U.S. patent application number 09/874626 was filed with the patent office on 2002-07-25 for infectious clones of rna viruses and vaccines and diagnostic assays derived thereof.
Invention is credited to Bos-de Ruijter, Judy Norma Aletta, Meulenberg, Johanna Jacoba Maria, Pol, Johannes Maria Antonius.
Application Number | 20020098573 09/874626 |
Document ID | / |
Family ID | 8224533 |
Filed Date | 2002-07-25 |
United States Patent
Application |
20020098573 |
Kind Code |
A1 |
Meulenberg, Johanna Jacoba Maria ;
et al. |
July 25, 2002 |
Infectious clones of RNA viruses and vaccines and diagnostic assays
derived thereof
Abstract
An infectious clone based on the genome of a wild-type RNA virus
is produced by the process of providing a host cell not susceptible
to infection by the wild-type RNA virus, providing a recombinant
nucleic acid based on the genome of the wild-type RNA virus,
transfecting the host cell with the recombinant nucleic acid and
selecting for infectious clones. The recombinant nucleic acid
comprises at least one full-length DNA copy or in vitro-transcribed
RNA copy or a derivative of either. The infectious clones can be
used in single or dual purpose vaccines and in viral vector
vaccines.
Inventors: |
Meulenberg, Johanna Jacoba
Maria; (Amsterdam, NL) ; Pol, Johannes Maria
Antonius; (Lelystad, NL) ; Bos-de Ruijter, Judy Norma
Aletta; (Almere-Buiten, NL) |
Correspondence
Address: |
TRASK BRITT
P.O. BOX 2550
SALT LAKE CITY
UT
84110
US
|
Family ID: |
8224533 |
Appl. No.: |
09/874626 |
Filed: |
June 5, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09874626 |
Jun 5, 2001 |
|
|
|
09297535 |
Oct 12, 1999 |
|
|
|
09297535 |
Oct 12, 1999 |
|
|
|
PCT/NL97/00593 |
Oct 29, 1997 |
|
|
|
Current U.S.
Class: |
435/235.1 ;
424/184.1; 424/204.1; 424/221.1; 424/815; 435/239; 435/252.3;
435/335; 435/5; 435/69.3; 435/91.1; 530/350; 536/23.1;
536/23.72 |
Current CPC
Class: |
C12N 2770/10022
20130101; C12N 2770/10034 20130101; A61K 39/00 20130101; A61P 37/04
20180101; C07K 14/005 20130101; C12N 7/00 20130101 |
Class at
Publication: |
435/235.1 ;
424/184.1; 424/204.1; 424/221.1; 424/815; 536/23.1; 435/5;
435/69.3; 435/91.1; 435/239; 435/252.3; 435/335; 530/350;
536/23.72 |
International
Class: |
C12Q 001/70; C07H
021/04; C12P 019/34; A61K 039/38; A61K 039/215; C12N 007/01; C12N
001/20; C12N 005/16; C07H 021/02; A61K 039/00; C12N 007/00; C12N
005/06; C07K 014/00; C07K 001/00 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 30, 1996 |
EP |
96203024.3 |
Claims
What is claimed is:
1. A method of generating an infectious clone, said infectious
clone based upon a positive strand RNA virus's genome, said method
comprising: producing a recombinant nucleic acid comprising at
least one full-length DNA copy or at least one in vitro-
transcribed RNA copy or a derivative of either said at least one
DNA copy or said at least one in-vitro transcribed RNA copy,
wherein the RNA virus's genome is at least about 15 kb.
2. A method of generating an infectious clone based upon an RNA
virus's genome, said method comprising: producing a recombinant
nucleic acid comprising at least one full-length DNA copy or in
vitro-transcribed RNA copy or a derivative of either, and selecting
infectious clones by transfecting a host cell with said recombinant
nucleic acid wherein said host cell is not susceptible to infection
to said virus.
3. The method according to claim 2 wherein said RNA virus is a
positive strand RNA virus with a genome of at least about 15
kb.
4. The method according to claim 2 wherein said host cell is a
BHK-21 cell.
5. A modified RNA virus comprising a recombinant nucleic acid, said
recombinant nucleic acid comprising at least one full-length DNA
copy or in vitro-transcribed RNA copy or a derivative of
either.
6. A vaccine comprising a modified RNA virus, said modified RNA
virus comprising a recombinant nucleic acid which comprises at
least one full-length DNA copy or in vitro-transcribed RNA copy or
a derivative of either.
7. A cell culture infected with a modified RNA virus, said modified
RNA virus comprising a recombinant nucleic acid which comprises at
least one full-length DNA copy or in vitro-transcribed RNA copy or
a derivative of either.
8. A protein and/or antigen obtained from a cell culture according
to claim 7.
9. A diagnostic assay using a protein and/or antigen of claim 8,
said assay useful for diagnosis in an animal vaccinated with a
vaccine based on the modified RNA virus.
10. A recombinant nucleic acid comprising an infectious clone
produced by the method according to claim 1.
11. The recombinant nucleic acid of claim 10 wherein the infectious
clone is based on the genome of a virus of the order
Nidovirales.
12. The recombinant nucleic acid of claim 11 wherein the infectious
clone is based on the genome of a virus of the family
Arteriviridae.
13. The recombinant nucleic acid of claim 12 wherein the virus is
PRRSV.
14. The recombinant nucleic acid molecule of claim 10 wherein the
infectious clone further comprises at least one nucleic acid
sequence encoding a virulence marker and/or a serological marker
particular to said positive strand RNA virus, and wherein said at
least one nucleic acid sequence has been modified to effect a
change in virulence and/or a change in serological immune response
in vivo.
15. The recombinant nucleic acid molecule of claim 14 wherein the
nucleic acid sequence encoding said virulence or serological marker
or virulence and serological markers is located within any of the
genome's open reading frames encoding structural viral
proteins.
16. The recombinant nucleic acid molecule of claim 10 wherein said
infectious clone further comprises a nucleic acid sequence
comprising at least one open reading frame and wherein said at
least one open reading frame is substituted by an ORF7.
17. The recombinant nucleic acid molecule of claim 10 wherein at
least one additional heterologous nucleic acid sequence is
inserted, allowing the infectious clone to serve as a delivery
system for an additional heterologous nucleic acid sequence.
18. The recombinant nucleic acid molecule of claim 17 wherein said
heterologous nucleic sequence encodes an antigen.
19. The recombinant nucleic acid molecule of claim 10 wherein said
infectious clone further comprises a nucleic acid sequence
comprising at least one open reading frame, said at least one open
reading frame having been modified to effect a change in virulence
and/or a change in serological response in vivo in a cell into
which the infectious clone has been introduced.
20. A modified RNA virus comprising the recombinant nucleic acid of
claim 10.
21. A vaccine comprising the modified RNA virus of claim 20.
22. A cell culture infected with the modified RNA virus of claim
20.
23. A protein and/or antigen obtained from a cell culture according
to claim 22.
24. A diagnostic assay using a protein and/or antigen of claim 23,
said assay useful for diagnosis in an animal vaccinated with a
vaccine based on the modified RNA virus.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS:
[0001] This application is a continuation of application Ser. No.
09/297,535 filed Oct. 12, 1999, now U.S. Patent No.______ which was
the National Stage of International Application No. PCT/NL97/00593
filed Oct. 29, 1997.
TECHNICAL FIELD:
[0002] The invention relates to the field of RNA viruses and
infectious clones obtained from RNA viruses. Furthermore, the
invention relates to vaccines and diagnostic assays obtainable by
using and modifying such infectious clones of RNA viruses.
BACKGROUND:
[0003] Recombinant DNA technology comprises extremely varied and
powerful molecular biology techniques aimed at modifying nucleic
acids at the DNA level and makes it possible to analyze and modify
genomes at the molecular level. In this respect, viruses, because
of the small size of their genome are particularly amenable to such
manipulations. However, recombinant DNA technology is not
immediately applicable to nonretroviral RNA viruses because these
viruses do not encompass a DNA intermediate step in their
replication. For such viruses, infectious clones (for instance as a
DNA copy or as in vitro transcribed RNA copy or as derivative of
either) have to be developed before recombinant DNA technology can
be applied to their genome to generate modified virus. Infectious
clones can be derived through the construction of full-length
(genomic length) cDNA (here used in the broad sense of a DNA copy
of RNA and not only in the strict sense of a DNA copy of mRNA) of
the virus under study after which an infectious transcript is
synthesized in vivo in cells transfected with the full-length cDNA,
but infectious transcripts can also be obtained by in vitro
transcription from in vitro ligated partial-length cDNA fragments
that comprise the full viral genome. In all cases, the transcribed
RNA carries all the modifications that have been introduced to the
cDNA and can be used to further passage the thus modified
virus.
[0004] Infectious cDNA clones and infectious in vitro transcripts
have been generated for a great number of positive strand RNA
viruses (for a review see Boyer and Haenni, Virology 198, 415-426)
with a genome of up to 12 kb or slightly larger. The viral genomic
length of Pestiviruses seems until now the longest positive strand
viral RNA genome from which infectious clones (Moormann et al., J.
Vir. 70:763-770) have been prepared. Problems associated with
genomic length lie not only in the difficulty of obtaining and
maintaining long and stabile cDNA clones in bacteria but also in
the infectivity of the initial RNA transcript of which replication
in the host cell has to be achieved without the help of the
normally associated viral proteins connected with viral
replication. To achieve successful infection, viral transcripts
must interact with viral-encoded proteins, most particularly with
the viral replicase and with host cell components such as the
translation machinery; therefore, the structure of viral
transcripts has to mimic that of virion RNA as closely as possible.
Additional problems can be found with those positive strand RNA
viruses that replicate via a mechanism of subgenomic messenger RNAs
transcribed from the 3'side of the genome and with those positive
strand RNA viruses that generate during replication defective
interfering particles, such as naked capsids or empty shell
particles, comprising several structural proteins but only a part
of the genome. The presence of incomplete viral RNA fragments or
of, for example, matrix or nucleocapsid proteins interacting or
interfering with the viral RNA to be transcribed or to replicative
intermediate RNA and disrupting its structure will abolish
full-length RNA strand synthesis, and thus the generation of
infectious virus comprising genomic length RNA.
[0005] "Lelystad virus" (LV), also called "porcine reproductive
respiratory syndrome virus" (PRRSV, genomic length 15.2 kb), is a
member of the family Arteriviridae, which also comprises equine
arteritis virus (EAV, genomic length 12.7 kb), lactate
dehydrogenase-elevating virus (LDV, genomic length at least 14.2
kb) and simian haemorrhagic fever virus (SHFV genomic length
approximately 15 kb) ( Meulenberg et al., 1993a; Plagemann and
Moennig, 1993).
[0006] Recently, the International Committee on the Taxonomy of
Viruses decided to incorporate this family in a new order of
viruses, the Nidovirales, together with the Coronaviridae (genomic
length 28 to 30 kb), and Toroviridae (genomic length 26 to 28 kb).
Nidovirale represents enveloped RNA viruses that contain a
positive-stranded RNA genome and synthesize a 3' nested set of
subgenomic RNAs during replication. The subgenomic RNAs of
coronaviruses and arteriviruses contain a leader sequence which is
derived from the 5' end of the viral genome (Spaan et al, 1988;
Plagemann and Moennig, 1993). The subgenomic RNAs of toroviruses
lack a leader sequence (Snijder and Horzinek, 1993). Whereas the
ORFs 1a and 1b, encoding the RNA dependent RNA polymerase, are
expressed from the genomic RNA, the smaller ORFs at the 3' end of
the genomes of Nidovirales encoding structural proteins are
expressed from the subgenomic mRNAs. PRRSV (Lelystad virus), or
"LV", was first isolated in 1991 by Wensvoort et al. (1991). It was
shown to be the causative agent of a new disease now generally
known as a porcine reproductive respiratory syndrome, ("PRRS"). The
main symptoms of the disease are respiratory problems in pigs and
abortions in sows. Although the major outbreaks, such as observed
at first in the US in 1987 and in Europe in 1991, have diminished,
this virus still causes economic losses in herds in the US, Europe,
and Asia.
[0007] PRRSV preferentially grows in alveolar lung macrophages
(Wensvoort et al., 1991). A few cell lines, such as CL2621 and
other cell lines cloned from the monkey kidney cell line MA-104
(Benfield et al., 1992; Collins et al., 1992; Kim et al., 1993),
are also susceptible to the virus. Some well known PRRSV strains
are known under accession numbers CNCM I-1102 , I-1140,
I-1387,I-1388, ECACC V93070108, or ATCC VR 2332, VR 2385, VR 2386,
VR 2429, VR 2474, and VR 2402. The genome of PRRSV was completely
or partly sequenced (Conzelmann et al., 1993; Meulenberg et al.,
1993a, Murthaugh et al, 1995) and encodes, besides the RNA
dependent RNA polymerase (ORFs 1a and 1b), six structural proteins
of which four envelope glycoproteins named GP.sub.2 (ORF2),
GP.sub.3 (ORF3), GP.sub.4 (ORF4) and GP.sub.5 (ORF5), a
non-glycosylated membrane protein M (ORF6) and the nucleocapsid
protein N (ORF7) (Meulenberg et al. 1995, 1996; van Nieuwstadt et
al., 1996). Immunological characterization and nucleotide
sequencing of European and US strains of PRRSV has identified minor
antigenic differences within strains of PRRSV located in the
structural viral proteins (Nelson et al., 1993; Wensvoort et al.,
1992; Murtaugh et al., 1995).
[0008] Pigs can be infected by PRRSV via the oronasal route. Virus
in the lungs is taken up by lung alveolar macrophages and in these
cells replication of PRRSV is completed within 9 hours. PRRSV
travels from the lungs to the lung lymphnodes within 12 hours and
to peripheral lymphnodes, bone marrow and spleen within 3 days. At
these sites, only a few cells stain positive for viral antigen. The
virus is present in the blood during at least 21 days and often
much longer. After 7 days, antibodies to PRRSV are found in the
blood. The combined presence of virus and antibody in PRRS infected
pigs shows that the virus infection can persist for a long time,
albeit at a low level, despite the presence of antibody. During at
least 7 weeks, the population of alveolar cells in the lungs is
different from normal SPF lungs.
[0009] PRRSV needs its envelope to infect pigs via the oronasal
route. The normal immune response of the pig entails, among other
things, the production of neutralizing antibodies directed against
one or more of the envelope proteins. Such antibodies can render
the virus non-infective. However, once in the alveolar macrophage,
the virus also produces naked capsids, constructed of RNA
encapsidated by the M and/or N protein, sometimes partly containing
any one of the glycoproteins. The intra- and extracellular presence
of these incomplete viral particles or (partly) naked capsids can
be demonstrated by electron microscopy. Sometimes, naked capsids
without a nucleic acid content can be found. The naked capsids are
distributed through the body by the bloodstream and are taken up
from the blood by macrophages in spleen, lymphnodes and bone
marrow. These naked, but infectious, viral capsids can not be
neutralized by the antibodies generated by the pig thus explaining
the persistence of the viral infection in the presence of antibody.
In this way, the macrophage progeny from infected bone marrow cells
spreads the virus infection to new sites in the body. Because not
all bone marrow macrophage-lineage cells are infected, only a small
number of macrophages at peripheral sites are infected and produce
virus.
[0010] PRRSV capsids, consisting of ORF7 proteins only, can be
formed in the absence of other viral proteins by, for instance,
infection of macrophages with a chimeric pseudorabies-ORF7 vector
virus. The PRV virus was manipulated to contain ORF7 genetic
information of PRRSV. After 18 hours post infection, the cytoplasm
of infected cells contains large numbers of small, empty spherical
structures with the size of PRRS virus nucleocapsids.
BRIEF SUMMARY OF THE INVENTION
[0011] The invention provides an infectious clone derived from a
virus with a genomic length far exceeding the maximum genomic
length of the positive strand RNA viruses from which infectious
clones have been obtained so far. The experimental part hereof
describes the generation of an infectious clone based on and
derived from PRRSV with a genomic length of 15.2 kb but such clones
can now also be obtained from LDV and SHFV that also have a genomic
length of about 15 kb and from EAV, although its genome is slightly
smaller, and from viruses with greater genomic length, such as the
Coronaviridae or Toroviridae.
[0012] The invention also provides a method to generate infectious
clones by circumventing the problems encountered in viral RNA
strand synthesis associated with the presence of incomplete viral
RNA fragments or of, for example, matrix or nucleocapsid proteins
interacting or interfering with the to be transcribed RNA
transcript or with replicative intermediate RNA, disrupting the
structure that abolishes full-length RNA strand synthesis, and thus
the generation of infectious virus.
[0013] The invention provides a method of generating infectious
clones by transfecting a host cell that is, in essence, not
susceptible to infection with the wild-type virus with a
recombinant nucleic acid based on the genome of the virus followed
by rescuing infectious progeny virus from the host cell by
passaging to or cocultivation with cells that are susceptible to
the virus. Cells that are, in essence, not susceptible may, in
comparison with the cells that are routinely used for the
replication of the virus under study, be only slightly susceptible
or be not susceptible at all to the virus under study, but may be
fully susceptible to other virus strains.
[0014] The invention provides a method to generate infectious
clones by transfecting host cells that are not susceptible to
infection with the wild-type virus, thus avoiding the generation of
naked capsids or incomplete viral particles comprising RNA
fragments and matrix or nucleocapsid proteins that interfere with
viral RNA strand synthesis. Infectious virus is rescued from the
thus transfected host cells by passaging to cells that are
susceptible to the virus. In the experimental part, hereof, we
describe how, in this way, an infectious clone of PRRSV is
obtained, but the method is also applicable to other positive
strand RNA viruses.
[0015] The invention also provides the possibility of generating a
modified infectious clone via the further application of
recombinant DNA technology. Such modifications may be single or
multiple mutations, substitutions, deletions or insertions or
combinations thereof that can be achieved via any recombinant DNA
technology method known in the art. The present invention thus
provides modified RNA viruses that can be used to investigate RNA
viruses and to prepare vaccines.
[0016] The invention also provides infectious clones, for example,
derived from Arteriviridae, such as PRRSV, which can be used as a
single-purpose vaccine against the disease caused by the virus from
which the infectious clone is based. For example, the infectious
clone based on PRRSV can now be used to study virulence markers or
serological markers of the PRRSV. Known serological markers of
PRRSV are, for example, located on any of the structural proteins
of PRRSV encoded by ORF2 to ORF7. They can also be found in the
proteins encoded by ORF 1a and 1b.
[0017] Virulence markers are present in the ORF 1a and 1b encoding
the nonstructural proteins of PRRSV but can also be found on any of
the proteins encoded by ORF2 to ORF7. By modifying the genome of
the infectious clone with respect to those markers, it is possible
to obtain PRRSV that is not or is much less virulent than its
parent strain, and/or that is modified by deleting or introducing
serological markers to enable a serological differentiation between
vaccinated and wild-type virus infected pigs. Such modifications
are, for instance, provided by the PRRSV infectious clones in which
the nucleic acid sequence encoding the ORF7 N protein is replaced
by the ORF7 protein of ATCC VR2332 or LDV.
[0018] The invention also provides infectious clones, for example,
derived from Arteriviridae, such as PRRSV, which can be used as a
delivery system or viral vector vaccine for a wide variety of
antigens. In such clones, heterologous nucleic acid sequences that
do not correspond to the sequence of the virus under study are
inserted. Such heterologous nucleic acid sequences can be, for
example, derived from sequences encoding any antigen of choice. The
antigen is a protein or peptide that can induce immunity against a
pathogen. Since the virus infects macrophages and
macrophage-lineage cells in bone marrow, and distributes the
antigen-containing virus through its progeny cells, this viral
vector vaccine infects cells central to the immune system and can
present the antigens for further processing. The vector vaccine
virus infects antigen presenting cells like the dendritic
macrophages or the Kuppfer cells or other cells of the immune
system, and can do this as an (incompletely) enveloped viral
particle or as a naked capsid particle.
[0019] Since an infection with a naked capsid or an incomplete
virus particle ensures a persistent infection, the immunological
booster effect will cause a lifelong (because of continuous
stimulation on a low level) immunity against pathogens from which
the antigens are selected. The virus can be used as an antigen
carrier by including in the information for epitopes of other
pathogenic organisms or substances. Several of such vector vaccine
viruses carrying foreign epitopic information may be mixed and
administered at one time. This enables active immunity against
several different antigens of one pathogen, or active immunity
against several different pathogens.
[0020] The invention also provides infectious clones, for example,
derived from Arteriviridae, such as PRRSV, which can be used as a
dual purpose vaccine. For example, the infectious clone based on
PRRSV can be used to construct a vaccine which protects against
PRRSV and against another pathogen simply by combining the vector
vaccine development with the development directed towards the
development of a single purpose vaccine directed against PRRS. A
specific dual purpose vaccine could be developed that protects
against respiratory disease in pigs by inserting in the PRRS
vaccine antigens derived from any of the wide variety of other
respiratory pathogens that are known to infect pigs.
[0021] The invention also provides vaccines, be it single purpose,
dual purpose, or vector vaccines, that are relatively safe in the
sense that the vaccines cannot be shed to the environment. Safety
of the vaccines (non-shedding) can be ensured by deleting the
information of those viral proteins that is needed to produce
enveloped, infectious virus. This virus is propagated in a
cell-line that constitutively expresses the protein. Virus
replicating in this complementary cell-line has a complete
envelope, and is capable of infecting pig macrophages. After one
replication-cycle, the progeny virus, missing the information for
the envelope protein, is no longer capable of infecting other cells
as an enveloped virus. Infection of macrophages in the body is
still possible, as naked capsid or incomplete viral particle.
[0022] The invention also provides viral antigens and proteins that
can be harvested from cell cultures infected with the modified RNA
viruses according to the invention. Such antigens can be used in
diagnostic assays such as ELISA's or other types of diagnostic
assay known to the expert. Such assays can be used as stand-alone
tests for primary diagnosis or as accompanying tests to be applied
in animal populations that have been vaccinated with a
discriminating or marker vaccine based on the modified RNA viruses
according to the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0023] FIG. 1. Construction of a genome-length cDNA clone of LV.
The upper part (A) shows the fusion of cDNA clones, which were
previously sequenced (Meulenberg et al., 1993a) in pGEM-4Z. The
pABV numbers of the clones and the restriction sites that were used
are indicated. The black boxes represent those parts of the cDNA
clones that are fused in the next cloning step. Light grey boxes,
indicated with R.T., are cDNA clones newly generated by RT-PCR, a
dark grey box represents a new cDNA clone generated by PCR. The
lower part (B) shows the assembly of the larger cDNA clones
pABV331/369, pABV384, and pABV368 with the 5' end clone pABV396,
containing a T7 RNA polymerase promoter, and the 3' end clone
pABV395, containing a poly(A) tail, in low copy number vector
pOK12. The restriction sites within and outside the multiple
cloning site of pOK12 are indicated. The restriction endonuclease
sites are; A, ApaI; Ap, ApoI; B, BamHI; Bg, BglII; Bs, BspEl; Bc,
BclI; E, EcoRI; Ec, EcoRV; H, HindIII; K, KpnI; N, NarI; Nc, NcoI;
S, SacII; Sp, SpeI; Sa, SalI; Sc, ScaI; P, PstI; Pm, PmlI; X, XbaI;
Xh, XhoI.
[0024] FIG. 2. Terminal sequences of cloned full-length LV cDNA and
infectious RNA transcribed from this cDNA clone. Genome-length cDNA
clones were linearized with PvuI and were transcribed in the
presence of the synthetic cap analog m.sup.7G(5')ppp(5')G with T7
RNA polymerase. The resulting RNA should contain one extra
nucleotide (G) at the 5' end and two extra nucleotides (GC) at the
3' end. The arrows in the RNA correspond to the 5' and 3' terminal
nucleotides corresponding to the authentic LV RNA sequence.
[0025] FIG. 3. Growth curves of LV wild-type virus TH, LV4.2.1, and
recombinant viruses vABV414 and vABV416 in porcine alveolar
macrophages (A) and CL2621 cells (B). The recombinant viruses
vABV414 and vABV416 produced in BHK-21 cells were either used
directly (BHK), or used after multiplication in Porcine alveolar
macrophages (PAM). The TH virus was prepared in porcine alveolar
macrophages (PAM), whereas LV4.2.1 was prepared in CL2621 cells
(CL). The cell cultures were infected with the indicated viruses at
an MOI of 0.05 and harvested at the indicated time points. Virus
titers (TCID.sub.50/ml) were determined on Porcine alveolar
macrophages or CL2621 cells by endpoint dilution.
[0026] FIG. 4. Introduction of a unique PacI and SwaI site in the
infectious cDNA clone of LV. The PacI and SwaI sites were created
by PCR-directed mutagenesis, as described in detail in Materials
and Methods. The cDNA fragments containing the PacI and SwaI site
were exchanged in pABV414 using its unique HpaI and XbaI sites,
which are indicated. This resulted in pABV437 and pABV442,
respectively.
DETAILED DESCRIPTION OF THE INVENTION
[0027] The production of cDNA clones from which infectious RNA can
be transcribed in vitro has become an essential tool for molecular
genetic analysis of positive-strand RNA viruses. This technology is
applicable to positive-strand RNA viruses whose RNA genomes may
function as mRNA and initiate a complete infectious cycle upon
introduction into appropriate host cells. For a number of viruses,
infectious clones have been described that facilitate studies on
the genetic expression, replication, function of viral proteins and
recombination of RNA viruses (for a review, see, Boyer and Haenni,
1994). In addition, these clones can be considered for the
development of new viral vectors and vaccines. An infectious cDNA
clone has not been described for Arteriviruses so far. We report
here the generation of an infectious clone of PRRSV and its first
application in the generation of chimeric PRRSV viruses.
Cells and Viruses
[0028] The Ter Huurne strain of PRRSV (or LV) (deposited at CNCM,
Paris, under accession number I-1102) was isolated in 1991
(Wensvoort et al., 1991) and was grown in primary alveolar
macrophages or in CL2621 cells. Passage 6 of the Ter Huure strain
(TH) was used in this study as well as a derivative of this strain,
LV4.2.1, which was adapted for growth on CL2621 cells by serial
passage. Alveolar macrophages were maintained in RPMI 1640 growth
medium (Flow), whereas CL2621 cells were maintained in Hank's
minimal essential medium (Gibco-BRL/Life technologies). BHK-21
cells were maintained in Dulbecco's minimal essential medium. For
transfection experiments, BHK-21 cells were grown in Glasgow
minimal essential medium (GIBCO-BRL/Life Technologies Ltd),
according to the method of Liljestrom and Garoff (1993).
Isolation of Viral RNAs
[0029] Intracellular RNA was isolated from alveolar macrophages or
CL2621 cells 24 hours after infection with PRRSV at a multiplicity
of infection of 1, as described earlier (Meulenberg et al., 1993a).
In order to isolate virion genomic RNA, virions were purified on
sucrose gradients as described by van Nieuwstadt et al. (1996) and
were resuspended in TNE (0.01 M Tris-HCl, pH 7.2, 0.1 M NaCl, 1 mM
EDTA). One ml of Proteinase K buffer (100 mM Tris-HCl, pH 7.2, 25
mM EDTA, 300 mM NaCl, 2% (w/v) SDS) and 0.4 mg Proteinase K
(Boehringer Mannheim) was added to one ml of purified PRRSV virions
(10.degree. TCID.sub.50). This reaction mixture was incubated at
37.degree. C. for 30 min. The RNA was extracted once with
phenol/chloroform (1:1) and precipitated with ethanol. The RNA was
stored in ethanol at -20.degree. C. One tenth of this RNA
preparation was used in Reversed Transcription (RT) reactions.
Cloning of the 5' and 3' Termini of the PRRSV Genome.
[0030] The 5' end of the viral genome of PRRSV was cloned using a
modified single strand ligation to single-stranded cDNA procedure
(SLIC; Edwards et al., 1991). One tenth of the virion RNA, prepared
as described above, was used in a RT reaction with primer
11U113
(5'TACAGGTGCCTGATCCAAGA 3') (SEQ ID NO: 1)
[0031] which is complementary to nucleotides 1232 to 1251 of the
genome. The RT reaction was performed in a final volume of 20 ml,
as described earlier (Meulenberg et al., 1993b). Subsequently, 2 ml
6M NaOH was added to the RT-reaction and the RNA was hydrolyzed for
30 min at 37.degree. C. The single strand cDNA was purified using
the high pure PCR Product Purification Kit of Boehringer Mannheim.
The purified cDNA was precipitated with ethanol, resuspended in TE,
and ligated to an anchor primer ALG3
(5'CACGAATTCACTATCGATTCTGGATCCTTC 3') (SEQ ID NO:2).
[0032] This primer contains an EcoRI, ClaI, and BamHI site, and its
3' end is modified with an amino blocking group to prevent
self-ligation. The single strand cDNA product was ligated to 4 pmol
ALG3 in 50 mM Tris-HCl (pH 8.0), 10 mM MgCl.sub.2, 10 mg/ml BSA,
25% PEG, 1.0 mM Hexamine Cobaltchloride, 40 mM ATP, and 0.5 ml (10
U) T4 RNA ligase (New England Biolabs), overnight at room
temperature. One third of the ligation reaction was used as
template in a PCR with primers LV69
(5'AGGTCGTCGACGGGCCCCGTGATCGGGTACC 3') (SEQ ID NO:3)
[0033] and ALG4
(5'GAAGGATCCAGAATCGATAG 3') (SEQ ID NO:4).
[0034] Primer LV69 is complementary to nucleotides 594 to 615 of
the LV genome, whereas ALG4 is complementary to anchor primer ALG3.
The PCR conditions were as described in Meulenberg et al. (1993b)
and the obtained product was digested with EcoRI and SalI and
cloned in pGEM-4Z. A similar strategy was used to clone the 5'
terminus of the LV genome from intracellular LV RNA. For these
experiments 10 mg of total cellular RNA isolated from CL2621 cells
infected with LV was used. The 5' cDNA clones were sequenced and
one clone, pABV387, containing an extension of 10 nucleotides
compared to the published PRRSV sequence (Meulenberg et al.,
1993a), was used for further experiments.
[0035] A 3' end cDNA clone containing a long poly(A) tail was
constructed by reverse transcription of LV RNA with primer LV76
(5'TCTAGGAATTCTAGACGATCG(T).sub.40 3') (SEQ ID NO:5),
[0036] which contains an EcoRI, XbaI, and PvuI site. The reversed
transcription reaction was followed by a PCR with primers LV75
(5'TCTAGGAATTCTAGACGATCGT 3') (SEQ ID NO: 6),
[0037] which is identical to LV76 except for the poly(T) stretch,
and 39U70R
(5'GGAGTGGTTAACCTCGTCAA 3') (SEQ ID NO:7),
[0038] a sense primer corresponding to nucleotides 14566-14585 of
the LV genome and containing a HpaI site. The resulting PCR
products were digested with HpaI and EcoRI and cloned in cDNA clone
pABV39 restricted with the same enzymes (FIG. 1). Two cDNA clones
containing a poly(A) stretch of 45 A's (pABV382) and 109 A's
(pABV392) and the correct genomic cDNA sequence, as assessed by
oligonucleotide sequencing, were used to construct the full length
genomic cDNA clone.
Sequence Analysis.
[0039] Oligonucleotide sequences were determined with the PRISM.TM.
Ready Reaction Dye Deoxy.TM. Terminator Cycle Sequencing Kit and
Automatic sequencer of Applied Biosystems.
Construction of Full-length Genomic cDNA Clones of PRRSV.
[0040] cDNA clones generated earlier to determine the nucleotide
sequence of the genome of LV (Meulenberg et al., 1993a), were
ligated together at convenient restriction sites as shown in FIG.
1. Plasmid pABV254 was constructed from pABV clones 25, 11, 12, and
100 and was used in a previous study (den Boon et al., 1996).
Standard cloning procedures were carried out according to Sambrook
et al. (1989). This resulted in three plasmids containing
overlapping cDNA sequences of LV in high copy number plasmid
pGEM-4Z. Plasmids pABV331 and pABV369 consist of nucleotides 5 to
6015 of the LV genome. A nucleotide difference was found at
position 3462 at a ratio of 1:1 in a set of 6 independent cDNA
clones which were sequenced in that region. This nucleotide
difference resulted in an amino acid substitution at position 1084
in ORF1A (Leu instead of Pro). Since we could not predict the
influence of this amino acid on infectivity, we also cloned the Leu
encoding cDNA fragment in pABV331 by exchange at the EcoRV
(nucleotide 3403) and SacII (nucleotide 3605) site, which resulted
in pABV369. Plasmid pABV384 consists of nucleotides 5168 to 9825 of
the LV genome. Since no appropriate cDNA clone was yet available
that had overlap with plasmids pABV20 and pABV5, and could finally
be fused to the cDNA sequences of pABV331 and pABV369, two new cDNA
fragments were generated by RT-PCR. Sense primer LV59
(5'TCGGAATCTAGATCTCACGTGGTGCAGCTGCTG 3') (SEQ ID NO:8)
[0041] corresponding to nucleotides 5169-5186 and antisense primer
61 U303
(5'CATCAACACCTGTGCAGACC 3') (SEQ ID NO:9)
[0042] complementary to nucleotides 6078 to 6097 were used in one
PCR. Sense primer 61 U526R
(5'TTCCTTCTCTGGCGCATGAT 3') (SEQ ID NO:10)
[0043] located at nucleotides 5936 to 5955 and LV60
(5'GTACTGGTACCGGATCCGTGAGGATGTTGC 3') (SEQ ID NO: 11)
[0044] complementary to nucleotides 6727 to 6745 were used in
another PCR. These two PCR fragments were ligated together in
pABV20 using the XbaI site incorporated in LV59, the internal ApoI
site (nucleotides 6006) and the BamHI site at nucleotide 6740,
which was also incorporated in primer LV60. The new cDNA fragment
was completely sequenced and did not contain any mutations that
resulted in amino acid differences with the published sequence
(Meulenberg et al., 1993a). Plasmid pABV368 encompasses nucleotides
8274 to 13720 of the PRRSV genome. Since further ligation of cDNA
fragments in pGEM-4Z resulted in instable clones, the inserts of
pABV331/369, pABV384, and pABV368 were ligated to the 5' and 3'
cDNA fragments in pOK12 (Viera and Messing, 1991). Plasmid vector
pOK12 is expected to be more suitable for cloning of large foreign
cDNA sequences, because it has a lower copy number than pGEM-4Z.
Plasmids were transformed to Escherichia coli strain DH5a, grown at
32.degree. C. in the presence of 15 mg/ml Kanamycin, to keep the
copy number as low as possible. First, the cDNA fragments of
pABV382 ((A).sub.45) and pABV392 ((A).sub.109) were excised by
digestion with EcoRI and modification of this site with Klenow
polymerase (Pharmacia) to a blunt end, followed by digestion with
BamHI. These fragments were cloned in pOKI 12 digested with BamFH
and FspI, the latter site also modified to a blunt end, resulting
in pABV394 and pABV395. In this way, the T7 RNA polymerase promoter
present in pOK12 was removed. Subsequently, the cDNA fragments of
pABV368 and pABV384 were ligated to the 3' end cDNA clones using
the BclI site (nucleotide 13394), the ScaI site (nucleotide 8657)
and the BamHI and BglII sites in flanking or vector sequences. This
resulted in plasmids pABV401 and pABV402 (FIG. 1).
[0045] A 5' cDNA clone, containing the T7 RNA polymerase promoter
directly fused to the 5' terminus of the LV genome, was amplified
by PCR from pABV387 with primers LV83
(5'GAATTCACTAGTTAATACGACTCACTATAGATGATGTGTAGGGTATTCC 3') (SEQ ID
NO:12)
[0046] and LV69. LV83 is composed of, in order from 5' to 3', an
EcoRI and SpeI site, a T7 RNA polymerase promoter sequence, a
single G for initiation of transcription, and nucleotides 1 to 19
of the LV genome. The PCR fragment was cloned in the EcoRI and SalI
site of pOK12, resulting in pABV396. The correct sequence of
pABV396 was assessed by oligonucleotide sequencing. Subsequently,
the LV cDNA fragments of pABV331 and pABV369 were excised with ApaI
and BamHI, and were ligated to pABV396, digested with ApaI and
BamHI. Finally, the resulting 5' cDNA fragments were cloned into
pABV401 and pABV402, using the SpeI site upstream of the T7 RNA
polymerase promoter and the unique PmlI site at position 5168 in
the viral genome. In this way, genome-length cDNA clones were
obtained as corresponding to viruses resembling the parent strain
and to chimeric viruses comprising foreign open reading frames.
Production of Mutant Viruses Containing a PacI and/or SwaI Site
[0047] To introduce a unique PacI site in the genome-length cDNA
clone directly downstream of the ORF7 gene, the T and A at
nucleotides 14987 and 14988 were both replaced by an A in a PCR
using sense primer LV108
(5'GGAGTGGTTAACCTCGTCAAGTATGGCCGGTAAAAACCAGAGCC3') (SEQ ID NO:
13)
[0048] with antisense primer LV112
1 (5'CCATTCACCTGACTGTTTAATTAACTTGCACCCTGA3') (SEQ ID NO:14) and
sense primer LV111 (5'TCAGGGTGCAAGTTAATTAAACAGTCAGGTGAATGG3'- )
(SEQ ID NO:15)
[0049] with LV75. Similarly, a unique SwaI site was created by
changing the G at position 14980 for a T, and the T at position
14985 for an A by PCR with primers LV108 and LV110
2 (5'CCTGACTGTCAATTTAAATTGCACCCTGAC 3') (SEQ ID NO:16) and primers
LV109 (5'GTCAGGGTGCAATTTAAATTGACAGTCAGG 3') (SEQ ID NO:17)
[0050] and LV111. The PCR fragments were ligated in pABV395 using
the created PacI and SwaI site and flanking HpaI and XbaI sites,
resulting in pABV427 and pABV426, respectively. This fragment was
then inserted in pABV414 using the same unique HpaI and XbaI sites,
resulting in pABV437 and pABV442 (see, FIG. 4). To detect the
marker mutation in the virus recovered from transcripts of pABV437
and pABV422, RNA was isolated from the supernatant of infected
porcine alveolar macrophages. This RNA was used in reverse
transcription-PCR to amplify a fragment approximately 0.6 kb
(spanning nucleotides 14576-polyA tail of variable length) with
primers LV76, LV75 and 39U70R. The presence of the genetic marker
was detected by digesting the PCR fragments with PacI or SwaI.
In Vitro Transcription and Transfection of RNA
[0051] Plasmids pABV414, pABV416, containing the full-length
genomic cDNA fragment of LV, were linearized with Pvu1, which is
located directly downstream of the poly(A) stretch. Plasmid
pABV296, which consists of ORF4 in Semliki Forest virus (SFV)
expression vector pSFV 1 (Meulenberg et al., 1997), was linearized
with SpeI and served as control for in vitro transcription and
transfection experiments. The linearized plasmids were precipitated
with ethanol and 1.5 mg of these plasmids was used for in vitro
transcription with T7 RNA polymerase (plasmids pABV414, pABV416) or
Sp6 RNA polymerase (pABV296), according to the methods described
for SFV by Liljestrom and Garoff (1991 and 1993). The in vitro
transcribed RNA was precipitated with isopropanol, washed with 70%
ethanol and stored at -20.degree. C. until use. BHK-21 cells were
seeded in M6 wells (approximately 10.sup.6 cells/well) and
transfected with 2.5 mg RNA mixed with 10 ml lipofectin in optimem
as described by Liljestrom and Garoff (1993). Alternatively, RNA
was introduced in BHK-21 cells by electroporation. In this case, 10
mg in vitro transcribed RNA or 10 mg intracellular LV RNA was
transfected to approximately 10.sup.7 BHK-21 cells using the
electroporation conditions of Liljestrom and Garoff (16). The
medium was harvested 24 hours after transfection and transferred to
CL2621 cells to rescue infectious virus. Transfected and infected
cells were tested for expression of LV-specific proteins by an
immuno peroxidase monolayer assay (IPMA), essentially as described
by Wensvoort et al. (1986). Monoclonal antibodies (MAbs) 122.13,
122.59, 122.9 and 122.17, directed against the GP.sub.3, GP.sub.4,
M and N protein (van Nieuwstadt et al., 1996) were used for
staining in the IPMA.
Reconstruction of the 5' Terminal Sequence of the Genomic RNA of
LV.
[0052] Although the infectivity of in vitro-transcribed RNAs with
truncated 5' ends have been reported (Davis et al. 1989, Klump et
al., 1990), it is generally admitted that the entire viral
sequence, including the utmost 5' and 3' end, are required to
obtain infectious clones. To clone the 5' end of the LV genome, a
modified single strand ligation to single-stranded cDNA (SLIC;
Edwards et al., 1991) procedure was used. Both intracellular RNA
isolated from CL2621 cells infected with LV and LV RNA from
purified virions was reverse transcribed using primer LV69, which
was complementary to the 5' end of ORF1A. The first strand cDNA
product was ligated to an anchor primer ALG3 of which the 3' end
was blocked for self ligation. The ligated products were amplified
by PCR and cloned. Twelve clones, derived from LV intracellular RNA
and resulting from two independent PCRs, and fourteen clones
derived from virion RNA and resulting from two independent PCRs
were sequenced. From these 26 cDNA clones, 22 clones contained an
extension of 10 nucleotides (5'ATGATGTGTA 3') (SEQ ID NO:18)
compared to the cDNA sequence, published previously (Meulenberg et
al., 1993a), whereas four clones lacked one to three nucleotides at
the 5' end of this additional sequence (Table 1). This led us to
conclude that these ten nucleotides represent the utmost 5' end of
the LV genome and were therefore incorporated in the genome-length
cDNA clone.
Construction of Genome-length cDNA Clones of LV
[0053] In order to construct a genome-length cDNA clone of LV,
cDNAs that were isolated and sequenced previously (Meulenberg et
al., 1993 a) were joined at shared restriction enzyme sites,
according to the strategy depicted in FIG. 1. In addition, new cDNA
fragments were generated to assemble the genome-length cDNA clones.
One cDNA fragment spanning nucleotides 5168 to 6740 was created by
RT-PCR to enable the ligation of cDNA sequences from clones pABV5
and pABV20. A T7 RNA polymerase promoter for in vitro transcription
was directly linked to the 5' terminus of the genome of LV by PCR
and this new cDNA fragment, cloned in pABV396, and was inserted in
the genome-length cDNA clone. Resequencing of nucleotides 3420 to
3725 on six new and independent cDNA clones indicated that at amino
acid 1084 in ORF1a a Leu and Pro are present at a ratio of 1:1.
Since we could not predict the influence of this amino acid on the
infectivity of the RNA transcribed from the final genome-length
cDNA clone, we used both to construct this clone. At the 3' end,
two different cDNA clones were used. We had previously isolated 3'
end cDNA clones containing poly(A) tails of at maximum 20 A's
(Meulenberg et al., 1993a). However, in view of studies reported on
the length of poly(A) tails of related viruses such as LDV (Chen et
al., 1994), the entire poly(A) tail was expected to be much longer.
Therefore, new 3' end cDNA clones were generated using primer LV76
which contains a stretch of 40 T residues. These cDNA clones were
sequenced and contained stretches of 40 to 109 A residues. The cDNA
clone containing the longest poly(A) stretch (109 A residues;
pABV392) was used for the genome-length cDNA clone. Since long
homo-polymeric tracts might interfere with the replication of
plasmids in E. coli (Deng and Wu, 1981), we also selected a second
clone, pABV382, containing 45 A residues for use in subsequent
cloning steps. Previously, it was observed that maintenance of
genome-length cDNA clones in high copy number plasmids leads to
accumulation of mutations or deletions which results in loss of
infectivity of transcripts synthesized from these clones (Lai et
al., 1991; Rice et al., 1987; Sumiyoshi et al., 1992). We also
observed instability of plasmids, when we tried to ligate the
larger cDNA fragments of pABV clones 331/369, 384, and 368 to the
5' and 3' end in pGEM-4Z and, therefore, we finally fused these
clones to each other in low copy number vector pOK12 (Viera and
Messing, 1991). This resulted in the genome-length cDNA clones
pABV414/415 and 416, which could be stably propagated in E. coli
under the growth conditions used. No difference in stability of the
genome-length cDNA clones containing 45 or 109 A residues was
observed.
Infectivity of LV RNA
[0054] LV, preferentially, grows in porcine alveolar macrophages.
Thus far, cell line CL2621 or other clones derived from the monkey
kidney cell line MAI 104, are cell lines which have been shown to
propagate LV (Benfield et al., 1992; Collins et al, 1992; Kim et
al., 1993). Therefore, CL2621 cells were used to determine the
optimal conditions for transfection of LV RNA.
[0055] RNA isolated from CL2621 cells infected with LV was
transfected to CL2621 cells at different doses using different
methods, such as lipofectin, lipofectamin, DEAE-dextran and
electroporation. Cells were screened for cythopathic effect and
plaques until 7 days post transfection, but these signs of
infectious virus could not be detected. In addition, no LV-specific
antigens could be detected in IPMA using LV-specific MAbs. RNA
transcribed in vitro from pABV296 was used as control in these
experiments. Plasmid pABV296 consists of the ORF4 gene encoding
GP.sub.4 inserted in expression vector pSFV1 (Meulenberg et al,
1997).
[0056] The transfection efficiency of the pABV296 RNA was tested by
staining of the transfected cells in IPMA with GP.sub.4-specific
MAbs. The highest transfection efficiency, resulting in 0.01%
positive CL2621 cells, was obtained by electroporation, whereas
80-90% positive cells were obtained using similar conditions with
BHK-21 cells.
[0057] These results indicated that CL2621 cells were not suitable
for transfection experiments, whereas the BHK-21 cells (not
susceptible to infection with wild-type virus) surprisingly
appeared very suitable. Therefore BHK-21 cells were used to test
the infectivity of LV RNA. Two mg of RNA isolated from CL2621 cells
infected with LV was transfected to approximately 10.sup.6 BHK-21
cells with lipofectin, according to the conditions described for
SFV (Liljestrom and Garoff, 1993).
[0058] Twenty-four hours after transfection, cells were stained
with LV-specific MAb 122.17 directed against the N protein of LV.
Approximately 3-10 individual cells were stained positive, but no
infectious centers or plaques suggesting cell to cell spread were
observed. Transfection of the control RNA transcribed from pABV296
resulted in 60-70% positive BHK-21 cells using these conditions.
The supernatant of the BHK-21 cells transfected with intracellular
LV RNA and pABV296 RNA were transferred to CL2621 cells.
[0059] After 3 to 4 days, plaques were observed in the cells that
were incubated with the supernatant from BHK-21 cells transfected
with intracellular LV RNA, but not in those incubated with
supernatant from BHK-21 cells transfected with pABV296 RNA. The
plaques were positively stained with LV-specific MAbs in IPMA.
Similar results were obtained when RNA isolated from purified
virions of LV was used. Furthermore, the number of positively
stained cells increased 2 to 4 fold when cells were transfected by
electroporation.
[0060] These data indicated that LV can not infect BHK-21 cells
because, most likely, they lack the receptor for LV. However, once
the genomic RNA has been introduced in BHK-21 cells, new infectious
virus particles are being produced and excreted into the medium.
Reinfection of already transfected BHK-21 cells with these
particles being naked capsids or fully or partly enveloped
particles is again not possible.
In vitro Synthesis of Infectious RNA.
[0061] Since the --to a wild-type PRRSV in essence not
susceptible--BHK-21 cells were specifically appropriate for the
rescue of virus from intracellular LV RNA and the susceptible
CL2621 cells were not, BHK-21 cells were used to test whether RNA
transcribed from the genome-length cDNA clones was infectious.
Plasmids pABV414/416 were linearized with PvuI and transcribed in
vitro using T7 RNA polymerase. The PvuI site is located directly
downstream of the poly(A) stretch, such that the transcribed RNA
contains 2 non-viral nucleotides at the 3' end (FIG. 2). In
addition, transcripts should contain a non-viral G at the 5' end,
which is the transcription start site of T7 RNA polymerase.
Approximately 2.5 mg of in vitro transcribed RNA was transfected to
BHK-21 cells, together with 2 mg intracellular LV RNA as a positive
control for subsequent virus rescue in CL2621 cells, and pABV296
RNA as a positive control for RNA transfection to BHK-21 cells and
negative control for subsequent virus rescue in CL2621 cells. At 24
hours after transfection, the supernatant of the cells was
harvested and the cells were fixed and stained in IPMA with
N-specific MAb 122.17. Whereas only a few positive cells were
observed in the wells with BHK-21 cells that were transfected with
intracellular LV RNA, 800 to 2700 positive cells were observed in
the wells with BHK-21 cells transfected with RNA transcribed from
pABV414/416. In order to check whether infectious virus was
released from the cells, the supernatants were used to infect
CL2621 cells. Plaques were produced in CL2621 cultures that were
infected with the supernatant from BHK-21 cells transfected with
intracellular LV RNA and transcripts of pABV414/415. The plaques
stained positive in IPMA with MAbs against the N, M, GP.sub.4, and
GP.sub.3 protein, suggesting that these proteins were all properly
expressed. No plaques and staining in IPMA was observed in CL2621
cultures incubated with the supernatant of BHK-21 cells transfected
with RNA transcribed from pABV296. Therefore, these results clearly
show that transfection of RNA transcribed from genome-length cDNA
clones pABV414 and pABV416 to BHK-21 cells results in the
production and release of infectious LV. Moreover, when transcripts
of pABV414 and pABV416 were transfected to BHK-21 cells by
electroporation instead of lipofectin, a two- to four fold increase
of cells staining positive with LV-specific MAbs was obtained. The
titer of the recombinant viruses in the supernatant of these
electroporated BHK-21 cells was approximately 1I05
TCID.sub.50/ml.
Growth Curves of Infectious Copy Virus Compared to Ter Huurne and
LV4.2.1
Growth Characteristics of Rescued Virus
[0062] The initial transfection and infection experiments suggested
that the rescued recombinant viruses, designated vABV414 and
vABV416, infect and grow equally well in porcine alveolar
macrophages, but grow slower on CL2621 cells than the virus rescued
from BHK-21 cells transfected with intracellular LV RNA. This
intracellular LV RNA was isolated from CL2621 cells infected with
LV4.2.1, which has been adapted for growth on CL2621. To study the
growth properties of vABV414 and vABV416 more thoroughly, growth
curves were determined in CL2621 cells and porcine alveolar
macrophages and were compared with those of wild-type LV that has
only been passaged on porcine alveolar macrophages (TH) and with
those of LV4.2.1 grown on CL2621 cells. The growth rates of the two
recombinant viruses did not differ, growing equally well regardless
of whether they were derived directly from BHK-21 or further
passaged on porcine alveolar macrophages (FIG.3). Titers (7.1-7.9
TCID.sub.50/ml) in porcine alveolar macrophages peaked around 32
hours post infection, whereas the titers in CL2621 where slower and
had not yet peaked even at 96 hours post infection. TH virus had
growth characteristics similar to the recombinants. In contrast,
the CL2621-adapted virus LV4.2.1 grew faster on CL2621 cells than
the viruses vABV414, vABV416 and TH (FIG.3). In summary, these
results demonstrate that the growth properties of the recombinant
viruses are similar to those of the TH virus. This was expected,
since the cDNA sequence used to construct the infectious clones was
derived from the parental "non-adapted" TH virus.
Introduction of a Genetic Marker in the Infectious Clone of LV
[0063] To demonstrate that the genome-length cDNA clone can be used
to generate mutant LV viruses, a unique PacI and SwaI site was
introduced directly downstream of the ORF7 gene by PCR-directed
mutagenesis (FIG. 4). When RNA transcribed from the genome-length
cDNA clone pABV437 containing the PacI site and pABV442 containing
the SwaI site was transfected to BHK-21 cells and the supernatant
was transferred to porcine alveolar macrophages and CL2621 cells at
24 hours after transfection, infectious virus was produced. The
rescued viruses, vABV437 and vABV442, had similar growth properties
in porcine alveolar macrophages and CL2621 cells as the parental
virus vABV414 (data not shown). A specific region of approximately
0.6 kb (nucleotides 14576-poly(A) tail) was amplified by reverse
transcription and PCR of viral RNA isolated from the supernatant of
porcine alveolar macrophages infected with vABV414 and vABV416.
Digestion with PacI showed that this restriction site was indeed
present in the fragment derived from vABV437 but was absent from
the fragment derived from vABV414. Similarly, the presence of SwaI
site in vABV442 was demonstrated (data not shown). Thus we were
able to exclude the possibility of contamination with wild-type
virus and therefore we confirmed the identity of vABV437 and
vABV442.
Best Mode
[0064] Modern recombinant DNA technology allows us to analyze and
modify genomes at the molecular level and thus gain deeper insight
into their organization and expression. In the case of RNA viruses,
this requires the generation of genome-length cDNA clones from
which infectious transcripts can be synthesized. In most instances,
a prerequisite for the construction of infectious clones is the
identification of the sequences at the termini of the respective
viral genome which are probably crucial for replication of viral
RNA. In a previous study, it was shown that LV contains a
poly(A)tail at the 3' end (Meulenberg et al., 1993a). In the
present work, the exact 5' end of the LV genome was determined.
Whereas several methods have been described to determine the 5' end
of viral genomic RNAs or mRNAs, but most of them have important
limitations. For flaviruses and pestiviruses, a method has been
used which is based on the circularization of genomic RNA. However,
this method needs accompanying analyses to define the border
between the 5' and 3' end of the genome. The 5' rapid amplification
of cDNA ends (5' RACE) method is based on the addition of a
homopolymeric tail with terminal deoxyribonucleotide transferase
(TdT) to the first strand cDNA strand. However, the tailing
reaction is rather inefficient and this method also requires
additional analyses since it can not be concluded whether the first
nucleotide of the tail represents the viral sequence or is already
part of the enzymatically added tail. As described above, we have
determined the utmost 5' end of the viral genome by ligation of an
oligonucleotide with a specified sequence to a first strand primer
extension product and amplification by PCR. An extension of 10
nucleotides (ATGATGTGTA) (SEQ ID NO:19) with respect to the
published sequence was found in several independent clones and were
therefore assumed to represent the utmost 5' end nucleotides of the
viral genome. Altogether, this results in a leader sequence of 221
nucleotides, which is similar in length to the leader of EAV (207
nucleotides; den Boon et al, 1991), SHFV (208 nucleotides; Zeng et
al., 1995), but longer than the leader of LDV (155 nucleotides;
Chen et al., 1994). However, no significant homology exists between
the leader sequences of these arteriviruses.
[0065] The utmost 5' end was incorporated in genome-length cDNA to
create an infectious clone. Major problems with the generation of
infectious clones concern the stability of the virus sequences when
cloned in bacteria as well as the generation of the correct 5' and
3' termini. Although initial attempts to assemble a genome-length
cDNA clone in pGEM-4Z failed, the methods and principles of the
present invention produced the 15,207 nucleotides long genomic cDNA
fragment of LV which remained stable in low copy number plasmid
pOK12. As noted above this cDNA fragment is now the longest
infectious clone of a positive RNA strand virus thus far generated.
Transcripts of the genomic-length cDNA clones contained a 5' cap
structure and an extra non-viral G at the 5' end and a nonviral CG
at the 3' end, but these extensions did not abolish their
infectivity. Several investigators have reported a reduced initial
infection of RNA transcribed from full-length cDNA clones due to
extraneous, non-authentic sequences at either the 5' or 3' ends or
to incomplete capping. Transcripts of LV full-length cDNA lacking a
cap structure were not infectious. Whereas the infectivity of
transcripts of infectious cDNA clones have always been tested in
cell lines that are susceptible to the virus, we were unable to
demonstrate the infectivity of transcripts from genome-length cDNA
clones or LV RNA isolated from CL2621 cells by transfection of
these RNAs to CL2621 cells. This was due to the poor transfection
efficiency in CL262 1 cells, whereby viral RNA strand synthesis is
probably hampered by interference or interaction with incomplete
RNA fragments or capsid proteins resulting from reinfection of the
CL2621 cells with defective interfering particles such as naked
capsids containing only fragments of the viral genome. However,
transfection of transcripts from full-length cDNA clones and
intracellular LV RNA to BHK-21 resulted in the production and
release of infectious virus which could be rescued in CL262 1
cells. Reinfection of BHK-21 cells with naked capsids does not
occur and thus does not hamper full-length viral RNA synthesis. The
specific infectivity was roughly 400-1500 positive cells per mg in
vitro transcribed RNA, whereas 2 to 5 positive cells were obtained
per mg LV intracellular RNA. However, these specific infectivities
can not be compared because only a very small fraction of the
intracellular RNA isolated from LV-infected CL2621 cells represent
genomic LV RNA. Furthermore, the amount of genomic RNA isolated
from virions which was used for transfections was too small to
allow accurate quantification.
[0066] In addition, BHK-2 1 cells were scored for antigen
production in IPMA with LV-specific MAbs, which does not
necessarily correlate with production of infectious virus. This was
clear from the fact that the supernatant of BHK-2 1 cells
transfected with 2 mg intracellular LV RNA contained a higher titer
of plaque forming units assayed on CL2621 cells than the
supernatant of BHK-21 cells transfected with 2.5 mg transcript of
full-length cDNA clones. Although it was shown previously for a
number of viruses that the length of the poly(A) tail influenced
the infectivity of the viral transcripts (Holy and Abouhaidar,
1993; Sarow, 1989), we did not observe any difference in
infectivity between transcripts from genomic cDNA clones containing
a tail of 45 or 109 residues. It might be possible that a tail of
45 A residues is above a threshold length below which stability of
the corresponding transcripts will be altered. We have found a
clone difference at amino acid 1084 in ORF1a, giving a PRO and LEU
at a ratio of 1:1. This amino acid did not have an influence on
infectivity since transcripts of full-length cDNA clones containing
this LEU or PRO codon did not display any difference in infectivity
of BHK-21 cells.
[0067] The genome-length infectious clone was used to generate a
chimeric virus expressing the nucleocapsid protein of PRRSV strain
ATCC VR2332. In addition, the genome-length infectious clone was
used to generate a chimeric virus expressing the nucleocapsid
protein of the mouse virus LDV. The chimeric viruses can be
distinguished from parental viruses with strain-specific MAbs. They
do not stain with monoclonal antibodies specifically reactive with
the N (ORF7) protein of the Ter Huurne strain of PRRSV.
Furthermore, the chimeric virus in which the PRRSV N protein is
substituted with the LDV N protein is not reactive with porcine
convalescent antibodies reactive with the PRRSV N protein. Since
all PRRSV infected pigs develop antibodies directed against the
PRRSV N protein, the chimeric viruses can be used for future
projects using new live vaccines against PRRSV, making use of this
virus as a vector system which is specifically targeted to its host
cell, the alveolar lung macrophage. In this respect, it should be
mentioned that initial attempts to confer protection with killed
virus or recombinant subunits were disappointing. The up-to-date,
only effective, vaccine against PRRS available is a modified live
vaccine based on a US strain (Gorcyca, et al., 1995). However, pigs
vaccinated with this modified live product can not be discriminated
from pigs infected with field virus. The infectious clone of PRRSV
thus provides a so-called marker vaccine by site-directed
mutagenesis of the genome, such that vaccinated pigs can be
distinguished from field virus-infected pigs on the basis of
difference in serum antibodies. A distinguishing assay can thus be
fashioned using methods known to those skilled in the art.
[0068] The infectious clone of LV, described here, is the longest
infectious clone ever developed of a positive strand RNA virus and
the first of the arterivirus family. The generation of this
infectious clone of PRRSV opens up new opportunities for studies
directed at the pathogenesis, host tropism, and replication and
transcription of this virus. Arteriviruses and coronaviruses share
a specific transcription mechanism also referred to as leader
primed transcription which involves the generation of a so-called
nested set of subgenomic RNAs containing a common 5' leader (Spaan
et. al., 1988; Plagemann and Moennig, 1991). This leader primed
transcription is a complex process which is not yet fully
understood. Studies of coronavirus virologist to elucidate the
underlying mechanism of leader-primed transcription are restricted
to analyses and site directed mutagenesis of cDNAs of defecting
interfering RNAs, since the large size of the genome (28 to 30 kb)
has impeded the construction of an infectious clone. The infectious
clone of PRRSV thus provides a model system to study and unravel
the intriguing mechanism of transcription and replication of
arteriviruses and coronaviruses.
[0069] Infectious clones derived from PRRSV can also be used as a
delivery system or vector vaccine virus for foreign antigens
inserted in the PRRSV genome because the virus infects macrophages
and macrophage-lineage cells in bone marrow and other cells of the
immune system and distribute the antigen-containing virus through
its progeny cells. In the specific instance of antigens containing
fragments of the ORF7 or N protein of Arteriviruses or PRRSV, these
antigens will be (ove)expressed at the outer side of the cell
membrane of the infected cell, thereby further enhancing the immune
response. Such immunological booster effects will cause a lifelong
(because of continuous stimulation on a low level) immunity against
pathogens. We can use the virus as an antigen carrier by building
in the information for epitopes of other pathogenic organisms or
substances. Several modified PRRS viruses carrying foreign epitopic
information may be mixed and administered at one time. This enables
active immunity against several different epitopes of one pathogen,
or active immunity against several different pathogens. Safety of
the modified PRRSV vaccines (such as non-shedding) can be ensured
by deleting the information of those viral proteins that are needed
to produce enveloped, infectious virus. This virus has to be
propagated in a cell-line that constitutively expresses that
envelope protein. Virus replicating in this complementary cell-line
has a complete envelope and is capable of infecting macrophages in
the pig. After one replication-cycle, the progeny virus, missing
the information for the envelope protein, is no longer capable of
infecting other cells as a fully enveloped virus. Infection of
macrophages in the body is still possible as naked capsid. In this
way, the vaccine will be contained to the animal that has been
vaccinated and will not spread to other animals.
References
[0070] Benfield, D. A., E. Nelson, E. Collins, J. E., Harris, L.,
Goyal, S. M., Robison, D., Christianson, W. T., Morrison, R. B.,
Gorcyca, D. E., and Chladek, D. W. (1992). Characterization of
swine infertility and respiratory syndrome virus (Isolate
ATCC-VR2332) J. Vet. Diagn. Invest. 4, 127-133.
[0071] Boyer, J., and Haenni, A. (1994) Infectious transcripts and
cDNA clones of RNA viruses. Virology, 198, 415-426.
[0072] Chen, Z., Faaberg, K. S., and Plagemann, P. G. W. (1994)
Determination of the 5' end of the lactate dehydrogenase-elevating
virus genome by two independent approaches. J. Gen. Virol. 75,
925-930.
[0073] Collins, J. E., Benfield, D. A., Christianson, W. T.,
Harris, L., Hennings, J. C., Shaw, D. P., Goyal, S. M., McCullough,
S., Morrison, R. B., Joo, H. S., Gorcyca, D. E., Chladek, D. W.
(1992). Isolation of swine infertility and respiratory syndrome
virus (Isolate ATCC-VR-2332) in North America and experimental
reproduction of the disease in gnotobiotic pigs. J of Vet. Diagn.
Invest. 4, 117-126.
[0074] Conzelmann, K. K., Visser, N., van Woensel, P., and Tiel, H.
J. (1993). Molecular characterization of porcine reproductive and
respiratory syndrome virus, a member of the Arterivirus group.
Virology 193, 329-339.
[0075] den Boon, J. A., Faaberg, K. S., Meulenberg, J. J. M.,
Wassenaar, A. L. M., Plagemann, P. G. W., Gorbalenya, A. E., and
Snijder, E. J. (1995) Processing and evolution of the N-terminal
region of the arterivirus replicase ORFla protein: identification
of two papainlike cysteine proteases. J. Virol. 69: 4500-4505.
[0076] Davis, N. L., Willis, L. V., Smith, J. F., and Johnston, R.
E. (1989). In vitro synthesis of infectious Venezuelan equine
encephalitis virus RNA of an insect virus. Proc. Natl. Acad. Sci.
USA 83, 63-66.
[0077] Deng, R., and Wu, R. (1981). An improved procedure for
utilizing terminal transferase to add homopolymers to the 3'
termini of DNA. Nucleic Acids Res. 9, 4173-4188.
[0078] Edwards, J. B .D. M., Delort, J., and Mallet, J. (1991)
Oligodeoxyribonucleotide ligation to single-stranded cDNAs; A new
tool for cloning 5' ends of mRNAs and for contructing cDNA
libraries by in vitro amplification. Nucleic Acids Res. 19,
5227-5232.
[0079] Gorcyca, D., Schlesinger, K., Chladek, D., et al., (1995)
Proc. Am. Assoc. of Swine Pract., Ohama, NE, 1-22.
[0080] Holy, S., and Abouhaidar, M. G. (1993). Production of
infectious in vitro transcripts from a full-length clover yellow
mosaic virus cDNA clone. J. Gen. Virol., 74, 781-784.
[0081] Kim, H. S., Kwang, J., and Yoon, I. Y. (1993). Enhanced
replication of porcine reproductive and respiratory syndrome virus
in a homogeneous subpopulation of MA- 104 cell line. Arch. Virol.
133, 477-483.
[0082] Klump, W. M., Bergmann, I., Muller, B. C., Ameis, D., and
Kandolf, R. (1990) Complete nucleotide sequence of infectious
coxsackie-virus B3 cDNA: Two initial 5' uridine residues are
regained during plus-strand RNA synthesis. J. Virol. 64,
1573-1583.
[0083] Lai, C. J., Zhao, B., Hori, H., and Bray, M. (1991)
Infectious RNA transcribed from stably cloned full-length cDNA of
dengue type 4 virus. Proc. Natl. Acad. Sci. USA 88, 5139-5143.
[0084] Liljestrom, P. and Garoff, H. (1991). A new generation of
animal cell expression vectors based on the Semliki Forest virus
replicon. Biotechnol. 9, 1356-1361.
[0085] Liljestrom, P., and Garoff, H. (1993) Expression of proteins
using Semliki Forest virus vectors, p. 16.xx. 1-16.xx.00 In:
Current protocols in Molecular Biology, F. M. Ausubel, R. Brent, R.
E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman and K. Struhl
(Eds.). Greene Publishing associates and Wiley interscience, New
York.
[0086] Meulenberg, J. J. M., Hulst, M. M., de Meijer, E. J.,
Moonen, P. L. J. M., den Besten, A., de Kluyver, E. P., Wensvoort,
G., and Moormann, R. J. M. (1993a). Lelystad virus, the causative
agent of porcine epidemic abortion and respiratory syndrome (PEARS)
is related to LDV and EAV. Virology 192, 62-74.
[0087] Meulenberg, J. J. M., de Meijer, E. J., and Moormann, R. J.
M. (1993b). Subgenomic RNAs of Lelystad virus contain a conserved
junction sequence. J. of Gen. Virol. 74, 1697-1701.
[0088] Meulenberg, J. J. M., Petersen-den Besten, A., de Kluyver,
E. P., Moormann, R. J. M., Wensvoort, G (1995). Characterization of
proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology 206,
155-163.
[0089] Meulenberg, J. J. M., and Petersen-den Besten (1996)
Identification and characterization of a sixth structural protein
of Lelystad virus: The glycoprotein GP.sub.2 encoded by ORF2 is
incorporated in virus particles. Virology, in press.
[0090] Meulenberg et al., 1997
[0091] Murtaugh, M. P., Elam, M. R., and Kakach (1995) Comparison
of the structural protein coding sequences of the VR-23 32 and
Lelystad virus strains of the PRRS virus. Arch. Virol., 140,
1451-1460.
[0092] Nelson, E. A., Christopher-Hennings, J., Drew, T.,
Wensvoort, G., Collins, J. E., and * w Benfield, D. A. (1993).
Differentiation of United states and European isolates of porcine
reproductive and respiratory syndrome virus by monoclonal
antibodies. J. of Clin. Microbiol. 31, 3184-3189.
[0093] Plagemann, P. G. W., and Moennig, V. (1991). Lactate
dehydrogenase-elevating virus, equine arteritis virus, and simian
hemorrhagic fever virus: a new group of positive-strand RNA
viruses. Adv. in Virus Res. 41, 99-192.
[0094] Rice, C. M., Levis, R., Strauss, J. H., and Huang, H. V.
(1987). Production of infectious RNA transcripts from Sindbis virus
cDNA clones: mapping of lethal mutations, rescue of a
temperature-sensitive marker, and in vitro mutagenesis to generate
defined mutants. J. Virol., 61, 3809-3819.
[0095] Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989).
Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Lab.,
Cold Spring Harbor, N.Y.
[0096] Sarnow, P. (1989) Role of 3' end sequences in infectivity of
polio-virus transcripts made in vitro. J. Virol., 63, 467-470.
[0097] Snijder, E. J., and Horzinek, M. C. (1993). Toroviruses:
replication, evolution and comparison with other members of the
coronavirus-like superfamily. J. Gen. Virol., 74, 2305-2316.
[0098] Spaan, W. J. M., Cavanagh, D., and Horzinek, M. C. (1988)
Coronaviruses: Structure and genome expression. J. Gen. Virol. 69,
2939-2952.
[0099] Sumiyoshi, H., Hoke, C. H., and Trent, D. W. (1992).
Infectious Japanese encephalitis virus RNA can be synthesized from
in vitro-ligated cDNA templates. J. Virol., 66, 5425-5431.
[0100] van Nieuwstadt, A. P., Meulenberg, J. J. M., van
Essen-Zandbergen, A., Petersen-den Besten, A., Bende, R. J.,
Moormann, R. J. M., and Wensvoort, G. (1996). Proteins encoded by
ORFs 3 and 4 of the genome of Lelystad virus (Arteriviridae) are
structural proteins of the virion. J. Virol., 70, 4767-4772.
[0101] Viera, J., and Messing, J. (1991) New pUC-derived cloning
vectors with different selectable markers and DNA replication
origins. Gene, 100, 189-194.
[0102] Wensvoort, G., de Kluyver, E. P., Luijtze, E. A., de Besten,
A., Harris, L., Collins, J. E., Christianson, W. T., and Chladek,
D. (1992) Antigenic comparison of Lelystad virus and swine
infertility ans respiratory (SIRS) virus. J Vet. Diagn. Invest. 4,
134-138.
[0103] Wensvoort, G., Terpstra, C., Boonstra, J., Bloemraad, M.,
and Van Zaane, D. (1986) Production of monoclonal antibodies
against swine fever virus and their use in laboratory diagnosis.
Vet. Microbiol. 12, 101-108.
[0104] Wensvoort, G., Terpstra, C., Pol, J. M. A., Ter Laak, E. A.,
Bloemraad, M., de Kluyver, E. P., Kragten, C., van Buiten, L., den
Besten, A., Wagenaar, F., Broekhuijsen, J. M., Moonen, P. L. J. M.,
Zetstra, T., de Boer, E. A., Tibben, H. J., de Jong, M. F., van't
Veld, P., Groenland, G. J. R., van Gennep, J. A., Voets, M. Th.,
Verheijden, J. H. M., and Braamskamp, J. (1991). Mystery swine
disease in the Netherlands: the isolation of Lelystad virus. Vet.
Quart. 13, 121-130.
[0105] Zeng, L., Godeny, E. K., Methven, S. L., and Brinton, M. A.
(1995) Analysis of simian hemorrhagic fever virus (SHFV) subgenomic
RNAs, junction sequences and 5' leader. Virology 207, 543-548.
3TABLE 1 Nucleotide sequence of 5' end clones of LV. Sequence 1 No.
of clones ATGATGTGTAGGG..... 22 TGATGTGTAGGG..... 1
GATGTGTAGGG..... 2 ATGTGTAGGG..... 1 1) The underlined nucleotides
represent additional sequences that were not found in cDNA clones
isolated and sequenced previously (Meulenberg et al., 1993a).
[0106]
Sequence CWU 1
1
23 1 20 DNA Lelystad virus primer_bind (1)..(20) /note="Primer
11U113" 1 tacaggtgcc tgatccaaga 20 2 30 DNA Lelystad virus
primer_bind (1)..(30) /note="Anchor primer ALG3" 2 cacgaattca
ctatcgattc tggatccttc 30 3 31 DNA Lelystad virus primer_bind
(1)..(31) /note="Primer LV69" 3 aggtcgtcga cgggccccgt gatcgggtac c
31 4 20 DNA Lelystad virus primer_bind (1)..(20) /note="Primer
ALG4" 4 gaaggatcca gaatcgatag 20 5 22 DNA Lelystad virus
primer_bind (1)..(22) /note="Primer LV76" 5 tctaggaatt ctagacgatc
gt 22 6 22 DNA Lelystad virus primer_bind (1)..(22) /note="Primer
LV75" 6 tctaggaatt ctagacgatc gt 22 7 20 DNA Lelystad virus
primer_bind (1)..(20) /note="Sense primer 39U7OR" 7 ggagtggtta
acctcgtcaa 20 8 33 DNA Lelystad virus primer_bind (1)..(33)
/note="Sense primer LV59" 8 tcggaatcta gatctcacgt ggtgcagctg ctg 33
9 20 DNA Lelystad virus primer_bind (1)..(20) /note="Antisense
primer 61U303" 9 catcaacacc tgtgcagacc 20 10 20 DNA Lelystad virus
primer_bind (1)..(20) /note="Sense primer 61U526R" 10 ttccttctct
ggcgcatgat 20 11 30 DNA Lelystad virus primer_bind (1)..(30)
/note="Primer LV60" 11 gtactggtac cggatccgtg aggatgttgc 30 12 49
DNA Lelystad virus primer_bind (1)..(49) /note="Primer LV83" 12
gaattcacta gttaatacga ctcactatag atgatgtgta gggtattcc 49 13 44 DNA
Lelystad virus primer_bind (1)..(44) /note="Sense primer LV108" 13
ggagtggtta acctcgtcaa gtatggccgg taaaaaccag agcc 44 14 36 DNA
Lelystad virus primer_bind (1)..(36) /note="Antisense primer LV112"
14 ccattcacct gactgtttaa ttaacttgca ccctga 36 15 36 DNA Lelystad
virus primer_bind (1)..(36) /note="Sense primer LV111" 15
tcagggtgca agttaattaa acagtcaggt gaatgg 36 16 30 DNA Lelystad virus
primer_bind (1)..(30) /note="Primer LV110" 16 cctgactgtc aatttaaatt
gcaccctgac 30 17 30 DNA Lelystad virus primer_bind (1)..(30)
/note="Primer LV109" 17 gtcagggtgc aatttaaatt gacagtcagg 30 18 10
DNA Lelystad virus primer_bind (1)..(10) /note="5' prime end of the
genome" 18 atgatgtgta 10 19 37 DNA Lelystad virus primer_bind
(1)..(37) /note="5' end" 19 taatacgact cactatagat gatgtgtagg
gtattcc 37 20 121 DNA Lelystad virus primer_bind (1)..(121)
/note="3'end" 20 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 60 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaac gatcgtctag 120 a 121 21 6 DNA Lelystad virus
primer_bind (1)..(6) /note="Reverse 3' end" 21 cgatcg 6 22 19 RNA
Lelystad virus primer_bind (1)..(19) /note="5' end" 22 augaugugua
ggguauucc 19 23 111 RNA Lelystad virus primer_bind (1)..(111)
/note="3' end" 23 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 60 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaac g 111
* * * * *