U.S. patent application number 08/981354 was filed with the patent office on 2002-07-25 for recombinant adenoviruses containing an inducible promoter controlling a gene of viral origin.
This patent application is currently assigned to Rhone-Poulenc S.A.. Invention is credited to LATTA, MARTINE, ORSINI, CECILE, PERRICAUDET, MICHEL, PROST, EDOUARD, VIGNE, EMMANUELLE, YEH, PATRICE.
Application Number | 20020098165 08/981354 |
Document ID | / |
Family ID | 9480335 |
Filed Date | 2002-07-25 |
United States Patent
Application |
20020098165 |
Kind Code |
A1 |
PERRICAUDET, MICHEL ; et
al. |
July 25, 2002 |
RECOMBINANT ADENOVIRUSES CONTAINING AN INDUCIBLE PROMOTER
CONTROLLING A GENE OF VIRAL ORIGIN
Abstract
A recombinant adenovirus in which the expression of a nucleic
acid sequence coding for at least one homologous or heterologous
gene of viral origin is placed under the control of an inducible
promoter, is disclosed. The use of such recombinant adenoviruses
for preparing AAVs, and a complementary cell line and preparation
method therefor, are also disclosed. Furthermore, pharmaceutical
compositions containing such an adenovirus are disclosed.
Inventors: |
PERRICAUDET, MICHEL;
(ECROSNES, FR) ; LATTA, MARTINE; (CHARENTON LE
PONT, FR) ; PROST, EDOUARD; (SUCY EN BRIE, FR)
; YEH, PATRICE; (PARIS, FR) ; ORSINI, CECILE;
(PARIS, FR) ; VIGNE, EMMANUELLE; (IVRY SUR SEINE,
FR) |
Correspondence
Address: |
WILEY, REIN & FIELDING, LLP
ATTN: PATENT ADMINISTRATION
1776 K. STREET N.W.
WASHINGTON
DC
20006
US
|
Assignee: |
Rhone-Poulenc S.A.
|
Family ID: |
9480335 |
Appl. No.: |
08/981354 |
Filed: |
December 19, 1997 |
PCT Filed: |
June 20, 1996 |
PCT NO: |
PCT/FR96/00968 |
Current U.S.
Class: |
424/93.1 ;
424/93.2; 424/93.6; 435/320.1; 435/455; 435/456; 536/23.2;
536/24.1 |
Current CPC
Class: |
C12N 2710/16622
20130101; C12N 2750/14143 20130101; C12N 2830/003 20130101; C12N
15/86 20130101; C12N 15/63 20130101; C12N 2830/15 20130101; C12N
2710/10344 20130101; C12N 2750/14122 20130101; C12N 2710/10343
20130101 |
Class at
Publication: |
424/93.1 ;
424/93.2; 424/93.6; 435/320.1; 435/455; 435/456; 536/23.2;
536/24.1 |
International
Class: |
A61K 048/00; C12N
015/63; C07H 021/04; C12N 015/861; C12N 005/10 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 23, 1995 |
FR |
FR95/07570 |
Claims
1. Recombinant adenovirus in which the expression of at least one
homologous or heterologous gene of viral origin is placed under the
control of an inducible promoter.
2. Recombinant adenovirus according to claim 1, characterized in
that the inducible promoter is chosen from promoters responding to
heavy metals, to thermal shocks, to hormones or to
tetracycline.
3. Adenovirus according to claim 1 or 2, characterized in that the
promoter in question is a promoter which is inducible with
tetracycline or one of its analogues.
4. Adenovirus according to claim 3, characterized in that the
tetracycline-inducible promoter comprises a minimal promoter linked
operationally to a regulatory sequence comprising at least one
tetracycline operator.
5. Adenovirus according to claim 4, characterized in that the
regulatory sequence comprises at least two tetracycline
operators.
6. Adenovirus according to claim 4 or 5, characterized in that the
regulatory sequence is represented wholly or partially by SEQ ID
No. 3, SEQ ID No. 4 or one of their derivatives.
7. Recombinant adenovirus according to one of claims 4 to 6,
characterized in that the minimal promoter is derived from human
CMV.
8. Recombinant adenovirus according to one of claims 4 to 7,
characterized in that the minimal promoter corresponds to the
region lying between nucleotides +75 and -53 or +75 and -31 of the
human CMV promoter.
9. Recombinant adenovirus according to one of claims 4 to 6,
characterized in that the promoter is a promoter, homologous or
heterologous to the viral gene, mutated so as to be incapable of
procuring on its own the transcription of the gene of viral origin
which it controls.
10. Adenovirus according to claim 9, characterized in that the
minimal promoter is derived from a promoter homologous to the viral
gene in question.
11. Adenovirus according to claim 9, characterized in that the
minimal promoter is derived from the thymidine kinase promoter of
herpes simplex virus.
12. Adenovirus according to claim 11, characterized in that the
minimal promoter is represented wholly or partially by SEQ ID No.
1, SEQ ID No. 2 or one of their derivatives.
13. Adenovirus according to one of claims 4 to 12, characterized in
that the minimal promoter is placed upstream of the viral gene to
be transcribed, as a replacement or otherwise for its own
promoter.
14. Adenovirus according to one of claims 4 to 13, characterized in
that it comprises, besides the said minimal promoter, the promoter
belonging to the viral gene in question, but in an inactivated or
non-functional form.
15. Adenovirus according to one of claims 4 to 14, characterized in
that the regulatory sequence is placed upstream of the minimal
promoter.
16. Adenovirus according to one of claims 4 to 14, characterized in
that the regulatory sequence is placed downstream of the viral gene
in question.
17. Adenovirus according to claim 16, characterized in that the
regulatory sequence is bound directly or otherwise to the viral
gene in question.
18. Adenovirus according to one of the preceding claims,
characterized in that the inducible promoter is represented by
Op.sub.2/Tk.
19. Adenovirus according to one of claims 1 to 6 or 9 to 18,
characterized in that the inducible promoter is represented wholly
or partially by SEQ ID No. 5 or one of its derivatives.
20. Recombinant adenovirus according to one of the preceding
claims, comprising at least one homologous gene whose expression is
placed under the control of an inducible promoter.
21. Recombinant adenovirus according to one of the preceding
claims, comprising at least one homologous gene whose expression is
placed under the control of a promoter which is inducible with
tetracycline or one of its analogues.
22. Recombinant adenovirus according to claim 20 or 21,
characterized in that the gene or genes in question is/are all or
part of a genomic region of the said adenovirus which is essential
for its replication and/or propagation.
23. Recombinant adenovirus according to claim 22, characterized in
that the region essential for its replication and/or propagation is
chosen from all or part of the E4, E2 region, the IVa2 region
and/or the L5 region.
24. Recombinant adenovirus according to claim 23, characterized in
that the E2 region is represented by a fragment chosen from the
fragments corresponding to the 72K cDNA, the 140K polymerase cDNA
and the 87K pre-terminal protein cDNA.
25. Recombinant adenovirus according to claim 23, characterized in
that the E4 region is represented by the Taq1-Bgl2 fragment
corresponding to nucleotides 35576-32490.
26. Recombinant adenovirus according to claim 23, characterized in
that the E4 region is represented by at least the coding frame
ORF6.
27. Recombinant adenovirus according to claim 23 or 25,
characterized in that the E4 region is represented by the Bgl2
fragment lying between positions 34115 and 32490 containing the
sequences of ORF6 and ORF7.
28. Recombinant adenovirus according to claim 23, characterized in
that the region coding for IVa2 consists of a fragment chosen from
the BglII-NruI fragment comprising nucleotides 3328 to 6316, the
DraI-NlaIII fragment corresponding to nucleotides 4029 to 5719 and
the DraI-XhoI fragment corresponding to the fragment 4029 to 5788,
on the Ad5 adenovirus sequence.
29. Recombinant adenovirus according to one of claims 1 to 23 and
25 to 27, characterized in that it carries a deletion of all or
part of the E1 gene and possesses the E4 region, wholly or
partially, under the control of an Op.sub.2/Tk inducible
promoter.
30. Recombinant adenovirus according to one of claims 1 to 24,
characterized in that it carries a deletion of all or part of the
E1 gene and possesses the E2 region, wholly or partially, under the
control of an Op.sub.2/Tk inducible promoter.
31. Recombinant adenovirus according to one of claims 1 to 27 and
29, characterized in that it carries a deletion of all or part of
the E1 and E2 genes and possesses the E4 region, wholly or
partially, under the control of an Op.sub.2/Tk inducible
promoter.
32. Recombinant adenovirus according to one of claims 1 to 27 and
30, characterized in that it carries a deletion of all or part of
the E1 and E4 genes and possesses the E2 region, wholly or
partially, under the control of an Op.sub.2/Tk inducible
promoter.
33. Recombinant adenovirus according to one of claims 20 to 32,
characterized in that the region placed under the control of an
Op.sub.2/Tk promoter lacks its own promoter.
34. Recombinant adenovirus according to one of claims 20 to 33,
characterized in that it contains, in addition, a nucleic acid
sequence coding for one or more therapeutic genes.
35. Recombinant adenovirus according to claim 34, characterized in
that the said nucleic acid sequence is present in the E1, E3 or E4
region, in addition to or as a replacement for deleted
sequences.
36. Recombinant adenovirus according to one of claims 1 to 19,
comprising at least one heterologous gene of viral origin whose
expression is placed under the control of an inducible
promoter.
37. Recombinant adenovirus according to one of claims 1 to 19 and
36, comprising at least one heterologous gene of viral origin whose
expression is placed under the control of a promoter which is
inducible with tetracycline or one of its analogues.
38. Recombinant adenovirus according to claim 36 or 37,
characterized in that the gene is or is derived from a gene of the
genome of an adeno-associated virus (AAV) or one of its functional
homologues.
39. Recombinant adenovirus according to claim 38, characterized in
that the gene in question is a gene representing the encapsidation
functions of an adeno-associated virus (AAV).
40. Recombinant adenovirus according to one of claims 36 to 39,
characterized in that it comprises the expression of the AAV rep
and/or cap genes or one of their homologues under the control of an
inducible promoter.
41. Recombinant adenovirus according to one of claims 36 to 40,
characterized in that it carries an Op2/Tk-rep-cap expression
cassette.
42. Recombinant adenovirus according to claim 41, characterized in
that the Op.sub.2/Tk promoter replaces the original p5
promoter.
43. Recombinant adenovirus according to one of claims 36 to 42,
characterized in that the heterologous gene of viral origin and the
inducible promoter are present in the E1 region of the genome of
the said adenovirus, in addition to or as a replacement for deleted
sequences.
44. Recombinant adenovirus according to one of the preceding
claims, characterized in that it comprises its ITRs and a sequence
permitting encapsidation.
45. Recombinant adenovirus according to one of the preceding
claims, in which at least the E1 region is non-functional.
46. Recombinant adenovirus according to one of the preceding
claims, characterized in that the adenovirus genome is of human,
animal or mixed origin.
47. Recombinant adenovirus according to claim 46, characterized in
that the adenoviruses of human origin are chosen from those
classified in group C, preferably from adenoviruses type 2 or 5
(Ad2 or Ad5).
48. Recombinant adenovirus according to claim 47, characterized in
that the adenoviruses of animal origin are chosen from adenoviruses
of canine, bovine, murine, ovine, porcine, avian and simian
origin.
49. Use of a recombinant adenovirus comprising at least one gene of
AAV origin under the control of a tetracycline-inducible promoter
for the preparation of AAV.
50. Method for preparing AAV, characterized in that it comprises
the cotransfection, in the presence of tetracycline or one of its
analogues, of a cell line comprising in its genome the cassette for
the expression of a transcription activator, with an adenovirus
comprising at least one gene of AAV origin under the control of a
tetracycline-inducible promoter, and either a recombinant virus
derived from the AAV or an encapsidation plasmid carrying a
transgene between the ITRs of the AAV.
51. Method according to claim 50, characterized in that the
adenovirus comprises the rep and cap genes under the control of a
tetracycline-inducible promoter.
52. Method according to claim 50 or 51, characterized in that the
production of AAV is induced by the presence of a sufficient amount
of tetracycline or one of its analogues.
53. Method according to one of claims 50 to 52, characterized in
that the transformed cell line is derived from line 293.
54. Method according to claim 53, characterized in that the cell
line in question is a cell line 293 containing in its genome the
cassette for the expression of a transcription activator consisting
of a first polypeptide capable of binding, in the presence of
tetracycline or one of its analogues, to the regulatory sequence of
the inducible promoter present in the adenovirus, combined with a
second polypeptide which activates transcription.
55. Method according to claim 54, characterized in that the first
polypeptide is a wild-type tetracycline repressor mutated so as to
endow it with the capacity to bind to the regulatory sequence of
the said inducible promoter only in the presence of tetracycline or
one of its analogues.
56. Method according to claim 55, characterized in that the
mutation is a deletion, substitution and/or deletion of at least
one amino acid of the sequence coding for a wild-type tetracycline
repressor.
57. Method according to claim 55 or 56, characterized in that the
mutated tetracycline repressor is the wild-type repressor Tn10
mutated in at least one of its amino acids localized at position
71, 95, 101 or 102.
58. Method according to one of claims 54 to 57, characterized in
that the repressor in question is the tetracycline repressor shown
wholly or partially as SEQ ID No. 8.
59. Method according to one of claims 54 to 58, characterized in
that the second polypeptide comprises the transcription activation
domain of a protein.
60. Method according to claim 59, characterized in that the protein
in question is the virion protein 16, VP16, of HSV.
61. Method according to one of claims 50 to 60, characterized in
that the cassette for the expression of the said transcription
activator comprises a promoter which is inducible with tetracycline
or one of its analogues.
62. Method according to one of claims 50 to 61, characterized in
that it employs a cell line 293 integrating in its genome the
Op.sub.2/Tk-TetR-VP16 expression cassette.
63. Cell line, characterized in that it is a line 293 integrating
in its genome a cassette for the expression of a transcription
activator as defined in claims 54 to 60.
64. Cell line according to claim 63, characterized in that it
integrates in its genome the Op.sub.2/Tk-TetR-VP16 expression
cassette.
65. Use of a cell line according to claim 63 or 64 for producing
adenoviruses or AAVs.
66. Method for producing adenoviruses according to one of claims 1
to 35, characterized in that it comprises the cotransfection of a
cell line carrying in trans the functions necessary for
complementation of the adenovirus and a transcription activator as
defined in claim 54 to 60. a first DNA comprising the left-hand
portion of the genome of the said adenovirus, possessing a deletion
in the E1 region, and a second DNA comprising at least the
right-hand portion of the genome of the said adenovirus, possessing
at least one region essential for its replication under the control
of a tetracycline-inducible promoter, and a portion common to that
of the first DNA, in the presence of tetracycline or one of its
analogues, and the adenoviruses produced by recombination are
recovered.
67. Method according to claim 66, characterized in that the first
or the second DNA carries, in addition, a heterologous DNA sequence
of interest.
68. Pharmaceutical composition comprising at least one recombinant
adenovirus according to one of claims 1 to 35.
69. Pharmaceutical composition according to claim 68, comprising a
vehicle which is pharmaceutically acceptable for an injectable
formulation.
70. Tetracycline-inducible promoter, characterized in that it is
Op.sub.2/Tk.
71. Promoter according to claim 70, characterized in that the
Op.sub.2/Tk sequence is represented wholly or partially by SEQ ID
No. 5.
Description
[0001] The present invention relates to new viral vectors, to their
preparation and to their uses. It also relates to pharmaceutical
compositions containing the said viral vectors.
[0002] Gene therapy consists in correcting a deficiency or an
abnormality (mutation, aberrant expressions, and the like) by
introducing genetic information into the cell or organ affected.
This genetic information may be introduced either in vitro into a
cell extracted from the organ, the modified cell then being
reintroduced into the body, or directly in vivo into the
appropriate tissue. In this second case, different techniques
exist, including various techniques of transfection involving
complexes of DNA and DEAE-dextran (Pagano et al., J. Virol. 1
(1967) 891), of DNA and nuclear proteins (Kaneda et al., Science
243 (1989) 375) and of DNA and lipids (Felgner et al., PNAS 84
(1987) 7413), the use of liposomes (Fraley et al., J. Biol. Chem.
255 (1980) 10431), and the like.
[0003] More recently, the use of viruses as vectors for gene
transfer has been seen to be a promising alternative to these
physical transfection techniques. In this connection, different
viruses have been tested for their capacity to infect certain cell
populations. This applies especially to retroviruses (RSV, HMS,
MMS, and the like), the HSV virus, adeno-associated viruses and
adenoviruses.
[0004] As regards adenoviruses more especially, the latter are
linear double-stranded DNA viruses approximately 36 kb in size.
Their genome comprises, in particular, an inverted sequence (ITR)
at each end, an encapsidation sequence, early genes and late genes
(see FIG. 1). The main early genes are contained in the E1, E2, E3
and E4 regions. Among them, the genes contained in the E1 region
(E1a and E1b, in particular) are necessary for viral replication.
The E4 and L5 regions, for example, are involved in viral
propagation, and the main late genes are contained in the L1 to L5
regions. The Ad5 adenovirus genome has been sequenced completely
and is available on a database (see, in particular, Genebank
M73260). Similarly, portions, or in some cases the whole, of the
genome of adenoviruses of different serotypes (Ad2, Ad7, Ad12, and
the like) have also been sequenced. These viral vectors
advantageously display a fairly broad host range, are capable of
infecting quiescent cells, do not integrate in the genome of the
infected cell and have not been hitherto associated with
significant pathologies in man. In view of their properties, they
have already been used for gene transfer in vivo. To this end,
different vectors derived from adenoviruses have been prepared,
incorporating different genes (.beta.-gal, OTC, .alpha..sub.1-AT,
cytokines, and the like).
[0005] Naturally, all of these viral vectors contain numerous viral
genes whose expression is, on the other hand, not desirable in gene
therapy. It is essential to control in vivo the non-expression of
wild-type viral genes and/or of proteins which are derived
therefrom and which are liable to induce an immune and/or
inflammatory response which is undesirable or even thoroughly
deleterious with respect to the body being treated.
[0006] For these purposes, the viral vector constructions currently
proposed are modified so as to render the said vectors incapable of
replicating autonomously in the target cell. They are said to be
defective. Generally, the genome of defective viruses hence lacks
at least the sequences necessary for replication of the said virus
in the infected cell. These regions may be either removed (wholly
or partially), or rendered non-functional, or replaced by other
sequences, and in particular by a sequence coding for a molecule of
therapeutic interest. Preferably, the defective virus nevertheless
retains the sequences of its genome which are necessary for
encapsidation of the viral particles.
[0007] In the particular case of recombinant adenoviruses, the
constructions described in the prior art are generally adenoviruses
from which the E1 (E1a and/or E1b) and possibly E3 regions have
been deleted, in which regions the heterologous DNA sequences are
inserted (Levrero et al., Gene 101 (1991) 195; Gosh-Choudhury et
al., Gene 50 (1986) 161). Other constructions contain a deletion in
the E1 region and of a non-essential portion of the E4 region (WO
94/12649). These defective recombinant adenoviruses may be prepared
in different ways, employing or otherwise a competent cell line
capable of complementing all the defective functions essential for
replication of the recombinant adenovirus. At the present time, the
vectors derived from adenoviruses are generally produced in a
complementation line (line 293) in which a portion of the
adenovirus genome has been integrated. More specifically, line 293
contains the left-hand end (approximately 11-12%) of the adenovirus
serotype 5 (Ad5) genome, comprising the left-hand ITR, the
encapsidation region and the E1 region, including E1a, E1b and a
portion of the region coding for the pIX protein. This line is
capable of trans-complementing recombinant adenoviruses which are
defective for the E1 region, that is to say lacking all or part of
the E1 region, necessary for replication.
[0008] However, during the production of these defective viral
vectors, it is not possible to rule out completely the possibility
of recombinations generating replicative viral particles, or in
vivo trans-complementations by E1 type cellular functions. It is
obvious that this type of event is completely incompatible with
their subsequent use in gene therapy. The presence in vivo of
replicative viral particles may have highly deleterious
consequences, such as, for example, the induction of a viral
propagation and production of an uncontrolled dissemination with
risks of inflammatory reaction, recombination, and the like.
[0009] Concomitantly, it is essential to prevent in vivo the
expression of corresponding viral proteins. Although the latter do
not necessarily display a toxic character with respect to the cell,
they are also highly undesirable since they are also liable to
induce immune system responses of the inflammation type and/or
fevers which are detrimental to the body being treated (D. Y.
Schwarz, (1995), P.N.A.S. 92, 1401-1405; J. F. Engelhardt, (1994),
Human Gene Therapy, 5, 1217-1229 and (1994) P.N.A.S. 91, 6196-6200;
Y. Yang, (1994), Immunity, 1, 433-442, (1995) J; Virol., 69,
2004-2015 and Nature Genetics, (1994) 7, 362-369).
[0010] The objective of the present invention is specifically to
provide an approach enabling these drawbacks to be remedied, and
the invention proves most especially useful for preparing batches
of adenovirus type viruses displaying enhanced safety since, in
particular, they lack replicative viral particles.
[0011] Unexpectedly, the Applicant demonstrated that it was
possible, using a novel promoter system, to control effectively the
expression of viral gene, which expression is effective in vitro
during viral production but, on the other hand, subsequently
ineffective in vivo when the said recombinant viruses are used
therapeutically.
[0012] More specifically, the present invention relates to a
recombinant adenovirus in which the expression of at least one
homologous or heterologous gene of viral origin is controlled by an
inducible promoter.
[0013] For the purposes of the present invention, inducible
promoter is understood to mean any promoter whose activity is
initiated by the presence of an external chemical and/or biological
agent, which agent, in the context of the present invention,
displays, in addition, low or even zero toxicity. "External" is
understood to mean that the chemical and/or biological agent does
not naturally exist in the cells treated with the claimed
adenovirus.
[0014] As inducible promoters capable of being employed according
to the present invention, traditional promoters such as those
responding to heavy metals (CRC Boca Raton, Fla. (1991), 167-220;
Brinster et al. Nature (1982), 296, 39-42), to thermal shocks, to
hormones (Lee et al. P.N.A.S. USA (1988), 85, 1204-1208; (1981),
294, 228-232; Klock et al. Nature (1987), 329, 734-736; Isral and
Kaufman, Nucleic Acids Res. (1989), 17, 2589-2604) or to chemical
agents of the glucose, lactose, galactose or antibiotic type may be
mentioned in particular.
[0015] Very recently, a tetracycline-inducible promoter which is
especially advantageous in the context of the present invention has
been described.
[0016] This promoter, termed tetracycline-inducible promoter,
comprises a minimal promoter linked operationally to one or more
tetracycline operator(s). The binding of a so-called "transcription
activator" protein to the tetracycline operator sequences, which
binding is established only in the presence of tetracycline or one
of its analogues, is the event which permits the activation of the
minimal promoter and hence the transcription of the associated
viral gene or genes.
[0017] As regards, more especially, the so-called transcription
activator protein, this is hence characterized by its ability to
bind, in the presence of tetracycline, to the operator sequences of
the tetracycline-inducible promoter, and its capacity to activate
the minimal promoter. More preferably, the protein in question
consists of two polypeptides, a first polypeptide which binds to
the tet operator sequences in the presence of tetracycline or an
analogue of the latter, and a second polypeptide whose function is
more specifically to activate the said transcription. The first
polypeptide of the so-called transcription activator protein is a
tetracycline repressor mutated so as to manifest a behaviour
opposite to that of a wild-type repressor, that is to say it binds
to the tet operator sequences only in the presence and not in the
absence of tetracycline. As regards the second polypeptide, this is
preferably the activation domain of herpes simplex virus protein
16.
[0018] In the case where the inducible promoter used is, for
example, inducible with glucose or galactose, it is possible to
envisage employing a transcription activator constructed on this
model, that is to say, for example, Glu-VP16 or Gal4-VP16.
[0019] According to a preferred embodiment of the invention, the
inducible promoter employed is a promoter which is inducible with
tetracycline or one of its analogues, as described above.
[0020] For the purposes of the present invention, a
tetracycline-inducible promoter comprises a minimal promoter linked
operationally to a so-called regulatory sequence comprising at
least one operator for tetracycline, "tet operator", or for one of
its analogues.
[0021] Tetracycline analogue is understood to cover any compound
displaying structural homologies with tetracycline and which is
capable of binding to its receptor bound to the trans-activation
domain of the so-called transcription activator protein presented
above, with a Ka of at least approximately 10.sup.6 M.sup.-1. As
analogues capable of being used according to the present invention,
doxycycline, chlorotetracycline and anhydrotetracycline may be
mentioned in particular.
[0022] Minimal promoter is understood to denote any promoter
sequence which, on its own, is not capable of effectively procuring
the transcription of the DNA sequence which is associated with it.
The activity of such a promoter proves to be completely dependent
on the binding of the transcription activator protein to the
so-called regulatory sequence in the presence of tetracycline. In
fact, this minimal promoter has above all the function of orienting
the transcription. From this standpoint, it is preferably located
upstream of the viral sequence so as to form a continuous
nucleotide sequence with the latter.
[0023] This minimal promoter may be derived from the human
cytomegalovirus immediate-early promoter, and more preferably lies
between nucleotides +75 and -53 or +75 and -31. However, it is also
possible to employ, according to the invention, a minimal promoter
derived from a conventional promoter such as, for example, the one
that activates the transcription of the gene coding for thymidine
kinase.
[0024] A conventional promoter may also be rendered minimal by
means of one or more genetic mutations which render it incapable of
effectively procuring on its own the transcription of the gene
which is associated with it. A minimal promoter derived directly
from the promoter naturally responsible for the expression of the
viral gene in question may also be employed in the context of the
present invention. It is also possible to envisage the use of a
so-called "TATA-less" promoter as described by E. MARTINEZ et al.
(EMBO Journal, (1994), 13, No. 13, 3115-3126), so as to obtain the
lowest possible background baseline in the uninduced situation.
[0025] Generally speaking, this minimal promoter is placed upstream
of the nucleotide sequence whose expression it controls, as a
replacement or otherwise for its natural promoter. The promoter
belonging to the nucleic acid sequence can, in effect, remain
present, but in a form which is inactivated or rendered
non-functional by different techniques known to a person skilled in
the art, and in particular by elimination, deletion and/or addition
of one or more bases.
[0026] According to a particular embodiment of the invention, the
minimal promoter is derived from the thymidine kinase minimal
promoter of herpes simplex virus (McKnight et al. (1984) Cell
37:253-262). It is then designated Tk.
[0027] More preferably, it is represented wholly or partially by
one of the sequences shown as SEQ ID No. 1 or No. 2 or one of their
derivatives.
[0028] For the purposes of the present invention, the term
derivative denotes any sequence obtained by modification of a
genetic and/or chemical nature of given sequences and which retains
the desired activity. Modification of a genetic and/or chemical
nature should be understood to mean any mutation, substitution,
deletion, addition and/or modification of one or more nucleic
acid.
[0029] As regards the so-called regulatory sequence, this comprises
at least one operator for tetracycline or one of its analogues. The
operator or operators are recognized by the transcription activator
in the presence of tetracycline and hence, as a result, permit the
activation of the minimal promoter.
[0030] The tet operator sequences which can be employed may be
chosen, in particular, from those described by Hillen and Wissemann
(Protein-Nucleic Acid Interaction, Saeger and Heinemann, eds.,
Macmillan, London, (1989) 10, 143-162), Waters et al. (Nucleic
Acids Res. (1983), 11, 525-539), Stuber et al. (P.N.A.S. USA,
(1981), 78, 167-171), Unger et al. (Nucleic Acids Res. (1984), 12,
7693-7703) and Tovar et al. (Mol. Gen. Genet. (1988), 215,
76-80).
[0031] The regulatory sequence may comprise a single tet operator
sequence or, on the contrary, several tet operator sequences, which
can number as many as 10 depending on whether or not it is desired
to increase the regulation of transcription. According to a
particular embodiment of the invention, the regulatory sequence
employs 2 tet operator sequences. It will then be termed Op2.
[0032] More preferably, the regulatory sequence is represented
wholly or partially by one of the sequences shown as SEQ ID No. 3
or No. 4 or one of their derivatives.
[0033] Traditionally, this regulatory sequence is linked
operationally upstream, that is to say at the 5' end of the minimal
promoter, so as to permit the transcription of the gene of viral
origin in the presence of the complex formed by the transcription
activator and its tetracycline ligand. The structure thus
comprises, successively, in the 5' to 3' orientation, the
regulatory sequence, bound directly or otherwise to the minimal
promoter, the minimal promoter and the gene of viral origin.
However, it is also possible to envisage placing this regulatory
sequence, within the minimal promoter, downstream of the viral
nucleotide sequence to be transcribed, that is to say at its 3'
end. The order of succession is then, in the 5' to 3' direction,
minimal promoter, viral gene and regulatory sequence.
[0034] According to a preferred embodiment of the invention, the
tetracycline-inducible promoter links a regulatory sequence
represented by Op2 to the thymidine kinase minimal promoter termed
Tk. It is in this particular case identified below under the name
Op2/Tk. More preferably, the inducible promoter employed according
to the invention is represented wholly or partially by SEQ ID No. 5
or one of its derivatives.
[0035] This tetracycline-inducible promoter Op2/Tk, and more
especially the one represented wholly or partially by SEQ ID No. 5
or one of its derivatives, also constitute one of the subjects of
the present invention.
[0036] Consequently, the expression of the viral gene or genes
linked operationally, in the claimed adenovirus, to an inducible
promoter is completely dependent on the binding of the complex
formed by the transcription activator and tetracycline to the
regulatory sequence of the said promoter.
[0037] This binding is effective only in the presence of
tetracycline. In the absence of tetracycline or of any analogue of
the latter, no binding is established between the regulatory
sequence and the transcription activator. No transcription of the
viral sequence bound to the minimal promoter ensues. What is more,
advantageously, the agent inducing transcription does not have to
be present continuously.
[0038] One of the subjects of the present invention relates more
especially to an adenovirus comprising at least one homologous,
that is to say adenoviral, gene whose expression is controlled by
an inducible promoter, and more preferably by a
tetracycline-inducible promoter.
[0039] Thus, in a particular embodiment, the subject of the present
invention is a recombinant adenovirus in which at least one genomic
region essential for viral replication and/or propagation is placed
wholly or partially under the control of a tetracycline-inducible
promoter. The region essential for viral replication and/or
propagation according to the present invention is advantageously
chosen from all or part of the E4, E2 region, the IVa2 region
and/or the L5 region, and the like.
[0040] According to an especially advantageous embodiment, the
recombinant adenoviruses of the present invention comprise all or a
functional portion of the E2 or E4 regions as sequences necessary
for replication and/or propagation. More especially, as regards the
E4 region, the important genes are the ORF3, ORF6 and ORF6/7
genes.
[0041] The E2 region is involved in the regulation of the viral
DNA. This E2 region consists of two transcription subunits E2A and
E2B.
[0042] The E4 region is involved in regulation of the expression of
the late genes, in the stability of the late nuclear RNAs, in
abolishing the expression of the host cell's proteins and in the
efficacy of the replication of the viral DNA. Mutants lacking E4
are incapable of propagating. E4 thus constitutes a region
essential for viral propagation. This E4 region consists of 7 open
reading frames, designated ORF1, ORF2, ORF3, ORF4, ORF3/4, ORF6 and
ORF6/7 (FIG. 2). Among these, ORF3 and ORF6 are the two genes
essential for viral propagation. Each of these genes is capable of
inducing viral propagation, ORF6, however, playing a larger part
therein than ORF3 (Huang and Hearing (1988), J. Virol. 63,
2605).
[0043] In a particular embodiment, in the vectors of the invention,
the whole of the region in question is placed under the control of
a tetracycline-inducible promoter. In the particular case of the E2
region, the region in question can be a fragment corresponding to
the 72K cDNA, to the 140K polymerase cDNA or to the 87K
pre-terminal protein cDNA. As regards the E4 region, the region in
question can be, in particular, the Taq1l-Bgl2 fragment
corresponding to nucleotides 35576-32490.
[0044] In another particular embodiment, only the expression of a
functional portion of these regions, that is to say sufficient to
permit viral propagation, is controlled. In the particular case of
E4, this portion comprises at least one functional ORF3 or ORF6
gene. Preferably, the functional portion of E4 consists essentially
of ORF6. As an example, the Bgl2 fragment, lying between positions
34115 and 32490 and containing the sequences of the ORF6 and ORF7
of Ad5, may be positioned downstream of an inducible promoter as
defined according to the invention.
[0045] In another particular embodiment of the present invention,
the essential region consists of the region coding for the IVa2
protein, and for example its cDNA. In another embodiment, the
region coding for the IVa2 protein is included in a BglII-NruI
fragment corresponding to nucleotides 3328 to 6316 on the wild-type
Ad5 adenovirus sequence, a DraI-NlaIII fragment corresponding to
nucleotides 4029 to 5719 or a DraI to XhoI fragment corresponding
to nucleotides 4029 to 5788.
[0046] According to a preferred embodiment of the invention, the
promoters of the regions essential for viral propagation are
replaced within the viral genome by an inducible promoter, and more
preferably by a tetracycline-inducible promoter.
[0047] In a first particular embodiment, the recombinant
adenoviruses of the invention carry a deletion of all or part of
the E1 gene and possess the E4 region, wholly or partially, under
the control of a tetracycline-inducible promoter, preferably of the
Op2/Tk type.
[0048] In another particular embodiment, the recombinant
adenoviruses of the invention carry a deletion of all or part of
the E1 gene and possess the E2 region wholly or partially under the
control of a tetracycline-inducible promoter, preferably of the
Op2/Tk type.
[0049] Still according to a preferred embodiment, the recombinant
adenoviruses of the invention carry a deletion of all or part of
the E1 and E2 genes and possess the E4 region wholly or partially
under the control of a tetracycline-inducible promoter, preferably
of the Op2/Tk type.
[0050] In an especially advantageous variant, the recombinant
adenoviruses of the invention carry a deletion of all or part of
the E1 and E4 genes and possess the E2 region wholly or partially
under the control of a tetracycline-inducible promoter, preferably
of the Op2/Tk type.
[0051] Advantageously, the recombinant adenoviruses of the
invention contain, in addition, a heterologous nucleic acid
sequence containing one or more therapeutic genes whose transfer to
a cell, organ or body and/or expression therein is sought.
[0052] Therapeutic genes which may be transferred in this way are
any gene whose transcription and, where appropriate, translation in
the target cell generate products having a therapeutic effect.
[0053] Such genes can be, in particular, ones coding for
proteinaceous products having a therapeutic effect. The
proteinaceous product thus encoded can be a protein, a peptide, and
the like. This proteinaceous product can be homologous with respect
to the target cell (that is to say a product which is normally
expressed in the target cell when the latter does not display any
pathology). In this case, the expression of a protein makes it
possible, for example, to compensate for an insufficient expression
in the cell or for the expression of a protein that is inactive or
poorly active as a result of a modification, or alternatively to
overexpress the said protein. The therapeutic gene can also code
for a mutant of a cellular protein, having enhanced stability,
modified activity, and the like. The proteinaceous product can also
be heterologous with respect to the target cell. In this case, an
expressed protein can, for example, supplement or supply an
activity which is deficient in the cell, enabling it to combat a
pathology.
[0054] Among products which are therapeutic for the purposes of the
present invention, there may be mentioned, more especially,
enzymes, blood derivatives, hormones, lymphokines, namely
interleukins, interferons, TNF, and the like (FR 92/03120), growth
factors, neurotransmitters or their precursors or synthetic
enzymes, trophic factors, namely BDNF, CNTF, NGF, IGF, GMF, aFGF,
bFGF, NT3, NT5, and the like; apolipoproteins, namely ApoAI,
ApoAIV, ApoE, and the like (FR 93/05125), dystrophin or a
minidystrophin (FR 91/11947), tumour-suppressing genes, namely p53,
Rb, Rap1A, DCC, k-rev, and the like (FR 93/04745), genes coding for
factors involved in coagulation, namely factors VII, VIII, IX, and
the like, suicide genes, namely thymidine kinase; cytosine
deaminase, and the like; or alternatively all or part of a natural
or artificial immunoglobulin (Fab, ScFv, and the like), and the
like.
[0055] The therapeutic gene can also be an antisense gene or
sequence whose expression in the target cell enables the expression
of cellular genes or the transcription of cellular mRNA to be
controlled, for instance ribozymes. Such sequences can, for
example, be transcribed in the target cell into RNAs complementary
to cellular mRNAs, and can thus block their translation into
protein, according to the technique described in Patent EP
140,308.
[0056] The therapeutic gene can also be a gene coding for an
antigenic peptide capable of generating an immune response in man.
In this particular embodiment, the invention hence makes it
possible to produce vaccines enabling humans to be immunized, in
particular against microorganisms or viruses. Such antigenic
peptides can be, in particular, specific to the Epstein-Barr virus,
the HIV virus, the hepatitis B virus (EP 185,573) or the
pseudorabies virus, or alternatively tumour-specific (EP
259,212).
[0057] Generally, the heterologous nucleic acid sequence also
comprises a transcription promoter region which is functional in
the infected cell, as well a region located at the 3' end of the
gene of interest and which specifies a transcription termination
signal and a polyadenylation site. These elements collectively
constitute the expression cassette. As regards the promoter region,
this can be a promoter region naturally responsible for the
expression of the gene in question when the region is capable of
functioning in the infected cell. Regions of different origin
(responsible for the expression of other proteins, or even
synthetic) are a further possibility. In particular, such regions
can be promoter sequences of eukaryotic or viral genes. For
example, they can be promoter sequences originating from the genome
of the cell which it is desired to infect. Similarly, they can be
promoter sequences originating from the genome of a virus,
including the adenovirus used. In this connection, the promoters of
E1A, MLP, CMV, RSV, and the like, genes may be mentioned as
examples. In addition, these promoter regions may be modified by
the addition of activator or regulatory sequences or sequences
permitting a tissue-specific or -preponderant expression. Moreover,
when the heterologous nucleic acid does not contain promoter
sequences, it may be inserted into the genome of the defective
virus downstream of such a sequence.
[0058] Moreover, the heterologous nucleic acid sequence can also
contain, especially upstream of the therapeutic gene, a signal
sequence directing the therapeutic product synthesized into the
pathways of secretion of the target cell. This signal sequence can
be the natural signal sequence of the therapeutic product, but it
can also be any other functional signal sequence, or an artificial
signal sequence.
[0059] This nucleic acid sequence is preferably present in the E1,
E3 or E4 regions, in addition or as a replacement for deleted
sequences.
[0060] A second main subject of the present invention is an
adenovirus containing at least one heterologous gene of viral
origin whose expression is controlled by an inducible promoter, and
more preferably a tetracycline-inducible promoter.
[0061] According to a preferred embodiment of the invention, the
heterologous gene of viral origin is or is derived from a gene of
the genome of an AAV or one of its functional homologues.
[0062] AAVs are relatively small-sized DNA viruses which integrate
in the genome of the cells they infect, stably and
site-specifically. They are also capable of infecting a broad range
of cells without inducing an effect on cell growth, morphology or
differentiation. Moreover, they appear not to be involved in
pathologies in man. The AAV genome has been cloned, sequenced and
characterized. It comprises 4,680 bases, and contains an inverted
repeat region (ITR) of approximately 145 bases at each end, serving
as origin of replication for the virus. The remainder of the genome
is divided into two essential regions carrying the encapsidation
functions: the left-hand portion of the genome, which contains the
rep gene involved in viral replication and the expression of the
viral genes; the right-hand portion of the genome, which contains
the cap gene coding for the capsid proteins of the virus. Three
promoters have been localized therein and named according to their
approximate position in map units p5, p19 and p40. Four proteins
are at least synthesized from the rep region and have been named on
the basis of their apparent molecular mass Rep78, Rep68, Rep52 and
Rep40. The 2 mRNAs transcribed from the p5 promoter are used for
the synthesis of Rep78 and Rep68. Rep52 and Rep40, for their part,
are synthesized from messengers originating from the p19 promoter.
As regards the cap gene more especially, this codes for the
envelope proteins of the virus (VP1, VP2 and VP3). VP3 is the
preponderant capsid protein, and its amino acid sequence is
contained in those of two larger but less abundant proteins VP1 and
VP2 (make a diagram). The rep and cap genes have been characterized
and their respective sequences described in the literature
(Srivastava et al., J. Virol. 45 (1983) 555).
[0063] The use of vectors derived from AAVs for gene transfer in
vitro and in vivo has been described in the literature (see, in
particular, WO 91/18088; WO 93/09239; U.S. Pat. Nos. 4,797,368,
5,139,941, EP 488,528). Generally, the constructions used in gene
therapy contain a deletion of the rep and/or cap genes which are
replaced by a gene of interest.
[0064] In order to replicate, AAVs require the presence of a helper
virus capable of trans-complementing the functions necessary for
their replication. This can be, in particular, an adenovirus, a
herpesvirus or a vaccinia virus. (In the absence of such a helper
virus, AAVs remain in latent form in the genome of infected cells,
but cannot replicate and thus cannot produce viral particles.)
Traditionally, recombinant AAVs are hence produced by
cotransfection, into a cell line infected with a human helper virus
(for example an adenovirus), of a plasmid containing the gene of
interest flanked by two AAV inverted repeat regions (ITR) and a
plasmid carrying the AAV encapsidation genes (rep and cap genes).
Coinfection with the adenovirus initiates a cascade of events which
end in the production of high titres of AAV and substantially
decrease the production of adenovirus. This cascade starts with the
synthesis of the product of the E1a gene, which induces
transcription from the p5 and p19 promoters and leads to the
synthesis of a small amount of Rep proteins. One or more Rep
proteins synthesized from p5 then induce the synthesis of mRNA in
more abundant amounts from the 3 promoters at a much greater level
and in a coordinated manner. In the absence of adenovirus, the AAV
genome is either lost or integrated in the host's chromosome. Genes
other than E1A of the adenovirus are also necessary for an
effective expression of the AAV genes.
[0065] Advantageously, the Applicant demonstrated that it was
possible to place effectively at least the expression of one of the
viral genes of the AAV under the control of an inducible promoter
in an adenovirus, and more preferably to control the expression of
the AAV encapsidation functions, especially the expression of the
rep and/or cap genes, or of any functional homologous gene.
[0066] A functional homologue corresponds to any gene obtained by
modification (mutation, elimination, addition, and the like) of the
rep or cap genes and displaying an activity of the same nature.
Such functional homologous genes can also be genes obtained by
hybridization from nucleic acid libraries by means of probes
corresponding to the rep or cap genes. As a mutated rep gene
capable of being controlled according to the invention, its mutant
in1177 described in the publication Y. Yang et al. ((1992) Journal
of virology, 6058-6069), and derived from an insertion of serines
between codons 286 and 287, may be mentioned more especially.
[0067] According to a preferred embodiment of the invention, the
inducible promoter employed is a tetracycline-inducible promoter as
defined above.
[0068] Such an adenovirus is advantageous in several ways: from the
standpoint of manipulations, it considerably simplifies the method
for preparing stocks of AAV. In effect, in this particular case,
essentially only the said adenovirus containing the rep and cap
genes under the control of the inducible promoter, a recombinant
AAV and an appropriate cell line are employed. Lastly, the expected
titres of AAV from such an adenovirus prove greater than those
obtained according to a conventional method.
[0069] The inducible promoter can, in particular, be introduced as
a replacement for one of the promoters normally leading to the
expression of the gene or genes in question, and especially as a
replacement for the p5, p19 or p40 promoter. Since the p5 promoter
appears to be the one most involved in the initiation of the
cascade of events leading to the production of the virus, its
replacement by a tetracycline-inducible promoter, preferably of the
Op2/Tk type, is more preferably undertaken. Advantageously, such a
construction enables the expression of rep and cap to be blocked in
the absence of tetracycline.
[0070] The AAV encapsidation functions under the control of an
inducible promoter may be introduced into different regions of the
genome of the claimed adenovirus. Advantageously, the encapsidation
functions are inserted into a region which does not interfere with
the capacity of the virus to trans-complement AAVs. It is also
possible to insert the encapsidation functions into a functional
region of the genome of the said adenovirus, this region then being
supplied in trans, either by a plasmid or by the cell line used. It
is possible, for example, to insert the rep gene, the cap gene or
the rep and cap genes in the E1 or E3 regions as a replacement for
or in addition to the deleted sequences.
[0071] In order to abolish any transcriptional leakage due to the
proximity of the ITR-psi region, a so-called negative regulatory
sequence may, in addition, be introduced. Such a sequence inserted,
in particular, between the left-hand ITR and the psi sequence of
the claimed adenovirus on the one hand, and the sequence coding for
the tetracycline-inducible promoter, makes it possible to curb any
spurious transcriptional activation of rep and cap induced, where
appropriate, by the enhancer located in the left-hand ITR of the
adenovirus and the psi sequence. As negative sequences which may be
employed according to the invention, those identified in the
vimentin promoter (Salvetti et al. (1993), Mol. Cell. Biol.
1676-1685), in the interferon promoter (Whitemore et al. (1990),
P.N.A.S., 87, 7799-7803), in the cardiac myosin light chain 2 gene
(Ruoquian-Shen et al. (1991), Mol. Cell. Biol., 1676-1685) and in
the mouse albumin promoter (Herbst et al. (1990), Mol. Cell. Biol.,
3896-3905) may be mentioned in particular.
[0072] According to a preferred embodiment, the invention relates
to a recombinant adenovirus containing an Op2/Tk-rep-cap expression
cassette.
[0073] The subject of the present invention is also the use of
these adenoviruses integrating a viral sequence of AAV origin under
the control of a tetracycline-inducible promoter for preparing
AAVs.
[0074] In a preferred embodiment, the adenoviruses which are the
subjects of the invention comprise the ITR sequence and a sequence
permitting encapsidation. Preferably, these adenoviruses possess,
in addition, a non-functional E1 region.
[0075] The inverted repeat sequences (ITR) constitute the origin of
replication of the adenoviruses. They are localized at the 3' and
5' ends of the viral genome (see FIG. 1), from where they may be
isolated readily according to the traditional techniques of
molecular biology known to a person skilled in the art. The
nucleotide sequence of the ITR sequences of human adenoviruses
(especially of the serotypes Ad2 and Ad5) is described in the
literature, as are those of canine adenoviruses (in particular CAV1
and CAV2). As regards the Ad5 adenovirus for example, the left-hand
ITR sequence corresponds to the region comprising nucleotides 1 to
103 of the genome.
[0076] The encapsidation sequence (also designated psi sequence) is
necessary for encapsidation of the viral DNA. This region must
hence be present in order to permit the preparation of defective
recombinant adenoviruses according to the invention. The
encapsidation sequence is localized in the genome of the
adenoviruses, between the left-hand (5') ITR and the E1 gene (see
FIG. 1). It may be isolated or synthesized artificially by
traditional techniques of molecular biology. The nucleotide
sequence of the encapsidation sequence of human adenoviruses
(especially of the serotypes Ad2 and Ad5) is described in the
literature, as are those of canine adenoviruses (in particular CAV1
and CAV2). As regards the Ad5 adenovirus for example, the
encapsidation sequence corresponds to the region comprising
nucleotides 194 to 358 of the genome.
[0077] According to an especially advantageous embodiment, in the
recombinant adenoviruses of the present invention, the E1 region is
inactivated by deletion of a PvuII-BglII fragment extending from
nucleotide 454 to nucleotide 3328 on the Ad5 adenovirus sequence.
This sequence is available in the literature and also on a database
(see, in particular, Genebank No. M73260). In another preferred
embodiment, the E1 region is inactivated by deletion of a
HinfII-Sau3A fragment extending from nucleotide 382 to nucleotide
3446.
[0078] The adenoviruses of the invention may be prepared from
adenoviruses of diverse origins. There are, in effect, different
serotypes of adenovirus, the structure and properties of which vary
somewhat but which display a comparable genetic organization. Thus,
the teachings described in the present application may be readily
reproduced by a person skilled in the art for any type of
adenovirus.
[0079] More especially, the adenoviruses of the invention may be of
human, animal or mixed (human and animal) origin.
[0080] As regards adenoviruses of human origin, it is preferable to
use those classified in group C. More preferably, among the
different serotypes of human adenovirus, it is preferable to use
adenoviruses type 2 or 5 (Ad2 or Ad5) in the context of the present
invention.
[0081] As mentioned above, the adenoviruses of the invention may
also be of animal origin, or may contain sequences originating from
adenoviruses of animal origin. The Applicant has, in effect, shown
that adenoviruses of animal origin are capable of infecting human
cells with great efficacy, and that they are incapable of
propagating in the human cells in which they have been tested (see
Application WO 94/26914). The Applicant has also shown that
adenoviruses of animal origin are in no way trans-complemented by
adenoviruses of human origin, thereby eliminating any risk of
recombination and propagation in vivo in the presence of a human
adenovirus, which can lead to the formation of an infectious
particle. The use of adenoviruses or of regions of adenoviruses of
animal origin is hence especially advantageous, since the risks
inherent in the use of viruses as vectors in gene therapy are even
lower.
[0082] The adenoviruses of animal origin which may be used in the
context of the present invention can be of canine, bovine, murine
(for example: Mavl, Beard et al., Virology 75 (1990) 81), ovine,
porcine, avian or alternatively simian (for example: SAV) origin.
More especially, among avian adenoviruses, there may be mentioned
the serotypes 1 to 10 which are available in the ATCC, such as, for
example, the strains Phelps (ATCC VR-432), Fontes (ATCC VR-280),
P7-A (ATCC VR-827), IBH-2A (ATCC VR-828), J2-A (ATCC VR-829), T8-A
(ATCC VR-830), K-11 (ATCC VR-921) or alternatively the strains
referenced ATCC VR-831 to 835. Among bovine adenoviruses, the
different known serotypes may be used, and in particular those
available in the ATCC (types 1 to 8) under the references ATCC
VR-313, 314, 639-642, 768 and 769. There may also be mentioned the
murine adenoviruses FL (ATCC VR-550) and E20308 (ATCC VR-528),
ovine adenovirus type 5 (ATCC VR-1343) or type 6 (ATCC VR-1340),
porcine adenovirus 5359, or simian adenoviruses such as, in
particular, the adenoviruses referenced in the ATCC under the
numbers VR-591-594, 941-943, 195-203, and the like.
[0083] Among the different adenoviruses of animal origin, it is
preferable in the context of the invention to use adenoviruses or
regions of adenoviruses of canine origin, and in particular all
strains of CAV2 adenoviruses [strain Manhattan or A26/61 (ATCC
VR-800) for example]. Canine adenoviruses have been subjected to
many structural studies. Thus, complete restriction maps of CAV1
and CAV2 adenoviruses have been described in the prior art (Spibey
et al., J. Gen. Virol. 70 (1989) 165), and the E1a and E3 genes as
well as the ITR sequences have been cloned and sequenced (see, in
particular, Spibey et al., Virus Res. 14 (1989) 241; Linne, Virus
Res. 23 (1992) 119, WO 91/11525).
[0084] The present invention relates, in addition, to a method
which is useful for the preparation of AAV.
[0085] More specifically, its subject is a method for preparing
AAV, characterized in that it comprises the cotransfection, in the
presence of tetracycline or one of its analogues, of a cell line
comprising in its genome the cassette for the expression of a
transcription activator, with an adenovirus comprising at least one
gene of AAV origin under the control of a tetracycline-inducible
promoter, and either a recombinant virus derived from the AAV or a
plasmid carrying a transgene between the ITRs of the AAV. The
adenovirus is preferably one comprising the rep and cap genes as
heterologous viral genes.
[0086] The method according to the invention turns to good account
the ability to induce the expression of these rep and cap genes
placed under the control of a tetracycline-inducible promoter
within an adenovirus, in the presence of a sufficient amount of
tetracycline and a transcription activator.
[0087] As explained earlier, this method has the advantage of being
simplified from the standpoint of manipulations compared to a
traditional method. In the present case, all that is carried out is
a coinfection of a cell line with an adenovirus such as is claimed
and a recombinant virus derived from an AAV.
[0088] Besides the transformed adenovirus according to the
invention, this method employs a cell line containing in its genome
a cassette for the expression of the so-called transcription
activator protein consisting of a first polypeptide capable of
binding, in the presence of tetracycline or one of its analogues,
to the regulatory sequence of the inducible promoter present in the
adenovirus, combined with a second polypeptide which activates
transcription.
[0089] As regards, more especially, the so-called transcription
activator protein, this is hence characterized by its ability to
bind, in the presence of tetracycline, to the so-called regulatory
sequence and its capacity to activate the minimal promoter which is
associated with it. As explained above, it is a protein consisting
of two polypeptides, a first polypeptide which binds to the tet
operator sequences in the presence of tetracycline or an analogue
of the latter, and a second polypeptide whose function is more
specifically to activate the said transcription.
[0090] According to a favoured embodiment of the invention, the
first polypeptide of the so-called transcription activator protein
is a tetracycline repressor mutated so as to manifest a behaviour
opposite to that of a wild-type repressor, that is to say it binds
to the tet operator sequences only in the presence and not in the
absence of tetracycline. This type of mutation may be performed
according to traditional biological techniques of the mutagenesis
type. The difference in amino acids between the wild-type repressor
and the mutated repressor according to the present invention can
consist of a substitution, deletion and/or addition of one or more
amino acids. It has the effect of endowing the repressor thus
transformed with two functional properties: it can bind to the
regulatory sequence represented by tetracycline operators by
analogy with the wild-type repressor; in contrast, it is regulated
inversely by tetracycline.
[0091] Numerous classes of wild-type tetracycline repressors have
already been described in the literature, among which classes A, B,
C, D and E may be mentioned in particular. As a representative
example of these repressors, the repressor termed Tn10 which
belongs to class B may be mentioned more especially. According to a
preferred embodiment of the invention, the repressor employed is
derived from this wild-type repressor Tn10. More specifically, it
is a Tn10 repressor mutated in at least one amino acid localized at
position 71, 95, 101 or 102.
[0092] More preferably, it possesses wholly or partially the amino
acid sequence shown as SEQ ID No. 8. It will termed TetR.
[0093] As regards the second polypeptide present in the so-called
transcription activator protein, this can be any already known
transcriptional activation domain. According to a preferred
embodiment of the invention, it is the activation domain of herpes
simplex virus protein 16, more especially the 130 amino acids of
the C-terminal end of VP16, and more preferably the 11 amino acids
of this C-terminal end of VP16 or alternatively peptide portions of
the C-terminal portion of VP16 (Sceipel K; et al. EMBO J. 1992; 13,
4961-4968) or derivatives.
[0094] In the case of the claimed method for producing AAV, the
cassette for the expression of this transcription activator is
preferably integrated in the genome of a cell line 293.
[0095] According to a preferred embodiment of the invention, the
expression of this transcription activator is also placed, in the
cell line, under the control of a promoter which is inducible with
tetracycline or one of its analogues as is defined above. More
preferably, the cell line in question is a cell line 293
integrating in its genome the Op2/Tk-TetR-VP16 cassette.
[0096] The subject of the present invention is also a cell line
containing in its genome a cassette for the expression of a
transcription activator as defined above, comprising or otherwise
an inducible promoter as defined according to the invention. More
preferably, a cell line is a line integrating in its genome the
Op2/Tk-TetR-VP16 cassette.
[0097] The invention also relates to the use of this type of cell
line for producing adenoviruses according to the invention or
AAVs.
[0098] The subject of the present invention is also a method for
preparing adenoviruses containing at least one of their genes whose
expression is under the control of the tetracycline-inducible
promoter.
[0099] The defective recombinant adenoviruses according to the
invention may be prepared in different ways.
[0100] A first method consists in transfecting the DNA of the
defective recombinant virus prepared in vitro (either by ligation
or in plasmid form) into a competent cell line, that is to say one
carrying in trans all the functions necessary for complementation
of the virus, and a transcription activator. These functions are
preferably integrated in the genome of the cell, thereby enabling
risks of recombination to be avoided and endowing the cell line
with enhanced stability.
[0101] Thereafter, the vectors which have multiplied in the
presence of a sufficient amount of tetracycline or one of its
analogues are recovered, purified and amplified according to
traditional techniques of molecular biology.
[0102] According to a variant of implementation, it is possible to
prepare in vitro, either by ligation or in plasmid form, the DNA of
the defective recombinant virus carrying the appropriate deletions,
one or more viral genes under the control of a
tetracycline-inducible promoter and one or more therapeutic genes.
The eliminations are generally carried out on the DNA of the
defective recombinant virus, by performing digestions by means of
suitable restriction enzymes, followed by ligations, according to
the techniques of molecular biology, as illustrated in the
examples. The viral or therapeutic genes and the inducible promoter
may then be inserted into this DNA by enzymatic cleavage followed
by ligation, in the selected regions and in the chosen orientation.
The DNA thereby obtained, which hence carries the appropriate
deletions, one or more viral genes under the control of a
tetracycline-inducible promoter and one or more therapeutic genes,
enables the claimed recombinant adenovirus to be generated
directly.
[0103] It is also possible to prepare the recombinant virus in
successive steps, permitting the successive introduction of the
heterologous genes and the inducible promoter. Thus, the DNA of a
first recombinant virus carrying the appropriate deletions (or a
part of the said deletions) and an inducible promoter such as, for
example, Op2/Tk is constructed by ligation or in plasmid form. This
DNA is then used to generate a first recombinant virus carrying the
said deletions with an inducible promoter. The DNA of this first
virus is then isolated and cotransfected with a second plasmid or
the DNA of a second defective recombinant virus carrying the
appropriate deletions, in particular a deletion in the E1 region, a
region permitting homologous recombination and, where appropriate,
a therapeutic gene. This second step thus generates the recombinant
virus according to the invention.
[0104] The present invention also relates to any pharmaceutical
composition comprising one or more recombinant adenoviruses as
described above. The pharmaceutical compositions of the invention
may be formulated with a view to topical, oral, parenteral,
intranasal, intravenous, intramuscular, subcutaneous, intraocular,
transdermal, and the like, administration.
[0105] Preferably, the pharmaceutical composition contains vehicles
which are pharmaceutically acceptable for an injectable
formulation. These can be, in particular, sterile, isotonic saline
solutions (of monosodium or disodium phosphate, sodium, potassium,
calcium or magnesium chloride, and the like, or mixtures of such
salts), or dry, in particular lyophilized, compositions which, on
adding sterilized water or physiological saline, as the case may
be, enable injectable solutions to be formed.
[0106] The doses of virus used for the injection may be adapted in
accordance with different parameters, and in particular in
accordance with the mode of administration used, the pathology in
question, the gene to be expressed or the desired period of
treatment. Generally speaking, the recombinant adenoviruses
according to the invention are formulated and administered in the
form of doses of between 10.sup.4 and 10.sup.14 pfu/ml, and
preferably 10.sup.6 to 10.sup.10 pfu/ml. The term pfu (plaque
forming unit) corresponds to the infectious power of a solution of
virus, and is determined by infecting a suitable cell culture and
measuring, generally after 5 days, the number of plaques of
infected cells. The techniques of determination of the pfu titre of
a viral solution are well documented in the literature.
[0107] The adenoviruses of the invention may be used for the
treatment or prevention of numerous pathologies. They are
especially advantageous for the treatment of hyperproliferative
pathologies (cancers, restenosis, and the like), by direct
injection at the site in question. In this connection, the present
invention also relates to a method for the destruction of
proliferative cells, comprising the infection of the said cells or
of a portion of them with an adenoviral vector as defined above. In
the case where the suicide gene is a gene conferring sensitivity to
a therapeutic agent, the method of destruction according to the
invention thereafter comprises the treatment of the cells with the
said therapeutic agent. To carry out this method, the subject of
the invention is also the products comprising a recombinant
adenovirus as defined above in which the suicide gene is a gene
conferring sensitivity to a therapeutic agent; and the said
therapeutic agent as a combination product for use simultaneously,
separately or spread over time for the treatment of
hyperproliferative pathologies. More especially, the suicide gene
is a thymidine kinase gene and the therapeutic agent is ganciclovir
or acyclovir or an analogue.
[0108] Recombinant vectors according to the invention possess
especially attractive properties for use in gene therapy. These
vectors combine, in effect, very superior properties of infection,
safety and gene transfer capacity.
[0109] The present invention will be described more completely by
means of the examples and figures which follow, which should be
considered to be illustrative and non-limiting.
[0110] FIG. 1: Genetic organization of the Ad5 adenovirus. The
complete sequence of Ad5 is available on a database, and enables a
person skilled in the art to select or create any restriction site,
and thus to isolate any region of the genome.
[0111] FIG. 2: Genetic organization of the E4 region.
[0112] FIG. 3: Genetic organization of AAV.
[0113] General Techniques of Molecular Biology
[0114] The methods traditionally used in molecular biology, such as
preparative extractions of plasmid DNA, centrifugation of plasmid
DNA in a caesium chloride gradient, agarose or acrylamide gel
electrophoresis, purification of DNA fragments by electroelution,
phenol or phenol-chloroform extractions of proteins, ethanol or
isopropanol precipitation of DNA in a saline medium, transformation
in Escherichia coli, and the like, are well known to a person
skilled in the art and are amply described in the literature
[Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982; Ausubel
F. M. et al. (eds), "Current Protocols in Molecular Biology", John
Wiley & Sons, New York, 1987].
[0115] Plasmids of the pBR322 and pUC type and phages of the M13
series are of commercial origin (Bethesda Research
Laboratories).
[0116] To carry out ligation, the DNA fragments may be separated
according to their size by agarose or acrylamide gel
electrophoresis, extracted with phenol or with a phenol-chloroform
mixture, precipitated with ethanol and then incubated in the
presence of phage T4 DNA ligase (Biolabs) according to the
supplier's recommendations.
[0117] The filling in of 5' protruding ends may be performed with
the Klenow fragment of E. coli DNA polymerase I (Biolabs) according
to the supplier's specifications. The destruction of 3' protruding
ends is performed in the presence of phage T4 DNA polymerase
(Biolabs) used according to the manufacturer's recommendations. The
destruction of 5' protruding ends is performed by a controlled
treatment with S1 nuclease.
[0118] In vitro site-directed mutagenesis using synthetic
oligodeoxynucleotides may be performed according to the method
developed by Taylor et al. [Nucleic Acids Res. 13 (1985) 8749-8764]
using the kit distributed by Amersham.
[0119] The enzymatic amplification of DNA fragments by the
so-called PCR [polymerase-catalysed chain reaction, Saiki R. K. et
al., Science 230 (1985) 1350-1354; Mullis K. B. and Faloona F. A.,
Meth. Enzym. 155 (1987) 335-350] technique may be performed using a
"DNA thermal cycler" (Perkin Elmer Cetus) according to the
manufacturer's specifications.
[0120] Verification of the nucleotide sequences may be performed by
the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA,
74 (1977) 5463-5467] using the kit distributed by Amersham.
[0121] Cell Lines Used
[0122] In the examples which follow, the following cell lines were
or may be used:
[0123] Human embryonic kidney line 293 (Graham et al., J. Gen.
Virol. 36 (1977) 59). This line contains, in particular, integrated
in its genome, the left-hand portion of the Ad5 human adenovirus
genome(12%).
[0124] KB human cell line: Originating from a human epidermal
carcinoma, this line is available in the ATCC (ref. CCL17),
together with the conditions enabling it to be cultured.
[0125] Hela human cell line: Originating from a human epithelial
carcinoma, this line is available in the ATCC (ref. CCL2), together
with the conditions enabling it to be cultured.
[0126] MDCK canine cell line: The conditions of culture of MDCK
cells have been described, in particular, by Macatney et al.,
Science 44 (1988) 9.
[0127] gm DBP6 cell line (Brough et al., Virology 190 (1992) 624).
This line consists of Hela cells carrying the adenovirus E2 gene
under the control of the MMTV LTR.
EXAMPLE 1
[0128] Construction of an Adenovirus Carrying its E4 Domain Under
the Control of an Op2-Tk Promoter.
[0129] 1--Construction of the Plasmid pIC20H/Op2-Tk:
[0130] This plasmid carries the sequence of the Tk minimal promoter
preceded by two sequences of the tetracycline operator; these
sequences are recognized by the tetracycline repressor when it is
bound to tetracycline.
[0131] To obtain it, the plasmid pIC20H (Marsh et al., Gene 32
(1984) 481) is digested with ClaI/BamHI, and the sequence SEQ ID
No. 5, comprising two tetracycline operators upstream of a
thymidine kinase minimal promoter, is introduced between these two
sites.
[0132] 2--Construction of the Plasmid pIC20H/ITR-Op2Tk
[0133] This plasmid is obtained by Cla1 digestion of plasmid
pIC20H/Op2Tk and insertion of an Hpa2 fragment containing the Ad5
ITR (coordinates: 1/+122). This fragment comes from the commercial
vector pSL1180 (Pharmacia) digested with Hind3, into which site the
ITR manufactured by PCR is introduced, with Hind3 sites on each
side of the amplified fragment. There is obtained in the following
order: ITR-Op2-TKprom.
[0134] 3--Construction of the Plasmid pIC20H/ITR-Op2Tk-E4
[0135] This plasmid corresponds to plasmid pIC20H/ITR-Op2Tk
digested with Hind3, into which site the Nhe-Xba1 fragment of PY6
containing the E4 region of Ad5 is inserted. The plasmid pPY6, for
its part, is obtained according to the following protocol:
[0136] A plasmid pPY2 is prepared from plasmid pIC20H. This plasmid
pPY2 corresponds to the cloning of the Avr2-Sal1 fragment
(approximately 1.3 kb including the MMTV promoter) of the plasmid
pMSG (Pharmacia) between the Xba1 and Sal1 sites of plasmid pIC20H
prepared from an E. coli dam+ context. The plasmid pPY4 is derived
from plasmid pPY2 by deletion of a 35-bp fragment after cleavage
with BamH1 and Bgl2 followed by religation. The plasmid pPY5
corresponds to plasmid pIC20H in which the Taq1-Bgl2 fragment
including the E4 region of adenovirus type 5, located between
positions 35576 (Taq1) and 32490 (Bgl2), has been cloned between
the Cla1 and BamH1 sites. The E4 region of plasmid pPY5 is hence
included in an EcoRV-Sph1 fragment which is cloned after partial
digestion between the Sma1 and Sph1 sites of plasmid pPY4, thereby
generating the plasmid pPY6.
[0137] 4--Construction of the Plasmid pIC20H/ITR-Op2Tk-E4-L5
[0138] This is obtained by digestion of plasmid pIC20H/ITR-Op2Tk-E4
with Kpn1 and Xba1, and insertion of the 3.1-kb Kpn1-Xba1 fragment
of Ad5 (coordinates: 33595-30470) containing the whole of the L5
region.
[0139] 5--Construction of the Plasmid pYG4-EP
[0140] Plasmid pIC20H/ITR-Op2Tk-E4-L5 is digested with Xba1 and
Nru1 to recover the corresponding fragment, which carries in order
the ITR, Op2, the Tk promoter, E4 and L5. This fragment is inserted
into the Xba1 and Nru1 sites of plasmid pYG4, which contains the
whole of the sequence of the adenovirus from the Xba1 site to the
Sph1 site. This plasmid pYG4-EP is a vector pIC20H into which the
Sph1-Xba1 fragment of Ad5 (coordinates: 25095-28590) is inserted
between its Sph1 and Xba1 sites.
[0141] This vector pYG4-EP, from which the E3 adenoviral region has
been deleted, possesses sufficient adenoviral sequences between the
Sph1 and Xba1 sites to permit complementary recombination of the
adenovirus for the production of a recombinant adenovirus.
[0142] 6--Construction of the Recombinant Adenovirus
[0143] This is carried out by cotransfection of 293/TetR-VP16
cells, prepared according to Example 3 below, with plasmid pYG4
linearized by Sph1 digestion and with the adenovirus RSV-.beta.gal
or an adenovirus carrying a transgene, linearized by Srf1
digestion, in the presence or absence of tetracycline. The
selection and amplification of the recombinant adenovirus is then
carried out according to traditional virological techniques.
EXAMPLE 2
[0144] Construction of the Recombinant Adenovirus Carrying the AAV
Rep-cap Genes Under the Control of the OP2/Tk Promoter.
[0145] 1--Construction of the Intermediate Plasmid pXL2630
[0146] This intermediate plasmid enables an EcoRI site to be
introduced downstream of Op2-Tk. The presence of a restriction site
at this position is of twofold interest. It serves to introduce
this promoter upstream of rep-cap after the p5 promoter has been
eliminated, and it also enables this hybrid promoter to be inserted
upstream of TetR-VP16 for the preparation of a transformed cell
line 293, as described in Example 3 below.
[0147] To this end, plasmid pIC20H/Op2-Tk, obtained according to
the protocol described in Example 1, is digested with BamHI,
treated with T4 DNA polymerase in order to blunt the ends and then
redigested with EcoRV, and the fragment originating from this
digestion and carrying the Op2-Tk promoter is introduced at the
EcoRV site of the commercial plasmid pBSSK+. The orientation of the
fragment is selected for the presence of an EcoRI site downstream
of the promoter.
[0148] 3--Introduction of an EcoRI Site at the +1 Position With
Respect to Transcription of p5
[0149] To eliminate the p5 promoter, an EcoRI site is introduced at
the +1 position with respect to transcription of the p5 promoter
upstream of the Rep78 coding sequence by the PCR technique on the
plasmid pAV2 (Laughlin C., Gene (1983), 23, 69-73). This reaction
was carried out using the oligonucleotides:
[0150] SEQ ID No. 6 (seq5269): 5'GAATTCTTTTGAAGCGGGAGGTTTGAACGCG 3
' EcoRI
[0151] SEQ ID No. 7 (seq5039): 5' CTCCATGTACCTGGCTGA 3'
[0152] The fragment thus generated was introduced into pCRII
(Invitrogen) to give the plasmid pMA4. The nucleotide sequence of
this fragment was verified.
[0153] 4--Construction of the Plasmid pMA6 Carrying the
OP2-Tk-rep-cap Junction
[0154] This intermediate plasmid enables the joining of the
inducible promoter with rep to be carried out. The SalI-EcoRI
fragment of pXL2630 and the EcoRI-NruI fragment of pMA4 are
introduced at the XhoI (compatible with SalI) and NruI sites of
pIC20R (Marsh et al., Gene 32 (1984) 481) to give plasmid pMA6.
[0155] 5--Construction of the Plasmid pC01 (FIG. 7 EX94008) Which
Contains the Left-hand Portion of the Ad5 Adenovirus Up to the
HinfI Site (382), a Multiple Cloning Site and the Sau3A (3446)-NruI
(6316) Fragment of the Ad5 Adenovirus
[0156] 5-a/ Construction of the Plasmid pCE
[0157] The EcoRI-XbaI fragment corresponding to the left-hand end
of the Ad5 adenovirus genome was first cloned between the EcoRI and
XbaI sites of the vector pIC19H (Marsh et al., Gene 32 (1984) 481).
This generates the plasmid pCA. Plasmid pCA was then cut with
HinfI, its 5' protruding ends were filled in with the Klenow
fragment of E. coli DNA polymerase I and it was then cut with
EcoRI. The fragment thus generated of plasmid pCA, which contains
the left-hand end of the Ad5 adenovirus genome, was then cloned
between the EcoRI and SmaI sites of the vector pIC20H (Marsh et
al., Gene 32 (1984) 481). This generates the plasmid pCB. Plasmid
pCB was then cut with EcoRI, its 5' protruding ends were filled in
with the Klenow fragment of E. coli DNA polymerase I and it was
then cut with BamHI. The fragment thus generated of plasmid pCB,
which contains the left-hand end of the Ad5 adenovirus genome, was
then cloned between the NruI and BglII sites of the vector pIC20H.
This generates the plasmid pCE, an advantageous feature of which is
that it possesses the first 382 base pairs of the Ad5 adenovirus
followed by a multiple cloning site.
[0158] 5-b/ Construction of the Plasmid pCD'
[0159] The Sau3A (3346)-SstI (3645) fragment and the SstI
(3645)-NarI (5519) fragment of the Ad5 adenovirus genome were first
ligated and cloned between the ClaI and BamHI sites of the vector
pIC20H, thereby generating plasmid pPY53. The SalI-TaqI fragment of
plasmid pPY53 prepared from a dam- context, containing the portion
of the Ad5 adenovirus genome lying between the Sau3A (3346) and
TaqI (5207) sites, was then cloned between the SalI and ClaI sites
of the vector pIC20H, thereby generating the plasmid pCA'. The TaqI
(5207)-NarI (5519) fragment of the Ad5 adenovirus genome prepared
from a dam- context and the SalI-TaqI fragment of plasmid pCA' were
then ligated and cloned between the SalI and NarI sites of the
vector pIC20H. This generates the plasmid pCC'. The NarI
(5519)-NruI (6316) fragment of the Ad5 adenovirus genome prepared
from a dam- context and the SalI-NarI fragment of plasmid pCC' were
then ligated and cloned between the SalI and NruI sites of the
vector pIC20R. This generates the plasmid pCD'.
[0160] 5-c/ Construction of plasmid pC01
[0161] A partial digestion with XhoI followed by a complete
digestion with SalI of plasmid pCD' generates a restriction
fragment which contains the Ad5 adenovirus sequence from the Sau3A
site (3446) to the NruI site (6316). This fragment was cloned into
the SalI site of plasmid pCE. This generates plasmid pC01.
[0162] 6--Construction of the Plasmids pMA7 and pMA8
[0163] The EcoRV-SnaBI fragment of pMA6, carrying the AAV
Op2-Tk-rep-cap-polyA+ (up to the SnaBI site, position 4495 on the
AAV sequence), is introduced at the EcoRV site of pCO1 in both
orientations relative to the adenovirus ITR. The plasmids thereby
obtained are designated pMA7 (orientation of the cassette in the
direction opposite to the adenovirus ITR) and pMA8 (same
orientation).
[0164] 7--Construction of the Recombinant Adenovirus Carrying
Op2-Tk-rep-cap
[0165] This part describes the construction of a defective
recombinant adenovirus carrying the AAV Op2-Tk-rep-cap-polyA+
cassette. This adenovirus is obtained by cotransfection of plasmid
pMA7 or pMA8 with a deficient adenoviral vector, into helper cells
(line 293) supplying in trans the functions encoded by the
adenovirus E1 (E1A and E1B) regions.
[0166] More specifically, the adenoviruses AdMA7 and AdMA8 were
prepared by homologous recombination in vivo between the adenovirus
AdRSV.beta.gal and plasmids pMA7 and pMA8 according to the
following protocol: plasmid pMA7 or pMA8 linearized with NdeI and
the adenovirus AdRSVBgal linearized with ClaI are cotransfected
into line 293 in the presence of calcium phosphate to permit
recombination. The recombinant adenoviruses thus generated are
selected by plaque purification. After isolation, the recombinant
adenovirus is amplified in cell line 293, leading to a culture
supernatant containing the unpurified defective recombinant
adenovirus having a titre of approximately 1010 pfu/ml. For the
purification, the viral particles are centrifuged on a caesium
chloride gradient according to known techniques (see, in
particular, Graham et al., Virology 52 (1973) 456).
[0167] The adenovirus AdMA7 or AdMA8 is stored at -80.degree. C. in
20% glycerol.
[0168] 8 Construction of the Recombinant Adenovirus Carrying Op2/Tk
rep-cap polyA+AAV in the E3 Region:
[0169] This part describes the construction of a recombinant
adenovirus which is deleted for E1 and which carries Op2: Tk repcap
polyA+AAV in the E3 region.
[0170] Plasmid pMA28 contains all of the sequence of the Ad(E1-,
E3-) carrying Op2: Tk repcap polyA+AAV in the E3 region. It was
constructed by means of recombination in E.Coli, by, for example,
introducing the plasmid pMA24 into the strain C2110 (pXL2638) (E1-,
E3-), which strain is described in application PCT/FR96/00215,
which is included herein by reference.
[0171] 8.1 Construction of the Intermediate Plasmid pMA22:
[0172] The Xba1-Xba1 fragment of the plasmid pMA7, carrying Op2: Tk
repcap polyA+AAV, was introduced into the Xba1 site of pYG4-EP in
place of the E3 region, such that Op2: Tk repcap polyA+AAV is in
the inverse orientation to that of the E3 region. The plasmid which
is constructed in this way is pMA22.
[0173] 8.2 Construction of Plasmid pMA24, Which is Used to Perform
Recombination in E.Coli:
[0174] The Nhe1-Spe1 fragment of pMA22, containing the Op2: Tk
repcap polyA+AAV cassette flanked by the adenovirus 27082-28593 and
3471-31509 sequences, was introduced into the compatible site of
plasmid pXL2756 in order to generate plasmid pMA24, which plasmid
carries the regions required for recombination flanking the Op2: Tk
repcap polyA+AAV cassette, the B. subtilis sacB gene and the gene
for resistance to kanamycin.
[0175] 8.3 Construction of the Recombinant Adenovirus Carrying Op2:
Tk Repcap Polya+AAV in the E3 Region:
[0176] This construction was carried out by means of recombination
in E.Coli, by electroporating plasmid pMA24 into strain C2110
(pXL2688) or C2110 (pXL2789) and selecting for a second
recombination event on LB medium containing sucrose and
tetracyclin. A C2110 strain harbouring plasmid pMA28 is thereby
obtained.
[0177] This plasmid was then transfected, after digestion with
Pac1, into 293 cells.
EXAMPLE 3
[0178] Construction of the Producing Line 293
[0179] Op2-Tk-TetR-VP16.
[0180] This part describes the construction of a 293 line carrying,
integrated in its genome, the cassette of the hybrid
trans-activator TetR-VP16 under the control of the Op2-Tk promoter.
For this purpose, the plasmid pMA2 was constructed in order to
establish a line by cotransfection of this plasmid pMA2 with a
plasmid pMSCV (Hawley et al. J. Exp. Med. (1993), vol. 176,
1149-1163) carrying the neomycin-resistance gene under the control
of the PGK (phosphoglycerate kinase) promoter. pMA2 is constructed
by inserting the SalI-EcoRI fragment of pXL2630 between the
compatible XhoI-EcoRI sites of a plasmid pUHD17.1. Plasmid pUHD17.1
is a plasmid comprising the sequences coding for a mutated
tetracycline repressor linked operationally to the VP16 sequence.
This vector is derived from the vector pUHD15.1 (H. Bujard;
P.N.A.S. U.S.A. 1992, 89, 55476-5551) which comprises the sequence
of the wild-type tetracycline repressor combined with the 130 amino
acids of the C-terminal end of herpes simplex virus VP16. A
399-base pair Xbal-Eco47III fragment corresponding to amino acids 3
to 135 of the mutated tetracycline repressor is exchanged for the
corresponding restriction fragment of pUHD15.1 to yield
pUHD17.1.
[0181] The line 293 Op2-Tk-TetR-VP16 of the invention was
constructed by cotransfection of the chosen cells in the presence
of calcium phosphate with plasmids pMA2 and pMSCV and a
construction coding for the glucocorticoid receptor (Hollenberg et
al., 1985). More specifically, line 293 cells in dishes 5 cm in
diameter were transfected with 1 to 5 .mu.g of plasmid pMA2.
[0182] Selection of Geneticin-resistant Clones
[0183] After transfection of the cells, the latter are washed, the
culture medium (MEM, Sigma) supplemented with foetal calf serum (7%
final) is then added and the cells are incubated for 20 hours. Next
day, the cells are selected in the presence of geneticin G418
(Gibco-BRL, Life Technologies) at an effective concentration of 400
mg/l. The geneticin is changed every three days and the selectable
clones appear after approximately 3 weeks. When all the
untransfected cells have died, only cells which have inserted the
resistance gene survive and divide to generate cell clones. When
the cell clones are sufficiently large to be visible to the naked
eye, they are transfer individually to the culture wells of a
"24-cavity" culture plate. Each clone is then gradually amplified
in the presence of geneticin, first in the wells of a "12-cavity"
culture plate and then of a "6-cavity" culture plate, and
thereafter amplified in cell culture dishes. Each cell clone is
then stored by freezing in liquid nitrogen.
[0184] A number of clones were isolated, amplified and selected for
their capacity to express a reporter gene, for example lacZ under
the control of the Op2-Tk promoter after adding a suitable
concentration of tetracycline. The plasmid used is pMA9, and was
constructed by introducing a StuI-BamHI fragment of pRSVgalIX
carrying the sequence coding for E. coli .beta.-galactosidase and a
nuclear localization signal into plasmid pMA2 previously linearized
with EcoRI; treated with bacteriophase T4 DNA polymerase in order
to blunt its ends and then redigested with BamHI.
[0185] Among these clones, those permitting a conditional
expression of rep-cap carried by the adenovirus described above and
permitting AAV production at high titres were used as producing
line.
Sequence CWU 1
1
* * * * *