleotide sequencing reactions. By sequencing the
individual clones thus identified with sequencing primers designed
from the original sequence it is then possible to extend the
sequence in both directions to determine the full gene sequence.
Suitable techniques are described by Maniatis, T., Fritsch, E. F.
and Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd
Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New
York (1989). (See Screening By Hybridization 1.90 and Sequencing
Denatured Double-Stranded DNA Templates 13.70). The sequences were
compared to those sequences available in public databases (i.e.,
Genbank) to determine homologies/gene identification. In some cases
the sequencing data from two or more clones containing overlapping
segments of DNA were used to construct the contiguous DNA sequence
below.
Example 2
Construction of Expression Cassettes for Homology-Dependent Gene
Silencing of Phytate Biosynthetic Enzyme Expression
[0231] To facilitate manipulations of this trait in conventional
breeding programs, the expression cassette described above is used
in homologous gene silencing (i.e. Knockout) of the end ogenous
phytate biosynthetic enzyme polynucleotides by using the
embryo-preferred promoter globulin-1 to drive expression of the
genes.
[0232] Plant expression cassettes are made using the
embryo-preferred promoter globulin-1 to drive expression of the
phytate biosynthetic enzyme polynucleotides. Globulin-1 termination
sequences are also included in this cassette. The entire expression
cassette is cloned into a pUC based plasmid vector for easy
manipulation in E. coli. This construct is used for particle
bombardment transformation of corn in conjunction with another
expression construct which includes a selectable marker (for
example Pat, PH P8092.fwdarw.Ubi::mo-PAT:: ubi). For
Agrobacterium-mediated transformation, a plasmid is moved into an
appropriate binary vector containing both left and right border
sequences to facilitate DNA transfer into the target genome.
[0233] This polynucleotide, encoding the inventive polypeptides,
when made to be non-functional in plants, results in a reduction in
phytic acid and an increase in non-phytate phosphorus levels. This
can be demonstrated using the transposable element Mu. Maize lines
are confirmed as having a Mu element inserted into the coding
region of the phytate biosynthetic enzyme polynucleotides.
Extensive genetics are done on this phenotype demonstrating it to
be transmitted to progeny as a homozygous recessive trait.
Example 3
Transformation of Maize
[0234] The inventive polynucleotides contained within a vector are
transformed into embryogenic maize callus by particle bombardment.
Transgenic maize plants are produced by bombardment of
embryogenically responsive immature embryos with tungsten particles
associated with DNA plasmids. The plasmids consist of a selectable
and an unselectable marker gene.
[0235] Preparation of Particles
[0236] Fifteen mg of tungsten particles (General Electric), 0.5 to
1.8.mu., preferably 1 to 1.8.mu., and most preferably 1.mu., are
added to 2 ml of concentrated nitric acid. This suspension was
sonicated at 0.degree. C. for 20 minutes (Branson Sonifier Model
450, 40% output, constant duty cycle). Tungsten particles are
pelleted by centrifugation at 10000 rpm (Biofuge) for one minute,
and the supernatant is removed. Two milliliters of sterile
distilled water are added to the pellet, and brief sonication is
used to resuspend the particles. The suspension is pelleted, one
milliliter of absolute ethanol is added to the pellet, and brief
sonication is used to resuspend the particles. Rinsing, pelleting,
and resuspending of the particles is performed two more times with
sterile distilled water, and finally the particles are resuspended
in two milliliters of sterile distilled water. The particles are
subdivided into 250-ml aliquots and stored frozen.
[0237] Preparation of Particle-Plasmid DNA Association
[0238] The stock of tungsten particles are sonicated briefly in a
water bath sonicator (Branson Sonifier Model 450, 20% output,
constant duty cycle) and 50 ml is transferred to a microfugetube.
Equimolar amounts of selectable and unselectable plasmid DNA are
added to the particles for a final DNA amount of 0.1 to 10 mg in 10
ml total volume, and briefly sonicated. Preferably, 1 mg total DNA
is used. Specifically, 4.9 ml of PHP 8092
(Ubiquitin::ubiquitinintron::mo-PAT::35SCaMV, 6.329 kbp)) plus 5.1
ml of (globulin 1: mi ps::globulinl ),where any phytate
biosynthetic enzyme polynucleotide can replace mi1 ps, both at 0.1
mg/ml in TE buffer, are added to the particle suspension. Fifty
microliters of sterile aqueous 2.5 M CaCl.sub.2 are added, and the
mixture is briefly sonicated and vortexed. Twenty microliters of
sterile aqueous 0.1 M spermidine are added and the mixture is
briefly sonicated and vortexed. The mixture is incubated at room
temperature for 20 minutes with intermittent brief sonication. The
particle suspension is centrifuged, and the supernatant is removed.
Two hundred fifty microliters of absolute ethanol are added to the
pellet, followed by brief sonication. The suspension is pelleted,
the supernatant is removed, and 60 ml of absolute ethanol are
added. The suspension is sonicated briefly before loading the
particle-DNA agglomeration onto macrocarriers.
[0239] Preparation of Tissue
[0240] Immature embryos of maize variety High Type II are the
target for particle bombardment-mediated transformation. This
genotype is the F.sub.1 of two purebred genetic lines, parents A
and B, derived from the cross of two know maize inbreds, A188 and
B73. Both parents are selected for high competence of somatic
embryogenesis, according to Armstrong et al., Maize Genetics Coop.
News 65:92 (1991).
[0241] Ears from F.sub.1 plants are selfed or sibbed, and embryos
are aseptically dissected from developing caryopses when the
scutellum first became opaque. This stage occurs about 9-13 days
post-pollination, and most generally about 10 days
post-pollination, depending on growth conditions. The embryos are
about 0.75 to 1.5 millimeters long. Ears are surface sterilized
with 20-50% Clorox for 30 minutes, followed by three rinses with
sterile distilled water.
[0242] Immature embryos are cultured with the scutellum oriented
upward, on embryogenic induction medium comprised of N6 basal
salts, Eriksson vitamins, 0.5 mg/l thiamine HCl, 30 gm/l sucrose,
2.88 gm/l L-proline, 1 mg/l 2,4-dichlorophenoxyaceticacid, 2 gm/l
Gelrite, and 8.5 mg/l AgNO.sub.3. Chu et al., Sci. Sin. 18:659
(1975); Eriksson, Physiol. Plant 18:976 (1965). The medium is
sterilized by autoclaving at 121.degree. C. for 15 minutes and
dispensed into 100.times.25 mm Petri dishes. AgNO.sub.3 is
filter-sterilized and added to the medium after autoclaving. The
tissues are cultured in complete darkness at 28.degree. C. After
about 3 to 7 days, most usually about 4 days, the scutellum of the
embryo swells to about double its original size and the
protuberances at the coleorhizal surface of the scutellum indicated
the inception of embryogenic tissue. Up to 100% of the embryos
displayed this response, but most commonly, the embryogenic
response frequency is about 80%.
[0243] When the embryogenic response is observed, the embryos are
transferred to a medium comprised of induction medium modified to
contain 120 gm/l sucrose. The embryos are oriented with the
coleorhizal pole, the embryogenically responsive tissue, upwards
from the culture medium. Ten embryos per Petri dish are located in
the center of a Petri dish in an area about 2 cm in diameter. The
embryos are maintained on this medium for 3-16 hour, preferably 4
hours, in complete darkness at 28.degree. C. just prior to
bombardment with particles associated with plasmid DNAs containing
the selectable and unselectable marker genes.
[0244] To effect particle bombardment of embryos, the particle-DNA
agglomerates are accelerated using a DuPont PDS-1 000 particle
acceleration device. The particle-DNA agglomeration is briefly
sonicated and 10 ml were deposited on macrocarriers and the ethanol
is allowed to evaporate. The macrocarrier is accelerated onto a
stainless-steel stopping screen by the rupture of a polymer
diaphragm (rupture disk). Rupture is effected by pressurized
helium. The velocity of particle-DNA acceleration is determined
based on the rupture disk breaking pressure. Rupture disk pressures
of 200 to 1800 psi are used, with 650 to 1100 psi being preferred,
and about 900 psi being most highly preferred. Multiple disks are
used to effect a range of rupture pressures.
[0245] The shelf containing the plate with embryos is placed 5.1 cm
below the bottom of the macrocarrier platform (shelf #3). To effect
particle bombardment of cultured immature embryos, a rupture disk
and a macrocarrier with dried particle-DNA agglomerates are
installed in the device. The He pressure delivered to the device is
adjusted to 200 psi above the rupture disk breaking pressure. A
Petri dish with the target embryos is placed into the vacuum
chamber and located in the projected path of accelerated particles.
A vacuum is created in the chamber, preferably about 28 in Hg.
After operation of the device, the vacuum is released and the Petri
dish is removed.
[0246] Bombarded embryos remain on the osmotically-adjusted medium
during bombardment, and 1 to 4 days subsequently. The embryos are
transferred to selection medium comprised of N6 basal salts,
Eriksson vitamins, 0.5 mg/l thiamine HCl, 30 gm/l sucrose, 1 mg/l
2,4-dichlorophenoxyaceticacid, 2 gm/l Gelrite, 0.85 mg/l Ag
NO.sub.3 and 3 mg/l bialaphos (Herbiace, Meiji). Bialaphos is added
filter-sterilized. The embryos are subcultured to fresh selection
medium at 10 to 14 day intervals. After about 7 weeks, embryogenic
tissue, putatively transformed for both selectable and unselected
marker genes, proliferates from about 7% of the bombarded embryos.
Putative transgenic tissue is rescued, and that tissue derived from
individual embryos is considered to be an event and is propagated
independently on selection medium. Two cycles of clonal propagation
are achieved by visual selection for the smallest contiguous
fragments of organized embryogenic tissue.
[0247] A sample of tissue from each event is processed to recover
DNA. The DNA is restricted with a restriction endonuclease and
probed with primer sequences designed to amplify DNA sequences
overlapping the phytate biosynthetic enzymes and non-phytate
biosynthetic enzyme portion of the plasmid. Embryogenic tissue with
amplifiable sequence is advanced to plant regeneration.
[0248] For regeneration of transgenic plants, embryogenic tissue is
subcultured to a medium comprising MS salts and vitamins (Murashige
& Skoog, Physiol. Plant 15: 473 (1962)), 100 mg/l myo-inositol,
60 gm/l sucrose, 3 gm/l Gelrite, 0.5 mg/l zeatin, 1 mg/l
indole-3-acetic acid, 26.4 ng/l cis-trans-abscissic acid, and 3
mg/l bialaphos in 100.times.25 mm Petri dishes, and is incubated in
darkness at 28.degree. C. until the development of well-formed,
matured somatic embryos can be seen. This requires about 14 days.
Well-formed somatic embryos are opaque and cream-colored, and are
comprised of an identifiable scutellum and coleoptile. The embryos
are individually subcultured to a germination medium comprising MS
salts and vitamins, 100 mg/l myo-inositol, 40 gm/l sucrose and 1.5
gm/l Gelrite in 100.times.25 mm Petri dishes and incubated under a
16 hour light:8 hour dark photoperiod and 40
meinsteinsm.sup.-2sec.sup.-1 from cool-white fluorescent tubes.
After about 7 days, the somatic embryos have germinated and
produced a well-defined shoot and root. The individual plants are
subcultured to germination medium in 125.times.25 mm glass tubes to
allow further plant development. The plants are maintained under a
16 hour light:8 hour dark photoperiod and 40
meinsteinsm.sup.-2sec.sup.-1 from cool-white fluorescent tubes.
After about7 days, the plants are well-established and are
transplanted to horticultural soil, hardened off, and potted into
commercial greenhouse soil mixture and grown to sexual maturity in
a greenhouse. An elite inbred line is used as a male to pollinate
regenerated transgenic plants.
Example 4
Identification of High Phosphorus Transgenic Corn Lines
[0249] The resulting transformants are screened for elevated levels
of inorganic phosphorus using a simple colorimetric assay.
Individual transgenic kernels are crushed in the well of a
megatiter breeding tray using a hydraulic press to 2000 psi. The
crushed kernels are then soaked in 2 ml of 1 N H2SO4 for 2 hours at
room temperature. Color development is then initiated by the
addition of 4 ml of developing solution (1 part 10% ascorbic acid,
6 parts 0.42% ammonium molybdate in 1 N H2SO4) to each crushed
kernel. Kernels are scored after 30 minute incubation at room
temperature as either positive (blue) or negative (clear). Positive
in this instance refers to a high level of inorganic phosphorus.
This protocol is a modified version of what is described in Chen et
al., Anal. Chem. 28:1756 (1956). Those transformants which are
screened as positive with the calorimetric assay will then be
subjected to more rigorous analyses to include Southern, Northern
and Western blotting and quantitation of phytic acid levels.
[0250] Confirmation of Elevated Non-Phytate Phosphorus Levels
[0251] The present transgenics preferably have non-phytate
phosphorus levels in excessive of the natural levels of available
phosphorus for the plant species of interest. In respect to corn it
is preferred to have non-phytate phosphorus levels of about 0.175%,
more preferably about 0.2% and most preferably about 0.225% or
higher. These percentages being base on %wt/wt at a 13% moisture
basis for both corn seed. With respect to soybeans, it is preferred
to have non-phytate phosphorus levels of about 0.47%, more
preferably about 0.49% and most preferably about 0.51%. These
latter percentage being based on the weight of non-phytate
phosphorus/(non phytate P/gram of meal on a 13% moisture
basis).
[0252] Each plant identified as a potential high phosphorus
transgenic is tested again to confirm the original elevated
phosphorus reading. Some putative transgenics may not confirm for
the elevated phosphorus trait. Those which confirm are selected on
the basis of uniformity for the elevated phosphorus trait.
[0253] Confirmation of Reduced Phytate Levels
[0254] To determine whether high non-phytate phosphorus transgenics
are also characterizes by reduced levels of phytate, the following
method is used to quantify the level of phytic acid in a tested
sample.
[0255] The sample is ground, placed in a conical plastic centrifuge
tube and treated with hydrochloric acid. It is homogenized with
polytron, and extracted at room temperature with vortexing. The
extracted sample is placed in a clinical centrifuge at 2500 RPM for
15 minutes. 2.5 ml of the supernatant is removed and added to 25 ml
water. The sample is washed through a SAX.RTM. column. The column
is washed with HCl, eluted and evaporated to dryness. The dried
sample is resuspended in water and filtered through a 0.45
micrometer syringe tip filter into a vial. 10 to 20 microliters of
samples are prepared to inject into an HPLC column.
[0256] The eluting solvent is prepared by mixing 515 ml of
methanol, 485 ml of double distilled water, 8 ml tetrabutyl
ammonium hydroxide 40% (TBAH), 200 microliters of 10 N, (5 M)
sulfuric acid, 0.5 ml formic acid and 1-3 mg phytic acid. Phytic
acid is prepared by placing 16 mg of sodium phytate in 5 ml of
water. This solution is placed on Dowex ion exchange resin (1 ml
Dowex-50 acid form on glass wool in 5 ml pipefte tip). This is
rinsed with 1-2 ml water, and the filtrate brought to 10 ml with
water. Concentration is 1 mg/ml phytic acid. 2 ml is used for 1
liter of solvent. pH of the solvent is adjusted to 4.10+/-0.05 with
10 N sulfuric acid. Chromatography is accomplished by pumping the
sample through a Hamilton PRP-1 reverse phase HPLC column heated to
40 degrees centigrade at a rate of 1 ml per minute. The detection
of inositol phosphate is accomplished with a refractive index
detector (Waters), which is auto-zeroed at least two (2) minutes
before each run.
[0257] The confirmed high phosphorus transgenics are tested in this
manner. Some, but not all, of the mutants evaluated in this way are
confirmed to be low in phytate.
[0258] Sequence Description
[0259] SEQ ID NO:1 PHOSPHATIDYLINOSITOL-3-KINASE cDNA
[0260] SEQ ID NO:2 PHOSPHATIDYLINOSITOL-3-KINASE POLYPEPTIDE
[0261] SEQ ID NO:3 PHOSPHATIDYLINOSITOL-3-KINASE PRIMER
[0262] SEQ ID NO:4 PHOSPHATIDYLINOSITOL-3-KINASE PRIMER
[0263] SEQ ID NO:5 MYO-INOSITOL 1,3,4-TRIPHOSPHATE 5/6-KINASE
cDNA
[0264] SEQ ID NO:6 MYO-INOSITOL 1,3,4-TRIPHOSPHATE 5/6-KINASE
POLYPEPTIDE
[0265] SEQ ID NO:7 MYO-INOSITOL 1,3,4-TRIPHOSPHATE 5/6-KINASE
GENERIC
[0266] SEQ ID NO:8 MYO-INOSITOL 1,3,4-TRIPHOSPHATE 5/6-KINASE
PRIMER
[0267] SEQ ID NO:9 MYO-INOSITOL 1,3,4-TRIPHOSPHATE 5/6-KINASE
PRIMER
[0268] SEQ ID NO:10 MYO-INOSITOL 1- PHOSPHATE SYNTHASE cDNA
[0269] SEQ ID NO:11 MYO-INOSITOL 1-PHOSPHATE SYNTHASE
POLYPEPTIDE
[0270] SEQ ID NO:12 MYO-INOSITOL 1-PHOSPHATE SYNTHASE PRIMER
[0271] SEQ ID NO:13 MYO-INOSITOL 1-PHOSPHATE SYNTHASE PRIMER
[0272] SEQ ID NO:14 MYO-INOSITOL 1-PHOSPHATE SYNTHASE GENOMIC
[0273] SEQ ID NO:15 MYO-INOSITOL 1-PHOSPHATE SYNTHASE GENOMIC
[0274] SEQ ID NO:16 MYO-INOSITOL MONOPHOSPHATE-3 cDNA
[0275] SEQ ID NO:17 MYO-INOSITOL MONOPHOSPHATE-3 POLYPEPTIDE
[0276] SEQ ID NO:18 MYO-INOSITOL MONOPHOSPHATE-3 PRIMER
[0277] SEQ ID NO:19 MYO-INOSITOL MONOPHOSPHATE-3 PRIMER
[0278] SEQ ID NO:20 INOSITOL POLYPHOSPHATE 5-PHOSPHATASE cDNA
[0279] SEQ ID NO:21 D-MYO-INOSITOL-3-PHOSPHATE SYNTHASE cDNA
[0280] SEQ ID NO:22 1D-MYO-INOSITOL TRIPHOSPHATE 3-KINASE B
cDNA
[0281] SEQ ID NO:23 MYO-INOSITOL TRANSPORTER cDNA
[0282] SEQ ID NO:24 MAIZE PHYTASE CDNA
[0283] SEQ ID NO:25 PHOSPHATIDYLINOSITOL TRANSFER PROTEIN cDNA
[0284] SEQ ID NO:26 PHOSPHATIDYLOINOSITOL-4-PHOSPHATE-5-KINASE
cDNA
[0285] SEQ ID NO:27 PHOSPHATIDYLINOSITOL-SPECIFIC PHOSPHOLIPASE C
cDNA
[0286] SEQ ID NO:28 MYO-INOSITOL MONOPHOSPHATASE-1 cDNA
[0287] SEQ ID NO:29 PHOSPHATIDYLINOSITOL 4-KINASE cDNA
[0288] SEQ ID NO:30 PHOSPHATIDYLINOSITOL (4,5) BISPHOSPHATE
5-PHOSPHATASE
[0289] SEQ ID NO: 31 PHOSPHATIDYLINOSITOL SYNTHASE CDNA
Sequence CWU 0
0
* * * * *