U.S. patent application number 09/462561 was filed with the patent office on 2002-08-01 for determination of genetic sex in equine species by analysis of y-chromosomal dna sequences.
Invention is credited to HARRISON, BRUCE THOMAS, KING, BRIAN WILLIAM, MURPHY, KATHLEEN MARGARET, REED, KENNETH CLIFFORD, WADE, NICHOLAS MICHAEL.
Application Number | 20020102541 09/462561 |
Document ID | / |
Family ID | 3802091 |
Filed Date | 2002-08-01 |
United States Patent
Application |
20020102541 |
Kind Code |
A1 |
WADE, NICHOLAS MICHAEL ; et
al. |
August 1, 2002 |
DETERMINATION OF GENETIC SEX IN EQUINE SPECIES BY ANALYSIS OF
Y-CHROMOSOMAL DNA SEQUENCES
Abstract
The present invention relates to DNA sequences, probes and
primers specific to the Y chromosome of Equus caballus. The present
invention also relates to methods of determining the sex of a
horse, a equine fetus, and equine embryo or equine cells. The
present invention further relates to a method for the isolation of
Y chromosomal DNA sequences.
Inventors: |
WADE, NICHOLAS MICHAEL;
(QUEENSLAND, AU) ; HARRISON, BRUCE THOMAS;
(QUEENSLAND, AU) ; KING, BRIAN WILLIAM;
(QUEENSLAND, AU) ; REED, KENNETH CLIFFORD;
(QUEENSLAND, AU) ; MURPHY, KATHLEEN MARGARET;
(QUEENSLAND, AU) |
Correspondence
Address: |
NIXON & VANDERHYE
1100 NORTH GLEBE ROAD
8TH FLOOR
ARLINGTON
VA
22201-4714
US
|
Family ID: |
3802091 |
Appl. No.: |
09/462561 |
Filed: |
March 22, 2000 |
PCT Filed: |
July 8, 1998 |
PCT NO: |
PCT/AU98/00533 |
Current U.S.
Class: |
435/6.11 ;
435/6.12; 435/91.2; 536/24.3; 536/24.31 |
Current CPC
Class: |
C07K 14/47 20130101;
C12Q 1/6879 20130101; C12Q 2600/16 20130101 |
Class at
Publication: |
435/6 ; 435/91.2;
536/24.3; 536/24.31 |
International
Class: |
C12Q 001/68; C07H
021/04; C12P 019/34 |
Claims
1. An isolated polynucleotide, the polynucleotide having a sequence
as set out in any one of SEQ ID NOS: 1 to 4 or 8 to 11, or a
sequence which hybridises thereto, wherein the polynucleotide
hybridises specifically to the equine Y chromosome.
2. An isolated polynucleotide, the polynucloetide having a sequence
characterised by nucleotides 990-2497 of SEQ ID NO: 8, 421-1920 of
SEQ ID NO. 9, 421-1930 of SEQ ID NO. 10, or 1502-2996 of SEQ ID NO.
11 or a sequence which hybridises thereto, wherein the
polynucleotide hybridises specifically to the equine Y
chromosome.
3. An isolated polynucleotide as claimed in claim 1 in which the
sequence shares at least 60% homology with a sequence shown in any
one of SEQ ID Nos 1 to 4 or 8 to 11, wherein the homology is
calculated by the blastn program as herein described.
4. An isolated polynucleotide as claimed in claim 3 in which the
sequence shares at least 80% homology with a sequence shown in any
one of SEQ ID Nos 1 to 4 or 8 to 11, wherein the homology is
calculated by the blastn program as herein described.
5. An isolated polynucleotide as claimed in claim 3 or claim 4,
wherein the sequence shown in any one of SEQ ID Nos 1 to 4 or 8 to
11 is characterised by nucleotides 990-2497 of SEQ ID NO: 8,
421-1920 of SEQ ID NO. 9, 421-1930 of SEQ ID NO. 10, or 1502-2996
of SEQ ID NO. 11
6. An isolated polynucleotide as claimed in claim 1 which has a
sequence as set out in SEQ ID NO: 3 or a sequence which hybridises
thereto.
7. A vector including a polynucleotide sequence as claimed in any
one of claims 1 to 6.
8. A host cell including a vector as claimed in claim 7.
9. An oligonucleotide probe or primer of at least 8 nucleotides,
the oligonucleotide having a sequence that hybridises to a
polynucleotide as claimed in claim 1 or claim 2.
10. An oligonucleotide probe or primer as claimed in claim 9 which
is at least 10 nucleotides in length.
11. An oligonucleotide probe or primer as claimed in claim 10 which
is at least 18 nucleotides in length.
12. An oligonucleotide probe or primer as claimed in claim 11 which
includes a sequence selected from: AGCGGAGAAAGGAATCTCTGG, (SEQ ID
NO: 12) or TACCTAGCGCTTCGTCCTCTAT (SEQ ID NO: 13).
13. An oligonucleotide probe as claimed in any one of claims 9 to
12 in which the probe is conjugated to a detectable label.
14. An oligonucleotide probe as claimed in claim 13 in which the
label is selected from a radioisotope, an enzyme, biotin, a
fluorescer or a chemiluminescer.
15. A method of determining the sex of a horse, an equine fetus, an
equine embryo or an equine cell(s) which method includes analysing
a biological sample derived from the horse, fetus, embryo or
cell(s) for the presence of a polynucleotide sequence as set out in
any one of SEQ ID NOS: 1 to 4 or 8 to 11, wherein the presence of
the polynucleotide in multiple copy number is indicative that the
biological sample is derived from a male.
16. A method according to claim 15 wherein the multiple copy number
is greater than 5 copies in the haploid genome.
17. A method according to claim 15 or claim 16 in which the
biological sample includes one or more sperm cells.
18. A method according to claim 15 or claim 16 in which the
biological sample includes nucleated fetal cells.
19. A method according to claim 15 or claim 16 in which the
analysis involves Southern blot hybridisation, dot blot
hybridisation or in situ hybridisation.
20. A method according to claim 19 in which the analysis involves
the use of an oligonucleotide probe as claimed in any one of claims
9 to 14.
21. A method according to claim 15 or claim 16 in which the
analysis involves the polymerase chain reaction or ligation
amplification reaction.
22. A method according to claim 21 in which the analysis involves
the use of an oligonucleotide primer according to any one of claims
9 to 12.
23. A kit for sex determination of a horse, an equine fetus, an
equine embryo, an equine cell or a population of equine cells,
which includes a polynucleotide as claimed in any one of claims 1
to 6 or an oligonucleotide probe or primer as claimed in any one of
claims 9 to 14.
24. A method for the isolation of polynucleotides which are
specific for the Y chromosome which includes: (i) pooling
substantially equivalent amounts of genomic DNA from two or more
male animals of a single species and pooling substantially
equivalent amounts of genomic DNA from a similar number of female
animals of the same species; (ii) subjecting substantially
equivalent samples of the male and female pooled DNA mixtures to
PCR or LCR with an arbitrary oligonucleotide primer and resolving
the resultant amplified polynucleotides by gel electrophoresis: and
(iii) isolating polynucleotide(s) from the gel that are amplified
from male DNA but are not amplified from female DNA.
25. A method according to claim 24 in which the male and female
animals in step (i) are siblings.
26. A method according to claim 24 or claim 25 which includes the
additional step of confirming that the isolated polynucleotide(s)
from step (iii) is specific for the Y chromosome by using the
isolated polynucleotide, or fragment thereof, as a primer in PCR
reactions performed on DNA samples isolated from individual male
and female animals, wherein the presence of an amplified product
following the PCR reaction on DNA isolated from the male, but not
the female, is confirmation that the polynucleotide is specific for
the Y chromosome.
27. A method according to claim 24 or claim 25 which includes the
additional step of confirming that the isolated polynucleotide(s)
from step (iii) is specific for the Y chromosome by using the
isolated polynucleotide, or fragment thereof, to probe samples of
male and female genomic DNA, wherein a hybridisation signal
indicative of multiple copy number in the male DNA, but not the
female DNA, is confirmation that the polynucleotide is specific for
the Y chromosome.
28. A method according to claim 27 wherein the multiple copy number
is greater than 5 copies in the haploid genome.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to polynucleotide sequences
associated with the equine Y chromosome and to methods of
identifying such polynucleotide sequences. The present invention
also relates to methods of determining the primary (i.e. genetic)
sex of individuals and of samples of cells removed from
individuals, and is particularly concerned with equine sex
determination.
BACKGROUND OF THE INVENTION
[0002] Many sectors of the various horse industries prefer a
preponderance of animals of one sex. This may be for reasons of
reproductive potential, heritability of particular traits,
tractability, performance, stature and physique, appearance or
other reasons.
[0003] The ability to determine the sex of a fetus is advantageous
since it allows optimal management and valuation of
pregnancies.
[0004] Where methods of assisted reproduction are available, by
embryo transfer (with or without induced multiple ovulation) or by
recovery and return into the donor or by in vitro fertilisation,
the ability to determine the sex of an embryo is advantageous since
it allows the sex of potential progeny to be predetermined. If
combined with artificial twinning by means of embryo bisection
(1,2) it further allows enhanced propagation of the desired sex
without reduction in the total number of potential progeny.
[0005] It would be particularly advantageous to predetermine the
sex of progeny by means of insemination of a receptive mare with
sperm populations comprising a preponderance of sperm having one or
the other sex chromosome constitution, i.e. either the X chromosome
(which sperm yield female progeny) or the Y chromosome (which sperm
yield male progeny). Such enriched populations of sperm could also
be used to great advantage in in vitro fertilisation. In a further
very advantageous application. an individual sperm cell of a known
sex chromosome constitution can be injected into the cytoplasm of a
mature oocyte in vitro (ICSI: intra-cytoplasmic sperm injection).
effecting fertilisation to yield a zygote of known sex. The ability
to determine the sex chromosome constitution of populations of
sperm cells and of individual sperm cells is an essential
prerequisite in such applications.
[0006] The primary sex of equine species, as in the overwhelming
majority of mammalian species, is determined by the presence or
absence of the entire Y chromosome or a functional portion thereof
(3-8). The essential portion is a gene known as SRY that is
responsible for initiating testis differentiation (9-11).
Secretions of the resultant testis have a dominant influence on the
development of secondary sex characters (12).
[0007] The sex or presumptive sex of an individual horse can thus
be determined by analysis for DNA sequences that are associated
uniquely with the equine Y chromosome.
[0008] Previous reports of DNA sequences associated with the equine
Y chromosome (11,13,14) concern presumptive sequences that are
amplified by polymerase chain reaction (PCR; 15,16) from primer
oligonucleotides whose sequences are derived from genes known to be
Y-linked in other mammalian species, viz. ZFY(13,14) and
SRY(11,13). There are no published DNA sequence data for DNA
sequences associated with the equine Y chromosome. Both ZFY and SRY
occur in single copy in all mammalian species examined (with the
known exception of Mus species, in which two similar Zfy genes have
been described; 17) and so, presumably, in the horse. In the
context of determining the genetic sex of viable embryos where only
a small number of cells is available from a microscopic biopsy,
assay sensitivity is a significant consideration. The advantages
for embryo sexing of testing for a DNA sequence that is repeated on
the Y chromosome have been detailed previously (18,19).
[0009] A report of a repeated DNA sequence that is found on the Y
chromosome of horses (20) concerns a short DNA sequence element
known as Bkm (5'-G.cndot.A.cndot.C/T.cndot.A-3'; 21-23) that has
been reported in many vertebrate species. It is also abundant
elsewhere in the genome, to the extent that representatives on the
Y chromosome comprise a small minority of the total. Such a
sequence, of itself, has no utility in the diagnosis of genetic sex
in microscopic biopsies.
SUMMARY OF THE INVENTION
[0010] The present inventors have now identified specific DNA
sequences that are repeated in the Y chromosome of the horse. The
nucleic acid isolates correspond to all or part of a DNA sequence
found on the Y chromosome of Equus caballus. The present invention
therefore provides a number of polynucleotide isolates capable of
specifically hybridizing to samples of nucleic acid derived from
horses which contain Y chromosomal DNA sequences.
[0011] A procedure similar in essence to that used in the first
part of the present invention has been applied previously to
animals where it was used to observe, but not isolate or otherwise
define, DNA fragments associated with the heterogametic sex of
chicken (24), cattle (25) and sheep (26).
[0012] Accordingly, in a first aspect the present invention
provides an isolated polynucleotide, the polynucleotide having a
sequence as set out in any one of SEQ ID NOS: 1 to 4 or 8 to 11, or
a sequence which hybridizes thereto.
[0013] The polynucleotide sequences of the present invention
hybridize specifically to the equine Y chromosome. By "hybridize
specifically to the equine Y chromosome" we mean the
polynucleotides hybridize to a repeat sequence which is present on
the equine Y chromosome in a substantially greater copy number than
is present elsewhere in the equine genome. Preferably, the sequence
is present in less than six copies and more preferably in only one
copy in the haploid female genome.
[0014] In a preferred embodiment the polynucleotide sequence has a
sequence as set out in SEQ ID NO: 3 or a sequence which hybridizes
thereto.
[0015] The polynucleotide sequences of the present invention
preferably hybridize to sequences set out in SEQ ID NOS: 1 to 4 or
8 to 11 under high stringency. When used herein, "high stringency"
refers to conditions that (i) employ low ionic strength and high
temperature for washing after hybridization, for example,
0.1.times. SSC and 0.1% (w/v) SDS at 50.degree. C.; (ii) employ
during hybridization conditions such that the hybridization
temperature is 25.degree. C. lower than the duplex melting
temperature of the hybridizing polynucleotides, for example
1.5.times. SSPE, 10% (w/v) polyethylene glycol 6000 (27), 7% (w/v)
SDS (28). 0.25 mg/ml fragmented herring sperm DNA at 65.degree. C.:
or (iii) for example, 0.5M sodium phosphate, pH 7.2. 5 mm EDTA. 7%
(wv/v) SDS (28) and 0.5% (w/v) BLOTTO (29.30) at 70.degree. C.: or
(iv) employ during hybridization a denaturing agent such as
formamide (31), for example, 50% (v/v) formamide with 5.times. SSC,
50 mM sodium phosphate (pH 6.5) and 5.times. Denhardt's solution
(32) at 42.degree. C.; or (v) employ, for example. 50% (v/v)
foriamide. 5.times. SSC. 50 mM sodium phosphate (pH 6.8). 0.1%
(w/v) sodium pyrophosphate. 5.times. Denhardt's solution (32).
sonicated salmon sperm DNA (50 .mu.g/mM) and 10%/o dextran sulphate
(33) at 42.degree. C. See generally references 34-36.
[0016] In a further preferred embodiment, the polynucleotide which
hybridises under stringent conditions is less than 500 nucleotides,
more preferably less than 200 nucleotides, and more preferably less
than 100 nucleotides in length.
[0017] In a further preferred embodiment, the polynucleotide
sequences of the present invention share at least 40% homology,
more preferably at least 60% homology, more preferably at least 80%
homology, more preferably at least 90% homology and more preferably
at least 95% homology with a sequence shown in any one of SEQ ID
NOS: 1 to 4 or 8 to 11, wherein the homology is calculated by the
BLAST program blastn as described in Altschul, S. F., Madden, T.
L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. And Lipman,
D. J. (1997) "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Research
25(17):3389-3402.
[0018] In a further preferred embodiment, the polynucloetide
sequence of the present invention hybridises under stringent
conditions to a sequence characterised by nucleotides 990-2497 of
SEQ ID NO: 8. 421-1920 of SEQ ID NO. 9. 421-1930 of SEQ ID NO. 10,
or 1502-2996 of SEQ ID NO. 11.
[0019] The polynucleotide of the present invention may comprise DNA
or RNA sequences.
[0020] The present invention also provides a vector including a
polynucleotide sequence according to the first aspect of the
present invention and a host cell transformed with such a
vector.
[0021] In a second aspect, the present invention provides an
oligonucleotide probe or primer of at least 8 nucleotides, the
oligonucleotide having a sequence that hybridizes to a
polynucleotide of the first aspect of the present invention.
[0022] In a preferred embodiment the oligonucleotide is at least
10. more preferably at least 15 and more preferably at least 18
nucleotides in length.
[0023] In one preferred embodiment the oligonucleotide is derived
from the sequence shown in SEQ ID NO:3. In one preferred embodiment
the oligonucleotide comprises the sequence:
[0024] 5'-AGCGGAGAAAGGAATCTCTGG-3'(SEQ ID NO: 12) or
[0025] 5'-TACCTAGCGCTTCGTCCTCTAT-3'(SEQ ID NO: 13) derived from nts
6-26 and the reverse complement of nts 184-205, respectively, of
the equine male genomic DNA sequence shown in SEQ ID NO: 7.
[0026] It will be appreciated that the probes or primers of the
present invention may be produced by in vitro or in vivo synthesis.
Methods of in vitro probe synthesis include organic chemical
synthesis processes or enzymatically mediated synthesis, e.g. by
means of SP6 RNA polymerase and a plasmid containing a
polynucleotide sequence according to the first aspect of the
present invention under transcriptional control of an SP6 specific
promoter.
[0027] In a further preferred embodiment the oligonucleotide probe
is conjugated with a label such as a radioisotope, an enzyme,
biotin, a fluorescer or a chemiluminescer.
[0028] In a third aspect, the present invention provides a method
of determining the sex of a horse, an equine fetus, an equine
embryo or an equine cell(s) which method includes analysing a
biological sample derived from the horse or the fetus or embryo or
the population of cells, for the presence of a polynucleotide
according to the first aspect of the present invention.
[0029] The equine cell(s) may be, for example, the sperm cells of a
horse. In a preferred embodiment they may be populations of sperm
cells or individual sperm cells that have been resolved by flow
cytometry after staining with the fluorescent DNA-binding dye
Hoechst 33342 (37,38).
[0030] The equine cell(s) may further be, for example, nucleated
fetal cells. Such cells may be collected by amniocentesis or
chorionic villus sampling. In a preferred embodiment they may be
sampled in the peripheral blood of a pregnant mare (see generally
reference 39 the disclosure of which is incorporated herein by
reference).
[0031] In order to minimise the possibility of false negatives, the
method is preferably conducted with one or more suitable positive
controls. For example, the biological sample may be simultaneously
analysed for the presence of a sequence which is present in
approximately equal copy numbers in male and female horses. The
biological sample may be analysed, for example, for the presence of
a dispersed autosomal repeated sequence.
[0032] It will be understood by a person skilled in this field that
an analysis to determine whether a sample contains the
polynucleotide sequence of the present invention may be performed
in a number of ways. For example, the analysis may involve Southern
blot hybridization, dot blot hybridization or in situ hybridization
tests using probes according to the present invention.
Alternatively, the analysis may involve the technique of polymerase
chain reaction (PCR; 16) or ligation amplification reaction (LAR;
40,41) using oligonucleotide primers and probes of the present
invention.
[0033] The term "polymerase chain reaction" or "PCR" when used
herein generally refers to a procedure where minute amounts of a
specific piece of nucleic acid, RNA and/or DNA, are amplified as
described in references 42 and 43. Generally, sequence information
from the ends of the region of interest or beyond needs to be
available, such that oligonucleotide primers can be designed; these
primers will be identical in sequence or similar in sequence to
opposite strands of the template to be amplified. The 5' terminal
nucleotides of the two primers may coincide with the ends of the
amplified material. PCR can be used to amplify specific RNA
sequences, specific DNA sequences from total genomic DNA, and cDNA
transcribed from total cellular RNA. bacteriophage or plasmid
sequences, etc. See generally references 16 and 44.
[0034] As used herein, PCR is considered to be one, but not the
only, example of a nucleic acid polymerase reaction method for
amplifying a nucleic acid test sample, comprising the use of an
established nucleic acid (DNA or RNA) as a primer, and utilises a
nucleic acid polymerase to amplify or generate a specific piece of
nucleic acid or to amplify or generate a specific piece of nucleic
acid which is complementary to a particular nucleic acid (see, for
example, references 45 and 46).
[0035] The terms "ligation chain reaction" or "LCR" or "ligation
amplification reaction" or "LAR" when used herein generally refer
to a procedure where minute amounts of a specific piece of nucleic
acid, RNA and/or DNA, are amplified as described in references 40
and 41. Generally, sequence information from the region of interest
needs to be available, such that oligonucleotide pairs can be
designed that are complementary to adjacent sites on an appropriate
nucleic acid template. The oligonucleotide pair is ligated together
by the action of a ligase enzyme. The amount of ligated product may
be increased by either linear or exponential amplification using
sequential rounds of such template-dependent ligation. In the case
of linear amplification, a single pair of oligonucleotides is
ligated, the reaction is heated to dissociate the ligation product
from its template, and similar additional rounds of ligation are
performed. Exponential amplification utilises two pairs of
oligonucleotides, one pair being complementary to one strand of a
target sequence and the other pair being complementary to the
second strand of the target sequence. In this case the products of
ligation serve as mutually complementary templates for subsequent
rounds of ligation, interspersed with heating to separate the
ligated products from the template strands. A single base-pair
mismatch between the annealed oligonucleotides and the template
prevents ligation, thus allowing the distinction of single
base-pair differences between DNA templates. LAR can be used to
amplify specific RNA sequences, specific DNA sequences from total
genomic DNA, and cDNA transcribed from total cellular RNA,
bacteriophage or plasmid sequences, etc. See generally references
40 and 41. As used herein, LAR is considered to be one, but not the
only, example of a nucleic acid ligase reaction method for
amplifying a nucleic acid test sample, comprising the use of an
established nucleic acid (DNA or RNA) as a primer/probe, and
utilises a nucleic acid ligase to amplify or generate a specific
piece of nucleic acid or to amplify or generate a specific piece of
nucleic acid which is complementary to a particular nucleic acid
(see, for example, references 47 and 48).
[0036] In a fourth aspect, the present invention provides a kit for
sex determination of a horse, an equine fetus, an equine embryo, an
equine cell or a population of equine cells, which kit includes a
polynucleotide according to the first aspect of the present
invention or an oligonucleotide probe or primer according to the
second aspect of the present invention.
[0037] The terms "EY.AC6", "EY.AD11", "EY.AI5" and "EY.AM7" as used
herein refer to, where provided, the specific DNA sequences set
forth in SEQ ID NOS: 1-4 respectively. These terms also include
variants where nucleotides have been substituted, added to or
deleted from the relevant sequences shown in SEQ ID NOS: 1-4 so
long as the variants hybridize specifically to the equine Y
chromosome.
[0038] Such variants may be naturally occurring variants which may
arise within an individual or a population by virtue of point
mutation(s). deletion(s) or insertion(s) of DNA sequences, by
recombination, gene conversion, flawed replication or
rearrangement. Alternatively, such variants may be produced
artificially, for example by site-directed mutagenesis, by "gene
shuffling", by deletion using exonuclease(s) and/or
endonuclease(s), or by the addition of DNA sequences by ligating
portions of DNA together, or by the addition of DNA sequences by
template-dependent and/or template-independent DNA
polymerase(s).
[0039] The EY.AC6 DNA sequence is shown in SEQ ID NO: 1. The
sequence, comprising 432 base pairs of nucleotides, was determined
from a fragment of DNA that was cloned into plasmid pGEM-T
(trademark Promega). The cloned fragment had been recovered from a
polyacrylamide gel following electrophoresis and staining of the
products of RAPD PCR of male equine genomic DNA with Operon
(trademark) primer OPAC.06. The fragment was selected because it
was visible as a product of RAPD PCR of male but not female genomic
DNA. Homologues of the cloned fragment EY.AC6 have been shown, by
its hybridization to Southern blots of genomic DNA from male and
female Equus caballus, to be present in both sexes but are repeated
at much higher amounts in males, with the haploid female genome
containing just one or a small number of copies. The defined
sequence EY.AC6 appears to be contiguous with sequence EY.AM7 in
the equine Y chromosome since the two sequenced isolates share a
region of overlap of 128 bp with 91% similarity.
[0040] The EY.AD11 DNA sequence is shown in SEQ ID NO: 2. The
sequence, comprising 600 base pairs of nucleotides, was determined
from a fragment of DNA that was cloned into plasmid pGEM-T
(trademark Promega). The cloned fragment had been recovered from a
polyacrylamide gel following electrophoresis and staining of the
products of RAPD PCR of male equine genomic DNA with Operon
(trademark) primer OPAD.11. The fragment was selected because it
was visible as a product of RAPD PCR of male but not female genomic
DNA. Homologues of the cloned fragment EY.AD11 have been shown, by
its hybridization to Southern blots of genomic DNA from male and
female Equus caballus, to be present in both sexes but are repeated
at much higher amounts in males, with the haploid female genome
containing just one or a small number of copies.
[0041] The EY.AI5 DNA sequence is shown in SEQ ID NO: 3. The
sequence. comprising 230 base pairs of nucleotides, was determined
from a fragment of DNA that was cloned into plasmid pGEM-3Z
(trademark Promega). The cloned fragment had been recovered from a
polyacrylamide gel following electrophoresis and staining of the
products of RAPD PCR of male equine genomic DNA with Operon
(trademark) primer OPAI.05. The fragment was selected because it
was visible as a product of RAPD PCR of male but not female genomic
DNA. Homologues of the cloned fragment EY.AI5 have been shown, by
its hybridization to Southern blots of genomic DNA from male and
female Equus caballus, to be present in both sexes but are repeated
at much higher amounts in males, with the haploid female genome
containing just one or a small number of copies.
[0042] The EY.AM7 DNA sequence is shown in SEQ ID NO: 4. The
sequence, comprising 285 base pairs of nucleotides, was determined
from a fragment of DNA that was cloned into plasmid pGEM-T
(trademark Promega). The cloned fragment had been recovered from a
polyacrylamide gel following electrophoresis and staining of the
products of RAPD PCR of male equine genomic DNA with Operon
(trademark) primer OPAM.07. The fragment was selected because it
was visible as a product of RAPD PCR of male but not female genomic
DNA. Homologues of the cloned fragment EY.AM7 have been shown, by
its hybridization to Southern blots of genomiic DNA from male and
female Equus caballus, to be present in both sexes but are repeated
at much higher amounts in males, with the haploid female genome
containing just one or a small number of copies. The defined
sequence EY.AM17 appears to be contiguous with sequence EY.AC6 in
the equine Y chromosome since the sequences isolated share a region
of overlap of 128 bp with 91% similarity.
[0043] The DNA sequences described herein (SEQ ID NOS: 1-4) were
determined by chain-termination DNA sequencing techniques (49)
using fluorescence-labelled dideoxynucleotides (50-53).
[0044] It will be appreciated by those skilled in the art that the
polynucleotide sequences of the present invention are advantageous
in that they are present in multiple copies on the Y chromosome,
thereby providing greater sensitivity in assays for the presence of
a Y chromosome than is possible when the assay involves detection
of a unique (single copy) DNA sequence. This allows detection to be
applied with greater facility to very small samples, as in a few
cells removed from a viable embryo (2) or cells of fetal origin in
peripheral blood of a pregnant mare (39) or sperm cells separated
by fluorescence activated cell sorting (38).
[0045] The polynucleotide sequences and oligonucleotide primers and
probes of the present invention have application, for example, in
sexing of embryo biopsy; fetal sex detection, i.e. by
amniocentesis, chorionic villus sampling, fetal cells circulating
in peripheral blood of a pregnant mare; analysis of the sex
chromosome constitution of an individual sperm cell or of
populations of sperm cells; resolution of ambiguities in sexual
phenotype; sex analysis of tissues derived from horses (meat, hide,
hair, bone, etc. from living or dead horses); and similar
applications in related equine species, including extinct or
endangered species.
[0046] The polynucleotide sequences and oligonucleotide primers and
probes of the present invention also have a variety of uses in
addition to their use in sexual identification. For example, the
sequences may be used to screen recombinant DNA libraries prepared
from a variety of mammalian species. The DNA sequences may be used
to deduce similar sequences or genetically linked sequences having
similar functionality. The sequences may also be used in chromosome
walking or jumping techniques to isolate coding and non-coding
sequences proximal to the nucleotide sequence of the present
invention.
[0047] According to a further aspect of the present invention,
there is provided a method for the isolation of Y-chromosomal DNA
sequences comprising:
[0048] pooling equivalent amounts of genomic DNA from a number of
male animals of a single species and pooling equivalent amounts of
genomic DNA from a similar number of female animals of the same
species, with the female animals preferably being related closely
to the male animals, e.g. siblings: subjecting equivalent samples
of the male and female pooled DNA mixtures to PCR with an arbitrary
oligonucleotide primer and resolving the resultant fragments by gel
electrophoresis;
[0049] examining the stained resolved products for fragments that
are amplified from male DNA but not from female DNA;
[0050] recovering said fragment(s) from an electrophoresis gel and
isolating individual fragments by molecular cloning; and
[0051] PCR analysis of samples of male and female genomic DNA using
oligonucleotide primers derived from the DNA sequence of said
isolated fragment(s).
[0052] In a preferred embodiment the method includes the additional
step after step (iii) of confirming the male association of
fragment(s) by PCR and electrophoretic analysis of equivalent
genomic DNA samples from a number of individual male and female
animals. Preferably the method also includes an additional step
after step (iv) of confirming the isolation of individual
male-associated fragment(s) by hybridization of the labelled said
fragment(s) with samples of male and female genomic DNA. The terms
"comprise", "comprises" and-"comprising" as used throughout the
specification are intended to refer to the inclusion of a stated
component or feature or group of components or features with or
without the inclusion of a further component or feature or group of
components or features.
[0053] The present invention will now be described, by way of
example only, with reference to the following non-limiting drawings
and examples.
BRIEF DESCRIPTION OF THE FIGURES
[0054] FIG. 1 shows hybridization analysis of horse breeds, donkey
and camel with male-associated sequence EY.AI5. Samples of genomic
DNA (2.5 .mu.g) from male (m) and female (f) horses of various
breeds (Family Equidae: Equus caballus) as well as Przewalski's
horse (E. przewalskii). donkey (E. asinus) and the camel (Family
Camelidae: Camelus dromedarius) as indicated, were digested with
Sau3AI. The fragments were resolved by agarose gel electrophoresis,
transferred onto positively-charged nylon membrane and hybridized
with digoxigenin-labelled probe EY.AI5. as described in the text.
The lane labelled M contained DNA standards whose sizes are
indicated in base pairs.
[0055] FIG. 2 shows the sequence of fragments amplified directly
from genomic DNA of male and female horses using primers EQYL1 and
EQYR1. Differences between the sequences determined from male and
female genomic DNA are indicated by .cndot.; differences between
the cloned EY.AI5 sequence (SEQ ID NO: 3) and the sequence from
male genomic DNA are indicated by *. The underlined region from nt
6 to nt 26 is the sequence of sexing primer EQYL2: the underlined
region from nt 184 to nt 205 is the reverse complement of the
sequence of sexing primer EQYR5 (refer to text).
[0056] FIG. 3 shows hybridization analysis of recombinant phage DNA
with cloned male-associated sequences. Samples of DNA (10 .mu.g) of
Lambda Fix.RTM.II vectors containing equine genomic inserts were
digested with restriction enzymes EcoRI and HindII as shown.
Digests were treated at 68.degree. C. for 15 min then resolved by
agarose gel electrophoresis before transfer to positively- charged
nylon membrane as described in the text. The membrane was
hybridized with digoxigenin-labelled probes prepared by PCR
amplification of cloned inserts from the flanking plasmid primers
SP6 and T7. One probe was stripped from the membrane by methods
described in the text before hybridization with the second probe.
The inserts used as probes were: (a) EY.AI5; (b) EY.AD11. A
photograph of the gel taken under uv transillumination before DNA
transfer is shown. The lanes labelled M contained DNA standards
whose sizes are indicated in base pairs.
[0057] FIG. 4 shows in (a) the sites for restriction enzyme EcoRI
in the equine genomic DNA insert 32.3 after excision of the insert,
together with its flanking T3 and T7 promoter sequences, from the
Lambda Fix.RTM.II vector with the restriction enzyme NotI. The
position of 4.7 kb subcloned EcoRI fragment 32.3E5 is indicated.
The complete sequence of 32.3E5 was determined and, in (b). the
positions of previously described sequences EY.AC6, EY.AD11, EY.AI5
and EY.AMI7 within the subclone are illustrated, as is the relative
position of the truncated LINE repeat EY.LINE as defined in the
text. There is a close relationship between the DNA sequences of
subclone 32.3E5 and subclone 33.1H7 (see FIG. 5) which allows
33.1H7 to be superimposed on 32.3E5 as shown.
[0058] FIG. 5 shows in (a) the sites of restriction enzyme HindIII
in the genomic DNA insert 33.1 after excision of the insert,
together with its flanking T3 and T7 promoter sequences, from the
Lambda Fix.RTM.II vector with the restriction enzyme NotI. The
locations of two 3.4 kb subcloned repeated HindIII fragments 33.1H7
and 33.1H2 are indicated although it was not possible to determine
which repeat occupied either of the two possible positions. The
complete sequences of both fragments were determined and found to
have 88-90 % identity. In (b), the positions of previously
described sequences EY.AC6. EY.AD11. EY.AI5 and EY.AMs7 within the
subclone 33.1H7 are illustrated, as is the relative position of the
truncated LINE repeat EY.LINE as defined in the text. There is a
close relationship between the DNA sequences of subclone 32.3E5 and
subclone 33.1H7 which allows 33.1H7 (and 33.1H2) to be superimposed
on 32.3E5 as shown in FIG. 4b.
[0059] FIG. 6 shows in (a) the sites of restriction enzymes EcoRI
and HindIII in the equine genomic DNA insert 36.1 after excision of
the insert, together with its flanking T3 and T7 promoter
sequences, from the Lambda Fix.RTM.II vector with the restriction
enzyme NotI. The position of 6.0 kb subcloned EcoRI fragment 36.1E2
is indicated, as is the position of 4.4 kb subcloned HindII
fragment 36.1H7. The complete sequence of 36.1H7 was determined
and, in (b), the positions of previously described sequences
EY.AC6, EY.AD11, EY.AI5 and EY.AN17 within the subclone are
illustrated, as is the relative position of the truncated LINE
repeat EY.LINE as defined in the text. There is a close
relationship between DNA sequences from base 1378 to base 4355 of
subclone 36.1H7 to sequences in subclone 32.3E5 (see FIG. 4b) and
subclones 33.1H7 and 33.1H2 (see FIG. 5b). Sequence in subclone
36.1H7 located 5' to this homologous region encoded inverted and
direct repeats of EY.AC6, EY.AD11 and intervening sequence.
BRIEF DESCRIPTION OF SEQUENCE LISTINGS
[0060] SEQ ID NO: 1 shows the sequence of one strand of equine
repeat element EY.AC6 comprising 432 complementary base pairs. The
sequence is -written in single-letter code from the 5'-terminus to
the 3'-terminus according to standard practice.
[0061] SEQ ID NO: 2 shows the sequence of one strand of equine
repeat element EY.AD11 comprising 600 complementary base pairs.
[0062] SEQ ID NO: 3 shows the sequence of one strand of equine
repeat element EY.AI5 comprising 230 complementary base pairs.
[0063] SEQ ID NO: 4 shows the sequence of one strand of equine
repeat element EY.AN17 comprising 285 complementary base pairs.
[0064] SEQ ID NO: 5 shows the sequence of the cloned EY.AI5
sequence
[0065] SEQ ID NO: 6 shows the sequence of fragments amplified
directly from genomic DNA of female horses using primers EQYL1 and
EQYR1.
[0066] SEQ ID NO: 7 shows the sequence of fragments amplified
directly from genomic DNA of male horses using primers EQYL1 and
EQYR1.
[0067] SEQ ID NO: 8 shows the sequence of one strand of subclone
32.3E5 comprising 4693 complementary base pairs of equine genomic
DNA. Subclone 32.3E5 is an EcoRI fragment of recombinant phage
32.3. The position of the fragment within the phage insert is shown
in FIG. 4a.
[0068] SEQ ID NO: 9 shows the sequence of one strand of subclone
33.1H7 comprising 3430 complementary base pairs of equine genomic
DNA. Subclone 33.1H7 is one of two repeated HindIII fragments of
recombinant phage 33.1 and is 88-90% homologous with a second
HindIII fragment, 33.1H2 (detailed in SEQ ID NO:10). The position
of the repeated fragment within the phage insert is shown in FIG.
5a.
[0069] SEQ ID NO: 10 shows the incomplete sequence of one strand of
subclone 33.1H2 comprising 3230 complementary base pairs of equine
genomic DNA, from 1 to 2122 and from 2342 to 3450 of the subclone.
Subclone 33.1H2 is the second of two repeated HindIII fragments of
phage 33.1 and is 88-90 % homologous with the HindIII fragment,
33.1H7 (detailed in SEQ ID NO: 9). The position of the repeated
fragment within the phage insert is shown in FIG. 5a.
[0070] SEQ ID NO: 11 shows the sequence of one strand of subclone
36.1H7 comprising 4355 complementary base pairs of equine genomic
DNA. Subclone 36.1H7 is a HindIII fragment of phage 36.1 The
position of the fragment within the phage insert is shown in FIG.
6a.
[0071] SEQ ID NO: 12 shows an oligonucleotide probe (EQYL2) derived
from SEQ ID NO:3.
[0072] SEQ ID NO: 13 shows an oligonucleotide probe (EQYR5) derived
from SEQ ID NO:3.
[0073] SEQ ID NO: 14 shows an oligonucleotide primer (EQYR4)
derived from SEQ ID NO:3.
[0074] SEQ ID NO: 15 shows an oligonucleotide primer (EQYL1)
derived from SEQ ID NO:3.
[0075] SEQ ID NO: 16 shows an oligonucleotide primer (EQYR1)
derived from SEQ ID NO:3.
[0076] SEQ ID NO: 17 shows an oligonucleotide primer (EQSIN8)
derived from SEQ ID NO:3.
[0077] SEQ ID NO: 18 shows an oligonucleotide primer (EQSIN9)
derived from SEQ ID NO:3.
[0078] SEQ ID NO: 19 shows an oligonucleotide primer (mEQYL2)
derived from SEQ ID NO:3.
[0079] SEQ ID NO: 20 shows an oligonucleotide primer (mEQYR5)
derived from SEQ ID NO: 3.
[0080] SEQ ID NO: 21 shows an oligonucleotide primer (mEQSIN8)
derived from SEQ ID NO:3.
[0081] SEQ ID NO: 22 shows an oligonucleotide primer (mEQSIN9)
derived from SEQIDNO:3.
[0082] Definitions and Abbreviations
[0083] ATP adenosine-5'-triphosphate
[0084] BLOTTO skim milk powder
[0085] bp base pairs
[0086] ccc covalently closed circular
[0087] cfu colony-forming units
[0088] BSA bovine serum albumin
[0089] Denhardt's solution 0.02% (w/v) BSA, 0.02Yo (w/v) Ficoll
400, 0.02% (w/v) PVP
[0090] DIG digoxigenin
[0091] DNA deoxyribonucleic acid
[0092] dNTP deoxynucleotide triphosphate (dATP, dCTP, dGTP,
dTTP)
[0093] DTT dithiothreitol
[0094] EDTA ethylenediamninetetraacetic acid
[0095] g force of gravity
[0096] h hour(s)
[0097] LAR ligation amplification reaction
[0098] LB Luria-Bertani
[0099] mg milligram(s)=10.sup.-3 gram
[0100] min minute(s)
[0101] ml milliliter(s) =10.sup.-3 liter
[0102] .mu.g microgram(s)=10.sup.-6 gram
[0103] .mu.l microliter(s)=10.sup.-6 liter
[0104] ng nanogram(s)=10.sup.-9 gram
[0105] nm nanometers=10.sup.-9 meter (ref. wavelength of light)
[0106] nt(s) nucleotide(s)
[0107] oligonucleotide single-stranded DNA<30 nts
[0108] PAGE polyacrylamide gel electrophoresis
[0109] PBS phosphate-buffered saline=100 mM NaCl, 2.7 mM KCl, 1.75
mM KH.sub.2PO.sub.4, 4.3mN Na.sub.2HPO.sub.4, pH 7.4
[0110] PCR polymerase chain reaction
[0111] pg picogram(s)=10.sup.-12 gram
[0112] polynucleotide single- or double-stranded DNA or RNA
[0113] primer oligonucleotide used to prime PCR
[0114] probe (labelled) nucleic acid that hybridizes to specific
target sequence(s)
[0115] PVP polyvinylpyrrolidone
[0116] RAPD random amplification of polymorphic DNA
[0117] RNA ribonucleic acid
[0118] rpm revolutions per minute
[0119] SDS sodium dodecylsulphate
[0120] SINE short interspersed repetitive element
[0121] SSC standard saline-citrate=0.15 M NaCl, 15 ml trisodium
citrate
[0122] SSPE standard saline-phosphate-EDTA=0.18M NaCl, 10 mM
NaH.sub.2PO.sub.4, 1 mM EDTA, pH 7.7
[0123] TAE tris-acetate-EDTA=40mM tris-acetate, 20 mM acetic acid,
10 mM
[0124] EDTA, pH 8.4
[0125] Taq Thermus aquaticus
[0126] TBE tris-borate-EDTA=89 MM tris-HCl, 0.89M sodium borate, 2
mM EDTA,
[0127] pH 8.4
[0128] TE tris-EDTA=10 mM tris-HCl, 1 mM EDTA, pH 7.5
[0129] TEINED N,N,N',N'-tetramethylethylenediarine
[0130] temp temperature
[0131] tris tris(hydroxymethyl)-aminomethane
[0132] uv ultraviolet
[0133] V volts
[0134] vol volume equivalent
[0135] v/v volume/volume equivalent
DETAILED DESCRIPTION OF THE INVENTION
EXAMPLE 1
[0136] Preparation of Genomic DNA from Equine Blood Samples:
[0137] Equine blood samples were collected into 10 ml EDTA
Vacutainers.RTM., placed immediately on ice and delivered to the
laboratory within two days. It was found that samples could be
stored in a Vacutainer.RTM. at 4.degree. C. for up to six months
without significant loss of yield or quality of DNA extracted
therefrom.
[0138] Twenty five ml of cold lysis buffer (0.32M sucrose, 10mM
tris-HCl. pH 7.5, 5 mM MgCl.sub.2. 1% (v/v) Triton X-100) was added
to 10 ml of whole blood. The suspension was centrifuged at
4000.times. g for 20 min at 4.degree. C. and the pelleted cells
were resuspended in PBS and recentrifuged. The cells were then
suspended in 9 ml of TE. The suspension was adjusted to 25mM EDTA,
0.5% (w/v) SDS and 0.1 mg/ml of proteinase K (Boehringer Mannheim)
and the lysed mixture was incubated overnight at 37.degree. C. with
gentle agitation. The digested sample was extracted with 5 ml of
phenol/chloroform (equal volumes of phenol equilibrated with
tris-HCl/EDTA (Sigma) and 24:1 (v/v) chloroform/isoamyl alcohol)
for 60 min and the mixture was centrifuged at 4000.times. g for 25
min at 25.degree. C. The aqueous phase was removed from each tube
and transferred to a clean tube.
[0139] DNA was precipitated by the addition of 2.5 vol ethanol or 1
vol propanol, the supernatant decanted and the DNA pellet rinsed
with 0.5 ml of 70% (v/v) ethanol and air-dried. The DNA was finally
dissolved in 2 ml of 0.1.times. TE and stored at -20.degree. C.
[0140] DNA concentrations were determined using a Pharmacia Gene
Quant RNA/DNA calculator. The yield was typically 50-250 .mu.g of
high molecular weight DNA (estimated by ethidium staining after
agarose gel electrophoresis).
[0141] Conceptual Basis for Identification of Male-associated
DNA:
[0142] The Y chromosome is the sole genetic difference between male
and female horses, being present in all nucleated cells of normal
males and absent from the cells of normal females. This genetic
difference must be reflected in the presence of Y-chromosomal DNA
sequences in the male genome that are absent from the female
genome. It would be expected that Y- chromosomal, male-specific DNA
sequences could be identified by a technique that surveys multiple
genomic DNA sequences at random (54), by comparing survey data from
normal male and female genomes which are in all other respects
identical.
[0143] It was not possible to obtain isogenic male and female
horses, i.e. individuals whose genomes are identical except for the
Y chromosome of the male (cf. inbred strains of mice). In the
absence of genetic homology, a combination of statistical and
genetic techniques was used to generate pseudo-isogenic samples of
male and female equine DNA.
[0144] DNA was extracted from white blood cells of nine
brother-sister sibling pairs and equal amounts of DNA from each of
the nine males were pooled to provide a sample of male DNA. Equal
amounts of DNA from each of their sisters were pooled to provide a
parallel sample of pseudo-isogenic female DNA.
[0145] RAPD PCR of Pooled DNA Samples:
[0146] The pooled mixtures of male and female DNA were surveyed for
male-associated sequence differences by PCR amplification, using
decanucleotide primers known as RAPD primers that are available
commercially from Operon Technologies.
[0147] The method used for RAPD PCR was adapted from a method
described previously (55). Each PCR reaction contained 25 ng of
equine genomic DNA, 5 .mu.M RAPD primer (Operon Technologies), 3
units of Taq DNA polymerase Stoffel fragment (Perkin-Elmer), 200
.mu.M of each of the four dNTPs (Promega), 10 mM tris-HCl, pH 8.0,
10 mM KCl and 5 mM MgCl.sub.2 in a total volume of 20 .mu.l.
[0148] Reactions were cycled in a Corbett Research PC-960
Air-Cooled Thermocycler with an initial step of 94.degree. C. for 5
min followed by 35 cycles consisting of 94.degree. C. for 30 sec
then 1 min at each of 57.degree. C., 56.degree. C., 55.degree. C.,
54.degree. C. and 53.degree. C.; on completion of cycling the
samples were heated at 72.degree. C. for 5 min.
[0149] Electrophoretic Analysis of RAPD PCR Products:
[0150] Polyacrylamide gel electrophoresis was used to resolve the
products of RAPD PCR, greatly increasing the resolution of
fragments relative to that attainable by agarose gel
electrophoresis. Silver staining enhanced the sensitivity of
detection compared with uv fluorescence of ethidium bromide.
[0151] DNA amplification products were resolved by polyaclylamide
gel electrophoresis (PAGE) in a Bio-Rad Mini-Protean II. The
polyacrylamide gels were 10% (w/v) acrylamide and 2% (w/v)
bis-acrylamide in TBE buffer containing 10% (w/v) urea and 5% (v/v)
glycerol. Ammonium persulphate (0.15% w/v) and TEMED (0.15% v/v)
were used to initiate and catalyse polymerisation.
[0152] The 0.5 mm gels were cast on Gel Bond PAG backing film (FMC;
56). Samples (2 .mu.l) of PCR reaction product were mixed with 1
.mu.l of loading buffer (40% (w/v) urea, 3% (w/v) Ficoll 400, 10 mM
tris-HCl, pH 8.0, 3 mM EDTA, 0.02% (w/v) xylene cyanol, 0.02% (w/v)
bromophenol blue), loaded into pre-formed slots and electrophoresed
in TBE buffer at 300V for 40 min. Resolved DNA fragments were
visualised by silver staining (57).
[0153] In total, 216 different Operon RAPD primers were used to
screen the pooled pseudo-isogenous samples of male and female DNA.
of which 90% yielded clear, reproducible results for both pooled
samples.
[0154] Identification of Male-associated DNA Fragments:
[0155] Nineteen of the 216 tested primers were found to amplify a
fragment from the male DNA pool that was either less intense than a
fragment of similar size in the female DNA pool or apparently
absent from the PCR products of the female DNA pool. To determine
whether candidate fragments were indeed amplified from the DNA of
all males and only males, primers yielding candidate
male-associated fragments from the pooled DNA samples were used for
RAPD PCR of DNA isolated from a number of individual males and
females. A fragment amplified differentially from pooled male DNA
could arise from an autosomal polymorphism in one or two
individuals, a possibility confirmed by the occasional observation
of differential RAPD PCR fragments from the pooled female DNA
sample.
[0156] The 19 candidate primers were used to amplify individual DNA
samples from four male and four female horses. Unambiguous
male-associated fragments were evident in the products from five of
these primers: OPAC.06 (5'-CCAGAACGGA-3'), OPAD.11
(5'-CAATCGGGTC-3'), OPAI.05 (5'-GTCGTAGCGG-3'), OPAM.01
(5'-TCACGTACGG-3') and OPAM.07 (5'-AACCGCGGCA-3'). The sizes of the
differential fragments were estimated at approximately 460 bp, 530
bp. 240 bp. 320 bp and 300 bp, respectively.
[0157] Isolation of Male-associated DNA Fragments:
[0158] For each of the five candidate male-specific fragments, a
slice containing the fragment was cut from the silver-stained
polyacrylamide gel and allowed to stand in 20-50 .mu.l of
0.1.times. TE at room temp for 60 min. Eluted DNA was re-amplified
under the conditions described above for RAPD PCR using the
relevant RAPD primer and 1 .mu.l of excised fragment solution as
template. Reactions were cycled in a Corbett Research PC-960
Air-Cooled Thermocycler with an initial step at 94.degree. C. for 2
min followed by 35 cycles of 94.degree. C. for 30 sec then
55.degree. C. or 60.degree. C. for 1 min: on completion of cycling
the samples were heated at 72.degree. C. for 2 min.
[0159] It was necessary to confirm that the re-amplified DNA
samples corresponded in electrophoretic mobility with the candidate
RAPD fragments and that each contained a male-associated DNA
fragment. Accordingly, each re-amplified sample was electrophoresed
on a polyacrylamide gel adjacent to the products of RAPD PCR of
male and female genomic DNA with the relevant primer, and with the
products of RAPD PCR from female DNA mixed with the re-amplified
sample.
[0160] In each case, the re-amplified fragment migrated similarly
to the fragment associated differentially with male DNA. In further
confirmation, each of the re-amplified samples was labelled with
digoxigenin and the resultant probes were hybridized to Southern
blots of male and female horse genomic DNA that had been digested
with the restriction enzyme Sau3AI. Each re-amplified fragment
showed an unequivocal male-associated pattern of hybridization
(data not shown; refer to "Colony Screening By Dot Blot
Hybridization" for details of probe preparation, hybridization and
detection). In each case the probe also hybridized with female
genomic DNA, implying that the fragments may not be associated
uniquely with the Y chromosome and/or the sample included
contaminating non-Y-chromosomal DNA.
[0161] Re-amplified PCR products were electrophoresed in 1% (w/v)
LMP agarose (Sigma) in 0.5.times. TBE buffer. The material
recovered from PCR with the OPAI.05 primer was visualised by
illumination at 302 nm of an ethidium bromide-stained gel. The
material recovered from PCR of equine genomic DNA with the OPAC.06,
OPAD.11, OPAM.01 and OPAM.07 primers were visualised by staining
with crystal violet (58).
[0162] A minimal portion of gel containing the desired fragment was
excised and melted at 70.degree. C. in a 1.5 ml microcentrifuge
tube. The molten gel slice was diluted with three volumes of TE and
extracted with an equal volume of phenol (saturated with TE) at
70.degree. C. for 2 min. The tube was transferred to ice for 2 min
then centrifuged at 14,000 rpm in an Eppendorf 5414C
microcentrifuge for 4 min at room temp and the aqueous phase
removed into a clean tube. The phenol phase was back-extracted with
50 .mu.l of TE and this was combined with the original extracted
aqueous phase.
[0163] DNA was precipitated by the addition of 0.1 vol of 3M sodium
acetate. pH 5. and 2.5 vol ethanol. The tube was stored overnight
at -20.degree. C. then centrifuged at 13000 rpm in an Eppendorf
5414C microcentrifuge for 30 min at 4.degree. C. The supernatant
was decanted carefully, the DNA pellet was rinsed with cold 75%
(v/v) ethanol and centrifuged briefly. The pellet was dried in a
vacuum desiccator for 10 min and the DNA was finally dissolved in
20 .mu.l of TE and stored at 4.degree. C.
[0164] Ligation of PCR-amplified Male-associated Fragments into
Plasmid Vector:
[0165] Fragments resulting from PCR with RAPD primers OPAC.06.
OPAD.11. OPAM.01 and OPAM.07 were ligated into plasmid pGEM-T (a
linearised derivative of pGEM-3) using the pGEM-T vector cloning
system (Promega) according to the supplier's instructions.
[0166] Fragments resulting from PCR with RAPD primer OPAI.05 were
cloned by blunt-end ligation into the plasmid vector pGem-3Z
(Promega). The vector was linearised by digestion with restriction
endonuclease SmaI (New England BioLabs) in NEBuffer 4 (New England
BioLabs) then treated with calf alkaline phosphatase (New England
BioLabs). The digested plasmid DNA was purified by electrophoresis
in 1% (w/v) LvP agarose (Sigma) in 0.5 x TBE buffer. The gel was
stained with crystal violet (58), a minimal portion of gel
containing the linear plasmid was excised and DNA was recovered as
described above.
[0167] The gel-purified OPAI.05 male-associated RAPD material was
treated with T4 DNA polymerase (New England BioLabs) according to
the supplier's instructions then heated at 65.degree. C. for 15
min. The cooled sample was then treated with T4 polynucleotide
kinase (New England BioLabs) according to the supplier's
instructions, then again heated at 65.degree. C. for 15 min. The
gel-purified linear vector (approx. 10 ng) and PCR fragments
(approx. 5 ng) were ligated with 3 Weiss units of T4 DNA ligase
(Promega) in 50 .mu.l of Promega DNA ligase buffer (30 mM Tris-HCl,
pH 7.8, 10 mM MgCl.sub.2, 10 mM DTT, 0.5 mM ATP) at 4.degree. C.
for 14-16 h.
[0168] Transformation with Recombinant Plasmids:
[0169] Single colonies of Escherichia coli strain DH5a (fragments
from RAPD PCR with primers OPAC.06, OPAD.11, OPAM.01 and OPAM.07)
or strain XL1-Blue (fragments from RAPD PCR with primer OPAI.05)
were inoculated into 200 ml of LB broth and grown in a shaking
incubator at 37.degree. C. to an optical absorbance of approx. 0.3
at 550 nm (3-4 h). The cells were collected by centrifugation at
3000 rpm for 5 min at 4.degree. C. in an Eppendorf 5414C
microcentrifuge, resuspended in 30 ml of cold 0.1M NMgCl.sub.2 and
placed on ice for 20 min. The cells were collected by
centrifugation as before and the pellet suspended in 1 ml of cold
0.1 mM CaCl2. Glycerol was added to 15% (v/v) and the competent
cells were stored at -70.degree. C.
[0170] For transformation, 50 .mu.l of competent cells was thawed
and mixed with 5 .mu.l of ligation reaction, placed on ice for 20
min. heat-shocked at 42.degree. C. for 45 sec then returned to ice
for 5 min. The transformed cells were allowed to recover by
incubation at 37.degree. C. for 1 h in 500 .mu.l of SOC medium (2%
(w/v) bacto-tryptone, 0.5% (w/v) bacto-yeast extract, 10 mm, NaCl,
2.5 mM KCl, 10mM MgCl.sub.2. 10mM MgSO.sub.4, 20 mM glucose) and
were then plated onto LB agar containing ampicillin (100 .mu.g/ml),
X-gal (25 .mu.g/ml) and IPTG (10 .mu.M) for overnight culture at
37.degree. C. Transformation efficiency was 2.times.10.sup.7
cfu/.mu.g plasmid (with ccc pGEM-T).
[0171] Colony Screening by PCR:
[0172] White colonies were selected and incubated overnight in 500
.mu.l of LB broth. Inserts in recombinant plasmids of the cloned
cells were analysed by PCR amplification from primer sites flanking
the cloning site. One .mu. of the cell suspension was mixed with
2.7ACM each of the SP6 (5'-ATTTAGGTGACACTATAGAATAC-3') and T7
(5'-ATTATGCTGAGTGATATCCCGCT-3'- ) primers (both from Bresatec
Custom Oligos), 200 .mu.mM of each of the four dNTPs, 1.5 mM
MgCl.sub.2, 100 mM tris-HCl, pH 8.3, 500 mM KCl and 1 unit of Taq
DNA polymerase (Boehringer Mannheim) in a final volume of 25
.mu.l.
[0173] Reactions were cycled in a Corbett Research PC-960
Air-Cooled Thermocycler with an initial step at 94.degree. C. for 2
min followed by 35 cycles of 94.degree. C. for 20 sec, 50.degree.
C. for 20 sec and 72.degree. C. for 30 sec; on completion of
cycling the samples were heated at 72.degree. C. for 2 min.
[0174] Colony Screening by Dot Blot Hybridization:
[0175] Colonies that were found by PCR to contain a recombinant
insert of appropriate size (i.e. appropriate to the size of the
male-associated fragment generated from genomic DNA by RAPD PCR)
were labelled by incorporating 8 .mu.M digoxigenin-11-dUTP
(DIG-dUTP: Boehringer Mannheim) in colony PCR reactions, as
described above.
[0176] A replicate dilution series of male and female horse genomic
DNA samples (1 .mu.g, 250 ng, 100 ng and 10 ng of each) were
denatured in 0.2 ml of 0.4 mM NaOH, 10 mM EDTA and heated at
100.degree. C. for 10 min. The samples were applied to
positively-charged nylon membrane (Boehringer Mannheim; 59) with a
Vacuum Blot Manifold (Gibco-BRL). Each well was washed with 500
.mu.l of 0.4M NaOH and the membrane was neutralised by 3.times.10
min washes in 2.times. SSC.
[0177] DNA hybridizations were performed according to the DIG
System User's Guide for Filter Hybridization (Boehringer Mannheim).
Membranes were prehybridized at 50.degree. C. for at least 2 h in
10 ml of DIG Easy Hvb hybridization buffer (Boehringer Mannheim,
cat. no. 1603558) in glass hybridization bottles (Hybaid) placed in
a Eurotherm 91E Rotating Hybridization Incubator (Model 310;
Robbins Scientific).
[0178] DIG-labelled probes were prepared as described above from
the inserts of recombinant plasmids, using the SP6 and T7 primers.
Each was added to 4 ml of DIG Easy Hyb solution (Boehringer
Mannheim) at a concentration of 50-100 ng/ml and denatured at
68.degree. C. for 10 min. The prehybridization solution was
replaced by the probe solution and hybridization was conducted in
the rotating incubator at 50.degree. C. for 14-16 h.
[0179] The membrane was then removed and washed for 3.times.10 min
at low stringency (2.times. SSC, 0.1% (w/v) SDS, 25.degree. C.)
followed by 2.times.10 min at high stringency (0.2.times. SSC, 0.1%
(w/v) SDS, 68.degree. C.). The washed membrane was rotary-incubated
for 1 h in 2.times. blocking solution (Boehringer Mannheim, cat.
no. 1585762) containing 1.times. maleic acid buffer (Boehringer
Mannheim, cat. no. 1585762).
[0180] Anti-DIG antibody labelled with alkaline phosphatase
(Boehringer Mannheim, cat. no. 1093274) was added to the blocking
solution at a concentration of 0.075 units/ml and rotary incubation
continued for a further 30 min.
[0181] The membrane was then washed for 2.times.15 min in 1.times.
wash buffer (Boehringer Mannheim, cat. no. 1585762) and transferred
to 1.times. detection buffer (Boehringer Mannheim. cat. no.
1585762) for 5 min.
[0182] The chemiluminescent substrate CDP-Star (Boehringer
Mannheim, cat. no. 1685627) was diluted 1:100 in detection buffer
and 1 ml was added per 150 cm.sup.2 of membrane. The substrate
solution was spread evenly between clear transparency sheets and
the signal was detected at room temperature using X-ray film (AGFA
Eurix RP1) with intensifying screens (Dupont Quanta III-T).
[0183] Differential intensity of hybridization to male and female
DNA samples indicated probes derived from clones containing a
male-associated fragment from RAPD PCR with each of primers
OPAC.06, OPAD.11, OPAI.05 and OPAiM.07 (data not shown). Attempts
to recover a cloned male-associated fragment from RAPD PCR with
primer OPAM.01 were unsuccessful.
EXAMPLE 2
[0184] Sequence Analysis of Cloned Male-associated Fragments:
[0185] DNA sequencing was performed using dideoxy sequencing
chemistry utilising the ABI PRISM.TM. Dye Terminator
Cycle-Sequencing-Ready Reaction Kit (ABI Perkin-Elmer) with
AmpliTaq DNA polymerase, according to the manufacturer's
instructions (ABI Perkin-Elmer). Products of sequencing reactions
were analysed according to the manufacturer's instructions on an
ABI A373 sequencer at the University of Queensland DNA Sequence and
Analysis Facility.
[0186] The sequence of cloned inserts of recombinant plasmids,
derived from recovered products of RAPD PCR with each of primers
OPAC.06, OPAD.11, OPAI.05 and OPAM.07, that hybridized
differentially with male DNA on dot blots are shown in SEQ ID NOS:
1, 2, 3 and 4, respectively. These inserts are known henceforth as
EY.AC6, EY.AD11, EY.AI5 and EY.AN17, respectively.
[0187] Hybridization Analysis of Cloned Male-associated
Fragments:
[0188] Samples of genomic DNA (2.5 .mu.g) from nine male and nine
female horses were digested with 5 units of Sau3AI (New England
BioLabs) in NEBuffer (New England BioLabs: 100 mM NaCl, 10 mM
bis-tris-propane-HCl, pH 7.0 at 25.degree. C., 10 mM N/gCl.sub.2, 1
mM dithiothreitol) and 0.1 mg/ml BSA in a final volume of 25
.mu.l.
[0189] The digested samples, together with a DIG-labelled DNA
molecular weight marker mix (Boehringer Mannheim, cat. no.
1218603), were electrophoresed in 1% (w/v) agarose at 70V for 3 h
in 0.5.times.TBE. Resolved fragments were capillary-transferred
overnight in 0.4M NaOH to a positively-charged nylon membrane
(Boehringer Mannheim: 30). Following transfer, the membrane was
neutralised with 3.times.10 mM washes in 2.times. SSC. All
hybridizations were performed according to the DIG System User's
Guide for Filter Hybridization (Boehringer Mannheim).
[0190] Membranes were prehybridized at 50.degree. C. for at least 2
h in 10 ml of DIG Easy Hyb hybridization buffer (Boehringer
Mannheim, cat. no. 1603558) in glass hybridization bottles (Hybaid)
placed in a Eurotherm 91E Rotating Hybridization Incubator (Model
310: Robbins Scientific).
[0191] DIG-labelled DNA probes were prepared as described above
from the four recombinant plasmids containing inserts EY.AC6,
EY.AD11. EY.AI5 and EY.AM7. Each was added to 4 nil of DIG Easy Hyb
solution (Boehringer Mannheim) at a concentration of 50-100 ng/ml
and denatured at 68.degree. C. for 10 min. The prehybridization
solution was replaced by the probe solution and hybridization was
conducted in the rotating incubator at 50.degree. C. for 14-16
h.
[0192] The membrane was then removed and washed for 3.times.10 min
at low stringency (2.times. SSC, 0.1% (w/v) SDS, 25.degree. C.)
followed by 2.times.10 min at high stringency (0.2.times. SSC, 0.1%
(w/v) SDS, 68.degree. C.). The washed membrane was rotary-incubated
for 1 h in 2.times. blocking solution (Boehringer Mannheim, cat.
no. 1585762) containing 1.times. maleic acid buffer (Boehringer
Mannheim, cat. no. 1585762).
[0193] Anti-DIG antibody labelled with alkaline phosphatase
(Boehringer Mannheim, cat. no. 1093274) was added to the blocking
solution at a concentration of 0.075 units/ml and rotary incubation
continued for a further 30 min.
[0194] The membrane was then washed for 2.times.15 min in 1.times.
wash buffer (Boehringer Mannheim, cat. no. 1585762) and transferred
to 1.times. detection buffer (Boehringer Mannheim, cat. no.
1585762) for 5 min.
[0195] The chemiluminescent substrate CDP-Star (Boehringer
Mannheim, cat. no. 1685627) was diluted 1:100 in detection buffer
and 1 ml was added per 150 cm.sup.2 of membrane. The substrate
solution was spread evenly between clear transparency sheets and
the signal was detected at room temperature using X-ray film (AGFA
Eurix RP1) with intensifying screens (Dupont Quanta III-T).
[0196] The male-differential hybridization pattern using EY.AI5
indicated that this sequence is present in multiple copies in the
DNA of all male horses surveyed. A homologous sequence is present
in the female genome but is much less abundant, where the relative
intensity and pattern of hybridization are suggestive of just one
or a few copies.
[0197] In order to confirm that the cloned fragment EY.AI5
represents a canonical genomic repeated element, a DIG-labelled
probe was prepared by direct PCR of male genomic DNA using primers
EQYL2: 5'-AGCGGAGAAAGGAATCTCTGG-3'(SEQ ID NO: 12) and EQYR4:
5'-TTCGTCCTCTATGTTGAAATCAG-3'(SEQ ID NO: 14) derived from the
sequence of EY.AI5 (nts 6-26 and the reverse complement of nts
173-195. respectively, in SEQ ID NO: 3; both primers provided by
Bresatec Custom Oligos).
[0198] The hybridization patterns with both probes are similar,
although the direct genomic probe appeared to hybridize relatively
more strongly with fragments smaller than 900 bp in both male and
female DNA. suggesting that genomic representatives of the repeat
include sequences that are not part of the cloned EY.AI5
fragment.
[0199] The four cloned sequences EY.AC6, EY.AD11, EY.AI5 and EY.AM7
were subsequently DIGlabelled and hybridized with Southern blots of
male and female genomic DNA that had been digested with nine
different restriction enzymes. All showed male-specific
hybridization patterns but also hybridized with female DNA, albeit
to a significantly lesser extent.
[0200] These data demonstrate that each of the four sequences is
repeated many times in the male genome and hence, by comparison
with hybridization to female DNA, on the Y chromosome.
[0201] The striking similarity of hybridization patterns with all
four probes to fragments cut by restriction enzymes having a
six-base recognition sequence (KpnI, EcoRI, HindIII, BamHI) implies
that all four cloned fragments are components of a single
long-range tandem repeat in the equine Y chromosome. Sequence
analysis of the four cloned fragments revealed overlap between
EY.AC6 and EY.AM7 (SEQ ID NOS: 1 and 4), consistent with this
interpretation.
[0202] Of the four cloned sequences, EY.AI5 showed the greatest
quantitative difference between male and female DNA. Restriction
patterns suggest that it has a basic repeat unit in the genome of
approximately 230 bp (TaqI and RsaI digests). consistent with the
length of the sequenced isolate (SEQ ID NO: 3).
[0203] Using the conditions described above, the cloned sequence
EY.AI5 was DIG-labelled and hybridized with Southern blots of male
and female genomic DNA that had been isolated from a variety of
horse breeds and digested with Sau3AI (FIG. 1). Hybridization
patterns were similar for all breeds examined, including the
subspecies known as Przewalski's horse. This confirms the
sex-differential occurrence of EY.AI5 sequences throughout the
species Equus caballus.
EXAMPLE 3
[0204] Conceptual Basis for Discriminatory PCR-Based Sexing
Assay:
[0205] Each of the four male-associated DNA sequences is clearly
present in the equine Y chromosome since each shows a male-specific
hybridization pattern, but none is unique to the male genome.
Considering the four candidates as targets for a diagnostic test
for the equine Y chromosome. the EY.AI5 fragment appears to offer
most promise in that it shows the greatest differential between
abundance on the Y chromosome and elsewhere. Accordingly, further
studies focused on this sequence in an attempt to develop PCR
conditions that would provide absolute discrimination between male
and female equine DNA by utilising potential differences between
the sequence on the Y chromosome and its homologue(s) elsewhere in
the genome.
[0206] The fact that the EY.AI5 sequence is repeated on the Y
chromosome implies that it is not represented by a single,
definable sequence; repeated DNA elements invariably show sequence
heterogeneity (e.g. 60). Cloning of PCR-amplified sequences yields
single, specific representatives that, in addition to intrinsic
sequence variations, may additionally contain errors due to
incidental in vitro and in vivo mutagenesis.
[0207] Furthermore, EY.AI5-primed sequence(s) present in female
genomes must be analysed to allow identification of possible
sequence differences between it/them and Y-chromosomal
representatives.
[0208] Analysis of EY.AI5 Sequences in Male and Female Genomic
DNA:
[0209] For the above reasons, samples of genomic DNA from
individual male and female horses were amplified by PCR from a pair
of primers specific to the sequence EY.AI5. Primers EQYL1:
5'-GTCGTAGCGGAGAAAGGAATC-3' (SEQ ID NO: 15) and EQYR1:
5'-AGCGGACTGTTCCGTTCGG-3' (SEQ ID NO: 16) derived from the sequence
of EY.AI5 (nts 1-21 and the reverse complement of nts 206-225,
respectively, in SEQ ID NO: 3) were used to amplify genomic DNA
targets from a male and female horse (both primers provided by
Bresatec Custom Oligos). The products were sequenced directly from
these primers, without cloning, to allow sequence analysis of the
bulk population of repeated elements.
[0210] The sequence data (FIG. 2) show minor variations between the
individual (cloned) representative EY.AI5 and the bulk sequence
population in the male.
[0211] Two regions in fragments derived directly from the male
genome differ from the equivalent regions in female-derived
fragments (nts 1-30 and nts 162-220). These regions of sequence
divergence were chosen as the annealing targets for PCR primers
designed to discriminate between EY.AI5 sequences in male and
female genomic DNA.
EXAMPLE 4
[0212] Development of PCR-Based Equine Sexing Assay:
[0213] A primer pair was derived from the sequence data of FIG. 2
for specific detection of equine Y-chromosomal DNA. These primers
are EQYL2: 5'-AGCGGAGAAAGGAATCTCTGG3'(SEQ ID NO: 12) and EQYR5:
5'-TACCTAGCGCTTCGTCCTCTAT-3'(SEQ ID NO: 13), derived from nts 6-26
and the reverse complement of nts 184-205, respectively, of the
male genomic DNA sequence shown in FIG. 2 (underlined). These two
regions exhibit significant sequence differences between male and
female genomes.
[0214] Amplification of equine genomic DNA samples (15 pg to 2 ng)
from these primers (both primers provided by Bresatec Custom
Oligos) yielded a product of approximately 200 bp from male DNA
samples and no detectable product from female DNA samples (data not
shown). Analysis of genomic DNA samples from ten unrelated horses
(data not shown) confirmed that PCR amplification from these
primers provides an accurate means of detecting the presence of
Y-chromosomal DNA sequences.
[0215] In a diagnostic assay for genetic sex, no detectable product
of PCR amplification from male-specific primers may result not only
from a female sample but from PCR failure or loss of sample. The
possibility of false negative results must be minimised. For this
reason, a duplex PCR assay was developed in which a 121 bp
(approximately) fragment of a dispersed autosomal repeated sequence
(SINE; 61) was amplified simultaneously with the Y-specific
target.
[0216] Primers used to amplify the SINE element were EQSIN8:
5'-GCCCAGTGTTTCGTTGGTTCG-3'(SEQ ID NO: 17) and EQSIN9:
5'-CATAGTTGTATATTCTTCGTTGTGG-3'(SEQ ID NO: 18), derived from nts
53-72 and the reverse complement of nts 148-172, respectively, of
the ERE-1 SINE sequence family (61).
[0217] Duplex PCR amplifications were mutually optimised by
inclusion of a common m13 sequence at the 5'-termini of all four
primers (62.63). The two primer pairs used for duplex equine sexing
by PCR were:
1 sexing primers: mEQYL2 (SEQ ID NO: 19)
5'-GCGGTCCCAAAAGGGTCAGTAGCGGAGAAAGGAATCTCTGG-3' mEQYR5 (SEQ ID NO:
20) 5'-GCGGTCCCAAAAGGGTCAGTTACCTAGCGCTTCGTCCTCTAT-3' control
primers: mEQSIN8 (SEQ ID NO: 21)
5'-GCGGTCCCAAAAGGGTCAGTGCCCAGTGTTTCGTTGGTTCG-3' mEQSIN9 (SEQ ID NO:
22) 5'-GCGGTCCCAAAAGGGTCAGTCATAGTTGTATATTCTTCGTTGTGG-3- '
[0218] Duplex PCR reactions for internally-controlled assay of
equine genetic sex were conducted in plastic capillary tubes (for
use with the Corbett Research FTS-1 thermal cycler) containing 50
mM KCl, 10 mM Tris-HCl, pH 8.3, 0.001%(w/v) gelatin, 2 mM
MgCl.sub.2, 100 .mu.m dATP, 100 mM dCTP, 100 .mu.M dGTP, 100 .mu.M
dTTP, 0.2 .mu.M mEQSIN8, 0.2 .mu.M mEQSIN9, 0.45 .mu.M mEQYL2, 0.45
.mu.M mEQYR5 (all four primers provided by Bresatec Custom Oligos)
and 0.5 units of AmpliTaq (Perkin-Elmer) in a total volume of 10
.mu.l.
[0219] Samples were placed in a Corbett Research FTS-1 capillary
thermal cycler and subjected to a heating program of 94.degree. C.
for 30 sec, 69.degree. C. for 30 sec and 72.degree. C. for 30 sec
for a total of six cycles, followed by an additional 20 cycles of
94.degree. C. for 30 sec and 72.degree. C. for 30 sec, then finally
held at 25.degree. C. pending analysis by agarose gel
electrophoresis.
[0220] The products were electrophoresed in 2% (w/v) agarose gel in
TAE buffer (Boehringer Mannheim) at 100V for approximately 30 ml,
then stained with ethidium bromide and visualised under uv
irradiation. Duplex PCR amplification of equine genomic DNA samples
resulted in a single visible fragment of approximately 160 bp from
female horse DNA. resulting from amplification of SINE elements.
Male DNA gave rise to a similar band and an additional band at
approximately 240 bp, resulting from amplification of Y-chromosomal
EY.AI5 elements. No product was seen in the absence of DNA.
[0221] The duplex PCR sexing assay described above is clearly able
to identify and discriminate between male and female DNA samples,
from 5 ng to as little as 20 pg (approximately equivalent to the
amount of DNA in three cells).
EXAMPLE 5
[0222] Application of Duplex PCR Sexing Assay to Horses of Various
Breeds:
[0223] Samples of DNA isolated from male and female horses of
various breeds were analysed by duplex PCR as described above.
[0224] Duplex PCR with the sexing and control primers was able to
identify and discriminate between DNA samples from male and female
horses of all breeds, with similar results for all breeds including
the subspecies known as Przewalski's horse.
EXAMPLE 6
[0225] Application of Duplex PCR Sexing Assay to Whole Blood
Cells:
[0226] The preceding examples illustrate successful application of
the described duplex PCR sexing assay to small DNA samples. For
ease of utility it is desirable to conduct the assay on small
numbers of cells without the necessity to isolate DNA from them.
White blood cells were used to establish appropriate assay
conditions.
[0227] Blood samples were withdrawn into Vacutainer.RTM.CPT.TM.
tubes with sodium citrate (Becton Dickinson). Tubes were kept
upright at room temperature and processed within 2 hours of
collection.
[0228] Each tube was centrifuged in a swinging bucket rotor (Sigma
3K18 with 11133 rotor) at 1900g for 30 min at 24.degree. C.
Approximately 60-70% of the clear plasma layer was removed then the
remaining liquid above the gel matrix, substantially free of red
blood cells, was transferred into a clean tube. The sample was
diluted to 10 ml with PBS and centrifuged at 300.times. g for 15
min at 24.degree. C. Supernatant was removed and the pellet
resuspended gently in 10 ml of PBS and centrifuged under the same
conditions. The pellet was again suspended in 10 ml of PBS then
centrifuged at 100.times. g.
[0229] The cell pellet was resuspended in 250 .mu.l of PBS and the
suspension counted by haemocytometer to determine the concentration
of nucleated cells. The suspension was finally diluted in PBS to a
concentration of 10.sup.6 nucleated cells/ml.
[0230] Samples of cell suspensions from male and female horses were
serially diluted in PBS containing 50 mM DTT and appropriate
dilutions were subjected to two successive freeze/thaw cycles:
tubes containing the samples were initially floated on liquid
nitrogen for 1-2 min until frozen, then transferred to a water bath
at room temperature until the suspension thawed. The tubes were
placed in a boiling water bath for 15 min then cooled on ice.
Duplex PCR reactions were conducted in plastic capillary tubes (for
use with the Corbett Research FTS-1 thermal cycler) containing 50mM
KCl, 10 mM Tris-HCl, pH 8.3, 0.001%(w/v) gelatin, 2mM MgCl.sub.2,
100.mu.M dATP, 100 .mu.M dCTP, 100 .mu.M dGTP, 100 .mu.M dITP, 0.2
.mu.M mEQSIN8, 0.2 .mu.M mEQSIN9, 0.45 .mu.M mEQYL2, 0.45 .mu.M
mEQYR5, 0.5 units of AmpliTaq and 2 .mu.l of treated cell
suspension in a total volume of 10 .mu.l.
[0231] Samples were placed in a Corbett Research FTS-1 capillary
thermal cycler and subjected to a heating program of 94.degree. C.
for 30 sec. 69.degree. C. for 30 sec and 72.degree. C. for 30 sec
for a total of six cycles, followed by an additional 21 cycles of
94.degree. C. for 30 sec and 72.degree. C. for 30 sec, then finally
held at 25.degree. C. pending analysis by agarose gel
electrophoresis.
[0232] The products were electrophoresed in 2% (w/v) agarose gel in
TAE buffer (Boehringer Mannheim) at 100V for approximately 30 min,
then stained with ethidium bromide and visualised under uv
irradiation.
[0233] As before, no bands were observed in the absence of equine
DNA whereas bands are clearly visible with 20 pg of DNA from a
female horse (single band at approximately 160 bp) and a male horse
(two bands, at approximately 160 bp and 240 bp).
[0234] Samples of white blood cells containing approximately 5
cells to 100 cells each yielded one (160 bp) or two (160 and 240
bp) bands, consistent with their origin from female or male horses,
respectively.
EXAMPLE 7
Application of Duplex PCR Sexing Assay to Equine Embryos:
[0235] Eight embryos were recovered from five mares approximately
eight days after fertilisation and each was immediately split into
four or more sections depending on the size of the blastocyst (each
sample contained an estimated maximum of 50 cells). Splitting was
performed by micromanipulation (1,2) in 50 .mu.l of PBS. Each
section of the blastocyst was collected with 2 .mu.l of 4% (w/v)
BSA (Miles Pentex crystalline, cat. no. 81-001-4; 1,2) and
transferred into 7.5 .mu.l of deionised water. The sections were
stored frozen at -20.degree. C.
[0236] The thawed suspension of each embryo section, containing
approximately 15-50 cells, was made 20 mM in DTT and dispensed
randomly into tubes numbered from 8 to 39. The 32 samples were from
this stage processed `blind` by a second individual who had not
been involved with embryo collection, splitting or sample
preparation.
[0237] Each sample was subjected to two successive freeze/thaw
cycles. For each cycle the tubes containing the samples were
floated on liquid nitrogen for 1-2 min until frozen, then
transferred to a water bath at room temperature until the
suspension thawed. The tubes were finally placed in a boiling water
bath for 15 min then cooled on ice.
[0238] Duplex PCR reactions were conducted in plastic capillary
tubes (for use with the Corbett Research FTS-1 thermal cycler)
containing 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 0.001%(w/v) gelatin,
2mM 1MgCl.sub.2. 100 .mu.M dATP. 100.mu.M dCTP, 100 .mu.M dGTP, 100
.mu.M dTTP, 0.2 .mu.M mEQSIN8, 0.2 .mu.M mEQSIN9, 0.6 .mu.M mEQYL2.
0.6 .mu.M mEQYR5, 0.5 units of AmpliTaq and 9.5 .mu.l of embryo
cell suspension in a total volume of 20 .mu.l.
[0239] Samples were placed in a Corbett Research FTS-1 capillary
thermal cycler and subjected to a heating program of 94.degree. C.
for 30 sec, 69.degree. C. for 30 sec and 72.degree. C. for 30 sec
for a total of six cycles, followed by an additional 21 cycles of
94.degree. C. for 30 sec and 72.degree. C. for 30 sec, then finally
held at 25.degree. C. pending analysis by agarose gel
electrophoresis.
[0240] The products were electrophoresed in 2% (w/v) agarose gel in
TAE buffer (Boehringer Mannheim) at 100V for approximately 30 min,
then stained with ethidium bromide and visualised under uv
irradiation.
[0241] No bands are observed in the absence of equine DNA whereas
bands are clearly visible with 20 pg of DNA from female DNA (single
band at approximately 160 bp) and male DNA (two bands, at
approximately 160 bp and 240 bp). Bands are clearly visible with
both 125 and 5 (approximately) white blood cells from a female
horse (single band at approximately 160 bp) and a male horse (two
bands, at approximately 160 bp and 240 bp).
[0242] Products resulting from assay of embryo sections showed
relatively weak signals which were variable in intensity; this was
found subsequently to result from sub-optimal PCR conditions due to
a pH shift caused by the BSA used in the collection of embryo
sections.
[0243] Two individuals, who had not been involved in earlier stages
of the analysis, independently called the sex of each embryo
section from the assay results. The calls of both individuals were
in complete agreement and are shown in Table 1.
[0244] Table 1 shows the analysis of sex of embryo biopsies by
duplex PCR. Embryos were recovered from mares approximately eight
days after fertilisation, cut into four or more sections and the
sections frozen at -20.degree. C. The thawed sections, each
containing approximately 15-50 cells, were dispensed randomly into
tubes numbered from 8 to 39 and the 32 samples were analysed
`blind` by duplex PCR, as described in the text. At the conclusion
of assay, two further individuals independently called the sex of
each assay result. The calls of both individuals were in complete
agreement. F is female diagnosis, M is male diagnosis and NR is no
result. The data have been rearranged for clarity.
[0245] For every embryo, all four sections from the same embryo
were called as the same sex, with the exception of sample 34 which
yielded no result (neither male-specific band nor control band was
visible, confirming the value of including primers for an internal
control). The probability of such a result arising by chance is
<10.sup.-7.
[0246] These data provide statistical validation of the duplex PCR
sexing assay for embryo sections.
2 TABLE 1 Embryo no. Estimated no. cells Sample ID Sex called 1 50
12 F 1 50 39 F 1 50 20 F 1 50 33 F 2 45 10 M 2 45 13 M 2 45 30 M 2
35 24 M 3 30 31 F 3 35 17 F 3 45 37 F 3 35 19 F 4 50 36 M 4 50 8 M
4 50 21 M 4 50 38 M 5 50 27 F 5 30 16 F 5 50 35 F 5 50 29 F 6 50 25
M 6 50 14 M 6 50 23 M 6 50 11 M 7 50 32 M 7 50 28 M 7 50 9 M 7 50
22 M 8 15 26 M 8 25 15 M 8 40 18 M 8 40 34 NR
EXAMPLE 8
[0247] Identification of Long-range Repeat in the Equine Y
Chromosome:
[0248] To investigate the inter-relation, repetition, conservation
and genomic environment of the four described sequence elements
associated with the equine Y chromosome, these elements were used
as probes to identify recombinant bacteriophage in an equine
genomic library.
[0249] Equine Genomic Library:
[0250] A male horse genomic DNA library in the Lambda Fix.RTM.II
vector was obtained from Stratagene (cat. no. 946701). The
estimated titre of the library after a single round of
amplification was 2.0.times.10.sup.9 plaque forming units (pfu)/ml.
Phage and host bacteria were cultured according to methods detailed
in the instruction manual provided with the library
(Stratagene).
[0251] Screening of Equine Genomic Library With EY.AI5 Probe:
[0252] For the first round of screening a total of 25,000 to 30.000
plaques grown in host E. coli XL1-Blue MRA (P2) were present on
each 150 mm plate of growth medium. Duplicate plaque lifts were
made from each plate and DNA was bound to uncharged Nylon Membranes
for Colony and Plaque Hybridization (132 mm diameter) purchased
from Boehringer Mannheim (cat. no. 1699083) according to protocols
outlined in the DIG System User's Guide for Filter Hybridization
(Boehringer Mannheim). After uv cross-linking (Bio-Rad GS Gene
Linker). membranes were prehybridized at 42.degree. C. for at least
2 h in 10 ml of DIG Easy Hyb hybridization buffer (Boehringer
Mannheim, cat. no. 1603558) in glass hybridization bottles (Hybaid)
placed in a Eurotherm 91E Rotating Hybridization Incubator (Model
310: Robbins Scientific). A DIG-labelled EY.AI5 probe and a control
probe for a 121 bp (approximately) fragment of a dispersed
autosomal repeated sequence (SINE: 61) were prepared as described
above from the inserts of recombinant plasmids, using the SP6 and
T7 primers. Each was added to 10 ml of DIG Easy Hyb solution
(Boehringer Mannheim) at a concentration of 25-50ng/ml and
denatured at 68.degree. C. for 10 min. The prehybridization
solution was replaced by the probe solution and hybridization was
conducted in the rotating incubator at 42.degree. C. for 14-16
h.
[0253] The membrane was then removed and washed for 3.times.10 min
at low stringency (2.times. SSC, 0.1% (w/v) SDS, 25.degree. C.)
followed by 2.times.10 min at high stringency (0.2.times. SSC, 0.1%
(w/v) SDS, 68.degree. C.). The washed membrane was rotary-incubated
for 1 h in 2.times. blocking solution (Boehringer Mannheim, cat.
no. 1585762) containing 1.times. maleic acid buffer (Boehringer
Mannheim, cat. no. 1585762).
[0254] Anti-DIG antibody labelled with alkaline phosphatase
(Boehringer Mannheim, cat. no. 1093274) was added to the blocking
solution at a concentration of 0.075 units/ml and rotary incubation
continued for a further 30 min.
[0255] The membrane was then washed for 2.times.15 min in 1.times.
wash buffer (Boehringer Mannheim, cat. no. 1585762) and transferred
to 1.times. detection buffer (Boehringer Mannheim, cat. no.
1585762) for 5 min.
[0256] The chemiluminescent substrate CDP-Star (Boehringer
Mannheim, cat. no. 1685627) was diluted 1:100 in detection buffer
and 1 ml was added per 150 cm.sup.2 of membrane. The substrate
solution was spread evenly between clear transparency sheets and
the signal was detected at room temperature using X-ray film (AGFA
Eurix RP1) with intensifying screens (Dupont Quanta III-T).
[0257] Fifty plaques of the 100 (approximately) plaques that gave
positive signals in duplicate were selected from the 300.000 that
were screened and each was removed in a small agar plug: the plugs
were stored in SMT buffer at 4.degree. C.
[0258] A second round of screening was conducted at reduced plaque
density (approx. 3.500 pfu) for 20 of the positives. Methods for
plaque lifts and hybridizations were identical to those used in
first round screening. Sixteen independent clones positive for
EY.AI5 probe (on duplicate filters) were selected for further
investigation. These were: 31.1, 31.2, 31.3. 31.4, 31.5
(originating from five positive plugs selected from plate number 31
in the first screening round). 32.3. 33.1. 33.2, 33.4, 34.1, 34.2,
34.3. 34.5, 36.1, 36.2 and 36.3 (similarly selected from plates 32,
33. 34 and 36. respectively).
[0259] Isolation of DNA from Recombinant Phase:
[0260] DNA was isolated from five positive clones using host strain
E. coli XL1-Blue MRA growing at 37.degree. C. overnight in 50 ml LB
medium supplemented with 0.3%/o (v/v) glycerol and 10 mM MgSO.sub.4
(64). DNA (200, g) was isolated using anion-exchange resin under
appropriate salt and pH conditions (QIAGEN Lambda Maxi Kit; cat.
no. 12562) in accordance with the methods supplied by the
manufacturers.
[0261] Southern Hybridization of Phage Inserts with EY.AI5 And
EY.AD11 Probes:
[0262] Twenty .mu.g of recombinant phage DNA was incubated
overnight with 40 units of restriction enzyme EcoRI or HindIII. All
restriction digests were carried out with enzymes supplied by
Boehringer Mannheim or New England Biolabs in buffers as supplied
by the manufacturers and in accordance with their instructions.
Aliquots of 10 .mu.g of digested DNA, together with a DIG-labelled
DNA molecular weight marker mix (Boehringer Mannheim, cat. no.
1218603), were electrophoresed in 1% (w/v) agarose at 80V for 5 h
in 0.5.times. TAE. Resolved fragments were capillary-transferred
overnight in 0.4M NaOH to a positively-charged nylon membrane
(Boehringer Mannheim; 30). Following transfer, the membrane was
neutralised with 3.times.10 min washes in 2.times. SSC then DNA was
uv cross-linked to the membrane (Bio-Rad GS Gene Linker).
[0263] All hybridizations were performed according to the DIG
System User's Guide for Filter Hybridization (Boehringer Mannheim).
Membranes were prehybridized at 42.degree. C. for at least 2 h in
10 ml of DIG Easy Hyb hybridization buffer (Boehringer Mannheim,
cat. no. 1603558) in glass hybridization bottles (Hybaid) placed in
a Eurotherm 91E Rotating Hybridization Incubator (Model 310:
Robbins Scientific).
[0264] DIG-labelled DNA probes were prepared as described above
from the two recombinant plasmids containing inserts EY.AD11 and
EY.AI5 (Example 2). Probe was added to 10 ml of DIG Easy Hyb
solution (Boehringer Mannheim) at a concentration of 25-50 ng/ml
and denatured at 68.degree. C. for 10 min. The prehybridization
solution was replaced by the probe solution and hybridization was
conducted in the rotating incubator at 42.degree. C. for 14-16
h.
[0265] The membrane was then removed and washed for 3.times.10 min
at low stringency (2.times. SSC, 0.1% (w/v) SDS, 25.degree. C.)
followed by 2.times.10 min at high stringency (0.2.times. SSC. 0.1%
(w/v) SDS, 68.degree. C.). The washed membrane was rotary-incubated
for 1 h in 2.times. blocking solution (Boehringer Mannheim. cat.
no. 1585762) containing 1.times. maleic acid buffer (Boehringer
Mannheim. cat. no. 1585762).
[0266] Anti-DIG antibody labelled with alkaline phosphatase
(Boehringer -Mannheim, cat. no. 1093274) was added to the blocking
solution at a concentration of 0.075 units/ml and rotary incubation
continued for a further 30 min.
[0267] The membrane was then washed for 2.times.15 min in 1.times.
wash buffer (Boehringer Mannheim, cat. no. 1585762) and transferred
to 1.times. detection buffer (Boehringer Mannheim, cat. no.
1585762) for 5 min.
[0268] The chemiluminescent substrate CDP-Star (Boehringer
Mannheim, cat. no. 1685627) was diluted 1:100 in detection buffer
and 1 ml was added per 150 cm.sup.2 of membrane. The substrate
solution was spread evenly between clear transparency sheets and
the signal was detected at room temperature using X-ray film (AGFA
Eurix RP1) with intensifying screens (Dupont Quanta III-T).
[0269] Following detection of the positive signals for EY.AI5 probe
(FIG. 3a), the probe was stripped from the membrane by treatment
with 0.1% (w/v) SDS in 0.2M NaOH at 68.degree. C. for 20 min. The
membrane was then hybridized using the methods detailed above with
the probe for the EY.AD11 sequence (FIG. 3b). Most restriction
fragments positive for EY.AI5 were also positive for EY.AD11. Phage
31.1 failed to exhibit hybridization with either probe.
[0270] Phage restriction fragments were selected for sequence
analysis based on their hybridization to both probes. The fragments
were alike in size to genomic repeated elements identified by using
the same two probes for Southern analysis of equine genomic DNA
digested with EcoRI and HindIII. Fragments selected for sequencing
were: a 3.3 kb HindIII fragment from phage 33.1 (similar in size to
a HindIII fragment in both male and female genomic DNA at an
intensity ratio of approximately 2:1); a 4.4 kb HindIII fragment
from phage 36.1 (similar in size to a HindIII fragment in both male
and female genomic DNA at an intensity ratio of approximately
20:1): a 4.7 kb EcoRI fragment from phage 32.3 (similar in size to
a genomic EcoRI band which hybridizes to both probes at low
intensity in the male and at a barely detectable level in the
female); and a 6.0 kb EcoRI fragment from phage 36.1 (present in
male genomic DNA but not detected in the female).
[0271] Restriction Mapping of Recombinant Phage Inserts:
[0272] Inserts of equine genomic DNA flanked by T3 and T7 promoter
sites were excised from the Lambda Fix.RTM.II vector by digestion
with NotI. This cassette (1 .mu.g) was subjected to partial
digestion with either EcoRI (for page 32.3 and 36.1) or HindIII
(for phage 33.land 36.1). The partial digestion fragments, together
with fragments of I DNA digested with HindIII and EcoRI as size
markers (Boehringer Mannheim; cat. no. 528552), were
electrophoresed through a 1% (w/v) agarose gel at 80V for 5 h in
0.5.times. TAE with ethidium bromide; the gel was then overlaid
with a scale ruler and photographed with uv transillumination (302
nm).
[0273] The resolved fragments were transferred to an uncharged
membrane (Hybond-N, Amersham cat. no. RPN303N) with 20.times. SSC
following depurination in 0.25M HCl, denaturation in 0.5M NaOH,
1.5M NaCl and neutralization in 1M Tris (pH 7.5), 1.5M NaCl (65).
The membranes were probed successively with biotinylated
oligonucleotide probes for the T3 and T7 promoter sequences,
respectively (New England Biolabs cat. nos. 1227-BT and 1223-BT);
membranes were stripped before the second hybridization by
treatment with 0.1% (w/v) SDS in 0.2M NaOH at 68.degree. C. for 20
min. Prehybridization was done in glass hybridization bottles
(Hybaid) placed in a Eurotherm 91E Rotating Hybridization Incubator
(Model 310: Robbins Scientific) in 10 ml phosphate buffered 7%
(w/v) SDS solution with 1% (w/v) BSA and 0.5 mg/mil carrier DNA
(28). Biotinylated oligonucleotide probe was added to a final
concentration of 10 ng/ml. Hybridizaton temperatures were
59.degree. C. for the T7 probe and 49.degree. C. for the T3 probe.
Post-hybridization washes were in 5.times. SSC, 0.1% (w/v) SDS at
25.degree. C. for 15 min, then in 5.times. SSC. 0.1% (w/v) SDS at
60.degree. C. for 15 min. Membranes were blocked with 10 ml of
1.times. Blocker (5.0% (w/v) SDS, 125 mM NaCl. 25 mM sodium
phosphate (pH 7.2)) at 25.degree. C. for 15 min. Alkaline
phosphatase-conjugated streptavidin (Boehringer Mannheim: cat no.
1093266) was added to the blocking mixture to a concentration of 1
unit/ml and the membranes were treated for a further 10 min.
Post-treatment washes were in 1.times. Blocker for 10 min then in
two changes of 0.1.times. Blocker for 15 min followed by detection
with CDP-Star and autoradiography as outlined above.
[0274] Sizes of hybridizing fragments were estimated by comparison
with positions of control size markers run concurrently in the Gel.
The resulting ladder of DNA fragments corresponded to the distance
from the T3 or T7 promoter site, respectively, and successive
restriction sites (analagous to the ladder generated from labelled
primers with dideoxy DNA sequencing). Because the T3 and T7
promoter sites flank the two ends of the insert, complementary maps
were obtained, allowing confirmation of the position of restriction
sites.
[0275] Analysis of complete digestion products on an ethidium
bromide-stained gel provided additional information regarding
distances separating all adjacent cleavage sites. Restriction maps
of phage clones 32.3 (EcoRI), 33.1 (HindIII) and 36.1 (HindIII and
EcoRI) are shown in FIGS. 4a, 5a and 6a, respectively.
[0276] Subcloning of Restriction Fragments from Recombinant
Phage:
[0277] Recombinant phage DNA (7.5 ,g) was digested with 20 units of
EcoRI (for phage 32.2 and 36.1) or HindIII (for phage 33.1 and
36.1) for 6 h at 37.degree. C. Restriction fragments were resolved
by electrophoresis in 1% (w/v) agarose in 0.5.times. TAE buffer
containing ethidium bromide. Bands were visualized with uv
transillumination (302 nm) and the selected fragments were excised.
DNA was recovered using silica-gel membrane technology (QIAquick
Gel Extraction Kit. QIAGEN cat. no. 28704) in accordance with the
manufacturer's instructions.
[0278] The cloning vector was phagemid pBluescript.RTM.II KS.sup.+
(Stratagene) which had been linearized by digestion with either
HindIII or EcoRI then treated with shrimp alkaline phosphatase
(Boehringer Mannheim: cat. no. 1758250). Vector DNA was purified as
above by gel electrophoresis and the QIAquick gel extraction
technique. The linear vector (approx. 20 ng) and phage restriction
fragments (approx. 20 ng) were ligated with 1 Weiss unit of T4 DNA
ligase (Boehringer Mannheim) in 10 .mu.l of T4 DNA ligase buffer,
as supplied with the enzyme, at 15.degree. C. for 16 h. Ligation
reactions were used to transform 100 .mu.l of competent E. coli
DH5a cells.
[0279] Single colonies of E. coli strain DH5a were inoculated into
250 ml of LB broth and grown in a shaking incubator at 37.degree.
C. to an optical absorbance of approx. 0.5 at 550 ml. The cells
were collected by centrifugation at 3.000 rpm for 5 min at
4.degree. C. in an Eppendorf 5414C microcentrifuge. resuspended in
30 ml of cold 0.1M MgCl.sub.2 and placed on ice for 20 min. The
cells were collected by centrifugation as before and the pellet
suspended in 1 ml of cold 0.1M CaCl2. Glycerol was added to 15%
(v/v) and the competent cells were stored at -70.degree. C.
[0280] For transformation, a 100 .mu.l aliquot of competent cells
was thawed and mixed with 10 .mu.l of ligation reaction, placed on
ice for 30 min, heat-shocked at 42.degree. C. for 2 min then
returned to ice for 2 min. The transformed cells were allowed to
recover by incubation at 37.degree. C. for 1 h in 900 Al of SOC
medium (2% (w/v) bacto-tryptone, 0.5% (w/v) bacto-yeast extract, 10
mM NaCl, 2.5mM KCl, 10 mM MgCl.sub.2, 10 mM MgSO.sub.4, 20 mm
glucose) and were then plated onto LB agar containing ampicillin
(100 .mu.g/ml) for overnight culture at 37.degree. C. Eight or
sixteen colonies were selected from ligations of each vector/insert
pair.
[0281] A volume of 3 ml of LB broth containing ampicillin (100
.mu.g/ml) was inoculated with each colony and bacterial suspensions
were harvested after 16 h at 37.degree. C. in a shaking incubator.
Miniprep DNA was prepared from each suspension (Wizard.TM. Plus
Minpreps, Promega cat no. A7500). Purified plasmid DNA was compared
with uncut vector by gel electrophoresis to identify clones with
plasmids containing an insert of appropriate size.
[0282] DNA from these clones was digested with either HindIII or
EcoRI, as appropriate, and clones with excisable inserts of the
correct size were used for sequence analysis. Insert-containing
plasmid clones were as follows: 32.3E1 and 32.3E5
(pBluescript.RTM.II with 4.7 kb EcoRI fragments from recombinant
phage 32.3): 33.1H2. 33.1H3, 33.1H4. 33.1H6. 33.1H7 and 33.1H8
(pBluescript.RTM.II with 3.3 kb HindIII fragments from recombinant
phage 33.1): 36.1H1, 36.1H2. 36.1H4. 36.1H6, 36.1H7. 36.1H8. 36.1H9
and 36.1H10 (pBluescript.RTM.II with 4.4 kb HindIII fragments from
recombinant phage 36.1): and 36.1E2 and 36.1E8 (pBluescripP.RTM.II
with 6.0 kb EcoRI fragments from recombinant phage 36.1).
[0283] Single colonies of E. coli DH5a with plasmids 32.3E5.
33.1H2, 33.1H7. 36.1H7. 36.1H1 and 36.1E2 were used to prepare
bacterial suspensions in 50 ml LB broth with ampicillin (100,
g/ml). Preparations of 100-200 .mu.g of plasmid DNA were purified
from these suspensions according to supplier's instructions using a
QIAGEN Plasmid Kit and QIAGEN-tip 100 resin columns (QIAGEN; cat.
no. 12144).
[0284] Sequence Analysis of Subcloned Phage Fragments Hybridizing
to Probes EY.AI5 And EY.AD11.
[0285] DNA sequencing was performed using dideoxy sequencing
chemistry utilising the ABI PRISM.TM. Big Dye Terminator Cycle
Sequencing Ready Reaction Kit (ABI Perkin-Elmer) with AmpliTaq DNA
polymerase according to the manufacturer's instructions (ABI
Perkin-Elmer). Where apparent secondary DNA structure in insert
36.1H7 impeded the terminator sequencing reaction, the Big Dye
Primer Cycle Sequencing Ready Reaction Kit (T7) (ABI Perkin-Elmer)
was used. Products of sequencing reactions were analysed according
to the manufacturer's instructions on an ABI A377 sequencer at the
Australian Genome Research Facility located at The University of
Queensland.
[0286] A total of 112 sequencing reactions with an average read
length of 700 bases were undertaken. Approximately 20 kb of novel
equine genomic DNA sequences were recorded then analysed, firstly
for homology to sequences described herein as EY.AC7, EY.AN17,
EY.AD11 and EY.AI5, and secondly for homology to sequences
available worldwide in GenBank (National Center for Biotechnology
Information, Maryland, USA [NCBI]) and similar DNA and protein
databases.
[0287] Primers for T3 and T7 promoter sequences flanking inserts in
pBluescript.RTM.II vector (Bresatec Custom Oligos) were used for
the initial sequencing steps. Sequences were extended from their 3'
extremity with 19-24-mer oligonucleotide primers (Bresatec Custom
Oligos) designed for this purpose from known sequence data, then
matching this extended sequence to the primary data. Replicate,
overlapping and complementary strand sequencing assured the
accuracy of the final genomic DNA sequences. Computer software used
to construct contiguous DNA sequences was Sequencher.TM. 3.0 (Gene
Codes Corporation) for Macintosh.RTM..
[0288] Eight 4.4 kb HindIII fragments subcloned from phage 36.1
proved to be identical, differing only in the orientation of the
insert in the vector. This conclusion was based on 100% identity
observed within blocks of at least 400 bases of sequence.
Application of this criterion established that the two 6.0 kb EcoRI
fragments from phage 36.1 were also identical. Two subcloned EcoRI
fragments of 4.7 kb from phage 32.3 were not identical.
[0289] Mapping and restriction analysis of phage clone 33.1 (see
FIG. 5a) indicated the presence of two similar 3.3 kb HindIII
fragments. Partial sequencing of six subcloned 3.3 kb inserts
supported this view. Inserts in plasmids 33.1H7, 33.1H3, 33.1H4 and
33.1H6 were identical; inserts in plasmids 33.1H2 and 33.1H8 were
identical to each other but exhibited 88-90% similarity with the
former group. Accordingly, inserts in plasmids 33.1H7 and 33.1H2
were sequenced independently.
[0290] Sequencing of phage DNA selected for hybridization with
EY.AI5 and EY.AD11 sequences (Example 2) revealed that these and
the sequences EY.AC6 and EY.AM7 (Example 2) were components of a
long range repeat unit in the equine Y chromosome. The structure of
the repeat as it was found in equine genomic DNA inserts in phage
32.3, 33.1 (twice) and 36.1 is shown in FIGS. 4b, 5b and 6b.
[0291] Plasmid 32.3E1 contains an insert, possibly part of a
pseudogene, with limited homology to open reading frames of a
number of unrelated genes, as determined by a database nucleotide
and protein translation search (GenBank BLAST 2.0: blastn and
blastx programs; NCBI).
[0292] The repeat element identified in equine genomic DNA
comprises sequences which include the aforementioned repeats
EY.AI5, EY.AD11, EY.AC6 and EY.AM7. In addition, EY.AI5 sequence
featured as part of a 1500 bp (approximately) unit, hereafter
referred to as EY.LINE. found to be approximately 50% homologous at
the protein level (GenBank BLAST 2.0; blastx search: NCBI) to
regions of open reading frame 2 (ORF2) in a mammalian long
interspersed repeated element (LINE: GenBank accession nos. U93574
(human) and ABO12223 (dog)). These elements, when functional, are
6.0 kb in size and contain a 5' untranslated region (UTR) with an
internal promoter, two open reading frames (ORF1 and 0RF2) and a 3'
UTR that terminates in a polyA tail. ORF1 encodes a nucleic acid
binding protein and ORF2 encodes a protein with endonuclease and
reverse transcriptase activities. The EY-LINE sequence is located
at nucleotides 990-2497 of SEQ ID NO: 8, 421-1920 of SEQ ID NO. 9.
421-1930 of SEQ ID NO. 10. and 1502-2996 of SEQ ID NO. 11.
[0293] LINEs are highly repetitive DNA sequence elements capable of
retrotransposition that pervade mammalian genomes. Most are
functionally inactive due to truncations, rearrangements and
nonsense mutations (67). LINEs are present in all mammals that have
been studied (including marsupials) and are thought to be derived
from a common ancestor. When cloned elements from a particular
species are compared there may be differences between individual
sequences. Southern hybridizations of restricted genomic DNA give
species-specific patterns when hybridized with a LINE probe
(68).
[0294] The aforementioned four DNA sequences associated with the
equine Y chromosome, when used as probes, detect this EY.LINE
repeated element. This element is, in turn, a part of a larger
repeated element of 3.5 kb (minimum length) that is evident from
comparison of FIGS. 4b, 5b and 6b. This explains the similarity
between Southern hybridizations using the different sequences as
probes. That the EY.LINE described here is specific to Equidae is
illustrated by FIG. 1 where no hybridization of EY.AI5 is detected
to restricted genomic DNA of the camel. The male specificity of EY.
LINE in Equus spp. is illustrated clearly by the data of FIG.
1.
[0295] It will be appreciated by persons skilled in the art that
numerous variations and/or modifications may be made to the
invention as shown in the specific embodiments without departing
from the spirit or scope of the invention as broadly described. The
present embodiments are, therefore, to be considered in all
respects as illustrative and not restrictive.
REFERENCES
[0296] 1. Herr, C., Holt, N., Pietrzak, U., Old, K. and Reed, K.
(1990) Increased number of pregnancies per collected embryo by
bisection of blastocyst stage ovine embryos. Theriogenology
33:244.
[0297] 2. Herr, C. M. and Reed, K. C. (1991) Micromanipulation of
bovine embryos for sex determination. Theriogenology 35:45-54.
[0298] 3. Ford, C. E., Jones, K. W., Polani, P. E., de Almeida, J.
C. and Briggs, J. H. (1959) A sex chromosome anomaly in a case of
gonadal dysgenesis (Turner's syndrome). Lancet i:711-713.
[0299] 4. Jacobs, P. A. and Strong, J. A. (1959) A case of human
intersexuality having a possible XXY sex-determining mechanism.
Nature 183:302-303.
[0300] 5. Welshons, W. J. and Russell, L. B. (1959) The Y
chromosome as the bearer of male determining factors in the mouse.
Proc. Natl. Acad. Sci. USA 45:560-566.
[0301] 6. Kent. M. G., Shoffner, R. N., Buoen, L. and Weber, A. F.
(1986) XY sex-reversal syndrome in the domestic horse. Cytogenet.
Cell Genet. 42:8-18.
[0302] 7. Kent. M. G., Shoffner, R. N., Hunter, A., Elliston, K.
O., Schroder, W., Tolley. E. and Wachtel, S. S. (1988) XY sex
reversal syndrome in the mare: clinical and behavioral studies, H-Y
phenotype. Hum. Genet. 79:321-328.
[0303] 8. Milliken, J. E., Paccamonti. D. L., Shoemaker. R. S. and
Green. W. H. (1995) XX male pseudohermaphroditism in a horse. J.
Am. Vet. Med. Assoc. 207:77-79.
[0304] 9. Sinclair, A. H., Berta, P., Palmer, M. S. Hawkins. J. R.,
Griffiths. B. L., Smith. M. J. Foster, J. W., Frischauf, A. -M.,
Lovell-Badge, R. and Goodfellow. P. N. (1990) A gene from the human
sex-determining region encoding a protein with homology to a
conserved DNA-binding motif. Nature 346:240-244.
[0305] 10. Koopman. P., Gubbay, J., Vivian. N., Goodfellow, P. and
Lovell-Badge. R. (1991) Male development of chromosomally female
mice transgenic for Sny. Nature 351:117-121.
[0306] 11. Tiersch, T. R., Mitchell, J. M. and Wachtel. S. S.
(1991) Studies on the phylogenetic conservation of the SRY gene.
Hum. Genet. 87:571-573.
[0307] 12. Jost, A., Vigier, B. Prepin. J. and Perchellet, J. P.
(1973) Studies on sex differentiation in mammals. Rec. Prog. Hornm.
Res. 29:1-41.
[0308] 13. Pomp, D., Good, B. A., Geisert, R. D., Corbin, C. J. and
Conley, A. J. (1995) Sex identification in mammals with polymerase
chain reaction and its use to examine sex effects on diameter of
day-10 or -11 pig embryos. J. Animal Sci. 73:1408-1415.
[0309] 14. Peippo, J., Huhtinen, M. and Kotilainen, T. (1995) Sex
diagnosis of equine preimplantation embryos using the polymerase
chain reaction. Theriogenology 44:619-627.
[0310] 15. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B.,
Horn, G. T., Erlich, H. A. and Arnheim. N. (1985) Enzymatic
amplification of b-globin genomic sequences and restriction site
analysis for diagnosis of sickle cell anemia. Science
230:1350-1354.
[0311] 16. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G.
and Erlich, H. (1986) Specific enzymatic amplification of DNA in
vitro: the polymerase chain reaction. Cold Spr. Harb. Symp. Quant.
Biol. 51:263-273.
[0312] 17. Mardon, G., Mosher, R., Disteche, C.M., Nishioka, Y.
MicLaren, A. and Page, D. C. (1989) Duplication, deletion, and
polymorphism in the sex- determining region of the mouse Y
chromosome. Science 243:78-80.
[0313] 18. Reed. K. C., Matthews, L. E. and Jones, M. A. S. (1986)
Sex determination in ruminants using Y-chromosome specific
polynucleotides. PCT AU87/00254, WO88/01300.
[0314] 19. Reed. K. C. Lord, E. A. Matthaei, K. I., Mann. D. A.,
Beaton, S. Herr. C. M. and Matthews, M. E. (1988) Determination of
genetic sex in ruminants using Y-chromosome-specific
polynucleotides. PCT AU89/00029, WO89/07154.
[0315] 20. Kent. M. G., Elliston, K. O., Shroeder, W., Guise, K. S.
and Wachtel. S.S. (1988) Conserved repetitive DNA sequences (Bkm)
in normal equine males and sex-reversed females detected by in situ
hybridization. Cytogenet. Cell Genet. 48:99-102.
[0316] 21. Singh. L., Purdom. I. F. and Jones, K. W. (1981)
Conserved sex-chromosome-associated nucleotide sequences in
eukaryotes. Cold Spr. Harb. Symp. Quant. Biol. 46:805-814.
[0317] 22. Epplen, J. T., McCarrey. J. R., Sutou, S. and Ohno, S.
(1982) Base sequence of a cloned snake W-chromosome DNA fragment
and identification of a male-specific putative mRNA in the mouse.
Proc. Natl. Acad. Sci. USA 79:3798-3802.
[0318] 23. Niklos, G. L. G., Matthaei, K. I. and Reed, K. C. (1989)
occurrence of the (GATA).sub.n sequences in vertebrate and
invertebrate genomes. Chromosoma 98:194-200.
[0319] 24. Levin, I., Crittenden, L. B. and Dodgson, J. B. (1993)
Genetic map of the chicken Z chromosome using random amplified
polymorphic DNA (RAPD) markers. Genomics 16:224-230.
[0320] 25. Antoniou, E. and Skidmore, C. J. (1995) A bovine
Y-specific marker amplified by RAPD. Animal Genet. 26:444-445.
[0321] 26. Cushwa, W. T., Dodds, K. G., Crawford, A. M. and
Medrano, J. F. (1996) Identification and genetic mapping of random
amplified polymorphic DNA (RAPD) markers to the sheep genome. Mamm.
Genome 7:580-585.
[0322] 27. Amasino, R. M. (1986) Acceleration of nucleic acid
hybridization rate by polyethylene glycol. Anal. Biochem.
152:304-307.
[0323] 28. Church, G. M. and Gilbert, W. (1984) Genomic sequencing.
Proc. Natl. Acad. Sci. USA 81:1991-1995.
[0324] 29. Johnson. D. A., Gautsch, J. W., Sportsman, J. R. and
Elder, J. H. (1984) Improved technique utilizing nonfat dry milk
for analysis of proteins and nucleic acids transferred to
nitrocellulose. Gene Anal. Techn. 1:3-8.
[0325] 30. Reed, K. C. and Mann. D. A. (1985) Rapid transfer of DNA
from agarose gels to nylon membranes. Nucl. Acids Res.
13:7207-7221.
[0326] 31. Casey, J. and Davison. N. (1977) Rates of formation and
thermal stabilities of RNA:DNA and DNA:DNA duplexes at high
concentrations of formamide. Nucl. Acids Res. 4:1539-1552.
[0327] 32. Denhardt. D. T. (1966) A membrane-filter technique for
the detection of complementary DNA. Biochem. Biophys. Res. Commun.
23:641-646.
[0328] 33. Wahl, G. M., Stern, M. and Stark, G. R. (1979) Efficient
transfer of large DNA fragments from agarose gels to
diazobenzyloxymethyl-paper and rapid hybridization by using dextran
sulfate. Proc. Natl. Acad. Sci. USA 76:3683-3687.
[0329] 34. Meinkoth. J. and Wahl, G. (1984) Hybridization of
nucleic acids immobilized on solid supports. Anal. Biochemi.
138:267-284.
[0330] 35. Reed. K. C. (1991) Nucleic acid hybridizations with
positive charge- modified nylon membrane. In "Methods in Gene
Technology", Dale. J. W. and Sanders, P. G., eds. (JAI Press.
London) 1:127-160.
[0331] 36. Dyson, N. J. (1991) Immobilization of nucleic acids and
hybridization analysis. In "Essential Molecular Biology: A
Practical Approach", Brown, T. A., ed. (IRL Press at Oxford
University Press, Oxford UK) 2:111-156.
[0332] 37. Keeler, K. D., Mackenzie, N. M. and Dresser, D. W.
(1983) Flow microfluorometric analysis of living spermatozoa
stained with Hoechst 33342. J. Reprod. Fertil. 68:205-212.
[0333] 38. Johnson, L. A. (1987) Separation of X and Y
chromosome-bearing mammalian sperm by DNA content using flow
cytometric analysis and sorting. Biol. Reprod. 36:80.
[0334] 39. Simpson, J. L. and Elias, S., eds. (1994) "Fetal Cells
in Maternal Blood: Prospects for Noninvasive Prenatal Diagnosis."
(The New York Academy of Sciences, New York).
[0335] 40. Wu, D. Y. and Wallace. R. B. (1989) The ligation
amplification reaction (LAR): amplification of specific DNA
sequences using sequential rounds of template-dependent ligation.
Genomics 4:560-569.
[0336] 41. Barany, F., Zebala, J., Nickerson, D., Kaiser, R. J.,
Jr. and Hood, L. (1996) Thermostable ligase-mediated DNA
amplifications system for the detection of genetic disease. U.S.
Pat. No. 5,494,810.
[0337] 42. Mullis. K. B., Erlich. H. A., Arnheim, N., Horn, G. T.,
Saiki, R. K. and Scharf. S. J. (1987) Process for amplifying,
detecting, and/or cloning nucleic acid sequences. U.S. Pat. No.
4.683,195.
[0338] 43. Mullis, K. B. (1987) Process for amplifying nucleic acid
sequences. U.S. Pat. 4,683,202.
[0339] 44. Erlich, H. A., ed. (1989) "PCR Technology. Principles
and Applications for DNA Amplification." (Stockton Press, New
York).
[0340] 45. Kwoh, D. Y., Davis. G. R., Whitfield, K. M. Chappelle,
H. L., DiMichele, L. J. and Gingeras, T. R. (1989)
Transcription-based amplification system and detection of amplified
human immunodeficiency virus type 1 with a bead-based sandwich
hybridization format. Proc. Natl. Acad. Sci. USA 86:1173-1177.
[0341] 46. Malek. L. T. Davey, C. Henderson, G. and Sooknanan, R.
(1992) Enhanced nucleic acid amplification process. U.S. Pat. No.
5.130.238.
[0342] 47. Birkenmever. L. G., Carrino. J. J., Dille, B. J. Hu, H.
-Y. Kratochvil. J. D., Laffler, T. G. Marshall, R. L. Rinehardt, L.
A. and Solomon, N. A. (1995) Amplification of target nucleic acids
using gap filling ligase chain reaction. U.S. Pat. No.
5,427,930.
[0343] 48. Backman, K. C., Carrino, J. J., Shimer, G. H. and Yocum,
R. R. (1996) Ligase chain reaction with endonuclease IV correction
and contamination control. U.S. Pat. No. 5,516,663.
[0344] 49. Sanger, F., Nicklen, S. and Coulson, A. R. (1977) DNA
sequencing with chain-terminating inhibitors. Proc. Natl. Acad.
Sci. USA 74:5463-5467.
[0345] 50. Smith, L. M., Sanders, J. Z., Kaiser, R. J., Hughes, P.,
Dodd, C., Connell, C. R., Heiner, C., Kent, S. B. and Hood, L. E.
(1986) Fluorescence detection in automated DNA sequence analysis.
Nature 321:674-679.
[0346] 51. Prober, J. M., Trainor, G. L., Dam, R. J., Hobbs, F. W.,
Robertson, C. W., Zagursky, R. J., Cocuzza, A. J., Jensen, M. A.
and Baumeister, K. (1987) A system for rapid DNA sequencing with
fluorescent chain-terminating dideoxynucleotides. Science
238:336-341.
[0347] 52. McBride, L. J., Koepf, S. M., Gibbs, R. A., Salser, W.,
Mayrand, P. E., Hunkapiller, M. W. and Kronick, M. N. (1989)
Automated DNA sequencing methods involving polymerase chain
reaction. Clin. Chem. 35:2196-2201.
[0348] 53. McCombie, W. R., Heiner, C., Kelley, J. M., Fitzgerald,
M. G. and Gocayne, J. D. (1992) Rapid and reliable fluorescent
cycle sequencing of double-stranded templates. DNA Seq.
2:289-296.
[0349] 54. Michelmore, R. W., Paran. I. and Kesseli, R. V. (1991)
Identification of markers linked to disease-resistance genes by
bulked segregant analysis: a rapid method to detect markers in
specific genomic regions by using segregating populations. Proc.
Natl. Acad. Sci. USA 88:9828-9832.
[0350] 55. Bentley, S. and Bassam, B. J. (1996) A robust DNA
amplification fingerprinting system applied to analysis of genetic
variation within Fusarium oxysporum f.sp. cubense. J. Phytopathol.
144:207-213.
[0351] 56. Bassam, B. J. and Bentley, S. (1995) Electrophoresis of
polyester-backed polyacrylamide gels. BioTechniques 19:568-570.
[0352] 57. Bassam, B. J. Caetano Anolles, G. and Gresshoff. P.M.
(1991) Fast and sensitive silver staining of DNA in polyacrylamide
gels. Anal. Biochem. 196:80-83.
[0353] 58. Rand, K. N. (1997) Use of crystal violet in agarose gels
for preparation of DNA fragments. Lorne Conf. "Organisation and
Expression of the Genome" 19:P1.29.
[0354] 59. Reed, K. C. and Matthaei, K. I. (1990) Rapid preparation
of DNA dot blots from tissue samples, using hot alkaline lysis and
filtration onto charge- modified nylon membrane. Nucl. Acids Res.
18:3093.
[0355] 60. Jeffreys, A. J., Neumann, R. and Wilson, V. (1990)
Repeat unit sequence variation in minisatellites: a novel source of
DNA polymorphism for studying variation and mutation by single
molecule analysis. Cell 60:473-485.
[0356] 61. Sakagarni, M., Ohshima, K., Mukoyama, H., Yasue, H. and
Okada, N. (1994) A novel tRNA species as an origin of short
interspersed repetitive elements (SINEs). Equine SINEs may have
originated from tRNASer. J. Molec. Biol. 239:731-735.
[0357] 62. Shuber, A. P., Grondin, V. J. and Klinger, K. W. (1995)
A simplified procedure for developing multiplex PCRs. Genome Res.
5:488-493.
[0358] 63. Lin, Z., Cui, X. and Li, H. (1996) Multiplex genotype
determination at a large number of gene loci. Proc. Natl. Acad.
Sci. USA 93:2582-2587.
[0359] 64. Lee, S. H. and Clark, J. B. (1997) High-yield method for
isolation of 1 DNA. BioTechniques 23:598-600.
[0360] 65. Southern, E. M. (1975) Detection of specific sequences
among DNA fragments separated by gel electrophoresis. J. Niolec.
Biol. 98:503-517.
[0361] 66. Gebauer, F. and Richter, J. D. (1996) Mouse cytoplasmic
polvadenvlation element binding protein: an evolutionarily
conserved protein that interacts with the cytoplasmic
polyadenylation elements of c-mos mRNA. Proc. Natl. Acad. Sci. USA
93:14602-14607.
[0362] 67. Sassaman. D. M., Dombroski, B. A. Moran, J. V.,
Kimberland. M. L., Naas, T. P., DeBerardinis. R. J. Gabriel. A.
Swergold, G. D. and Kazazian. H. H. Jr (1997) Many human Li
elements are capable of retrotransposition. Nature Genet.
16:37-43.
[0363] 68. Scott. A. F., Schmeckpeper, B. J. Abdelrazik. M.,
Theisen Comey. C., O'Hara. B. Pratt Rossiter, J., Cooley, T.,
Heath, P. Smith, K. D. and Margolet, L. (1987) Origin of the human
Li elements: proposed progenitor genes deduced from a consensus DNA
sequence. Genomics 1:113-125.
Sequence CWU 1
1
29 1 432 DNA Equus caballus 1 ccagaacgga gcaggccttt ccaagttcga
ggagaaagtt agaaacctac aagaaatcca 60 gagaaagcaa aactatccta
cctggaaagg gggaggagtc agacaggtct gagatggctc 120 tgaaactctg
tgtacttgga ggttgccagg acaacttagg tatctgaggt tgtttatgac 180
atcacggtga ccatgttccc caagttggcc gcatggttac agtctgagaa ttgccctggc
240 tggtctatta aaggaagaca tacccagaaa tagctttgac aaacagaagt
cgtgcacaga 300 aactagaaga gatcaaacag actctgatta caggcataag
aaaggactcc ttgccaagaa 360 gcgagaagag agggacaagc actgagagga
gaacattctc atctgttcaa gtctatgggg 420 attccgttct gg 432 2 600 DNA
Equus caballus 2 caatcgggtc cagaataacg acatacagct gtgggggctg
aaagagatta gagaacgtga 60 acttccaagg attgaaaatc acctcaaaag
tcttactgat gctacagaag ggtagaccat 120 tccaaataca tgaagaggaa
cactaccaag agaacccgat ccgtgctaag cccaggaacc 180 aacgtaaagc
gctagcgtcc atgatgttcc tactaatcac cttcacgaat aatccaaaca 240
ggcccacatc ttcccaagat caggatacag gttggtccaa aagtaaaagt cagggccggc
300 cctgtggggg agaaggcaag tgcccaggtt ctgatgggtg gcccagccct
cagtctttca 360 cagaacgggt gcagatcaca ttagcactga tgggaaatag
agatctcatg ggacggtgaa 420 gacagagggc atacataagt agcaattgtg
aaggtcggtt atcaatacgc cccagaaaat 480 caaccatgat aatattccaa
tctatgaaag catctgatac acttccacaa aggaagaagg 540 aaggaaatca
tgggacctgc caaggtggac ttggcagagt gctaagagat gacccgattg 600 3 230
DNA Equus caballus 3 gtcgtagcgg agaaaggaat ctctggattc catgcaatcc
cagtcaaagt ggcagccata 60 tttgccggag agatagaaga gagaatccta
aagtgtctag ccagcaacaa gagcccctga 120 ataggccaag gaatcctcag
gaaaacgaac aaagcaggac ggatcacact ttctgatttc 180 aacatagagg
acgaagcgct aggtaccgaa acggaacagt ccgctacgac 230 4 285 DNA Equus
caballus 4 aaccgcggca tcgactagtc tcttcattgt cctaatgaga tccttctgga
ctttggatta 60 tgcttaaggc agaaggacac tgtaggtctg ataaggccca
agtccggcct cgtgtttgca 120 aacaagtttc aagattgaat cagcatggcc
tccccataga cttgaacaga tgacaatgtt 180 ctcctctcag tgcttgtccc
tctcttctcg cttattgcca aggattcctt tcctatgcca 240 agaatcagag
tctgtttgat ctcttgcagt ttctgtgccg cggtt 285 5 230 DNA Equus caballus
5 gtcgtagcgg agaaaggaat ctctggattc catgcaatcc cagtcaaagt ggcagccata
60 tttgccggag agatagaaga gagaatccta aagtgtctag ccagcaacaa
gagcccctga 120 ataggccaag gaatcctcag gaaaacgaac aaagcaggac
ggatcacact ttctgatttc 180 aacatagagg acgaagcgct aggtaccgaa
acggaacagt ccgctacgac 230 6 217 DNA Equus caballus 6 kcggagggag
gaatgtatgt attgcatgca atcccagtca aagtggcagc catatttgcc 60
agagagatag aagagagaat cctaaagttt ctagccagca acaagagccc ctgaataggc
120 caaggaatcc tcaggaaaac gaacaaagca ggacgtatca cactttctga
tttcaaccta 180 aaggaccack cggtaggtac cgagacggat cgtccgc 217 7 220
DNA Equus caballus 7 gtagcggaga aaggaatctc tggattccat gcaatcccag
tcaaagtggc agccatattt 60 gccagagaga tagaagagag aatcctaaag
tttctagcca gcaacaagag cccctgaata 120 ggccaaggaa tcctcaggaa
aacgaacaaa gcaggacgta tcacactttc tgatttcaac 180 atagaggacg
aagcgctagg taccgaaacg gaacagtcgc 220 8 4693 DNA Equus caballus 8
gaattcatca aatttgccaa atttgtctcg gaaaagcatt gtgtccatga actggattgc
60 caggaccacc tcgaatttgg agtttctgat ctcaggatgt caaagcaacc
cagatgacca 120 cgggtactca gtgcttcgtt tgacctaggc taggatagca
aagagcacaa cgagtgacag 180 gtgcaaattc aaaaacagca accaagattc
acgaaagcac tcacacctcg gcctagagaa 240 catacggtga ttcaagaaac
acaaaattac tccctgggtg tgaaggagaa tggactgata 300 agcacatcaa
agggagatag ctgagaagac catgacgagt atactgtgga aaagaaaaaa 360
agggtccagg aaattgcaag gcgaacagat atcacacctg aataatccac gatgaaagat
420 gtcagttttt agacaggctc tgctagaacg attgaaagtc agagaaagcc
acaagccaaa 480 aaacggcagc ggaggtcaaa cctgggctca ctgggaagtg
tgagctatga gacagctcga 540 agcgggctct gaagcccttt gtccatgacg
attgccagga cagcagacac acacttatga 600 ccaatcctct gacgtcacag
tggccccgac aaacaacctg gcatcctcta cacagtgcca 660 gagttgggct
caagcagcat attcaatacc cattgcgctc aagtgcaggt tgccaatgga 720
acatgaaagg ggccggccgg tggtgcagcg gtgaggtccg cagcttctga gtcagtggcc
780 aggggtgggc cgcgtggaat cctctgggtg agcctcctca ccactgcttc
agtcattctg 840 ggccaggagt ccaagggggt gtagaggcag atgggaaggg
acgttagata gggccagact 900 ttaacagcaa atacaagagc attgccagca
gatgtgagca tagcgatgca cttctgccaa 960 aacacaacca attacaagtt
gcaaagaata gaaaaaggga agctaaaaac aaacaaagaa 1020 acgaaaaaca
cagcttgcca gtaccatgaa gaagatctct atgaagaacc ttagcaaaac 1080
aggtgaaagc tatgtcaatc gaaaaccagc aaacctttgg ggagagaaat tcaagaagac
1140 aaaaggaaaa agaaggatat tttcagacct acgtatctaa gaattaacac
actggagacg 1200 tccatagcgg agaaaggaat ttctggattc catgcaatcc
cagtcaaagt ggcagccata 1260 tttgccagag agatagaaga gasaatccta
aagtttctar ccagyracaa gagcccctga 1320 ataggccaag gaatcctcag
gaaaaygaac aaagcaggac gtatcacact ttctgakttc 1380 aacatagagg
acgaagcgct aggtaccgaa acggmacagt cgcgggctcc aaaacaggca 1440
cacagaccca tgcaacagaa tcgagagagc agagactaac tcaaatatac atggacagcc
1500 catttgcgac cagggagcca agaggacaca gtggaccaag gattgtctct
ccaataaact 1560 gtgctgggaa gcctgcatag ccacaggaac acaacgagag
tagaccatga tgttccacct 1620 ggcaaaggca ccacctgaaa aagattaaag
ccctgaatgg cacacttgaa accgtgaaac 1680 ttttaggaga agacctaggc
agagtgctct ttgccatctg tctgagccgc ctatttggaa 1740 gaagcctgtc
tgacagggca agggcagcaa aggagacaag aaacaaacgg gaccacctca 1800
aatgcagacg cttctgccca gtcaaggaaa ccatcgactc actgcaaaga cagcacaaca
1860 cctgggagtg gatgtttgca aagcacacat cggacgaggg gtgaaaagcc
cacagatgca 1920 atcaactcac acgtctccac aagaaaaaaa acaagcaaat
gaaaacctgg gcaaaagatg 1980 gatacagaga tttctcccaa taagatctaa
agagggccaa caggttcatg aaaacttgtt 2040 cacccgcatt aagtcttagt
ccaatgcaaa tccaaaccgc aatgacatag cagctcactg 2100 tggtcagaat
ggctataagg aggcccacag gaaaacaaca agtgtcagag aggaggtgga 2160
gagaagggaa gcctcctgca ctgctggtgg cagtgtaaac gggtgcagcc actaggccaa
2220 gcggtgtgga actgcctcag aaatttaaga acccatgtcc cataggatcc
agctattcct 2280 cggggccgtg tttagacaaa gaactcggaa acacaaccgc
taaagacatg tgcaccgctg 2340 agttcaccac agccttattc ccgctctcca
agacttggaa gccgcctggt gccgagcaag 2400 ggacgaatag agaaggacat
gggctatagc cacacatggc ataccactca gcgggaacaa 2460 aggatgcaat
ccagccattt gtgaccacca gaatggctgg gagggtttca gggtaagtga 2520
aaaaggcccc agggacatag tcaaataccg tagcatcaca cttacaagga gaagataaaa
2580 aaagcactaa ccaacaggtg gcgcaggaca tttgattggg ggtgcccaga
ggcaaagcgg 2640 ggcggtggcg agggtgtaag agatgatgag gcacaagtgt
gtggtgaggt catgtgattc 2700 ggcttaagct ggtgaagagg atgtcaacta
cacggaagtc caaatcgatg aggatgcaaa 2760 tctgaaagac ataggatatt
gtaacgcagg gttaaggcaa taaattcacc tacaatcaaa 2820 aatcccaaac
gtgggtccag aatgacgaca tacagctctg ggagctaaaa gagattagag 2880
aaattgaaca tccaaggatg gaaaatcacc tcaaaaggct tactgatgct acagaagggt
2940 agacccattc caaatccatg aagaagaatg cttaccaaga gaccttgatc
cgtggttaag 3000 cccttggacc aaacccaaaa cattaccgtc catgatgtta
ctacttaata accttcacaa 3060 atcatccaaa caggcccaca tcttcccaag
ttcaggccac aggttggtcc aaaagtacaa 3120 gtcagggccg gccctgtggt
ggagtgggca agtgccctcg ttccgcttgg gtggcccggg 3180 cctcactctt
tcacagcccg ggtgcagatc acattagcac tgttaggaaa tagagatttc 3240
atgggacggt gcggacagag gtcataaaga agtagcaatt gtgagggtcc attatcagca
3300 cgccacagaa aaacaaccat gggaatatta caatctatga aggcatctgg
tacacttccc 3360 caaaggaaga aggaaggaaa acatgggacc tgccaaggtg
gacttggcag agtgctagga 3420 gatgacacga tcattgcgca tcagaggatt
gcctgggcaa cttcaacttg ggagggagtc 3480 caggactttc tctggggaag
gtccagtcac ttggccctct ccccaagaca taagatataa 3540 gagccagggt
aatcttacag ggaagaaacc agtgtctaga gtgaacggag caggcctttc 3600
caagttcgag gagaaagtta gaaaccgaca agaaaatcag aaaaaggtaa actatcctac
3660 ctggaaaggg ggaggagtca gactggtctg agatggcact gaaactctgt
gtgcttggag 3720 gttgtcagga caacttagcc ttctgaggtt ctttatgaca
tcagggcgaa catgtccccc 3780 aagatggccg catggttaca gtctgagtat
tggcctaggc tgggctacta aaggatgaca 3840 tacccagaaa cagctttgac
aaagagaaag cgggtacaga aactggaaga gatcaaacag 3900 actctgattc
caggcataag aaagaaatcc ttggcaagaa gcgagaagag agggacaagc 3960
actgagagga gaacatcgtc atctattcaa gtctagggga ggccatgctg atgcaagcct
4020 gaaacttgat tggaaacacg aggtcggact tgggccttat cagacctaca
gtgtccttct 4080 gccttaagca taatccaaag tcacgaagga tctcttgagg
acattgaata ggagagtcga 4140 tgcctccttt cctaggcccc tagcattctt
tgaagatcag tctcactttc cataactctg 4200 gcgtcacggg ggcccactgg
atacatgcta atgcgtccca agaaatgtct tggaagcctt 4260 aaatgaatgg
agccctgtca tgcttggggt aggtctcttt gttgggaacg gcctctccaa 4320
gtgtgctgaa aatcaccctt ttccagaggg cttggttcct ttgtgaaggc tgccctctca
4380 ggcttgtgtg ctcactttgg ctccaatgaa attctctccc cctacctctt
cccgtatatg 4440 gattactgat tacgtgcttt gacgccatat ggaattaagc
tggctgaaaa ttagaacatt 4500 acaattctgt ttccagaaat atagacatgc
cagggctgag gctgtaggtc aaacaaatgg 4560 cacacactat agacataaag
taagcccgta actagacgga atctagggca acgttcaact 4620 gtcaggggca
agttcgaacc tttccaaatc cacaaaaaag acagaaaaat atcattcctg 4680
gagagtggaa ttc 4693 9 3430 DNA Equus caballus unsure (1110) n at
position 1110 =a, t, c, or g 9 aagcttgccg ggacagcaga cacacaatta
tgaccaatcc tctgacgtca cagtggcccc 60 gacaaacaac ctggcctcct
ctacactgtg ccagagttgg gctcaagcag catattccag 120 ccacactgcg
ctcaactgca ggtttccaat agaacatgaa agaggccgcc ggtggtgcag 180
cggtgaggtc cgcagctttg tgtcggtggc ccgtggtggg ccaggtggaa tcctggggtt
240 gagcctcctc accactgctt cagtcattct ggggcaggcg tccgagggcg
tgtagaggct 300 gatgggaagg gacgttagat agggccagaa ttccacagca
aatacaggag cattgccggc 360 agacgtgagc acatcgatgc acttctgcca
aaacagaacc aataacaagt tgcaaagaac 420 agaaaaacgg aagctaaaca
aataaacaaa aataaacaca gcttcccagt acgaagaaga 480 agatgtctat
gaagaacctt agcaaaacag gtgaaagcta tgttaatcga aaatagcaaa 540
tgtttgggga gagaaattta agaagacaca aggaaaaaga aggatattcc gcgacctagg
600 aatggaagaa ttaacacact ggaaacgtcc atagcagaga aaggaatctc
tggattccag 660 gcaatcccag ttaaagtgga agccttcttt gccagarata
tagaagagag aatcctaaag 720 tttctagcca gcaagaagag cccctgaata
ggccaaggaa tcctcaggaa aacgaacaaa 780 gcaggacgta tcacactttc
tgatttcaac atagagcacg aagcgctagg tactgaaacg 840 gtacagtcca
gtcccaaaaa caggcacaca gacaaatgta acactataga gagcccagag 900
cccaactcaa acatacatgg acagcccatt tgcgaccagg gagccaagag gacacagtgg
960 acaaacgaga gtctctccaa aaaacggtgc tgggaagcct gcacagccac
atggtacaca 1020 acgagagtag accatgatgt tccacctggc acacgcacca
tctgaaattg attcaagccc 1080 tgaatggcgc acttgaaacc cgggaacttn
ttaggagaag acctaggcag agcgctctkk 1140 cccatctgtc tgagccgccc
acttggaaga agcctgtctg actcggcaag ggcagcaaag 1200 gagacaagaa
gcaaacggga ccacctcaaa tgcagacgct tctgcccagt caaggaaacc 1260
atcgactcaa ggcaaagaca gcacaacaac tgggagtgga tgtttgcaaa gcacacatcg
1320 gacgaggggt gaaaagccca aagatacaat caaatcacac gtctccacaa
gaaataaaac 1380 aagccaatga aaacctgcgc aaaagatgga cacagagact
tctcccaaga agatctaaag 1440 agggccaaca ggtgcatgaa aacttgttca
ccctcattaa gtctgaggcc aatgcaaatc 1500 caaaccgcaa tgacatagca
gctaactgag ttcagaatgg ctataaggag accgacagga 1560 cagcaacaat
tgtcagaggg gaggtggaga gaagggaagc ctcctgcact gctggtggca 1620
gtgtaaatgg gtgcagccac taaggcaagc aatgtngnac tggccacaga aatttaagaa
1680 tccatgtcct ttaggatcca gcgattcctc gggggcgtgt ttagccaaag
aaatcggaaa 1740 ctcaacccgc taaagacatg tgcatcgctg agttcaccac
agcttactcc gctctccaag 1800 acttggaagc cgcctggtgc ccaacaagga
agaatggaga agaacatggc tatagccaca 1860 caatggcata ccactcattg
cggaccagat gccatccagc cattgtggcc accagatggt 1920 tgaggtttag
gtgaagtgaa caggcccagg aaatagtgaa ttccatagca cgtcacttac 1980
aaggagaaga aaaancaagc actaacccaa caggtggccc ttggacaatt tgattggggg
2040 tgcccaaagg caaaaaaggg ccgttttgga aggagaaagg gatgatnagg
cacaagtgcg 2100 tggtgagtgc ctgtgattcg gcttacgctg gagaagagga
tgtcgcctac acggaagtct 2160 aaatcgatgg ggatgtaaat ctgaaagaca
tcggatattc taatgcaggg ttatggtaat 2220 aaattcacct acaatgaaaa
atccaaaaag gggtccggaa tgacggcata cagctctggg 2280 ggctgaaaga
gattagagaa ggcgaacttt caaagatgga aaatcacctc aaaaggctta 2340
ctgatgctac agaagggtag agcattccaa atacatgaag gggaatacta ccatgagaac
2400 cttatccatg cttagcccag gaacccacgg aaaacgttac cgtccatgat
gttactacta 2460 atcaccttca cgaataatcc aaacaggccc acatcttccc
aagttcaggc cacgggtcgt 2520 ccaaaagtac aagtcaggga cggcgctgcg
gggagcgggc aaatgcccat gttccgcttg 2580 gtggcccggg cctcactctt
tcacagcacg ggtgcagatc acattagcac tgttaggaaa 2640 tagagatttc
atggacrctc ggacaaaggk yataaatagg tagcaattgt gaagggtcag 2700
ttatcaatac gccccagaaa agccaaccat gagaatattc caatctatga aggcatctgg
2760 gtcactttcc acaaaggaag naggaagaaa acatgggacc tgccaaggtg
gacttggaag 2820 agtgctagga gatgacacgg taattgggca tcagaggact
gcctgggcaa ttcaacttgg 2880 aagggagtcc aggactttct gtggggaagg
tccagccact tggccctttc cccaagacta 2940 aagagataag agccagggtt
atcttacagg gaagaaacca gtgtctagag agaatggagc 3000 aggcctttcc
aagttcgagg agaattttag aaacttacaa gaaataaaga aaaaggaaaa 3060
caatcctacc tggaaagggg gaggagtcag actggtctga gatggctctg gaactctgtg
3120 tgcttggagg ttgtcaggac aacttagcct tctgaggttg tttatgacat
cacggtgaac 3180 atgtccccca agatggccgc atggttatag tctgaggatt
ggcctaggct gggctattaa 3240 agggagacat acccaaaaac agctttgaca
aacagaaagc gggcacagaa actggaagag 3300 atcaaacaga ctctgattcc
aggcataaga aaggaatcct tggcaagaag cgagaagaga 3360 gggacaagca
ctgagaggag aacattgtca tctgttcaag tctatgggga ggccatgctg 3420
attcaagctt 3430 10 3450 DNA Equus caballus unsure (2122)..(2341) n
at positions 2122 through 2341 = a, t, c, or g 10 aagcttgccg
ggacagcaga cacacaatta tgaccaatcc tctgatgtca cagtggcccc 60
gacaaacaac ctggcctcat ctacacagtg cgagagttgg gctcaagcag catattcaag
120 tcccattgcg ttcaactgca ggttgccaat ggaacatgaa acggccggcc
ggtggtgcag 180 cggtgaggtc cgcagattct gggtcggtgg acaggggtgg
gccgggtgga atcctggggg 240 tgaggctcct caccactgct tcagtcattc
cggggcaggc gtccgcgtgg ttgtagaggc 300 agatgggaag ggacgttaca
tagggccaga cgtccacatc aaatacagga gcattgccag 360 cagatgtgag
aacagcgatg cacttctgcc aaaacacaac caattacaag ttgaaaagat 420
tagaaaaacg gatgctaaaa acaaacaaac aaacaaaaaa cacagcttgc cagtacgaag
480 aagaagatct ctatgaagac acttagcaaa acaggtgaaa gctatgtcaa
tagaaaacca 540 gcaaacgttt ggggaaagaa attcaagaag acacaaggaa
aaagaaggat ataccgggac 600 ctaggaatgg aagaattaac acactggaaa
cgaccatagc ggagaaggga atatctggat 660 tccattcaat cccagtcaaa
gtggcagcca tcttcgtcag agagatagaa gagagaatcc 720 taaagtttct
agccagcaat aagagcccct gaataggcca aggaatcctc aggaaagcaa 780
acaaagcaga acgtatcaca ctttctgatt tcaacataga ggacgaagcg ctaggtaccg
840 acacggcaca gtccgggccc aaacacagac acacagaccc atgcaacaga
atcgagagcc 900 cagagcccaa ctcaaacata catggacggc ccatttgcga
ccaaggagcc aagaggagac 960 agcggacaaa ggagagtctc tccaataaac
gctgctggga agtctgaaca gccacatggt 1020 gcacaacgag agtagaccat
gatgttccac ctggcacacg cagaacctga aatggattaa 1080 agccctgaat
ggcacacttg aaaccgtgaa acttgtagga gaagacctag gcagagtgct 1140
ctttgccatc tgtctgagcc acctatttgg aagaagcctg tctgactggg caagggcagc
1200 aaaggagaca agaaacaaac gggaccacct caaatgcaga cgcttctgcc
cagtcaagga 1260 aaccatcgac tcaatgcaaa gacagcacaa caactgggag
tggatgtttg caaagcacac 1320 atcggactaa gggtgaaaag cccaaagata
caatcaactc acacgtctcc acaagaaaaa 1380 aaacaagcca atgaaaacct
gggcaaaaga tggacacaga gatttctccc aagaagatct 1440 aaagagggcc
aacaggtgca tgaaaacttg ttcaccctca ttaagtctga ggccaatgca 1500
aatccaaacc gcaatgacat agcagctcac tgtggtcaga atggctataa ggagtccgac
1560 aggaaaacaa ttgtcagaga ggaggtggag agaagggaag ccgcctgcac
tgctggtggc 1620 actgtaaacc ggtgcagcca ctatgccaag cggtgtggaa
ctgcctcagg aatttaagaa 1680 tccatgtccc ataggatgcc gctattcctc
gggggcgtgt ttagccaaag aactcggaaa 1740 cacaaccgcc taaagacatg
tgcaccgctg agttccccac agccttactc ccgctctcca 1800 agacttggaa
gccaccctgg tccccagcaa gggacgaatg gagaaggaac atgggctata 1860
gccacacaat ggcaaaccac tcagcgggaa caaaggatgc aatccagcca tttgtgagca
1920 ccagaatggc tgggaggctt ttaggggaag tgaaacaggc cccagggaca
tagtcaaata 1980 ccgtaggatc tcactttcaa ggagaagata aaagaagaac
taaccaacag gtggcgctgg 2040 acatttgatt gggggtgccc agaggcaaag
cggggccatg ggggaggagt gacagagata 2100 gatgaggcaa atgggtgtga
cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 2160 nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 2220
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
2280 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn 2340 nyacntcaaa aggcttactg atgcgacaga agggtagcca
ttccaaatac atgtagagga 2400 atactaccaa gagaacctga tccatgctaa
acccaggaac caacggaaaa tgttaccgtc 2460 catgatgttg ctactaatca
ccttcaggaa taatccaaac aggcccacaa cttccccaag 2520 ttcaggccac
aggttggtcc aaagtcaagt ccagtttcgg ccctgtggtg gatcgggcaa 2580
gtgaccacgt tccgcttggg tggcccgggc ctcactcttt cacagcacgg gtgcagatca
2640 cattagcact gtaaggaaat agagatttca tgggacggtg cggacagagg
tcataaagaa 2700 gtagcaattg tgagggtccg ttatcaatac accccagaaa
agcatccatt agaatattcc 2760 aatctatgaa ggcatctggt acacttcccc
aaaggaagaa ggaaggaaaa catgggacct 2820 gccaaggtgg acttggcaga
gtgctaggag atgacaggat cattgggcat ctgaggatta 2880 cctgggcaac
ttcaacttgg gatggagtcc aggactttct ctggggaagg tccagccact 2940
tggccctctc cccaagacat aagagataag agccagggta atcttacagg gaagaaacca
3000 gtgtctagag agaatggagc aggccattcc aagttcgagg agaaagttag
aaaccgacaa 3060 gaaatccaga aaaaggaaaa ctatcctacc tggaaagggg
gatgagtcag actggtctga 3120 gatggctctg aaactctgtg tgcttggagg
ttgtcaggac aacttagccg tctgaggttg 3180 tttgtgacat cacggtgaac
atgtccccca agatggaggc atggttacag tctgagcatt 3240 ggcctagcct
gggctattca agggggacat acccaaaaac agctttgaca aacagaaagc 3300
gggcacagaa actggatgag atcaaacaga ctctgattcc aggcataaga agggaatcct
3360 tggcaagaag cgagaagaga gggtcaagca ctgacaggag aacatttccc
tctgttcaag 3420 actataggga ggccatgctg attcaagctt 3450 11 4344 DNA
Equus caballus 11 aagcttgaat cagcatggcc tccccataga cttgaacaga
tgacagtgtt ctcctctcag 60 tgcttgtccc tctcttctcg cttcttgcca
aggattcctt tcttatgcct ggaatcagag 120 tctgcctgat ctcctccagt
ttctgtgccc gctttctgtt tgtcaaagct gtttctgggt 180 atgtctccct
ttaatagccc agcctaggcc aatcctcaga ctgtaaccat gcggccatct 240
tgggggacat gttcaccgtg atgtcataaa caacctcaga aggctaagtt gtcctgacaa
300 cctccaagca cacagagttt cagagccatc tcagaccagt ctgactcctc
ctcctttcca 360 ggtgattact agtaacatca tggagggtag cctttcagtt
tgttcctgga cttagcactg 420 atcaggttct ctttgtagta ttcctcttca
tgtatctgga atggtgtacc cttctgtcgc 480 atcagtaaga cttttcaggt
gattttctgg tacacttccc caaagcaaga aggaaggaga 540 acttgggacc
tgccaaggtg gtcttggcag agtgctagga gatgagaaca aaggatgcaa 600
tccagccatt
tgtgaccatc agaatgggtg ggagggtttt aggggaagtg aaacaggccc 660
cagggacata gtcaaacacc ataggattca ctttcaagga gaagatataa gaagcactaa
720 ccaacaggtg gcgctggaca tttgattggg ggtgcccaga ggcaaagccg
ggcagtgggg 780 gagggtgaaa gagatgatga ggcacaagtg tgtggtgagg
gcctatgatt cggcttacgc 840 tggggaagag gatgtcacct acacggaagt
ctaaatcgat gaggatgtaa atctgagaga 900 cataggatgt tctaatgcag
ggttatggca ataaattcac ctacaatcaa aaatccaaaa 960 agtggtccag
aatgactcca taaagctctg ggggctgaaa gagattagag acggtgaact 1020
tcaaaggatg gaaaatcacc tcaaaagtct tagtgatgcg acagaagggt agaccattcc
1080 aaatacatga agaggaatac tacaaagaga acctgatccg tgctaagccc
aggaaccaac 1140 ggaaaatgtt accgtccatg atgttactac taatcacctt
catgaataat ccaaacaggc 1200 cctcatcttc ccaagatcag gccacaggtt
ggtccaaaag tacaagtcag ttccggctct 1260 gtggtggagc gggcaagtgc
ccacgttccg cttgggtggg cagggcttca gtctttcaca 1320 gcacgggtca
gatcccatta gccttgttag gaaatagaga tttcttggac ggtcggacag 1380
aggtcataaa gggacgttag ataaggcaga tttccacagc aaatacagga gcattcccag
1440 cagatgtgat cacaacgatg cacttctgcc aaaacacaac cacttacaag
ttgcaaagat 1500 tagaaaaccg gaagctaaaa acaaaaaaac aaaaacaaaa
cacagcttgc cactacgaag 1560 aagaagatct ctatgaagaa ccttagcaaa
acaggtgaaa ggtatgtcaa tctaaaacca 1620 acaaacgttt ggggaaagaa
attcaagaag acacaaggaa taagaaggat attccgggac 1680 ctaggaatgg
aagaattagc acacttgaaa cgtccataga ggagaaagga atctctggat 1740
tccatgcaat cccagtcaaa gtggcagcca tatttgccag agagatagaa gagagaatcc
1800 taaagtttct agccagcaag aaaagcccct gaataggcca aggaatcctc
aagaaaacga 1860 acaaagcagg acggatcaca ctttctgatt tcaacataga
ggacgaagcg ctaggtactg 1920 aaacggcaca gtccgggccc aaaaacaggc
acacagaccc atgcgacaga atcgagagcc 1980 cacagcccaa ctcaaacata
catggacacc ccatttgcga ccagggagcc aagaggagac 2040 agtggacaaa
ggagagtctc tccaataaac gggctgggaa gcctgacagc cacatagaac 2100
acaagaatag accatgatgt tccacctggc agacgcccac tgaatggatt caagccctga
2160 tggccacttg aaccgtgaac ttgtaggaga agacctagca gagtgctctt
tgccatctgt 2220 ctgacccgcc tatttggaag caggctgtct gactgggcaa
gggcagcaaa ggagacaaga 2280 aacaaacggg accacctgaa atgcagacgc
ttctgcccag tcaaggaaac catcgactca 2340 atgcaaagac agcacaacac
ctgggagtgg atgttagcaa agcacacatc ggatgagggg 2400 cgaaaagccc
aaagatacaa tcaactcaca cgtctccaca agaaaaaaaa caagccaatg 2460
aaaatctggg caaaagatgg acacagagat ttctcccaag aagatctaag agggccaaca
2520 ggtgcatgaa aacttgttca ccctcattag tctaaggcca atgcaatcca
accgcaatga 2580 catagcagct cacttgtggt cagaatggct ataaggaggc
agacaggaaa acaacaagtg 2640 tcagagagga ggtggagagt aggaagcctc
ctgcactgct ggtggcagtg taaacgggtg 2700 cagccagtag gccaagcggt
gtgaaactac ctcagcaatt tcagaatccg tgtaccatag 2760 gatccagcta
ttcctcgggg gcgtgtttag ccaaaaaact cggaaacaca aactcctaaa 2820
gacatgtgca ccgctgagtt caccacagcc ttactcccgc tctccaagac ttggaagccg
2880 tcctggtgcc gagcaaggga cgaatgtaga aggaacatgg gctatagcca
cacaatggca 2940 taccagtcag tgggaacaaa ggttgcaatc cagtcatttg
cgaccaccag aatggcttgg 3000 agagttttat gggaagtgaa acaggaccca
gggatatagt caaataccgt agcataacac 3060 ttacaaggag aagataaaaa
aagcactaac caacaggtgg cgctggacat ttgattgggg 3120 gtgcccagag
gcaaagcggg gcggtggggg agggttaaag acttgatgag gcacaagtgt 3180
gtggtgagga catgtgattc ggcttatgct ggtgaagagg atgtcaccta cacggaagac
3240 taaatcgatg agcatgtaaa tgtgaaagac atagggtgtt ctaatgcaag
gttatggcac 3300 taaattcacc tacaatcaaa aatccaaaaa ggggtccaga
atgacggcat acagctctgc 3360 gggctgaaag agattagaga aggtgaactt
ccaaggatgg aaaatcacct caaaaggctt 3420 actgatgcta cagaagggtg
accattccaa atacttgaag aggaatacta ccaagagaac 3480 ctgatcagtg
ctaagcccag gaaccaacgg aaaacgttac catccatgat gttactacta 3540
atcaccttcg cgaataatcc aaacaggccc acatcttccc aagttcaggc cacatgttgg
3600 tccaaaagta caagtcaggg aagccctgtg ggggagcggg caagggccaa
cgttccgctt 3660 gggtggccag ggcctcactc tttcacagca cgggtgcaga
tcacattagc actgttagga 3720 aatagagatt tcatgggacg gtgcggacag
aggacataaa gaagtagcaa ttgtgagggt 3780 cctttatcaa tacgccccaa
aaaagcaacc atgacagtat tccaatctat gaaggcatct 3840 ggaacacttc
cccaaaggaa gaaggaagga aatcatggga cctgccaaga tggacttggc 3900
agagtgctag gagatgactg gatcattgca catcagagga ttgcctgggc aacatcaact
3960 tgggagggag tccaggactt tctctgggga aggtccagcc acttatccct
ctctccaaga 4020 cataagagca agagccaggg tatcttacag ggaagaacca
gtgtctagag agaatggaca 4080 accctttcca agttcgagga taaagttcga
aaccgacaag aaatccagaa aaaggaaaac 4140 tatcctacct ggaaaggggg
aggagtcaga ctggtctgag atggctctga aactctgtgt 4200 gctgggaggt
tgtcaggaca acttagactt ctgaggttgt ttatgacata acggcgaaca 4260
tgtcccccaa gatggccgca tggttactgt gtgaggattg gcctaggctg ggctattaaa
4320 ctgagacata cccagaaaaa gctt 4344 12 21 DNA Equus caballus 12
agcggagaaa ggaatctctg g 21 13 22 DNA Equus caballus 13 tacctagcgc
ttcgtcctct at 22 14 23 DNA Equus caballus 14 ttcgtcctct atgttgaaat
cag 23 15 21 DNA Equus caballus 15 gtcgtagcgg agaaaggaat c 21 16 20
DNA Equus caballus 16 agcggactgt tccgtttcgg 20 17 21 DNA Equus
caballus 17 gcccagtgtt tcgttggttc g 21 18 25 DNA Equus caballus 18
catagttgta tattcttcgt tgtgg 25 19 41 DNA Equus caballus 19
gcggtcccaa aagggtcagt agcggagaaa ggaatctctg g 41 20 42 DNA Equus
caballus 20 gcggtcccaa aagggtcagt tacctagcgc ttcgtcctct at 42 21 41
DNA Equus caballus 21 gcggtcccaa aagggtcagt gcccagtgtt tcgttggttc g
41 22 45 DNA Equus caballus 22 gcggtcccaa aagggtcagt catagttgta
tattcttcgt tgtgg 45 23 10 DNA Equus caballus 23 ccagaacgga 10 24 10
DNA Equus caballus 24 caatcgggtc 10 25 10 DNA Equus caballus 25
gtcgtagcgg 10 26 10 DNA Equus caballus 26 tcacgtacgg 10 27 10 DNA
Equus caballus 27 aaccgcggca 10 28 23 DNA Equus caballus 28
atttaggtga cactatagaa tac 23 29 23 DNA Equus caballus 29 attatgctga
gtgatatccc gct 23
* * * * *